Polypeptide having 4-aminobenzoic acid hydroxylation activity and use thereof
Patent Information
- Application Number
- JP2022117492
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2022-07-22
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2042-07-22
AI Technical Summary
Existing methods for producing 4-amino-3-hydroxybenzoic acid have limited efficiency due to the low hydroxylation activity of known 4-hydroxybenzoic acid hydroxylases, hindering the effective use of renewable resources for producing polybenzoxazole monomers.
Development of a mutant 4-hydroxybenzoic acid hydroxylase with specific amino acid sequence modifications, such as substitutions at positions 47, 106, 201, 222, and 294, significantly enhancing the 4-aminobenzoic acid hydroxylation activity, which is used to produce 4-amino-3-hydroxybenzoic acid through microbial fermentation.
The mutant hydroxylase exhibits superior 4-aminobenzoic acid hydroxylation activity, enabling efficient conversion to 4-amino-3-hydroxybenzoic acid, thereby improving the production yield and efficiency in microbial fermentation processes.
Smart Images
Figure 2024014569000001 
Figure 2024014569000002
Abstract
Description
[Technical field]
[0001] The present invention relates to a polypeptide having 4-aminobenzoic acid hydroxylating activity and use thereof. [Background technology]
[0002] Polybenzoxazole (PBO) is known as an engineering plastic with excellent heat resistance and mechanical strength, and is used for textile materials and insulating films of semiconductor elements (Non-Patent Document 1).
[0003] The benzoxazole skeleton is produced by condensation of an o-aminophenol skeleton with a carboxylic acid. Therefore, 4-amino-3-hydroxybenzoic acids (4,3-AHBA) containing these functional groups in the molecule are expected to be useful as PBO monomers. In fact, the synthesis and property evaluation of polybenzoxazole using 4,3-AHBA have been investigated (Non-Patent Document 2).
[0004] In recent years, methods for producing compounds by microbial fermentation using renewable resources as raw materials have been attracting attention in order to reduce the burden on the global environment, etc. For example, the microbial production and polymerization of 3-amino-4-hydroxybenzoic acid (3,4-AHBA), which has a structure similar to 4,3-AHBA, has been investigated (Patent Document 1).
[0005] Known methods for producing 4,3-AHBA include chemical synthesis through reduction of nitroaromatics (Patent Document 2). One possible method for enabling fermentative production of 4,3-AHBA by a microbial method is to hydroxylate the 3-position of 4-aminobenzoic acid (4-ABA), which can be biosynthesized in microorganisms, but it has only been reported that some 4-hydroxybenzoate hydroxylases have slight activity in this reaction (Non-Patent Documents 3 and 4).
[0006] Under these circumstances, the applicant has discovered a specific 4-hydroxybenzoate hydroxylase (HFM122) having 4-aminobenzoate hydroxylation activity, and a mutant of said enzyme having high 4-aminobenzoate hydroxylation activity, and has already filed patent applications (Patent Documents 3 to 7). [Prior art documents] [Patent documents]
[0007] [Patent Document 1] Patent No. 5445453 [Patent Document 2] Patent No. 3821350 [Patent Document 3] JP 2020-39330 A [Patent Document 4] Patent Publication No. 2021-73914 [Patent Document 5] JP 2021-101626 A [Patent Document 6] Patent Publication No. 2021-101627 [Patent Document 7] Patent Publication No. 2022-47939 [Non-patent literature]
[0008] [Non-Patent Document 1] Hirotaka Murase, SENI GAKKAISHI (Textiles and Industry), Vol.66, No.6 (2010) [Non-Patent Document 2] Lon J. Mathias et al., Macromolecules, Vol.18, No.4, pp.616-622 (1985) [Non-Patent Document 3] Barrie Entsch et al., The Journal of Biological Chemistry, Vol.262, No.13, pp.6060-6068 (1987) [Non-Patent Document 4] Domenico L. Gatti et al., Biochemistry, Vol.35, No.2, pp.567-578 (1996) Summary of the Invention [Problem to be solved by the invention]
[0009] The present invention relates to providing a polypeptide having excellent 4-aminobenzoic acid hydroxylating activity and a method for using the same. [Means for solving the problem]
[0010] The present inventors have found that mutants of 4-hydroxybenzoate hydroxylase having specific amino acid sequences have significantly superior 4-aminobenzoate hydroxylating activity and are useful for producing 4-amino-3-hydroxybenzoic acids.
[0011] That is, the present invention relates to the following 1) to 7). 1) A polypeptide having 4-aminobenzoate hydroxylating activity, in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 are as follows; or in which the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 are as follows in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2: (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine 2) A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylating activity, comprising substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of SEQ ID NO:2 with the amino acids listed below; or, in a polypeptide having an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:2 and having 4-aminobenzoic acid hydroxylating activity, substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of SEQ ID NO:2 with the amino acids listed below. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine 3) A method for improving 4-aminobenzoic acid hydroxylating activity, comprising substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 with the amino acids listed below; or, in a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 and having 4-aminobenzoic acid hydroxylating activity, substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 with the amino acids listed below. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine 4) A polynucleotide encoding the polypeptide of 1). 5) A vector or DNA fragment containing the polynucleotide of 4). 6) A transformed cell containing the vector or DNA fragment of 5). 7) A method for producing 4-amino-3-hydroxybenzoic acids, comprising a step of culturing the transformed cell of 6). Effect of the Invention
[0012] The polypeptide having 4-aminobenzoic acid hydroxylating activity of the present invention has remarkably excellent 4-aminobenzoic acid hydroxylating activity, and therefore, by using it, 4-amino-3-hydroxybenzoic acids can be efficiently produced from 4-aminobenzoic acids. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0013] In the present specification, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing an analysis using the search homology program of the genetic information processing software GENETYX Ver. 12 with the unit size to compare (ktup) set to 2.
[0014] In the present specification, the "corresponding position" on an amino acid sequence or a nucleotide sequence can be determined by aligning a target sequence with a reference sequence (e.g., the amino acid sequence shown in SEQ ID NO: 2) so as to give maximum homology. Alignment of amino acid sequences or nucleotide sequences can be performed using known algorithms, and the procedures are known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple alignment program (Thompson, J. D. et al., 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Alternatively, Clustal W2 or Clustal omega, which are revised versions of Clustal W, can be used. Clustal W, Clustal W2 and Clustal omega are available, for example, on the Clustal website operated by University College Dublin [www.clustal.org], the European Bioinformatics Institute (EBI [www.ebi.ac.uk / index.html]), and the website of the DNA Data Bank of Japan operated by the National Institute of Genetics (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]). The position of the target sequence aligned to any position of the reference sequence by the above-mentioned alignment is considered to be a "position corresponding to" the any position.
