Reagent and target nucleic acid detection method using the same

Abstract

To provide a reagent that is less prone to a decrease in the enzymatic activity of a complex of a Cas protein and a guide RNA even in an aqueous liquid.SOLUTION: A reagent comprises: complex particles each including a particle and a complex bound to the particle; and an aqueous liquid in which the complex particles are dispersed, where the complex includes a Cas protein and a guide RNA bound to the Cas protein.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a reagent and a method for detecting a target nucleic acid using the same.

Background Art

[0002] Jennifer Doudna et al. of the University of California have reported a highly sensitive detection of target DNA using the trans-cleavage reaction of the genome editing enzyme Cas12a. A complex consisting of Cas12a, which is a kind of Cas protein (crispr associated protein), and crRNA (which can also be referred to as crisprRNA, guide RNA) recognizes and binds to the sequence of target DNA, and Cas12a cleaves the bound target DNA. At that time, when a reporter molecule in which a fluorescent substance and a quencher are linked by single-stranded DNA is added to the reaction system, Cas12a cleaves the single-stranded DNA at this linkage, and the target DNA can be detected by the fluorescence emission of the fluorescent substance (Non-Patent Document 1). Note that crispr is an abbreviation for clustered regularly interspaced short palindromic repeats.

Prior Art Documents

Non-Patent Documents

[0003]

Non-Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0004] The present inventors have found problems with Non-Patent Document 1. That is, when the complex of Cas12a and guide RNA is stored in an aqueous liquid, it has been found that the enzyme activity is likely to decrease in a short period of time.

[0005] Therefore, the present invention aims to provide a reagent in which the enzymatic activity of a complex of Cas protein and guide RNA is maintained even in aqueous solution. [Means for solving the problem]

[0006] The reagent according to the present invention comprises a composite particle containing a particle and a complex bound to the particle, and an aqueous liquid in which the composite particle is dispersed, wherein the complex contains a Cas protein and a guide RNA bound to the Cas protein.

[0007] A method for detecting a target nucleic acid according to the present invention comprises the steps of mixing a sample containing a target nucleic acid with a reagent having a complex particle on which a complex comprising a Cas protein and a guide RNA bound to the Cas protein is bound to a particle, and a reporter molecule containing nucleic acid containing a specific base sequence; and detecting a change in luminescence caused by the cleavage of the nucleic acid containing the specific base sequence by the complex binding to the target nucleic acid. [Effects of the Invention]

[0008] The reagent according to the present invention can reduce the rapid decrease in the enzymatic activity of the Cas protein-guide RNA complex in aqueous liquid. [Brief explanation of the drawing]

[0009] [Figure 1] A graph showing that particles containing Cas12a exhibit enzyme activity. [Figure 2] A graph comparing the activity of Cas12a directly bound particles and Cas12a-antibody particles. [Figure 3] A graph comparing the activity of Cas12a-antibody particles and Cas12a-nickel particles. [Figure 4] A graph comparing the activity of Cas12a-antibody particles and Cas12a-commercially available His-tagged antibody particles. [Figure 5]A graph comparing the activity of Cas12a-antibody particles and Cas12a-crRNA aqueous solution. [Figure 6] A graph showing the change in the enzyme activity of Cas12a-antibody particles when the Cas12a preparation ratio is varied. [Figure 7] A graph showing the change in the enzyme activity of Cas12a- antibody particles when the anti-His tag antibody loading ratio is varied. [Figure 8] A graph comparing the activity of Cas12a-antibody particles and Cas12a-antibody particles (with crRNA added later). [Figure 9] A graph showing the change in enzyme activity in Cas12a-antibody particles and Cas12a-crRNA aqueous solution. [Figure 10] A graph showing the effect of blocking in the production of Cas12a antibody particles. [Figure 11] A graph showing the change in enzyme activity in Cas12a-antibody particles and Cas12a-crRNA aqueous solution upon ultrasonic irradiation. [Figure 12] A graph showing the enzyme activity when the blocking agent is changed during the production of Cas12a antibody particles. [Figure 13] Microscopic images evaluating the particle aggregation properties when the blocking agent was changed during the production of Cas12a antibody particles. [Figure 14] A graph showing the enzyme activity when the core particle of the Cas12a antibody particle is changed. [Modes for carrying out the invention]

[0010] The present invention will be described below using more specific configuration examples, but the present invention is not limited to these.

[0011] Furthermore, in the following sections, the term "bonding" will refer not only to chemical bonds such as covalent bonds and coordinate bonds, but also to non-chemical bonding modes such as affinity interactions and surface adsorption, as well as bonding modes consisting of combinations of these.

[0012] (Target nucleic acid detection reagent) The reagent in the embodiment of the present invention has composite particles including particles and a composite body bound to the particles, and an aqueous liquid in which the composite particles are dispersed. This composite body includes a Cas protein and a guide RNA bound to the Cas protein.

[0013] In the reagent according to this embodiment, a composite body including a Cas protein and a guide RNA bound to the Cas protein is bound to the particles. Therefore, it is possible to reduce the decrease in intramolecular hydrogen bonds and van der Waals forces due to the hydration of the Cas protein. This is because particles are present in the vicinity of the composite body (Cas protein), making it difficult for water molecules to access. Further, in the reagent according to this embodiment, it is preferable that a plurality of composite bodies are bound to the particles. This is because the local concentration of the composite body increases, making it even more difficult for water molecules to access the Cas protein. Thereby, the decrease in the enzyme activity of the composite body (Cas protein) is reduced. As a result, the reagent according to this embodiment can be used for a long period as a reagent capable of cleaving a specific base sequence.

[0014] Here, generally, when the protein concentration is high, the enzyme activity is less likely to decrease even in an aqueous liquid, but dilution is required during use. On the other hand, the reagent according to this embodiment has the effect of being easy to use because the enzyme activity is less likely to decrease even when the concentration of the composite of the Cas protein and the guide RNA is low, and thus dilution is not required during use.

[0015] Further, the reagent according to this embodiment can be a reagent for detecting a target nucleic acid. This reagent further has a reporter molecule including a nucleic acid containing a specific base sequence, and the emission of the reporter molecule changes when the nucleic acid containing the specific base sequence is cleaved by the composite body to which the target nucleic acid is bound.

[0016] Here, the target nucleic acid conjugates with the guide RNA constituting the composite body.

[0017] The guide RNA binds to the target nucleic acid, and the complex cleaves the nucleic acid containing a specific base sequence, thus acquiring enzymatic activity. In this embodiment, the reagent for detecting the target nucleic acid changes its luminescence when the nucleic acid is cleaved by the guide RNA, allowing the target nucleic acid to be detected by the change in luminescence. Single-stranded DNA can be used as the nucleic acid containing the specific base sequence. Furthermore, the reporter molecule can be one in which the fluorescence intensity increases after the nucleic acid containing the specific base sequence is cleaved by the complex compared to before.

