Depleting unwanted RNA species

Abstract

To provide methods and kits for inhibiting cDNA synthesis of unwanted RNA species during reverse transcription.SOLUTION: The methods and kits use blocking oligonucleotides such as those comprising locked nucleic acids (LNAs). In another aspect, the present disclosure provides a set of blocking oligonucleotides that are complementary (preferably fully complementary) to a plurality of regions of an unwanted RNA species, where each blocking oligonucleotide comprises one or more modified nucleotides that increase its binding to a region of the unwanted RNA species.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing Statement The sequence listing accompanying this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference. The name of the text file containing the sequence listing is 830109_416WO_SEQUENCE_LISTING.txt. The text file is 97.5KB, was created on September 15, 2019, and has been submitted electronically via EFS-Web.

[0002] background The present disclosure relates to methods and kits for purging undesired RNA species from an RNA sample, particularly for constructing a transcriptome sequencing library. [Background technology]

[0003] Libraries constructed for transcriptome sequencing are composed of a large amount of undesired species (e.g., cytoplasmic ribosomal RNA, mitochondrial ribosomal RNA, and globin mRNA) that take up most of the sequencing budget and make RNA sequencing extremely inefficient. rRNA alone constitutes more than 80% of the RNA found in a sample. As a result, various methods have been developed to enrich mRNA or clear undesired RNA from next-generation sequencing (NGS) libraries. For example, poly(A) RNA is isolated from RNA samples. Although effective, this procedure is laborious and does not allow for the characterization of long non-coding RNAs or other RNAs that lack polyA tails. Moreover, it is unsuitable for highly damaged samples, such as FFPE samples. Other methods use antisense DNA or RNA probes to hybridize undesired RNAs in RNA samples prior to NGS library construction. After hybridization, in one approach, the sample is digested with a double-stranded RNA-specific enzyme (RNase H), thus removing the RNA probe and undesired RNA. However, this method is not very efficient and is fraught with technical uncertainties. In an alternative approach, the probes are biotinylated probes, allowing the undesired RNA to be selectively removed from the sample by capturing the probe / target RNA molecules on streptavidin-coated beads or surfaces. However, this method is time-consuming, costly, and only marginally effective. Furthermore, binding and washing of the beads is difficult, and usually results in significant sample loss due to non-specific binding and capture. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure provides methods, blocking oligonucleotides, compositions and kits for elimination of undesired RNA species from an RNA sample.

[0005] In one aspect, the disclosure provides a method for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription, the method comprising: (a) providing an RNA sample containing one or more desired RNA species and one or more undesired RNA species; (b) annealing one or more blocking oligonucleotides to one or more regions of one or more undesired RNA species in the RNA sample to generate a template mixture, the one or more blocking oligonucleotides are complementary to and stably bind to one or more regions of the one or more undesired RNA species and contain a 3' modification that prevents extension of the one or more blocking oligonucleotides; and (c) mixing the template mixture: (i) at least one reverse transcriptase; (ii) one or more reverse transcription primers, and (iii) Reaction buffer under conditions sufficient to synthesize cDNA molecules using one or more desired RNA species as templates, wherein cDNA synthesis using one or more undesired RNA species is inhibited.

[0006] In another aspect, the disclosure provides a set of blocking oligonucleotides that are complementary (preferably fully complementary) to multiple regions of an undesired RNA species, each blocking oligonucleotide containing one or more modified nucleotides that increase its binding to a region of the undesired RNA species.

[0007] In a related aspect, the disclosure provides multiple sets of blocking oligonucleotides.

[0008] In another aspect, the disclosure provides a kit for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample, comprising: (1)(a) one or more blocking oligonucleotides complementary to one or more regions of one or more undesired RNA species in an RNA sample, each containing one or more modified nucleotides that increase binding between the one or more blocking oligonucleotides and a region of the one or more undesired RNA species; or (b) a set of a plurality of sets of blocking oligonucleotides provided herein; and (2) Reverse transcriptase A kit comprising:

[0009] In another aspect, the disclosure provides a method for designing blocking oligonucleotides for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription, comprising: (a) generating a plurality of blocking oligonucleotides complementary to regions of one or more undesired RNA species; (b) filtering out non-acceptable blocking oligonucleotides; (c) generating one or more populations of blocking oligonucleotides that are complementary to a plurality of different regions of the one or more undesired RNA species; and (d) optionally shuffling the blocking oligonucleotides between the groups to generate new groups of blocking oligonucleotides and selecting one or more of the new groups of blocking oligonucleotides. The present invention provides a method comprising:

[0010] In another aspect, the present disclosure provides the use of a kit of any of claims 28 to 43 or component (1) thereof in inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample. [Brief description of the drawings]

[0011] [Figure 1]FIG. 1 is a scatter plot comparing the relative gene expression of non-rRNA genes between the use of the Ribo-Zero rRNA Removal kit (Illumina) and the use of blocking oligonucleotides (blockers B1 to B193) in eliminating undesired RNA species according to Example 2.

[0012] [Diagram 2] FIG. 2 is a scatter plot comparing the relative gene expression of non-rRNA genes between the use of blocking oligonucleotides (blockers B1 to B193) and polyA selection in the elimination of undesired RNA species according to Example 2.

[0013] [Diagram 3] FIG. 3 is a scatter plot comparing the relative gene expression of non-rRNA genes between the use of the Ribo-Zero rRNA Removal kit (Illumina) and the use of polyA in the elimination of undesired RNA species according to Example 2.

[0014] [Figure 4] FIG. 4 is a scatter plot comparing the relative gene expression of non-rRNA genes between the use of the Ribo-Zero rRNA Removal kit (Illumina) in removing unwanted RNA species according to Example 2 and no removal.

[0015] [Diagram 5] FIG. 5 is a scatter plot comparing the relative gene expression of non-rRNA genes between the use of blocking oligonucleotides (blockers B1 to B193) in elimination of undesired RNA species according to Example 2 and no elimination.

[0016] [Figure 6] FIG. 6 illustrates an exemplary algorithm for designing blockers as described in Example 4.

[0017] [Figure 7]FIG. 7 is a graph showing the relationship between the number of blockers and the percentage of target 5S rRNA covered by the blockers, as described in Example 4.

[0018] [Figure 8] FIG. 8 is a graph showing the relationship between the number of blockers and the percentage of target 16S rRNA covered by the blockers, as described in Example 4.

[0019] [Figure 9] FIG. 9 is a graph showing the relationship between the number of blockers and the percentage of target 23S rRNA covered by the blockers, as described in Example 4. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The present disclosure provides methods, blocking oligonucleotides, compositions and kits for eliminating undesired RNA species from an RNA sample. The resulting eliminated RNA sample is useful for a variety of downstream applications, particularly for constructing a transcriptome sequencing library.

[0021] The methods provided herein use blocking oligonucleotides (e.g., locked nucleic acid (LNA)-enhanced antisense oligonucleotides) complementary to regions of undesired RNA species to inhibit cDNA synthesis of undesired RNA species during reverse transcription.

[0022] Also disclosed are methods for designing blocking oligonucleotides (e.g., LNA-enhanced antisense oligonucleotides) that are spaced along undesired RNAs (e.g., cytoplasmic and mitochondrial rRNAs, globin mRNAs) at designated positions. LNA bases are placed in the oligonucleotides to promote persistent binding of the antisense oligonucleotides to undesired RNAs at commonly used reverse transcription temperatures.

[0023] The methods of eliminating undesired RNA species provided herein have one or more of the following advantages over existing methods: (1) because undesired RNA elimination by the methods occurs during rather than before NGS library construction, they are faster and take fewer steps; (2) the methods can be used with tethered oligo(dT) primed libraries as well as random 6mer primed libraries; (3) the methods can be used to eliminate any undesired RNA (in contrast to enriching only poly(A)-containing RNA using oligo(dT)); (4) the methods do not significantly alter the remaining RNA profile of the sample (in contrast to poly(A) mRNA enrichment using oligo(dT)); (5) the methods are more effective or at least as effective as existing methods in eliminating undesired RNA; and (6) the methods cause less sample loss (e.g., compared to rRNA removal using biotin-labeled antisense oligonucleotides and streptavidin-coated magnetic beads).

[0024] In the following description, any range provided herein includes all values ​​within that range. It should be noted that the term "or" is generally used in its sense including "and / or" (i.e., meaning either one, both, or any combination of alternatives) unless the content dictates otherwise. Furthermore, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include the plural forms unless the content dictates otherwise. The terms "include," "having," "comprise," "including ... and variants thereof are used interchangeably and should be construed as non-limiting. The term "about" refers to ±10% of the reference value. For example, "about 50°C" refers to "50°C ±5°C" (i.e., 50°C ±10% of 50°C).

[0025] A. Methods for eliminating unwanted RNA species In one aspect, the disclosure provides a method for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription, the method comprising: (a) providing an RNA sample containing one or more desired RNA species and one or more undesired RNA species; (b) annealing one or more blocking oligonucleotides to one or more regions of one or more undesired RNA species in the RNA sample to generate a template mixture, the one or more blocking oligonucleotides are complementary to and stably bind to one or more regions of the one or more undesired RNA species and contain a 3' modification that prevents extension of the one or more blocking oligonucleotides; and (c) mixing the template mixture: (i) at least one reverse transcriptase; (ii) one or more reverse transcription primers, and (iii) Reaction buffer under conditions sufficient to synthesize cDNA molecules using one or more desired RNA species as templates, wherein cDNA synthesis using one or more undesired RNA species is inhibited. The present invention provides a method comprising:

[0026] 1. Inhibiting cDNA synthesis cDNA synthesis of an RNA species is inhibited if the amount of single-stranded or double-stranded cDNA produced during reverse transcription using the RNA species as a template is reduced to a statistically significant extent under altered conditions (e.g., in the presence of one or more blocking oligonucleotides complementary to one or more regions of the RNA species) compared to the amount of single-stranded or double-stranded cDNA produced during reverse transcription under reference conditions (e.g., in the absence of one or more blocking oligonucleotides).