[0015] Those skilled in the art can further fine-tune the alignment of the amino acid sequences obtained above to optimize it. Such an optimal alignment is preferably determined taking into consideration the similarity of the amino acid sequences, the frequency of gaps to be inserted, and the like. Here, the similarity of the amino acid sequences refers to the ratio (%) of the number of positions at which identical or similar amino acid residues exist in both sequences when the two amino acid sequences are aligned to the total number of amino acid residues. The similar amino acid residues refer to amino acid residues that have similar properties in terms of polarity and charge among the 20 types of amino acids that constitute proteins, and that cause so-called conservative substitution. Such groups of similar amino acid residues are well known to those skilled in the art, and examples thereof include, but are not limited to, arginine and lysine or glutamine; glutamic acid and aspartic acid or glutamine; serine and threonine or alanine; glutamine and asparagine or arginine; leucine and isoleucine.
[0016] As used herein, the term "amino acid residue" refers to the 20 types of amino acid residues constituting proteins: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).
[0017] As used herein, the term "operably linked" between a control region such as a promoter and a gene means that the gene and the control region are linked in such a way that the gene can be expressed under the control of the control region. Procedures for "operably linked" between a gene and a control region are well known to those skilled in the art.
[0018] In this specification, "upstream" and "downstream" of a gene refer to the upstream and downstream of the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is present on the 3' side of the promoter in the DNA sense strand, and "upstream" of a gene means the 5' region of the gene in the DNA sense strand.
[0019] As used herein, the term "native" when referring to a function, property, or trait of a cell is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "exogenous" is used to indicate a function, property, or trait that is not inherently present in the cell, but is introduced from the outside. For example, an "exogenous" gene or polynucleotide is a gene or polynucleotide that is introduced into a cell from the outside. An exogenous gene or polynucleotide may be derived from the same organism as the cell into which it is introduced, or from a different organism (i.e., a heterologous gene or polynucleotide).
[0020] <Polypeptides with 4-aminobenzoic acid hydroxylation activity> The polypeptide of the present invention having 4-aminobenzoic acid hydroxylating activity (referred to as "polypeptide of the present invention") is a polypeptide in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO:2 are as follows; or in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO:2 are as follows in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:2: (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine Such polypeptides are mutant polypeptides having 4-aminobenzoate hydroxylating activity, in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence of a reference polypeptide, i.e., a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, are substituted with the amino acids (a) to (e) above; or in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence of SEQ ID NO: 2, which is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, are substituted with the amino acids (a) to (e) above.
[0021] Preferred polypeptides of the present invention are those in which, in the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 90% identity thereto, the amino acid residue at position 47 or a corresponding position in the amino acid sequence shown in SEQ ID NO:2 is leucine and the amino acid residue at position 106 or a corresponding position is alanine, the amino acid residue at position 106 or a corresponding position is alanine and the amino acid residue at position 201 or a corresponding position is phenylalanine, or the amino acid residue at position 106 or a corresponding position is alanine and the amino acid residue at position 294 or a corresponding position is serine.
[0022] In the present invention, the term "4-aminobenzoic acid hydroxylation activity" means the activity of catalyzing the hydroxylation of 4-aminobenzoic acids, preferably the activity of catalyzing the hydroxylation at the 3-position of 4-aminobenzoic acids. The 4-aminobenzoic acid hydroxylation activity can be determined by culturing a microorganism that produces the polypeptide of the present invention and measuring the amount of 4-amino-3-hydroxybenzoic acid produced by HPLC or the like, as shown in the Examples below.
[0023] Such a polypeptide of the present invention can be produced by substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2 with the amino acids listed below; or by substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of SEQ ID NO:2 with the amino acids listed below in a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:2 and having 4-aminobenzoic acid hydroxylating activity. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine Here, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity is the "parent" polypeptide of the polypeptide of the present invention. A "parent" polypeptide refers to a reference polypeptide in which certain amino acid residues are made to result in a polypeptide of the invention.
[0024] In the present invention, HFM122, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 (NCBI Reference Sequence: WP_010920262.1), is known as 4-hydroxybenzoate-3-monooxygenase (EC1.14.13.2). 4-Hydroxybenzoate-3-monooxygenase is an enzyme having catalytic activity to promote either or both of a reaction in which the 3-position of 4-hydroxybenzoic acid is hydroxylated to produce protocatechuic acid and a reverse reaction, and is a type of enzyme (4-hydroxybenzoate hydroxylase) that catalyzes the hydroxylation of 4-hydroxybenzoic acids. The present applicant has found that such HFM122 has 4-aminobenzoic acid hydroxylation activity (Patent Document 3 mentioned above), and has also found that polypeptides in which any of the amino acid residues at positions 47, 106, 201, 222, and 294 of HFM122 have been substituted with specific amino acids have high 4-aminobenzoic acid hydroxylation activity (Patent Documents 4 to 7 mentioned above).
[0025] An example of a polypeptide having 4-aminobenzoic acid hydroxylation activity and consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is a polypeptide having 4-aminobenzoic acid hydroxylation activity and consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, specifically, 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.
[0026] The parent polypeptide preferably has a valine residue at position 47 or a corresponding position of the amino acid sequence shown in SEQ ID NO:2, preferably has a methionine residue at position 106 or a corresponding position, preferably has a tyrosine residue at position 201 or a corresponding position, preferably has a tyrosine residue at position 222 or a corresponding position, preferably has a threonine residue at position 294 or a corresponding position, preferably has a valine residue at position 47 or a corresponding position and a methionine residue at position 106 or a corresponding position, a valine residue at position 47 or a corresponding position and a tyrosine residue at position 201 or a corresponding position, a valine residue at position 47 or a corresponding position and a threonine residue at position 294 or a corresponding position those having a tyrosine residue at or corresponding to position 47; those having a valine residue at or corresponding to position 47 and a threonine residue at or corresponding to position 294; those having a methionine residue at or corresponding to position 106 and a tyrosine residue at or corresponding to position 201; those having a methionine residue at or corresponding to position 106 and a threonine residue at or corresponding to position 294 are more preferred; and those having a valine residue at or corresponding to position 47, a methionine residue at or corresponding to position 106, a tyrosine residue at or corresponding to position 201, a tyrosine residue at or corresponding to position 222 and a threonine residue at or corresponding to position 294 are even more preferred.The polypeptide of the present invention includes a polypeptide in which valine at position 47 or a corresponding position is replaced with leucine and methionine at position 106 or a corresponding position is replaced with alanine, a polypeptide in which valine at position 47 or a corresponding position is replaced with leucine and tyrosine at position 201 or a corresponding position is replaced with phenylalanine, a polypeptide in which valine at position 47 or a corresponding position is replaced with leucine and tyrosine at position 222 or a corresponding position is replaced with phenylalanine, a polypeptide in which valine at position 47 or a corresponding position is replaced with leucine and threonine at position 294 or a corresponding position is replaced with serine, a polypeptide in which methionine at position 106 or a corresponding position is replaced with alanine and tyrosine at position 201 or a corresponding position is replaced with phenylalanine, or a corresponding position, wherein the tyrosine at position 106 is replaced with alanine, and the threonine at position 294 is replaced with serine. More preferred are: a valine at position 47 or a corresponding position replaced with leucine and the methionine at position 106 or a corresponding position replaced with alanine; a methionine at position 106 or a corresponding position replaced with alanine and the tyrosine at position 201 or a corresponding position replaced with phenylalanine; and a methionine at position 106 or a corresponding position replaced with alanine and the threonine at position 294 or a corresponding position replaced with serine.