[0018] In this embodiment, the reagent exhibits reduced enzymatic activity of the complex (Cas protein) in aqueous liquid. Therefore, even when used as a reagent for target nucleic acid detection in aqueous liquid, the decrease in detection sensitivity of target nucleic acids can be reduced.

[0019] In this embodiment, the reagent contains less than 1 mg of the complex per 1 mL of reagent. Even at such low concentrations, the enzyme activity of the reagent in this embodiment does not decrease easily.

[0020] (Binding between particles and complexes via the N-terminus) In this embodiment, the particles and the complex may be linked via amide bonds. In this case, the C=O derived from the carboxyl group in the particle and the NH derived from the amino group in the protein form an amide bond. In other words, the particles and the complex can also be described as being linked via amide bonds.

[0021] In this embodiment, it is preferable that the particles are bound via the amino terminus (N terminus) of the Cas protein contained in the complex. This is because, as will be shown in the examples described later, the configuration in which the particles are bound via the N terminus of the Cas protein results in less reduction in activity compared to the configuration in which the particles are bound to amino groups other than the N terminus of the Cas protein (for example, the amino groups of lysine).

[0022] (Binding between particles and complexes) In this embodiment, the composite particles may be linked to the composite via an amide bond. Such a configuration can be prepared by providing a carboxyl group on the particle surface and linking that carboxyl group to an amino group of the Cas protein via an amide bond. This amino group is preferably the amino terminus of the Cas protein described above.

[0023] (Cas protein) In this embodiment, Cas12 or Cas13, specifically Cas12a and Cas13a, can be used as the Cas protein (CRISPR-associated protein). In this embodiment, the Cas protein is one that has nucleic acid cleavage activity.

[0024] In this embodiment, Cas12 can be at least one selected from the group consisting of LbCas12a, AsCas12a, FnCas12a, and AaCas12b.

[0025] In this embodiment, Cas13 can be at least one selected from the group consisting of, for example, LwaCas13a, LbaCas13a, LbuCas13a, BzoCas13b, PinCas13b, PbuCas13b, AspCas13b, PsmCas13b, RanCas13b, PauCas13b, PsaCas13b, PinCas13b, CcaCas13b, PguCas13b, PspCas13b, PigCas13b, and Pin3Cas13b.

[0026] (Guide RNA) In this embodiment, the guide RNA forms a complex with the Cas protein, as described above. Furthermore, by binding (conjugating) to the target nucleic acid, the complex cleaves the nucleic acid containing a specific base sequence. It is designed to bind to a target nucleic acid that serves as a diagnostic indicator of a disease state. That is, the guide RNA hybridizes with a specific base sequence of the target nucleic acid and has sufficient complementarity with the target nucleic acid sequence to induce sequence-specific binding of the complex containing the Cas protein and guide RNA to the target nucleic acid's base sequence. It may contain any polynucleotide sequence as long as it satisfies these conditions. Note that the guide RNA can also be called crRNA.

[0027] (target nucleic acid) Examples of target nucleic acids in this embodiment include DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). It can be applied to the diagnosis of disease states and constitutional assessments. Examples of disease states include cancer, autoimmune diseases, and infectious diseases. Examples of infectious diseases include DNA viruses and RNA viruses, but the target nucleic acid can be arbitrarily selected and is not limited to these.

[0028] (Reporter molecule) The reporter molecule in this embodiment is not particularly limited as long as its luminescence changes when the nucleic acid constituting the reporter molecule is cleaved by the trans cleavage reaction of the complex (Cas protein). Here, the change in luminescence can be either a change in luminescence intensity or a change in emission wavelength. A reporter molecule can be used in which the fluorescence intensity increases after the nucleic acid containing a specific base sequence is cleaved by the complex compared to before the cleavage.

[0029] For example, a reporter molecule can be used that has a structure in which a fluorescent substance that emits fluorescence and a quenching substance that reduces the intensity of fluorescence emitted from the fluorescent substance are linked via a nucleic acid containing the specific base sequence. As the nucleic acid containing the specific base sequence, single-stranded DNA, double-stranded DNA, RNA, etc., can be used. The base sequence of the nucleic acid containing the specific base sequence is any sequence that can be cleaved by the trans cleavage reaction of the complex (Cas protein). The nucleic acid containing the specific base sequence is preferably 5 to 30 bases, and more preferably 10 or more bases.

[0030] When using Cas12, a molecule in which a fluorescent substance and a quencher are linked by single-stranded DNA is preferred as the reporter molecule. For example, the reporter molecule included in the DNaseAlert Substrate Nuclease Detection System (IDT, 11-02-01-04) kit (hereinafter referred to as the IDT reporter), a molecule in which the fluorescent substance Cy5® and the quencher BHQ®-3 are linked by DNA, a molecule in which the fluorescent substance AlexaFluor® 647 and the quencher Iowa Black® RQ-Sp are linked by DNA, a molecule in which the fluorescent substance AlexaFluor® 647 and the quencher BHQ®-2 are linked by DNA, and a molecule in which the fluorescent substance 6-FAM® and the quencher Iowa Black® FQ are linked by DNA can be used. When using Cas13, a molecule in which a fluorescent substance and a quencher are linked by RNA is preferred as the reporter molecule.

[0031] There are no specific requirements for the number of base pairs in the single-stranded DNA linking the fluorescent substance and the quencher, but it is preferable to have five or more base pairs depending on the selected fluorescent substance and quencher. In addition to the combination of a fluorescent substance and a quencher, other reporter molecules can include molecules in which a fluorescent substance and biotin are linked by a single-stranded nucleic acid. If the single-stranded nucleic acid linking the fluorescent substance and biotin is cleaved by the Cas protein, biotin is released, and the reporter molecule may not be trapped by streptavidin immobilized on paper or other materials. In such cases, a technique called lateral flow can be used, which detects differences in the mobility of the fluorescent substance.

[0032] (Reaction buffer) Examples of reaction buffers used to obtain the test reagent according to this embodiment include Tris-based buffers and HEPES-based buffers, which have been reported in the enzymatic reactions of Cas12a and Cas13a. For example, NEBuffer(registered trademark) 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9), Binding buffer (20 mM Tris-HCl (pH 7.6), 100 mM KCl, 5 mM MgCl2, 1 mM DTT, 5% glycerol, 50 μg / mL heparin), and FZ buffer (20 mM HEPES, 60 mM NaCl, 6 mM MgCl2, pH 6.8).

[0033] A reaction temperature of around 37°C is preferable, but other temperatures are also acceptable. For example, EnGen(registered trademark)Lba Cas12a(Cpf1) from NEW ENGLAND BioLabs is known to exhibit activity over a wider temperature range of 16-48°C compared to Asp Cas12a(Cpf1).

