Method for detecting periodontitis risk

Abstract

To provide a widely applicable method for detecting periodontitis risk.SOLUTION: A method for detecting periodontitis risk includes the steps of: measuring the ratio (a / b) of the amount of bacteria (a) belonging to at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium to the amount of bacteria (b) belonging to at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella and Selenomonas in a biological sample collected from a subject's oral cavity; and comparing the measured ratio in the amount of bacteria (a / b) with a reference value.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for detecting the risk of periodontal disease using oral resident bacteria as an indicator. [Background technology]

[0002] As bacteria causing periodontal disease (periodontal disease-related bacteria), three species of bacteria called the Red complex, Porphyromonas gingivalis, Tannerella forsythensis, and Treponema denticola, are considered important, and it is known that the presence of these bacteria leads to the aggravation of periodontal disease (Non-Patent Document 1). In other words, it is possible to judge the progression of periodontal disease by measuring the three species of bacteria in the Red complex, and for example, it has been reported that the total number of bacteria in the three species of the Red complex in saliva or dental plaque is related to the progression of periodontal disease (Non-Patent Document 2). Furthermore, it has been reported that the risk of worsening periodontal disease in the early stages can be determined by calculating the ratio of the total number of bacteria of the three species of Red complex to the number of Fusobacterium nucleatum bacteria (Patent Document 1).

[0003] Periodontal disease is also known as a silent disease, and in many cases, by the time people become aware that they have it, it has already progressed and become severe. Even if treatment is started after the symptoms of periodontal disease are recognized, advanced surgical treatment is often required. Therefore, there is a need for a method to predict periodontal disease risk before the onset or in the early stages.

[0004] On the other hand, the Red complex used in Patent Document 1 and Non-Patent Document 2 is a species of obligate anaerobic bacteria that is detected only when periodontal disease progresses and a periodontal pocket that becomes an anaerobic environment is formed, and therefore is not considered suitable for use as an indicator in patients before or at the early stage of periodontal disease. Furthermore, since the Red complex is a species of bacteria present in the periodontal pocket, when the Red complex is not detected in a sample, it is difficult to determine whether the bacterial amount is truly zero or whether the sample from the periodontal pocket was not properly collected, which is also an issue with bacterial testing for the Red complex.

[0005] The genera Neisseria and Haemophilus are widely detected in the oral cavity of people with healthy oral conditions (Non-Patent Documents 3 and 4). It has been reported that the Neisseria genus prevents infection by periodontal disease bacteria (Patent Document 2), but there are many unclear aspects regarding its role in the oral cavity. The Cardiobacterium genus is also detected in the oral cavity, but its presence rate is low compared to the Neisseria and Haemophilus genera. There are few studies focusing on the Cardiobacterium genus in the oral cavity, but it has been reported that the amount of Cardiobacterium genus in the saliva of patients with esophageal squamous cell carcinoma is low (Non-Patent Document 5). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent No. 7122337 [Patent Document 2] Patent Publication No. 2021-90416 [Non-patent literature]

[0007] [Non-Patent Document 1] Socransky SS, et al. J Clin Periodontol. 1998 Feb;25(2):134-44 [Non-Patent Document 2] Clinical Practice Guidelines for Antimicrobial Therapy in Patients with Periodontal Disease 2010, edited by the Japanese Society of Periodontology [Non-Patent Document 3] Kageyama S,et al. PLoS One. 2017 Apr 3;12(4): e0174782 [Non-Patent Document 4] Takayuki Nanbu, Japanese Journal of Conservative Dentistry, Vol. 63, No. 2, 2020, p. 127-130 [Non-Patent Document 5] Chen X, et al. PLoS One. 2015 Dec 7;10(12): e0143603 Summary of the Invention [Problem to be solved by the invention]

[0008] The present invention relates to providing a highly versatile method for detecting the risk of periodontal disease. [Means for solving the problem]

[0009] The inventors focused on normal oral bacteria that are widely present in the oral cavity of everyone from healthy individuals to patients with periodontal disease, rather than on periodontal disease-associated bacteria such as the Red complex, and found that by using the ratio of the abundance of a specific genus of normal oral bacteria to the abundance of another specific genus as an indicator, it is possible to evaluate the risk of periodontal disease in a wide range of subjects, including healthy individuals and patients with early-stage periodontal disease, compared to using the abundance of only the genus to which periodontal disease-associated bacteria belongs as an indicator.

[0010] That is, the present invention relates to the following 1) to 3). 1) A method for detecting periodontal disease risk, comprising the steps of: measuring a ratio (a / b) of the amount of bacteria (a) of at least one genus selected from the group consisting of the genera Neisseria, Haemophilus, and Cardiobacterium in a biological sample collected from the oral cavity of a subject to the amount of bacteria (b) of at least one genus selected from the group consisting of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas; and comparing the measured ratio of bacterial amounts (a / b) with a standard value. 2) A method for evaluating a preventive or therapeutic intervention for periodontal disease, comprising the steps of measuring the ratio (a / b) of the amount of bacteria (a) of at least one genus selected from the group consisting of the genera Neisseria, Haemophilus, and Cardiobacterium to the amount of bacteria (b) of at least one genus selected from the group consisting of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas in a biological sample collected from the oral cavity of a subject before and after the intervention, and evaluating an intervention that increases the bacterial amount ratio (a / b) as an intervention having a preventive or therapeutic effect against periodontal disease. 3) A kit for detecting periodontal disease risk used in the method described in 1) or a kit for evaluating an intervention used in the method described in 2), containing a reagent for measuring the amount of bacteria of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium, and the amount of bacteria of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas. Effect of the Invention

[0011] According to the present invention, it is possible to evaluate the risk of periodontal disease in a wide range of subjects, including healthy individuals and patients with early-stage periodontal disease, and it is therefore possible to take appropriate preventive or therapeutic measures depending on the evaluation results. [Brief description of the drawings]

[0012]

Figure 1

[0013] All patents, non-patent publications, and other publications cited herein are hereby incorporated by reference in their entirety.