[0027] The reduction in the amount of cDNA synthesized can be measured using qPCR or transcriptome sequencing as disclosed in the examples provided herein, and can also include other techniques known to those of skill in the art (e.g., DNA microarrays).

[0028] Inhibition of cDNA synthesis of an RNA species can be referred to as elimination of the RNA species or elimination of the RNA species. Even if the RNA species is not physically removed from the initial RNA sample, the participation of the RNA species in downstream manipulations or analyses of the initial RNA sample is reduced or eliminated due to inhibition of cDNA synthesis of the RNA species.

[0029] 2. Unwanted RNA species The term "undesirable RNA species," "undesirable RNA," or "undesirable RNA molecule" refers to an RNA species or molecule that is not desired in an initial RNA composition for a given downstream manipulation or analysis of the RNA composition. Such an RNA species or molecule is not the target of the downstream manipulation or analysis and may interfere with it.

[0030] The undesired RNA may be any undesired RNA present in the initial RNA composition. The undesired RNA may comprise any sequence, so long as it is distinguishable from the remaining RNA population of interest by its sequence, allowing for sequence-specific design of blocking oligonucleotides.

[0031] According to one embodiment, the undesired RNA is selected from one or more of the group consisting of rRNA, tRNA, snRNA, snoRNA and abundant protein mRNA.

[0032] When processing eukaryotic samples, the undesired RNA may be eukaryotic rRNA, preferably selected from 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA, mitochondrial 12S rRNA and mitochondrial 16S rRNA. Preferably, at least two, at least three, more preferably at least four of said rRNA types are deleted, where preferably 18S rRNA and 28S rRNA are among the rRNAs to be deleted. According to one embodiment, all of said rRNA types are deleted. Furthermore, in addition to 28S rRNA and 18S rRNA, it is also preferred to delete other non-coding rRNA species, such as 12S and 16S eukaryotic mitochondrial rRNA molecules. When processing total RNA from plant samples, plastid rRNA, such as chloroplast rRNA, may be deleted.

[0033] In certain embodiments, the undesired RNA is one or more selected from the group consisting of 23S, 16S and 5S prokaryotic rRNA.This is particularly feasible when processing prokaryotic samples.Preferably, all these rRNA types are eliminated using one or more groups of blocking oligonucleotides that are specific to each rRNA type.

[0034] Furthermore, the disclosed method can also be used to specifically eliminate abundant protein-coding mRNA species. Depending on the sample processed, the mRNA contained in the sample may correspond mainly to a certain abundant mRNA type. For example, when it is intended to analyze, e.g., sequence, the transcriptome of a blood sample, most of the mRNA contained in the sample corresponds to globin mRNA. However, for many applications, the sequence of the contained globin mRNA is not of interest, and thus, although it is a protein-coding mRNA, globin mRNA represents undesirable RNA for this application. Additional undesirable abundant protein-coding mRNAs can include ACTB, B2M, GAPDH, GUSB, HPRT1, HSP90AB1, LDHA, NONO, PGK1, PPIH, RPLP0, TFRC, or various mitochondrial genes.

[0035] In certain embodiments, as described below, the RNA sample can be derived from (e.g., isolated from) a starting material containing nucleic acids from multiple organisms, such as an environmental sample containing plant, animal and / or bacterial species, or a clinical sample containing human cells or tissues and one or more bacterial species. In such embodiments, the undesired RNA species can include or consist of a specific type of RNA species (e.g., 5S rRNA) from multiple organisms (e.g., multiple different bacteria) present in the starting material, such that the method can inhibit cDNA synthesis of a specific type of RNA species from multiple organisms (e.g., inhibit cDNA synthesis of 5S rRNA from multiple bacteria in the starting material). In some other embodiments, the undesired RNA species can include or consist of a multiple type of RNA species (e.g., 5S, 16S and 23S rRNA) from multiple organisms (e.g., multiple different bacteria) present in the starting material, such that the method can inhibit cDNA synthesis of a multiple type of RNA species from multiple organisms (e.g., inhibit cDNA synthesis of 5S rRNA from multiple bacteria in the starting material).

[0036] In certain embodiments, the number of different undesired RNA species to which the blocking oligonucleotides are complementary is at least 2, at least 3, at least 4, or at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400 or at least 500, and / or at most 1,000,000, at most 500,000, at most 100,000, at most 50,000, at most 10,000, at most 9000, at most 8000, at most 7000, at most 6000, at most 5000, at most 4000, at most 3000, or at most 2000, e.g., 2 to 1,000,000, 100 to 500,000, 500 to 100,000, and 1000 to 10,000.

[0037] 3.RNA Samples As described above, step (a) of the method for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription disclosed herein is providing an RNA sample containing one or more desired RNA species and one or more undesired RNA species.

[0038] The term "RNA sample" refers to a sample containing RNA. Preferably, the RNA sample is a sample that contains RNA isolated from starting material. The RNA sample can further contain DNA isolated from starting material. In some embodiments, the RNA sample contains RNA molecules that are isolated from starting material and further fragmented. In other cases, the RNA sample is derived from a sample that is directly dissolved without specific nucleic acid isolation.

[0039] The term "nucleic acid" or "nucleic acids (plural)" as used herein generally refers to a polymer containing ribonucleosides or deoxyribonucleosides covalently linked by phosphodiester bonds between the subunits. Nucleic acids include DNA and RNA. DNA includes, but is not limited to, genomic DNA, linear DNA, circular DNA, plasmid DNA, cDNA and free circulating DNA (e.g., tumor-derived or fetal DNA). RNA includes, but is not limited to, hnRNA, mRNA, non-coding RNA (ncRNA) and free circulating RNA (e.g., tumor-derived RNA). Non-coding RNA includes, but is not limited to, rRNA, tRNA, lncRNA (long non-coding RNA), lincRNA (long intergenic non-coding RNA), miRNA (microRNA) and siRNA (small interfering RNA). The starting material from which the RNA sample is generated may be any material that contains RNA molecules. The starting material may be a biological sample or material, such as a cell sample, an environmental sample, a sample obtained from the body, particularly a body fluid sample, and a human, animal or plant tissue sample. Specific examples include, but are not limited to, whole blood, blood products, plasma, serum, red blood cells, white blood cells, buffy coat, urine, sputum, saliva, semen, lymph, amniotic fluid, cerebrospinal fluid, peritoneal effusion, pleural fluid, fluid from cysts, synovial fluid, vitreous fluid, aqueous humor, bursafluid, eye wash, eye aspirate, lung wash, bone marrow aspirate, lung aspirate, biopsy sample, swab sample, animal (including human) or plant tissue, as well as lysates, extracts or materials and fractions obtained from the above samples, or any cells and microorganisms and viruses that may be present on or in the sample, etc.

[0040] Materials obtained from clinical or forensic situations containing RNA also fall within the intended meaning of starting material. Preferably, the starting material is a biological sample derived from a eukaryote or prokaryote, preferably from a human, animal, plant, bacteria or fungus. Preferably, the starting material is selected from the group consisting of cells, tissues, tumor cells, bacteria, viruses and body fluids, such as blood, blood products (e.g. buffy coat, plasma and serum), urine, liquor, sputum, faeces, CSF and semen, epithelial swabs, biopsies, bone marrow samples and tissue samples, preferably organ tissue samples, such as lung, kidney or liver.

[0041] Starting materials also include processed samples, such as preserved, fixed and / or stabilized samples. Non-limiting examples of such samples include preserved, for example, formalin-fixed and paraffin-embedded cell-containing samples (FFPE samples), or other samples treated with cross-linking or non-cross-linking fixatives (for example, glutaraldehyde) or PAXgene Tissue system. For example, tumor biopsy samples are routinely preserved after surgical procedures by FFPE, which may compromise the integrity of RNA, and in particular may degrade the RNA contained therein. Thus, RNA samples can consist of or contain modified or degraded RNA. Modification or degradation can be, for example, by treatment with preservatives.

[0042] Nucleic acid can be isolated from the starting material by methods known in the art to provide an RNA sample. The RNA sample can contain both DNA and RNA. In certain embodiments, the DNA in the starting material is removed or degraded, so that the RNA sample contains mainly RNA. The RNA in the RNA sample can be the total RNA isolated from the starting material. Alternatively, the RNA in the RNA sample can be a fraction (e.g., a fraction containing mostly mRNA) of the total RNA isolated from the starting material, in which certain RNA species (e.g., RNA without poly(A) tail) are deleted or removed.

[0043] As disclosed above, the RNA sample can contain RNA molecules that are isolated from the starting material and further fragmented. Fragmenting nucleic acids such as isolated RNA can be performed physically, enzymatically or chemically. Physical fragmentation includes acoustic shearing, sonication and hydrodynamic shearing. Enzymatic fragmentation can use endonucleases (e.g., RNase III) that cut RNA into small fragments with 5' phosphate and 3' hydroxyl groups. Chemical fragmentation includes heat and divalent metal cations (e.g., magnesium or zinc).

[0044] Similarly, as disclosed above, in certain embodiments, the RNA sample is derived from a crude lysate in which no specific nucleic acid isolation has been performed.

[0045] 4. Desired RNA species In addition to undesired RNA, RNA sample also contains one or more desired RNA species.Desired RNA species can be any RNA species or molecule whose characteristics (e.g., expression level or sequence) are of interest.In certain embodiments, desired RNA species includes mRNA, preferably whose expression level change (compared to reference expression level) or whose sequence change (compared to wild-type sequence) is associated with disease or disorder, or response to treatment of disease or disorder.

[0046] 5. Blocking Oligonucleotides The term "blocking oligonucleotide" as used herein refers to an oligonucleotide that is complementary to and can stably bind to a region of an undesired RNA species. A blocking oligonucleotide can be described as "targeting" a region of an undesired RNA species. A blocking oligonucleotide cannot be extended due to the modification of its 3' end (i.e., "3' modification"). As a result, a blocking oligonucleotide can use the region of an undesired RNA species as a template during reverse transcription to inhibit cDNA synthesis.