[0034] (Linker (the part that connects the Cas protein to the particle)) In this embodiment, the linking portion between the Cas protein and the particle can be called a linker.

[0035] In this embodiment, the particles and the composite may be bonded via a linker.

[0036] In this embodiment, the linker may contain a peptide consisting of 6 to 11 consecutive histidine molecules, and preferably contains a peptide consisting of 6 consecutive histidine molecules (hereinafter sometimes referred to as the His tag). In this case, the linker may have an antibody (anti-His tag antibody) that binds to this peptide (His tag) by an antigen-antibody reaction. In such a configuration, the linker may have a structure in which a C=O derived from a carboxyl group contained in the particle and an NH derived from an amino group contained in the antibody are bonded together by an amino bond. Furthermore, this linker includes a structure in which the antibody and the His tag are bound, and a structure in which the His tag and the Cas protein are bound.

[0037] Alternatively, a metal complex that binds to this peptide (His tag), such as nitrilotriacetic acid or iminodiacetic acid, may be used in combination with a divalent nickel ion.

[0038] Examples of binding sites between the Cas protein and the Cas protein linker include the ε-amino group of the Cas protein lysine residue, the α-amino group at the N-terminus of the Cas protein, and various tag peptide sequences and tag proteins artificially inserted into the N-terminus of the Cas protein. The preferred location for the binding site to the Cas protein linker is one that does not inhibit the activity of the Cas protein. For example, in the Cas protein, the active site is known to be located at the carboxyl terminus (C-terminus), so a location away from the C-terminus is preferred. For example, the N-terminus is particularly preferred because it is far from the C-terminus and allows for the insertion of various tag peptides and tag proteins. Examples of tag peptides include the His tag, HA tag, and DDDDK tag (FLAG®).

[0039] Other examples of tag proteins include Halo-tag®.

[0040] Various types of linkers can be used as the binding site between a particle and a particle-side linker. For example, when binding to the ε-amino group of a Cas protein lysine residue and the α-amino group at the N-terminus of the Cas protein, the binding site to the particle-side linker can be a carboxyl group, an aldehyde group, etc. For example, when forming an amide bond between an amino group in the Cas protein and a carboxyl group in the particle, a condensation reaction using N-hydroxysuccinimide (NHS) / water-soluble carbodiimide (WSC) can be used. Another example is when binding a particle to a His tag artificially inserted at the N-terminus of the Cas protein; an anti-His tag antibody can be used as the linker. In this case, for example, the carboxyl group of the particle is used as the particle-side linker, and the anti-His tag antibody is bound to the particle surface by a condensation reaction with the amino group of the anti-His tag antibody using NHS / WSC. This allows the Cas protein to be bound to the particle using the antigen-antibody reaction between the His tag at the N-terminus of the Cas protein and the anti-His tag antibody. In addition to anti-His tag antibodies, Cas proteins can also be immobilized onto particles by using metal chelate ligands such as iminodiacetic acid (IDA) or nitrilotriacetic acid (NTA) as linkers to bind to the particles, thereby forming coordination bonds via metal ions such as nickel ions and cobalt ions.

[0041] Other linkers include various tag peptide sequences, tag proteins and their affinity sites, avidin-biotin complexes, and polyethylene glycols with various functional groups at their ends. Linking can also occur through physical adsorption between Cas proteins and the particle surface.

[0042] (particle) The particles in this embodiment are not particularly limited as long as they can bind the composite. In this embodiment, it is preferable that the particles have carboxyl groups that facilitate the binding of the composite and linker. The shape of the primary particles in this embodiment may be not only spherical, but also rod-shaped or sheet-shaped. Furthermore, the particles in this embodiment may be primary particles or secondary particles formed by aggregates of primary particles. Examples of particle materials in this embodiment include polymer resin (styrene resin, acrylic resin, etc.) particles, silica particles, resin particles, agarose carrier resin particles, metal particles, and latex particles. Examples include Magnosphere® MS300, Magnosphere® MS160, and PureProteome® Nickel Magnetic Beads. While it is preferable to use particles containing paramagnetic materials such as iron, nickel, and magnetite, as well as ferromagnetic and supermagnetic materials, other materials are also acceptable. Magnetic particles can be used as particles in this embodiment. Using magnetic particles makes it easier to control the position of the composite by applying a magnetic field.

[0043] The particle size of the particles according to this embodiment is preferably 10 nm or larger, and particularly preferably 1 μm or larger and 10 μm or smaller. Specific methods for measuring particle size include observation with an optical microscope or electron microscope, laser diffraction, dynamic light scattering, and centrifugal sedimentation, but other particle size measurement methods may also be used.

[0044] (Blocking agent) The reagent according to this embodiment may contain a blocking agent. That is, when binding particles to Cas proteins, the portion of the linker binding site of the particles to which the Cas protein did not bind can be filled with a blocking agent. For example, when condensing the amino group of a Cas protein or anti-His tag antibody with the carboxyl group of a particle using NHS / WSC, the portion to which the Cas protein did not bind after the reaction can be reacted with ethanolamine or PEG having an amino group.

[0045] (Method for detecting target nucleic acids) The method for detecting target nucleic acids according to this embodiment comprises the following steps. (1) A step of mixing a reagent having a complex particle in which a complex containing a Cas protein and a guide RNA bound to the Cas protein is bound to a particle, and a reporter molecule containing a nucleic acid containing a specific base sequence, with a sample containing a target nucleic acid. (2) A step in which the complex binds to a target nucleic acid, thereby cleaving a nucleic acid containing a specific base sequence. (3) A step of detecting a change in luminescence that occurs when a nucleic acid containing a specific base sequence is cleaved.

[0046] The terms used in the target nucleic acid detection method in this embodiment are the same as those used in the reagents described in the above embodiment, and therefore their explanations are omitted.

[0047] Furthermore, the composite particle in (1) may be formed by first binding the Cas protein and the guide RNA to form a complex, and then attaching the complex to a particle. Alternatively, the Cas protein may be bound to a particle, and then the guide RNA may be attached to the Cas protein to form the composite particle. [Examples]

[0048] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the following.

[0049] (Preparation of reagents) Before describing the embodiments of the present invention, we will explain the materials used in each embodiment and the method for evaluating the test reagents.

[0050] (Cas12a concentration preparation) EnGen® LbaCas12a(Cpf1) (NEW ENGLAND BioLabs (NEB), M0653T) 100 μM was diluted with nuclease-free water (NEB, B1500L) (hereinafter referred to as "water") to adjust the concentration.