[0027] <Polynucleotide encoding the polypeptide of the present invention> In the present invention, various mutagenesis techniques known in the art can be used as a means for mutating amino acid residues in a parent polypeptide. For example, a polynucleotide encoding the polypeptide of the present invention can be obtained by mutating a nucleotide sequence encoding an amino acid residue to be mutated in a polynucleotide encoding the amino acid sequence of a parent polypeptide (hereinafter also referred to as a parent gene) to a nucleotide sequence encoding the amino acid residue after the mutation.
[0028] The introduction of a desired mutation into a parent gene can basically be carried out using various site-directed mutagenesis methods well known to those skilled in the art. Site-directed mutagenesis can be carried out by any method, such as inverse PCR or annealing. Commercially available site-directed mutagenesis kits (e.g., QuikChange II Site-Directed Mutagenesis Kit and QuikChange Multi Site-Directed Mutagenesis Kit, both from Agilent Technologies) can also be used.
[0029] Site-specific mutagenesis of a parent gene can be most commonly performed using a mutagenesis primer containing the nucleotide mutation to be introduced. The mutagenesis primer can be designed to anneal to a region containing a nucleotide sequence encoding the amino acid residue to be mutated in the parent gene, and to contain a nucleotide sequence having a nucleotide sequence (codon) encoding the mutated amino acid residue instead of the nucleotide sequence (codon) encoding the amino acid residue to be mutated. Those skilled in the art can appropriately recognize and select the nucleotide sequences (codons) encoding the amino acid residues before and after the mutation based on ordinary textbooks, etc. Alternatively, site-specific mutagenesis can be performed by a method in which DNA fragments obtained by amplifying the upstream and downstream sides of the mutation site using two complementary primers containing the nucleotide mutation to be introduced separately are linked together by SOE (splicing by overlap extension)-PCR (Gene, 1989, 77(1): p61-68).
[0030] The template DNA containing the parent gene can be prepared by extracting genomic DNA from the above-mentioned microorganism producing 4-hydroxybenzoate hydroxylase by a conventional method, or by extracting RNA and synthesizing cDNA by reverse transcription. Alternatively, a corresponding nucleotide sequence may be chemically synthesized based on the amino acid sequence of the parent polypeptide and used as the template DNA. The DNA sequence containing the base sequence encoding HFM122, which has already been described as a polypeptide having 4-aminobenzoate hydroxylation activity, is shown in SEQ ID NO:1.
[0031] The mutation primer can be prepared by a well-known oligonucleotide synthesis method such as the phosphoramidite method (Nucleic Acids Research, 1989, 17:7059-7071). Such primer synthesis can also be performed using, for example, a commercially available oligonucleotide synthesizer (such as that manufactured by ABI). A primer set including the mutation primer is used to perform site-specific mutagenesis as described above using a parent gene as a template DNA, thereby obtaining a polynucleotide encoding the polypeptide of the present invention having the desired mutation.
[0032] The polynucleotide encoding the polypeptide of the present invention may comprise single-stranded or double-stranded DNA, cDNA, RNA or other artificial nucleic acid. The DNA, cDNA and RNA may be chemically synthesized. The polynucleotide may comprise a nucleotide sequence of an untranslated region (UTR) in addition to an open reading frame (ORF). The polynucleotide may be codon-optimized according to the species of the transformant used to produce the mutant polypeptide of the present invention. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).
[0033] <Vector or DNA fragment> The obtained polynucleotide encoding the polypeptide of the present invention can be incorporated into a vector. The vector containing the polynucleotide is an expression vector. Also preferably, the vector is an expression vector capable of introducing the polynucleotide encoding the polypeptide of the present invention into a host microorganism and expressing the polynucleotide in the host microorganism. Preferably, the vector comprises the polynucleotide encoding the polypeptide of the present invention and a control region operably linked thereto. The vector may be a vector capable of autonomously replicating and replicating outside a chromosome, such as a plasmid, or may be a vector that is integrated into a chromosome.
[0034] Specific examples of vectors include pBluescript II SK(-) (Agilent Technologies), pUC vectors such as pUC18 / 19 and pUC118 / 119 (Takara Bio), pET vectors (Merck), pGEX vectors (Merck), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2):93-103), pBR322 (Takara Bio), pMW218 / 219 (Nippon Gene), pRI vectors such as pRI909 / 910 (Takara Bio), pBI vectors (Clontech), IN3 vectors (Implanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al., 2011). al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr225 (CDSkory et al., Mol Genet Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), and the like.
[0035] The polynucleotide encoding the polypeptide of the present invention may be constructed as a DNA fragment containing the polynucleotide. Examples of the DNA fragment include a PCR-amplified DNA fragment and a restriction enzyme-cleaved DNA fragment. Preferably, the DNA fragment may be an expression cassette containing the polynucleotide encoding the polypeptide of the present invention and a control region operably linked thereto.
[0036] The control region contained in the vector or DNA fragment is a sequence for expressing a polynucleotide encoding the polypeptide of the present invention in a host cell into which the vector or DNA fragment has been introduced, and examples of such control regions include expression regulatory regions such as promoters and terminators, and replication origins. The type of control region can be appropriately selected depending on the type of host microorganism into which the vector or DNA fragment is introduced. If necessary, the vector or DNA fragment may further have a selection marker such as an antibiotic resistance gene or an amino acid synthesis-related gene (e.g., resistance genes for drugs such as ampicillin, neomycin, kanamycin, and chloramphenicol). The vector or DNA fragment may contain a polynucleotide sequence encoding a polypeptide required for the biosynthesis of 4-aminobenzoic acids, such as 4-amino-4-deoxychorismate synthase (pabAB) or 4-amino-4-deoxychorismate lyase (pabC).
[0037] The polynucleotide encoding the polypeptide of the present invention can be linked to the above-mentioned control region or marker gene sequence by the above-mentioned SOE-PCR method, seamless cloning method, or the like. The procedure for introducing a gene sequence into a vector is well known in the art. The types of control regions such as promoter regions, terminators, and secretion signal regions are not particularly limited, and promoters and secretion signal sequences that are commonly used can be appropriately selected and used depending on the host to be introduced.
[0038] Suitable examples of the control region include strong control regions that can enhance expression compared to the wild type, such as known high expression promoters such as the T7 promoter, lac promoter, tac promoter, trp promoter, gap promoter, and tuf promoter, but are not particularly limited to these.
[0039] <Transformed cells> The transformed cell of the present invention can be obtained by introducing a vector containing a polynucleotide encoding the polypeptide of the present invention into a host, or by introducing a DNA fragment containing a polynucleotide encoding the polypeptide of the present invention into the genome of the host. Such transformed cells are cells into which a polynucleotide encoding the polypeptide of the present invention has been introduced so as to be expressible, and can be said to be cells in which expression of the polynucleotide has been enhanced, and ultimately cells in which expression of the polypeptide of the present invention has been enhanced.