[0047] During reverse transcription of an RNA sample that contains an RNA species, if an oligonucleotide anneals to a region of the RNA species and remains bound to a region of the RNA species, the oligonucleotide may be stably bound to a region of the RNA species.

[0048] Preferably, blocking oligonucleotide contains one or more modified nucleotides that increase the binding between oligonucleotide and the region of undesired RNA species compared to the oligonucleotide with the same sequence but without any modified nucleotides.In certain other embodiments, blocking oligonucleotide does not contain any of the above modified nucleotides, but is long enough to be able to stably bind to the region of undesired RNA species during reverse transcription.

[0049] In embodiments in which the blocking oligonucleotide contains one or more modified nucleotides that increase binding between the oligonucleotide and a region of the undesired RNA species, the region of the undesired RNA species to which the blocking oligonucleotide is complementary may be at least 10 nucleotides in length, e.g., at least 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides in length. Such a region may be at most 100 nucleotides in length, e.g., at most 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 24, 23, 22, 21, or 20 nucleotides in length. In certain embodiments, the region may be 10-100 nucleotides in length, e.g., 15-80, 20-60, 25-40, 10-30, 16-24, or 18-22 nucleotides in length.

[0050] In embodiments in which the blocking oligonucleotide does not contain any modified nucleotides that increase binding between the oligonucleotide and a region of the undesired RNA species, the region of the undesired RNA species to which the blocking oligonucleotide is complementary may be at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length. Such regions may be at most 100 nucleotides in length, e.g., at most 90, 80, 70, 60, or 50 nucleotides in length. In certain embodiments, the region may be 20-100 nucleotides in length, e.g., 25-90, 25-80, 25-70, 25-60, 25-50, 25-40, 25-30, 30-90, 30-80, 30-70, 30-60, 30-50, 30-40, 35-90, 35-80, 35-70, 35-60, 35-50, 35-40, 40-90, 40-80, 40-70, 40-60 or 40-50 nucleotides in length.

[0051] As disclosed above, a blocking oligonucleotide is complementary to a region of an undesired RNA species. An oligonucleotide is complementary to a region of an undesired RNA species when at least 80%, for example at least 85%, at least 90% or preferably at least 95% of the nucleotides in the oligonucleotide are complementary to the region of an undesired RNA species. In certain embodiments, a blocking oligonucleotide comprises one or more (for example, at most 6, at most 5, at most 4, at most 3, at most 2 or only 1) nucleotide mismatches with a region of an undesired RNA species. Preferably, the mismatches are at or near the 5' end of the oligonucleotide (for example, within the first 10 nucleotides therefrom, for example, within the first 5 nucleotides therefrom). For example, a blocking oligonucleotide having a sequence of 5'-GACAAACCCTTGTGTCGAG-3' (SEQ ID NO: 15) is complementary to a region of an undesired RNA species of 3'-GTCGACACAAGGGTTTGTC-5' (SEQ ID NO: 508), even if there is a mismatch between the "G" at the 5' end of the oligonucleotide and the "G" at the 3' end of the region of the undesired RNA species. In certain other embodiments, the blocking oligonucleotide can include one or more nucleotide insertions (e.g., an insertion having at most 6, at most 5, at most 4, at most 3, at most 2 or as few as one nucleotide) when compared to the fully complementary sequence of the region of the undesired RNA species. For example, the blocking oligonucleotide can include two segments that are each fully complementary to two consecutive sections of the region of the undesired RNA species, but separated by one or more nucleotides.

[0052] Preferably, the blocking oligonucleotide is completely complementary to a region of the undesired RNA species. An oligonucleotide is completely complementary to a region of the undesired RNA species when each nucleotide of the oligonucleotide is complementary to a nucleotide at a corresponding position of the region of the undesired RNA species. For example, an oligonucleotide having a sequence of 5'-GACAAACCCTTGTGTCGAG-3' (SEQ ID NO: 15) is completely complementary to a region of 3'-CTCGACACAAGGGTTTGTC-5' (SEQ ID NO: 509) of the undesired RNA species.

[0053] As also disclosed above, blocking oligonucleotides have 3' modifications that prevent oligonucleotides from being extended during reverse transcription. 3' modifications replace the 3'-OH of oligonucleotides with another group (e.g., phosphate group), which makes the resulting oligonucleotides unable to be extended by reverse transcriptase during reverse transcription. 3' modifications that prevent oligonucleotides containing such modifications from being extended include, but are not limited to, 3'ddC (dideoxycytidine), 3'inverted dT, 3'C3 spacer, 3'Amino Modifier (3AmMo) and 3' phosphorylation. Some of the 3' modifications are commercially available, for example, from Integrated DNA Technologies.

[0054] a. Blocking oligonucleotides with modified nucleotides to increase binding As disclosed above, preferably the blocking oligonucleotide contains one or more modified nucleotides that increase binding between the blocking oligonucleotide and the region of the undesired RNA species to which it is complementary, compared to an oligonucleotide having the same sequence but without any modified nucleotides.

[0055] Modified nucleotides are nucleotides other than naturally occurring nucleotides that each contain a phosphate group, a five-carbon sugar (ie, deoxyribose or ribose), and a nitrogenous base selected from adenine, cytosine, guanine, thymine and uridine.

[0056] A modified nucleotide increases binding between an oligonucleotide and a region of an undesired RNA species, compared to an oligonucleotide having the same sequence but without any modified nucleotides, if it increases the melting temperature of a duplex formed between an oligonucleotide containing the modified nucleotide and a region of an undesired RNA species, compared to the melting temperature of a duplex formed between an oligonucleotide having the same sequence but without any modified nucleotides and a region of an undesired RNA species, measured under the same conditions (e.g., 20 mM KCl).

[0057] The melting temperature (Tm) of an oligonucleotide used in this disclosure is the temperature at which 50% of the oligonucleotide is duplexed with its perfect complement and 50% is free in 115 mM KCl.Tm is determined by measuring the absorbance change of the oligonucleotide with its complement as a function of temperature (i.e., generating a melting curve).Tm is the halfway reading between the plateaus of double-stranded DNA and single-stranded DNA in the melting curve.

[0058] Exemplary nucleotides that can increase the Tm of an oligonucleotide containing such nucleotides include, but are not limited to, nucleotides containing 2'-O-methyl ribose, 5-hydroxybutynyl-2'-deoxyuridine (Integrated DNA Technologies), 2-amino-2'deoxyadenosine (IBA Lifesciences), 5-methyl-2'deoxycytidine (IBA Lifesciences), or locked nucleic acids (LNAs).

[0059] Preferably, the blocking oligonucleotide comprises one or more LNAs. LNAs are modified RNA nucleotides. The ribose portion of LNA nucleotides is modified with an additional bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (north) conformation, which is often found in A-form duplexes. LNA nucleotides can be mixed with DNA or RNA residues of oligonucleotides and can hybridize with DNA or RNA by Watson-Crick base pairing rules. The locked ribose conformation enhances base stacking and backbone preorganization. This significantly increases the hybridization properties (melting temperature) of oligonucleotides (see, for example, Kauret et al., Biochemistry 45(23):7347-55, 2006; Owczarzy et al., Biochemistry50(43):9352-67, 2011). When incorporated into an oligonucleotide, the increase in the melting temperature of the duplex may be 2-8° C. per LNA nucleotide. DNA or RNA oligonucleotides containing one or more LNA nucleotides are referred to as "LNA oligonucleotides." Such oligonucleotides can be synthesized by conventional phosphoramidite chemistry and are also commercially available (e.g., from Exiqon).

[0060] Additional blocking oligonucleotides may be peptide nucleic acid oligomers, which are synthetic polymers with a backbone composed of repeating N-(2-aminoethyl)-glycine units similar to DNA or RNA but linked by peptide bonds. In peptide nucleic acid oligomers, the various purine and pyrimidine bases are linked to the backbone by methylene bridges (-CH2-) and carbonyl groups (-(C=O)-).

[0061] The number of modified nucleotides (eg, LNA) in the blocking oligonucleotide ranges from 3-30, preferably 4-16, and more preferably 3-15.

[0062] The length of the blocking oligonucleotides may be at least 10 nucleotides long, such as at least 11, 12, 13, 14, 15, 16, 17 or 18 nucleotides long. They may be at most 100 nucleotides long, such as at most 100 nucleotides long, such as at most 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 24, 23, 22, 21 or 20 nucleotides long. In certain embodiments, the length may be between 10 and 100 nucleotides, such as between 15 and 80, 20 and 60, 25 and 40, 10 and 30, 16 and 24 or 18 and 22 nucleotides.

[0063] The melting temperature of the duplex formed between the blocking oligonucleotide and the region of the undesired RNA species to which it is complementary ranges from 80 to 96°C, 82 to 94°C, or preferably 86 to 92°C, when measured in 115 mM KCl.

[0064] b. Blocking oligonucleotides without modified nucleotides to increase binding As disclosed above, in certain embodiments, the blocking oligonucleotide does not contain any modified nucleotides that would increase binding between the blocking oligonucleotide and the region of the undesired RNA species to which it is complementary, but is long enough that it can stably bind to a region of the undesired RNA species during reverse transcription.

[0065] The length of the blocking oligonucleotides without modified nucleotides described above may be at least 20 nucleotides long, such as at least 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleotides long. They may be at most 100 nucleotides long, such as at most 90, 80, 70, 60, 50, 45 or 40 nucleotides long. In certain embodiments, the length may be 25-100 nucleotides, such as 30-80, 30-70, 30-60, 30-50, 30-45, 30-40, 35-80, 35-70, 35-60, 35-50, 35-45, 40-80, 40-70, 40-60, 40-50 or 40-45 nucleotides.

[0066] The melting temperature of the duplex formed between the blocking oligonucleotide and the region of the undesired RNA species to which it is complementary ranges from 80 to 96°C, 82 to 94°C, or preferably 86 to 92°C, when measured in 115 mM KCl.