[0014] In the present invention, "periodontal disease" refers to an inflammatory disease in which inflammation of the gums is caused by bacteria in dental plaque, and includes gingivitis and periodontitis. Gingivitis is a pathological condition in which periodontal tissues are infected with bacteria that cause periodontal disease (periodontal disease-related bacteria) in dental plaque, causing inflammation of the gums. If this gingivitis pathological condition is left untreated and the inflammation worsens, not only will the gums swell and bleed, but the periodontal pockets will deepen and progress to periodontitis pathological condition. The progression of this periodontitis will cause gingival recession and absorption of the alveolar bone that supports the tooth roots, ultimately leading to tooth loss.

[0015] In the present invention, "periodontal disease risk" encompasses the risk of developing periodontal disease (ease of contracting periodontal disease) and the risk of worsening periodontal disease (ease of worsening periodontal disease). That is, when a certain human individual is in the high-risk group, it means that the human individual is expected to have a high risk of developing periodontal disease or a high risk of worsening periodontal disease, and when a certain human individual is in the low-risk group, it means that the human individual is expected to have a low risk of developing periodontal disease or a low risk of worsening periodontal disease.

[0016] The oral resident bacteria to be measured in the present invention are Neisseria, Haemophilus, Cardiobacterium, Saccharibacteria (TM7) [G-1], Prevotella and Selenomonas. As shown in the Examples below, Neisseria, Haemophilus and Cardiobacterium are bacteria that decrease in the oral cavity with the progression of periodontal disease, and are referred to as healthy bacteria in this specification. On the other hand, Saccharibacteria (TM7) [G-1], Prevotella and Selenomonas are bacteria that increase in the oral cavity with the progression of periodontal disease, and are referred to as risk bacteria in this specification.

[0017] As shown in the Examples below, cluster analysis was performed based on similarity between the subjects' dental clinical indicators, such as the gingival index (GI) for all teeth, bleeding on probing (BOP), and probing pocket depth (PPD), and the proportion of bacterial genera in biological samples collected from the oral cavity. As a result, Neisseria, Haemophilus, Cardiobacterium, and Arachnia were identified as healthy bacteria, while Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas were identified as risk bacteria. Next, a correlation analysis was performed between the data on the abundance ratio of healthy bacteria, risk bacteria, or genera of periodontal disease-related bacteria as a comparison subject and GI or PPD. When the abundance ratio of one or two genera of specific healthy bacteria was taken as the ratio of one genera of specific risk bacteria to the abundance ratio of one genera of specific risk bacteria, the correlation coefficient with GI was higher than when the abundance ratio of one genera of risk bacteria was used, and was comparable to when the abundance ratio of one genera of periodontal disease-related bacteria was used. In addition, the number of determinable subjects for which the correlation coefficient could be calculated was equal to or greater than when the abundance ratio of one genera of risk bacteria was used, and significantly increased compared to when the abundance ratio of one genera of periodontal disease-related bacteria was used. The number of determinable subjects was calculated according to the following criteria, taking into account the respective characteristics of healthy bacteria, risk bacteria, and periodontal disease-related bacteria. Healthy bacteria are oral indigenous bacteria that are possessed by both healthy individuals and patients with periodontal disease, and can be widely detected from saliva to dental plaque, so when the abundance ratio is 0%, it can be considered that the subject does not truly possess it. Therefore, subjects with an abundance ratio of 0% of healthy bacteria were analyzed. On the other hand, because periodontal disease-related bacteria are bacteria that are detected in periodontal pockets after periodontal disease has progressed, if the presence rate is 0%, it is impossible to determine whether the subject truly does not have the bacteria, or whether the subject actually has the bacteria but the sample was not collected because the site of sampling was inappropriate. Therefore, subjects with a presence rate of 0% of periodontal disease-related bacteria were excluded from the analysis. Similarly, subjects with a presence rate of 0% of risk bacteria were excluded from the analysis.

[0018] Therefore, the ratio of the abundance ratio of at least one genus selected from the group consisting of Neisseria, Haemophilus and Cardiobacterium to the abundance ratio of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella and Selenomonas in a biological sample collected from the oral cavity of a subject can be used as an index to detect the risk of periodontal disease in the subject. Since the ratio of the abundance ratio of bacteria corresponds to the ratio of the amount of bacteria, the ratio (a / b) of the amount of bacteria (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus and Cardiobacterium to the amount of bacteria (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella and Selenomonas in a biological sample collected from the oral cavity of a subject can be used as an index to detect the risk of periodontal disease in the subject. Here, detecting the risk of periodontal disease includes detecting the possibility of onset of periodontal disease, the possibility of worsening of periodontal disease (preferably the possibility of worsening of periodontal disease in the early stages of periodontal disease), the degree of progression of the pathological condition of periodontal disease (preferably the degree of progression of the pathological condition of periodontal disease in the early stages of periodontal disease), the degree of prevention or cure of periodontal disease, and the preventive or therapeutic effects, etc.

[0019] In the present invention, the term "detection" can be replaced with the terms "measurement," "determination," "evaluation," or "evaluation assistance." Note that the terms "determination" and "evaluation" herein do not include determination or evaluation by a physician.

[0020] The method for detecting a risk of periodontal disease of the present invention includes a step of measuring a ratio (a / b) of a bacterial amount (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium to a bacterial amount (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas in a biological sample collected from the oral cavity of a subject, and a step of comparing the measured bacterial amount ratio (a / b) with a standard value. The method for detecting a risk of periodontal disease of the present invention is suitable as a method for detecting a risk of developing periodontal disease or a risk of worsening of periodontal disease in the early stage of periodontal disease, and is particularly suitable as a method for detecting a risk of worsening of periodontal disease in the early stage of periodontal disease. Here, "early stage periodontal disease" refers to a state in which the periodontal pocket depth is within the healthy range, but gingival inflammation is observed. For example, this refers to a gingival condition in which the periodontal pocket depth is less than 4 mm and the gingival inflammation index is between 0.2 and 1.0, which is classified as non-periodontitis in the 2015 Guidelines for Periodontal Treatment (compiled by the Japanese Academy of Periodontology, a non-profit organization).