[0040] As the host cell, any of fungi, yeast, actinomycetes, Escherichia coli, Bacillus subtilis, etc. may be used, but Escherichia coli and actinomycetes are preferred. Examples of actinomycetes include bacteria of the genus Corynebacterium, Mycobacterium, Rhodococcus, Streptomyces, and Propionibacterium, and are preferably bacteria of the genus Corynebacterium, and more preferably Corynebacterium glutamicum. Among them, a microorganism capable of supplying 4-aminobenzoic acids serving as a substrate for the biosynthesis of 4-amino-3-hydroxybenzoic acids is preferred, and a microorganism having enhanced ability to supply 4-aminobenzoic acids is more preferred. Examples of methods for enhancing the ability of a microorganism to supply 4-aminobenzoic acids include a method of introducing a vector containing a polynucleotide encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acids and a control region operably linked thereto into a microorganism, and a method of replacing the control region of an endogenous polynucleotide encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acids inherent to the microorganism with a strong expression promoter.
[0041] Methods for introducing a vector or a DNA fragment into a host include, for example, electroporation, transformation, transfection, conjugation, protoplast, particle gun, and Agrobacterium methods.
[0042] Furthermore, the method of introducing a polynucleotide into the genome of a host is not particularly limited, and examples thereof include a double crossover method using a DNA fragment containing the polynucleotide. The DNA fragment may be introduced downstream of the promoter sequence of a gene that is highly expressed in the host cell described above, or a fragment in which the DNA fragment and the above-mentioned control region are operably linked in advance may be prepared, and the linked fragment may be introduced into the genome of the host. Furthermore, the DNA fragment may be linked in advance to a marker (such as a drug resistance gene or an auxotrophy complementing gene) for selecting a cell into which the polynucleotide of the present invention has been appropriately introduced.
[0043] A transformant into which a vector or DNA fragment of interest has been introduced can be selected using a selection marker. For example, when the selection marker is an antibiotic resistance gene, the transformant into which a vector or DNA fragment of interest has been introduced can be selected by culturing the transformant in a medium containing the antibiotic. For example, when the selection marker is an amino acid synthesis-related gene, the transformant into which a vector or DNA fragment of interest has been introduced can be selected using the presence or absence of the amino acid requirement as an indicator after gene introduction into a host microorganism that requires the amino acid. Alternatively, the introduction of a vector or DNA fragment of interest can be confirmed by examining the DNA sequence of the transformant by PCR or the like.
[0044] When the transformed cells thus obtained are cultured in an appropriate medium, the polynucleotide introduced into the cells is expressed, and the polypeptide of the present invention is produced. That is, the transformed cells can become a polypeptide-producing bacterium having 4-aminobenzoic acid hydroxylation activity. As shown in the examples described below, when the transformed cells of the present invention are cultured, the productivity of 4-amino-3-hydroxybenzoic acid is significantly improved compared to when a transformed cell producing a parent polypeptide is used. The polypeptide of the present invention is composed of an amino acid sequence in which two specific amino acid residues in the amino acid sequence of the parent polypeptide are predetermined amino acids. When the transformed cells of the present invention are cultured, the productivity of 4-amino-3-hydroxybenzoic acid is significantly improved compared to when a transformed cell producing a polypeptide in which only one of the two specific amino acid residues in the amino acid sequence of the parent polypeptide is a predetermined amino acid, and the improvement rate is even higher than the productivity improvement rate expected from the latter polypeptide. That is, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, mutations in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are replaced with the amino acids listed below; or in a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 and having 4-aminobenzoic acid hydroxylating activity, mutations in which the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in SEQ ID NO: 2 are replaced with the amino acids listed below, are useful for synergistically improving 4-aminobenzoic acid hydroxylating activity and, ultimately, for synergistically improving productivity of 4-amino-3-hydroxybenzoic acids. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine The transformed cell of the present invention is a bacterium capable of producing a polypeptide having significantly improved 4-aminobenzoic acid hydroxylation activity, and is a useful strain capable of producing 4-amino-3-hydroxybenzoic acids.
[0045] <Production of 4-amino-3-hydroxybenzoic acids> The method for producing 4-amino-3-hydroxybenzoic acids of the present invention includes a step of culturing the transformed cell of the present invention, and 4-amino-3-hydroxybenzoic acids can be obtained by recovering the 4-amino-3-hydroxybenzoic acids from the medium. In the present invention, the 4-amino-3-hydroxybenzoic acid is specifically represented by the following general formula (1):
[0046] [ka]
[0047] [In the formula, R 1 indicates a hydrogen atom, a hydroxyl group (-OH), a methoxy group (-OCH3), an amino group (-NH2), a fluorine atom (-F), a chlorine atom (-Cl), a bromine atom (-Br), an iodine atom (-I), a carboxyl group (-COOH), a methyl group (-CH3), or an ethyl group (-CH2CH3), and R 2 represents a hydrogen atom, a hydroxyl group (-OH), a methoxy group (-OCH3), an amino group (-NH2), a fluorine atom (-F), a chlorine atom (-Cl), a bromine atom (-Br), an iodine atom (-I), a carboxyl group (-COOH), a methyl group (-CH3) or an ethyl group (-CH2CH3), and X 1 and X 2 represents a hydrogen atom or a hydroxy group, and at least one of them represents a hydroxy group. Examples of such 4-amino-3-hydroxybenzoic acid derivatives include those represented by the following formula:
[0048] R 1 The functional group represented by the formula (I) is preferably a hydrogen atom, a hydroxy group (-OH), a methoxy group (-OCH3), a fluorine atom (-F) or a methyl group (-CH3). R 2 The functional group represented by the formula (I) is preferably a hydrogen atom, a hydroxy group (-OH), a methoxy group (-OCH3), a fluorine atom (-F) or a methyl group (-CH3). R 1 and R 2 More preferably, both are hydrogen atoms. Also, X 1 and X 2 may be hydroxy groups, but X 1 Or X 2 It is preferable that one of them is a hydroxy group.
[0049] If necessary, 4-aminobenzoic acids, which serve as substrates for the biosynthesis of 4-amino-3-hydroxybenzoic acids, can be present in the medium. Here, the 4-aminobenzoic acids include those represented by the following general formula (2):
[0050] [ka]
[0051] [In the formula, R 1 and R 2 indicates the same as above. Examples of such 4-aminobenzoic acid derivatives include those represented by the following formula:
[0052] The medium for culturing the transformed cells may be either a natural medium or a synthetic medium, as long as it contains a carbon source, a nitrogen source, inorganic salts, etc., and can efficiently culture the transformed cells of the present invention. Examples of the carbon source that can be used include sugars such as glucose, polyols such as glycerin, alcohols such as ethanol, and organic acids such as pyruvic acid, succinic acid, and citric acid. Examples of the nitrogen source that can be used include peptone, meat extract, yeast extract, casein hydrolysate, alkaline extract of soybean meal, alkylamines such as methylamine, and ammonia or a salt thereof. In addition, salts such as phosphates, carbonates, sulfates, magnesium, calcium, potassium, iron, manganese, and zinc, specific amino acids, specific vitamins, and antifoaming agents may also be used as necessary.