[0067] c. Multiple blocking oligonucleotides The number of blocking oligonucleotides used in the methods disclosed herein may be at least 2, at least 3, at least 4, at least 5, at least 10, at least 50, at least 100, at least 150, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500 or at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000 or at least 10,000, and / or at most 100,000, at most 90,000, at most 80,000, at most 70,000, at most 60,000 or at most 50,000, e.g., from 2 to 100,000, 100 to 80,000, or 800 to 50,000.

[0068] In certain embodiments, two or more blocking oligonucleotides are complementary to multiple different regions (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10) of a single undesired RNA species. In certain other embodiments, two or more blocking oligonucleotides are complementary to multiple different regions (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 different regions) of multiple undesired RNA species (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 undesired RNA species).

[0069] In certain embodiments, where multiple blocking oligonucleotides are complementary to multiple different regions of one or more undesirable RNA species, the distance between two adjacent regions of the one or more undesirable RNA species to which the blocking oligonucleotides are complementary may range from 0 to 100 nucleotides, e.g., 0 to 75 nucleotides, 0 to 50 nucleotides, 20 to 100 nucleotides, 20 to 75 nucleotides, 20 to 50 nucleotides, 30 to 100 nucleotides, 30 to 75 nucleotides, 30 to 50 nucleotides, or 30 to 45 nucleotides.

[0070] In certain embodiments, the blocking oligonucleotides comprise or consist of a set of blocking oligonucleotides for inhibiting cDNA synthesis of a single undesired RNA species (e.g., E. coli 5S rRNA), the blocking oligonucleotides being complementary to multiple distinct (preferably evenly spaced, as described in detail in other sections below) regions of the undesired RNA species.

[0071] In certain other embodiments, the blocking oligonucleotide comprises or consists of multiple sets of blocking oligonucleotides for inhibiting cDNA synthesis of multiple undesired RNA species, each set of blocking oligonucleotides being complementary to multiple different (preferably equally spaced) regions of the undesired RNA species as described above, and the different sets of blocking oligonucleotides being complementary to equally spaced regions of the different undesired RNA species.

[0072] Blocking oligonucleotides may also be referred to herein as "blockers," "blocking antisense oligonucleotides," and the like.

[0073] Exemplary blocking oligonucleotides (blockers B1-B193) that can be used in the methods of the present disclosure to erase human 18S rRNA are described in the Examples. Exemplary blocking oligonucleotides (blockers 5S1-5S100, blockers 16S1-16S100, blockers 23S1-23S100) that can be used in the methods of the present disclosure to erase bacterial 5S, 16S, and 23S rRNA, respectively, are described in Example 4.

[0074] Additional description of blocking oligonucleotides is provided in Sections B, C, and D of this disclosure below.

[0075] 6. Annealing blocking oligonucleotides to unwanted RNA As disclosed above, step (b) of the method for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription disclosed herein is annealing one or more blocking oligonucleotides to one or more regions of one or more undesired RNA species in the RNA sample to generate a template mixture.

[0076] This step can be carried out by mixing the RNA sample with one or more blocking oligonucleotides under conditions suitable for the blocking oligonucleotides to anneal to one or more regions of one or more undesired RNA species in the RNA sample, the resulting mixture being referred to herein as an "annealing mixture."

[0077] Generally, the annealing mixture is first heated to an elevated temperature (e.g., about 65°C, about 70°C, 75°C, 80°C, 85°C, 90°C or 95°C, or at least 65°C, at least 70°C, preferably at least 75°C) for a sufficient time (e.g., at least about 30 seconds, e.g., at least 1 minute or at least 2 minutes) to denature the RNA molecules in the RNA sample, and then cooled to a lower temperature (e.g., 40°C or lower, e.g., 25°C or lower, room temperature or lower (22°C-25°C), or 4°C).

[0078] The cooling process can be carried out in a variety of ways, such as by gradually decreasing the temperature at a specified level for a specified time, or by allowing it to cool naturally to room temperature. Exemplary cooling processes include, but are not limited to, the following: Process 1 temperature time 75℃ 2 minutes 70℃ 2 minutes 65℃ 2 minutes 60℃ 2 minutes 55℃ 2 minutes 37℃ 5 min 25℃ 5 min Hold at 4℃ Process 2 temperature time 90℃ 30 seconds 85℃ 2 minutes 80℃ 2 minutes 75℃ 2 minutes 70℃ 2 minutes 65℃ 2 minutes 60℃ 2 minutes 55℃ 2 minutes 37℃ 5 min Process 3 temperature time 90℃ 2 minutes Turn off the thermocycler and allow it to cool to room temperature. Process 4 temperature time 89℃ 8 min 75℃ 2 minutes 70℃ 2 minutes 65℃ 2 minutes 60℃ 2 minutes 55℃ 2 minutes 37℃ 2 min 25℃ 2 minutes

[0079] The amount of one or more blocking oligonucleotides in the annealing mixture can be from about 0.1 pmol to about 50 pmol per blocking oligonucleotide, e.g., from about 0.5 pmol to about 20 pmol, from about 0.5 pmol to about 10 pmol, from about 1 pmol to about 20 pmol, from about 1 pmol to about 10 pmol, from about 1.5 pmol to about 10 pmol, from about 1.5 pmol to about 8 pmol, or from 2 pmol to about 7 pmol per blocking oligonucleotide.

[0080] Preferably, each of different blocking oligonucleotides is present in annealing mixture in approximately the same amount.In certain embodiments, the amount of different blocking oligonucleotides is different.For example, the molar ratio of the blocking oligonucleotide with the highest amount to the one with the lowest amount can be about 10 to about 1.1, about 5 to about 1.1 or about 2 to about 1.1.

[0081] The amount of RNA from the annealing mixture can be from about 1 pg to about 5000 ng, e.g., from about 5 pg to about 5000 ng, from about 10 pg to about 5000 ng, from about 100 pg to about 5000 ng, from about 1 ng to about 5000 ng, from about 5 ng to about 5000 ng, from about 10 ng to about 5000 ng, from about 100 ng to about 5000 ng, from about 5 pg to about 3000 ng, from about 10 pg to about 3000 ng, from about 100 pg to about 3000 ng, from about 1 n The amount of the antibody may range from about 1 g to about 3000 ng, about 5 ng to about 3000 ng, about 10 ng to about 3000 ng, about 100 ng to about 3000 ng, about 5 pg to about 1000 ng, about 10 pg to about 1000 ng, about 100 pg to about 1000 ng, about 1 ng to about 1000 ng, about 5 ng to about 1000 ng, about 10 ng to about 1000 ng, about 100 ng to about 1000 ng, or about 25 ng to about 500 ng. The amount of RNA may be at least about 1 pg, about 5 pg, about 10 pg, about 50 pg, about 100 pg, about 500 pg, about 1 ng, about 5 ng, about 10 ng, about 50 ng or about 100 ng, and / or at most about 500 ng, about 1000 ng, about 3000 ng or about 5000 ng.

[0082] The annealing mixture may contain, in addition to the one or more blocking oligonucleotides and the RNA sample, one or more monovalent cations (e.g., Na + and K. + The concentration of the monovalent in the annealing mixture can range from 5 mM to 50 mM, e.g., 10 mM to 30 mM or 15 mM to 25 mM.

[0083] Preferably, the annealing mixture contains NaCl or KCl at a concentration of 10 mM to 30 mM, for example 15 mM to 25 mM.

[0084] The annealing mixture can optionally include a buffer having a pH in the range of 5 to 9, for example a buffer containing 20-50 nM phosphate, pH 6.5-7.5.

[0085] Once the annealing process is performed, the annealing mixture can be referred to as a "template mixture" which is used as a template for subsequent cDNA synthesis. In certain embodiments, the annealing mixture can be purified before being used as a template for cDNA synthesis. For example, purification can be performed using a solid support that binds nucleic acids (e.g., RNA) by mixing the annealing mixture with the solid support, separating the solid support with the nucleic acids bound thereto from the liquid phase, optionally washing the solid support, and eluting the nucleic acids from the solid support. This mixing, separation, optional washing, and elution process can be repeated once (i.e., two purifications), twice (i.e., three purifications), or more times. Exemplary solid supports include QIAseq beads, used in the examples below.

[0086] 7. Reverse Transcription As described above, step (c) of the method for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription disclosed herein is to incubate the template mixture generated as described above with a reaction mixture comprising (i) at least one reverse transcriptase, (ii) one or more reverse transcription primers, and (iii) a reverse transcription buffer under conditions sufficient to synthesize cDNA molecules using the one or more desired RNA species as templates. The one or more blocking oligonucleotides anneal to the one or more undesired RNA species, thereby inhibiting transcription of such undesired RNA species.

[0087] 8. Reverse Transcriptase The term "reverse transcriptase" refers to an RNA-dependent DNA polymerase capable of synthesizing a complementary DNA (cDNA) strand using an RNA template. The reverse transcriptase useful in step (c) may be one or more viral reverse transcriptases, including but not limited to AMV reverse transcriptase, RSV reverse transcriptase, MMLV reverse transcriptase, HIV reverse transcriptase, EIAV reverse transcriptase, RAV reverse transcriptase, TTH DNA polymerase, C. hydrogenoformans DNA polymerase, Superscript® I reverse transcriptase, Superscript® II reverse transcriptase, Thermoscript™ RT MMLV, ASLV and its RNase H mutant, or a mixture of some of the above enzymes. Preferably, the reverse transcriptase is EnzScript™ M-MLV reverse transcriptase RNA H- (Enzymatics), which contains three point mutations that eliminate the native measurable RNase H activity for wild-type M-MLV reverse transcriptase. Loss of RNase H activity allows for greater yields of full-length cDNA transcripts (5 kb) and increased thermostability relative to wild-type M-MLV reverse transcriptase, which allows for higher incubation temperatures (up to 50° C.) for the first strand reaction and aids in denaturing template RNA secondary structures in GC-rich regions.

[0088] 9. Reverse Transcription Primer The reverse transcription primer useful in step (c) may be an oligo(dT) primer, i.e., a single-stranded sequence of deoxythymine (dT). The length of the oligo(dT) may vary from 8 bases to 30 bases, and oligo(dT) of different lengths, e.g., oligo(dT) 12~18 or a single oligo(dT) of defined length, e.g., oligo(dT) 18 or oligo(dT) 20 It may be a mixture of.

