Method for protecting pig embryo from virus infection
Patent Information
- Application Number
- JP2023061345
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-04-05
- Publication Date
- 2025-11-11
AI Technical Summary
Current vaccines for porcine reproductive and respiratory syndrome virus (PRRSV) are ineffective due to strain mutation and insufficient immune stimulation, and there is a lack of reliable methods to identify persistently infected pigs, complicating control efforts, particularly in protecting pig fetuses from in utero infection.
Breeding sow animals with modified chromosomal sequences in both alleles of the CD163 gene to reduce susceptibility to PRRSV infection, using CRISPR/Cas9 technology to introduce inactivating mutations in the CD163 gene, thereby protecting fetuses from both type 1 and type 2 PRRSV viruses.
The method significantly reduces the susceptibility of pig fetuses to PRRSV infection in utero, providing effective protection against both genotypes of the virus and reducing the incidence and severity of clinical symptoms.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
Technical Field
[0004] ,
[0003] , , ,
[0001] Reference to Electronically Submitted Sequence Listing The official copy of the sequence listing was created on March 27, 2018, and was electronically submitted via EFS-Web as an ASCII-formatted sequence listing with a file named "Sequence Listing 18054WO" having a size of 175.5 kilobytes, and was submitted electronically simultaneously with this specification. The sequence listing contained in this ASCII-formatted document is part of this specification and is hereby incorporated by reference in its entirety into this specification.
[0002] The present invention relates to a method for protecting pig fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV).
Background Art
[0003] Porcine reproductive and respiratory syndrome virus (PRRS) is the most economically important pig disease in North America, Europe, and Asia, and North American producers spend approximately $600 million annually (Holtkamp et al., 2013). The clinical disease syndrome caused by infection with porcine reproductive and respiratory syndrome virus (PRRSV) was first reported in the United States in 1987 (Keffaber, 1989) and then in Europe in 1990 (Wensvoort et al., 1991). Infection with PRRSV results in respiratory diseases including cough and fever, reproductive failure in late pregnancy, and reduced growth ability. The virus is also involved in various polymicrobial disease syndrome interactions while maintaining a lifelong subclinical infection (Rowland et al., 2012). The losses are the result of respiratory diseases, poor growth ability, reproductive failure, and intrauterine infection in young pigs (Keffaber, 1989).
[0004] The reproductive form of this disease accounts for an estimated 45% of losses, resulting from miscarriage, stillbirth, and neonatal respiratory illness. In its most severe form, reproductive PRRS can result in a 90% fetal / neonatal mortality rate, along with increased maternal mortality. The reproductive form of PRRS occurs approximately 90 days into the 114-day gestation period, following infection in pregnant nulliparous or multiparous sows (Christianson et al., 1993; Rowland, 2010). After an initial stage of replication in maternal macrophages, the virus crosses the placenta and begins to proliferately infect the fetus. The virus initially infects only a small number of fetuses, followed by horizontal transmission of the virus from fetus to fetus (Wilkinson et al., 2016). The exact mechanism by which the virus crosses the placenta remains unknown, but it may be similar to the infected “Trojan horse” macrophages previously described for lactate dehydrogenase-elevating viruses (LDV) (Cafruny, 1996). Unlike alveolar macrophages in adult animals, the primary site of PRRSV replication in fetuses is the thymus (Rowland, 2003). Since pig fetuses become immunocompetent at approximately 70 days of gestation, PRRSV infection occurs in the fetal immune environment, which contains functional B and T cells (Rowland, 2003, Rowland, 2010).
[0005] Pigs that survive intrauterine infection become a continuous source of the virus in the downstream production period, resulting in uniquely infected populations (Rowland, et al., 2003). The most severe forms of reproductive disease are associated with a group of highly virulent isolates called atypical PRRSV (Halbur et al., 1997, Mengeling et al., 1998). Interestingly, many atypical PRRSV isolates emerged from farms that had been vaccinated against PRRS (Key et al., 2001). In 2006, an atypical virus called highly pathogenic PRRSV (HP-PRRSV) appeared in China and continues to decline the country's pig population (Tian et al., 2007). Since a standard commercial breeding facility houses approximately 5,000 lactating pigs, an outbreak of high-mortality reproductive PRRS can have devastating effects. Solutions for controlling reproductive PRRS remain a priority to ensure the sustainability of pork production and food security. Vaccines have been unable to control the disease, primarily due to genetic diversity within the viral structural proteins (Shi et al., 2010). In practice, intensive biosecurity measures provide the only means of protecting the reproductive population.
[0006] Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the family Arteriviridae, along with mouse lactate dehydrogenase elevation virus, monkey hemorrhagic fever virus, and equine arteritis virus. Structurally, arteriviruses are similar to togaviruses, but like coronaviruses, they replicate via nested 3' co-terminal sets of subgenomic mRNAs with a common leader and poly-A tail. Arteriviruses share key characteristics related to viral pathogenicity, including macrophage tropism, the ability to cause severe disease and persistent infection (Plagemann, 1996). Molecular comparisons between North American and European viruses place all PRRSV isolates into one of two genotypes, type 2 or type 1, respectively. Although the two genotypes have only about 70% identity at the nucleotide level (Nelsen et al., 1999), both share tropism towards CD163-positive cells, establish long-term infection, and produce similar clinical signs.
[0007] CD163 is a 130 kDa type 1 membrane protein consisting of nine scavenger receptor cysteine-rich (SRCR) domains and two spacer domains, along with a transmembrane domain and a short cytoplasmic tail (Fabriek et al., 2005). Porcine CD163 contains 17 exons encoding a peptide signal sequence, followed by nine SRCR domains, two linker domains (also referred to as prolineserine threonine (PST) domains located after SRCR 6 and SRCR 9), as well as a cytoplasmic domain followed by a short cytoplasmic tail. Surface expression of CD163 is limited to cells of the monocyte-macrophage lineage. In addition to functioning as a viral receptor, CD163 exhibits several important functions related to maintaining normal homeostasis. For example, following infection or tissue injury, CD163 acts as a scavenger molecule, removing haptoglobin-hemoglobin complexes from the blood (Kristiansen et al., 2001). The resulting heme degradation products regulate the associated inflammatory response (Fabriek et al., 2005). HbHp scavenging is a major function of CD163, located in SRCR3 (Madsen et al., 2004). Metabolites released by macrophages following HbHp degradation include bilirubin, CO, and free iron. One important function of CD163 is the prevention of oxidative toxicity resulting from free hemoglobin (Kristiansen et al., 2001, Soares et al., 2009).
[0008] Other important functions of CD163 include erythroblast adhesion (SRCR2), TWEAK (tumor necrosis factor-like weak apoptosis-inducing factor) receptor (SRCR1-4 and 6-9), bacterial receptor (SRCR5), and African swine virus receptor (Sanchez-Torres et al. 2003). CD163 also has a potential role as an immunomodulator (discussed in Van Gorp et al. 2010).
[0009] CD163 was first described as a receptor for PRRSV by Calvert et al. (2007). Transfection of non-tolerant cell lines with CD163 cDNA from various species, including monkeys, humans, dogs, and mice, can make cells tolerant to PRRSV infection (Calvert et al., 2007). In addition to CD163, a second receptor protein, CD169 (also known as sialoadhesin or SIGLEC1), was identified as a primary PRRSV receptor involved in the formation of initial interactions with the GP5-matrix (M) heterodimer, the major protein on the surface of virions (Delputte et al., 2002). In this model, subsequent interactions between CD163 and the GP2,3,4 heterotrimer within the endosomal compartment mediate the uncoating and release of the viral genome into the cytoplasm (Van Breedam et al., 2010, Allende et al., 1999). Previous models explaining PRRSV infection in alveolar macrophages identified SIGLEC1 (CD169) as the primary viral receptor on the macrophage surface, but earlier studies using SIGLEC 1- / - pigs showed no difference in viral replication compared to wild-type pigs (Prather et al., 2013). These results supported earlier in vitro studies showing that PRRSV-resistant cell lines lacking surface CD169 and CD163 supported viral replication after transfection with the CD163 plasmid (Welch et al., 2010).
[0010] Many aspects of PRRSV, both its etiology (particularly at the molecular level) and its zoonotic epidemiology, remain unknown, thus complicating control efforts. Currently, producers often vaccinate pigs against PRRSV with modified live attenuated strains or inactivated virus vaccines, but current vaccines often fail to provide satisfactory protection. This is attributed to both strain mutations and inadequate stimulation of the immune system. In addition to concerns regarding the effectiveness of available PRRSV vaccines, there is strong evidence that currently used modified live vaccines can persist and accumulate mutations in individual pigs and pig herds (Mengeling et al. 1999), as demonstrated in virulent wild isolates after experimental infection of pigs (Rowland et al., 1999). Furthermore, vaccine viruses have been shown to leach in the semen of vaccinated boars (Christopher-Hennings et al., 1997). As an alternative to vaccination, some experts advocate a "test and elimination" strategy in breeding herds (Dee et al., 1998). The successful use of this strategy depends on the removal of all pigs acutely or persistently infected with PRRSV, followed by strict control measures to prevent reintroduction of the virus. The difficulties and significant costs associated with this strategy stem from the fact that little is known about the pathogenesis of persistent PRRSV infection, and therefore, there is no reliable technology for identifying persistently infected pigs.
[0011] As can be seen, there is a need in this technology field for developing strategies to induce PRRSV resistance in animals. There is also a particular need for technologies to protect the fetus from PRRSV infection in utero, and technologies to prevent PRRSV transmission from mother to fetus. [Overview of the project]
[0012] A method is provided for protecting pig fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV). The method involves breeding sow animals with boar animals. The sow animals contain modified chromosomal sequences in both alleles of their CD163 gene, and the modified chromosomal sequences reduce the susceptibility of the sow animals to PRRSV infection compared to sow animals that do not contain any modified chromosomal sequences in their CD163 gene alleles. The boar animals contain at least one wild-type CD163 allele.
[0013] Other objects and features are partially self-evident and partially noted below. [Brief explanation of the drawing]
[0014] [Figure 1] Figure 1 shows the targeted vector and CRISPR used to modify CD163. Panel A shows wild-type exons 7, 8, and 9 of the CD163 gene targeted for modification using CRISPR. Panel B shows a targeted vector designed to replace porcine exon 7 (the porcine domain SRCR5 of CD163) with DNA encoding human SRCR8 of CD163L. This targeted vector was used for transfection with drug selection by G418. PCR primers for long-range, left-arm, and right-arm assays are labeled with arrows for 1230, 3752, 8791, 7765, and 7775. Panel C shows the same targeted vector as shown in Panel B, but with the Neo cassette removed. This targeted vector was used to target CD163 in cells that were already resistant to neomycin. Primers used for small deletion assays are indicated with arrows and labeled with GCD163F and GCD163R. Panel D highlights the exons targeted by CRISPR. The locations of CRISPR10, 131, 256, and 282 are represented by downward arrows on exon 7. The CRISPR number represents the number of base pairs from the intron-exon junction of intron 6 and exon 7. [Figure 2]Figure 2 shows the targeted vector and CRISPR used to modify CD1D. Panel A shows wild-type exons 3, 4, 5, 6, and 7 of the CD1D gene targeted for modification by CRISPR. Panel B shows the targeted vector designed to replace exon 3 with the selectable marker Neo. This targeted vector was used in combination with CRISPR to modify CD1D. PCR primers for long-range, left-arm, and right-arm assays are labeled with arrows for 3991, 4363, 7373, and 12806. Panel C shows the exons targeted by CRISPR. The positions of CRISPR 4800, 5350, 5620, and 5626 are represented by downward arrows on exon 3. Primers used for small deletion assays are illustrated with arrows and labeled with GCD1DF and GCD1DR. [Figure 3]Figure 3 shows the generation of CD163 and CD1D knockout pigs by CRISPR / Cas9 and SCNT. A) Targeted deletion of CD163 in somatic cells after transfection with CRISPR / Cas9 and donor DNA. The wild-type (WT) genotype yields a 6545 base pair (bp) band. Lanes 1–6 represent six distinct colonies from single transfection with CRISPR10 with donor DNA containing Cas9 and Neo. Lanes 1, 4, and 5 show large homozygous deletions of 1500–2000 bp. Lane 2 represents a smaller homozygous deletion. Lanes 3 and 6 represent the WT allele, as well as either small deletions of both alleles or biallelic modifications. The exact modification of each colony was determined solely by sequencing of the colonies used for SCNT. Thin WT bands in some lanes may represent cross-contamination of embryonic fibroblasts from adjacent WT colonies. NTC = no template control. B) Targeted deletion of CD1D in somatic cells after transfection with CRISPR / Cas9 and donor DNA. WT genotypes result in an 8729 bp band. Lanes 1-4 represent colonies with 500-2000 bp deletions of CD1D. Lane 4 appears to be a WT colony. NTC = no template control. C) Image of a CD163 knockout pig produced by SCNT during testing. This boar contains a homozygous 1506 bp deletion of CD163. D) Image of CD1D pigs produced during testing. These pigs contain a 1653 bp deletion of CD1D. E) Genotypes of two SCNT littermates containing a 1506 bp deletion of CD163. Lanes 1-3 (littermate 63) and 1-4 (littermate 64) represent the genotype of each piglet from each litter. Multiparous sows indicate recipient females of SCNT embryos, and WT represents the WT control. NTC = No template control. F) Genotypes of two SCNT littermates containing a 1653bp deletion in CD1D. Lanes 1-7 (littermate 158) and lanes 1-4 (littermate 159) represent the genotype of each piglet. [Figure 4]Figure 4 shows the effects of the CRISPR / Cas9 system in pig embryos. A) Frequency of blastocyst formation after injection of different concentrations of the CRISPR / Cas9 system into zygotes. The toxicity of the CRISPR / Cas9 system was lowest at 10 ng / μL. B) When introduced into zygotes, the CRISPR / Cas9 system can successfully inhibit eGFP expression in blastocysts. Original magnification × 4. C) Types of mutations on eGFP produced using the CRISPR / Cas9 system: WT genotype (SEQ ID NO: 16), #1 (SEQ ID NO: 17), #2 (SEQ ID NO: 18), and #3 (SEQ ID NO: 19). [Figure 5] Figure 5 shows the effect of the CRISPR / Cas9 system on targeted CD163 in pig embryos. A) Examples of mutations generated on CD163 by the CRISPR / Cas9 system: WT genotype (SEQ ID NO: 20), #1-1 (SEQ ID NO: 21), #1-4 (SEQ ID NO: 22), and #2-2 (SEQ ID NO: 23). All embryos examined by DNA sequencing showed mutations in CD163 (18 / 18). CRISPR131 is highlighted in bold. B) Sequencing reads of homozygous deletions caused by the CRISPR / Cas9 system. The image shows #1-4 from panel A with 2bp deletions of CD163. [Figure 6]Figure 6 shows the effect of the CRISPR / Cas9 system when introduced with two types of CRISPR. A) PCR amplification of CD163 in blastocysts injected with CRISPR / Cas9 as a zygote. Lanes 1, 3, 6, and 12 show the designed deletion between the two different CRISPRs. B) PCR amplification of CD1D in blastocysts injected with CRISPR / Cas9 as a zygote. CD1D had a lower deletion frequency compared to CD163 (3 / 23), as determined by gel electrophoresis; lanes 1, 8, and 15 show the clear deletion in CD1D. C) The CRISPR / Cas9 system successfully targeted two genes when two CRISPRs targeting CD163 and eGFP were provided to the system. Modifications of CD163 and eGFP are shown: CD163 WT (SEQ ID NO: 24), CD163#1 (SEQ ID NO: 25), CD163#2 (SEQ ID NO: 26), CD163#3 (SEQ ID NO: 27), eGFP WT (SEQ ID NO: 28), eGFP#1-1 (SEQ ID NO: 29), eGFP#1-2 (SEQ ID NO: 30), eGFP#2 (SEQ ID NO: 31), and eGFP#3 (SEQ ID NO: 32). [Figure 7] Figure 7 shows CD163 knockout pigs generated by the CRISPR / Cas9 system injected into zygotes. A) PCR amplification of CD163 from knockout pigs; clear signs of deletion were detected in littermates 67-2 and 67-4. B) Image of CD163 knockout pigs with surrogate mothers. All animals are healthy and show no signs of abnormality. C) Genotype of CD163 knockout pigs. Wild-type (WT) sequence is shown as SEQ ID NO: 33. Two animals (from littermates 67-1 (SEQ ID NO: 34) and 67-3 (SEQ ID NO: 37)) carry homozygous deletions or insertions in CD163. The other two animals (derived from littermates 67-2 and 67-4) carried both allele modifications of CD163: #67-2 A1 (SEQ ID NO: 35), #67-2 A2 (SEQ ID NO: 36), #67-4 A1 (SEQ ID NO: 38), and #67-4 a2 (SEQ ID NO: 39). The deletion was induced by introducing two different CRISPRs along with the Cas9 system. Animals from zygote injection of CD163 did not exhibit mosaic genotypes. [Figure 8]Figure 8 shows CD1D knockout pigs generated by the CRISPR / Cas9 system injected into zygotes. A) PCR amplification of CD1D from knockout pigs; 166-1 shows a mosaic genotype of CD1D. 166-2, 166-3, and 166-4 do not show changes in amplified size, but amplified sequencing revealed modifications. WT FF = wild-type fetal fibroblasts. B) PCR amplification of long-range assay showed a clear deletion of one allele in piglets 166-1 and 166-2. C) Image of CD1D knockout pigs with surrogate mother. D) Sequence data of CD1D knockout pigs, WT (SEQ ID NO: 40), #166-1.1 (SEQ ID NO: 41), #166-1.2 (SEQ ID NO: 42), #166-2 (SEQ ID NO: 43), #166-3.1 (SEQ ID NO: 44), #166-3.2 (SEQ ID NO: 45), and #166-4 (SEQ ID NO: 46). The atg start codon in exon 3 is shown in bold and lowercase. [Figure 9] Figure 9 shows the clinical signs during acute PRRSV infection. The results of daily evaluations of respiratory signs and fever in patients with CD163+ / + (n=6) and CD163- / - (n=3). [Figure 10] Figure 10 shows lung histopathology during acute PRRSV infection. Representative micrographs of H and E stained tissue from wild-type and knockout pigs. The left panel shows mononuclear cell edema and infiltration. The right panel of the knockout pig shows lung structure from a normal lung. [Figure 11] Figure 11 shows viremia in various genotypes. Note that the CD163- / - piglet data are arranged along the X-axis. [Figure 12] Figure 12 shows antibody production in null, wild-type, and uncharacterized allergenic pigs. [Figure 13-1]Figure 13 shows the cell surface expression of CD163 in individual pigs. The lines appearing to the right of the uncharacterized A, uncharacterized B, and CD163+ / + panels represent the CD163 antibody, while the lines appearing to the left of these panels are the antibody-free control (background). Note that in CD163− / − animals, the CD163 staining overlaps with the background control, and the CD163 staining in the uncharacterized alleles is approximately half between the WT level and the background (note that this is on a logarithmic scale and is also less than about 10%). [Figure 13-2] Same as above. [Figure 13-3] Same as above. [Figure 13-4] Same as above. [Figure 14] Figure 14 shows the levels of CD169 (FITC-labeled anti-CD169) on alveolar macrophages from three representative pigs and an antibody-free control. [Figure 15] Figure 15 shows viremia in various genotypes. Note that the Δ43 amino acid pig data are along the x-axis. [Figure 16-1] Figure 16 shows the genomic sequence of wild-type CD163 exons 7–10 used as a reference sequence (SEQ ID NO: 47). The sequence includes 3000 bp from upstream of exon 7 to the last base of exon 10. The underlined regions indicate the positions of exons 7, 8, 9, and 10, respectively. [Figure 16-2] Same as above. [Figure 17] Figure 17 is a diagram of CD163 modifications showing several CD163 chromosomal modifications, the predicted protein products for each modification, and the relative macrophage expression for each modification, as measured by the level of surface CD163 on porcine alveolar macrophages (PAM). The black regions indicate introns, the white regions indicate exons. The hatched region indicates the hCD163L1 exon 11 mimic, which is a homolog of porcine exon 7. The gray region indicates a synthetic intron with a PGK Neo construct. [Figure 18]Figure 18 is a diagram of the porcine CD163 protein and gene sequence. A) CD163 protein SRCR (ellipse) and PST (square) domains, and the corresponding gene exons. B) Comparison of porcine CD163 SRCR5 (SEQ ID NO: 120) and human CD163L1 SRCR8 (SEQ ID NO: 121) homologs. [Figure 19-1] Figure 19 shows representative results of the surface expression of CD163 and CD169 on PAMs derived from wild-type and CD163-modified pigs. Panels A - E show the results of the CD163 modifications illustrated in Figure 17. Pooled data for d7(1467) and d7(1280) are shown in Panel D. [Figure 19-2] Same as above. [Figure 20] Figure 20 shows serum haptoglobin levels in wild-type and CD163-modified pigs. [Figure 21] Figure 21 shows the relative tolerance of wild-type and HL11m PAMs to infection with type 2 PRRSV isolates. [Figure 22] Figure 22 shows the infection of CD163-modified pigs with type 1 and type 2 PRRSV isolates. [Figure 23] Figure 23 shows the viral loads in WT and CD163-modified pigs infected with type 2 virus. [Figure 24]Figure 24 shows fetal outcomes after maternal infection with PRRSV. The numbers on the left indicate each female parent ("Female Parent Number," see Table 16 below). Below each female parent number in parentheses are the results of PRRS PCR in serum measured as a log10 template / reaction. "N" indicates negative for PRRSV nucleic acid (Ct>39). Fetuses are identified by their number and relative position within each uterine horn. Asterisks identify fetal PCR samples obtained from ascites. The numbers below each fetus are the results of PRRS PCR in fetal serum (log10 template / reaction). The numbers in each circle indicate the presence of anatomical pathology: 1) normal fetus, 2) small fetus, 3) placental changes such as placental abruption and / or necrosis, 4) meconium-stained fetus, 5) fetus is dead and necrotic. Lowercase letters identify the genotype of individual fetuses (see Table 16). Keys: a,A / A;b,C / A;c,B / A;d,E / A;e,B / C;f,B / D;g,D / C;h,D / D;i,E / C;j,E / D;ND, could not be determined due to fetal necrosis;nd, genotype could not be determined. [Modes for carrying out the invention]
[0015] This invention relates to a method for protecting pig fetuses from infection with Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). Pigs with inactivating mutations in both alleles of the CD163 gene are resistant to PRRSV infection. It has been unexpectedly discovered that CD163-positive fetuses (e.g., fetuses with one or two wild-type CD163 alleles) can be protected from PRRSV infection in utero, as long as the female parent has inactivating mutations in both alleles of the CD163 gene. Therefore, for example, a female parent with inactivating mutations in both alleles of the CD163 gene may be a mating male with two wild-type CD163 alleles, and the resulting heterozygous fetuses will be protected from PRRSV infection.
[0016] definition When introducing elements of the present invention or preferred embodiments thereof, the articles "a," "an," "the," and "said" are intended to indicate the presence of one or more elements.
[0017] The term "and / or" means any one of the items, any combination of items, or all items to which this term is associated.
[0018] As used herein, the term “reproduction” refers to the union of male and female gametes so that fertilization occurs. Such union can be brought about by mating (copulation) or by artificial methods in vitro or in vivo. Such artificial methods include, but are not limited to, artificial insemination, surgically assisted artificial insemination, in vitro fertilization, intracytoplasmic sperm injection, zona pellucida opening, in vitro culture of fertilized egg cells, ovarian transplantation, and ovarian division. As used herein, the term “reproduction” also includes the transfer of a fertilized egg into the reproductive tract of a female animal.
[0019] The terms "comprising," "including," and "having" are intended to be comprehensive and imply that additional elements may exist beyond those listed.
[0020] The term "CRISPR" refers to "clustered, regularly arranged, short palindromic sequences of repetitions." CRISPR systems include Type I, Type II, and Type III CRISPR systems.
[0021] The term "Cas" refers to "CRISPR-related proteins." Examples of Cas proteins include, but are not limited to, Cas9 family member proteins, Cas6 family member proteins (e.g., Csy4 and Cas6), and Cas5 family member proteins.
[0022] The term “Cas9” can generally refer to polypeptides having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or similarity to the wild-type Cas9 polypeptide (e.g., Cas9 from S. pyogenes). Exemplary Cas9 sequences are provided by SEQ ID NOs. 1-256 and 795-1346 of U.S. Patent Publication 2016 / 0046963. SEQ ID NOs. 1-256 and 795-1346 of U.S. Patent Publication 2016 / 0046963 are incorporated herein by reference. "Cas9" may refer to a polypeptide having up to approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or similarity to the wild-type Cas9 polypeptide (e.g., from S. pyogenes). "Cas9" may refer to the wild-type or modified form of the Cas9 protein, which may include amino acid changes such as deletions, insertions, substitutions, variants, mutations, fusions, chimeras, or any combination thereof.
[0023] The term “Cas5” can generally refer to polypeptides having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or similarity with a wild-type exemplary Cas5 polypeptide (e.g., Cas5 from D. vulgaris). An exemplary Cas5 sequence is provided in Figure 42 of U.S. Patent Publication 2016 / 0046963. Figure 42 of U.S. Patent Publication 2016 / 0046963 is incorporated herein by reference. "Cas5" can generally refer to polypeptides having at least approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or similarity to the wild-type Cas5 polypeptide (e.g., Cas5 from D. vulgaris). "Cas5" can refer to wild-type or modified forms of the Cas5 protein, which may include amino acid changes such as deletions, insertions, substitutions, variants, mutations, fusions, chimeras, or any combination thereof.
[0024] The term “Cas6” can generally refer to polypeptides having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or similarity with a wild-type exemplary Cas6 polypeptide (e.g., Cas6 from T. thermophilus). An exemplary Cas6 sequence is provided in Figure 41 of U.S. Patent Publication 2016 / 0046963. Figure 41 of U.S. Patent Publication 2016 / 0046963 is incorporated herein by reference. “Cas6” can generally refer to polypeptides having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or similarity with a wild-type Cas6 polypeptide (e.g., Cas6 from T. thermophilus). "Cas6" may refer to the wild-type or modified form of the Cas6 protein, which may include amino acid changes such as deletions, insertions, substitutions, mutants, mutations, fusions, chimeras, or any combination thereof.
[0025] The terms "CRISPR / Cas9" or "CRISPR / Cas9 system" refer to a programmable nuclease system for genetic engineering that includes the Cas9 protein or its derivatives, as well as one or more non-coding RNAs that can provide the functionality of Cas9's CRISPR RNA (crRNA) and transactivating RNA (tracrRNA). crRNA and tracrRNA can be used individually or combined to produce a "guide RNA" (gRNA). The crRNA or gRNA provides a sequence complementary to the genomic target.
[0026] In this specification, any reference to a deletion in a nucleotide sequence from nucleotide x to nucleotide y means that all nucleotides within that range (including x and y) are deleted. Therefore, for example, the phrase "11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 compared to SEQ ID NO: 47" means that each of the nucleotides 3,317–3,147, including nucleotides 3,317 and 3,147, is deleted.
[0027] "Resistance" to animal diseases is a characteristic of animals, and animals avoid disease symptoms that result from animal pathogen interactions, such as the interaction between pigs and PRRSV. That is, the pathogen prevents the animal disease and associated disease symptoms from occurring, or alternatively, reduces the incidence and / or severity of clinical signs, or reduces clinical symptoms. Those skilled in the art will understand that the methods disclosed herein may be used in conjunction with other compositions and methods available in the art for protecting animals from pathogenic outbreaks.