[0053] The culture can usually be performed at 10° C. to 40° C. for 6 to 96 hours, preferably 24 to 96 hours, and more preferably 48 to 96 hours, with stirring or shaking as necessary. During the culture, antibiotics such as ampicillin and kanamycin may be added to the medium as necessary.
[0054] The method for recovering and purifying 4-amino-3-hydroxybenzoic acids from the culture is not particularly limited. That is, it can be carried out by combining well-known ion exchange resin methods, precipitation methods, crystallization methods, recrystallization methods, concentration methods, and other methods. For example, after removing the bacterial cells by centrifugation or the like, ionic substances are removed with cation and anion exchange resins, and the mixture is concentrated to obtain 4-amino-3-hydroxybenzoic acids. The 4-amino-3-hydroxybenzoic acids accumulated in the culture may be used as they are without isolation.
[0055] The present invention also includes the following substances, manufacturing methods, uses, methods, etc. as exemplary embodiments, but the present invention is not limited to these embodiments. <1> A polypeptide having 4-aminobenzoate hydroxylating activity, wherein the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 are as follows; or wherein the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 are as follows in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2: (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine <2> A polypeptide having 4-aminobenzoate hydroxylating activity, in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 are substituted with the amino acids listed below, or in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence shown in SEQ ID NO: 2 have been substituted with the amino acids listed below in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine <3> the substitution of amino acid residues is a substitution of valine at position 47 or a corresponding position with leucine and a substitution of methionine at position 106 or a corresponding position with alanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 222 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of threonine at position 294 or a corresponding position with serine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of threonine at position 294 or a corresponding position with serine, <2> Polypeptides. <4> A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylating activity, comprising substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of SEQ ID NO: 2 with the amino acids listed below; or substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of SEQ ID NO: 2 with the amino acids listed below in a polypeptide having an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 2 and having 4-aminobenzoic acid hydroxylating activity. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine <5> the substitution of amino acid residues is a substitution of valine at position 47 or a corresponding position with leucine and a substitution of methionine at position 106 or a corresponding position with alanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 222 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of threonine at position 294 or a corresponding position with serine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of threonine at position 294 or a corresponding position with serine, <4> How to. <6> A method for improving 4-aminobenzoic acid hydroxylating activity, comprising substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 with the amino acids listed below; or substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in the amino acid sequence of SEQ ID NO: 2 with the amino acids listed below in a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 2 and having 4-aminobenzoic acid hydroxylating activity. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine <7> the substitution of amino acid residues is a substitution of valine at position 47 or a corresponding position with leucine and a substitution of methionine at position 106 or a corresponding position with alanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 222 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of threonine at position 294 or a corresponding position with serine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of threonine at position 294 or a corresponding position with serine, <6> How to. <8> In the case of producing 4-amino-3-hydroxybenzoic acids using a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylating activity, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in SEQ ID NO: 2 are replaced with the following amino acids: or substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 in a polypeptide having an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 and having 4-aminobenzoic acid hydroxylating activity, with any of the amino acids listed below. (a) Position 47 or a position equivalent thereto: leucine (b) Position 106 or a position equivalent thereto: alanine (c) position 201 or a position equivalent thereto: phenylalanine (d) Position 222 or a position equivalent thereto: phenylalanine (e) position 294 or a position equivalent thereto: serine <9> the substitution of amino acid residues is a substitution of valine at position 47 or a corresponding position with leucine and a substitution of methionine at position 106 or a corresponding position with alanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of tyrosine at position 222 or a corresponding position with phenylalanine, a substitution of valine at position 47 or a corresponding position with leucine and a substitution of threonine at position 294 or a corresponding position with serine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of tyrosine at position 201 or a corresponding position with phenylalanine, a substitution of methionine at position 106 or a corresponding position with alanine and a substitution of threonine at position 294 or a corresponding position with serine, <8> How to. <10> <1> ~ <3> A polynucleotide encoding any one of the polypeptides described above. <11> <10> A vector or DNA fragment comprising the polynucleotide of <12> <11> A transformed cell containing the vector or DNA fragment of the above. <13> Escherichia coli or Corynebacterium sp. <12> The transformed cell described. <14> A microorganism capable of supplying 4-aminobenzoic acids. <12> or <13> Transformed cells. <15> Improved supply of 4-aminobenzoic acids. <12> or <13> Transformed cells. <16> A microorganism into which a vector containing a polynucleotide encoding a polypeptide required for biosynthesis of 4-aminobenzoic acids and a control region operably linked thereto has been introduced. <15> Transformed cells. <17> A microorganism in which the control region of an endogenous polynucleotide encoding a polypeptide required for biosynthesis of 4-aminobenzoic acids is replaced with a strong expression promoter. <15> Transformed cells. <18> <12> ~ <17> A method for producing 4-amino-3-hydroxybenzoic acids, comprising a step of culturing any one of the transformed cells of the above. <19> It is cultivated in a medium containing sugars as a carbon source. <18> How to. <20> The method includes a step of recovering 4-amino-3-hydroxybenzoic acids from the medium. <18> or <19> How to. <21> The culture is carried out in the presence of 4-aminobenzoic acids. <18> ~ <20> Either way. <22> The 4-amino-3-hydroxybenzoic acid is represented by the following general formula (1):
[0056] [ka]
[0057] [In the formula, R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group, and R 2 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group; X 1 and X 2 represents a hydrogen atom or a hydroxy group, and at least one of them represents a hydroxy group. It is a 4-amino-3-hydroxybenzoic acid derivative represented by the formula: <18> ~ <21> Either way. <23> The 4-aminobenzoic acid is represented by the following general formula (2):
[0058] [ka]
[0059] [In the formula, R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group, and R 2 represents a hydrogen atom, a hydroxy group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxy group, a methyl group, or an ethyl group. It is a 4-aminobenzoic acid derivative represented by the formula: <21> or <22> How to. EXAMPLES
[0060] The present invention will be described in more detail below based on test examples, but the present invention is not limited thereto.
[0061] Test Example 1: Production of 4-amino-3-hydroxybenzoic acid (1) Preparation of a plasmid containing a gene encoding HFM122 or an HFM122 mutant In the following test examples, PCR was performed using KOD One PCR Master Mix (Toyobo). After treating the PCR product with DpnI (Takara Bio), the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The In-Fusion HD Cloning Kit (Takara Bio) was used to ligate the DNA fragments. The ligated DNA fragments were used to transform ECOS Competent E. coli JM109 strain (Nippon Gene), and the cell liquid was spread on LBKm agar medium (Difco LB Broth Lennox 20g / L, kanamycin sulfate 50μg / mL, agar 1.5%) and left to stand overnight at 37℃. The resulting colonies were inoculated into 750μL of TBKm liquid medium (Difco Terrific Broth 47.6g / L, kanamycin sulfate 50μg / mL) and cultured overnight at 37℃. Plasmids were prepared from the resulting cells using NucleoSpin Plasmid EasyPure (Takara Bio), and DNA sequence analysis of the resulting plasmids was performed by the Sanger method (Eurofins Genomics).