[0089] Preferably, the reverse transcription primer used in step (c) is a random primer, such as a random 6mer (N6), 7mer (N7), 8mer (N8), 9mer (N9), etc.

[0090] In certain embodiments, the reverse transcription primer may be a mixture of one or more oligo(dT) primers and one or more random primers.

[0091] In certain other embodiments, the reverse transcription primer may include a primer specific for one or more desired RNA species.

[0092] The reverse transcription primers may be immobilized or tethered, e.g., tethered oligo(dT) primers, or they may be in solution and not immobilized on a solid phase (e.g., beads).

[0093] 10. Reaction Buffers and Other Components The reaction mixture for step (c) (also referred to as the "reverse transcription reaction mixture") comprises a reaction buffer suitable for reverse transcription, e.g., a Tris buffer having a pH of about 8.3 or 8.4, at a concentration in the range of about 20 to about 50 mM.

[0094] The reaction mixture also includes dNTPs at a concentration in the range of about 0.1 to about 1 mM of each dNTP (eg, about 0.5 mM).

[0095] The reaction mixture also typically includes MgCl2 at a concentration in the range of about 1 to about 10 mM, for example, about 3 to about 5 mM.

[0096] The reaction mixture optionally further comprises a reducing agent, such as DTT, at a concentration in the range of about 5 to about 20 mM, such as about 10 mM.

[0097] 11. Reverse transcription conditions The reaction mixture is exposed to conditions sufficient to synthesize cDNA molecules using one or more desired RNA species in the RNA sample as templates. The conditions generally include incubating the reaction mixture at one or more suitable temperatures (e.g., about 35°C to about 50°C or about 37°C to 45°C, e.g., about 35°C, about 37°C, about 40°C, about 42°C, about 45°C or about 50°C) for a sufficient time (e.g., about 30 minutes to about 1 hour). In certain embodiments, a lower temperature incubation step (e.g., at 25°C for about 2 to about 10 minutes) can be performed for primer extension to increase primer Tm, prior to a higher temperature incubation step for first strand cDNA synthesis.

[0098] 12. Synthesizing the second strand of cDNA In certain embodiments, after step (c) (i.e., synthesis of first strand cDNA), the methods disclosed herein can include a step (d) of synthesizing second strand cDNA to generate double-stranded cDNA.

[0099] Procedures known in the art for synthesizing second strand cDNA can be used in step (d). For example, E. coli RNase H can be used to incise nicks and gaps in the mRNA resulting from the endogenous RNase H of the reverse transcriptase. Polymerase I then primes second strand synthesis by nick translation. E. coli DNA ligase then seals any breaks left in the second strand cDNA, generating a double stranded cDNA product.

[0100] Step (d) can be performed using the QIAseq Stranded Total RNA Library Kit (QIAGEN) or other commercially available kits (e.g., Illumina, New England BioLabs, KAPA Biosystems, Thermo Scientific). This can also be done using the RT-PCR kit (available from Fisher Scientific).

[0101] 13. Construction of Sequencing Libraries and Sequencing In certain embodiments, after the double-stranded DNA is generated in step (d), the methods disclosed herein further comprise a step (e) for amplifying the double-stranded cDNA generated in step (d) to construct a sequencing library, which can be used in a further step, step (f), to sequence one or more desired RNA species.

[0102] The double-stranded cDNA generated in step (d) can be used to prepare a sequencing library in step (e) using methods known in the art. For example, the double-stranded DNA can be end-repaired, subjected to A-addition, and ligated to adapters. The adapter-ligated cDNA molecules can be further amplified through one or more rounds of amplification (e.g., universal PCR, bridge PCR, emulsion PCR, or rolling cycle amplification) to generate a sequencing library (i.e., a collection of DNA fragments ready for sequencing, e.g., including sequencing primer binding sites).

[0103] The sequencing library can be sequenced in step (f) using methods known in the art (see Myllykangas et al., Bioinformatics for High Throughput Sequencing, Rodriguez-Ezpeleta et al. (eds.), Springer Science+Business Media, LLC, 2012, pages 11-25). Exemplary high-throughput DNA sequencing systems include, but are not limited to, the GS FLX sequencing system originally developed by 454 Life Sciences and subsequently acquired by Roche (Basel, Switzerland), the Genome FLX sequencing system developed by Solexa and subsequently acquired by Illumina Inc. (San Diego, CA). Analyzer(Bentley,Curr Opin Genet Dev 16:545-52, 2006;Bentley et al., Nature 456:53-59, 2008), Life Technologies (Foste The sequencing technology developed by Pacific Biosciences (Menlo Park, CA) (see Eidetal., Science 323: 133-8, 2009) and Life Sciences (see Life Sciences, Menlo Park, CA) were used to sequence the genomic DNA (SoliD sequencing system by Life Sciences (Smith et al., Nucleic Acid Res 38: e142, 2010; Valouevet et al., Genome Res 18:1051-63,2008), CGA developed by Complete Genomics and acquired by BGI (see Drmanacet al., Science327:78-81, 2010), PacBio RS sequencing technology developed by Pacific Biosciences (Menlo Park, CA) (see Eidetal., Science 323: 133-8, 2009), and Life Sciences (see Life Sciences, Menlo Park, CA). and Ion Torrent, developed by Ion Technologies Corporation (see U.S. Patent Application Publication Nos. 2009 / 0026082; 2010 / 0137143; and 2010 / 0282617).

[0104] The sequencing reads obtained from sequencing the sequencing library can be analyzed to determine the expression levels and / or sequences of the RNA species of interest. Such information can aid in diagnosing disease or predicting the responsiveness to a particular treatment of the subject from whom the RNA sample was obtained.

[0105] 14. Other downstream uses The double-stranded cDNA generated in step (d) can be used in microarray analysis to determine expression levels, including the presence or absence, of the RNA species of interest. Additional applications include functional cloning to identify genes based on the function of their encoded proteins, to discover novel genes, or to study alternative splicing in different cells or tissues.

[0106] 15.Erasing efficiency The first strand cDNA molecule can be used as a template in qPCR to test the efficiency of the blocking oligonucleotide in inhibiting cDNA synthesis from the undesired RNA species to which the blocking oligonucleotide is complementary. An exemplary method is disclosed in Example 1 below. Briefly, an increase in the Ct of the amplification of cDNA reverse transcribed from the undesired RNA species when one or more blocking oligonucleotides are used during reverse transcription compared to when no blocking oligonucleotides are used during reverse transcription indicates that the one or more blocking oligonucleotides are effective in inhibiting cDNA synthesis from the undesired RNA species. The increase in Ct can be compared to that of another treatment (e.g., a commercially available treatment) to demonstrate equivalence or improvement over the other treatment.

[0107] In certain embodiments, the Ct value of amplification of cDNA reverse transcribed from undesired RNA species when one or more blocking oligonucleotides are used during reverse transcription is at least 2-fold, at least 2.5-fold, at least 3-fold, or at least 4-fold the Ct value when no blocking oligonucleotides are used during reverse transcription.

[0108] The efficiency of blocking oligonucleotides in inhibiting cDNA synthesis from undesired RNA species can also be analyzed through whole transcriptome sequencing. An exemplary method is disclosed in Example 2 below. Briefly, the efficiency of blocking oligonucleotides in inhibiting cDNA synthesis from undesired RNA species (e.g., 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 53S, 54S, 55S A percentage reduction in total reads derived from ribosomal RNA (rRNA) indicates that one or more blocking oligonucleotides are effective in inhibiting cDNA synthesis from undesired RNA species. The percentage reduction can be compared to that of another treatment (e.g., a commercially available treatment) to demonstrate equivalence or improvement over the other treatment.

[0109] When one or more blocking oligonucleotides are used during reverse transcription according to the present disclosure, the percentage of total reads derived from undesired RNA species (e.g., 18S rRNA) may be at most 5%, at most 4%, at most 3%, at most 2%, at most 1%, at most 0.8%, at most 0.6%, at most 0.5%, at most 0.4%, at most 0.3%, at most 0.2%, at most 0.1%, or at most 0.05%.

[0110] The ratio of the percentage of total reads derived from undesired RNA species (e.g., 18S rRNA) when one or more blocking oligonucleotides are used during reverse transcription to that when no blocking oligonucleotides are used is at most 0.2, at most 0.15, at most 0.1, at most 0.08, at most 0.06, at most 0.05, at most 0.04, at most 0.03, or at most 0.02.

[0111] 16. Off-target Elimination To examine the degree of off-target elimination by blocking oligonucleotides, the first strand cDNA molecules can be used as templates in qPCR. An exemplary method is disclosed in Example 1 below. Briefly, an increase in the Ct of the amplification of cDNA reverse transcribed from a desired RNA species when one or more blocking oligonucleotides targeting one or more undesired RNA species are used during reverse transcription compared to when no blocking oligonucleotides are used during reverse transcription indicates that one or more blocking oligonucleotides cause inhibition of cDNA synthesis from the desired RNA species. Such inhibition is referred to as "off-target elimination". To evaluate the off-target elimination of two therapeutic agents, the Ct increase can be compared to that of another treatment (e.g., a commercially available treatment).

[0112] In certain embodiments, the increase in Ct value of amplification of cDNA reverse transcribed from a desired RNA species (e.g., GAPDH mRNA) between when one or more blocking oligonucleotides are used during reverse transcription and when no blocking oligonucleotides are used during reverse transcription is at most 20%, at most 15%, at most 10%, at most 8%, at most 6%, or at most 5% of the Ct value when no blocking oligonucleotides are used during reverse transcription.

[0113] The degree of off-target erasure by blocking oligonucleotides can also be analyzed through whole transcriptome sequencing. An exemplary method is disclosed in Example 2 below. Briefly, a scatter plot can be generated that compares the relative gene expression of genes other than those encoding one or more undesired RNA species when one or more blocking oligonucleotides are used during reverse transcription with when no blocking oligonucleotides are used during reverse transcription. The R of the scatter plot can be calculated by the following formula: 2 indicates how similar the relative gene expression is between treatment with one or more blocking oligonucleotides and no treatment. R 2The closer to 1, the lower the degree of off-target elimination associated with the use of one or more blocking oligonucleotides.