[0021] In the present invention, examples of biological samples include specimens containing oral bacteria of a subject, such as dental plaque or saliva, or samples collected from the tooth surface, tongue surface, or buccal mucosa. Among these, dental plaque or saliva is preferred, dental plaque is more preferred, and subgingival plaque is even more preferred, from the viewpoint of the recovery efficiency of risk bacteria. The method of collecting the biological sample is not particularly limited and may be appropriately selected depending on the type of sample. The biological sample can be used for the next operation immediately after collection, but can also be frozen and stored at -80°C.

[0022] The subject from whom the biological sample is collected is not particularly limited in terms of gender or race, but is preferably a human who needs to detect the risk of periodontal disease or a human who wishes to detect the risk of periodontal disease, more preferably a human who needs to detect the risk of developing periodontal disease or the risk of worsening periodontal disease or a human who wishes to detect the risk of developing periodontal disease or the risk of worsening periodontal disease in the early stages of periodontal disease, even more preferably a human who needs to detect the risk of developing periodontal disease or the risk of worsening periodontal disease in the early stages of periodontal disease or a human who wishes to detect the risk of developing periodontal disease or the risk of worsening periodontal disease in the early stages of periodontal disease, and even more preferably a human who needs to detect the risk of worsening periodontal disease in the early stages of periodontal disease or a human who wishes to detect the risk of worsening periodontal disease in the early stages of periodontal disease.

[0023] In the present invention, from the viewpoints of accuracy, the number that can be determined, and operability, the ratio (a / b) of the amount of bacteria (a) of one or two genera selected from the group consisting of the genera Neisseria, Haemophilus, and Cardiobacterium to the amount of bacteria (b) of one genus selected from the group consisting of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas is preferable, and any of the following (i) to (xi) is more preferable. (i) Ratio of Neisseria bacterial count (a) to Saccharibacteria (TM7) [G-1] bacterial count (b) (a / b) (ii) The ratio (a / b) of the amount of Haemophilus bacteria (a) to the amount of Prevotella bacteria (b) (iii) The ratio of the amount of bacteria of the genus Haemophilus (a) to the amount of bacteria of the genus Saccharibacteria (TM7) [G-1] (b) (a / b). (iv) The ratio of the amount of bacteria of the genus Haemophilus (a) to the amount of bacteria of the genus Selenomonas (b) (a / b). (v) Ratio of the amount of bacteria in the genus Cardiobacterium (a) to the amount of bacteria in the genus Saccharibacteria (TM7) [G-1] (b) (a / b) (vi) The ratio (a) of the amount of Cardiobacterium bacteria to the amount of Selenomonas bacteria (b) (a / b) (vii) The ratio (a / b) of the amount of bacteria of the genera Neisseria and Haemophilus (a) to the amount of bacteria of the genus Saccharibacteria (TM7) [G-1] (b). (viii) The ratio (a / b) of the amount of bacteria of the genera Neisseria and Cardiobacterium (a) to the amount of bacteria of the genus Saccharibacteria (TM7) [G-1] (b) (ix) The ratio (a / b) of the bacterial load of the genera Cardiobacterium and Haemophilus (a) to the bacterial load of the genus Prevotella (b) (x) Ratio (a) of bacterial load of genera Cardiobacterium and Haemophilus to bacterial load of genus Saccharibacteria (TM7) [G-1] (b) (a / b) (xi) The ratio (a) of the bacterial load of the genera Cardiobacterium and Haemophilus to the bacterial load of the genus Selenomonas (b) (a / b).

[0024] The means for measuring the amount of bacteria (a) of at least one genus selected from the group consisting of the genera Neisseria, Haemophilus, and Cardiobacterium, and the amount of bacteria (b) of at least one genus selected from the group consisting of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas in a biological sample is not particularly limited, but a preferred method includes a method of analyzing the bacterial genus or species in the biological sample based on the base sequence of the 16S rRNA gene contained in the bacterial genomic DNA in the biological sample. Below, we explain a method for classifying and identifying bacterial genus or species in a biological sample based on the base sequence of the 16S rRNA gene.

[0025] 1) Extraction of genomic DNA from biological samples Nucleic acids are liberated from biological samples collected from the oral cavity of subjects using known methods such as the lytic enzyme method (BMC Microbiol., 2004, 4:16) or the bead method (Science, 2008, 320, 1647-1651), and bacterial genomic DNA is then extracted using known methods for isolating and extracting DNA, such as commonly used methods such as the phenol-chloroform method (Mol. Biol., 1986, 191, 615-624) or the guanidine method (Science, 2005, 308:1635-1638).

[0026] 2) Sequencing of the 16S rRNA gene in genomic DNA Next, the sequence of the 16S rRNA gene contained in the extracted bacterial genomic DNA is determined. That is, the sequence of the 16S rRNA gene characteristic of each bacterial genus or species is determined, and the oral bacterial flora structure is analyzed based on the sequence data. For this reason, it is necessary to select the region of the 16S rRNA gene to be sequenced so as to reflect the bacterial flora structure, but in order to perform the analysis quickly and eliminate sequence reading errors, it is desirable to determine and compare the sequence of a short region as long as it reflects the characteristics of the sequence of each bacterial genus or species. The region of the 16S rRNA gene to be sequenced is amplified by PCR, and in this case, the primers are preferably set to a region that is universally conserved among bacterial genera or species. Examples of such primers include, but are not limited to, primers containing the sequences shown in Table 1, and forward and reverse primers can be used in appropriate combination so that the desired region is amplified.