[0028] As used herein, “gene editing,” “gene-edited,” “genetically edited,” and “gene-editing effector” refer to the use of homing techniques that have naturally occurring or artificially engineered nucleases, also referred to as “molecular scissors,” “homing endonucleases,” or “targeted endonucleases.” Nucleases create specific double-strand breaks (DSBs) at desired locations in the genome and, in some cases, utilize endogenous cellular mechanisms to repair breaks induced by the natural processes of homologous recombination (HR) and / or non-homologous end joining (NHEJ). Examples of gene-editing effectors include zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), clustered and regularly arranged short palindromic repeat (CRISPR) systems (e.g., CRISPR / Cas9 systems), and meganucleases (e.g., meganucleases reengineered as homing endonucleases). This term also includes the use of transgenic procedures and techniques, including, for example, when the alteration is a deletion or a relatively small insertion (typically less than 20 nt) and / or when DNA is not introduced from an exotic species. The term also encompasses offspring animals, such as those created by sexual or asexual reproduction from the initial gene-edited animals.
[0029] The terms “genome manipulation,” “genetic manipulation,” “genetically modified,” “gene alteration,” “genome modification,” and “genome modified” can refer to altering a genome by deleting, inserting, mutating, or substituting specific nucleic acid sequences. The alteration may be gene-specific or site-specific. Genome manipulation can involve cleaving nucleic acids using nucleases, thereby generating sites for modification. Manipulation of non-genomic nucleic acids is also attempted. Proteins containing nuclease domains can bind to and cleave target nucleic acids by forming complexes with the nucleic acid-targeting nucleic acid. In one example, cleavage can introduce a double-strand break into the target nucleic acid. The nucleic acid can be repaired, for example, by an endogenous non-homologous end-joining (NHEJ) mechanism. In a further example, nucleic acid fragments can be inserted. Modifications of nucleic acid-targeting nucleic acids and site-specific polypeptides can introduce novel functions used for genome manipulation.
[0030] As used herein, “homing DNA technology,” “homing technology,” and “homing endonuclease” include any mechanism that enables a designated molecule to target a designated DNA sequence, including zinc finger (ZF) proteins, transcription activator-like effector (TALE) meganucleases, and CRISPR systems (e.g., CRISPR / Cas9 systems).
[0031] The terms “increased resistance” and “reduced susceptibility” as used herein mean, but are not limited to, a statistically significant reduction in the incidence and / or severity of clinical signs or symptoms associated with pathogen infection. For example, “increased resistance” or “reduced susceptibility” may refer to a statistically significant reduction in the incidence and / or severity of clinical signs or symptoms associated with PRRSV infection in animals containing a modified chromosome sequence in the CD163 gene protein compared to control animals with an unmodified chromosome sequence. The term “statistically significant reduction in clinical symptoms” means, but are not limited to, that the incidence of at least one clinical symptom in the modified control group is at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 50%, and even more preferably at least 70% lower than in the unmodified control group after exposure to the infectious agent.
[0032] "Knockout" refers to the disruption of a gene's structure or regulatory mechanism. Knockouts may be induced by homologous recombination with targeted vectors, substitution vectors, or hit-and-run vectors, or by random insertions with gene trap vectors, resulting in complete, partial, or conditional loss of gene function.
[0033] As used herein, the term “mutation” includes alterations of the nucleotide sequence of a polynucleotide, such as a gene or coding DNA sequence (CDS), compared to a wild-type sequence. This term includes, but is not limited to, substitutions, insertions, frameshifts, deletions, inversions, translocations, duplications, splice-donor site mutations, point mutations, and the like.
[0034] In this specification, “reduction in the incidence and / or severity of clinical signs” or “reduction in clinical symptoms” means, but is not limited to, reducing the number of infected subjects in a group, reducing or eliminating the number of subjects exhibiting clinical signs of infection, or reducing the severity of any clinical signs present in one or more subjects compared to wild-type infection. For example, these terms include reduction in any clinical signs of infection, pulmonary pathology, viremia, antibody production, reduced pathogen load, pathogen shedding, reduced pathogen transmission, or any clinical signs that are symptoms of PRRSV. Preferably, these clinical signs are reduced by at least 10% in one or more animals of the present invention compared to infected subjects that do not have modifications to the CD163 gene. More preferably, in subjects of the present invention, the clinical signs are reduced by at least 20%, preferably at least 30%, more preferably at least 40%, and even more preferably at least 50%.
[0035] A "TALE DNA-binding domain" or "TALE" is a polypeptide containing one or more TALE repeat domains / units. The repeat domains are involved in the binding of the TALE to its congenerally target DNA sequence. A single "repeat unit" (also referred to as a "repeat") is typically 33–35 amino acids long and exhibits at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. Zinc fingers and TALE-binding domains can be "engineered" to bind to a given nucleotide sequence, for example, by manipulating the recognition helical region of a naturally occurring zinc finger or TALE protein (modification of one or more amino acids). Thus, an engineered DNA-binding protein (zinc finger or TALE) is a non-naturally occurring protein. Non-limiting examples of methods for manipulating DNA-binding proteins are design and selection. An engineered DNA-binding protein is a protein that does not exist naturally, whose design / composition arises primarily from reasonable criteria. Reasonable criteria for design include the application of substitution rules and computerized algorithms for processing information in databases that store information on existing ZFP and / or TALE design and binding data. See, for example, U.S. Patent Nos. 6,140,081, 6,453,242, and 6,534,261. Also see WO98 / 53058, WO98 / 53059, WO98 / 53060, WO02 / 016536, and WO03 / 016496, as well as U.S. Publication No. 2011 / 0301073.
[0036] A "zinc finger DNA-binding protein" (or binding domain) is a domain within a protein or larger protein that binds sequence-specifically to DNA via one or more zinc fingers. This is a region of amino acid sequence within the binding domain whose structure is stabilized by the coordination of zinc ions. The term zinc finger DNA-binding protein is often abbreviated as zinc finger protein or ZFP.
[0037] "Selected" zinc finger proteins, or TALEs, are proteins not found naturally, and their production arises primarily from empirical processes such as phage display, interaction trapping, or hybrid selection. See, for example, U.S. Patents 5,789,538, 5,925,523, 6,007,988, 6,013,453, 6,200,759, WO95 / 19431, WO96 / 06166, WO98 / 53057, WO98 / 54311, WO00 / 27878, WO01 / 60970, 01 / 88197, WO02 / 099084, and U.S. Publication 2011 / 0301073.
[0038] The following definitions are provided for various other terms.
[0039] Methods to protect pig fetuses from PRRSV infection A method is provided for protecting pig fetuses from infection with Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). This method involves breeding sow animals with boar animals. The sow animals contain modified chromosomal sequences in both alleles of their CD163 gene, and the modified chromosomal sequences reduce the susceptibility of the sow animals to PRRSV infection compared to sow animals that do not contain any modified chromosomal sequences in their CD163 gene alleles. The boar animals contain at least one wild-type CD163 allele.
[0040] In the methods described herein, the modified chromosome sequence may be a sequence that is altered to impair, reduce, or eliminate the CD163 protein function associated with PRRSV infection. Therefore, the sow animals used in the methods described herein may be referred to as “knockout” animals.
[0041] Male pigs may contain two wild-type CD163 alleles.
[0042] As used herein, the term “wild-type CD163 allele” means that the sequence of the CD163 allele is a naturally occurring sequence, or that the sequence of the CD163 allele contains one or more mutations (e.g., insertions, deletions, or substitutions) that do not substantially impair CD163 activity. Thus, wild-type CD163 alleles may contain polymorphisms and / or mutations, provided that their polymorphisms or mutations do not substantially impair CD163 activity.
[0043] Using the methods described herein, a fetus is protected from both type 1 and type 2 PRRSV viruses, including various type 1 and type 2 PRRSV isolates.
[0044] Therefore, in the methods described herein, the modified chromosome sequence can reduce the susceptibility of sow animals to type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses.
[0045] Modified chromosome sequences can reduce susceptibility in sows to PRRSV isolates selected from the group consisting of NVSL 97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
[0046] Sow animals may include genetically edited sow animals.
[0047] Genetically edited sow animals may be animals edited using a homing endonuclease. The homing endonuclease may be a naturally occurring endonuclease, but preferably it is a reasonably designed non-naturally occurring homing endonuclease having a DNA recognition sequence designed so that the endonuclease targets a chromosomal sequence within the gene encoding the CD163 protein.
[0048] Therefore, homing endonucleases can be engineered homing endonucleases. Homing endonucleases may include clustered and regularly arranged short palindromic repeat (CRISPR) systems, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), recombinase fusion proteins, meganucleases, or any combination thereof.
[0049] Homing nucleases preferably include CRISPR systems. Examples of CRISPR systems that can be used to create female pig animals for use in the methods described herein include, but are not limited to, CRISPR / Cas9, CRISPR / Cas5, and CRISPR / Cas6. The use of CRISPR systems for generating gene-edited animals will be discussed further below.
[0050] In any of the methods described herein, a female pig may have the same modified chromosome sequence in both alleles of the CD163 gene.
[0051] Alternatively, female pigs may have a first modified chromosome sequence in the first allele of the CD163 gene and a second modified chromosome sequence in the second allele of the CD163 gene, where the first and second modified chromosome sequences are distinct from each other.
[0052] In any of the methods described herein, each allele of the CD163 gene in a sow may include insertions, deletions, or combinations thereof.
[0053] For example, at least one allele of the CD163 gene in a sow may contain a deletion.
[0054] At least one allele of the CD163 gene may contain an intraframe deletion.
[0055] At least one allele of the CD163 gene in female pigs may contain an insertion.
[0056] In the methods described herein, the modified chromosome sequence preferably reduces CD163 protein production or activity compared to CD163 protein production or activity in sow animals lacking the modified chromosome sequence.
[0057] Preferably, the modified chromosome sequence does not result in substantially no production of functional CD163 protein by the sow animal. "Substantially no functional CD163 protein" means that the level of CD163 protein in the animal, offspring, or cell is undetectable, or, if detectable, at least about 90%, preferably at least about 95%, more preferably at least about 98%, and even more preferably at least about 99% lower than the level observed in the animal, offspring, or cell without the modified chromosome sequence.
[0058] For example, in any of the methods described herein, the female pig does not produce the CD163 protein.
[0059] In any of the methods described herein, each allele of the CD163 gene in a sow may include modifications in exon 7, modifications in exon 8, modifications in an intron adjacent to exon 7 or exon 8, or any combination thereof.
[0060] For example, one or both alleles of the CD163 gene in a sow may contain modifications in exon 7 of the CD163 gene.
[0061] Modifications in exon 7 can include deletions.
[0062] In any of the methods described herein, which involve a deletion of an allele of the CD163 gene in a sow, the deletion may include an intraframe deletion.
[0063] Modifications in exon 7 can include insertions.
[0064] In any of the methods described herein, modified chromosomal sequences in one or both alleles of the CD163 gene in sow animals may result in miscoding.
[0065] If a modified chromosomal sequence results in a miscoding in the CD163 gene allele, this miscoding may lead to an immature stop codon downstream of the miscoding in the CD163 gene allele.
[0066] In any of the methods described herein, at least one allele of the CD163 gene in a female pig is subjected to an 11-base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to reference SEQ ID NO: 47, a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to reference SEQ ID NO: 47, and a 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949 on the same allele compared to reference SEQ ID NO: 47, and a 124-base pair deletion from nucleotide 3,024 to nucleotide 3,147 compared to reference SEQ ID NO: 47. Base pair deletions, 123 base pair deletions from nucleotide 3,024 to nucleotide 3,146 compared to reference SEQ ID NO: 47, 1 base pair insertion between nucleotides 3,147 and 3,148 compared to reference SEQ ID NO: 47, 130 base pair deletions from nucleotide 3,030 to nucleotide 3,159 compared to reference SEQ ID NO: 47, 132 base pair deletions from nucleotide 3,030 to nucleotide 3,161 compared to reference SEQ ID NO: 47, 1506 base pair deletions from nucleotide 1,525 to nucleotide 3,030 compared to reference SEQ ID NO: 47, reference SEQ ID NO: Compared to 47, there is a 7-base pair insertion between nucleotides 3,148 and 3,149; compared to reference SEQ ID NO: 47, there is a 1280-base pair deletion from nucleotides 2,818 to 4,097; compared to reference SEQ ID NO: 47, there is a 1373-base pair deletion from nucleotides 2,724 to 4,096; compared to reference SEQ ID NO: 47, there is a 1467-base pair deletion from nucleotides 2,431 to 3,897; compared to reference SEQ ID NO: 47, there is a 1930-base pair deletion from nucleotides 488 to 2,417 (the deleted sequence is nucleotide 47). (Replaced by a 12-base pair insertion starting at 488, with an additional 129 base pair deletions in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to reference SEQ ID NO: 47), 28 base pair deletions from nucleotide 3,145 to nucleotide 3,172 compared to reference SEQ ID NO: 47, 1387 base pair deletions from nucleotide 3,145 to nucleotide 4,531 compared to reference SEQ ID NO: 47, 1382 base pair deletions from nucleotide 3,113 to nucleotide 4,494 compared to reference SEQ ID NO: 47 (the deleted sequence is nucleotide 3,Modifications include those selected from the group consisting of: replacement by an 11-base pair insertion starting at 113; a 1720-base pair deletion from nucleotide 2,440 to nucleotide 4,160 compared to reference SEQ ID NO: 47; a 452-base pair deletion from nucleotide 3,015 to nucleotide 3,466 compared to reference SEQ ID NO: 47; and any combination thereof.
[0067] At least one allele of the CD163 gene in female pigs may contain an 11-base pair deletion from nucleotides 3,137 to 3,147 compared to reference sequence number 47.
[0068] At least one allele of the CD163 gene in female pigs may contain a 377 base pair deletion between nucleotides 2,573 and 2,949 compared to reference SEQ ID NO: 47 on the same allele, as well as a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to reference SEQ ID NO: 47.
[0069] If the modification includes a 377-base-pair deletion between nucleotides 2,573 and 2,949 compared to reference sequence number 47 on the same allele, along with a 2-base-pair insertion between nucleotides 3,149 and 3,150 compared to reference sequence number 47, then this 2-base-pair insertion may include a dinucleotide AG.
[0070] At least one allele of the CD163 gene in female pigs may contain a 124-base pair deletion from nucleotide 3,024 to nucleotide 3,147 compared to reference sequence number 47.
[0071] At least one allele of the CD163 gene in female pigs may contain a 123-base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to reference SEQ ID NO: 47.
[0072] At least one allele of the CD163 gene in female pigs may contain a single base pair insertion between nucleotides 3,147 and 3,148 compared to reference sequence number 47.
[0073] If the modification involves a single base pair insertion between nucleotides 3,147 and 3,148 compared to reference sequence number 47, this single base pair insertion may contain a single adenine residue.
[0074] At least one allele of the CD163 gene in female pigs may contain a 130-base pair deletion from nucleotide 3,030 to nucleotide 3,159 compared to reference SEQ ID NO: 47.
[0075] At least one allele of the CD163 gene in female pigs may contain a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161 compared to reference SEQ ID NO: 47.
[0076] At least one allele of the CD163 gene in female pigs may contain a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to reference sequence number 47.
[0077] At least one allele of the CD163 gene in female pigs may contain a 7-base pair insertion between nucleotides 3,148 and 3,149 compared to reference sequence number 47.
[0078] If the modification includes a 7-base pair insertion between nucleotides 3,148 and 3,149 compared to reference sequence number 47, this 7-base pair insertion may include the sequence TACTACT (sequence number 115).
[0079] At least one allele of the CD163 gene in female pigs may contain a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to reference sequence number 47.
[0080] At least one allele of the CD163 gene in female pigs may contain a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to reference SEQ ID NO: 47.
[0081] At least one allele of the CD163 gene in female pigs may contain a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 compared to reference sequence number 47.
[0082] At least one allele of the CD163 gene in female pigs may contain a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to reference SEQ ID NO: 47, the deleted sequence being replaced by a 12 base pair insertion starting at nucleotide 488, and a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to reference SEQ ID NO: 47.
[0083] If the modification includes a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to reference SEQ ID NO: 47, and the deleted sequence is replaced by a 12 base pair insertion starting at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to reference SEQ ID NO: 47, then the 12 base pair insertion may include the sequence TGTGGAGAATTC (SEQ ID NO: 116).
[0084] At least one allele of the CD163 gene in female pigs may contain a 28-base pair deletion from nucleotide 3,145 to nucleotide 3,172 compared to reference sequence number 47.
[0085] At least one allele of the CD163 gene in female pigs may contain a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 compared to reference sequence number 47.
[0086] In female pigs, at least one allele of the CD163 gene may contain a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 compared to reference sequence number 47, and the deleted sequence is replaced by an 11 base pair insertion starting at nucleotide 3,113.
[0087] If the modification involves a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 compared to reference sequence number 47, and the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113, then the 11-base pair insertion may include the sequence AGCCAGCGTGC (sequence number 117).
[0088] At least one allele of the CD163 gene in female pigs may contain a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 compared to reference sequence number 47.
[0089] At least one allele of the CD163 gene in female pigs may contain a 452-base pair deletion from nucleotide 3,015 to nucleotide 3,466 compared to reference SEQ ID NO: 47.
[0090] For example, at least one allele of the CD163 gene in female pigs contains modifications selected from the group consisting of a 7-base pair insertion between nucleotides 3,148 and 3,149 compared to reference sequence number 47, a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to reference sequence number 47, a 377-base pair deletion from nucleotides 2,573 to 2,949 compared to reference sequence number 47 on the same allele, an 11-base pair deletion from nucleotides 3,137 to 3,147 compared to reference sequence number 47, a 1382-base pair deletion from nucleotides 3,113 to 4,494 compared to reference sequence number 47 (the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113), and any combination thereof.
[0091] The CD163 gene in female pigs may contain any combination of the modified chromosome sequences described herein.
[0092] For example, a female pig may have a 7-base pair insertion between nucleotides 3,148 and 3,149 in one allele of the CD163 gene compared to reference SEQ ID NO: 47, and a 2-base pair insertion between nucleotides 3,149 and 3,150 in the other allele of the CD163 gene compared to reference SEQ ID NO: 47, along with a 377-base pair deletion from nucleotides 2,573 to 2,949 compared to reference SEQ ID NO: 47.
[0093] Sow animals may have a 1382 base pair deletion in one allele of the CD163 gene, from nucleotides 3,113 to 4,494 compared to reference SEQ ID NO: 47 (the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113 in one allele of the CD163 gene), and a 377 base pair deletion in the other allele of the CD163 gene, from nucleotides 2,573 to 2,949 compared to reference SEQ ID NO: 47, along with a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to reference SEQ ID NO: 47.
[0094] Sow animals may have a 7-base pair insertion between nucleotides 3,148 and 3,149 in one allele of the CD163 gene compared to reference sequence number 47, and an 11-base pair deletion between nucleotides 3,137 and 3,147 in the other allele of the CD163 gene compared to reference sequence number 47.
[0095] Sow animals may have a 1382 base pair deletion from nucleotides 3,113 to 4,494 compared to reference sequence number 47 (the deleted sequence is replaced by an 11 base pair insertion starting at nucleotide 3,113 in one allele of the CD163 gene), and an 11 base pair deletion from nucleotides 3,137 to 3,147 in the other allele of the CD163 gene compared to reference sequence number 47.
[0096] In any of the methods described herein, an allele of the CD163 gene in a sow may contain a chromosomal sequence having at least 80% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0097] The CD163 gene allele of a female pig may contain a chromosomal sequence having at least 85% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0098] The CD163 gene allele of a female pig may contain a chromosomal sequence having at least 90% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0099] The CD163 gene allele of a female pig may contain a chromosomal sequence having at least 95% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0100] The CD163 gene allele of a female pig may contain a chromosomal sequence having at least 98% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0101] The CD163 gene allele of a female pig may contain a chromosomal sequence having at least 99% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0102] An allele of the CD163 gene in a female pig may contain a chromosomal sequence having at least 99.9% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0103] The CD163 gene allele of a female pig may contain a chromosomal sequence having at least 100% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
[0104] In any of the methods described herein, a female pig may have a chromosomal sequence in one or both alleles of the CD163 gene that includes sequence numbers 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, or 119.
[0105] For example, female pigs may have chromosomal sequences containing sequence numbers 99, 102, 103, or 113 in one or both alleles of the CD163 gene.
[0106] In female pigs, alleles of the CD163 gene can include any combination of chromosomal sequences, including sequence numbers 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, or 119. Therefore, female pigs may have a chromosomal sequence in one allele of the CD163 gene containing any one of sequence numbers 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, or 119, and a chromosomal sequence in the other allele of the CD163 gene containing any one of sequence numbers 98, 99, 100, 101, 102, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, or 119.
[0107] For example, a female pig may have a chromosomal sequence in which one allele of the CD163 gene contains sequence number 99, and the other allele of the CD163 gene contains sequence number 103.
[0108] Female pigs may have a chromosomal sequence containing sequence number 113 on one allele of the CD163 gene, and a chromosomal sequence containing sequence number 99 on the other allele of the CD163 gene.
[0109] Female pigs may have a chromosomal sequence containing sequence number 99 on one allele of the CD163 gene, and a chromosomal sequence containing sequence number 102 on the other allele of the CD163 gene.
[0110] Female pigs may have a chromosomal sequence containing sequence number 113 on one allele of the CD163 gene, and a chromosomal sequence containing sequence number 102 on the other allele of the CD163 gene.
[0111] In any of the methods described herein, breeding produces one or more fetuses containing a modified chromosome sequence within a single allele of the CD163 gene. Since the sow animals used in the methods described herein contain modified chromosome sequences in both alleles of its CD163 gene, breeding a sow animal with a boar animal containing at least one wild-type CD163 allele produces fetuses that inherit the CD163 allele containing the modified chromosome sequence from the sow animal and the wild-type CD163 allele from the boar animal. Thus, this breeding produces fetuses that are heterozygous for the modified CD163 chromosome sequence. If the boar animal contains two wild-type CD163 alleles, all fetuses produced as a result of breeding will be heterozygous for the modified CD163 chromosome sequence.
[0112] Fetuses produced through breeding will likely have reduced susceptibility to intrauterine PRRSV infection compared to intrauterine fetuses in wild-type sow animals.
[0113] In any of the methods described herein, breeding may include mating between a female pig and a male pig.
[0114] In any of the methods described herein, reproduction may include artificial insemination of a female animal using sperm obtained from a male animal.
[0115] In any of the methods described herein, breeding may include transferring fertilized eggs to the reproductive tract of a sow.
[0116] In a method of reproduction that includes transferring a fertilized egg to the reproductive tract of a female pig, the fertilized egg can be produced by in vitro fertilization of an oocyte using sperm obtained from a male pig.
[0117] In vitro fertilization may include intracytoplasmic injection of sperm obtained from male pigs into oocytes.
[0118] If reproduction involves transferring a fertilized egg to the reproductive tract of a sow, the oocyte may be an oocyte derived from a sow so as to contain modified chromosome sequences in both alleles of its CD163 gene. Alternatively, the oocyte may be an oocyte derived from a different sow so as to contain modified chromosome sequences in both alleles of its CD163 gene, and the modified chromosome sequences reduce the susceptibility of the animal to PRRSV infection compared to the susceptibility of a sow sow that does not contain any modified chromosome sequences in its CD163 gene alleles. Therefore, for example, any oocyte having modified chromosome sequences in both alleles of its CD163 gene (e.g., knockout of both alleles of the C163 gene) can be used.
[0119] However, if reproduction involves transferring a fertilized egg to the reproductive tract of a sow, the oocyte does not need to contain any modified chromosomal sequences within its CD163 gene allele. Oocytes containing two wild-type CD163 alleles can be used. Oocytes containing two wild-type CD163 alleles can be fertilized with sperm obtained from a boar, and the sperm will contain two wild-type CD163 alleles, creating fertilized egg cells containing two wild-type CD163 alleles. If such fertilized egg cells (containing two wild-type CD163 alleles) are transferred to the reproductive tract of a sow that contains modified chromosomal sequences in both alleles of its CD163 gene, the resulting fetus will be protected from PRRSV infection.
[0120] Alternatively, if breeding involves transferring a fertilized egg to the reproductive tract of a sow, the fertilized egg may contain a modified chromosome sequence within a single allele of its CD163 gene. Such a fertilized egg also produces a fetus that is protected from PRRSV infection when transferred to the reproductive tract of a sow, which contains modified chromosome sequences in both alleles of its CD163 gene.
[0121] Therefore, if breeding involves transferring a fertilized egg into the reproductive tract of a sow, the fertilized egg may contain modified chromosome sequences in both alleles of its CD163 gene (e.g., knockout of both alleles of its CD163 gene), contain modified chromosome sequences in only one allele of its CD163 gene, or contain only the wild-type CD163 allele.
[0122] Affinity tags An "affinity tag" can be either a peptide affinity tag or a nucleic acid affinity tag. The term "affinity tag" generally refers to a protein or nucleic acid sequence that can bind to a molecule (e.g., a small molecule, a protein, or a protein or nucleic acid sequence that can be bound by covalent bonds). An affinity tag can be a non-native sequence. A peptide affinity tag can contain peptides. A peptide affinity tag can be part of a splitting system (e.g., two inactive peptide fragments can be joined together trans-bonded to form an active affinity tag). A nucleic acid affinity tag can contain nucleic acids. A nucleic acid affinity tag can be a sequence that can selectively bind to a known nucleic acid sequence (e.g., through hybridization). A nucleic acid affinity tag can be a sequence that can selectively bind to a protein. An affinity tag can be fused to a native protein. An affinity tag can be fused to a nucleotide sequence.
[0123] In some cases, one, two, or more affinity tags can be fused to a native protein or nucleotide sequence. Affinity tags can be introduced into nucleic acid-targeted nucleic acids using in vitro or in vivo transcription methods. Nucleic acid affinity tags may include, for example, chemical tags, RNA-binding protein-binding sequences, DNA-binding protein-binding sequences, sequences hybridizable to affinity-tagged polynucleotides, synthetic RNA aptamers, or synthetic DNA aptamers. Examples of chemical nucleic acid affinity tags include, but are not limited to, biotin, fluorescent dyes, and ribonucleotide triphodes containing digoxeginine. Examples of protein-binding nucleic acid affinity tags include, but are not limited to, MS2-binding sequences, U1A-binding sequences, stem-loop-binding protein sequences, boxB sequences, eIF4A sequences, or any sequence recognized by an RNA-binding protein. Examples of nucleic acid affinity-tagged oligonucleotides include, but are not limited to, biotinylated oligonucleotides, 2,4-dinitrophenyl oligonucleotides, fluorescein oligonucleotides, and primary amine-conjugated oligonucleotides.
[0124] Nucleic acid affinity tags can be RNA aptamers. Examples of aptamers include amino acid aptamers such as those that bind to theophylline, streptavidin, dextran B512, adenosine, guanosine, guanine / xanthine, and 7-methyl-GTP; amino acid aptamers such as those that bind to arginine, citrulline, valine, tryptophan, cyanocobalamin, N-methylmesoporphyrin IX, flavin, and NAD; and antibiotic aptamers such as those that bind to tobramycin, neomycin, lividomycin, kanamycin, streptomycin, biomycin, and chloramphenicol.