[0051] (Preparation of crRNA concentration) A 100 μM concentration of crRNA (LbaCas12a-crRNA1) (SIGMA, custom-made) for EnGen® LbaCas12a(Cpf1) (NEW ENGLAND BioLabs (NEB), M0653T) was diluted with water to adjust the concentration. The sequence is shown below. (Sequence ID 1) uaauuucuacuaaguguagaugucuggccuuaauccaugcc

[0052] (DNA preparation) Using an aqueous solution of deoxyribonucleic acid (DNA) for quantitative analysis (1 ng / μL, 600 base pairs) (Fujifilm Wako Pure Chemical Industries, Ltd., 630-31991) as a template, 113 bp of target DNA was amplified by PCR, purified, and then the concentration was measured using Qubit. The primer sequences are shown below. (Sequence 2) Forward:CTCACGCCTTATGACTG (Sequence ID 3) Reverse:TAGCTATGAGGCATGGAT

[0053] A 4nM stock solution was prepared by diluting 113bp of DNA with measured concentration using water. Furthermore, DNA solutions of various concentrations were prepared by diluting the 4nM stock solution with water.

[0054] The DNA_113bp sequence is shown below. The underlined portion indicates the Cas12a target sequence. (Sequence No. 4) ctcacgccttatgactgcccttatgtcaccgcttatgtctcccgatatcacacccgttatctcagccctaatctctgcggtttagtctggccttaatccatgcctcatagcta

[0055] (Preparation of 12 μM reporter molecule) The reporter molecule included in the DNaseAlert Substrate Nuclease Detection System (IDT, 11-02-01-04) kit (hereinafter referred to as the IDT reporter) was used. Twelve 50 pmol / tube samples were used and dissolved in 50 μL of 800 nM HiLyte® Fluor488 (AnaSpec) solution (hereinafter referred to as HiLyte488). HiLyte488 was used as the standard fluorescent substance in the 96 wells.

[0056] (Preparation of enzyme reaction buffer) NEBuffer® 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9) was used by adding 10 × NEBuffer® 2.1, which was included with EnGen® LbaCas12a (Cpf1) (NEB Corporation, M0653T), to the reaction solution in an amount equal to 1 / 10th of the reaction solution volume.

[0057] (Immobilization experiment of anti-His tag antibodies against magnetic particles) A dispersion of magnetic particles (Magnosphere® MS300, Magnosphere® MS160) was placed in a microcentrifuge tube, and the magnetic particles were precipitated using a magnet. After removing the supernatant, MES buffer (100 mM, pH 5.4) was added to the magnetic particle pellet and dispersed again. N-hydroxysulfosuccinimide (sulfo-NHS) and water-soluble carbodiimide (WSC) were then added. The mixture was stirred at 25°C for 1 hour, and the magnetic particles were recovered using a magnet. The recovered magnetic particles were washed with MES buffer, dispersed in MES buffer, and an arbitrary amount of anti-His-tag antibody (Anti-His-tag mAb, MBL Life Sciences) was added. The mixture was stirred at 25°C for 2 hours. Subsequently, if blocking was performed, a large excess of PEGamine with a molecular weight of 5000 relative to the surface carboxyl groups was added, and the mixture was stirred at room temperature for 45 minutes. Regardless of whether blocking was performed, a large excess of ethanolamine was then added to deactivate the active groups on the bead surface. Magnetic particles were collected using a magnet, washed with MES buffer, and antibody-immobilized beads were prepared. Storage buffer (10 mM HEPES-NaOH (pH 7.9), 50 mM KCl, 1 mM EDTA, 10% glycerol) was added to the antibody-immobilized beads to prepare an antibody particle solution, which was stored at 4°C until use.

[0058] (Reaction experiment between Cas12a-crRNA and antibody particles) Diluted Cas12a and crRNA were mixed in a concentration ratio of 1:1.25, and incubated at 37°C for 30 minutes to produce Cas12a-crRNA complexes.

[0059] Prepared antibody particles (1 wt%) or commercially available anti-His-tag antibody particles (Anti-His-tag mAb-Magnetic Beads®, MBL Life Sciences, 1 wt%) were dispensed into 2 mL sample tubes (VIOLAMO, model 1-1600-04). After vortexing, the sample tubes were placed in a magnetic stand (Magical Trapper, TOYOBO, model MGS-101) and allowed to stand for 1 minute to remove the solution. PBS-T was added as a particle washing solution, vortexed, and the solution was removed. This procedure was repeated twice. The particles were suspended in PBS-T, the Cas12a-crRNA solution prepared above was added to the desired concentration, vortexed, and the mixture was reacted with a shaker for 1 hour. After the reaction, the solution was removed and washed with PBS-T. Cas12a-antibody particles were prepared by suspending them in PBS-T or storage buffer. After vortexing, the particles were stored at 4°C until use.

[0060] (Reaction experiments between Cas12a alone and antibody particles, as well as reaction experiments with crRNA) Prepared antibody particles (1 wt%) or commercially available anti-His-tag antibody particles (Anti-His-tag mAb-Magnetic Beads®, MBL Life Sciences, 1 wt%) were dispensed into 2 mL sample tubes (VIOLAMO, model 1-1600-04). After vortexing, the sample tubes were placed in a magnetic stand (Magical Trapper, TOYOBO, model MGS-101) and allowed to stand for 1 minute to remove the solution. PBS-T was added as a particle washing solution, vortexed, and the solution was removed. This procedure was repeated twice. The particles were suspended in PBS-T, Cas12a alone was added to the desired concentration, vortexed, reacted with a shaker for 1 hour, the solution was removed after the reaction, and washed with PBS-T. Cas12a-antibody particles (without crRNA) were prepared by suspending them in PBS-T or storage buffer.

[0061] Cas12a antibody particles (without crRNA) were suspended in PBS-T after vasoconstriction. crRNA (1.25 equivalents relative to the initial Cas12a) was added, and the mixture was incubated at 37°C for 30 minutes. After the reaction, the solution was removed, PBS-T was added, and the mixture was vortexed. The solution was then removed again. Cas12a antibody particles (with crRNA added later) were prepared by suspending the mixture in PBS-T or storage buffer. After vortexing, the mixture was stored at 4°C until use.

[0062] (Reaction experiment between Cas12a-crRNA and nickel particles) Diluted Cas12a and crRNA were mixed in a concentration ratio of 1:1.25, and incubated at 37°C for 30 minutes to produce a Cas12a-crRNA complex.

[0063] Commercially available nickel particles (PureProteome TM Nickel Magnetic Beads (Merck, 3 wt%) were dispensed into 2 mL sample tubes (VIOLAMO, model 1-1600-04). After vortexing, the sample tubes were placed in a magnetic stand (Magical Trapper, TOYOBO, model MGS-101) and the solution was removed. PBS-T was added as a particle washing solution, vortexed, and the solution was removed. This procedure was repeated twice. The particles were suspended in PBS-T, and the Cas12a solution prepared above was added to the desired concentration. After vortexing, the mixture was reacted in a shaker for 1 hour. After the reaction, the solution was removed and washed with PBS-T. Cas12a-nickel particles were prepared by suspending them in PBS-T or storage buffer. After vortexing, the particles were stored at 4°C until use.