[0027] [Table 1]

[0028] After purifying the amplified PCR product, sequencing is performed. Any known method can be used for sequencing, but for example, the next-generation ultra-high-speed sequencing device, such as MiSeq (Illumina), can be used to rapidly sequence the product. It is known that the 16S rRNA gene of bacteria contains regions (V1 to V9) whose nucleotide sequences are not conserved among bacterial species and are highly variable. Therefore, it is desirable to determine the nucleotide sequence of at least one of such regions, for example, the region including V1 and V2, or the region including V3 and V4. The region including V1 and V2 can be amplified, for example, with a primer set of 27Fmod (SEQ ID NO: 1) and 338R (SEQ ID NO: 5), and the region including V3 and V4 can be amplified, for example, with a primer set of 341F (SEQ ID NO: 2) and 806R (SEQ ID NO: 6).

[0029] The obtained sequence data can be analyzed using analysis software such as QIIME2 (Quantitative Insights Into Microbial Ecology 2) for the obtained base sequence data group. Identification of the genus or species from the sequence can be performed, for example, by obtaining amplicon sequence variants (ASVs) and assigning taxonomies to each ASV using eHOMD 16S rRNA RefSeq (Version 15.22) and a Taxonomy file. Alternatively, the search can be performed according to the system of The Ribosomal Database Project (Lan, Y et al., Using the RDP classifier to predict taxonomic novelty and reduce the search space for finding novel organisms. PLoS One 2012. 7:e32491.), or by performing a homology search using the BLAST algorithm against gene sequence databases such as the NCBI nucleotide database, NCBI 16S microbial rRNA database, Greengenes database, and SILVA (J.Mol.Biol.,1990,215(3):403-410).

[0030] 3) Measurement of bacterial load Based on the data obtained in 2), the number of sequence data of bacteria of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium, and the number of sequence data of bacteria of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas are calculated. These correspond to the amount of bacteria of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium (a) and the amount of bacteria of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas (b), respectively.

[0031] The thus measured bacterial amount (a) is divided by the bacterial amount (b) to calculate the ratio (a / b) of the bacterial amount (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium to the bacterial amount (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas.

[0032] Alternatively, as a means for measuring the amount of bacteria (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus and Cardiobacterium, and the amount of bacteria (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella and Selenomonas in a biological sample, a method for measuring the amount of bacteria of each genus using a base sequence characteristic of each genus contained in bacterial genomic DNA in the biological sample, preferably the base sequence of the 16S rRNA gene, can be used. Hereinafter, this method will be described using the genus Neisseria as an example.

[0033] Based on the base sequence characteristic of Neisseria bacteria contained in the bacterial genomic DNA extracted from the biological sample collected from the oral cavity of a subject by the above 1), the amount of Neisseria bacteria is measured. That is, the base sequence characteristic of Neisseria bacteria is amplified by PCR using the bacterial genomic DNA as a template, and the amount of Neisseria bacteria contained in the bacterial genomic DNA is measured using a calibration curve created using the genomic DNA of Neisseria bacteria with a known bacterial amount or a plasmid with a base sequence characteristic of Neisseria bacteria as a template. In this case, the PCR primer is a primer that specifically recognizes and amplifies the base sequence characteristic of Neisseria bacteria. The amount of each of Haemophilus bacteria, Cardiobacterium bacteria, Saccharibacteria (TM7) [G-1] bacteria, Prevotella bacteria, and Selenomonas bacteria can also be measured in the same manner.

[0034] The thus measured bacterial amount (a) is divided by the bacterial amount (b) to calculate the ratio (a / b) of the bacterial amount (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium to the bacterial amount (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas.

[0035] Next, in the method for detecting a risk of periodontal disease of the present invention, the measured bacterial amount ratio (a / b) is compared with a standard value. The standard value can be determined in advance based on the relationship between the progression of periodontal disease (the presence or absence or progression of periodontal disease classified based on the dental clinical index value, or the dental clinical index value) and the ratio of bacterial amounts (a / b).

[0036] In a preferred example, the reference value is the bacterial amount ratio (a / b) in a biological sample collected from the oral cavity of a healthy person. The bacterial amount ratio (a / b) can be a statistical value (e.g., average value) of data from multiple healthy people. Alternatively, a reference value corresponding to a healthy person can be appropriately set based on the distribution of the bacterial amount ratio (a / b) in biological samples collected from the oral cavity of randomly selected subjects. A healthy person refers to a person who does not have periodontal disease, and for example, a person with a periodontal pocket depth of less than 4 mm and a gingival inflammation index of less than 0.2 can be considered to be a healthy person.

[0037] If the measured bacterial quantity ratio (a / b) is smaller than the standard value, the subject can be determined to have a high risk of periodontal disease, specifically, a high risk of developing periodontal disease or a high risk of worsening periodontal disease; if not, the subject can be determined to have a low risk of periodontal disease, specifically, not having periodontal disease, a low risk of developing periodontal disease, or a low risk of worsening periodontal disease. For example, if the measured bacterial amount ratio (a / b) is statistically significantly smaller than the reference value, the subject can be judged to have a high risk of periodontal disease, specifically, a high risk of developing periodontal disease or a high risk of worsening periodontal disease, and if not, the subject can be judged to have a low risk of periodontal disease, specifically, no periodontal disease, a low risk of developing periodontal disease, or a low risk of worsening periodontal disease. Also, for example, if the measured bacterial amount ratio (a / b) is preferably 90% or less, more preferably 80% or less, and even more preferably 70% or less of the reference value, the subject can be judged to have a high risk of periodontal disease, specifically, a high risk of developing periodontal disease or a high risk of worsening periodontal disease, and if not, the subject can be judged to have a low risk of periodontal disease, specifically, no periodontal disease, a low risk of developing periodontal disease, or a low risk of worsening periodontal disease.