[0125] Nucleic acid affinity tags may include RNA sequences that can be bound by site-specific polypeptides. Site-specific polypeptides may be conditionally enzymatically inactive. RNA sequences may include sequences that can be bound by members of type I, type II, and / or type III CRISPR systems. RNA sequences can be bound by RAMP family member proteins. RNA sequences can be bound by Cas9 family member proteins, Cas6 family member proteins (e.g., Csy4, Cas6). RNA sequences can be bound by Cas5 family member proteins (e.g., Cas5). For example, Csy4 can bind to specific RNA hairpin sequences with high affinity (Kd approximately 50 pM) and can cleave RNA at site 3' relative to the hairpin.
[0126] Nucleic acid affinity tags may include DNA sequences that can be bound by site-specific polypeptides. Site-specific polypeptides may be conditionally enzymatically inactive. DNA sequences may include sequences that can be bound by members of type I, type II, and / or type III CRISPR systems. DNA sequences may be bound by Argonaut proteins. DNA sequences may be bound by proteins containing zinc finger domains, TALE domains, or any other DNA-binding domains.
[0127] Nucleic acid affinity tags may include ribozyme sequences. Suitable ribozymes include peptidyltransferase 23 SrRNA, RnaseP, group I introns, group II introns, GIR1 branched ribozyme, leadzyme, hairpin ribozyme, hammerhead ribozyme, HDV ribozyme, CPEB3 ribozyme, VS ribozyme, glmS ribozyme, CoTC ribozyme, and synthetic ribozymes.
[0128] Peptide affinity tags may include tags that can be used for tracking or purification (e.g., fluorescent proteins such as green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato; His tags (e.g., 6XHis tags); hemagglutinin (HA) tags; FLAG tags; Myc tags; GST tags; MBP tags; chitin-binding protein tags; calmodulin tags; V5 tags; streptavidin-binding tags, etc.).
[0129] Both nucleic acid and peptide affinity tags can include small molecule tags such as biotin or digitoxin, and fluorescently labeled tags such as fluorothane, rhodamine, Alexafluoro dye, cyanine-3 dye, and cyanine-5 dye.
[0130] Nucleic acid affinity tags can be located at the 5' position relative to nucleic acids (e.g., nucleic acid-targeted nucleic acids). Nucleic acid affinity tags can be located at the 3' position relative to nucleic acids. Nucleic acid affinity tags can be located at both the 5' and 3' positions relative to nucleic acids. Nucleic acid affinity tags can be located within nucleic acids. Peptide affinity tags can be located at the N-terminus relative to polypeptide sequences. Peptide affinity tags can be located at the C-terminus relative to polypeptide sequences. Peptide affinity tags can be located at both the N-terminus and C-terminus relative to polypeptide sequences. Multiple affinity tags can be fused to nucleic acids and / or polypeptide sequences.
[0131] scavenger As used herein, “scavenger” may generally refer to agents capable of purifying polypeptides and / or nucleic acids. Scavengers may be biologically active molecules or substances (e.g., any biological substance found naturally or synthetically, but not limited to cells, viruses, subcellular particles, proteins, and more specifically, antibodies, immunoglobulins, antigens, lipoproteins, glycoproteins, peptides, polypeptides, protein complexes, (strept)avidin-biotin complexes, ligands, receptors, or small molecules, aptamers, nucleic acids, DNA, RNA, peptide nucleic acids, oligosaccharides, polysaccharides, lipid polysaccharides, cellular metabolites, haptens, pharmacologically active substances, alkaloids, steroids, vitamins, amino acids, and sugars). In some embodiments, the capture agent may include affinity tags. In some embodiments, the capture agent may preferentially bind to a target polypeptide or nucleic acid of interest. The capture agent may be freely suspended in a mixture. The capture agent may be bound to particles (e.g., beads, microbeads, nanoparticles). The capture agent may be bound to a solid or semi-solid surface. In some cases, the capture agent is irreversibly bound to the target. In other cases, the capture agent is reversibly bound to the target (e.g., if the target is elutable, or by the use of a chemical such as imidazole).
[0132] DNA-binding polypeptide Site-specific integration can be achieved, for example, by using factors capable of recognizing and binding to specific nucleotide sequences in the genome of a host organism. For instance, many proteins contain polypeptide domains capable of recognizing and binding to DNA in a site-specific manner. The DNA sequence recognized by a DNA-binding polypeptide can be referred to as the “target” sequence. A polypeptide domain capable of recognizing and binding to DNA in a site-specific manner generally folds correctly and functions independently to bind to DNA in a site-specific manner, even if the domain is expressed in polypeptides other than the protein from which it was originally isolated. Similarly, target sequences for recognition and binding by DNA-binding polypeptides can generally be recognized and bound by such polypeptides, even if they are located in large DNA structures (e.g., chromosomes), especially if the site where the target sequence is located is known to be accessible to soluble cellular proteins (e.g., genes).
[0133] DNA-binding polypeptides identified from naturally occurring proteins typically bind to distinct nucleotide sequences or motifs (e.g., consensus recognition sequences), but many methods exist and are known in the art for modifying such DNA-binding polypeptides to recognize different nucleotide sequences or motifs. Examples of DNA-binding polypeptides include, but are not limited to, zinc finger DNA-binding domains, leucine zippers, UPA DNA-binding domains, GAL4, TAL, LexA, Tet repressors, LacI, and steroid hormone receptors.
[0134] For example, DNA-binding polypeptides can be zinc fingers. Individual zinc finger motifs can be designed to target and specifically bind to any of the long-range DNA sites. Canonical Cys2His2 (and non-canonical Cys3His) zinc finger polypeptides bind to DNA by inserting an α-helix into the major groove of the target DNA double helix. DNA recognition by zinc fingers is modular, with each finger primarily contacting three consecutive base pairs at the target and several key residues in polypeptide-mediated recognition. By including multiple zinc finger DNA-binding domains in a targeted endonuclease, the DNA-binding specificity of the targeted endonuclease can be further increased (and therefore the specificity of any gene regulatory effects conferred thereby). See, for example, Urnov et al. (2005) Nature 435:646-51. Therefore, one or more zinc finger DNA-binding polypeptides may be engineered and utilized so that the targeted endonuclease introduced into the host cell interacts with DNA sequences that are unique within the host cell's genome.
[0135] Preferably, zinc finger proteins are non-natural in that they are engineered to bind to selected target sites. For example, Beerli et al. (2002) Nature Biotechnol. 20:135-141, Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340, Isalan et al. (2001) Nature Biotechnol. 19:656-660, Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637, Choo et al. See al.(2000)Curr.Opin.Struct.Biol.10:411-416, U.S. Patent Nos. 6,453,242, 6,534,261, 6,599,692, 6,503,717, 6,689,558, 7,030,215, 6,794,136, 7,067,317, 7,262,054, 7,070,934, 7,361,635, 7,253,273, and U.S. Patent Publications 2005 / 0064474, 2007 / 0218528, and 2005 / 0267061.
[0136] Manipulated zinc finger-binding domains can possess novel binding specificity compared to naturally occurring zinc finger proteins. Manipulation methods, but not limited to them, include rational design and various types of selection. Rational design involves, for example, using a database containing triple-chain (or quadruple-chain) nucleotide sequences and individual zinc finger amino acid sequences, where each triple-chain or quadruple-chain nucleotide sequence associates with one or more amino acid sequences of zinc fingers that bind to a specific triple-chain or quadruple-chain sequence. See, for example, U.S. Patents 6,453,242 and 6,534,261.
[0137] Exemplary selection methods, including phage displays and two hybrid systems, are disclosed in U.S. Patents 5,789,538, 5,925,523, 6,007,988, 6,013,453, 6,410,248, 6,140,466, 6,200,759, and 6,242,568, as well as WO98 / 37186, WO98 / 53057, WO00 / 27878, WO01 / 88197, and GB2,338,237. In addition, enhancement of binding specificity to zinc finger binding domains is described, for example, in WO02 / 077227.
[0138] In addition, as disclosed in these and other references, zinc finger domains and / or polyfingered zinc finger proteins may be linked together using any suitable linker sequence, for example, containing a linker of 5 amino acids or longer. For example linker sequences of 6 amino acids or longer, see also U.S. Patents 6,479,626, 6,903,185, and 7,153,949. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
[0139] Selection of target sites: Methods for designing and constructing ZFPs and fusion proteins (and the polynucleotides encoding them) are known to those skilled in the art, as per U.S. Patents 6,140,081, 5,789,538, 6,453,242, 6,534,261, 5,925,523, 6,007,988, 6,013,453, and 6,2 Details are provided in issues 00,759, WO95 / 19431, WO96 / 06166, WO98 / 53057, WO98 / 54311, WO00 / 27878, WO01 / 60970, WO01 / 88197, WO02 / 099084, WO98 / 53058, WO98 / 53059, WO98 / 53060, WO02 / 016536, and WO03 / 016496.
[0140] In addition, as disclosed in these and other references, zinc finger domains and / or polyfingered zinc finger proteins may be linked together using any suitable linker sequence, for example, containing a linker of 5 amino acids or longer. For example linker sequences of 6 amino acids or longer, see also U.S. Patents 6,479,626, 6,903,185, and 7,153,949. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
[0141] If a female porcine for use in the methods described herein is to be gene-edited using a zinc finger nuclease, the female can be prepared using a process that includes introducing at least one RNA molecule encoding the target zinc finger nuclease, and optionally at least one accessory polynucleotide, into an embryo or cell. This method further includes incubating the embryo or cell to enable the expression of the zinc finger nuclease, and the double-strand breaks introduced into the target chromosome sequence by the zinc finger nuclease are repaired by an error-prone non-homologous end-joining DNA repair process or a homology-directed DNA repair process. Methods for editing chromosome sequences encoding proteins related to germline development using targeted zinc finger nuclease technology are rapid, accurate, and highly efficient.
[0142] Alternatively, the DNA-binding polypeptide is the DNA-binding domain derived from GAL4. GAL4 is a modular transactivator in Saccharomyces cerevisiae, but also functions as a transactivator in many other organisms. See, for example, Sadowski et al. (1988) Nature 335:563-4. In this regulatory system, the expression of genes encoding enzymes in the galactose metabolic pathway in S. cerevisiae is strictly regulated by available carbon sources. Johnston (1987) Microbiol. Rev. 51:458-76. The transcriptional regulation of these metabolic enzymes is mediated by the interaction between the positive regulatory protein GAL4 and a 17 bp symmetric DNA sequence (upstream activation sequence (UAS)) to which GAL4 specifically binds.
[0143] Natural GAL4 consists of 881 amino acid residues with a molecular weight of 99 kDa. GAL4 contains a functionally autonomous domain, and its combined activity explains the activity of GAL4 in vivo. (Ma and Ptashne (1987) Cell 48:847-53), Brent and Ptashne (1985) Cell 43(3 Pt2):729-36.) The N-terminal 65 amino acids of GAL4 contain the GAL4 DNA-binding domain. (Keegan et al. (1986) Science 231:699-704, Johnston (1987) Nature 328:353-5.) Sequence-specific binding requires the presence of a divalent cation coordinated by six Cys residues present within the DNA-binding domain. The coordination cation-containing domain interacts with and recognizes the conserved CCG triple helix at each end of the 17 bp UAS via direct contact with the major groove of the DNA helix. Marmorstein et al. (1992) Nature 356:408-14. The DNA-binding function of proteins positions the C-terminal transcriptional activation domain near the promoter so that the activation domain can induce transcription.
[0144] Additional DNA-binding polypeptides that can be used include, but are not limited to, binding sequences derived from AVRBS3-inducible genes, consensus binding sequences derived from AVRBS3-inducible genes, or synthetic binding sequences manipulated therefrom (e.g., UPA DNA-binding domain), TAL, LexA (e.g., Brent & Ptashne (1985), see above), LacR (e.g., Labow et al. (1990) Mol. Cell. Biol. 10:3343-56, Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88(12):5072-6), steroid hormone receptors (Ellliston et al. Examples include Tet repressors (US Patent No. 6,271,341), mutated Tet repressors that bind to the tet operator sequence in the presence of tetracycline (Tc) rather than in the absence of Tc, the DNA-binding domain of NF-κB, and components of the regulatory system described in Wang et al. (1994) Proc. Natl. Acad. Sci. USA 91(17):8180-4 (utilizing a fusion of GAL4, hormone receptors, and VP16).
[0145] One or more DNA-binding domains of the nucleases used in the methods and compositions described herein may include naturally occurring or engineered (non-naturally occurring) TAL effector DNA-binding domains. See, for example, U.S. Patent Publication 2011 / 0301073.
[0146] Alternatively, nucleases can include CRISPR systems. For example, nucleases can include CRISPR / Cas systems.
[0147] The CRISPR / Cas system evolved in bacteria and archaea as an adaptive immune system to defend against viral attacks. Upon exposure to a virus, a short segment of viral DNA is incorporated into the CRISPR locus. RNA is transcribed from the portion of the CRISPR locus containing the viral sequence. This RNA, containing a sequence complementary to the viral genome, mediates the targeting of a Cas protein (e.g., Cas9 protein) to the sequence within the viral genome. The Cas protein cleaves, thereby silencing the viral target. Recently, the CRISPR / Cas system has been adapted for genome editing in eukaryotic cells. The introduction of site-directed double-strand breaks (DSBs) allows for modification of the target sequence via either of two endogenous DNA repair mechanisms—non-homologous end joining (NHEJ) or homology-directed repair (HDR). The CRISPR / Cas system has also been used for gene regulation, including transcriptional repression and activation, without modifying the target sequence. Target gene regulation based on the CRISPR / Cas system can, for example, utilize enzymatically inactive Cas9 (also known as non-catalytic Cas9).
[0148] The CRISPR / Cas system includes a CRISPR (clustered, regularly arranged, short palindromic repeat sequence) locus that encodes the RNA component of the system, and a Cas (CRISPR-related) locus that encodes the protein (Jansen et al., 2002. Mol. Microbiol. 43:1565-1575, Makarova et al., 2002. Nucleic Acids Res. 30:482-496, Makarova et al., 2006. Biol. Direct 1:7, Haft et al., 2005. PLoS Comput. Biol. 1:e60). In microbial hosts, the CRISPR locus contains non-coding RNA elements that can program the combination of Cas genes, as well as the specificity of CRISPR-mediated nucleic acid cleavage.
[0149] Type II CRISPR is one of the most well-characterized systems, performing innate target DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, a pre-crRNA array, and a tracrRNA are transcribed from the CRISPR locus. Second, the tracrRNA hybridizes to the repeat region of the pre-crRNA, mediating the processing of the pre-crRNA into a mature crRNA containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex induces Cas9 to the target DNA via Watson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA adjacent to the protospacer-adjacent motif (PAM), which is an additional requirement for target recognition. Finally, Cas9 mediates the cleavage of the target DNA, creating a double-strand break within the protospacer.
[0150] For the use of the CRISPR / Cas system to create targeted insertions and deletions, two non-coding RNAs (crRNA and TracrRNA) can be replaced by a single RNA called guide RNA (gRNA). The activity of the CRISPR / Cas system consists of three steps: (i) insertion of an exogenous DNA sequence into the CRISPR array to prevent future attacks in a process called "adaptation," (ii) expression of related proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference with foreign nucleic acids. In bacterial cells, several Cas proteins are involved in the natural function of the CRISPR / Cas system and play a role in functions such as the insertion of foreign DNA.
[0151] Cas proteins can be “functional derivatives” of naturally occurring Cas proteins. “Functional derivatives” of natural sequence polypeptides are compounds that share qualitative biological properties with the natural sequence polypeptide. “Functional derivatives” include, but are not limited to, fragments of natural sequence polypeptides, derivatives of natural sequence polypeptides, and fragments thereof, provided that they share biological activity with the corresponding natural sequence polypeptide. The biological activity referred to herein is the ability of a functional derivative to hydrolyze a DNA substrate into fragments. The term “derivative” encompasses both amino acid sequence variants of polypeptides, covalent modifications, and fusions thereof. Preferred derivatives of Cas polypeptides or fragments thereof include, but are not limited to, mutants, fusions, and covalent modifications of Cas proteins or fragments thereof. Cas proteins, including Cas proteins or fragments thereof, and derivatives of Cas proteins or fragments thereof, can be obtained from cells, chemically synthesized, or by a combination of these two procedures. The cells may be cells that naturally produce the Cas protein, or cells that naturally produce the Cas protein and produce endogenous Cas protein at higher expression levels, or cells that have been genetically engineered to produce the Cas protein from exogenous introduced nucleic acid, which may be the same as or different from endogenous Cas. In some cases, cells do not naturally produce the Cas protein and are genetically engineered to produce it.
[0152] If the female pigs to be used in the methods described herein have been gene-edited using the CRISPR system, the female pigs can be generated using the CRISPR / Cas9 system. To edit the genome sequence using Cas9, the protein can be delivered directly to cells. Alternatively, the mRNA encoding Cas9 can be delivered to cells, or a gene that provides expression of the mRNA encoding Cas9 can be delivered to cells. In addition, either target-specific crRNA and tracrRNA can be delivered directly to cells, or target-specific gRNA can be delivered to cells (these RNAs can, alternatively, be produced by genes constructed to express these RNAs). The selection of target sites and the design of crRNA / gRNA are well known in the art. Considerations for gRNA construction and cloning can be found at http: / / www.genome-engineering.org / crispr / wp-content / uploads / 2014 / 05 / CRISPR-Reagent-Description-Rev20140509.pdf.
[0153] DNA-binding polypeptides can specifically recognize and bind to target nucleotide sequences contained within the genomic nucleic acids of a host organism. Any number of distinct instances of the target nucleotide sequence may be found in the host genome in some embodiments. The target nucleotide sequence may be rare within the organism's genome (e.g., fewer than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 copy of the target sequence may exist in the genome). For example, the target nucleotide sequence may be located in a specific site within the organism's genome. The target nucleotide sequences may, for example, be randomly distributed throughout the genome in relation to one another, located within different linking groups within the genome, located within the same linking group, located on different chromosomes, located on the same chromosome, located within the genome at sites where they are expressed under similar conditions within an organism (e.g., under the control of the same or substantially functionally identical regulators), or located closely together within the genome (e.g., the target sequences may be contained within nucleic acids incorporated as linkages at genomic loci).
[0154] Targeted endonucleases DNA-binding polypeptides that specifically recognize and bind to a target nucleotide sequence may be included within the chimeric polypeptide to confer specific binding to the target sequence on the chimeric polypeptide. In the examples, such chimeric polypeptides may include, for example, nuclease, recombinase, and / or ligase polypeptides, as described above. Chimeric polypeptides containing DNA-binding polypeptides as well as nuclease, recombinase, and / or ligase polypeptides may also include, for example, other functional polypeptide motifs and / or domains, such as spacer sequences located between functional polypeptides in the chimeric protein, leader peptides, peptides that target the fusion protein to an organelle (e.g., the nucleus), polypeptides that are cleaved by cellular enzymes, peptide tags (e.g., Myc, His, etc.), and other amino acid sequences that do not interfere with the function of the chimeric polypeptide, for example, but not limited to these.
[0155] Functional polypeptides in a chimeric polypeptide (e.g., DNA-binding polypeptides and nuclease polypeptides) can be operably linked. Functional polypeptides in a chimeric polypeptide can be operably linked by their expression from a single polynucleotide encoding functional polypeptides ligated to each other at least within a frame, to create a chimeric gene encoding a chimeric protein. Alternatively, functional polypeptides in a chimeric polypeptide can be operably linked by other means, e.g., by crosslinking independently expressed polypeptides.
[0156] DNA-binding polypeptides, or guide RNAs, that specifically recognize and bind to target nucleotide sequences may be present in naturally occurring isolated proteins (or their mutants), and naturally occurring isolated proteins or their mutants may also contain nuclease polypeptides (and may also contain recombinase and / or ligase polypeptides). Examples of such isolated proteins include TALENs, recombinases (e.g., Cre, Hin, Tre, and FLP recombinases), RNA-induced CRISPR / Cas9, and meganucleases.
[0157] As used herein, the term “targeted endonuclease” refers to innate or engineered isolated proteins and their mutants comprising a DNA-binding polypeptide or guide RNA and a nuclease polypeptide, as well as chimeric polypeptides comprising a DNA-binding polypeptide or guide RNA and a nuclease. Any targeted endonuclease comprising a DNA-binding polypeptide or guide RNA that specifically recognizes and binds to a targeted nucleotide sequence contained within the CD163 locus (for example, because the target sequence is contained within a natural sequence at the locus, or because the target sequence has been introduced into the locus, for example, by recombination) may be used.
[0158] Some examples of suitable chimeric polypeptides include, but are not limited to, combinations of polypeptides: zinc finger DNA-binding polypeptides; FokI nuclease polypeptides; TALE domains; leucine zippers; transcription factor DNA-binding motifs; and, but are not limited to, DNA recognition and / or cleavage domains isolated from TALEN, recombinases (e.g., Cre, Hin, RecA, Tre, and FLP recombinases), RNA-induced CRISPR / Cas9, meganucleases, and other domains known to those skilled in the art. Specific examples include chimeric proteins comprising site-specific DNA-binding polypeptides and nuclease polypeptides. Chimeric polypeptides can be manipulated by methods known to those skilled in the art to modify the recognition sequence of the DNA-binding polypeptide contained within the chimeric polypeptide so that the chimeric polypeptide targets a specific nucleotide sequence of interest.
[0159] Chimeric polypeptides may include a DNA-binding domain (e.g., zinc finger, TAL effector domain, etc.) and a nuclease (cleavage) domain. The cleavage domain may be heterogeneous to a DNA-binding domain, e.g., a zinc finger DNA-binding domain and a cleavage domain from a nuclease, or a TALEN DNA-binding domain and a cleavage domain, or a meganuclease DNA-binding domain and a cleavage domain from a different nuclease. Heterogeneous cleavage domains can be obtained from any endonuclease or exonuclease. Exemplary endonucleases that can induce cleavage domains include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, the 2002-2003 Catalogue, New England Biolabs, Beverly, Mass., and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes for DNA cleavage are known (e.g., 51 nuclease, manguine nuclease, pancreatic DNAse I, microcockal nuclease, yeast HO endonuclease; see Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or their functional fragments) can be used as sources for cleavage domains and cleavage half-domains.
[0160] Similarly, the cleavage half-domains can originate from any of the aforementioned nucleases or a portion thereof that require dimerization for cleavage activity. Generally, if a fusion protein contains cleavage half-domains, two fusion proteins are required for cleavage. Alternatively, a single protein containing two cleavage half-domains can be used. The two cleavage half-domains may originate from the same endonuclease (or its functional fragment), or each cleavage half-domain may originate from a different endonuclease (or its functional fragment). In addition, the target sites of the two fusion proteins are preferably positioned relative to each other, so that the binding of the two fusion proteins to their respective target sites positions the cleavage half-domains in a spatial orientation relative to each other, which allows the cleavage half-domains to form a functional cleavage domain, for example, by dimerization. Thus, the relatives of the target sites can be separated by 5-8 nucleotides or 15-18 nucleotides. However, any integer number of nucleotides, or pairs of nucleotides, can be interposed between the two target sites (e.g., 2-50 pairs or more). Generally, the cleavage site is located between the target sites.
[0161] Restriction endonucleases (restriction enzymes) are present in many species and can sequence-specifically bind to DNA (at a recognition site) and cleave the DNA at or near the binding site so that, for example, one or more exogenous sequences (donor / transgenes) are incorporated at or near the binding (target) site. Certain restriction enzymes (e.g., IIS type) cleave the DNA at the site removed from the recognition site and have separable binding and cleavage domains. For example, the IIS type enzyme Fok I catalyzes a double-strand break of DNA at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand. See, for example, U.S. Patent Nos. 5,356,802, 5,436,150, and 5,487,994, as well as Li et al. (1992) Proc.Natl.Acad.Sci.USA 89:4275-4279, Li et al. (1993) Proc.Natl.Acad.Sci.USA 90:2764-2768, Kim et al. (1994a) Proc.Natl.Acad.Sci.USA 91:883-887, and Kim et al. (1994b) J.Biol.Chem.269:31,978-31,982. Thus, the fusion protein may include at least one cleavage domain (or cleavage half-domain) derived from an IIS-type restriction enzyme and one or more zinc finger-binding domains, which may or may not be manipulated.
[0162] An exemplary IIS-type restriction enzyme in which the cleavage domain is separable from the binding domain is Fok I. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95:10,570-10,575. Therefore, for the purposes of this disclosure, the portion of the Fok I enzyme used in the disclosed fusion protein is considered a cleavage half-domain. Thus, for targeted double-strand breaks and / or targeted substitutions of cellular sequences using a zinc finger-Fok I fusion, the catalytically active cleavage domain can be reconstructed using two fusion proteins, each containing a Fok I cleavage half-domain. Alternatively, a single polypeptide molecule containing a DNA-binding domain and two Fok I cleavage half-domains can also be used.
[0163] A cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity or the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
[0164] An exemplary IIS-type restriction enzyme is described in U.S. Patent Publication 2007 / 0134796. Additional restriction enzymes also contain separable binding and cleavage domains, which are intended by this disclosure. See, for example, Roberts et al. (2003) Nucleic Acids Res. 31:418-420.
[0165] The cleavage domain may include one or more manipulated cleavage half-domains (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, as described, for example, in U.S. Patent Publications 2005 / 0064474, 2006 / 0188987, and 2008 / 0131962.
[0166] Alternatively, nucleases can be assembled in vivo at nucleic acid target sites using so-called "severance enzyme" techniques (see, for example, U.S. Patent Publication 2009 / 0068164). Components of such severance enzymes may be expressed on separate expression constructs, or the individual components may be linked within a single open reading frame separated, for example, by a self-cleaving 2A peptide or IRES sequence. The components may be individual zinc finger-binding domains or meganuclease nucleic acid-binding domains.
[0167] Zinc finger nuclease Chimeric polypeptides may include custom-designed zinc finger nucleases (ZFNs) that can be designed to deliver target-site-specific double-strand DNA breaks into which exogenous nucleic acids or donor DNA can be incorporated (see U.S. Patent Publication 2010 / 0257638). A ZFN is a chimeric polypeptide containing a nonspecific cleavage domain and a zinc finger DNA-binding domain polypeptide from a restriction endonuclease (e.g., FokI). For example, Huang et al. (1996) J.Protein Chem.15:481-9, Kim et al. (1997a) Proc. Natl. Acad. Sci. USA 94:3616-20, Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93:1156-60, Kim et al. al. (1994) Proc Natl. Acad. Sci. USA 91:883-7, Kim et al. (1997b) Proc. Natl. Acad. Sci. USA 94:12875-9, Kim et al. (1997c) Gene 203:43-9, Kim et al. al.(1998)Biol.Chem.379:489-95, Nahon and See Raveh (1998) Nucleic Acids Res. 26:1233-9 and Smith et al. (1999) Nucleic Acids Res. 27:674-81. ZFNs can contain non-canonical zinc finger DNA binding domains (see U.S. Patent Publication No. 2008 / 0182332). To cleave DNA and introduce double-strand breaks, FokI restriction endonucleases must dimerize via their nuclease domain. Therefore, ZFNs containing a nuclease domain derived from such an endonuclease also require dimerization of the nuclease domain to cleave target DNA. See Mani et al. (2005) Biochem. Biophys. Res. Commun. 334:1191-7 and Smith et al. (2000) Nucleic Acids Res. 28:3361-9. ZFN dimerization can be facilitated by two adjacent, oppositely oriented DNA binding sites. (Ibid.)