[0114] In one particular embodiment, the R of the scatter plot created above 2 is at least 0.85, at least 0.86, at least 0.87, at least 0.88, at least 0.89, at least 0.90 or at least 0.91.

[0115] B. Designing Blocking Oligonucleotides In one aspect, the disclosure provides a method for designing blocking oligonucleotides for inhibiting cDNA synthesis of one or more undesired RNA species in an RNA sample during reverse transcription, comprising: (a) generating a plurality of blocking oligonucleotides that are fully complementary (preferably perfectly complementary) to a region of one or more undesired RNA species; (b) filtering out non-acceptable blocking oligonucleotides; (c) generating one or more populations of blocking oligonucleotides that are complementary to multiple distinct (preferably evenly spaced) regions of one or more undesired RNA species; and

[0116] (d) optionally shuffling the blocking oligonucleotides between the groups to generate new groups of blocking oligonucleotides and selecting one or more of the new groups of blocking oligonucleotides. The present invention provides a method comprising:

[0117] The selected group of blocking oligonucleotides is effective in inhibiting cDNA synthesis of one or more undesired RNA species, preferably with minimal off-target elimination. The inhibition of cDNA synthesis from one or more undesired RNA species and the effectiveness of the selected group of blocking oligonucleotides for off-target elimination can be evaluated as described above in Section A.

[0118] Preferably, each blocking oligonucleotide contains one or more modified nucleotides that increase binding between the blocking oligonucleotide and their targeted region of the undesired RNA species.Also preferably, each blocking oligonucleotide contains a 3' modification that prevents their extension.

[0119] The following description uses LNA oligonucleotide as exemplary blocking oligonucleotide.The blocking oligonucleotide containing other modified nucleotides, as well as those that do not have any modified nucleotides to increase binding to the region of undesired RNA species, but are long enough to stably bind to the region of undesired RNA species, can be similarly designed to be effective in eliminating undesired RNA species, preferably with little or no off-target elimination.

[0120] 1. Step (a) Step (a) of the methods for designing blocking oligonucleotides provided herein is to generate a plurality of blocking oligonucleotides that are complementary (preferably perfectly complementary) to regions of one or more undesired RNA species.

[0121] In this step, one or more parameters of the blocking oligonucleotides can be characterized and scored, such as the length of the blocking oligonucleotide, the predicted Tm of the duplex formed between the blocking oligonucleotide and their corresponding region of the undesired RNA species (i.e., the region of the undesired RNA species to which the blocking oligonucleotide is perfectly complementary), self-hybridization, and off-target hybridization in the transcriptome to which the undesired RNA species belongs. The scores of the one or more parameters of each blocking oligonucleotide are used to generate a final combined score. During such a process, different parameters can be weighed differently to generate a final combined score.

[0122] Algorithms for predicting the Tm of duplexes formed between blocking oligonucleotides and their corresponding regions of undesired RNA species are described in SantaLucia, Proc. Natl. Acad. Sci. USA 95: 1460-5, 1998, and based on Tm measurements of LNA-containing blocking oligonucleotides.

[0123] Preferably, a pseudo-algorithm is used to improve and select the best blocking oligonucleotide by testing different parameters.For example, the Tm of the duplex formed between blocking oligonucleotide and its corresponding region of undesired RNA species can be improved by the following four methods: (1) reduce the number of LNA nucleotides, (2) increase the number of LNA nucleotides, (3) change the LNA nucleotide pattern, and (4) change the length of blocking oligonucleotide.In this way, multiple small algorithms are used to test different parameters to see whether the change improves the overall score of blocking oligonucleotide.

[0124] The LNA blocking oligonucleotide may have one, several, or all of the following properties:

[0125] (1) Their length may range from 10 to 30 nucleotides, preferably from 16 to 24 nucleotides, 17 to 23 nucleotides, or 18 to 22 nucleotides.

[0126] (2) The number of LNAs in each LNA blocking oligonucleotide may range from 2-20, preferably 4-16, and more preferably 3-15.

[0127] (3) the melting temperature of the duplex formed between the LNA blocking oligonucleotide and the region of the undesired RNA species to which it is complementary ranges from 80 to 96°C, preferably 86 to 92°C.

[0128] (4) The number of LNA blocking oligonucleotides produced in step (a) is at least 100, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000 or at least 10000, and / or at most 1,000,000, at most 500,000, at most 100,000, at most 90,000, at most 80,000, at most 70,000, at most 60,000 or at most 50,000, e.g., 100 to 1,000,000, 500 to 100,000, and 1000 to 10,000.

[0129] (5) LNA blocking oligonucleotides may bind to regions of undesired RNA species to which they are complementary, rather than to themselves.

[0130] (6) The LNA blocking oligonucleotide may bind to the region of the undesired RNA species to which it is complementary, but not to other regions in the transcriptome to which the undesired RNA species resides.

[0131] (7) The number of different undesired RNA species to which the LNA blocking oligonucleotides are complementary (preferably fully complementary) is at least 2, at least 3, at least 4 or at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400 or at least 500, and / or at most 1,000,000, at most 500,000, at most 100,000, at most 50,000, at most 10,000, at most 9000, at most 8000, at most 7000, at most 6000, at most 5000, at most 4000, at most 3000 or at most 2000, e.g., 2 to 1,000,000, 100 to 500,000, 500 to 100,000 and 1000 to 10,000.

[0132] Additional description of blocking oligonucleotides is provided above in Section A.5. Blocking Oligonucleotides and Section C. Sets of Blocking Oligonucleotides.

[0133] 2. Step (b) Step (b) of the method for designing blocking oligonucleotides provided herein is to filter unacceptable blocking oligonucleotides.This can be performed by setting a minimum final combined score for blocking oligonucleotides.Blocking oligonucleotides with a final combined score less than the minimum final combined score are considered unacceptable and are filtered out.

[0134] 3. Step (c) Step (c) of the methods for designing blocking oligonucleotides provided herein is to generate one or more groups of blocking oligonucleotides that are complementary to multiple distinct (preferably evenly spaced) regions of one or more undesirable RNA species.

[0135] In certain embodiments, a group of blocking oligonucleotides targets multiple regions of a single RNA species (eg, human 5S rRNA).

[0136] In certain other embodiments, a group of blocking oligonucleotides targets multiple RNA species of a single type from multiple organisms (eg, bacterial 5S rRNA).

[0137] In certain other embodiments, groups of blocking oligonucleotides target multiple types of RNA species of a single organism (eg, human rRNA).

[0138] In certain other embodiments, the groups of blocking oligonucleotides target multiple types of RNA species (eg, bacterial rRNA) in multiple organisms.

[0139] To inhibit cDNA synthesis of the undesired RNA species, it is preferred that the blocking oligonucleotides are spread along the undesired RNA species so that regions of the undesired RNA species are not reverse transcribed into cDNA and are not detected in downstream analysis. A program can be used in this step to select blocking oligonucleotides with the top final combined scores, picking out those that are evenly spread across the undesired RNA species.

[0140] Preferably, the multiple distinct regions of the undesired RNA species to which the blocking oligonucleotides are complementary are evenly spaced along the undesired RNA species. The uniform distribution of the distinct regions allows for effective inhibition of cDNA synthesis of the undesired RNA species with a minimal or reduced number of distinct blocking oligonucleotides.

[0141] The regions of undesirable RNA species are evenly spaced if the longest distance between adjacent regions is at most 2.5 times, preferably at most 2 times or at most 1.5 times, the shortest distance between adjacent regions. The distance between adjacent regions is the number of nucleotides between the 3' end of the upstream region (i.e., the region closer to the 5' end of the undesirable RNA species) and the 5' end of the downstream region (i.e., the region closer to the 3' end of the undesirable RNA species). For example, if the distances between adjacent regions of undesirable RNA species are 30, 32, 35, 37, 38, 40, 43 and 45, such regions are considered to be evenly spaced, since the longest distance between adjacent regions is 45, which is 1.5 times the shortest distance of 30.

[0142] The distance between uniformly distributed neighboring regions of the undesired RNA species to which the blocking oligonucleotides are complementary may range from 20-50, 25-50, 30-50, 20-45, 25-45, 30-45, or 31-43 nucleotides.

[0143] In certain embodiments, the multiple different regions of the undesired RNA species to which the blocking oligonucleotides are complementary are not uniformly distributed. The distance between the neighboring regions may range from 0 to 100 nucleotides, e.g., 0 to 75 nucleotides, 0 to 50 nucleotides, 5 to 100 nucleotides, 5 to 75 nucleotides, 5 to 50 nucleotides, 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 100 nucleotides, 10 to 75 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 20 to 100 nucleotides, 20 to 75 nucleotides, 20 to 60 nucleotides, or 30 to 100 nucleotides. In general, more blocking oligonucleotides are required when the neighboring regions of the undesired RNA species to which the blocking oligonucleotides are complementary are located close to each other (e.g., at most 25, 20, 15, 10, or 5 nucleotides apart). However, to avoid insufficient inhibition of cDNA synthesis using sequences between the flanking regions of undesired RNA species as templates, the flanking regions should not be too far apart (e.g., more than 75, 100, 125 or 150 nucleotides apart).

[0144] In certain embodiments where a large number (e.g., at least 10, at least 50, at least 100, at least 500, at least 1000, at least 2000, at least 300, at least 4000, or at least 5000) of different undesirable RNA species are to be eliminated, the groups can be formed by selecting blocking oligonucleotides that best increase the overall coverage of the targeted undesirable RNA species. The different undesirable RNA species can be a single type of undesirable RNA from multiple organisms (e.g., bacterial 5S rRNA), multiple types of undesirable RNA from a single organism (e.g., human abundant mRNA), or multiple types of undesirable RNA from multiple organisms (e.g., bacterial rRNA).