[0038] In another preferred example, a population is divided into a plurality of groups with different progression levels based on the progression level of periodontal disease, and a reference value for determining whether or not a subject belongs to each group can be determined based on the statistical value (e.g., average value) of the bacterial amount ratio (a / b) in each group. When a plurality of types of bacterial amount ratios (a / b) are used as indicators, it is preferable to obtain a reference value for each indicator. The group may be a group of patients with periodontal disease, a group of healthy subjects and patients with periodontal disease, or a group of patients with periodontal disease at a specific progression level. In addition, groups may be created by age, generation, sex, or race according to the subjects to be detected. Examples of groups used for calculating the standard value include a group with early periodontal disease (early group) and a group with advanced periodontal disease (advanced group). Alternatively, patient groups may be selected based on more detailed classification of the progression of disease, and standard values ​​may be calculated for each patient group. A healthy subject group (group without periodontal disease) may also be included as a control. For example, a reference value can be calculated from two or more groups of a particular stage of progression of periodontal disease, which are grouped based on the values ​​of GI or PPD, which are dental clinical indices, from a group of patients with periodontal disease.

[0039] In another preferred example, the bacterial amount ratio (a / b) in a subject is measured over time (for example, monthly), and the bacterial amount ratio (a / b) from a previous measurement can be used as a reference value.

[0040] If the measured bacterial quantity ratio (a / b) is smaller than the standard value, it can be determined that the subject is at higher risk of periodontal disease compared to previous measurements, specifically, that the risk of developing periodontal disease is higher or the risk of periodontal disease worsening is higher; if not, it can be determined that the subject is at lower risk of periodontal disease compared to previous measurements, specifically, that the risk of developing periodontal disease is lower or the risk of periodontal disease worsening is lower. For example, if the measured bacterial amount ratio (a / b) is statistically significantly smaller than the reference value, the subject can be judged to have a higher risk of periodontal disease compared to the previous measurement, specifically, the risk of developing periodontal disease is higher or the risk of periodontal disease is higher; otherwise, the subject can be judged to have a lower risk of periodontal disease compared to the previous measurement, specifically, the risk of developing periodontal disease is lower or the risk of periodontal disease is lower. For example, if the measured bacterial amount ratio (a / b) is preferably 90% or less, more preferably 80% or less, and even more preferably 70% or less of the reference value, the subject can be judged to have a higher risk of periodontal disease compared to the previous measurement, specifically, the risk of developing periodontal disease is higher or the risk of periodontal disease is higher; otherwise, the subject can be judged to have a lower risk of periodontal disease compared to the previous measurement, specifically, the risk of developing periodontal disease is lower or the risk of periodontal disease is lower.

[0041] According to the method of the present invention, since a specific oral resident bacteria is used as an indicator, the risk of periodontal disease can be detected in a wide range of subjects, including not only advanced periodontal disease patients but also healthy individuals and early periodontal disease patients. This allows subjects to recognize the risk of periodontal disease at an early stage and to take appropriate preventive or therapeutic measures according to the risk. Examples of preventive or therapeutic measures include those generally performed in the field of dentistry. For example, subjects who are determined to be at high risk of periodontal disease are preferably diagnosed by a dentist, and can receive basic periodontal treatment such as brushing, removal of plaque and tartar (scaling, root planing), and adjustment of occlusion, as well as surgical treatment and regenerative therapy, if necessary.

[0042] The above-mentioned method for detecting a risk of periodontal disease of the present invention can be carried out before and after preventive or therapeutic intervention against periodontal disease, thereby making it possible to evaluate the effect of the intervention. That is, the method for evaluating the preventive or therapeutic intervention effect against periodontal disease of the present invention includes a step of measuring the ratio (a / b) of the amount of bacteria (a) of at least one genus selected from the group consisting of Neisseria, Cardiobacterium, and Haemophilus to the amount of bacteria (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas in a biological sample collected from the oral cavity of a subject before and after preventive or therapeutic intervention against periodontal disease, and a step of evaluating an intervention that increases the ratio (a / b) of the amount of bacteria as an intervention having a preventive or therapeutic effect against periodontal disease. The method for evaluating the preventive or therapeutic intervention effect against periodontal disease of the present invention is particularly suitable as a method for evaluating the preventive intervention effect against periodontal disease or the therapeutic intervention effect against early stage periodontal disease.

[0043] Here, preventive or therapeutic intervention for periodontal disease refers to an intervention carried out in the hope of preventing or treating periodontal disease, and includes chemical intervention, physical or mechanical intervention, etc. Chemical intervention includes administration of natural substances, synthetic substances, compositions, etc., and physical or mechanical intervention includes measures such as brushing and removal of plaque and tartar.

[0044] The biological sample, the preferred bacterial amount ratio (a / b), and the method for measuring the bacterial amount ratio (a / b) are the same as those in the method for detecting periodontal disease risk of the present invention.

[0045] The measured bacterial quantity ratio (a / b) is compared before and after the intervention, and an intervention that increases the bacterial quantity ratio (a / b) after the intervention can be evaluated as having a preventive or therapeutic effect on periodontal disease, while an intervention that does not increase the bacterial quantity ratio (a / b) after the intervention can be evaluated as having no preventive or therapeutic effect on periodontal disease. In this case, the greater the increase in the bacterial quantity ratio (a / b) after the intervention, the greater the effect of the intervention in preventing or treating periodontal disease. For example, if the bacterial amount ratio (a / b) after the intervention is statistically significantly greater than the bacterial amount ratio (a / b) before the intervention, the intervention can be evaluated as having a preventive or therapeutic effect on periodontal disease, and if not, the intervention can be evaluated as having no preventive or therapeutic effect on periodontal disease. Also, for example, if the bacterial amount ratio (a / b) after the intervention is preferably 110% or more, more preferably 120% or more, and even more preferably 130% or more than the bacterial amount ratio (a / b) before the intervention, the intervention can be evaluated as having a preventive or therapeutic effect on periodontal disease, and if not, the intervention can be evaluated as having no preventive or therapeutic effect on periodontal disease.