[0168] A site-directed method for the incorporation of exogenous nucleic acids into at least one CD163 locus in a host may involve introducing a ZFN into a host cell, the ZFN recognizing and binding to a target nucleotide sequence, and the target nucleotide sequence being incorporated into at least one CD163 locus in the host. In certain specific cases, the target nucleotide sequence is not incorporated into the host genome at any other location other than at least one CD163 locus. For example, the DNA-binding polypeptide of the ZFN may be engineered to recognize and bind to a target nucleotide sequence identified within at least one CD163 locus (e.g., by sequencing the CD163 locus). A method for site-specific integration of an exogenous nucleic acid into at least one CD163 performance locus in a host, comprising introducing a ZFN into a host cell, may also comprise introducing an exogenous nucleic acid into a cell, wherein the recombination of the exogenous nucleic acid into the host nucleic acid containing at least one CD163 locus is facilitated by site-specific recognition and binding of the ZFN to a target sequence (and subsequent cleavage of the nucleic acid containing the CD163 locus).
[0169] Any exogenous nucleic acid for integration at the CD163 locus Exogenous nucleic acids for integration at the CD163 locus include exogenous nucleic acids for site-specific integration at at least one CD163 locus, such as, but not limited to, an ORF, a nucleic acid comprising a nucleotide sequence encoding a targeted endonuclease, and a vector comprising at least one of the aforementioned. Thus, a particular nucleic acid comprises a nucleotide sequence encoding a polypeptide, a structural nucleotide sequence, and / or a DNA-binding polypeptide recognition and binding site.
[0170] Any exogenous nucleic acid molecule for site-specific integration As described above, insertion of exogenous sequences (also called “donor sequences,” “donors,” or “transgenes”) is provided, for example, for polypeptide expression, correction of mutant genes, or increased expression of wild-type genes. It will be readily apparent that donor sequences are typically not identical to the genomic sequence in which they are placed. Donor sequences may contain non-homologous sequences adjacent to two homologous regions to enable efficient homology-directed repair (HDR) at the desired location. In addition, donor sequences may contain vector molecules containing sequences that are not homologous to the region of interest in cellular chromatin. Donor molecules may contain several discontinuous regions homologous to cellular chromatin. For example, for targeted insertion of sequences that are not normally present in the region of interest, such sequences may be present within the donor nucleic acid molecule and adjacent to regions homologous to the sequence in the region of interest.
[0171] Donor polynucleotides can be DNA or RNA, single-stranded or double-stranded, and can be introduced into cells in linear or circular form. See, for example, U.S. Patent Publications 2010 / 0047805, 2011 / 0281361, 2011 / 0207221, and 2013 / 0326645. When introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues may be added to the 3' end of the linear molecule and / or a self-complementary oligonucleotide may be ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963 and Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified nucleotide bonds such as phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues.
[0172] Polynucleotides can be introduced into cells as part of a vector molecule containing additional sequences, such as genes encoding origins of replication, promoters, and antibiotic resistance. Furthermore, donor polynucleotides can be introduced as naked nucleic acids, as nucleic acids complexed with drugs such as liposomes or poloxamers, or delivered by viruses (e.g., adenoviruses, AAVs, herpesviruses, retroviruses, lentiviruses, and integrase-deficient lentiviruses (IDLVs)).
[0173] Donors are generally integrated such that their expression is driven by an endogenous promoter at the integration site, i.e., a promoter that drives the expression of the endogenous gene into which the donor is integrated (e.g., CD163). However, it has become clear that donors may also contain promoters and / or enhancers, such as constitutive promoters or inducible or tissue-specific promoters.
[0174] Furthermore, although not required for expression, exogenous sequences may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding the 2A peptide, and / or polyadenylation signals.
[0175] Exogenous nucleic acids that can be site-specifically incorporated into at least one CD163 locus to modify the CD163 locus include, but are not limited to, nucleic acids containing a nucleotide sequence encoding a polypeptide of interest, nucleic acids containing an agricultural gene, nucleic acids containing a nucleotide sequence encoding an RNAi molecule, or nucleic acids that disrupt the CD163 gene.
[0176] Exogenous nucleic acids can be incorporated into the CD163 locus to modify it, and the nucleic acid contains a nucleotide sequence encoding the polypeptide of interest, thereby allowing that nucleotide sequence to be expressed in the host from the CD163 locus. In some examples, the polypeptide of interest (e.g., an exogenous protein) is expressed from a commercially available quantity of the nucleotide sequence encoding the polypeptide of interest. In such examples, the polypeptide of interest may be extracted from host cells, tissues, or biomass.
[0177] Nucleic acid molecules containing nucleotide sequences encoding target endonucleases The nucleotide sequence encoding a targeted endonuclease can be manipulated by manipulating (e.g., ligation) the native nucleotide sequence encoding the polypeptide contained within the targeted endonuclease. For example, the nucleotide sequence of a gene encoding a protein containing a DNA-binding polypeptide can be examined to identify the nucleotide sequence of the gene corresponding to the DNA-binding polypeptide, and that nucleotide sequence can be used as an element of the nucleotide sequence encoding the targeted endonuclease containing the DNA-binding polypeptide. Alternatively, for example, the nucleotide sequence encoding the targeted endonuclease can be estimated using the amino acid sequence of the targeted endonuclease, following genetic coding denaturation.
[0178] In an exemplary nucleic acid molecule containing a nucleotide sequence encoding a targeted endonuclease, the last codon of the first polynucleotide sequence encoding the nuclease polypeptide and the first codon of the second polynucleotide sequence encoding the DNA-binding polypeptide can be separated by any number of nucleotide triplets, for example, without encoding an intron or "STOP". Similarly, the last codon of the nucleotide sequence encoding the first polynucleotide sequence encoding the DNA-binding polypeptide and the first codon of the second polynucleotide sequence encoding the nuclease polypeptide may be separated by any number of nucleotide triplets. The last codons (i.e., the 3' ends in the nucleic acid sequences) of the first polynucleotide sequence encoding the nuclease polypeptide and the second polynucleotide sequence encoding the DNA-binding polypeptide can be fused in a phase register with the first codon of a further polynucleotide coding sequence directly following it, or separated by a short peptide sequence or a peptide sequence such that it is encoded by a synthetic nucleotide linker (e.g., a nucleotide linker that can be used to achieve fusion). Examples of such further polynucleotide sequences include, but are not limited to, tags, targeted peptides, and enzymatic cleavage sites. Similarly, the first codon at the 5' end (in the nucleic acid sequence) of the first and second polynucleotide sequences may be fused in the phase register with the last codon of a further polynucleotide coding sequence directly adjacent to it, or they may be separated from it by only a short peptide sequence.
[0179] The sequences that isolate the polynucleotide sequences encoding functional polypeptides in targeted endonucleases (e.g., DNA-binding polypeptides and nuclease polypeptides) can consist of, for example, any sequence, and consequently, the encoded amino acid sequence is unlikely to significantly alter the translation of the targeted endonuclease. Due to the autonomy of known nuclease polypeptides and known DNA-binding polypeptides, the intervening sequences do not interfere with the respective functions of these structures.
[0180] Other knockout methods Using various other techniques known in the art, genes can be inactivated to produce knockout animals, and / or nucleic acid constructs can be introduced into animals to produce founder animals, creating animal strains in which the knockout or nucleic acid construct is incorporated into the genome. Such techniques, though not limited to them, include prokaryotic microinjection (US Patent Nos. 4,873,191), retrovirus-mediated gene transfer into germ cell lines (Van der Putten et al. (1985) Proc. Natl. Acad. Sci. USA 82, 6148-1652), gene targeting of embryonic stem cells (Thompson et al. (1989) Cell 56, 313-321), embryonic electroporation (Lo (1983) Mol. Cell. Biol. 3, 1803-1814), and sperm-mediated gene transfer (Lavitrano et al. (2002) Proc. Natl. Acad. Sci. USA 99, 14230-14235, Lavitrano et al. Examples include in vitro transformation of somatic cells, e.g., cumulus oophorus or mammary gland cells, or adult, fetal, or embryonic stem cells, followed by nuclear transfer (Wilmut et al. (1997) Nature 385, 810-813 and Wakayama et al. (1998) Nature 394, 369-374). Prokaryotic microinjection, sperm-mediated gene transfer, and somatic cell nuclear transfer are particularly useful techniques. A genome-modified animal is one in which all cells, including its germline cells, have modifications. When using methods to produce animals that are mosaics in their modifications, the animals may be inbred, and genome-modified offspring may be selected. Cloning can be used, for example, to produce mosaic animals when the cells are modified in the blastocyst stage, or genome modification can be performed when a single cell is modified. Animals modified to prevent sexual maturity may be homozygous or heterozygous for the modification, depending on the specific approach used. Homozygosity is usually required when a particular gene is inactivated by a knockout modification.When specific genes are inactivated by RNA interference or dominant-negative strategies, heterozygosity is often sufficient.
[0181] Typically, in embryo / zygote microinjection, a nucleic acid construct or mRNA is introduced into the fertilized egg, and one or two cell fertilized eggs are used as nuclear structures containing genetic material from sperm heads, while the oocyte is visible within the cytoplasm. Prokaryotic stage fertilized eggs can be obtained in vitro or in vivo (i.e., surgically retrieved from the oviducts of donor animals). In vitro fertilized eggs can be produced as follows: For example, pig ovaries can be collected at the slaughterhouse and maintained at 22-28°C during transport. The ovaries can be washed and isolated for follicular aspiration, and follicles ranging from 4-8 mm can be aspirated into a 50 mL conical centrifuge tube under vacuum using an 18-gauge needle. The follicular fluid and aspirated oocytes can be washed through a pre-filter with commercially available TL-HEPES (Minitube, Verona, Wis.). Oocytes surrounded by compact cumulus oophores can be selected and placed in TCM-199 oocyte maturation medium (Minitube, Verona, Wis.) supplemented with 0.1 mg / mL cysteine, 10 ng / mL epidermal growth factor, 10% porcine follicular fluid, 50 μM 2-mercaptoethanol, 0.5 mg / mL cAMP, 10 IU / mL pregnant mare serum gonadotropin (PMSG), and human chorionic gonadotropin (hCG), respectively, for approximately 22 hours at 38.7°C and 5% CO2 humidified air. The oocytes can then be transferred to fresh TCM-199 maturation medium without cAMP, PMSG, or hCG and incubated for a further 22 hours. The mature oocytes can be removed by vortexing in 0.1% hyaluronidase for 1 minute to remove their cumulus cells.
[0182] In pigs, mature oocytes can be fertilized in 500 μL of Minitube PORCPRO IVF medium (Minitube, Verona, Wis.) in a Minitube 5-well fertilization dish. For in vitro fertilization (IVF) preparation, freshly collected or frozen boar semen can be washed and resuspended in PORCPRO IVF medium with 400,000 sperm. Sperm concentration can be analyzed by computer-assisted semen analysis (SPERMVISION, Minitube, Verona, Wis.). Final in vitro fertilization can be performed in 10 μL volume with a final concentration of approximately 40 motile sperm / oocytes, depending on the boar. All fertilized eggs can be incubated at 38.7°C for 6 hours in a 5.0% CO2 atmosphere. Six hours after fertilization, the putative zygotes can be washed twice in NCSU-23 and transferred to 0.5 mL of the same medium. This system can routinely produce 20-30% blastocysts across most boars, with a polyspermy rate of 10-30%.
[0183] Linear nucleic acid constructs or mRNA can be injected into one of the prokaryotes or into the cytoplasm. The injected egg can then be transferred to a recipient female (e.g., into the recipient female's oviduct) and developed in the recipient female to produce a transgenic or gene-edited animal. In particular, in vitro fertilized eggs can be separated into deposited lipids by centrifugation at 15,000 × g for 5 minutes, allowing visualization of the prokaryotes. The embryos can be injected using an Eppendorf FEMTOJET injector and cultured until blastocyst formation. The rate and quality of embryo cutting and blastocyst formation can be recorded.
[0184] The embryos can be surgically implanted into the uterus of an asynchronous recipient. Typically, 100–200 embryos (e.g., 150–200) can be deposited at the ampulla-isthmus junction of the fallopian tube using a 5.5-inch TOMCAT® catheter. Postoperatively, real-time ultrasound monitoring of pregnancy can be performed.
[0185] In somatic cell nuclear transfer, transgenic or gene-edited cells, such as germ cells, fetal fibroblasts, adult ear fibroblasts, or granulocytes containing the above nucleic acid constructs, can be introduced into excised oocytes to establish composite cells. Oocytes can be excised by partial zona pellucida incision near the polar body, followed by extrusion of the cytoplasm in the dissociation region. Typically, transgenic or gene-edited cells are injected into excised oocytes arrested at meiosis II using an injection pipette with a sharp, slanted tip. In some notations, oocytes arrested at meiosis II are referred to as oocytes. After producing a pig or bovine embryo (e.g., by fusing and activating the oocytes), the embryo is transferred to the fallopian tube of a recipient female approximately 20–24 hours after activation. For example, see Cibelli et al. (1998) Science 280,1256-1258 and U.S. Patents 6,548,741, 7,547,816, 7,989,657, or 6,211,429. In pigs, the recipient female can confirm pregnancy approximately 20-21 days after embryo transfer.
[0186] Using standard breeding techniques, animals homozygous for the inactivated gene can be created from initial heterozygous founder animals. However, homozygosity may not be necessary. The gene-edited pigs described herein can be bred with other pigs of interest.
[0187] Once gene-edited animals are produced, inactivation of endogenous nucleic acids can be evaluated using standard techniques. Initial screening can be achieved by Southern blot analysis to determine whether inactivation has occurred. For a description of Southern blot analysis, see sections 9.37–9.52 of Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Press, Plainview;NY. Polymerase chain reaction (PCR) techniques can also be used in initial screening PCR, where PCR refers to a procedure or technique in which a target nucleic acid is amplified. Generally, oligonucleotide primers are designed with sequence information from the end or subsequent regions of the target region to be used to design oligonucleotide primers that are identical or similar in sequence to the opposite strand of the template to be amplified. PCR can be used to amplify specific sequences from DNA as well as RNA (including sequences derived from whole-genomic DNA or whole-cellular RNA). Primers are typically 14–40 nucleotides long, but may range from 10 to several hundred nucleotides long. PCR is described, for example, in PCR Primer: A Laboratory Manual, ed. Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. Nucleic acids can also be amplified by ligase chain reaction, strand substitution amplification, self-persistent sequence replication, or nucleic acid sequence-based amplification. See, for example, Lewis (1992) Genetic Engineering News 12,1, Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874, and Weiss (1991) Science 254:1292. At the blastocyst stage, embryos can be processed individually for analysis by PCR, Southern hybridization, and Sprinklett PCR (see, for example, Dupuy et al. Proc Natl Acad Sci USA (2002) 99:4495).
[0188] Interfering RNA Various interfering RNA (RNAi) systems are known. Double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous gene transcription products. RNA-induced silencing complexes (RISCs) metabolize dsRNA into small interfering RNAs (siRNAs) of 21-23 nucleotides. RISCs contain double-stranded RNAse (dsRNAse, e.g., Dicer) and ssRNAse (e.g., Argonaut 2 or Ago2). RISCs utilize antisense strands as guides to find cleavable targets. Both siRNAs and microRNAs (miRNAs) are known. Methods for inactivating genes in gene-edited animals involve inducing RNA interference on target genes and / or nucleic acids so that the expression of the target gene and / or nucleic acid is reduced.
[0189] For example, exogenous nucleic acid sequences can induce RNA interference in nucleic acids encoding polypeptides. For instance, double-stranded small interfering RNA (siRNA) or small hairpin RNA (shRNA) homologous to target DNA can be used to reduce the expression of that DNA. Constructs for siRNA can be produced as described, for example, in Fire et al. (1998) Nature 391:806, Romano and Masino (1992) Mol. Microbiol. 6:3343, Cogoni et al. (1996) EMBO J. 15:3153, Cogoni and Masino (1999) Nature 399:166, Misquitta and Paterson (1999) Proc. Natl. Acad. Sci. USA 96:1451, and Kennerdell and Carthew (1998) Cell 95:1017. shRNA constructs can be produced as described by McIntyre and Fanning (2006) BMC Biotechnology 6:1. Generally, shRNA can be transcribed as a single-stranded RNA molecule containing a complementary region and formed by annealing a short hairpin.
[0190] The probability of finding a single, individual functional siRNA or miRNA directed at a specific gene is high. For example, the predictability of a particular siRNA sequence is about 50%, but several interfering RNAs can be constructed with sufficient confidence that at least one of them will be effective.
[0191] Gene-edited animals, such as in vitro cells, in vivo cells, or livestock animals expressing RNAi directed to the gene encoding CD163, can be used. The RNAi may be selected from the group consisting of, for example, siRNA, shRNA, dsRNA, RISC, and miRNA.
[0192] induction system The CD163 gene can be inactivated using induction systems. Various induction systems are known that allow for spatial and temporal control of gene inactivation. Some have been proven to function in vivo in pigs.
[0193] One example of an inducible system is the tetracycline (tet)-on promoter system, which can be used to regulate nucleic acid transcription. In this system, a mutated Tet repressor (TetR) fuses to the activation domain of the herpes simplex virus VP 16 transactivating protein to create a tetracycline-regulated transcription activator (tTA) regulated by tet or doxycycline (dox). In the absence of the antibiotic, transcription is minimal, but in the presence of tet or dox, transcription is induced. Alternative inducible systems include the ecdysone system or the rapamycin system. Ecdysone is an insect molting hormone whose production is regulated by the heterodimer of the ecdysone receptor and the product of the ultrasonic gene (USP). Expression is induced by treatment with ecdysone or an analog of ecdysone, such as muristerone A. Drugs administered to animals to induce an inducible system are called inducers.
[0194] Tetracycline induction systems and Cre / loxP recombinase systems (either constitutive or inductive) are among the more commonly used induction systems. Tetracycline induction systems involve tetracycline-controlled transactivators (tTA) / reverse tTA (rtTA). The method of using these systems in vivo involves generating two lines of gene-edited animals. One animal line expresses an activator (tTA, rtTA, or Cre recombinase) under the control of a selected promoter. Animals in the other line express an acceptor whose expression of the gene of interest (or the gene to be modified) is under the control of the target sequence of the tTA / rtTA transactivator (or adjacent to the loxP sequence). Crossing two of the animals results in the control of gene expression.
[0195] The tetracycline-dependent regulatory system (tet system) relies on two components: a tetracycline-regulated transactivator (tTA or rtTA) that controls the expression of downstream cDNA in a tetracycline-dependent manner, and a tTA / rtTA-dependent promoter. In the absence of tetracycline or its derivatives (such as doxycycline), tTA binds to the tetO sequence, enabling transcriptional activation of the tTA-dependent promoter. However, in the presence of doxycycline, tTA cannot interact with its target, and transcription does not occur. Because tetracycline or doxycycline enables down-transcriptional regulation, the tet system using tTA is referred to as tet-OFF. Administration of tetracycline or its derivatives allows for temporal control of transgene expression in vivo. rtTA is a variant of tTA that does not function in the absence of doxycycline but requires the presence of a ligand for transactivation. Therefore, this tet system is called tet-ON. The tet system is used in vivo for the inducible expression of several transgenes that encode, for example, reporter genes, oncogenes, or proteins involved in signaling cascades.
[0196] The Cre / lox system uses a Cre recombinase that catalyzes site-specific recombination through crossover between two distant Cre recognition sequences, i.e., loxP sites. A DNA sequence introduced between the two loxP sites (referred to as floxed DNA) is excised by Cre-mediated recombination. Control of Cre expression in transgenic and / or gene-edited animals, using either spatial control (with tissue- or cell-specific promoters) or temporal control (with an inducible system), results in controlled DNA excision between the two loxP sites. One application is for conditional gene inactivation (conditional knockout). Another approach is for protein overexpression, where a floxed stop codon is inserted between the promoter sequence and the target DNA. The gene-edited animal does not express the transgene until Cre is expressed, leading to the excision of the floxed stop codon. This system has been applied to tissue-specific oncogenesis and controlled antigen receptor expression in B lymphocytes. Inducible Cre recombinases have also been developed. Inducible Cre recombinase is activated only by the administration of an exogenous ligand. Inducible Cre recombinase is a fusion protein containing the original Cre recombinase and a specific ligand-binding domain. The functional activity of Cre recombinase depends on the external ligand that can bind to this specific domain in the fusion protein.
[0197] Genetically edited animals, such as livestock animals containing the CD163 gene, can be used in vitro, in vivo, or under the control of an induction system. The chromosomal modifications in animals may be genomic or mosaic. The induction system may be selected from, for example, the group consisting of Tet-On, Tet-Off, Cre-lox, and Hif1α.
[0198] Vectors and nucleic acids Various nucleic acids may be introduced into cells for knockout purposes, gene inactivation, gene expression, or other purposes. As used herein, the term nucleic acid includes DNA, RNA, and nucleic acid analogs, as well as nucleic acids that are double-stranded or single-stranded (i.e., sense or antisense single-stranded). Nucleic acid analogs can be modified with base moieties, sugar moieties, or phosphate backbone to improve, for example, the stability, hybridization, or solubility of the nucleic acid. Modifications in the base moiety include deoxyuridine in the case of deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo-2'-doxycytidine in the case of deoxycytidine. Modifications in the sugar moiety include modification of the 2'-hydroxyl group of ribose sugars to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate skeleton can be modified to produce morpholino nucleic acids, where each base moiety is linked to a six-membered morpholino ring or peptide nucleic acid, and the deoxyphosphate skeleton is replaced with a pseudopeptide skeleton, retaining four bases. See Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7(3):187 and Hyrup et al. (1996) Bioorgan. Med. Chem. 4:5. In addition, the deoxyphosphate skeleton can be replaced with, for example, a phosphorothioate or phosphorodithioate skeleton, a phosphoramidite, or an alkylphosphotryster skeleton.
[0199] A target nucleic acid sequence may be operably ligated to a regulatory region, such as a promoter. The regulatory region may be a porcine regulatory region or may be derived from another species. As used herein, operably ligated means positioning the regulatory region relative to the nucleic acid sequence in a manner that enables or facilitates the transcription of the target nucleic acid.
[0200] Any type of promoter can be operably linked to a target nucleic acid sequence. Examples of promoters include, but are not limited to, tissue-specific promoters, constitutive promoters, inducible promoters, and promoters that are responsive or unresponsive to specific stimuli. Preferred tissue-specific promoters may result in preferential expression of nucleic acid transcripts in β-cells, including, for example, the human insulin promoter. Other tissue-specific promoters may result in preferential expression in, for example, hepatocytes or cardiac tissue, including, for example, the albumin or α-myosin heavy chain promoter. Promoters that promote the expression of nucleic acid molecules without significant tissue or temporal specificity can be used (i.e., constitutive promoters). For example, β-actin promoters, such as the chicken β-actin gene promoter, ubiquitin promoter, mini-CAG promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, or 3-glyceryl phosphate kinase (PGK) promoter, as well as viral promoters, such as the herpes simplex virus thymidine kinase (HSV-TK) promoter, SV40 promoter, or cytomegalovirus (CMV) promoter can be used. For example, a fusion of the chicken β-actin gene promoter and the CMV enhancer can be used as a promoter. See, for example, Xu et al. (2001) Hum. Gene Ther. 12:563 and Kiwaki et al. (1996) Hum. Gene Ther. 7:821.
[0201] Additional regulatory regions that may be useful in nucleic acid constructs include, but are not limited to, polyadenylated sequences, translational regulatory sequences (e.g., internal ribosome entry segments, IRESs), enhancers, inducible elements, or introns. Such regulatory regions may increase expression by affecting transcription, mRNA stability, translation efficiency, etc., but may not be necessary. Such regulatory regions can be included in nucleic acid constructs as desired to achieve optimal nucleic acid expression in cells. However, sufficient expression can sometimes be achieved without such additional elements.
[0202] Nucleic acid constructs encoding signal peptides or selectable markers may be used. Signal peptides can be used to direct the encoded polypeptide to a specific cellular location (e.g., the cell surface). Non-limiting examples of selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase, thymidine kinase (TK), and xanthine-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in cultures. Other selectable markers include fluorescent polypeptides such as green fluorescent protein or yellow fluorescent protein.
[0203] Sequences encoding selectable markers can be flanked, for example, by the recognition sequences of recombinases such as Cre or Flop. For example, a selectable marker can be excised from a construct by flanking the loxP recognition site (a 34 bp recognition site recognized by Cre recombinase) or the FRT recognition site. For a review of Cre / lox techniques, see Orban, et al., Proc. Natl. Acad. Sci. (1992) 89:6861 and Brand and Dymecki, Dev. Cell (2004) 6:7. Animals with conditional expression of the transgene can also be obtained using transposons containing Cre or Flop activating transgenes interrupted by the selectable marker gene. For example, the promoter driving marker / transgene expression can be either ubiquitous or tissue-specific, which would result in ubiquitous or tissue-specific expression of the marker in F0 animals (e.g., pigs). Tissue-specific activation of a transgene can be achieved, for example, by crossing pigs that ubiquitously express a marker-disrupting transgene with pigs that express Cre or Flop in a tissue-specific manner, or by crossing pigs that ubiquitously express a marker-disrupting transgene with pigs that express Cre or Flop recombinase. Controlled expression of the transgene or controlled excision of the marker enables transgene expression.
[0204] Exogenous nucleic acids can encode polypeptides. A nucleic acid sequence encoding a polypeptide may include a tag sequence that encodes a “tag” designed to facilitate subsequent manipulation of the encoded polypeptide (e.g., localization or detection). The tag sequence may be inserted into the nucleic acid sequence encoding the polypeptide so that the encoded tag is located at either the carboxyl or amino terminus of the polypeptide. Non-limiting examples of encoded tags include glutathione S-transferase (GST) and the FLAG® tag (Kodak, New Haven, Conn.).
[0205] Nucleic acid constructs can be methylated using SssI CpG methylase (New England Biolabs, Ipswich, Mass.). Generally, nucleic acid constructs can be incubated with S-adenosylmethionine and SssI CpG methylase in buffer at 37°C. Hypermethylation can be confirmed by assaying with agarose gel electrophoresis after incubation with 1 unit of HinP1I endonuclease for 1 hour at 37°C.
[0206] Nucleic acid constructs can be introduced into any type of embryonic cell, fetal cell, or adult animal cell, including germ cells such as oocytes or oocytes, progenitor cells, adult stem cells or embryonic stem cells, primordial germ cells, kidney cells such as PK-15 cells, islet cells, β-cells, hepatocytes, or fibroblasts such as dermal fibroblasts, using a variety of techniques. Non-limiting examples of techniques include the use of transposon systems, recombinant viruses that can infect cells, or liposomes that can deliver nucleic acids to cells, or other non-viral methods such as electroporation, microinjection, or calcium phosphate precipitation.