[0064] (Experiment on immobilization of Cas12a-crRNA onto particles) Diluted Cas12a and crRNA were mixed in a concentration ratio of 1:1.25 and incubated at 37°C for 30 minutes to prepare a Cas12a-crRNA complex. A dispersion of magnetic particles (Magnosphere® MS300, Magnosphere® MS160) was placed in a microtube and the magnetic particles were precipitated using a magnet. After removing the supernatant, MES buffer (100 mM, pH 5.4) was added to the magnetic particle pellet and dispersed again, and N-hydroxysulfosuccinimide (sulfo-NHS) and water-soluble carbodiimide (WSC) were added. The mixture was stirred at 25°C for 1 hour, and the magnetic particles were recovered using a magnet. The recovered magnetic particles were washed with MES buffer, dispersed in MES buffer, and an arbitrary amount of Cas12a-crRNA complex was added. The mixture was stirred at 25°C for 2 hours. Subsequently, if blocking was required, a large excess of PEGamine with a molecular weight of 5000 relative to the surface carboxyl groups was added, and the mixture was stirred at room temperature for 45 minutes. Regardless of whether blocking occurred, a large excess of ethanolamine was subsequently added to deactivate the active groups on the bead surface. Magnetic particles were recovered using a magnet, washed with MES buffer, and Cas12a-immobilized particles were prepared. Storage buffer was added to the Cas12a-immobilized particles to prepare a Cas12a-directly bound particle solution, which was stored at 4°C until use.

[0065] (Immobilization experiments of Cas12a alone onto particles and reaction experiments with crRNA) A dispersion of magnetic particles (Magnosphere® MS300, Magnosphere® MS160) was placed in a microtube, and the magnetic particles were precipitated using a magnet. After removing the supernatant, MES buffer (100 mM, pH 5.4) was added to the magnetic particle pellet and dispersed again. N-hydroxysulfosuccinimide (sulfo-NHS) and water-soluble carbodiimide (WSC) were then added. The mixture was stirred at 25°C for 1 hour, and the magnetic particles were recovered using a magnet. The recovered magnetic particles were washed with MES buffer, dispersed in MES buffer, and an arbitrary amount of pure Cas12a was added. The mixture was stirred at 25°C for 2 hours. Subsequently, if blocking was performed, a large excess of PEGamine with a molecular weight of 5000 relative to the surface carboxyl groups was added, and the mixture was stirred at room temperature for 45 minutes. Regardless of whether blocking was performed, a large excess of ethanolamine was then added to deactivate the active groups on the bead surface. The magnetic particles were recovered using a magnet, washed with MES buffer, and Cas12a-immobilized beads were prepared. Cas12a-immobilized beads were mixed with storage buffer to prepare a Cas12a direct-binding particle solution (without crRNA), which was stored at 4°C until use.

[0066] Cas12a directly bound particles (without crRNA) prepared using the above method were suspended in PBS-T after solution removal. A diluted solution of crRNA (1.25 equivalents of the prepared Cas12a) was added, and the mixture was incubated at 37°C for 30 minutes. After the reaction, the solution was removed, PBS-T was added, vortexed, and then the solution was removed again.

[0067] Cas12a-bound particles (with crRNA added later) were prepared by suspending the material in PBS-T or storage buffer and stored at 4°C until use.

[0068] (Measurement of enzyme activity using Cas12a) To achieve a desired concentration of Cas12a, a 100 nM Cas12a solution and a 100 nM crRNA solution were mixed in a volume ratio of 1:1.25 and incubated at 37°C for 30 minutes to form a complex. This was then prepared as the Cas12a-crRNA aqueous solution.

[0069] Cas12a-immobilized particles (Cas12a-antibody particles, Cas12a-directly bound particles, Cas12a-nickel beads, etc.) or Cas12a-crRNA aqueous solution were placed in a 96-well plate (Thermo Fisher Scientific, 137101) at a desired concentration. Target nucleic acid, NE Buffer, reporter molecule, and water were added to prepare a total volume of 80 μL. Fluorescence intensity was measured at 37°C for 1-2 hours, every 2 minutes, using a Synergy MX fluorescence plate reader (BioTek). For HiLyte488, the excitation wavelength was 485±20 nm and the fluorescence wavelength was 528±20 nm. For the IDT reporter, the excitation wavelength was 535±20 nm and the fluorescence wavelength was 595±20 nm.

[0070] The following describes each example. The preparation of each reagent is as described above.

[0071] (Example 1: Investigation of whether only particles containing Cas12a exhibit enzyme activity) The trans-cleavage reaction of Cas12a-crRNA complexes (hereinafter referred to as Cas12a-antibody particles, shown as "Beads with Cas12a binding via Ab" in the figure) was evaluated by measuring the time change of the ratio of the fluorescence intensity of an IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. These complexes were prepared using an anti-His-tag antibody (Anti-His-tag mAb, MBL Life Sciences) as a linker, utilizing the His tag introduced at the N-terminus of LbaCas12a (cpf1, NEW ENGLAND BioLabs (NEB)). For comparison, particles bound only to the anti-His-tag antibody (Beads with Ab) and particles alone (MS300) are shown. Unless otherwise specified, the particles used in the Cas12a-antibody particle tests were Magnosphere® MS300 (JSR Corporation). The reagents used were Cas12a 11.8 nM, target DNA 1 nM, IDT reporter concentration 125 nM, and HiLyte488 concentration 8.3 nM. NEBuffer® 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9) (hereinafter referred to as NEBuffer) was used as the reaction buffer.

[0072] As a negative control (NC) for Cas12a-antibody particles, enzyme activity was compared between antibody particles without Cas12a binding and particles (Magnosphere® MS300) with neither Cas12a nor antibody binding. Figure 1 shows the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 for all of the control groups. The Cas12a concentration used in the Cas12a-antibody particles was 11.8 nM, the concentration of the target DNA (113 bp) was 1 nM, the IDT reporter concentration was 125 nM, the HiLyte488 concentration was 8.3 nM, and 4 μL of each bead was added to the system. The results confirmed that neither the NC antibody particles nor the particles with neither Cas12a nor antibody binding showed enzyme activity, and only the Cas12a-antibody particles exhibited enzyme activity.