[0046] The kit for detecting periodontal disease risk or the kit for evaluating the effect of intervention is a kit for detecting a subject's periodontal disease risk according to the method for detecting periodontal disease risk of the present invention, and a kit for evaluating the effect of intervention according to the method for evaluating the effect of intervention of the present invention. The kit of the present invention contains a reagent for measuring the amount of bacteria (a) of at least one genus selected from the group consisting of Neisseria, Cardiobacterium, and Haemophilus, and the amount of bacteria (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas. Examples of the reagent include a reagent for nucleic acid amplification or hybridization, which contains an oligonucleotide (e.g., a PCR primer) that specifically binds (hybridizes) with a nucleic acid derived from each bacterial genus. In addition, the kit may contain a standard sample for preparing a calibration curve, a labeling reagent, a buffer solution, instruments and controls required for the test, a tool for collecting a biological sample from the oral cavity of a subject, a reagent for storing the collected biological sample, a storage container, a reagent for extracting genomic DNA from the collected biological sample, and the like. EXAMPLES

[0047] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0048] Example 1 Prediction of periodontal disease risk using subgingival plaque samples Obtaining clinical information and collecting specimens This study was approved by the Ethics Committee of Kao Corporation, and all subjects provided informed consent before the study was conducted. Gingivitis index (GI), bleeding index (BOP), and periodontal pocket depth (PPD) of all teeth were measured as dental clinical indicators. The dental clinical indicator values ​​at the sample collection site were used in the analysis of this study. Subgingival plaque was collected as samples from a total of 180 subjects in their 20s to 70s. Plaque was collected from the mandibular left lingual molar area (left lower lingual 4-7) after the dental clinical indicator values ​​were measured. All biological samples were frozen on dry ice immediately after collection and stored at -80°C until DNA extraction. Gingivitis Index (GI): An index showing the degree of gingival inflammation. Healthy gums with no inflammation were scored as 0, mild inflammation with no bleeding as 1, moderate inflammation with bleeding as 2, and severe inflammation with spontaneous bleeding as 3. Bleeding index (BOP): A dental probe was inserted into the periodontal pocket. If bleeding was observed, it was scored as 0, if pinpoint bleeding, it was scored as 1, if spurt bleeding, it was scored as 2, and if spontaneous bleeding, it was scored as 3. Periodontal pocket depth (PPD): The value obtained by inserting a dental probe into the periodontal pocket and measuring the depth of the pocket to the nearest 1 mm.

[0049] <DNA extraction from specimens> DNA extraction from the specimens was performed using a QIAcube with the DNeasy PowerSoil Kit (QIAGEN). 180 μL of Enzyme Lysis buffer (20 mM Tris-HCl (pH 8.0) (Nippon Gene), 2 mM EDTA (Nippon Gene), 1.2% Triton-X 100 (Sigma-Aldrich), 20 mg / mL Lysozyme (Sigma-Aldrich)) was added to the subgingival plaque samples from 180 subjects and incubated at 37°C for 50 minutes. 180 μL of the solution was removed from the Power Bead tube included with the kit and 60 μL of Solution C1 was added, and 180 μL of the plaque sample solution after incubation was added. After adding the sample, the Power Bead tube was crushed for 10 minutes at maximum speed (1 / 50 s) in a TissueLyser LT (QIAGEN), centrifuged at 10,000 g, 20°C, and 2 minutes, and 480 μL of the supernatant was transferred to the center tube of the Rotor Adapters (QIAGEN). After loading into the QIAcube, extraction was performed using the PowerSoil Kit IRT protocol and eluted with 70 μL. The extracted gDNA was stored at -80°C until further analysis.

[0050] <Amplicon PCR> The abundance data of genus and species levels in the subgingival plaque flora was calculated by 16S rRNA sequencing analysis of the V1-V2 region using the Miseq platform (Illumina). Amplicon PCR was performed using the following primer set capable of amplifying approximately 300 bp of the V1-V2 region of the bacterial 16S rRNA gene, with the PCR reaction solution composition in Table 2 and the reaction conditions in Table 3 using 2xKAPA HiFi HotStart ReadyMix (KAPA Biosystems). After the amplicon PCR reaction, appropriate amplification of the amplicon PCR product was confirmed by agarose gel electrophoresis, and then purified using AMPure XP (Beckman Coulter). For each sample, 20 μL of AMPure XP was used for purification according to the reagent protocol, and elution was performed with 40 μL of 10 mM Tris-HCl (pH 8.5) (Nippon Gene). Forward primer (27Fmod): 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG AGRGTTTGATYMTGGCTCAG-3' (SEQ ID NO: 9, the underlined part is the adapter sequence) Reverse primer (338R): 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGT GCTGCCTCCCGTAGGAGT-3' (SEQ ID NO: 10, the underlined part is the adapter sequence)

[0051] [Table 2]

[0052] [Table 3]

[0053] <index PCR> Index PCR was performed using Illumina's Nextera XT IndexKit (Illumina) and unique barcodes were added according to the attached protocol. PCR was performed using 2xKAPA HiFi HotStart ReadyMix (KAPA Biosystems) with the PCR reaction solution composition shown in Table 4 and reaction conditions shown in Table 5 below.

[0054] [Table 4]

[0055] [Table 5]

[0056] <16S rRNA sequencing> The resulting index PCR products were cleaned up in the same manner as the AMPure XP purification described above, and then the concentrations were measured by qPCR using the KAPA Library Quantification Kits (KAPA Biosystems) and pooled to prepare libraries. The library concentration was measured using the Qubit dsDNA HS Assay Kit (Life Technologies) with a Qubit Fluorometer 2.0 (Life Technologies) and adjusted to a final concentration of 8 pM (containing 15% PhiX). Sequencing was performed using the MiSeq Reagent Kit v3 (Illumina) with a 300 bp paired-end sequencing protocol according to the manufacturer's protocol.