[0207] In transposon systems, the transcription unit of the nucleic acid construct, i.e., the regulatory region operably linked to the exogenous nucleic acid sequence, is adjacent to the transposon's inverted repeat. Several transposon systems have been developed to introduce nucleic acids into cells, including mouse, human, and porcine cells, including, for example, Sleeping Beauty (see U.S. Patent No. 6,613,752 and U.S. Publication No. 2005 / 0003542), Frog Prince (Miskey et al. (2003) Nucleic Acids Res. 31:6873), Tol2 (Kawakami (2007) Genome Biology 8 (Suppl. 1): S7), Minos (Pavlopoulos et al. (2007) Genome Biology 8 (Suppl. 1): S2), Hsmar1 (Miskey et al. (2007)) Mol Cell Biol. 27:4589), and Passport. The Sleeping Beauty transposon is particularly useful. The transposase can be delivered as a protein, encode on the same nucleic acid construct as the exogenous nucleic acid, be introduced on a separate nucleic acid construct, or be provided as mRNA (e.g., in vitro transcribed and capped mRNA).
[0208] Insulator sequences may also be included in nucleic acid constructs to maintain the expression of exogenous nucleic acids and inhibit undesirable transcription of host genes. See, for example, U.S. Publication No. 2004 / 0203158. Typically, insulator sequences are adjacent to each side of the transcription unit and within the reverse repeats of a transposon. Non-limiting examples of insulator sequences include matrix-binding region (MAR) type insulator sequences and border type insulator sequences. See, for example, U.S. Patents Nos. 6,395,549, 5,731,178, 6,100,448, and 5,610,053, and U.S. Publication No. 2004 / 0203158.
[0209] Nucleic acids can be incorporated into vectors. A vector is a broad term that includes any specific DNA segment designed to move from a carrier to target DNA. A vector may also be called an expression vector or vector system, which is a set of components necessary to bring about DNA insertion into a genome or other target DNA sequence, such as an episome, plasmid, or even a viral / phage DNA segment. Vector systems, such as viral vectors (e.g., retroviruses, adeno-associated viruses, and integrated phage viruses) used for gene delivery in animals, as well as non-viral vectors (e.g., transposons), have two basic components: 1) a vector consisting of DNA (or RNA that is reverse transcribed into cDNA), and 2) a vector consisting of a transposase, recombinase, or other integrase enzyme that recognizes both the vector and the DNA target sequence and inserts the vector into the target DNA sequence. A vector most often contains one or more expression cassettes, each containing one or more expression control sequences, which are DNA sequences that control and regulate the transcription and / or translation of another DNA sequence or mRNA, respectively.
[0210] Many different types of vectors are known. For example, plasmids and viral vectors, such as retroviral vectors, are known. Mammalian expression plasmids typically have an origin of replication, a suitable promoter and optional enhancer, the required ribosome binding site, a polyadenylation site, a splice donor and acceptor site, a transcription termination sequence, and a 5' adjacent non-transcription sequence. Examples of vectors include plasmids (which may be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAVs), lentiviruses (e.g., modified HIV-1, SIV, or FIV), retroviruses (e.g., ASV, ALV, or MoMLV), and transposons (e.g., Sleeping Beauty, P element, Tol-2, Frog Prince, piggyBac).
[0211] As used herein, the term nucleic acid refers to both RNA and DNA, including, for example, cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, and naturally occurring and chemically modified nucleic acids, such as those containing synthetic bases or alternative skeletons. Nucleic acid molecules may be double-stranded or single-stranded (i.e., sense or antisense single-stranded).
[0212] After describing the present invention in detail, it will become clear that modifications and variations are possible without departing from the scope of the invention as defined in the appended claims. [Examples]
[0213] To further illustrate the present invention, the following non-limiting embodiments are provided.
[0214] Example 1: Use of the CRISPR / Cas9 system to produce genetically modified pigs from in vitro derived oocytes and embryos Recent reports describing homing endonucleases such as zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and components within clustered and regularly arranged short palindromic repeat (CRISPR) / CRISPR-related (Cas9) systems suggest that genetic engineering (GE) in pigs may now be more efficient. Targeted homing endonucleases can induce double-strand breaks (DSBs) at specific locations in the genome, and when donor DNA is provided, this can lead to either random mutations via non-homologous end joining (NHEJ) or stimulation of homologous recombination (HR). Targeted genomic modification via HR can be achieved with homing endonucleases when donor DNA is provided along with the targeted nuclease. After introducing specific modifications into somatic cells, these cells were used to produce GE pigs of various purposes via SCNT. Therefore, homing endonucleases are useful tools in generating GE pigs. Among different homing endonucleases, the CRISPR / Cas9 system, adapted from prokaryotes where it is used as a defense mechanism, appears to be a viable approach. In nature, the Cas9 system requires three components: RNA containing a region complementary to the target sequence (cis-repressor RNA [crRNA]), RNA containing a region complementary to the crRNA (trans-activating crRNA [tracrRNA]), and RNA (approximately 20 bases) containing the enzyme protein component Cas9 in this complex. A single guide RNA (gRNA) can be constructed to fulfill the roles of the base-paired crRNA and tracrRNA. The gRNA / protein complex can scan the genome and catalyze DSBs at the regions complementary to the crRNA / gRNA. Unlike other designed nucleases, only short oligomers need to be designed to construct the reagents required to target the gene of interest, while a series of cloning steps are required to assemble ZFNs and TALENs.
[0215] Unlike current standard methods for gene disruption, the use of engineered nucleases offers the opportunity to use zygotes as starting material for GE. Standard methods for gene disruption in livestock involve HR in cultured cells and subsequent embryonic reconstruction by somatic cell nuclear transfer (SCNT). Because cloned animals produced via SCNT may show signs of developmental defects, offspring of SCNT / GE founder animals are typically used in research to avoid the confusing SCNT abnormalities and phenotypes that may occur if the founder animals are used in experiments. Given the longer gestation period and higher housing costs of pigs compared to rodents, there are time and cost benefits to reduce the need for breeding. Recent reports have demonstrated that direct injection of ZFNs and TALENs into pig zygotes can disrupt endogenous genes and produce pigs with desired mutations. However, only about 10% of pigs showed biallelic modification of the target gene, and some pigs exhibited mosaic genotypes. Recent articles have demonstrated that the CRISPR / Cas9 strain can induce mutations in developing embryos and produce GE pigs with higher efficiency than ZFNs or TALENs. However, GE pigs produced from the CRISPR / Cas9 strain also exhibited mosaic genotypes. In addition, all of the above studies used in vivo-derived zygotes for the experiments, which is labor-intensive and requires a large number of multiparous pigs to obtain a sufficient number of zygotes.
[0216] This example describes an efficient approach to using the CRISPR / Cas9 system to generate GE pigs via both in vitro-derived zygote injection and somatic cell modification followed by SCNT. Two endogenous genes (CD163 and CD1D) and one transgene (eGFP) were targeted, with only in vitro-derived oocytes or zygotes used for SCNT or RNA injection, respectively. CD163 appears to be required for productive infection by porcine reproductive and respiratory syndrome virus, a virus known to cause significant economic losses in the pig industry. CD1D is considered a non-classical major histocompatibility complex protein and is involved in the presentation of lipid antigens to invariant natural killer T cells. Pigs lacking these genes were designed to serve as models for agriculture and biomedicine. The eGFP transgene was used as a target for prior conceptual experiments and method optimization.
[0217] material and method Chemicals and reagents Unless otherwise stated, all chemicals used in this study were purchased from Sigma.
[0218] Designing gRNAs for constructing specific CRISPRs The guide RNA was designed for a region within exon 7 of CD163 that is specific to wild-type CD163 and not present in the domain-swap targeting vector (described later), so that CRISPR would produce a double-segment break (DSB) in wild-type CD163 but not in the domain-swap targeting vector. There were only four sites where the targeting vector could introduce single nucleotide polymorphisms (SNPs) that modify the S. pyogenes (Spy) protospacer adjacent motif (PAM). All four targets were selected, including:
[0219] (Sequence ID 1) TIFF2023098940000002.tif669(CRISPR 10), (Sequence 2) TIFF2023098940000003.tif567(CRISPR 131), (Sequence ID 3) TIFF2023098940000004.tif567(CRISPR 256), and (Sequence No. 4) TIFF2023098940000005.tif668(CRISPR 282). PAMs can be identified by the bold font used in each gRNA.
[0220] For CD1D mutations, the search for CRISPR targets was arbitrarily limited to the coding strand within the first 1000 bp of the primary transcript. However, RepeatMasker
[26] ("Pig" repeat library) identified a repeat element starting at base 943 of the primary transcript. The search for CRISPR targets was then limited to the first 942 bp of the primary transcript. Since the last Spy PAM is located at base 873, the search was further limited to the first 873 bp of the primary transcript. The first target (CRISPR 4800) was found to be located in the primary transcript. ( Selected to overlap with the start codon located at base 42 in TIFF2023098940000006.tif567 (Sequence ID 5). Arbitrarily selected region. ( TIFF2023098940000007.tif566 (sequence number 6) and Two additional targets (CRISPR 5620 and 5626) were selected because they were the most distal to the first selection in TIFF2023098940000008.tif567 (SEQ ID NO: 7). These targets overlap. Relative to the start codon, the most proximal Spy PAM was located in a simple sequence containing a broad homopolymer sequence, as determined by visual evaluation. The fourth target (CRISPR 5350) was selected in relation to the first target selection because of its broad homopolymer region. ( This was because it was the most proximal target that did not contain TIFF2023098940000009.tif567 (SEQ ID NO: 8). The specificity of the designed crRNA was confirmed by searching for similar porcine sequences in GenBank. Oligonucleotides (Table 1) were annealed and cloned into a p330X vector containing two expression cassettes, human codon-optimized S.pyogenes (hSpy)Cas9 and chimeric guide RNA. P330X was digested at BbsI (New England Biolabs) according to the Zhang experimental protocol (http: / / www.addgene.org / crispr / zhang / ).
[0221] To target eGFP, two specific gRNAs targeting the eGFP coding sequence were designed within the first 60 bp of the eGFP start codon. Both eGFP1 and eGFP2 gRNAs were located on the antisense strand, with eGFP1 directly targeting the start codon. The eGFP1 gRNA sequence is: The sequence is TIFF2023098940000010.tif665 (sequence number 9), and the eGFP2 gRNA sequence is: The filename was TIFF2023098940000011.tif468 (sequence number 10). [Table 1]
[0222] Synthesis of CD163 and CD1D gene donor DNA Both porcine CD163 and CD1D were amplified by PCR from DNA isolated from embryonic fibroblasts, which would be used for subsequent transfection, to ensure allogeneic compatibility between the targeting vector and the transfected cell line. Briefly, a 9538 bp fragment of CD163 was amplified using an LA tag with forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 11) and reverse primer TATTTCTCTCACATGGCCAGTC (SEQ ID NO: 12). The fragment was validated with a DNA sequence and used to construct a domain-swap targeting vector (Figure 1). This vector contained 33 point mutations within exon 7 to encode the same amino acid sequence as human CD163L derived from exon 11. The substituted exon was 315 bp. In addition, the subsequent intron could be removed with Cre-recombinase (Cre) and replaced with modified myostatin intron B containing a selectable marker gene that had previously demonstrated normal splicing when encapsulating the retained loxP site (Wells, unpublished results). The long arm of the construct was 3469 bp and contained a domain swap DS exon. The short arm was 1578 bp and contained exons 7 and 8 (Figure 1, panel B). Using this plasmid, we attempted to replace the coding region of exon 7 in the first transfection experiment, enabling the selection of a targeting event via a selectable marker (G418). If targeting occurred, the marker could be deleted by Cre-recombinase. The CD163 DS targeting vector was then modified for use with cell lines already containing the SIGLEC1 gene disrupted with Neo, which cannot be deleted by Cre. In this targeted vector, the Neo cassette, loxP, and myostatin intron B were removed, leaving only the DS exon in WT-length and short arms (Figure 1, Panel C).
[0223] The porcine CD1D genome sequence was amplified with an LA tag using forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 13) and reverse primer GACTGGCCATGTGAGAGAAATA (SEQ ID NO: 14) to obtain an 8729 bp fragment. The fragment was DNA sequenced and used to construct the targeted vector shown in Figure 2. The Neo cassette is under the control of a phosphoglycerol kinase (PGK) promoter and is adjacent to a loxP sequence introduced for selection. The construct had a long arm of 4832 bp and a short arm of 3563 bp and contained exons 6 and 7. If a successful HR occurs, exons 3, 4, and 5 are removed and replaced with the Neo cassette. If NHEJ repair occurs incorrectly, exon 3 is interrupted.
[0224] Fetal fibroblast collection Fetal pig tissue was collected at 35 days of gestation to create cell lines. Two wild-type (WT) male and female fetal fibroblast cell lines were established from large white domestic hybrids. Male and female fetal fibroblasts previously modified to contain the Neo cassette (SIGLEC1- / - gene) were also used in these studies. Fetal fibroblasts were collected as described with minor modifications, and tissue mince from each fetus was digested at 38.5°C for 5 hours in 20 mL of digestion medium (Dulbecco's Modified Eagle Medium [DMEM] containing L-glutamine and 1 g / L D-glucose [Cellgro], supplemented with 200 units / mL collagenase and 25 Kunitz units / mL DNAseI). After digestion, fetal fibroblasts were washed and cultured in DMEM, 15% fetal bovine serum (FBS), and 40 μg / mL gentamicin. After overnight incubation, the cells were treated with trypsin, frozen in aliquots in FBS with 10% dimethyl sulfoxide at -80°C, and stored in liquid nitrogen.
[0225] Cell transfection and genotyping The transfection conditions were substantially as previously reported. Donor DNA was always used in a constant amount of 1 μg, along with various amounts of CRISPR / Cas9 plasmids (listed below). Prior to transfection, the donor DNA was linearized with MLUI(CD163)(NEB) or AFLII(CD1D)(NEB). The sex of the established cell lines was determined by PCR as previously described prior to transfection. Both male and female cell lines were transfected, and genomic modification data were analyzed together between transfections. Embryonic fibroblast cell lines of similar passage numbers (2-4) were cultured for 2 days and grown at a culture density of 75-85% in DMEM containing L-glutamine and 1 g / L D-glucose (Cellgro), supplemented with 15% FBS, 2.5 ng / mL basic fibroblast growth factor, and 10 mg / mL gentamicin. Fibroblasts were washed with phosphate-buffered saline (PBS) (Life Technologies) and trypsinized. Immediately after cell separation, the cells were washed with electroporation medium (75% cell salt [120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, pH 7.6, 5 mM MgCl2]) and 25% Opti-MEM (Life Technologies). Cell concentration was quantified using a hemocytometer. Cells were pelleted at 600 × g for 5 minutes and resuspended in electroporation medium at a concentration of 1 × 10⁶. Each electroporation used 200 μL of cells in a 2 mm gap cuvette with three (1 msec) square wave pulses administered via BTX ECM2001 at 250 V. After electroporation, cells were resuspended in the aforementioned DMEM. For selection, 600 μg / mL of G418 (Life Technologies) was added 24 hours after transfection, and the medium was changed on day 7. Colonies were harvested 14 days after transfection. When G418 selection was used, embryonic fibroblasts were seeded at 10,000 cells / plate; when G418 selection was not used, they were seeded at 50 cells / plate.Embryonic fibroblast colonies were collected by applying 10 mm autoclave cloning cylinders sealed around each colony with autoclave vacuum grease. Colonies were washed with PBS, harvested via trypsin, and then resuspended in DMEM culture medium. A portion (1 / 3) of the resuspended colonies were transferred to 96-well PCR plates, and the remaining (2 / 3) cells were cultured in the wells of 24-well plates. The cell pellet was resuspended in 6 μL of lysis buffer (40 mM Tris, pH 8.9, 0.9% Triton X-100, 0.4 mg / mL proteinase K [NEB]), incubated at 65°C for 30 minutes for cell lysis, followed by incubation at 85°C for 10 minutes to inactivate proteinase K.
[0226] PCR screening for DS and large and small deletions. Detection of HR-directed repair. Mutations in either CD163 or CD1D were identified using long-range PCR. Three different PCR assays were used to identify HR events: PCR amplification of regions extending from the CD163 or CD1D sequence in the donor DNA to the right or left endogenous CD163 or CD1D sequence, as well as long-range PCR amplified large regions of CD163 or CD1D encompassing the designed donor DNA. An increase in the size of either a 1.8kb (CD1D) or 3.5kb (CD163) PCR product resulting from the addition of an exogenous Neo sequence was considered evidence of HR-directed repair of the gene. All PCR conditions included 33 cycles of initial denaturation at 95°C for 2 minutes, followed by 30 seconds at 94°C, 30 seconds at 50°C, and 7–10 minutes at 68°C. LA taq was used for all assays as recommended by the manufacturer. Primers are shown in Table 2. [Table 2]
[0227] Small Deletion Assay (NHEJ). Small deletions were determined by PCR amplification of CD163 or CD1D adjacent to the protruding cleavage site introduced by the CRISPR / Cas9 system. The amplicon sizes were 435 bp and 1244 bp for CD163 and CD1D, respectively. Lysates from both embryonic and fetal fibroblasts were PCR amplified in LA taq. The PCR conditions for the assay were 33 cycles of initial denaturation at 95°C for 2 minutes, followed by 30 seconds at 94°C, 30 seconds at 56°C, and 1 minute at 72°C. For genotyping of transfected cells, insertions and deletions (INDELs) were identified by separating PCR amplicons by agarose gel electrophoresis. For embryonic genotyping, the resulting PCR products were then sequenced to identify small deletions using forward primers used in PCR. Primer information is shown in Table 3. [Table 3]
[0228] Somatic cell nuclear transfer (SCNT) To produce SCNT embryos, either multiparous sow oocytes (ART, Inc.) or nulliparous sow oocytes were used from local slaughterhouses. Multiparous sow oocytes were shipped overnight in maturation medium (TCM-199 containing 2.9 mM Hepes, 5 μg / mL insulin, 10 ng / mL epidermal growth factor [EGF], 0.5 μg / mL porcine follicle-stimulating hormone [p-FSH], 0.91 mM pyruvate, 0.5 mM cysteine, 10% porcine follicular fluid, and 25 ng / mL gentamicin) and transferred to fresh medium after 24 hours. After 40–42 hours of maturation, oocytes were removed from the oocytes by vortexing in the presence of 0.1% hyaluronidase. For in vitro fertilization (IVF), nulliparous sow oocytes were matured as described below. During the procedure, oocytes were placed in TCM-199 [Life Technologies] (osmotic concentration 305 mOsm) supplemented with 7.0 μg / mL of cytochalasin B (containing 0.6 mM NaHCO3, 2.9 mM Hepes, 30 mM NaCl, 10 ng / mL gentamicin, and 3 mg / mL BSA). The polar bodies were removed along with a portion of the adjacent cytoplasm, presumably containing a metaphase II plate, and the donor cells were placed in the perivitelline space using a thin glass capillary. The reconstructed embryos were then fused in fusion medium (0.3 M mannitol, 0.1 mM CaCl2, 0.1 mM MgCl2, and 0.5 mM Hepes) for 30 seconds with two 1.2 kV / cm DC pulses (1 second apart) using a BTX electrocellular manipulator (Harvard Apparatus). After fusion, the fused embryos were fully activated with 200 μM thimerosal in the dark for 10 minutes and with 8 mM dithiothreitol for 30 minutes. Then, as previously described, they were incubated in modified porcine conjugation medium PZM3-MU1 for 14–16 hours with 0.5 μM Scriptaid (S7817; Sigma-Aldrich), a histone deacetylase inhibitor.
[0229] In vitro fertilization (IVF) For IVF, ovaries from pre-pubescent, nulliparous pigs were obtained from a slaughterhouse (Farmland Foods Inc.). Immature oocytes were aspirated from medium-sized (3-6 mm) follicles using an 18-gauge subcutaneous needle attached to a 10 mL syringe. Oocytes with uniformly dark cytoplasm and intact surrounding cumulus cells were then selected for maturation. Approximately 50 cumulus oocyte complexes were placed in wells containing 500 μL of maturation medium TCM-199 (Invitrogen) in humidified air for 42–44 hours at 38.5°C and 5% CO2. This medium contained 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 10 ng / mL EGF, 0.5 μg / mL luteinizing hormone (LH), 0.5 μg / mL FSH, 10 ng / mL gentamicin (APP Pharm), and 0.1% polyvinyl alcohol. At the end of maturation, surrounding cumulus cells were removed from the oocytes by vortexing for 3 minutes in the presence of 0.1% hyaluronidase. Next, oocytes matured in vitro were placed in 50 μL droplets of IVF medium (modified Tris-buffered medium containing 113.1 mM NaCl, 3 mM KCl, 7.5 mM CaCl2, 11 mM glucose, 20 mM Tris, 2 mM caffeine, 5 mM sodium pyruvate, and 2 mg / mL bovine serum albumin [BSA]) containing 25–30 oocytes. 100 μL of frozen semen pellets were thawed in 3 mL of Dulbecco's PBS supplemented with 0.1% BSA. Either frozen WT or fresh eGFP semen was washed at 6503 g for 20 minutes in 60% Percoll and then washed in modified Tris-buffered medium by centrifugation for 10 minutes. In some cases, heterozygous semen collected for previously described eGFP transgenes was washed three times in PBS. Next, the semen pellet was resuspended in IVF medium at a concentration of 0.5 × 10⁶ cells / mL. 50 microliters of the semen suspension was introduced into droplets containing oocytes. The gametes were co-incubated at 38.5°C for 5 hours in an atmosphere of 5% CO₂ in air. After fertilization, the embryos were incubated in PZM3-MU1 at 38.5°C and in 5% CO₂ in air.
[0230] Embryo transfer Embryos generated to produce GE CD163 or CD1D pigs were implanted in surrogate mothers on either day 1 (SCNT) or day 6 (zygote injection) after the first estrus. For day 6 implantation, the zygotes were cultured for an additional 5 days in PZM3-MU1 in the presence of 10 ng / mL ps48 (Stemgent, Inc.). The embryos were surgically implanted into the ampulla-narrow junction of the surrogate mother's fallopian tube.
[0231] In vitro synthesis of CRISPR / Cas9 RNA. Template DNA for in vitro transcription was amplified using PCR (Table 4). The CRISPR / Cas9 plasmid used in cell transfection experiments served as a template for PCR. To express Cas9 in zygotes, Cas9 mRNA was produced using the mMESSAGE mMACHINE Ultra kit (Ambion). A poly(A) signal was then added to the Cas9 mRNA using the poly(A) tailing kit (Ambion). CRISPR guide RNA was produced by MEGAshortscript (Ambion). The quality of the synthesized RNA was visualized on a 1.5% agarose gel, then diluted to a final concentration of 10 ng / μL (both gRNA and Cas9) and dispensed into 3 μL aliquots. [Table 4]
[0232] Designed CRISPR / Cas9 microinjection in composites Cas9 and messenger RNA encoding gRNA were injected into the zygotes 14 hours post-fertilization (presumably zygotes) using a FemtoJet microinjector (Eppendorf). Microinjection was performed on a heated stage of the Nikon inverted microscope (Nikon Corporation, Tokyo, Japan) using the microculture medium. The injected zygotes were then transferred to PZM3-MU1 with 10 ng / mL ps48 until further use.
[0233] statistical analysis Colonies with modified genomes were classified as having 1, and colonies without genome modification were classified as 0. Differences were determined using PROC GLM(SAS), where a P-value of 0.05 is considered statistically significant. Means were calculated as least squares mean. Data are presented as numerical mean ± SEM.
[0234] result CRISPR / Cas9-mediated knockout of CD163 and CD1D in somatic cells The efficiency of four different CRISPR plasmids targeting CD163 (guide 10, 131, 256, and 282) was tested with a donor DNA dose of 2 μg / μL (Table 5). CRISPR282 resulted in significantly more average colony formation than CRISPR10 and 256 treatments (P<0.05). From the long-range PCR assay described above, large deletions ranging from 503 bp to a maximum of 1506 bp were found instead of DS by HR as originally intended (Figure 3, Panel A). This was unexpected, as previous reports using other DNA editing systems showed much smaller deletions of 6–333 bp in pigs using ZFN. CRISPR10 and a mixture of all four CRISPRs resulted in a greater number of colonies with modified genomes than CRISPR256 and 282 (Table 5, P<0.002). Transfection with plasmids containing CRISPR10 and Neo but lacking homology to CD163 did not result in colonies exhibiting large deletions. Interestingly, a single monoalelelic deletion was also detected when donor DNA was introduced without any CRISPR. This assay likely underestimates the mutation rate because it did not screen for any potentially small deletions detected by sequencing on the agarose gel within transfected somatic cells. [Table 5]
[0235] The initial goal was to obtain a domain swap (DS) targeting event by HR for CD163, but CRISPR did not increase the efficiency of targeting CD163. Note that various combinations of this targeting vector, which have been used to modify CD163 by HR via conventional transfection, did not result in a targeting event after screening 3399 colonies (Whitworth and Prather, confidential results). Two pigs were obtained using complete DSs resulting from HRs containing all 33 mutations that were attempted to be introduced by transfection with CRISPR10 and DS targeting vectors as donor DNA.