[0145] In some embodiments, a single blocking oligonucleotide can target undesired RNA species from multiple organisms that are homologous to each other (e.g., 5S rRNA from a particular bacterial strain). Thus, the number of blocking oligonucleotides in the group can be less than the number of undesired RNA species that the blocking oligonucleotide targets.

[0146] To maximize the coverage of a large number of different undesired RNA species, a greedy algorithm can be used. A greedy algorithm is an algorithm that always makes a locally optimal choice in the hope that the choice will lead to a universally arbitrary solution. An exemplary greedy algorithm can include first defining the length of the blocking oligonucleotides ("BLOCKER LENGTH"), the distance between neighboring blocking oligonucleotides when annealing to the undesired RNA species ("DISTANCE"), and the number of blocking oligonucleotides that form a group ("NUMBER"), and performing the following steps:

[0147] 1. Count the frequency of all kmers with K=BLOCKER LENGTH in a set of target sequences; 2. Classify kmers by frequency; 3. Add the kmer with the highest frequency to the blocker set; 4. Find the position of the selected kmer in all target sequences; 5. Determine the kmer 0.5-2 DISTANCE (preferably 1 DISTANCE) downstream and 0.2-1 DISTANCE (preferably 0.5 DISTANCE) upstream of the kmer position in each target sequence; 6. Decrease the kmer within the DISTANCE in the frequency list, and 7. Repeat steps 2-6 until you reach the blocker's NUMBER.

[0148] An example of using such an algorithm to design blocking oligonucleotides that erase bacterial 5S, 16S and 23S rRNA sequences is provided in Example 4.

[0149] Such design algorithms are beneficial in selecting blockers that will most increase overall coverage of the target sequence. Because kmer frequencies are often autocorrelated, reducing the number of adjacent kmers avoids selecting blockers in regions already covered by previously selected blockers. Reducing the number of upstream kmers avoids selecting blockers that are too close to downstream already selected blockers. Such algorithms are tuned to partially cover as many target sequences as possible, rather than completely cover fewer target sequences.

[0150] 4. Step (d) In certain embodiments in which multiple groups are generated in step (c), the method for designing blocking oligonucleotides may further include shuffling the blocking oligonucleotides between the groups to generate new groups of blocking oligonucleotides, and selecting one or more of the new groups of blocking oligonucleotides.

[0151] A group of blocking oligonucleotides can be scored as the average score of the blocking oligonucleotides in the group.The parameters that affect scoring include the physical parameters of blocking oligonucleotides, such as the melting temperature of the duplex formed between blocking oligonucleotides and their corresponding regions of undesired RNA species, the length of blocking oligonucleotides, the self-hybridization of blocking oligonucleotides, LNA pattern, the number of LNA nucleotides in blocking oligonucleotides, and the off-target hybridization of blocking oligonucleotides; and group parameters, such as the minimum and maximum distance between neighboring blocking oligonucleotides when annealing to their corresponding regions of undesired RNA species, and the cross-hybridization between blocking oligonucleotides in the group.

[0152] In this step of shuffling blocking oligonucleotides between groups of blocking oligonucleotides, cross-hybridization within a group of blocking oligonucleotides is minimized, e.g., the number of blocking oligonucleotides that can form duplexes with each other at high Tm (e.g., greater than 65° C.) is minimized.

[0153] A program can be used to shuffle blocking oligonucleotides and test for increasing scores of a group of blocking oligonucleotides. This process can be repeated multiple times to generate a group of blocking oligonucleotides with the highest group score. Multiple groups of blocking oligonucleotides can be generated, each with the highest group score, for each of a given undesired RNA species (e.g., one group targets human 5.8S rRNA with the highest group score, another group targets human 18S rRNA with another highest group score), or for a given type of undesired RNA species (e.g., one group targets bacterial rRNA with the highest group score, another group targets bacterial 16S rRNA with another highest group score).

[0154] The selected group having the highest score may have at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different blocking oligonucleotides, and / or at most 10,000, at most 9000, at most 8000, at most 7000, at most 6000, or at most 5000 different blocking oligonucleotides, e.g., between 10 and 10,000, or between 100 and 5000 different blocking oligonucleotides.

[0155] In certain embodiments, multiple groups of blocking oligonucleotides are selected and such groups may be pooled together if they anneal to undesired RNA species from an RNA sample, or they may be annealed separately to their target undesired RNA species.

[0156] 5. Experimental Testing for Blocking Efficiency and Off-target Elimination A selected group of blocking oligonucleotides can be further tested experimentally for its blocking efficiency and / or off-target elimination. Exemplary methods for such testing are described in Section A above and in the Examples below.

[0157] C. Blocking Oligonucleotide Sets or Compositions In one aspect, the present disclosure provides a set of blocking oligonucleotides for inhibiting cDNA synthesis of an undesired RNA species, the blocking oligonucleotides being complementary (preferably perfectly complementary) to multiple distinct (preferably equally spaced) regions of the undesired RNA species.

[0158] The number of blocking oligonucleotides in the set may be at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, or at least 50, and / or at most 1000, at most 900, at most 800, at most 700, at most 600, at most 500, at most 400, at most 300 or at most 200, such as between 2 and 1000, between 5 and 500, and between 10 and 300.

[0159] Preferably, the set of blocking oligonucleotides is a set of LNA blocking oligonucleotides and may have one to all of the following properties: (1) Their length may range from 10 to 30 nucleotides, preferably from 16 to 24 nucleotides, 17 to 23 nucleotides, or 18 to 22 nucleotides. (2) The number of LNAs in each LNA blocking oligonucleotide may range from 2-20, preferably 4-16, and more preferably 3-15. (3) the melting temperature of the duplex formed between the LNA blocking oligonucleotide and the region of the undesired RNA species to which it is complementary ranges from 80 to 96°C, preferably 86 to 92°C. (4) Depending on the length of the undesired RNA species, the number of LNA blocking oligonucleotides is at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70 or at least 80. (5) The LNA blocking oligonucleotide may bind to a region of an undesired RNA species to which it is complementary, but not to itself. (6) The LNA blocking oligonucleotide may bind to the region of the undesired RNA species to which it is complementary, but not to other regions in the transcriptome to which the undesired RNA species resides. (7)(a) the regions of the undesired RNA species to which the blocking oligonucleotides are complementary are uniformly distributed along the undesired RNA species, and the distance between adjacent regions may range from 20-50, 25-50, 30-50, 20-45, 25-45, 30-45, or 31-43 nucleotides; or (b) the regions of the undesired RNA species to which the blocking oligonucleotides are complementary are not uniformly distributed along the undesired RNA species, and the distance between neighboring regions may range from 0 to 100 nucleotides, e.g., 0 to 75 nucleotides, 0 to 50 nucleotides, 5 to 100 nucleotides, 5 to 75 nucleotides, 5 to 50 nucleotides, 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 100 nucleotides, 10 to 75 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 20 to 100 nucleotides, 20 to 75 nucleotides, 20 to 60 nucleotides, or 30 to 100 nucleotides.

[0160] In a related aspect, the present disclosure provides multiple sets of blocking oligonucleotides for inhibiting cDNA synthesis of multiple undesired RNA species.Each set of blocking oligonucleotides is complementary (preferably completely complementary) to multiple different (preferably equally spaced) regions of the undesired RNA species as described above.In certain embodiments, different sets of blocking oligonucleotides are complementary to multiple different (preferably equally spaced) regions of different undesired RNA species.

[0161] The number of sets may be at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400 or at least 500, and / or at most 10,000, at most 9000, at most 8000, at most 70 00, at most 6000, at most 5000, at most 4000, at most 3000 or at most 2000, for example, 2 to 10,000, 2 to 5000, 2 to 1000, 2 to 500, 2 to 200, 10 to 10,000, 10 to 5000, 10 to 1000, 10 to 500, 10 to 200, 100 to 10,000, 100 to 5000, 100 to 1000 or 100 to 500.

[0162] The total number of blocking oligonucleotides in the multiple sets of blocking oligonucleotides can be at least 5, at least 10, at least 50, at least 100, at least 150, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500 or at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000 or at least 10,000, and / or at most 100,000, at most 90,000, at most 80,000, at most 70,000, at most 60,000 or at most 50,000, e.g., between 2 and 100,000, between 100 and 80,000 or between 800 and 50,000.

[0163] In certain embodiments, the multiple undesirable RNA species targeted by the multiple sets of blocking oligonucleotides belong to multiple types of RNA species from a single organism (e.g., human 5.8S rRNA, human 18S rRNA, and human 28S rRNA). In certain other embodiments, the multiple undesirable RNA species are derived from multiple organisms. In such embodiments, the multiple undesirable RNA species can belong to a single type of RNA species (e.g., 5S rRNA from multiple bacterial strains) or multiple different types of RNA species (e.g., 5S rRNA, 16S rRNA, and 23S rRNA from multiple bacterial strains).

[0164] The number of different undesired RNA species to which the set of blocking oligonucleotides are fully complementary is at least 2, at least 3, at least 4 or at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400 or at least 500, and / or at most 1,000,000, at most 500,000, at most 100,000, at most 50,000, at most 10,000, at most 9000, at most 8000, at most 7000, at most 6000, at most 5000, at most 4000, at most 3000 or at most 2000, such as between 2 and 1,000,000, 100 and 500,000, 500 and 1000 to 10,000.

[0165] In certain embodiments, multiple sets of blocking oligonucleotides are prepared, each set targeting one or more undesirable species from a single organism (e.g., human, plant, specific bacterial strain). Depending on what organisms are potentially present in a given sample, different sets of blocking oligonucleotides targeting undesirable species of such organisms can be combined together and used in erasing undesirable RNA species from those organisms. The number of different organisms from which undesirable RNA species should be erasing can be at least 2, at least 3, at least 4, at least 5, at least 10, at least 25, at least 50 and / or at most 10,000, at most 5,000, at most 1000, at most 500 or at most 100, for example, 2-10,000, 5-5,000 or 10-1,000.