[0057] <Analysis of sequence data and acquisition of bacterial species ratio data> The sequence data of 16S rRNA gene amplicons were analyzed using the open source software "QIIME2". For all paired reads, the end sequences including primer sequences and low-quality sequence data were removed, and amplicon sequence errors were corrected using DADA2 to obtain amplicon sequence variants (ASVs). Taxonomy for ASVs was assigned using a classifier trained on eHOMD 16S rRNA RefSeq (Version 15.22) and Taxonomy file (eHOMD 16S rRNA RefSeq Version 15.22 Taxonomy File for QIIME) with classify-sklearn naive Bayes taxonomy classifier. Following the QIIME2 analysis, the actual data analysis preprocessing and the acquisition of bacterial species ratio data (genus level) were obtained using the statistical software "R" using the qiime2R package and the phyloseq package. The number of reads was standardized to 7000 reads, and samples with fewer than 7000 reads were excluded from the analysis (173 samples were analyzed).

[0058] <Correlation analysis between dental clinical indicators and bacterial species ratio> For the 173 samples analyzed, dental clinical indicators (GI, BOP, PPD) were matched with the bacterial species ratio data (genus level) obtained. In order to cluster the dental clinical indicators and bacterial species proportion data (genus level) of each matched sample by similarity, the Euclidean distance of each sample was calculated using R, and then cluster analysis was performed using the Ward method, and the cluster classification and phylogenetic tree were visualized (Figure 1). The mean and standard deviation (SD) of the dental clinical indicators in each cluster were calculated to show the differences in gingival condition in each cluster (Table 6).

[0059] [Table 6]

[0060] The difference in the proportion of bacterial species (genus level) in each cluster for the top 20 genera with the highest average abundance ratio is shown in Table 7. Among these, bacteria that decrease with the progression of periodontal disease were defined as healthy bacteria, and bacteria that increase with the progression of periodontal disease were defined as risk bacteria.

[0061] [Table 7]

[0062] In the correlation analysis, in addition to healthy and risk bacteria, we also performed a correlation analysis between the abundance ratio (genus level) of the genera Porphyromonas, Tannerella, and Treponema, which belong to the Red complex, a periodontal disease-related bacteria, and GI or PPD. The correlation coefficient was calculated using Spearman's correlation coefficient, and the number of people for whom the correlation coefficient could be calculated was counted as the number of people who could be determined (Table 8).

[0063] [Table 8]

[0064] In Table 9, a correlation analysis was performed between the ratio of the abundance rate of healthy bacteria (genus level) to the abundance rate of risk bacteria / periodontal disease-related bacteria (genus level) (healthy bacteria / risk bacteria or healthy bacteria / periodontal disease-related bacteria) and GI or PPD, and in Table 10, a correlation analysis was performed between the ratio of the sum of the abundance rate of two types of healthy bacteria (genus level) to the abundance rate of risk bacteria / periodontal disease-related bacteria (genus level) ((proportion of healthy bacteria 1 + proportion of healthy bacteria 2) / risk bacteria or (proportion of healthy bacteria 1 + proportion of healthy bacteria 2) / periodontal disease-related bacteria) and GI or PPD. As in Table 8, the correlation coefficient was calculated using Spearman's correlation coefficient, and the number of people for whom the correlation coefficient could be calculated was counted as the number of people who could be determined.

[0065] [Table 9]

[0066] [Table 10]

[0067] The reason why healthy bacteria are not counted as a determinable number and the basis for the ratio are as follows. Simply put, healthy bacteria are normal bacteria that are possessed by healthy people and can be widely detected from saliva to dental plaque. Therefore, when the presence rate is 0%, it can be considered that they are not truly possessed, and it can be judged that they can be evaluated in all samples. On the other hand, periodontal disease-related bacteria are mainly obligate anaerobic bacteria that are detected in periodontal pockets after periodontal disease has progressed (Non-Patent Document 1). In other words, when the value is 0%, it is impossible to determine whether the true possession rate is 0%, or whether the bacteria are actually possessed in the periodontal pocket but have not been detected due to a shift in the sample collection site. Although risk bacteria are not as strict anaerobic as periodontal disease-related bacteria, due to their nature, it is difficult to assert that a detection rate of 0% truly means a possession rate of 0%. Therefore, in order to appropriately assess periodontal disease risk in healthy individuals with shallow periodontal pockets or patients with early periodontal disease, it is thought necessary to make judgments only when risk bacteria or periodontal disease-related bacteria are detected. It is important to increase the number of possible judgments while maintaining sufficient accuracy in assessing periodontal disease risk in healthy individuals and patients with early periodontal disease.