[0236] Next, we tested the efficiency of CRISPR / Cas9-induced mutation without drug selection. The embryonic fibroblast cell lines used in this study already had Neo-resistant cassettes incorporated and SIGLEC1 knockout. We also tested whether the ratio of CRISPR / Cas9 to donor DNA increased genome modification or resulted in toxic effects at high concentrations. CRISPR131 was selected for this test because in previous experiments it resulted in an increase in the percentage of colonies with a large number of total colonies and colonies with modified genomes. Increasing the amount of CRISPR131 DNA from 3:1 to 20:1 did not have a significant effect on embryonic fibroblast viability. The percentage of colonies with genomes modified by NHEJ did not differ significantly between various CRISPR concentrations, but the ratio of 10:1 had the most NHEJ (Table 6, P=0.33). No HR was observed even at the highest ratio of CRISPR DNA to donor DNA (20:1). [Table 6]
[0237] Based on this experience, targeted disruption of CD1D in somatic cells was attempted. Four different CRISPRs were designed and tested in both male and female cells. CD1D modifications could be detected from three of the applied CRISPRs, but the use of CRISPR 5350 did not result in CD1D modifications with deletions large enough to be detected by agarose gel electrophoresis (Table 7). Interestingly, donor DNA was provided, but no genetic changes were obtained through HR. However, large deletions similar to those observed in CD163 knockout experiments were observed (Figure 3, Panel B). When CRISPR / Cas9 was not used with donor DNA, targeted modifications of CD1D with large deletions were not detected. CD1D modifications from CRISPR / Cas9-induced targeting were 4 / 121 and 3 / 28 in male and female colonies of cells, respectively. Transfection data included only indelibles detectable by agarose gel electrophoresis. [Table 7]
[0238] Production of CD163 and CD1D pigs using SCNTs with GE cells CD163 and CD1D knockout pigs were produced using SCNTs (Sclerotic Cell Tumors) that displayed CD163 or CD1D modifications (Figure 3). Seven embryo transfers (CD163, Table 8), six embryo transfers (without CD163-Neo), and five embryo transfers (CD1D) were performed using SCNT embryos from male and female fetal fibroblasts transfected with CRISPR / Cas9. Six (CD163), two (without CD163-Neo), and four (CD1D) recipient heifers remained pregnant for the specified period (Table 9), with pregnancy rates of 85.7% (CD163), 33.3%, and 80% (CD1D), respectively. Of the CD163 recipients, five delivered healthy piglets by cesarean section. One piglet (O044) was delivered spontaneously. The litter sizes ranged from 1 to 8 inches. Four piglets were euthanized due to postnatal growth disorders. One piglet was euthanized due to a severe cleft palate. All remaining piglets appeared healthy (Figure 3, Panel C). Two littermates of male pigs obtained from fetal fibroblasts transfected with CRISPR10 and donor DNA, as described in Figure 3, Panel B, had a 30 bp deletion in exon 7 adjacent to CRISPR10 and an additional 1476 bp deletion in the preceding intron, thus removing the intron 6 / exon 7 junction of CD163 (Figure 3, Panel E). Genotypes and predicted translations are summarized in Table 10. One male piglet and one female littermate (four piglets) were obtained from CD163-Neo-free transfection of previously modified SIGLEC1 cells. All five piglets were double knocked out for SIGLEC1 and CD163. Male piglets had biallelic modifications of CD163, with a 28bp deletion in exon 7 on one allele, and a 1387bp deletion on the other allele and a progressing intron, including a partial deletion of exon 7 and a complete deletion of exon 8. Therefore, the intron-exon junction was removed. Female piglets had biallelic mutations of CD163, including a 1382bp deletion with an 11bp insertion on one allele and a 1720bp CD163 deletion on the other allele. A summary of CD163 modifications and predictive translations can be found in Table 10. A summary of CD1D modifications and predictive translations by CRISPR modification can be found in Table 11.In short, one female and two male littermates were born, resulting in 13 piglets. One piglet died shortly after birth. Twelve of the 13 piglets contained either a biallele deletion or a homozygous deletion of CD1D (Figure 3, Panel F). One piglet was wild-type (WT). [Table 8] [Table 9] [Table 10-1] [Table 10-2] [Table 11]
[0239] Efficiency of the CRISPR / Cas9 system in porcine conjugates Based on the targeted disruption of CD163 and CD1D in somatic cells using the CRISPR / Cas9 system, this approach was applied to porcine embryonic development. First, the efficacy of the CRISPR / Cas9 system in developing embryos was tested. The eGFP-targeting CRISPR / Cas9 system was introduced into zygotes fertilized with semen from heterozygous male pigs for the eGFP transgene. Subsequent embryos expressing eGFP were monitored after injection. Various concentrations of the CRISPR / Cas9 system were tested, and the cytotoxicity of the delivered CRISPR / Cas9 system was observed (Figure 4, Panel A); embryonic development after CRISPR / Cas9 injection was lower compared to controls. However, all concentrations of CRISPR / Cas9 tested were effective in generating eGFP modification, as no embryos expressing eGFP were found in the CRISPR / Cas9 injection group (Figure 4, Panel B); of the non-injected control embryos, 67.7% were green, indicating eGFP expression. Genotyping of individual blastocysts allowed for the identification of small mutations near the CRISPR binding site (Figure 4, Panel C). Based on toxicity and efficacy, 10 ng / μL of gRNA and Cas9 mRNA were used in the following experiments.
[0240] When a CRISPR / Cas9 component designed to target CD163 was introduced into putative zygotes, targeted gene editing was observed in subsequent blastocysts. Genotyping of individual blastocysts for CD163 mutations revealed specific mutations in all embryos (100% GE efficiency). More importantly, while homozygous or biallelic modification embryos were found (8 / 18 and 3 / 18, respectively) (Figure 5), mosaic (single-allelic modification) genotypes were also detected (4 / 18 embryos). No difference in mutagenesis efficiency was found when several embryos from the pool (8 / 10) were injected with 2 ng / μL Cas9 and 10 ng / μL CRISPR. Next, based on the in vitro results, two CRISPRs representing different gRNAs were introduced to disrupt CD163 or CD1D during embryonic development and induce specific deletions of the target gene. As a result, we were able to successfully induce designed deletions of CD163 and CD1D by introducing the two guides. A designed deletion is defined as a deletion that removes the genomic sequence between the two introduced guides. Of the embryos that received two CRISPR injections targeting CD163, all but one resulted in targeted modification of CD163. In addition, five of the thirteen embryos were found to have a designed deletion on CD163 (Figure 6, Panel A), and ten of the thirteen embryos appeared to have CD163 modification in either a homozygous or biallelic manner. Targeting CD1D using two CRISPR injections was also effective, as all embryos (23 / 23) showed modification of CD1D. However, a designed deletion of CD1D was found in only two embryos (2 / 23) (Figure 6, Panel B). Five of the 23 embryos were also found to have a mosaic genotype, while the remaining embryos had either homozygous or biallelic modification of CD1D. Finally, we tested whether multiple genes could be targeted by the same CRISPR / Cas9 system within the same embryo. For this purpose, both CD163 and eGFP were targeted in zygotes fertilized with heterozygous eGFP sperm.Genotyping of blastocysts from injected embryos for CD163 and eGFP revealed that CD163 and eGFP were successfully targeted during embryo development. Sequencing results demonstrated that multiple genes can be targeted by introducing multiple CRISPRs together with Cas9 (Figure 6, panel C).
[0241] Generation of CD163 and CD1D mutants from CRISPR / Cas9 injected conjugates Based on the success of previous in vitro tests, several CRISPR / Cas9 injected conjugates were produced and 46 - 55 blastocysts were transplanted per recipient (this number has been shown to be effective in producing pigs from in vitro - derived embryos). Four embryo transfers were performed (two each for CD163 and CD1D), and pregnancies were obtained for each modification. Four healthy pigs with modifications on CD163 were produced (Table 8). All piglets, littermate 67 from recipient sow ID O083, showed either homozygous or bi - allelic modification of CD163 (Figure 7). Two piglets showed the designed deletion of CD163 by the two CRISPRs delivered. All piglets were healthy. For CD1D, one pregnancy also produced four piglets (littermate 166 from recipient sow identification number O165), one female and three males (Table 9). One piglet (166 - 1) carried a mosaic mutation of CD1D that included a 362bp deletion that completely removed exon 3 containing the start codon (Figure 8). One piglet had a 6bp insertion with a 2bp mismatch in one allele and a large deletion in the other allele. Two additional piglets had single - bp insertions in both alleles. For CD163, no mosaic mutations were detected.
[0242] Discussion Improving the efficiency of GE (genetically evolved) pig production could have far-reaching implications by providing more GE pigs for agriculture and biomedicine. The data described above demonstrate that GE pigs with specific mutations can be produced with high efficiency using the CRISPR / Cas9 system. We have successfully applied the CRISPR / Cas9 system to edit genes in both somatic cells and pre-transplant embryos.
[0243] When the CRISPR / Cas9 system was introduced into somatic cells, it successfully induced targeted disruption of target genes by NHEJ, but did not increase the targeting ability by HR. The targeting efficiency of individual CRISPR / Cas9 in somatic cells was variable, indicating that guide design may affect targeting efficiency. Specifically, when CRISPR5350 and Cas9 were introduced into somatic cells, it was impossible to find targeted modification of CD1D. This suggests that it may be beneficial to design multiple gRNAs and verify their efficiency before producing pigs. The reason for the lack of HR-directed repair in the presence of donor DNA remains unclear. After screening 886 colonies (both CD163 and CD1D) transfected with CRISPR and donor DNA, only one colony had evidence of a partial HR event. The results demonstrated that the CRISPR / Cas9 system, in conjunction with the introduced donor DNA, caused unexpected large deletions in target genes, but did not increase the HR efficiency of these two specific targeting vectors. However, the specific mechanism for observing large deletions remains unknown. Previous reports from our group suggested that donor DNA could be effectively used with ZFNs to induce HR-directed repair. Similarly, when donor DNA was used with the CRISPR / Cas9 system, increased targeting efficiency was observed, but complete HR-directed repair was not. Previous studies using ZFNs observed that targeted modification could occur through a combination of HR and NHEJ, as partial recombination of donor DNA introduced after ZFN-induced DSBs was found. One explanation is that the HR and NHEJ pathways are not independent but can act together to complete the repair process after homing endonuclease-induced DSBs. Higher concentrations of CRISPR could improve targeting efficiency in somatic cells, but no statistically significant differences were found in these experimental results. This may suggest that CRISPR is a limiting factor in the CRISPR / Cas9 system, but further verification is needed. We successfully produced GE pigs via SCNTs using target cells.This demonstrates that the application of CRISPR / Cas9 does not affect the capabilities of the cloned cells. Several piglets were euthanized due to health problems, but this is not uncommon in piglets derived from SCNTs.
[0244] When the CRISPR / Cas9 system was introduced into developing embryos by zygote injection, nearly 100% of the embryos and pigs contained INDEL in the target gene, demonstrating the high effectiveness of this technique during embryonic development. The efficiency observed during this study exceeded the frequencies reported in other studies utilizing homing endonucleases during embryonic development. The decrease in the number of embryos reaching the blastocyst stage suggested that the concentration of CRISPR / Cas9 introduced in this study may be toxic to the embryos. Further optimization of the delivery system may increase embryonic viability and thus improve the overall efficiency of the process. The nearly 100% mutagenesis rate observed here differed from previous reports in CRISPR / Cas9-mediated knockout in pigs, but the difference in efficiency between trials may be due to the combination of selected guides and targets. In this study, lower concentrations of CRISPR / Cas9 (10 ng / μL each) were effective in generating mutations in embryonic development and GE pig production. This concentration is lower than previously reported concentrations in porcine zygotes (Cas9 at 125 ng / μL and CRISPR at 12.5 ng / μL). Lower concentrations of the CRISPR / Cas9 component may be beneficial to developing embryos, as introducing excessive amounts of nucleic acid into developing embryos can be toxic. Several mosaic genotypes were observed in CRISPR / Cas9-injected embryos from in vitro assays, but only one piglet produced through the approach had a mosaic genotype. Potentially, since mosaic genotypes were considered the main hurdle to using the CRISPR / Cas9 system in zygotes, injections containing the CRISPR / Cas9 component may be more effective than the introduction of other homing endonucleases. Another advantage of using the CRISPR / Cas9 system demonstrated by these results is that CD163 knockout pigs produced from IVF-derived zygotes injected with the CRISPR / Cas9 system were not lost, although several piglets obtained from SCNTs were euthanized a few days later. This suggests that it not only avoids the need for SCNTs when producing knockout pigs, but also has the potential to overcome common health problems associated with SCNTs.Since the injection of CRISPR / Cas9 mRNA into the zygote has been optimized, future experiments will likely include the simultaneous injection of donor DNA.
[0245] This study demonstrates that introducing two CRISPRs and Cas9 into a zygote can induce a chromosomal deletion in a developing embryo, producing a pig with a desired deletion, i.e., a specific deletion between the two CRISPR guides. This designed deletion may be beneficial because it allows for specifying the size of the deletion rather than relying on random events caused by NHEJ. Specifically, if there is a multiple of 3 nucleotide insertion / deletion caused by a homing endonuclease, the mutation may rather result in a low-phenotypic mutation because no frameshift occurs. However, by introducing two CRISPRs, it is possible to induce a larger deletion, which has a higher probability of producing a non-functional protein. Interestingly, the CD1D CRISPR was designed to span a larger area within the genome than the CD163, with a distance of 124 bp between CD163 CRISPRs 10 and 131, and a distance of 550 bp between CRISPRs 4800 and 5350 for CD1D. The longer distance between CRISPRs was not as effective in generating the deletion, as shown in the study. However, this study includes only a limited number of observations, and it is necessary to consider the effectiveness of individual CRISPRs, which are not discussed here. Therefore, it is necessary to examine the relationship between the distance between CRISPRs and the probability of causing the intended deletion.
[0246] The CRISPR / Cas9 system was also effective in simultaneously targeting two genes within the same embryo, with the only additional step being the introduction of one additional CRISPR containing crRNA. This demonstrates an ease of disrupting multiple genes compared to other homing endonucleases. These results suggest that this technique can be used to target gene clusters or gene families that may have compensatory effects, thus demonstrating that it is difficult to determine the role of individual genes unless all genes are disrupted. The results demonstrate that the CRISPR / Cas9 technology can be applied to the generation of GE pigs by increasing the efficiency of gene targeting in somatic cells and by direct zygote injection.
[0247] Example 2: Increased resistance to PRRSV in pigs with modified chromosome sequences in the gene encoding the CD163 protein. Porcine genital and respiratory syndrome virus (PRRSV) has ravaged the pig industry for the last quarter of the century. Both SIGLEC1 and CD163 are included in speculations regarding the mode of viral entry. While SIGLEC1 knockout did not affect the response to viral exposure, this embodiment demonstrates that CD163-null animals do not exhibit the clinical signs of infection, pulmonary pathology, viremia, or antibody production characteristic of PRRSV infection. Not only have PRRSV entry mediators been identified, but strategies to prevent significant economic losses and animal suffering are described if similarly created animals are permitted to enter the food supply.
[0248] material and method Genotype determination Genotyping was based on both DNA and mRNA sequencing. The male parent's genotype had an 11bp deletion in one allele, which, when translated, predicted 45 amino acids in domain 5, resulting in an immature stop codon at amino acid 64. In the other allele, there was a 2bp addition in exon 7 and a 377bp deletion in the intron preceding exon 7, which, when translated, predicted the first 49 amino acids in domain 5, resulting in an immature stop code at amino acid 85. One multiparous sow had a 7bp addition in one allele, which, when translated, predicted the first 48 amino acids in domain 5, resulting in an immature stop codon at amino acid 70. The other allele was not characterized (A) because no band from exon 7 was present by either PCR or long-range 6.3kb PCR. The other three multiparous sows were clones and had a 129bp deletion in exon 7, which is predicted to result in a 43-amino acid deletion from domain 5. The other allele was not characterized (B).
[0249] The growth of PRRSV in culture and the production of a viral inoculum for infecting pigs are included in the approved IBC application 973. The reference strain of PRRSV, isolate NVSL 97-7895 (GenBank# AF325691 2001-02-11), was propagated as described in the approved IBC protocol 973. This laboratory isolate has been used in experimental studies for approximately 20 years (Ladinig et al., 2015). A second isolate was used in the second trial, KS06-72109, as previously described (Prather et al., 2013).
[0250] Pig infection by PRRSV A standardized infection protocol for PRRSV was used for the infection of pigs. Three-week-old piglets were inoculated with approximately 10⁴ TCID50 PRRS virus administered via intramuscular (IM) and intranasal (IN) routes. Pigs were monitored daily, and those exhibiting symptoms of the disease were treated according to the recommendations of CMG veterinarians. Pigs showing severe distress and at risk of succumbing to infection were humanely euthanized, and samples were collected. Staff and veterinarians were not informed of the genetic status of the pigs to eliminate bias in evaluation or treatment. Since PRRSV is present in bodily fluids during infection, blood samples were collected and stored at -80°C until measured to determine the amount or degree of viremia in each pig. At the end of the experiment, the weight of the pigs was measured, they were humanely euthanized, tissues were collected, fixed in 10% buffered formalin, embedded in paraffin, and processed for histopathological diagnosis by a board-certified pathologist.
[0251] Phenotypic scoring of exposed pigs The pigs' phenotypes were scored daily in a blinded manner as follows: What is the pig's attitude? Attitude score: 0: BAR, 1: QAR, 2: Slightly depressed, 3: Depressed, 4: Near death. What is the pig's physical condition? Physical condition score: 1: Emaciated, 2: Underweight, 3: Ideal, 4: Fat, 5: Fat / Obese. What is the pig's rectal temperature? Normal body temperature 101.6~103.6°F (fever is considered ≥104°F). Is there lameness (grade)? Which limb? Evaluate the limbs for joint swelling and hoof lesions (check the bottom and sides of the hoof). Lameness score: 1: No lameness, 2: Slightly uneven gait, some joint contractures but no lameness, 3: Mild lameness, slight limp while walking, 4: Moderate lameness, noticeable limp including difficulty touching the toes, 5: Severe lameness, no weight bearing on the limbs, requires encouragement to stand / walk. Is there difficulty breathing (grade)? Is there breathing with the mouth open? Is there nasal discharge (color and amount of nasal discharge: mild / moderate / severe)? Have you noticed the animal coughing? Is there eye discharge? Respiratory score: 0: Normal, 1: Mild dyspnea and / or tachypnea when stressed (handled), 2: Mild dyspnea and / or tachypnea at rest, 3: Moderate dyspnea and / or tachypnea when stressed (handled), 4: Moderate dyspnea and / or tachypnea at rest, 5: Severe dyspnea and / or tachypnea when stressed (handled), 6: Severe dyspnea and / or tachypnea at rest. Is there evidence of diarrhea (grade) or vomiting? Is there blood or mucus? Diarrhea score: 0: No noticeable stool, 1: Normal stool, 2: Loose stool with form (soft cream yogurt consistency, cow dung-like), 3: Brown / yellowish liquid diarrhea with particulate fecal matter, 4: Brown / yellowish liquid diarrhea without particulate fecal matter, 5: Liquid diarrhea that looks like water.
[0252] This scoring system was developed at KSU by Dr. Megan Niederwerder and is based on the following publications: Halbur et al., 1995; Merck, Miao et al., 2009; Patience and Thacker, 1989; Winckler and Willen, 2001. Scores and temperatures were analyzed using ANOVA, which separated individuals based on genotype as a treatment.
[0253] Measurement of PRRSV viremia Viremia was determined by two approaches. Viral titration was performed by adding serum in 1:10 serial dilutions to confluent MARC-145 cells in 96-well plates. Serum was diluted in Eagle's Minimum Essential Medium supplemented with 8% fetal bovine serum, penicillin, streptomycin, and amphotericin B, as previously described (Prather et al., 2013). After 4 days of incubation, cells were examined for the presence of cytopathic effects by microscopy. The highest dilution showing cytopathic effects was scored as the titration endpoint. Total RNA was isolated from serum by using the Life Technologies MagMAX-96 Viral RNA Isolation Kit to measure viral nucleic acids. Reverse transcription polymerase chain reaction was performed on a CFX-96 Real-Time PCR System (Bio-Rad) using the Tetracore EZ-PRRSV MPX 4.0 Kit, according to the manufacturer's instructions. Each reactant (25 μL) contained 5.8 μL of serum-derived RNA. Calibration curves were constructed by preparing serial dilutions of RNA controls supplied by the kit (Tetracore). The number of templates per PCR is reported.
[0254] SIGLEC1 and CD163 staining of PAM cells Porcine alveolar macrophages (PAMs) were collected by resecting the lungs and filling them with approximately 100 mL of cold phosphate-buffered saline. After collecting the phosphate-buffered saline wash, the cells were pelleted, resuspended in 5 mL of cold phosphate-buffered saline, and stored on ice. Approximately 107 PAMs were incubated on ice for 30 minutes in phosphate-buffered saline diluted with various antibodies (anti-porcine CD169 (clone 3B11 / 11; AbD Serotec); anti-porcine CD163 (clone 2A10 / 11; AbDSerotec)) along with 5% fetal bovine serum and 0.1% sodium azide. The cells were washed and resuspended in fluorescein isothiocyanate (FITC) conjugated goat anti-mouse IgG (Life Technologies), diluted in staining buffer at a 1 / 100 dilution, and incubated on ice for 30 minutes. At least 10⁴ cells were analyzed using a FACSCalibur flow cytometer and Cell Quest software (Becton Dickinson).
[0255] Measurement of PRRSV-specific Ig To measure PRRSV-specific Ig, recombinant PRRSV N protein was expressed in bacteria (Trible et al., 2012) and conjugated to magnetic Luminex beads using a kit (Luminex Corporation). The N protein-conjugated beads were diluted to 2,500 beads / 50 μL in phosphate-buffered saline containing 10% goat serum and placed in the wells of a 96-well round-bottom polystyrene plate. The serum was diluted 1:400 in phosphate-buffered saline containing 10% goat serum, and 50 μL was added to two wells of a plate. The plates were incubated at room temperature for 30 minutes with gentle shaking. Next, the plates were washed with phosphate-buffered saline containing 10% goat serum (3×), and 50 μL of biotin-SP conjugate affinity purified goat anti-porcine secondary antibody (IgG, Jackson ImmunoResearch) or biotin-labeled affinity purified goat anti-porcine IgM (KPL) (diluted to 2 μg / mL in phosphate-buffered saline containing 10% goat serum) was added. After 30 minutes of incubation, the plates were washed (3×), and then 50 μL of streptavidin-conjugate phycoerythrin (2 μg / mL (Moss, Inc.) in phosphate-buffered saline containing 10% goat serum) was added. The plates were washed after 30 minutes, and the microspheres were resuspended in 100 μL of phosphate-buffered saline containing 10% goat serum and analyzed using MAGPIX and Luminex xPONENT 4.2 software. Mean fluorescence intensity (MFI) is reported.
[0256] result Mutations in CD163 were created using CRISPR / Cas9 technology as described above in Example 1. Several founder animals were produced from zygote injection and somatic cell nuclear transfer. Some of these founders were mated to produce offspring for study. A single founder male was mated with a female having two genotypes. Founder male (67-1) had an 11bp deletion in exon 7 on one allele and a 2bp addition in exon 7 on the other allele (and a 377bp deletion in the preceding intron), and was predicted to be a null animal (CD163- / -). One founder female (65-1) had a 7bp addition in exon 7 on one allele and an uncharacterized corresponding allele, and was therefore predicted to be heterozygous for the knockout (CD163- / ?). The second founder female genotype (three cloned animals) contained an allele that had not yet been characterized and an allele with a 129 bp deletion in exon 7. This deletion is predicted to be a 43 amino acid deletion in domain 5. Crossing these animals resulted in all piglets inheriting either a null allele from the boar and one of the 43 amino acid deletion or uncharacterized allele from the sow. In addition to the wild-type piglet that served as a positive control for viral exposure, this produced four additional genotypes (Table 12). [Table 12]
[0257] At weaning, genetically edited piglets and wild-type piglets of the same age were transported to Kansas State University for PRRSV exposure. PRRSV exposure was carried out as previously described (Prather et al., 2013). Piglets were brought to the exposure facility at 3 weeks of age and maintained as a single group. All experiments were initiated after approval of facility animal use and the Biosafety Committee. After acclimatization, the pigs were exposed to PRRSV isolate NVSL97-7895 (Ladinig et al., 2015), grown on MARC-145 cells (Kim et al., 1993). The pigs were exposed to approximately 10⁵ TCID50 of the virus. Half of the inoculation material was delivered intramuscularly, and the remainder was delivered intranasally. All infected pigs were maintained as a single group, which allowed for continuous exposure to the virus from infected individuals in the same cage. Blood samples were collected at various days up to 35 days post-infection and at the end of the period, on day 35. The pigs were autopsied, and the tissues were fixed in 10% buffered formalin, embedded in paraffin, and processed for histopathological diagnosis. Clinical signs associated with PRRSV recorded during the course of infection included dyspnea, discomfort, malaise, and fever. The results for clinical signs over the study period are summarized in Figure 9. As expected, wild-type (CD163+ / +) pigs showed early signs of PRRSV infection, which peaked between days 5 and 14 and persisted within the group for the remainder of the study. The percentage of feverish pigs peaked at approximately day 10. In contrast, null (CD163- / -) piglets showed no evidence of clinical signs throughout the entire study period. Respiratory signs during acute PRRSV infection are reflected in significant histopathological changes in the lungs (Table 9). Infection in wild-type pigs showed histopathology consistent with PRRS, including interstitial edema with mononuclear cell infiltration (Figure 10). In contrast, there was no evidence of lung changes in null (CD163- / -) pigs. Although the sample sizes for the various genotypes were small, the mean scores were still 3.85 (n=7) for wild-type, 1.75 (n=4) for uncharacterized A, 1.33 (n=3) for uncharacterized B, and 0 (n=3) for null (CD163- / -). [Table 13]
[0258] The peak clinical signs correlated with the level of PRRSV in the blood. Measurement of viral nucleic acid was performed by isolation of total RNA from serum followed by amplification of PRRSV RNA using a commercially available reverse transcription enzyme real-time PRRSV PCR test (Tetracore, Rockville, MD). A calibration curve was generated by preparing serial dilutions of the PRRSV RNA control supplied in the RT-PCR kit, and the results were normalized as the number of templates / 50 μL PCR reaction. PRRSV isolates followed the course for PRRSV viremia in wild-type CD163+ / + pigs (Figure 11). Viremia became apparent on day 4, peaked on day 11, and decreased until the end of the study. In contrast, viral RNA was not detected at any time point during the study in CD163− / − pigs. Consistent with viremia, antibody production by null and uncharacterized allele pigs was detectable up to 14 and increased until day 28. In null animals, no antibody production occurred (Figure 12). Taken together, these data indicate that wild-type pigs supported PRRSV replication and developed clinical signs consistent with PRRS. In contrast, knockout pigs did not develop viremia and clinical signs even when pigs were inoculated and constantly exposed to the same infected individuals.
[0259] At the end of the study, porcine alveolar macrophages were removed by lung lavage and stained for surface expression of SIGLEC1 (CD169, clone 3B11 / 11) and CD163 (clone 2A10 / 11) as previously described (Prather et al., 2013). Relatively high levels of CD163 expression were detected on CD163+ / + wild-type animals (Figure 13). In contrast, CD163- / - pigs showed only background-level anti-CD163 staining, thus confirming the knockout phenotype. Expression levels for another macrophage marker, CD169, were similar in both wild-type and knockout pigs (Figure 14). Other macrophage surface markers, including MHC II and CD172, were the same for both genotypes (data not shown).
[0260] Although the sample size was small, wild-type pigs tended to gain less weight throughout the experiment compared to the other three genotypes (uncharacterized A 1.32 kg ± 0.17, n=4; uncharacterized B 1.20 kg ± 0.16, n=3; null 1.21 kg ± 0.16, n=3) (average daily weight gain 0.81 kg ± 0.33, n=7).
[0261] In the second trial, six wild-type pigs, six Δ43 amino acid pigs, and six pigs with an uncharacterized allele (B) were exposed to KS06-72109 as described above, except that the piglets were inoculated with the drug. Similar to the NVSL data, the wild-type and uncharacterized B piglets developed viremia. However, KS06 did not result in viremia in the Δ43 amino acid pigs (Figure 15, Table 7).
[0262] Meaning and conclusion The most clinically relevant disease for the pig industry is PRRS. While vaccination programs have been successful in preventing or controlling most porcine pathogens, PRRSV has proven to be more challenging. Here, CD163 has been identified as an entry mediator for this viral strain. Since the founder boar was created by injecting CRISPR / Cas9 into a zygote (Whitworth et al., 2014), no transgene is present. Furthermore, one of the alleles derived from a multiparous sow (also created using CRISPR / Cas9) does not contain the transgene. Therefore, piglet #40 possesses a 7bp addition in one allele and an 11bp deletion in the other, but does not possess the transgene. These virus-resistant alleles of CD163 represent a small genome edit considering the pig genome is approximately 2.8 billion bp (Groenen et al., 2012). If similarly created animals are introduced into the food supply, significant economic losses can be prevented.
[0263] Example 3: Increased resistance to genotype 1 porcine reproductive PRRS virus in pigs having CD163 SRCR domain 5 replaced with human CD163-like homology SRCR domain 8. CD163 is considered the primary receptor for porcine reproductive and respiratory syndrome virus (PRRSV). In this study, pigs were gene-edited (GE) to have one of the following genotypes: complete knockout (KO) of CD163, deletion within CD163 scavenger receptor cysteine-rich (SRCR) domain 5, or replacement of SRCR domain 5 with a synthetic exon encoding a homolog of the human CD163-like (hCD163L1) SRCR8 domain (domain swap). Immunophenotyping of porcine alveolar macrophages (PAMs) showed that pigs with KO or SRCR domain 5 deletion did not express CD163, and PAMs did not support PRRSV infection. PAMs derived from pigs with the hCD163L1 domain 8 homolog expressed CD163 and supported type 2 replication, but did not support type 1 genotype viruses. Similar results were obtained when CD163-modified pigs were infected with representative type 1 and type 2 viruses. The results indicate a clear difference between PRRSV genotypes in their recognition of the CD163 molecule, even though type 1 and type 2 viruses require CD163 as a receptor and may be considered genetically and phenotypic similar at some levels.