[0062] (a) Construction of plasmid pKCG1 A DNA fragment was amplified by PCR using plasmid pHM1519 (Agric. Biol. Chem., 48, 2901-2903, (1984)) extracted from Corynebacterium glutamicum ATCC13058 strain as a template and primers pHM1519-Fw (SEQ ID NO: 3, CGTCGCTGATCGCCCTCGCGAC) and pHM1519-Rv (SEQ ID NO: 4, TTGGGAGCAGTCCTTGTGCGCTTACGAG). A DNA fragment was amplified by PCR using plasmid pHSG299 (Takara Bio) as a template and primers pHSG299-Fw (SEQ ID NO: 5, AAGGACTGCTCCCAATACGGTTATCCACAGAATCA) and pHSG299-Rv (SEQ ID NO: 6, GGGGCGATCAGCGACGACTGGCCGTCGTTTTACAAC). These PCR products were ligated to obtain the plasmid pKCG1.
[0063] (b) Construction of plasmid pKCG1_PtufT1 A DNA fragment for vector was amplified by PCR using primers pHM1519-Fw (SEQ ID NO: 3) and pKCG1vec-Rv (SEQ ID NO: 7, GGATCTAAACGATCTACTGGCCGTCGTTTTACAAC) with plasmid pKCG1 as a template. Next, a DNA fragment containing the promoter of the tuf gene (cg0587) (hereinafter referred to as tuf promoter) was amplified by PCR using primers Ptuf-Fw (SEQ ID NO: 8, AGATCGTTTAGATCCGAAGGAAAACGTCGAAAAGC) and Ptuf-Rv (SEQ ID NO: 9, TGTATGTCCTCCTGGACTTCGTGGTGGCTAC) with the genome of Corynebacterium glutamicum ATCC13032 as a template. Furthermore, a DNA fragment containing an artificially synthesized terminator sequence (SEQ ID NO: 10, GGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTT) was used as a template and amplified by PCR using primers T1-Fw (SEQ ID NO: 11, CCAGGAGGACATACAGGTAGTGTGGGGTCTCCCCA) and T1-Rv (SEQ ID NO: 12, GGGCGATCAGCGACGAAATCCGCTCCCGGCGGATT). These PCR products were ligated to obtain plasmid pKCG1_PtufT1.
[0064] (c) Construction of plasmid pKCG1_PtufT1_HFM122 A DNA fragment for vector was amplified by PCR using the primers pKCG1_PtufT1vec-Fw (SEQ ID NO: 13, GGTAGTGTGGGGTCTCCCCATGC) and pKCG1_PtufT1vec-Rv (SEQ ID NO: 14, TGTATGTCCTCCTGGACTTCGTGGTGGCTAC) with the plasmid pKCG1_PtufT1 as a template. Next, a gene (SEQ ID NO: 1) encoding the polypeptide HFM122 having 4-aminobenzoic acid hydroxylation activity was prepared by artificial gene synthesis, and a DNA fragment for insert was synthesized by PCR using the primers HFM122-Fw (SEQ ID NO: 15, CCAGGAGGACATACAATGCGCACTCAGGTGGCTAT) and HFM122-Rv (SEQ ID NO: 16, AGACCCCACACTACCTTATACGAGTGGCAGTCCTA) with the plasmid pKCG1_PtufT1_HFM122 as a template. These PCR products were ligated to obtain the plasmid pKCG1_PtufT1_HFM122. In the constructed plasmid, a gene encoding wild-type HFM122 is linked under the control of the tuf promoter.
[0065] (d) Construction of a plasmid containing a gene encoding a mutant enzyme Plasmid pKCG1_PtufT1_HFM122_V47L was constructed by PCR using plasmid pKCG1_PtufT1_HFM122 as a template and complementary primers HFM122 V47L F (SEQ ID NO: 17, GCTGGTCTCCTGGAACGTATCACGGTG) and HFM122 V47L R (SEQ ID NO: 18, TTCCAGGAGACCAGCCCGAACTCGGCC). Similarly, plasmids containing genes encoding each of the mutant enzymes were obtained by PCR using the primers shown in "Primers" in Table 1 instead of primers HFM122 V47L F and HFM122 V47L R.
[0066] [Table 1]
[0067] (2) Creation of host cells with enhanced 4-aminobenzoic acid biosynthesis ability (a) Construction of a plasmid containing the tuf promoter in the cg1829(aroC) promoter region The 5' upstream region of the cg1829 gene region (SEQ ID NO: 27) was amplified with two types of DNA primers (SEQ ID NO: 28 and 29), and the 5' region in the cg1829 gene ORF (SEQ ID NO: 30) was amplified with two types of DNA primers (SEQ ID NO: 31 and 32) to obtain a DNA fragment. A DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified with two types of DNA primers (SEQ ID NO: 34 and 35) using the genome of the ATCC13032 strain as a template to obtain a DNA fragment. In addition, pHKPsacB1 was used as a template and amplified with two types of DNA primers (SEQ ID NO: 36 and 37), and the obtained PCR product was treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and ligated using In-Fusion HD Cloning Kit (Takara Bio) to prepare the plasmid pHKPsacB_Ptuf-aroC.
[0068] (b) Construction of a strain with the tuf promoter introduced into the cg1829(aroC) promoter region The above-mentioned plasmid pHKPsacB_Ptuf-aroC was introduced into the KC315 strain (Patent Application No. 2021-201877) using a transformation method by electroporation, and the KC367sr strain was obtained by selecting for kanamycin resistance. When the KC367sr strain was analyzed by PCR using primers of SEQ ID NOs: 28 and 38 (Sapphire Amp (Takara Bio)), the expected results were obtained, confirming that the KC367sr strain is a single-crossover homologous recombination transformant into which the plasmid pHKPsacB_Ptuf-aroC was introduced. The KC367sr strain was cultured in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) for 24 hours, and a portion of the culture was smeared on LB agar medium containing 20% sucrose to obtain the KC367 strain. Using the PCR method (Sapphire Amp (Takara Bio)) with primers of SEQ ID NO: 38 and 39, it was confirmed that the KC367 strain was a double-crossover homologous recombinant in which the tuf promoter had been introduced into the cg1829 (aroC) promoter region, as expected.
[0069] (c) Construction of a plasmid containing the tuf promoter in the cg1774(tkt) promoter region The 5' upstream region of the cg1774 gene region (SEQ ID NO: 40) was amplified using two types of DNA primers (SEQ ID NO: 41 and 42), and the 5' region in the cg1774 gene ORF (base number 43) was amplified using two types of DNA primers (SEQ ID NO: 44 and 45) to obtain a DNA fragment. A DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified using two types of DNA primers (SEQ ID NO: 34 and 35) with the genome of the ATCC13032 strain as a template to obtain a DNA fragment. Amplified using two types of DNA primers (SEQ ID NO: 36 and 37) with pHKPsacB1 as a template, and the obtained PCR product was treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and ligated using In-Fusion HD Cloning Kit (Takara Bio) to prepare the plasmid pHKPsacB_Ptuf-tkt.