[0073] (Example 2: Comparison of activity between Cas12a directly bound particles and Cas12a-antibody particles) Figure 2 compares the difference in enzyme activity between complex particles (hereinafter referred to as Cas12a directly bound particles) and Cas12a-antibody particles (Beads with Cas12a binding via Ab in Figure 2), using the ε-amino groups of multiple lysine residues on the Cas12a surface and the carboxyl groups on the particle surface. Two types of Cas12a directly bound particles are shown: one in which a crRNA-Cas12a complex was reacted with the particle (Beads with Cas12a by direct coupling in Figure 2), and another in which Cas12a alone was bound to the particle and then reacted with crRNA (Beads with Cas12a by direct coupling (crRNA added later) in Figure 2). In both cases, the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 is shown. The particles were prepared using Magnosphere® MS300, with Cas12a at 11.8 nM, target DNA at 1 nM, IDT reporter concentration at 125 nM, and HiLyte488 concentration at 8.3 nM. NEBuffer was used as the reaction buffer. The results are shown in Figure 2.

[0074] As a result, the Cas12-antibody particles under condition 1 exhibited strong enzymatic activity, while the Cas12a directly bound particles under condition 2 showed relatively weak activity, and the Cas12a directly bound particles (with crRNA added later) under condition 3 showed almost no activity.

[0075] The enzyme activity mechanism of Cas12a is known to involve initially acquiring DNA cleavage activity by sandwiching crRNA and target nucleic acid inside it, after which it becomes capable of randomly cleaving probe molecules. Therefore, the crRNA, target nucleic acid, and probe molecule need to be in close proximity to the active site of Cas12a. Thus, it is hypothesized that if there is significant steric hindrance around the active site of Cas12a, the probability of these multiple molecules approaching each other decreases, potentially leading to a decrease in activity.

[0076] If Cas12a does not have any particular orientation and is bound to the particle randomly, a certain proportion of Cas12a may be bound via amino groups of lysine residues near the active site. Cas12a bound in this manner may have significant steric hindrance at the active site and may lose its enzymatic activity. Therefore, it is inferred that when binding occurs in a non-orienting manner, a certain proportion of Cas12a bound to the particle may always be inactivated.

[0077] On the other hand, when Cas12a is immobilized on particles via the His tag located at its N-terminus using anti-His tag antibodies or nickel ions, Cas12a binds to the particles in an oriented manner. In this case, the distance between the N-terminus of Cas12a and the active site is greater, resulting in less steric hindrance around the active site of Cas12a compared to directly bound microparticles. As a result, it is presumed that the proportion of Cas12a that is inactivated when immobilized on particles is less than when directly bound.

[0078] These differences suggest that, when Cas12a concentrations are matched, Cas12a-antibody particles and Cas12a-directly bound particles exhibit differences in enzymatic activity.

[0079] Furthermore, regarding the timing of Cas12a-crRNA complex formation in directly bound Cas12a particles, particles with crRNA added later exhibit relatively weak enzymatic activity. This is presumed to be because the structure of Cas12a changes when it is immobilized on the particle surface, or because crRNA introduction is unsuccessful due to steric hindrance on the particle surface, resulting in reduced enzymatic activity.

[0080] (Example 3: Comparison of activity between Cas12a-antibody particles and Cas12a-nickel particles) The His tag introduced at the N-terminus of LbaCas12a (cpf1, NEW ENGLAND BioLabs (NEB)) is known to form strong bonds with nickel ions, cobalt ions, copper ions, and other ions. Using commercially available nickel ion coordination binding particles (PureProteome® Nickel Magnetic Beads, Merck), Cas12a-nickel ion-particle complexes (hereinafter referred to as Cas12a-nickel particles, shown as Beads with Cas12a Binding via Ni in Figure 3) were prepared and demonstrated enzyme activity in combination with Cas12a-antibody particles (shown as Beads with Cas12a Binding via Ab in Figure 3, particles were prepared using Magnosphere® MS300). In both cases, the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 is shown. The reagents used were Cas12a 5.86 nM, target DNA 1 nM, IDT reporter concentration 125 nM, and HiLyte488 concentration 8.3 nM. NE Buffer was used as the reaction buffer.

[0081] As a result, both Cas12a-antibody particles and Cas12a-nickel particles exhibited relatively strong activity. Furthermore, it was demonstrated that Cas12a immobilized on particles with a particle size of 10 μm also functioned.

[0082] Similar to anti-His tag antibodies, nickel ions selectively coordinate to the His tag site and form a chelate. Therefore, it is presumed that strong activity is maintained because the particles and enzyme bind in an oriented manner, as in the experimental example in Figure 2.

[0083] (Example 4: Comparison of the activity of Cas12a-antibody particles and Cas12a-commercially available His-tagged antibody particles) The results of measuring enzyme activity using Cas12a-antibody particles (using Magnosphere® MS160, JSR Corporation; in Figure 4, Beads with Cas12a were ab-sensitized by myself) and a complex of commercially available anti-His-tag antibody magnetic particles (Anti-His-tag mAb-Magnetic Beads®, MBL Corporation) conjugated with Cas12a-crRNA (Purchased Ab-beads with Cas12a in Figure 4) are shown. In both cases, the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 is shown. The concentrations used were Cas12a 50 nM, target DNA 1 nM, IDT reporter 125 nM, and HiLyte488 8.3 nM. NE Buffer was used as the reaction buffer.

[0084] The results showed that Cas12a-antibody particles had a similar ability to bind Cas12a-crRNA complexes to that of Cas12a-commercial anti-His tag antibody particles, and that Cas12a immobilized on 1.5 μm particles was functional.

[0085] (Example 5: Comparison of the activity of Cas12a-antibody particles and Cas12a-crRNA aqueous solution) This figure shows a comparison of enzyme activity using Cas12a-antibody particles (beads with Cas12a binding via Ab in Figure 5) and a Cas12a-crRNA complex in aqueous solution (Cas12a solution in Figure 5). Both figures show the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. The concentrations used were Cas12a 5nM, target DNA 1nM, IDT reporter 125nM, and HiLyte488 8.3nM. NEBuffer was used as the reaction buffer.

[0086] This study compares the enzyme activity of Cas12a-antibody particles and a Cas12a-crRNA aqueous solution used as a positive control (PC). Figure 5 shows the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. The concentration of Cas12a bound to the aqueous solution and particles was 5 nM, the concentration of the target DNA_113 bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM. The results showed that the Cas12a-antibody particles had similar enzyme activity to the Cas12a-crRNA aqueous solution used as the PC.

[0087] (Example 6: Changes in the enzyme activity of Cas12a-antibody particles when the Cas12a charging ratio is changed) Four types of Cas12a-antibody particles with different Cas12a immobilization numbers were prepared by varying the mixing ratio of antibody particles to Cas12a (Cas12a concentrations: 1.9E+6 / particle, 9.0E+5 / particle, 8.3E+6 / particle, 4.5E+6 / particle). Enzyme reactions were performed using these particles, and their activity was measured. In all cases, the time-dependent ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 is shown. The Cas12a concentration was 11.7 nM, the target DNA was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM. NE Buffer was used as the reaction buffer.