[0264] material and method Genome modification of the porcine CD163 gene Experiments involving animals and viruses were conducted in accordance with the Federation of Animal Science Societies Guide for the Care and Use of Agricultural Animals in Research and Teaching, the USDA Animal Welfare Act and Regulations, and were authorized by the Kansas State University and University of Missouri Institutional Laboratory Animal Committees and Institutional Biosafety Committees. Mutations in CD163 used in this study were created using CRISPR / Cas9 technology, as described above in the previous example. The mutations are illustrated in Figure 17. The illustrated genomic region shown in Figure 17 extends from intron 6 to intron 8 of the porcine CD163 gene. The introns and exons illustrated in Figure 17 are not drawn to scale. Predicted protein products are shown to the right of each genomic structure. Relative macrophage expression, measured by the level of surface CD163 on PAM, is shown at the far right of Figure 17. Black regions indicate introns; white regions indicate exons; shaded regions indicate the hCD163L1 exon 11 mimic, homolog of buta exon 7; and gray regions indicate synthetic introns with PGK Neo constructs, as shown in Figure 17.
[0265] The CD163 gene construct KO-d7(11), shown in Figure 17, has an 11-base pair deletion in exon 7 from nucleotide 3,137 to nucleotide 3,147. The CD163 gene construct KO-i7(2) has a 2-base pair insertion between nucleotides 3,149 and 3,150 in exon 7, as well as a 377-base pair deletion in the upstream intron of exon 7 from nucleotide 2,573 to nucleotide 2,949. These edits are predicted to result in frameshift mutations and immature stop codons, resulting in only partial translation of SRCR5 and a KO phenotype. The other three mutations resulted in deletions in exon 7. First, d7(129) has a 129-base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172. The d7(129) construct also has a deletion in exon 6 from nucleotide 488 to nucleotide 2,417, where the deleted sequence is replaced by a 12 bp insertion. The other two deletion constructs, d7(1467) and d7(1280), have complete deletions in exons 7 and 8, as shown in Figure 17. d7(1467) has a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897, and d7(1280) has a 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097. For these deletion constructs, the other CD163 exons remained intact.
[0266] The final construct, HL11m, shown in Figure 17, was produced using a targeting event that deleted exon 7 and replaced it with a synthetic exon encoding a homolog of SRCR8 in human CD163-like protein 1 (hCD163L1 domain 8 is encoded by hCD163L1 exon 11). The SRCR8 peptide sequence was created by altering 33 nucleotides in the porcine exon 7 sequence. A neomycin cassette was included in the synthetic exon to allow screening for modification. Sequence ID 118 provides the nucleotide sequence of the HL11m construct in the region corresponding to the same region in reference sequence ID 47.
[0267] Figure 18 provides diagrams of the porcine CD163 protein and gene. The CD163 protein SCRC (oval) and PST (square) domains, along with their corresponding gene exons, are shown in panel A of Figure 18. A peptide sequence comparison of porcine CD163 SRCR5 (sequence number 120) and human CD163 SRCR8 homolog (sequence number 121) is shown in panel B of Figure 18. The diagrams are based on GenBank acceptance numbers AJ311716 (porcine CD163) and GQ397482 (hCD163-L1).
[0268] virus Table 14 lists the panel of viruses used in this example. Isolates were grown on MARC-145 cells and titrated (Kim et al., 1993). For titration, each virus was serially diluted 1:10 in MEM supplemented with 7% FBS, Pen-Strep (80 units / mL and 80 μg / mL, respectively), 3 μg / mL FUNGIZONE (amphotericin B), and 25 mM HEPES. The diluted samples were added in four strips to confluent MARC-145 cells in a 96-well plate to a final volume of 200 μL / well and incubated at 37°C in 5% CO2 for 4 days. The titration endpoint was identified as the last well exhibiting cytopathic effect (CPE). The 50% tissue culture infectious dose (TCID50 / mL) was calculated using the method described above (Reed and Muench 1938). [Table 14]
[0269] Infection of alveolar macrophages Macrophage preparation and infection were carried out as described above (Gaudreault, et al., 2009 and Patton, et al., 2008). The lungs were removed from euthanized pigs and washed by pouring 100 mL of cold phosphate-buffered saline (PBS) into the trachea. The trachea was clamped and the lungs were gently massaged. The alveolar contents were poured into a 50 mL centrifuge tube and stored on ice. Porcine alveolar macrophages (PAMs) were precipitated by centrifugation at 1200 × g at 4°C for 10 minutes. The pellet was resuspended in cold sterile PBS and washed once. The cell pellet was resuspended in frozen medium containing 45% RPMI1640, 45% fetal bovine serum (FBS), and 10% dimethyl sulfoxide (DMSO) and stored in liquid nitrogen until use. Frozen cells were thawed on ice, counted, and adjusted to 5 × 10⁵ cells / mL in medium (RPMI1640; RPMI-FBS supplemented with 10% FBS, PenStrep, and FUNGIZONE). Approximately 10³ PAM / well was added to a 96-well plate and incubated overnight at 37°C in 5% CO₂. Cells were lightly washed to remove non-adherent cells. 1:10 serial dilutions of the virus were added to three wells. After overnight incubation, cells were washed with PBS and fixed with 80% acetone for 10 minutes. After drying, the wells were stained with PRRSV N-protein specific SDOW-17mAb (Rural Technologies Inc.) diluted 1:1000 in PBS (PBS-FG; Sigma Aldrich) containing 1% fish gelatin. After incubation at 37°C for 30 minutes, cells were washed with PBS and stained with ALEXAFLUOR488-labeled anti-mouse IgG (Thermofisher Scientific) diluted 1:200 in PBS-FG. Plates were incubated in the dark at 37°C for 30 minutes, washed with PBS, and observed under a fluorescence microscope. The 50% tissue culture infectious dose (TCID50) / mL was calculated according to the method previously described (Reed and Muench 1938).
[0270] Measurement of CD169 and CD163 surface expression on PAM Surface staining for CD169 and CD163 expression was performed as described above (Prather et al., 2013). Approximately 1 × 10⁶ PAM cells were placed in a 12 mm × 75 mm polystyrene flow cytometry (FACS) tube and incubated for 15 minutes at room temperature in 1 ml of PBS containing 10% normal mouse serum to block Fc receptors. Cells were pelleted by centrifugation and resuspended in 5 μL of FITC conjugate mouse anti-porcine CD169 mAb (clone 3B11 / 11; AbD Serotec) and 5 μL of PE conjugate mouse anti-porcine CD163 mAb (clone: 2A10 / 11, AbD Serotec). After 30 minutes of incubation, cells were washed twice with PBS containing 1% bovine serum albumin (BSA Fraction V; Hyclone) and immediately analyzed using FCS Express5 software (De Novo Software) on a BD LSR Fortessa flow cytometer (BD Biosciences). For each sample, at least 10,000 cells were analyzed.
[0271] Measurement of PRRS viremia RNA was isolated from 50 μL of serum using the Ambion MagMAX96 virus isolation kit (Applied Biosystems) according to the manufacturer's instructions. PRRSV RNA was quantified using the EZ-PRRSV MPX4.0 Real Time RT-PCR target-specific reagent (Tetracore) as performed according to the manufacturer's instructions. Each plate contained Tetracore quantification standards and control sets designed for use with the RT-PCR reagent. PCR was performed on a CFX96 Touch Real-Time PCR detection system (Bio-Rad) in a 96-well format using the recommended cycling parameters. PCR assay results were reported as log10 PRRSV RNA copy number / 50 μL reaction volume, which approximates the copy number / mL of serum. Area under the curve (AUC) for viremia over time was calculated using GraphPad Prism version 6.00 for Windows.
[0272] Measurement of PRRSV antibody Microsphere fluorescence immunoassay (FMIA) for the detection of antibodies against PRRSV nucleocapsid (N) protein was performed as previously described (Stephenson et al., 2015). Recombinant PRRSV N protein was conjugated to carboxylated Luminex MAGPLEX polystyrene microsphere beads according to the manufacturer's instructions. For FMIA, approximately 2500 antigen-coated beads suspended in 50 μL PBS (PBS-GS) containing 10% goat serum were placed in each well of a 96-well polystyrene round-bottom plate. The serum was diluted 1:400 in PBS-GS and 50 μL was added to each well. The plate was wrapped in foil and incubated at room temperature for 30 minutes with gentle shaking. The plate was placed on a magnet and the beads were washed three times with 190 μL of PBS-GS. For IgG detection, 50 μL of biotin-SP conjugate affinity purified goat anti-porcine secondary antibody (IgG, Jackson ImmunoResearch) was diluted to 2 μg / mL in PBS-GS, and 100 μL was added to each well. The plate was incubated at room temperature for 30 minutes, washed three times, and then 50 μL of streptavidin conjugate phycoerythrin (2 μg / mL in PBS-GS; SAPE) was added. After 30 minutes, the microspheres were washed and resuspended in 100 μL of PBS-GS, and analyzed using a MAGPIX instrument (LUMINEX) and LUMINEX xPONENT 4.2 software. Mean fluorescence intensity (MFI) was calculated using a minimum of 100 microsphere beads.
[0273] Haptoglobin (HP) measurement The amount of Hp in serum was measured using a porcine-specific Hp ELISA kit (Genway Biotech Inc.), and the procedure was carried out according to the manufacturer's instructions. Serum samples were diluted 1:10,000 in 1X diluent solution, pipetted in double strips onto a pre-coated anti-porcine Hp 96-well ELISA plate, incubated at room temperature for 15 minutes, and then washed three times. Anti-Hp-horseradish peroxidase (HRP) conjugate was added to each well and incubated in the dark at room temperature for 15 minutes. The plate was washed, and 100 μL of chromogenic substrate solution was added to each well. After incubation in the dark for 10 minutes, 100 μL of stop solution was added to each well. The plate was read at 450 nm on a Fluostar Omega filter-based microplate reader (BMG Labtech).
[0274] result Phenotypic characteristics of PAM derived from CD163-modified pigs We gated mononuclear subpopulations of cells using the forward and lateral scattering properties of cells in lung lavage material. Representative CD169 and CD163 staining results for different chromosomal modifications shown in Figure 17 are shown in Figure 19. In the representative example presented in panel A of Figure 19, over 91% of PAMs from WT pigs were positive for both CD169 and CD163. Results for the 12 WT pigs used in this study showed a mean of 85+ / -8% double-positive cells. As shown in panel B of Figure 19, PAMs from CD163 KO pigs did not show evidence of CD163 but retained normal surface levels of CD169. CD163 polypeptides from d7(1467) and d7(1280) deletion genotypes were predicted to produce modified CD163 polypeptides immobilized on the PAM surface, but immunostaining results did not show surface expression of CD163 (see Figure 19, panel D). Since MAb 2A10 recognizes epitopes located in the first three SRCR domains, the absence of detection was not a result of a deletion of the immunoreactive epitope. The d7(129) genotype was predicted to have a 43-amino acid deletion in SRCR5 (see Figure 17). In the examples presented in panel C of Figure 19, only 2.4% of cells were in the double-positive quadrant. Analysis of PAMs from nine d7(129) pigs used in this study showed a percentage of double-positive cells ranging from 0% to 3.6% (mean = 0.9%). CD169 surface expression remained similar to that of WT PAMs. For the purposes of this study, all pigs with KO, d7(1467), d7(1280), and d7(129) genotypes were classified as having a CD163-null phenotype.
[0275] CD163 modifications including the hCD163L1 domain 8 peptide sequence HL11m showed dual expression of CD163+ and CD169+ on PAM (Panel E, Figure 19). However, in all HL11m pigs analyzed in this study, CD163 surface expression was significantly reduced compared to WT PAM. CD163 levels were located on a contiguous spectrum, ranging from undetectable CD163 to moderate levels in some pigs. In the example shown in Panel E, Figure 19, approximately 60% of cells were in the dual-positive quadrant, and 40% of cells stained for CD169 only. Analysis of PAM from a total of 24 HL11m pigs showed that 38+ / -12% of PAM cells were positive for CD169 only, and 54+ / -14% were dual-positive (CD169+CD163+).
[0276] Circulating haptoglobin levels in WT and CD163-modified pigs As a capture molecule, CD163 is responsible for removing the HbHp complex from the blood (Fabriek, et al., 2005, Kristiansen et al., 2001, and Madsen et al., 2004). Serum Hp levels provide a convenient method for determining the overall functional characteristics of CD163-expressing macrophages. Serum Hp levels from WT, HL11m, and CD163 null pigs were measured at 3–4 weeks of age, immediately before PRRSV infection. The results presented in Figure 20 showed that serum from WT pigs had the lowest Hb levels (mean A450 = 23 + / - 0.18, n = 10). The mean and standard deviation for each group were: WT, 0.23 + / - 0.18, n = 10; HL11m, 1.63 + / - 0.8, n = 11; and 2.06 + / - 0.57, n = 9, null group. The null group consisted of genotypes that did not express CD163 (CD163 null phenotype pigs). Hp measurements were performed on a single ELISA plate. There were no significant differences between groups with the same letter (p>0.05, Kruskal-Wallis one-way ANOVA and Dunnett post-hoc test). Mean A450 values for WT pigs were significantly different from those of HL11m and CD163-null pigs (p<0.05). Mean A450 values in the HL11m group were lower than in the CD163-null group (A450=1.6+ / 0.8 vs. 2.1+ / -0.6), but this difference was not statistically significant. Since the interaction between HbHp and CD163 occurs via SRCR3 (Madsen et al., 2004), the increased circulating Hp in HL11m pigs compared to WT pigs is unlikely to be a result of reduced affinity of CD163 to Hb / Hp, but rather a consequence of a reduced number of CD163+ macrophages and reduced CD163 expression on the remaining macrophages (see panel E in Figure 19).
[0277] PAM infection by type 1 and type 2 viruses Tolerance of CD163-modified pigs to PRRSV was first evaluated by infecting PAM cells in vitro with a population of 6 type 1 and 9 type 2 PRRSV isolates (see Table 14 for a list of viruses). Viruses within the population represent different genotypes, as well as differences in nucleotide and peptide sequences, pathogenesis, and year of isolation. The data presented in Table 15 show the results of experiments using PAMs from three pigs for each CD163 genotype group. The listed viruses correspond to the PRRSV isolates listed in Table 14. Results are presented as the mean + / - standard deviation of the percentage of infected PAMs. CD163-null PAMs were derived from pigs expressing the d7(129) allele (see Figures 17 and 19 for CD163 gene constructs and CD163 expression on PAMs, respectively). [Table 15]
[0278] As expected, WT PAMs were infected with all viruses. In contrast, CD163-null phenotypic pigs were negative for all viral infections. A significant difference was observed in the PAM response from HL11m pigs. None of the type 1 viruses were able to infect HL11m PAMs, while all viruses in the type 2 population were able to infect HL11m PAMs, albeit at a much lower percentage compared to WT PAMs.
[0279] Tolerance was also evaluated by comparing the viral titration endpoints between WT and HL11m PAM for the same type 2 virus. The results are shown for two WT and two HL11m pigs (Figure 21). The log10TCID50 values were calculated based on infection of macrophage cultures with the same viral sample. The infection results represent two different pigs from each genotype. The viruses used for infection are listed in Table 14. The log10TCID50 values for HL11m pig-derived PAM were 1–3 logs lower compared to WT PAM infected with the same virus. The only exception was infection with a modified live virus vaccine strain. In summary, the results suggest that HL11m pig-derived PAM has reduced susceptibility or tolerance to infection with type 2 virus.
[0280] CD163-modified pigs infected with type 1 and type 2 viruses WT (round), HL11m (square), and CD163-null (triangular) pigs were infected with representative type 1 (SD13-15) (Figure 22, Panel A, left graph) and type 2 (NVSL 97-7895) (Figure 22, Panel A, right graph) viruses. Null phenotype pigs were derived from KO and d(1567) alleles (see Figure 17). Pigs from the three genotypes inoculated with the same virus were mixed in a single enclosure, allowing for continuous exposure of CD163-modified pigs to viruses excreted from individuals in the same enclosure as WT. The number of pigs infected with representative type 1 virus was WT (n=4), HL11m (n=5), and null (n=3); and type 2 virus: WT (n=4), HL11m (n=4), and null (n=3). As shown in Figure 22, CD163 null pigs infected with either type 1 or type 2 virus were negative for viremia at all time points and did not undergo seroconversion. As expected, WT pigs were proliferatively infected and had mean viremia levels reaching 106 template / 50 μL PCR reaction at 7 days post-infection for both viruses. By 14 days, all WT pigs were seroconverted (see Figure 22, Panel B). Consistent with PAM infection results (Table 15), five HL11m pigs infected with type 1 virus showed no evidence of viremia or PRRSV antibody. All HL11m pigs infected with type 2 isolate NVSL supported infection and underwent seroconversion (Figure 22, Panel B). The existence of reduced tolerance levels in HL11m pigs was unclear. Mean viremia in three of the four HL11m pigs was similar to that of the WT pigs. However, in one HL11m pig, #101 (Figure 22, white square in the right graph of Panel A), viremia was significantly reduced compared to other pigs in the HL11m genotype group. The explanation for the 3-4 log reduction in viremia in pig #101 was not clear, but it suggests that some HL11m pigs may become less tolerant to PRRSV and supports the in vitro PAM infection outcome (Table 15).Since all pigs were inoculated with the same amount of virus and kept mixed with WT pigs, the lower viremia in pig #101 was not a result of receiving a lower amount of virus or lower exposure. Flow cytometry of macrophages showed that CD163 expression in pig #101 was comparable to that of other HL11m pigs (data not shown). There were no sequence differences in the exon 11 mimicry sequence.
[0281] Additional viral infection tests were conducted using two viruses, NVSL 97-7895 and KS06-72109. The results are shown in Figure 23. Pigs were followed for 35 days post-infection, and data were reported as area under the curve (AUC) for viremia measurements performed at 3, 7, 11, 14, 21, 28, and 35 days post-infection. As shown in Figure 23, for NVSL, the mean AUC value for 7 WT pigs infected with NVSL was 168+ / -8, and for 7 HL11m pigs it was 165+ / -15. For KS06, the mean AUC values for 6 WT pigs and 6 HL11m pigs were 156+ / -9 and 163+ / -13, respectively. There were no statistically significant differences between WT and HL11m pigs for both viruses (p>0.05). In summary, the results showed that HL11m pigs could not support type 1 PRRSV infection but maintained tolerance to type 2 virus infection. Even though there was a reduction in PMRSV tolerance in PAM derived from HL11m pigs infected with type 2 isolates in vitro, this difference was not translated into pigs. In the results shown in Figure 23, viral load was determined by calculating the area under the curve (AUC) for each pig over a 35-day infection period. AUC calculations were performed using log10 PCR viremia measurements taken at 0, 4, 7, 10, 14, 21, 28, and 35 days post-infection. Horizontal lines indicate the mean and standard deviation. Key: WT = wild-type pig, HL11 = HL11m genotype pig, Null = CD163-null genotype.
[0282] Consideration CD163 is a macrophage surface protein crucial for capturing excess Hb from the blood and regulating inflammation in response to tissue damage. It also functions as a viral receptor. CD163 is involved in both pro-inflammatory and anti-inflammatory responses (Van Gorp et al., 2010). CD163-positive macrophages are incorporated into alternatively activated M2 macrophages (generally described as having high phagocytic and anti-inflammatory properties). M2 macrophages are involved in cleansing and repair after mechanical tissue injury or infection (Stein et al., 1992). In terms of anti-inflammatory capacity, CD163 expression is upregulated by anti-inflammatory proteins such as IL-10 (Sulahian, et al., 2002). During inflammation, CD163 reduces inflammation by reducing oxidation through the removal of circulating heme from the blood. Heme degradation products such as bilbertin, bilirubin, and nitric oxide are potent anti-inflammatory molecules (Soares and Bach, 2009 and Jeney et al., 2002). In terms of pro-inflammatory capabilities, cross-linking of CD163 on the surface of macrophages by anti-CD163 antibodies or bacteria leads to the local release of inflammatory cytokines, such as IL-6, GM-CSF, TNFα, and IL-1β (Van den Heuvel et al., 1999 and Fabriek et al., 2009).
[0283] GE pigs lacking CD163 are unable to support the replication of type 2 PRRSV isolates (Whitworth et al., 2016). In this study, in vitro infection tests demonstrated the resistance of CD163-null phenotypic macrophages to a broad population of type 1 and type 2 PRRSV isolates, and potentially further extended to include all PRRSV isolates (Table 15). The resistance of CD163-null phenotypic macrophages to type 1 and type 2 viruses was confirmed in vivo (Figures 22 and 23). Based on these results, the contribution of other PRRSV receptors previously described in the literature (Zhang and Yoo, 2015) can be ruled out. For example, Shanmukhappa et al. (2007) showed that non-tolerant BHK cells transfected with the CD151 plasmid acquired the ability to support PRRSV replication, and that incubation with a polyclonal anti-CD151 antibody significantly reduced infection of MARC-145 cells. In addition, the monkey cell line SJPL, originally developed for the proliferation of swine influenza virus, has been previously shown to support PRRSV replication (Provost, et al., 2012). Key characteristics of the SJPL cell line included the presence of CD151, as well as the absence of sialoadhesin and CD163. Taken together, these data provided compelling evidence that the presence of CD151 alone is sufficient to support PRRSV replication. The results of this study, showing the absence of PRRSV infection in macrophages with a CD163 null phenotype and in pigs, indicate that CD151 is not biologically relevant as an alternative receptor for PRRSV.
[0284] The viral proteins GP2a and GP4, which form part of the GP2a, GP3, GP4 heterotrimer complex on the PRRSV surface, can co-precipitate with CD163 from cells transfected with GP2 and GP4 plasmids in a pull-down assay (Das, et al., 2009). Presumably, GP2 and GP4 form interactions with one or more CD163 SRCR domains. An in vitro infectivity assay incorporating a porcine CD163 cDNA backbone, including a domain swap between porcine SRCR5 and a homolog derived from hCD163-L1 SRCR8, further localized the region utilized by type 1 virus to SRCR5 (Van Gorp, et al., 2010). It is intriguing to speculate that a stable interaction between GP2 / GP4 and CD163 occurs via SRCR5. Additional viral glycoproteins, such as GP3 and GP5, may further stabilize the virus-receptor complex or function as co-receptor molecules. The requirement for SRCR5 was investigated in this study by infecting macrophages and pigs with the HL11m allele (reconstructed with a CD163L1 SRCR8 domain swap by creating a 33bp substitution in porcine exon 7). The HL11m allele also included a neomycin cassette to select cells positive for the genetic modification (Figure 17). HL11m pigs expressed CD163 on PAM, albeit at reduced levels compared to WT PAM (Figure 19, comparing panels A and E). The reduced expression was likely due to the presence of the neomycin cassette, which was located between the exon 11 mimite and the subsequent intron. HL11m pigs were not tolerant to type 1 viral infection, confirming the importance of SRCR5. However, HL11m macrophages and HL11m pigs did not support type 2 viral infection. Based on viral titration and infection rate results, PAMs derived from HL11m pigs showed an overall decrease in viral tolerance compared to WT macrophages (Table 15 and Figure 17). This decrease in tolerance may be due to a reduction in the level of CD163 on HL11m macrophages, along with a decrease in viral affinity for modified CD163 protein.Assuming that type 2 virus possesses the requirements of SRCR5 and L1 SRCR8 can function as a suitable substitution, the lower affinity may be explained by the difference in peptide sequences between human SRCR8 and porcine SRCR5 (see Figure 18, Panel B). However, the reduced tolerance of PAM was not translated to pigs. The mean viremia of HL11m pigs was not significantly different compared to WT pigs (Figure 23). In addition to PAM, PRRSV infection of intravascular, septal, and lymphoid tissue macrophages contributes to viremia (Lawson et al., 1997 and Morgan et al., 2014). The potential contribution of these and other CD163-positive cell populations in maintaining the overall viral load in HL11m pigs warrants further investigation.
[0285] Despite the stable expression of CD163 plasmids with SRCR domain deletions in HEK cells (Van Gorp et al., 2010), deletions of exons 7 and 8 in d7(1467) and d7(1280) resulted in the absence of detectable surface expression of CD163 (Figure 19, Panel D). Since 2A10mAB, used for flow cytometry, recognizes three N-terminal SRCR domains (Van Gorp et al., 2010) and possibly domains 7 and 8 (Sanchez, et al., 1999), the lack of detection was not due to the removal of the 2A10 epitope in the mutant protein. Low levels of CD163 expression were detectable on PAM derived from some d7(129) pigs (see Figure 19, Panel C), but the amount of expressed protein was not sufficient to support PRRSV infection in PAM or pigs. The absence of CD163 expression in exon 7 and 8 deletion mutants is not fully understood, but is likely a result of mRNA and / or protein degradation.
[0286] In 2003, CD163 was identified as a receptor for African swine fever virus (ASFV; Sanchez-Torres et al., 2003). This conclusion was based on the observation that infected macrophages have a mature CD163-positive phenotype, and that anti-CD163 antibodies such as 2A10 block ASFV infection of macrophages in vitro. It has not been determined whether CD163-null pigs are resistant to ASFV infection.
[0287] Cell culture models incorporating modifications to the PRRSV receptor provided valuable insights into the mechanisms of PRRSV entry, replication, and pathogenesis. A unique aspect of this study was the implementation of parallel in vivo experiments using receptor-modified pigs. This research has significant implications for the potential to develop preventive therapies against one of the most serious diseases constantly facing the global pig industry.
[0288] Example 4: Maternal CD163 knockout protects the fetus from porcine reproductive and respiratory syndrome virus (PRRSV) infection. Examples 1-3 above demonstrate that pigs with a complete knockout (KO) of the CD163 gene lack CD163 expression on macrophages and do not support PRRSV infection (see also Whitworth et al., 2016 and Wells et al., 2017). Since CD163 expression is a dominant trait and is inherited in a classical Mendelian manner, offspring with normal CD163 expression and function can be induced by mating KO CD163- / - sows with wild-type (WT) CD163+ / + males. For this study, CD163 KO heifers were bred with WT males to produce heterozygous CD163+ / - fetuses in order to determine whether the presence of the CD163 KO genotype in the female parent was sufficient to protect the fetus after maternal infection with PRRSV. In this study, CD163-positive fetuses that recovered at 109 days of gestation or 20 days after maternal infection were completely protected from PRRSV in female parents with complete knockout of the CD163 receptor. The results demonstrate a practical means of eliminating PRRSV-related reproductive diseases, which are a major cause of economic difficulties for agriculture.