[0068] JPEG2024157856000011.jpg112170

[0069] <Result> Cluster analysis formed four clusters with different stages of periodontal disease progression, and the subjects were divided into Group 1 with an average GI of 0.07 and almost no gingival inflammation, Groups 2 and 3 with an average GI of less than 1.0 and very mild gingival inflammation, and Group 4 with an average GI of 1.33 and gingival inflammation (Figure 1). Using the GI, a representative index for evaluating gingival inflammation, the group with an average GI of less than 0.2 is classified as a healthy group with almost no signs of gingival inflammation, the group with an average GI of 0.2 to less than 1.0 is classified as an early periodontal disease group with gingival inflammation in several places, and the group with an average GI of 1.0 or more is classified as an advanced periodontal disease group with inflammation in many places and a risk of progressing to not only gingivitis but also periodontitis. Group 1 corresponds to the healthy group, Groups 2 and 3 to the early periodontal disease group, and Group 4 to the advanced periodontal disease group. Therefore, the bacteria that decrease with the progression of periodontal disease were defined as healthy bacteria, and the bacteria that increase with the progression of periodontal disease were defined as risk bacteria. Note that, since this analysis intends to utilize bacterial species data that is widely held by everyone from healthy individuals to those with periodontal disease, the bacterial species proportion data at the genus level for the top 20 average abundance ratios was used as the bacterial species proportion data. As a result, among the many species of bacteria normally present in the oral cavity, the genera Neisseria, Arachnia, Cardiobacterium, and Haemophilus were found to be healthy bacteria, while the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas were found to be risk bacteria (Table 7). Table 8 shows the results of an analysis of the correlation between the abundance ratio (genus level) of these bacterial species and GI or PPD. Additionally, the correlation between the abundance ratio (genus level) of periodontal disease-related bacteria to which the Red complex belongs and GI or PPD is also shown as a benchmark. Even with risk bacteria alone, the correlation coefficient with GI was about 0.3, indicating an association with the progression of periodontal disease (Table 8). As is generally said, a higher correlation coefficient with GI was obtained by using the genera Tannerella and Treponema, which correspond to periodontal disease-related bacteria, compared to risk bacteria, but the number of people who could be determined was low, at 95 and 122 out of 173, respectively. We carefully considered ways to increase the number of possible determinations while maintaining the accuracy of determination (the absolute value of the correlation coefficient with GI), and found that by calculating the ratio of the abundance ratio (genus level) of healthy bacteria to risk bacteria, it was possible to maintain sufficient accuracy of determination for some combinations while significantly increasing the number of possible determinations compared to when periodontal disease-related bacteria were used. Specifically, in the combination of one healthy genus and one risky genus, the number of possible determinations was significantly increased while maintaining sufficient accuracy by utilizing the ratio of the abundance ratio of one of the genera Neisseria, Cardiobacterium, and Haemophilus among the healthy bacteria to the abundance ratio of one of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas among the risky bacteria. On the other hand, when Arachnia was used as the healthy bacteria, the effect was not observed (Table 9). When two genera of healthy bacteria were used, as shown in Table 10, a combination was observed in which the number of possible determinations was significantly increased while maintaining sufficient accuracy by utilizing the ratio of the sum of the abundance ratio of two genera of the healthy bacteria Neisseria, Arachnia, Cardiobacterium, and Haemophilus to the abundance ratio of one of the risk bacteria Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas. Therefore, by calculating the ratio of the abundance of specific healthy bacteria (genera Neisseria, Cardiobacterium, and Haemophilus) that we have defined among the oral flora to the risk bacteria (genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas), i.e., the ratio of the bacterial amount of the healthy bacteria to the bacterial amount of the risk bacteria, we found that periodontal disease risk testing, which was previously only possible in patients with advanced periodontal disease, can be widely applied to everyone from healthy individuals to those with periodontal disease.

Claims

1. A method for detecting periodontal disease risk, comprising the steps of: measuring the ratio (a / b) of the bacterial amount (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium to the bacterial amount (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas in a biological sample taken from the oral cavity of a subject; and comparing the measured ratio (a / b) of bacterial amounts with a reference value.

2. The method according to claim 1, wherein the ratio (a / b) of the bacterial mass (a) of one or two genera selected from the group consisting of the genera Neisseria, Haemophilus, and Cardiobacterium to the bacterial mass (b) of one genus selected from the group consisting of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas is measured.

3. The method according to claim 1, wherein the ratio (a / b) of the bacterial amounts in any of the following (i) to (xi) is measured. (i) The ratio (a / b) of the bacterial load of the genus Neisseria (a) to the bacterial load of the genus Saccharibacteria (TM7) [G-1] (b) (ii) The ratio (a / b) of the bacterial load of the genus Haemophilus (a) to the bacterial load of the genus Prevotella (b) (iii) The ratio (a / b) of the bacterial load of the genus Haemophilus (a) to the bacterial load of the genus Saccharibacteria (TM7) [G-1] (b) (iv) The ratio (a / b) of the bacterial load of the genus Haemophilus (a) to the bacterial load of the genus Selenomonas (b) (v) The ratio (a / b) of the bacterial load of the genus Cardiobacterium (a) to the bacterial load of the genus Saccharibacteria (TM7) [G-1] (b) (vi) The ratio (a / b) of the bacterial load of the genus Cardiobacterium (a) to the bacterial load of the genus Selenomonas (b) (vii) The ratio (a / b) of the bacterial load of Neisseria and Haemophilus genera (a) to the bacterial load of Saccharibacteria (TM7) [G-1] genera (b) (viiii) The ratio (a / b) of the bacterial load of Neisseria and Cardiobacterium genera (a) to the bacterial load of Saccharibacteria (TM7) [G-1] genera (b) (ix) Ratio (a / b) of bacterial load of the genera Cardiobacterium and Haemophilus (a) to bacterial load of the genera Prevotella (b) (x) The ratio (a / b) of the bacterial load of the genera Cardiobacterium and Haemophilus (a) to the bacterial load of the genera Saccharibacteria (TM7) [G-1] (b) (xi) The ratio (a / b) of the bacterial load of the genera Cardiobacterium and Haemophilus (a) to the bacterial load of the genera Selenomonas (b)

4. The method according to claim 1, wherein the periodontal disease risk is the risk of developing periodontal disease or the risk of worsening periodontal disease in its early stages.

5. A method for evaluating an intervention, comprising the steps of: measuring the ratio (a / b) of the bacterial load (a) of at least one genus selected from the group consisting of Neisseria, Haemophilus, and Cardiobacterium to the bacterial load (b) of at least one genus selected from the group consisting of Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas in a biological sample taken from the oral cavity of a subject before and after a preventive or therapeutic intervention for periodontal disease; and evaluating an intervention that increases the ratio (a / b) of bacterial loads as an intervention that has a preventive or therapeutic effect on periodontal disease.

6. A kit for detecting periodontal disease risk used in any one of claims 1 to 4, or a kit for evaluating an intervention used in the method according to claim 5, comprising a reagent for measuring the bacterial load of at least one genus selected from the group consisting of the genera Neisseria, Haemophilus, and Cardiobacterium, and the bacterial load of at least one genus selected from the group consisting of the genera Saccharibacteria (TM7) [G-1], Prevotella, and Selenomonas.

Images