[0088] This study compares the enzyme activity of various Cas12a-antibody particles with different Cas12a-crRNA concentrations, prepared by varying the starting concentration of Cas12a in the reaction between Cas12a and antibody particles. Figure 6 shows the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488.

[0089] As a result, we confirmed that changes in the initial concentration of Cas12a, as well as differences in Cas12a concentration on the particle surface, did not have a significant effect on enzyme activity.

[0090] (Example 7: Changes in the enzyme activity of Cas12a-antibody particles when the anti-His tag antibody loading ratio is changed) Regarding Cas12a-antibody particles, various loading ratios of anti-His tag antibody to the particles were investigated. Furthermore, the loading ratio of Cas12a was also investigated for each antibody particle, and Cas12a-antibody particles were prepared (antibody concentration: 1.3E+5 / particle, Cas12a concentrations of 4.3E+5 / particle and 7.4E+5 / particle; antibody concentration: 6.6E+5 / particle, Cas12a concentrations of 4.5E+5 / particle and 8.3E+5 / particle). Enzyme reactions were performed using these particles, and their activity was measured. All results show the time-dependent ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. The Cas12a concentration was 11.7 nM, target DNA 1 nM, IDT reporter concentration 125 nM, and HiLyte488 concentration 8.3 nM. NEBuffer was used as the reaction buffer. We compared the enzyme activity of various Cas12a-antibody particles prepared by varying the concentration of anti-His-tagged antibody in immobilization experiments with anti-His-tagged antibody particles. Furthermore, Cas12a-antibody particles were prepared by varying the concentration of Cas12a for each antibody particle. Figure 7 shows the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. The concentration of Cas12a bound to the particles was 11.7 nM, the concentration of the target DNA (113 bp) was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM.

[0091] As a result, we confirmed that changes in the concentration of anti-His tagged antibody did not have a significant effect on enzyme activity.

[0092] (Example 8: Comparison of activity between Cas12a-antibody particles and Cas12a-antibody particles (with crRNA added later)) Regarding Cas12a-antibody particles, a Cas12a-crRNA complex was formed and then bound to the antibody particles (Figure 8, Beads with Cas12a binding via Ab). However, this figure shows the results of a comparison between Cas12a-antibody particles (with crRNA added later) (Figure 8, Beads with Cas12a binding via Ab (crRNA added later)), which were prepared by binding Cas12a alone to antibody particles and then adding crRNA. In both cases, the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 is shown. The Cas12a concentration was 5.8 nM, target DNA was 1 nM, IDT reporter concentration was 125 nM, and HiLyte488 concentration was 8.3 nM. NE Buffer was used as the reaction buffer.

[0093] We investigated two conditions: Condition 1, in which a complex (2 complexes) of Cas12a and crRNA was formed and then reacted with antibody particles; and Condition 2, in which Cas12a and antibody particles were reacted first without prior complex formation, and then crRNA was reacted. In both cases, Figure 8 shows the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. The concentration of Cas12a bound to the particles was 5.8 nM in all cases, the concentration of the target DNA_113bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM.

[0094] As a result, it was confirmed that Cas12a-antibody particles (with crRNA added later) showed decreased enzyme activity compared to Cas12a-antibody particles. The particles with crRNA added later showed relatively weak enzyme activity, which is presumed to be due to a change in the structure of Cas12a when it is immobilized on the particle surface, or because the introduction of crRNA was unsuccessful due to steric hindrance on the particle surface, resulting in decreased enzyme activity.

[0095] (Example 9: Investigation of changes in enzyme activity in Cas12a-antibody particles and Cas12a-crRNA aqueous solution) The enzyme stability was measured in Cas12a-antibody particles (Beads with Cas12a binding via Ab in Figure 9) and Cas12a-crRNA aqueous solution (Cas12a solution in Figure 9). Both Cas12a-antibody particles and Cas12a-crRNA aqueous solution were adjusted to a Cas12a concentration of 100 nM and stored at 4°C for 12 days. The results of comparing the residual enzyme activity of Cas12a on day 0 and day 12 after concentration adjustment are shown. In both cases, the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488 is shown. The final Cas12a concentration was 5 nM, target DNA was 1 nM, IDT reporter concentration was 125 nM, and HiLyte488 concentration was 8.3 nM. NEBuffer was used as the reaction buffer.

[0096] Cas12a-antibody particles and Cas12a-crRNA aqueous solution were stored at 4°C for 12 days with a Cas12a concentration of 100 nM, and their activity was compared to that on day 0. Figure 9 shows the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. The Cas12a concentration in both the Cas12a-crRNA aqueous solution and Cas12a-antibody particles was 5 nM, the concentration of the target DNA_113 bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM.

[0097] As a result, we confirmed that the Cas12a-crRNA aqueous solution lost its activity after 12 days of storage, while the Cas12a-antibody particles maintained a significant level of activity even after 12 days of storage. This is presumed to be partly due to the high density of Cas12a immobilized on the particle surface, which allowed for the maintenance of a locally high concentration of Cas12a.

[0098] (Example 10: Investigation of the effect of blocking in the production of Cas12a-antibody particles) The effect of blocking agents during anti-His tag antibody immobilization was investigated when preparing Cas12a-antibody particles. Figure 10 shows the time evolution of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. PEG containing an amino group was used as the blocking agent. The concentration of Cas12a bound to the particles was 11.7 nM, the concentration of the target DNA_113 bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM. The results suggest that blocking agents do not affect enzyme activity during anti-His tag antibody immobilization.

[0099] (Example 11: Investigation of changes in enzyme activity in Cas12a-antibody particles and Cas12a-crRNA aqueous solution by ultrasonic irradiation) The changes in enzyme activity in Cas12a-antibody particles and Cas12a-crRNA aqueous solution induced by sonication were evaluated. Cas12a-antibody particles or Cas12a-crRNA aqueous solution were added to a 1.5 mL tube (Eppendorf) at a final Cas concentration of 10 nM, and the target DNA (113 bp) was mixed at a final concentration of 2 nM. The mixture was incubated at 37°C for 30 minutes. Subsequently, sonication was applied at 28 kHz for 0, 30, and 60 seconds using an ultrasonic cleaner (AS ONE) filled with ice-cold water. Enzyme activity was then evaluated. Figure 11(a) shows the results for Cas12a-antibody particles, and Figure 11(b) shows the results for Cas12a-crRNA aqueous solution. In both cases, Figure 11 shows the time change in the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. A PEG molecule with an amino group and a molecular weight of 5000 was used as a blocking agent. The concentration of Cas12a bound to the particles was 5 nM, the concentration of the target DNA_113bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM. As a result, it was confirmed that the activity of the Cas12a-crRNA aqueous solution was lost by sonication, while the enzyme activity was maintained in the Cas12a-antibody particles.