[0289] material and method CD163 gene editing. The CRISPR / Cas9 method used to generate all KO alleles is described in detail in Examples 1-3 above. Wild-type and knockout or heterozygous animals having the alleles generated as described in Examples 1-3 and listed in Table 16 were used in the experiments described in these examples. Each of these alleles is described in Examples 1-3 and PCT Publication WO2017 / 023570, which is incorporated herein by reference in its entirety. Specific editing of alleles B, D, and E is also described in Whitworth et al., 2014, and specific editing (2bp insertion) in allele C is described in Whitworth et al., 2016. All alleles listed in Table 16 were identified based on DNA sequencing. Knockout genotypes were confirmed by the absence of CD163 expression, as measured by staining alveolar macrophages with anti-CD163 mAb, 2A10, as described above in Example 2. [Table 16]
[0290] PRRSV infection The PRRSV strain NVSL97-7895 (NVSL) used in this study is a laboratory strain isolated in 1997 from a herd in southeastern Iowa, USA, that had experienced a PRRS abortion storm (Halbur et al., 1997). The virus was maintained as a low-passage isolate, grown, and titrated on MARC-145 cells. On days 89–91 of gestation, nulliparous pigs were inoculated with 105TCID50 virus diluted in 5 mL of culture medium. Half of the inoculation material was administered intramuscularly, and the remainder intranasally. All nulliparous pigs were maintained in an environment that allowed for continuous exposure to the virus released by infected individuals in the same cage. Blood samples were collected from nulliparous pigs before infection, 7 days after inoculation (dpi), and at the time of euthanasia. PRRSV nucleic acid was determined by isolating total RNA from serum and then measuring by reverse transcriptase real-time PRRSV PCR (Tetracore, Rockville, MD). A calibration curve was generated using the quantification standards supplied with the RT-PCR kit. The results were reported as log10 template / 25 μL reactant, which approximates the number of viral RNA templates / 1 mL of blood.
[0291] result A detailed description of the knockout alleles used in this study is shown in Table 16 above. Each knockout allele had a mutation in exon 7, which was predicted to result in a codon frameshift in mRNA, followed by an immature stop codon. Crosses between WT and CD163 KO parents are summarized in Table 17. The first group of three female parents that served as positive infection controls were CD163+ / + female parents (++ / ++ group) carrying CD163+ / + fetuses. The second group (-- / +-) consisted of CD163- / - female parents carrying CD163+ / - fetuses. In this group, the CD163- / - female parents were unable to support PRRS replication, while the CD163+ / - fetuses retained susceptibility to PRRS infection. Finally, the third group (-- / --) consisted of CD163- / - female parents carrying CD163- / - fetuses. In the last group, both the mother and the fetus needed to be resistant to the infection. [Table 17]
[0292] Clinical signs in infected wild-type (WT) female parents included lethargy and transient discomfort. KO female parents showed no clinical signs. During the study period, one WT female parent, No. 139, was aborted at 106 days of gestation (15 dpi). PRRSV nucleic acid, measured at 7 dpi, showed a viremia level of 5.5 log10 template / response in female parent 139, demonstrating the presence of productive PRRSV infection. Between 15 and 20 dpi, all remaining female parents were euthanized, and their uterine horns were immediately removed. From the tip of each horn, the fetus and placenta were removed and assessed for the presence of anatomical pathology. Blood samples were taken from each fetus. If blood was not available, fluid samples were taken from the peritoneal cavity. The number of fetuses recovered from each female parent is listed in Table 17. In the CD163 WT group (++ / ++) (including aborted mothers), the number of fetuses was 16, 14, and 12 (mean = 14.0). CD163 KO mothers who carried CD163+ / - fetuses (-- / +- group) produced 14, 17, and 11 fetuses (mean = 13.6). CD163 KO mothers who carried CD163 KO fetuses (-- / -- group) produced 7 and 9 fetuses. The results of fetal viremia and gross findings are summarized in Figure 24 and Table 18. [Table 18]
[0293] Figure 24 shows the various fetal outcomes after maternal infection with PRRSV. The numbers on the left identify each female parent. Below each female parent in parentheses are the results of PRRS PCR in serum measured as a log10 template / reaction. "N" indicates negative for PRRSV nucleic acid (Ct>39). Fetuses are identified by their number and relative position within each uterine horn. Asterisks identify fetal PCR samples obtained from ascites. The numbers below each fetus are the results of PRRS PCR in fetal serum (log10 template / reaction). The numbers in each circle indicate the presence of anatomical pathology: 1) normal fetus, 2) small fetus, 3) placental changes such as placental abruption and / or necrosis, 4) meconium-stained fetus, 5) fetus is dead and necrotic. Lowercase letters identify the genotype of individual fetuses (see Table 17). Keys: a,A / A;b,C / A;c,B / A;d,E / A;e,B / C;f,B / D;g,D / C;h,D / D;i,E / C;j,E / D;ND, could not be determined due to fetal necrosis;nd, genotype could not be determined.
[0294] At the anatomical level, 50% and 72% of fetuses from two CD163 WT(++ / ++) female parents, No. 138 and No. 140, showed some degree of pathology, including being smaller than normal fetuses (11% of all fetuses), fetuses with placental abruption or necrosis (14%), meconium staining (7%), and fetuses that died and were necrotic (25%). The pathological observations were typical of reproductive PRRS. The littermates had a high rate of PRRSV infection, with 92% of fetuses testing positive for the presence of PRRSV nucleic acid. PCR results from fetuses from WT female parents revealed two important characteristics of fetal PRRSV infection. First, there was considerable variability in the concentration of virus detected in serum among fetuses, resulting in infection at different times of the fetuses. Second, the level of viremia did not always correlate with pathology. For example, fetus No. 5 from female parent No. 138 had a high level of viremia (7.3 log10 template / reaction), but the fetus appeared unaffected. The reason for the difference between viremia and pathology is unknown. One possibility is that fetal pathology is a result of tissue damage occurring on the maternal side and is unrelated to the level of fetal viremia. In this area, these normal yet infected neonatal piglets can function as "super shedders," facilitating the rapid spread of PRRSV throughout the production system. In the - / + group (female parents No. 84, 87, 122), all fetuses appeared normal except for two fetuses that were smaller than the other littermates. Fetuses smaller than normal size are likely a result of congestion in the uterine horns, which reduces the placental surface area and thus restricts the growth of developing fetuses. All female parents and fetuses in the -- / +- group were negative for the presence of PRRSV nucleic acid. In the last group -- / --, there was no visible pathology, and all female parents (No. 86 and 121) and fetuses were negative for PRRSV nucleic acid.
[0295] The results of this study clearly demonstrate that the absence of CD163 in the female parent is sufficient to protect PRRSV-susceptible fetuses. CD163-positive offspring from CD163-knocking-out female parents are susceptible to the virus immediately after birth, but protection from PRRSV in utero provides a means of eliminating a major cause of economic loss and animal suffering.
[0296] The examples disclosed herein are provided for illustrative purposes only and are not intended to limit the scope of the invention.
[0297] Considering the above, it can be seen that some of the objectives of the present invention are achieved, and other advantageous results are attained.
[0298] Since various modifications can be made to the above products and methods without departing from the scope of the present invention, all matters included in the above description and shown in the accompanying drawings are intended to be construed as illustrative rather than restrictive. References Allende R, et al., 1999. North American and European porcine reproductive and respiratory syndrome viruses differ in non-structural protein coding regions. J.Gen.Virol.80:307-315. Bauer BK, et al.,Arginine supplementation in vitro increases porcine embryo development and affects mRNA transcript expression.Reprod Fertil Dev 2011; 23:107. Beaton BP,et al.,Compound transgenics:recombinase- mediated gene stacking.In:Pinkert CA (ed.).Transgenic Animal Technology:A Laboratory Handbook,3rd ed.Waltham,MA:Elsevier; 2014:565-578. Benfield DA,et al.,1992.Characterization of swine infertility and respiratory syndrome (SIRS) virus (Isolate ATCC VR-2332).J Vet Diag Invest 4:127-133. Boddicker,et al.,2014.Genome-wide association and genomic prediction for host response to porcine reproductive and respiratory syndrome virus infection.Genetics,selection,evolution:GSE 46,18. Borg NA,et al.,CD1d-lipid- antigen recognition by the semi-invariant NKT T-cell receptor.Nature 2007; 448:44-49. Brinster RL,et al.,Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs.Proc Natl Acad Sci U S A 1985; 82:4438-4442. Cafruny,WA,et al,Trojan Horse macrophages:studies with the murine lactate dehydrogenase-elevating virus and implications for sexually transmitted virus infection.J.Gen.Virol.77(12):3005-3012 (1996). Calvert JG,et al.,2007.CD163 expression confers susceptibility to porcine reproductive and respiratory syndrome viruses.J Virol.81:7371-7379. Carter DB,et al.,Phenotyping of transgenic cloned piglets.Cloning Stem Cells 2002; 4:131-145. Cong L,et al.,Multiplex genome engineering using CRISPR / Cas systems.Science 2013; 339:819-823. Christianson,W.T.et al.Experimental reproduction of swine infertility and respiratory syndrome in pregnant sows.American Journal of Veterinary Research 53,485-488 (1993). Christopher-Hennings,et al.,Effects of a modified-live virus vaccine against porcine reproductive and respiratory syndrome in boars,American J.Veterinary Research 58(1),40-45 (1997). Dai Y,et al.,Targeted disruption of the alpha1,3-galactosyltransferase gene in cloned pigs.Nat Biotechnol 2002; 20:251-255. Das PB,et al.,2009.The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163.J Virol.84:1731-40. Dee et al.,Elimination of porcine reproductive and respiratory syndrome virus using a test and removal process,The Veterinary Record 143,474-476 (1998). Delputte PL,et al.,2002.Involvement of the matrix protein in attachment of porcine reproductive and respiratory syndrome virus to a heparin-like receptor on porcine alveolar macrophages.J Virol.76:4312-4320. Etzerodt,A.,et al.,2013.Plasma clearance of hemoglobin and haptoglobin in mice and effect of CD163 gene targeting disruption.Antioxidants & redox signaling 18,2254-2263. Etzerodt,A.,et al.,2013.CD163 and inflammation:biological,diagnostic,and therapeutic aspects.Antioxidants & redox signaling 18,2352-2363. Fabriek BO,et al.,2005.The macrophage scavenger receptor CD163.Immunobiology.210:153-160. Fabriek BO,et al.,2009.The macrophage scavenger receptor CD163 functions as an innate immune sensor for bacteria.Blood.113:887-892. Gaj T,et al.,ZFN,TALEN,and CRISPR / Cas- based methods for genome engineering.Trends Biotechnol 2013; 31:397-405. Gaudreault N,et al.,2009.Factors affecting the permissiveness of porcine alveolar macrophages for porcine reproductive and respiratory syndrome virus.Archiv Virol.154:133-136. Graversen,J.H.,et al.,2012.Targeting the hemoglobin scavenger receptor CD163 in macrophages highly increases the anti-inflammatory potency of dexamethasone.Molecular therapy:the journal of the American Society of Gene Therapy 20,1550-1558. Groenen,M.A.,et al.,2012.Analyses of pig genomes provide insight into porcine demography and evolution.Nature 491,393-398. Hai T,et al.,One-step generation of knockout pigs by zygote injection of CRISPR / Cas system.Cell Res 2014; 24:372-375. Halbur,P.G.,et al.,1995.Comparison of the pathogenicity of two US porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus.Veterinary pathology 32,648-660. Halbur,P.& Bush,E.B.Update on abortion storms and sow mortality.Journal of Swine Health and Production 5,73 (1997). Hammer RE,et al.,Production of transgenic rabbits,sheep and pigs by microinjection.Nature 1985; 315:680-683. Hauschild J,et al.,Efficient generation of a biallelic knockout in pigs using zinc-finger nucleases.Proc Natl Acad Sci U S A 2011; 108:12013-12017. Holtkamp,D.J.,et al.,2013.Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers.Journal of Swine Health and Production 21,72-84. Hwang WY,et al.,Efficient genome editing in zebrafish using a CRISPR-Cas system.Nat Biotechnol 2013; 31:227-229. Jeney V,et al.,2002.Pro-oxidant and cytotoxic effects of circulating heme.Blood.100:879-887. Keffaber,K.K.,1989.Reproductive failure of unknown etiology.American Association of Swine Practitioners Newsletter 1,1-10. Key,K.F.et al.Genetic variation and phylogenetic analyses of the ORF5 gene of acute porcine reproductive and respiratory syndrome virus isolates.Veterinary Microbiology 83,249-263 (2001). Kim,H.S.,et al.,1993.Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line.Arch Virol 133,477-483. Kristiansen M,et al.,2001.Identification of the haemoglobin scavenger receptor.Nature.409:198-201. Kwon DN,et al.,Production of biallelic CMP-Neu5Ac hydroxylase knock-out pigs.Sci Rep 2013; 3:1981. Ladinig,A.,et al.,2015.Pathogenicity of three type 2 porcine reproductive and respiratory syndrome virus strains in experimentally inoculated pregnant gilts.Virus Res 203,24-35. Lai L,et al.,Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning.Science 2002; 295:1089-1092. Lai L,et al.,Creating genetically modified pigs by using nuclear transfer.Reprod Biol Endocrinol 2003; 1:82. Lai L,et al.,Production of cloned pigs by using somatic cells as donors.Cloning Stem Cells 2003; 5:233-241. Lawson SR,et al.,1997.Porcine reproductive and respiratory syndrome virus infection of gnotobiotic pigs:sites of virus replication and co-localization with MAC-387 staining at 21 days post-infection.Virus Res.51:105-113. Lee K,et al.,Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2 and accompanying severe combined immunodeficiency.Proc Natl Acad Sci U S A 2014; 111:7260-7265. Lee K,et al.,Piglets produced from cloned blastocysts cultured in vitro with GM-CSF.Mol Reprod Dev 2013; 80:145-154. Li D,et al.,Heritable gene targeting in the mouse and rat using a CRISPR-Cas system.Nat Biotechnol 2013; 31:681-683. Lillico SG,et al.,Live pigs produced from genome edited zygotes.Sci Rep 2013; 3:2847. Machaty Z,et al.,Complete activation of porcine oocytes induced by the sulfhydryl reagent,thimerosal.Biol Reprod 1997; 57:1123-1127. Madsen M,et al.,2004.Molecular characterization of the haptoglobin-hemoglobin receptor CD163.Ligand binding properties of the scavenger receptor cysteine-rich domain region.J Biol Chem.279:51561-51567. Mengeling,W.L.et al.Clinical consequences of exposing pregnant gilts to strains of porcine reproductive and respiratory syndrome (PRRS) virus isolated from field cases of “atypical” PRRS.American Journal of Veterinary Research.59,1540-1544 (1998). Merck,The Merck Veterinary Manual.http: / / www.merckmanuals.com / vet / appendixes / reference_guides / normal_rectal_temperature_ranges.html. Miao,Y.L.,et al.,2009.Centrosome abnormalities during porcine oocyte aging.Environmental and molecular mutagenesis 50,666-671. Morgan SB,et al.,2014.Pathology and Virus Distribution in the Lung and Lymphoid Tissues of Pigs Experimentally Inoculated with Three Distinct Type 1 PRRS Virus Isolates of Varying Pathogenicity.Transbound Emerg Dis.Nov 10.pp 1-11. Nelsen CJ,et al.,1999.Porcine reproductive and respiratory syndrome virus comparison:divergent evolution on two continents.J.Virol.73,270-280. Neumann EJ,et al.,Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States.J Am Vet Med Assoc 2005; 227:385-392. Niu Y,et al.,Generation of gene-modified Cynomolgus monkey via Cas9 / RNA-mediated gene targeting in one-cell embryos.Cell 2014; 156:836-843. Patience,J.F.,et al.,1989.Swine Nutrition Guide,in:Center,P.S.(Ed.),University of Saskatchewan,Saskatoon,CA,pp.149-171. Patton JP,et al.,2008.Modulation of CD163 receptor expression and replication of porcine reproductive and respiratory syndrome virus in porcine macrophages.Virus Res.140:161-171. Plagemann,P.G.W.Lactate dehydrogenase-elevating virus and related viruses.In Fields Virology,3rd Ed,Fields,B.ed.Lippincott- Raven,Philadelphia,pp 1105-1120 (1996). Prather RS,et al.,An intact sialoadhesin (Sn / SIGLEC1 / CD169) is not required for attachment / internalization of the porcine reproductive and respiratory syndrome virus.J Virol 2013; 87:9538-9546. Prather,R.S.,et al.,2013.An intact sialoadhesin (Sn / SIGLEC1 / CD169) is not required for attachment / internalization of the porcine reproductive and respiratory syndrome virus.J Virol 87,9538-9546. Provost C,et al.,2012.Identification of a new cell line permissive to porcine reproductive and respiratory syndrome virus infection and replication which is phenotypically distinct from MARC-145 cell line.Virol J.9:267. Reed JL,et al.,1938.A simple method of estimating fifty percent endpoints.The American Journal of Hygiene 27:493-497. Ross JW,et al.,Optimization of square-wave electroporation for transfection of porcine fetal fibroblasts.Transgenic Res 2010; 19:611-620. Rowland,R.R.R.,et al.,The evolution of porcine reproductive and respiratory syndrome virus:quasispecies and emergence of a virus subpopulation during infection of pigs with VR-2332,Virology 259,262-266 (1999). Rowland,R.R.R.et al.Lymphotropism of porcine reproductive and respiratory syndrome virus replication during persistent infection of pigs originally exposed to virus in utero.Veterinary Microbiology 96,219-235 (2003). Rowland,R.R.R.The interaction between PRRSV and the late gestation pig fetus.Virus Research 154,114-122 (2010). Rowland,R.R.,et al.,2012.Control of porcine reproductive and respiratory syndrome (PRRS) through genetic improvements in disease resistance and tolerance.Frontiers in genetics 3,260. Sanchez C,et al.,1999.The porcine 2A10 antigen is homologous to human CD163 and related to macrophage differentiation.Journal of Immunology 162:5230-5237. Sanchez-Torres C,et al.,2003.Expression of porcine CD163 on monocytes / macrophages correlates with permissiveness to African swine fever infection.Arch Virol.148:2307-2323. Schaer,C.A.,et al.,2006a.Constitutive endocytosis of CD163 mediates hemoglobin-heme uptake and determines the noninflammatory and protective transcriptional response of macrophages to hemoglobin.Circulation research 99,943-950. Schaer,D.J.,et al.,2006b.CD163 is the macrophage scavenger receptor for native and chemically modified hemoglobins in the absence of haptoglobin.Blood 107,373-380. Schaer,D.J.,et al.,2006c.Hemophagocytic macrophages constitute a major compartment of heme oxygenase expression in sepsis.European journal of haematology 77,432-436. Shanmukhappa,K,et al.,2007.Role of CD151,A tetraspanin,in porcine reproductive and respiratory syndrome virus infection.Virol J.4:62. Shimozawa N,et al.,Abnormalities in cloned mice are not transmitted to the progeny.Genesis 2002; 34:203-207. Shi,M.et al.Phylogeny-based evolutionary,demographical,and geographical dissection of North American type 2 porcine reproductive and respiratory syndrome viruses.Journal of Virology 84,8700-8711 (2010). Smit,AFA,et al.,RepeatMasker Open-3.0.1996-2010.Current Version:open-4.0.5 (RMLib:20140131 and Dfam:1.2).http: / / www.repeatmasker.org>.CD163:accessed July 25,2014; CD1D:accessed August 27,2013. Soares MP,et al.,2009.Heme oxygenase-1:from biology to therapeutic potential.Trends Mol Med.15:50-58. Stein M,et al.,1992.Interleukin 4 potently enhances murine macrophage mannose receptor activity:a marker of alternative immunologic macrophage activation.J Exp Med.176:287-292. Stephenson R,et al.,2015.Multiplex serology for common viral infections in feral pigs in Hawaii between 2007 and 2010.Accepted for publication.J Wildlife Dis 51:239-2343. Sulahian TH1,et al.,2002.2002.Human monocytes express CD163,which is upregulated by IL-10 and identical to p155.Cytokine.2000 12:1312-1321. Terns MP,et al.,CRISPR-based adaptive immune systems.Curr Opin Microbiol 2011; 14:321-327. Tian,K.et al.Emergence of fatal PRRSV variants:unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark.PLoS One.2,e526 (2007). Trible,B.R.,et al.,2012.Recognition of the different structural forms of the capsid protein determines the outcome following infection with porcine circovirus type 2.J Virol 86,13508-13514. U.S.Department of Agriculture and U.S.Department of Health and Human Services.Dietary Guidelines for Americans,2010.7th Edition, Van Breedam W,et al.,Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage.J Gen Virol 2010; 91:1659-1667. Van Breedam,W.,et al.,2010.Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage.J Gen Virol 91,1659-1667. Van den Heuvel MM,et al.,1999.Regulation of CD 163 on human macrophages:cross-linking of CD163 induces signaling and activation.J Leukoc Biol.66:858-866. van den Hoff MJ,et al.,Electroporation in ’intracellular’ buffer increases cell survival.Nucleic Acids Res 1992; 20:2902. Van Gorp,H.,et al.,2010.Scavenger receptor CD163,a Jack-of-all-trades and potential target for cell-directed therapy.Mol Immunol 47,1650-1660. Van Gorp H,et al.,2010.Identification of the CD163 protein domains involved in infection of the porcine reproductive and respiratory syndrome virus.J Virol.84:3101-3105. Walters EM,et al.,Advancing swine models for human health and diseases.Mo Med 2013; 110:212-215. Wang H,et al.,One-step generation of mice carrying mutations in multiple genes by CRISPR / Cas-mediated genome engineering.Cell 2013; 153:910-918. Welch SK,et al.,2010.A brief review of CD163 and its role in PRRSV infection.Virus Res.154:98-103. Wells,K.D.,et al.,2014.Use of the CRISPR / Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos.Biol Reprod 91,78. Wells,K.D.et al.Substitution of porcine CD163 SRCR domain 5 with a CD163-like homolog confers resistance of pigs to genotype1 but not genotype 2 porcine reproductive and respiratory syndrome (PRRS) viruses.Journal of Virology In press (2017). Wensvoort,G.,et al.,1991.Mystery swine disease in The Netherlands:the isolation of Lelystad virus.Veterinary Quarterly 13,121-130. Whitworth KM,et al.,2016.CD163 facilitates both entry and replication of porcine reproductive and respiratory syndrome virus.Nature Biotech.34:20-22. Whitworth KM,et al.,Method of oocyte activation affects cloning efficiency in pigs.Mol Reprod Dev 2009;76:490-500. Whitworth et al.Use of the CRISPR / Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos,Biology of Reproduction 91(3):1-13 (2014). Whitworth KM,et al.,Activation method does not alter abnormal placental gene expression and development in cloned pigs.Mol Reprod Dev 2010; 77:1016-1030. Whitworth KM,et al.,Scriptaid corrects gene expression of a few aberrantly reprogrammed transcripts in nuclear transfer pig blastocyst stage embryos.Cell Reprogram 2011; 13:191-204. Whitworth,K.M.,et al.,2014.Use of the CRISPR / Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos.Biol Reprod 91,78. Whyte JJ,et al.,Genetic modifications of pigs for medicine and agriculture.Mol Reprod Dev 2011; 78:879-891. Whyte JJ,et al.,Gene targeting with zinc finger nucleases to produce cloned eGFP knockout pigs.Mol Reprod Dev 2011; 78:2. Wiedenheft B,et al.,RNA-guided genetic silencing systems in bacteria and archaea.Nature 2012; 482:331-338. Wilkinson et al.Genome-wide analysis of the transcriptional response to porcine reproductive and respiratory syndrome virus infection at the maternal / fetal interface and in the fetus.BMC Genomics 17,383 (2016). Whitworth,K.M.et al.Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus.Nature Biotechnology 34,20-22 (2016). Winckler,C.,et al.,2001.The reliability and repeatability of a lameness scoring system for use as an indicator of welfare in dairy cattle.Acta Agricultura Scandinavica Section A.Animal Science,103-107. Yang D,et al.,Generation of PPARgamma mono-allelic knockout pigs via zinc-finger nucleases and nuclear transfer cloning.Cell Res 2011; 21:979-982. Yoshioka K,et al.,Birth of piglets derived from porcine zygotes cultured in a chemically defined medium.Biol Reprod 2002; 66:112-119. Zhang Q,et al.,2015.PRRS virus receptors and their role for pathogenesis.Vet Microbiol.177:229-241. Zhao J,et al.,Histone deacetylase inhibitors improve in vitro and in vivo developmental competence of somatic cell nuclear transfer porcine embryos.Cell Reprogram 2010; 12:75-83. Zhao J,et al.,Significant improvement in cloning efficiency of an inbred miniature pig by histone deacetylase inhibitor treatment after somatic cell nuclear transfer.Biol Reprod 2009; 81:525-530.
Table 19-1
Table 19-2
Claims
1. 1. A method for protecting fetal pigs in utero from infection with porcine reproductive and respiratory syndrome virus (PRRSV), said method comprising: using a homing endonuclease selected from a clustered regularly interspaced short palindromic repeats (CRISPR) system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or any combination thereof, to genetically edit the sow animal to introduce modified chromosomal sequences into both alleles of the CD163 gene, wherein said modified chromosomal sequences reduce the susceptibility of the sow animal to PRRSV infection compared to the susceptibility of a sow animal that does not comprise any modified chromosomal sequences in said alleles of its CD163 gene; wherein at least one of said alleles of said CD163 gene of said sow animal is a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 compared to reference SEQ ID NO:47 on the same allele, together with an insertion of the dinucleotide AG between nucleotides 3,149 and 3,150 compared to reference SEQ ID NO:47; a single adenine residue insertion between nucleotides 3,147 and 3,148 compared to reference SEQ ID NO: 47; a 1,506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to reference SEQ ID NO: 47; a 7 base pair insertion of TACTACT (SEQ ID NO: 115) between nucleotides 3,148 and 3,149 compared to reference SEQ ID NO: 47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to reference SEQ ID NO: 47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to reference SEQ ID NO: 47; a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 compared to reference SEQ ID NO: 47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to reference SEQ ID NO:47 (the deleted sequence is replaced with a 12 base pair insertion starting at nucleotide 488, with an additional 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to reference SEQ ID NO:47); a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172 compared to reference SEQ ID NO: 47; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531 compared to reference SEQ ID NO: 47; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 compared to reference SEQ ID NO:47 (the deleted sequence is replaced with an 11 base pair insertion of AGCCAGCGTGC (SEQ ID NO:117) beginning at nucleotide 3,113); a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 compared to reference SEQ ID NO: 47; a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466 compared to reference SEQ ID NO: 47; and any combination thereof; artificially inseminating said sow animal with sperm obtained from a boar animal comprising at least one wild-type CD163 allele, or producing fertilized oocytes by in vitro fertilization, and transferring said fertilized oocytes into the reproductive tract of said sow animal; and Producing a pig fetus comprising at least one wild-type CD163 allele, wherein the pig fetus is protected from PRRSV infection in utero. A method comprising:
2. The method described in claim 1, wherein the in vitro fertilization comprises in vitro fertilization of the oocyte using sperm obtained from a boar animal containing at least one wild-type CD163 allele.
3. The method described in claim 1, wherein the in vitro fertilization comprises intracytoplasmic injection of pig oocytes with sperm obtained from a boar animal containing at least one wild-type CD163 allele.
4. The method described in claim 1, wherein the fertilized oocyte contains a modified chromosomal sequence in only one allele of its CD163 gene.
5. The method described in claim 1, wherein the fertilized oocyte contains modified chromosomal sequences in both alleles of its CD163 gene.
6. The method described in claim 1, wherein the fertilized oocyte does not contain any modified chromosomal sequence in its CD163 gene allele.