[0070] (d) Construction of a strain in which the tuf promoter was introduced into the cg1774(tkt) promoter region The above-mentioned plasmid pHKPsacB_Ptuf-tkt was introduced into the KC367 strain using the electroporation transformation method, and the KC376sr strain was obtained by selecting for kanamycin resistance. The KC376sr strain was analyzed by PCR (Sapphire Amp (Takara Bio)) using primers of SEQ ID NOs: 41 and 46, and the expected results were obtained. It was therefore confirmed that the KC376sr strain is a single-crossover homologous recombination product in which the plasmid pHKPsacB_Ptuf-tkt was introduced into the promoter region of cg1774. The KC376sr strain was cultured in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) for 24 hours, and a portion of the culture was smeared on LB agar medium containing 20% sucrose to obtain the KC376 strain. Using PCR (Sapphire Amp (Takara Bio)) with primers of SEQ ID NO: 46 and 47, it was confirmed that the KC376 strain was a double-crossover homologous recombinant in which the tuf promoter had been introduced into the cg1774 (tkt) promoter region, as expected.
[0071] (e) Construction of a plasmid carrying the tuf promoter in the cg0644 (ppsA) promoter region The 5' upstream region of the cg0644 gene region (SEQ ID NO: 48) was amplified using two types of DNA primers (SEQ ID NO: 49 and 50), and the 5' region in the cg0644 gene ORF (base number 51) was amplified using two types of DNA primers (SEQ ID NO: 52 and 53) to obtain a DNA fragment. A DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified using two types of DNA primers (SEQ ID NO: 34 and 35) with the genome of the ATCC13032 strain as a template to obtain a DNA fragment. Amplified using two types of DNA primers (SEQ ID NO: 36 and 37) with pHKPsacB1 as a template, and the obtained PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and ligated using In-Fusion HD Cloning Kit (Takara Bio) to prepare the plasmid pHKPsacB_Ptuf-ppsA.
[0072] (f) Construction of a strain with the tuf promoter introduced into the cg0644(ppsA) promoter region The above-mentioned plasmid pHKPsacB_Ptuf-ppsA was introduced into the KC376 strain using the transformation method by electroporation, and the KC408sr strain was obtained by selecting for kanamycin resistance. The KC408sr strain was analyzed by PCR using primers of SEQ ID NOs: 49 and 54 (Sapphire Amp (Takara Bio)). The expected results were obtained, and it was confirmed that the KC408sr strain is a single-crossover homologous recombination transformant into which the plasmid pHKPsacB_Ptuf-ppsA was introduced. The KC408sr strain was cultured in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) for 24 hours, and a portion of the culture was smeared on LB agar medium containing 20% sucrose to obtain the KC408 strain. Using PCR (Sapphire Amp (Takara Bio)) with primers of SEQ ID NO: 54 and 55, it was confirmed that the KC408 strain was a double-crossover homologous recombinant in which the tuf promoter had been introduced into the cg0644 (ppsA) promoter region, as expected.
[0073] (g) Construction of a plasmid to delete the cg0502(qsuB) gene region The 5' upstream region of the cg0502 gene region (sequence number 56) was amplified using two types of DNA primers (sequence numbers 57 and 58), and the 3' downstream region of the cg0502 gene region (base number 59) was amplified using two types of DNA primers (sequence numbers 60 and 61) to obtain DNA fragments. In addition, pHKPsacB1 was used as a template and amplified using two types of DNA primers (sequence numbers 36 and 37), and the resulting PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the three obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and the DNA fragments were ligated using the In-Fusion HD Cloning Kit (Takara Bio) to produce the plasmid pHKPsacB_ΔqsuB.
[0074] (h) Construction of a strain lacking the cg0502(qsuB) gene region The above-mentioned plasmid pHKPsacB_ΔqsuB was introduced into the KC408 strain using the electroporation transformation method, and the KC525sr strain was obtained by selecting for kanamycin resistance. The KC525sr strain was analyzed by PCR (Sapphire Amp (Takara Bio)) using primers of SEQ ID NOs: 57 and 62, and the expected results were obtained, confirming that the KC525sr strain is a single-crossover homologous recombination transformant into which the plasmid pHKPsacB_ΔqsuB was introduced. The KC525sr strain was cultured in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) for 24 hours, and a portion of the culture was smeared on LB agar medium containing 20% sucrose to obtain the KC418 strain. Using the PCR method (Sapphire Amp (Takara Bio)) with primers of SEQ ID NO: 62 and 63, it was confirmed that the KC525 strain was a double-crossover homologous recombinant in which the cg (qsuB) gene region was deleted, as expected.
[0075] (i) Construction of a plasmid for introducing the tuf promoter into the cg1134(pabAB) promoter region The 5' upstream region of the cg1134 gene region (SEQ ID NO: 64) was amplified with two types of DNA primers (SEQ ID NO: 65 and 66), and the 5' region in the cg1134 gene ORF (SEQ ID NO: 67) was amplified with two types of DNA primers (SEQ ID NO: 68 and 69) to obtain DNA fragments. A DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified with two types of DNA primers (SEQ ID NO: 34 and 35) using the genome of the ATCC13032 strain as a template to obtain DNA fragments. Amplified with two types of DNA primers (SEQ ID NO: 36 and 37) using pHKPsacB1 as a template, and the obtained PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and ligated using In-Fusion HD Cloning Kit (Takara Bio) to prepare the plasmid pHKPsacB_Ptuf-pabAB.
[0076] (j) Construction of a strain with the tuf promoter introduced into the cg1134(pabAB) promoter region The above-mentioned plasmid pHKPsacB_Ptuf-pabAB was introduced into the KC525 strain using the electroporation transformation method, and the KC551sr strain was obtained by selecting for kanamycin resistance. The KC551sr strain was analyzed by PCR (Sapphire Amp (Takara Bio)) using primers of SEQ ID NOs: 65 and 70, and the expected results were obtained, confirming that the KC551sr strain is a single-crossover homologous recombination transformant into which the plasmid pHKPsacB_Ptuf-pabAB was introduced. The KC551sr strain was cultured in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) for 24 hours, and a portion of the culture was smeared on LB agar medium containing 20% sucrose to obtain the KC551 strain. Using the PCR method (Sapphire Amp (Takara Bio)) with primers of SEQ ID NO: 70 and 71, it was confirmed that the KC551 strain was a double-crossover homologous recombinant in which the tuf promoter had been introduced into the cg1134 (pabAB) promoter region, as expected.
[0077] (3) Introduction of the plasmid into the host cell Using each of the plasmids obtained above, Corynebacterium glutamicum KC551 strain was transformed by electroporation (ELEPO21, Nepagene). The resulting transformed cell solution was spread on LBKm agar medium and left at 30℃ for 2 days, and the resulting colonies were used as transformed strains.