[0100] (Example 12: Investigation of the effect of different types of blocking agents on the production of Cas12a-antibody particles) In preparing Cas12a-antibody particles, the effect of different blocking agents on anti-His tag antibody immobilization was investigated. Enzyme activity and particle aggregation were examined for the following blocking agents: amino group-containing PEG with molecular weights of 5000 and 2000, bovine serum albumin (BSA), and no blocking. The number of Cas immobilized particles ranged from approximately 6 x 10^4 to 8 x 10^5 per bead, and three different types of particles with varying Cas immobilization numbers were prepared and evaluated for each blocking agent. Regarding enzyme activity, Figure 12 shows the time-dependent ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. Figure 12(a) shows the results for no blocking agent, (b) for PEG with a molecular weight of 5000, (c) for PEG with a molecular weight of 2000, and (d) for BSA. The concentration of Cas12a bound to the particles was 4 nM, the concentration of the target DNA_113bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM. As a result, good enzyme activity was confirmed with all blocking agents. Regarding particle aggregation, Figure 13 shows optical microscope images of Cas12a-antibody particles with a Cas immobilization number of approximately 3E+5 / particles on a glass slide. Figure 13(a) shows the particles without a blocking agent, (b) shows the particles with PEG as the blocking agent with a molecular weight of 5000, (c) shows the particles with PEG as the blocking agent with a molecular weight of 2000, and (d) shows the particles with BSA as the blocking agent. Aggregated particles were observed only in the absence of a blocking agent, confirming the particle suppression effect of the blocking agent.

[0101] (Example 13: Investigation of changes in the core particle of Cas12a-antibody particles) In preparing Cas12a antibody particles, we investigated variations in the core particle. We used magnetic particles (Quanterix, 103611) included in the Simoa™ Homebrew Assay Starter Kit as the core particle. The magnetic particles were buffered in Bead Conjugation Buffer (Quanterix), to which EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (ThermoFisherScientific), also dissolved in Bead Conjugation Buffer, was added. After stirring at 4°C for 30 minutes, the magnetic particles were recovered using a magnet. The recovered magnetic particles were dispersed in Bead Conjugation Buffer, and an arbitrary amount of anti-His-tag antibody (Anti-His-tag mAb, MBL Life Sciences) was added. The mixture was stirred at 4°C for 2 hours. Afterward, it was washed with Bead Wash Buffer (Quanterix), and then Bead Blocking Buffer (Quanterix) was added. The mixture was stirred at room temperature for 45 minutes. Magnetic particles were collected using a magnet, washed with Bead Wash Buffer, dissolved in Bead Diluent (Quanterix), and stored at 4°C until use. The prepared antibody particles were buffered with PBS-T, and the prepared Cas12a-crRNA solution was added to the desired concentration. After vortexing, the mixture was reacted with a shaker for 1 hour. After the reaction, the solution was removed, washed with PBS-T, and suspended in ultrapure water to prepare Cas12a-antibody particles. The activity of the prepared Cas12a-antibody particles was evaluated. Figure 14 shows the time change of the ratio of the fluorescence intensity of the IDT reporter to the fluorescence intensity of the internal standard dye HiLyte488. For comparison, Figure 14 also shows the results for Cas12a-antibody particles prepared using Magnosphere® MS300 as the core particle and PEG with a molecular weight of 2000 as the blocking agent. The concentration of Cas12a bound to the particles was 4 nM, the concentration of the target DNA_113bp was 1 nM, the IDT reporter concentration was 125 nM, and the HiLyte488 concentration was 8.3 nM. As a result, it was confirmed that Cas12a-antibody particles with different enzyme activities in the core particles could be produced.

Claims

1. A reagent comprising a composite particle including a particle and a complex bound to the particle, and an aqueous liquid in which the composite particle is dispersed, the reagent comprising: The complex comprises a Cas protein and a guide RNA bound to the Cas protein, and the particle has a particle size of 1 μm or more and 10 μm or less.

2. A reagent for detecting a target nucleic acid, comprising: The reagent further comprises a reporter molecule comprising a nucleic acid containing a specific base sequence; The reagent according to claim 1 , wherein the reporter molecule changes its luminescence when the nucleic acid containing the specific base sequence is cleaved by the complex to which the target nucleic acid is bound.

3. The reagent according to claim 2 , wherein the change in the luminescence is a change in luminescence intensity or a change in luminescence wavelength.

4. The reagent according to claim 2 , wherein the reporter molecule has a higher fluorescence intensity after the nucleic acid containing the specific base sequence is cleaved by the complex than before the nucleic acid is cleaved by the complex.

5. The reagent according to claim 1 , wherein the composite particle has a carboxy group.

6. The reagent according to claim 1 , wherein the particle is bound via the amino terminus of a Cas protein contained in the complex.

7. The reagent according to claim 1 , wherein the particle and the complex are bonded via an amide bond.

8. The reagent according to claim 1 , wherein the particle and the complex are bonded via a linker.

9. The reagent according to claim 8 , wherein the linker comprises a peptide consisting of 6 to 11 consecutive histidines.

10. The reagent according to claim 9 , wherein the linker has an antibody that binds to the peptide through an antigen-antibody reaction.

11. The reagent of claim 9 , wherein the linker comprises a metal complex that binds to the peptide.

12. 12. The reagent according to claim 11, wherein the metal complex is a complex of nitrilotriacetic acid or iminodiacetic acid with a divalent nickel ion.

13. The reagent of claim 8 , wherein the linker comprises polyethylene glycol.

14. The reagent of claim 8 , wherein the linker comprises a complex of biotin and avidin. Reagents listed.

15. The reagent according to claim 1 , wherein the complex is contained in an amount of less than 1 mg per mL of the reagent.

16. 5. The reagent according to claim 2, wherein the reporter molecule has a structure in which a fluorescent substance that emits fluorescence and a quenching substance that reduces the intensity of the fluorescence emitted from the fluorescent substance are bound via a nucleic acid containing a specific base sequence.

17. The reagent of claim 1 , further comprising a blocking agent.

18. The reagent according to any one of claims 1 to 17, wherein the Cas protein is Cas12 or Cas13.

19. A method for detecting a target nucleic acid, comprising: A complex comprising a Cas protein and a guide RNA bound to the Cas protein, mixing a reagent having a composite particle bound to the particle and a reporter molecule including a nucleic acid containing a specific base sequence with a sample including a target nucleic acid; cleaving a reporter molecule comprising a nucleic acid containing the specific base sequence by binding of the complex to the target nucleic acid; and detecting a change in luminescence caused by cleavage of the nucleic acid containing the specific base sequence, wherein the particle has a particle size of 1 μm or more and 10 μm or less.

Images