[0078] (4) Cultivation of transformed strains The transformed strains obtained above were inoculated into 750 μL of CGTG15 medium (containing 50 μg / mL kanamycin sulfate) shown in Table 2, and cultured at 30° C. for 48 hours. The cells were then removed by centrifugation to obtain the culture supernatant. The 4-amino-3-hydroxybenzoic acid producing ability of the transformed strains was calculated according to the following formula (Number 1), and the improvement rate of 4-amino-3-hydroxybenzoic acid producing ability was calculated according to the following formula (Number 2). Here, "WT" indicates "a transformed strain into which a plasmid containing a gene encoding a wild-type enzyme has been introduced" and "MT" indicates "a transformed strain into which a plasmid containing a gene encoding a mutant enzyme has been introduced."
[0079] (Number 1) 4-Amino-3-hydroxybenzoic acid production capacity = Amount of 4-amino-3-hydroxybenzoic acid in culture supernatant / Amount of 4-aminobenzoic acid in culture supernatant (Number 2) Productivity improvement rate = 4-amino-3-hydroxybenzoic acid productivity of MT / 4-amino-3-hydroxybenzoic acid productivity of WT
[0080] [Table 2]
[0081] (5) Results As shown in Table 3, the strains into which each mutant enzyme was introduced had improved productivity of 4-amino-3-hydroxybenzoic acid compared to the strains into which the wild-type enzyme was introduced. In particular, among the productivity improvement rates of the transformed strains into which a plasmid containing a gene encoding an amino acid sequence in which any two positions in the amino acid sequence of HFM122 was introduced (productivity improvement rate of double mutants), the productivity improvement rates of the transformed strains into which a plasmid containing a gene encoding a V47L_M106A mutant, a V47L_Y201F mutant, a V47L_Y222F mutant, a V47L_T294S mutant, a M106A_Y201F mutant, and a M106A_T294S mutant was introduced were higher than the productivity improvement rate of the double mutant predicted by the following formula (Mathematical formula 3) from the productivity improvement rate of the transformed strain into which a plasmid containing a gene encoding an amino acid sequence in which any one position was substituted (productivity improvement rate of single mutants).
[0082] (Number 3) Expected productivity improvement rate of double mutants = productivity improvement rate of one single mutant + productivity improvement rate of the other single mutant
[0083] [Table 3]
[0084] Reference Example 1: Quantitative determination of 4-amino-3-hydroxybenzoic acid Quantitative determination of 4-amino-3-hydroxybenzoic acid was performed by HPLC. After the culture supernatant was diluted 10-fold with 0.1% phosphoric acid, insoluble matter was removed using an AcroPrep 96 filter plate (0.2 μm GHP membrane, Nippon Pole) and the sample was subjected to HPLC. The HPLC apparatus used was Chromaster (Hitachi High-Tech Science). The analytical column used was an L-column ODS (4.6 mm ID × 150 mm, Chemicals Evaluation and Research Institute), and gradient elution was performed with 0.1 M potassium dihydrogen phosphate in 0.1% phosphoric acid solution as eluent A and 70% methanol as eluent B at a flow rate of 1.0 mL / min and a column temperature of 40°C. A UV detector (detection wavelength 280 nm) was used to detect 4-aminobenzoic acid and 4-amino-3-hydroxybenzoic acid. A concentration calibration curve was prepared using standard samples [4-amino-3-hydroxybenzoic acid (Tokyo Chemical Industry Co., Ltd.), 4-aminobenzoic acid (Tokyo Chemical Industry Co., Ltd.)], and quantification was performed based on the concentration calibration curve.
Claims
**Claim 1** In the amino acid sequence represented by SEQ ID NO: 2, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are the following amino acids, or in an amino acid sequence having at least 90% identity with the amino acid sequence represented by SEQ ID NO: 2, the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence represented by SEQ ID NO: 2 are the following amino acids, a polypeptide having 4 - aminobenzoic acid hydroxylation activity. (a) Position 47 or the corresponding position: Leucine (b) Position 106 or the corresponding position: Alanine (c) Position 201 or the corresponding position: Phenylalanine (d) Position 222 or the corresponding position: Phenylalanine (e) Position 294 or the corresponding position: Serine **Claim 2** In a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2, substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence with the following amino acids, or in a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence represented by SEQ ID NO: 2 and having 4 - aminobenzoic acid hydroxylation activity, substituting the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence represented by SEQ ID NO: 2 with the following amino acids, a method for producing a mutant polypeptide having 4 - aminobenzoic acid hydroxylation activity. (a) Position 47 or the corresponding position: Leucine (b) Position 106 or the corresponding position: Alanine (c) Position 201 or the corresponding position: Phenylalanine (d) Position 222 or the corresponding position: Phenylalanine (e) Position 294 or the corresponding position: Serine **Claim 3** In a polypeptide consisting of the amino acid sequence shown by SEQ ID NO: 2, substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence with the following amino acids, or in a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown by SEQ ID NO: 2 and having 4 - aminobenzoic acid hydroxylation activity, substituting the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown by SEQ ID NO: 2 with the following amino acids, a method for improving 4 - aminobenzoic acid hydroxylation activity. (a) Position 47 or the corresponding position: Leucine (b) Position 106 or the corresponding position: Alanine (c) Position 201 or the corresponding position: Phenylalanine (d) Position 222 or the corresponding position: Phenylalanine (e) Position 294 or the corresponding position: Serine
4. A polynucleotide encoding the polypeptide according to Claim 1.
5. A vector or DNA fragment containing the polynucleotide according to Claim 4.
6. A transformed cell containing the vector or DNA fragment according to Claim 5.
7. The transformed cell according to Claim 6, which is Escherichia coli or a bacterium belonging to the genus Corynebacterium.
8. The transformed cell according to Claim 6, which is a microorganism capable of supplying 4 - aminobenzoic acids.
9. A method for producing 4 - amino - 3 - hydroxybenzoic acids, comprising the step of culturing the transformed cell according to Claim 6.
10. A method for producing 4 - amino - 3 - hydroxybenzoic acids, comprising the step of culturing the transformed cell according to Claim 7.
11. A method for producing 4 - amino - 3 - hydroxybenzoic acids, comprising the step of culturing the transformed cell according to Claim 8.
12. The method according to any one of Claims 9 to 11, comprising the step of recovering 4 - amino - 3 - hydroxybenzoic acids from the culture medium.
13. The method according to Claim 9, wherein the culturing is performed in the presence of 4 - aminobenzoic acids.
14. The 4 - amino - 3 - hydroxybenzoic acids are 4 - amino - 3 - hydroxybenzoic acid derivatives represented by the following general formula (1): 【Chemical 1】 [In the formula, R １ represents a hydrogen atom, a hydroxy group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxy group, a methyl group, or an ethyl group, and R ２ represents a hydrogen atom, a hydroxy group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxy group, a methyl group, or an ethyl group, X １ and X ２ are a hydrogen atom or a hydroxy group, and at least one of them represents a hydroxy group. ] and the 4 - aminobenzoic acids are represented by the following general formula (2): [Chemical Formula 2] [In the formula, R １ represents a hydrogen atom, a hydroxy group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxy group, a methyl group, or an ethyl group, and R ２ represents a hydrogen atom, a hydroxy group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxy group, a methyl group, or an ethyl group.] The method according to claim 11 or 13, which is a 4-aminobenzoic acid derivative represented by