[0166] In related aspects, the disclosure provides compositions or mixtures comprising one or more blocking oligonucleotides, sets of blocking oligonucleotides, and / or multiple sets of blocking oligonucleotides, as described in this and other sections (e.g., Section A). For example, a mixture can include an oligonucleotide targeting an undesirable RNA species in humans, and multiple sets of one or more blocking oligonucleotides targeting one or more undesirable RNA species from a pathogenic bacterial strain.

[0167] D. Kits for eliminating unwanted RNA species The present disclosure also provides a kit for inhibiting cDNA synthesis of one or more undesirable DNA species in an RNA sample, the kit comprising: (1) (a) one or more blocking oligonucleotides complementary (preferably fully complementary) to one or more regions of one or more undesirable RNA species in the RNA sample, (b) a set or sets of blocking oligonucleotides, and (2) a reverse transcriptase.

[0168] The sections above (eg, Sections A.5. and C) are referred to to describe one or more blocking oligonucleotides, the set or sets of blocking oligonucleotides, and the reverse transcriptase that may be included in the kit.

[0169] In certain embodiments, the kit can further include one to all of the following components: Reverse transcription primer, A reaction buffer suitable for reverse transcription, Enzymes for second strand cDNA synthesis (e.g., E. coli RNase H DNA polymerase I and E. coli DNA ligase), DNA polymerases (e.g., Taq DNA polymerase, Pfu DNA polymerase, KOD DNA polymerase, Hot Start DNA polymerase, Bst DNA polymerase, Bsu DNA polymerase, Tth DNA polymerase, and Pwo DNA polymerase), DNA ligase (e.g., E. coli DNA ligase, T4 DNA ligase, mammalian DNA ligase and thermostable DNA ligase), DNA polymerase for sequencing (e.g., T7 DNA polymerase, Sequenase, Sequenase version 2), Oligonucleotide primers for DNA amplification and / or sequencing, and Adaptors (single- or double-stranded oligonucleotides that can be ligated to single- or double-stranded DNA molecules).

[0170] The components of the kit are generally contained in separate containers or compartments. However, where appropriate, some of the components may be provided as mixtures or compositions. Additional descriptions of the components are provided in other sections, including the Examples, of this disclosure.

[0171] The following examples are offered by way of illustration and not by way of limitation. EXAMPLES

[0172] The following materials and reagents were used in Examples 1-3 of the present disclosure: Universal Human Reference RNA (UHRR) (Agilent Technologies). There are 193 pools of blockers (B1-B193), the sequences of which are shown in the table below. 96 pools of blockers (only odd-numbered wells from B1 to B193, i.e., B1, B3, ···, B193). 5x BC3 RT Buffer: 5x reverse transcription buffer from Qiagen RT2 First Strand kit QIAseq Beads N6 primer: random 6mer (standard desalted) ordered from IDT. Forward primer 18S FP2: CTCAACAGGGAAACCTCAC (SEQ ID NO: 1) Reverse primer 18S RP2: CGCTCACCAACTAAGAACG (SEQ ID NO: 2) Forward primer 18S FP1: ATGGCCGTTCTTAGTTGGTG (SEQ ID NO: 3) Reverse primer 18S RP1: CGCTGAGCCAGTCAGTGTAG (SEQ ID NO: 4) Forward primer 18S FP3: GTAACCCGTTGAACCCCATT (SEQ ID NO: 5) Reverse primer 18S RP3: CCATCCAATCGGTAGTAGCG (SEQ ID NO: 6) Forward primer 18S FP4: GGCCCTGTAATTGGAATGAGTC (SEQ ID NO: 7) Reverse primer 18S RP4: CCAAGATCCAACTACGAGCTT (SEQ ID NO: 8) Forward primer GAPDH FP: CACTGCCACCCAGAAGACTG (SEQ ID NO: 9) Reverse primer GAPDH RP: CAGCTCAGGGATGACCTTG (SEQ ID NO: 10) Forward primer ACTB FP: TGCGTGACATTAAGGAGAAGC (SEQ ID NO: 11) Reverse primer ACTB RP: GGAAGGAAGGCTGGAAGAGTG (SEQ ID NO: 12) Forward primer RPLP0 FP: CAATGTTGCCAGTGTCTGTC (SEQ ID NO: 13) Reverse primer RPLP0 RP: AGCAAGTGGGAAGGTGTAATC (SEQ ID NO: 14) 2x PA-012 Master Mix: 2x master mix for qPCR containing DNA polymerase from QIAGEN. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] The "+" indicates that the next nucleotide (i.e., the nucleotide to the right of the "+") is an LNA nucleotide. For example, in B193, "+A", "+C" and "+T" indicate the bases A, C and T. The LNA nucleotides each having the following structure are shown:

[0173] Example 1 Comparison Between Exemplary Methods of the Disclosure and the Ribo-Zero rRNA REMOVAL Kit This example describes an exemplary method of the present disclosure using the Ribo-Zero rRNA Removal kit by Illumina through qPCR to remove unwanted RNA.

[0174] Step-by-step workflow: 1a. Hybridize blockers to total RNA samples A. Mix 100 ng of Universal Human Reference RNA (UHRR) (Agilent Technologies) with blockers (B1-B193) in a volume of 15 μl also containing 20 mM KCl. B. Incubate in thermocycler: [Table 2]

[0175] 1b. rRNA removal using Illumina Ribo-zero rRNA Removal kit: A. For each reaction, wash 225 μl of magnetic beads twice with 225 μl of water. Remove all supernatant. B. Add 65 μl of Magnetic Bead Resuspension Solution and mix. Keep at room temperature. C. In a separate tube, mix 10 μl of Ribo-zero Removal solution, 4 μl of reaction buffer, RNA sample and water to a total volume of 40 μl. Incubate at 68° C. for 10 minutes. Incubate at room temperature for 5 minutes. D. Mix the sample from step C with the sample from step B and incubate at room temperature for 5 minutes. Incubate at 50°C for 5 minutes. E. Transfer the supernatant (i.e., the clarified sample) to a clean tube. F. Add 2 volumes of QIAseq beads to 1 volume of sample from step E. After RNA binds, wash twice with 200 μl of 80% ethanol. Allow to dry. Elute the final sample in 20 μl of water.

[0176] 2a. Reverse transcription reaction after step 1a A. Mix together RNA from the previous step: 13 μl [Table 3] B. Incubate in thermocycler: 25°C for 10 min, 42°C for 30 min, hold at 4°C.

[0177] 2b. Reverse transcription reaction after step 1b Proceed the same as step 2a with one exception: Instead of using 13 μl of sample, use only 0.36 μl (to achieve the same input as in step 2a)

[0178] 3. Purify cDNA Add 80 μl water and 130 μl QIAseq beads to the 20 μl sample from step 2a or step 2b. Wash bound cDNA twice with 200 μl 80% ethanol (EtOH). Dry. Elute in 20 μl water.

[0179] 4. Perform qPCR A. Mix together [Table 4] B. Incubate in real-time instrument: 95°C for 9 min, 98°C for 1 min, 40 cycles of (98°C for 15 sec, 60°C for 1.5 min, data collection performed). [Table 5]

[0180] Summary of data: The Ct values ​​of samples 1-5 show that using increasing amounts of B1-B193 blockers resulted in less synthesis of 18S rRNA cDNA regions measured by the 4 qPCR primer assay (18S FP2 and RP2, 18S FP1 and RP1, 18S FP3 and RP3, and 18S FP4 and RP4) compared to that of sample 6 without blockers. Using 18.55 pmol of each blocker gave the best results in blocking 18S rRNA cDNA synthesis.

[0181] Ct values ​​of three housekeeping genes (GAPDH, ACTB and RPLP0) in samples 2-5 indicate that there were no off-target effects due to the presence of blockers due to the similar Ct values ​​of samples 2-5 compared to sample 6 without blockers. 18.55 pmol of each blocker (sample 1) caused additional off-target effects compared to no blocker (sample 6).

[0182] Comparison of Ct values ​​between sample 7 (Ribo-Zero clearing) and sample 8 (no Ribo-Zero clearing) indicates that using the Ribo-Zero rRNA Removal kit resulted in less synthesis of the 18S rRNA cDNA region as measured by qPCR primer assay, and that Ribo-Zero clearing did not cause off-target effects.

[0183] The data further show that 8.75 pmol of each of the 193 blocker pool performed at least as well as Ribo-Zero in reducing both the amount of rRNA cDNA and off-target effects.

[0184] Example 2 Comparison of an exemplary method of the present disclosure with Ribo-Zero kit, poly(A) mRNA enrichment, and no treatment via sequencing of whole transcriptome libraries. This example compared 18S rRNA depletion of an exemplary method of the present disclosure with the RiboZero kit, poly(A) mRNA enrichment, and no treatment via sequencing of whole transcriptome libraries.

[0185] Step-by-step workflow: 1.A. For the 193 Pool of Blockers: Mix 100ng UHRR with 8.75pmol of each blocker. Proceed to step 2 below for the QIAseq Stranded Total RNA Library Kit.

[0186] B. For Illumina Ribo-zero: Use the same protocol as in Example 1, step 1b, with the following modifications: *Use 90 μl of magnetic beads and 35 μl of resuspension solution. *For a final volume of 20 μl, mix 100 ng UHRR, 2 μl Ribo-zero stripping solution, 2 μl reaction buffer and water. Proceed to Step 2 below with QIAseq Stranded Total RNA Library Kit.

[0187] C. For poly(A) mRNA enrichment: Use the QIAseq Strand mRNA Selection Kit as follows: i. Mix together 100 ng UHRR, 1 μl RNase inhibitor, 250 μl buffer mRBB, 25 μl pure mRNA beads and water to a total volume of 526 μl. Incubate at 70 °C for 3 min. ii. Incubate at room temperature for 10 minutes. Place on magnetic stand and remove supernatant. iii. Wash the beads twice with 400 μl Buffer OW2. Remove the supernatant. iv. Add 50 μl Buffer OEB, mix and incubate for 3 minutes at 70° C. Then incubate for 5 minutes at room temperature. v. Add 50 μl of buffer mRBB, mix, and incubate for 10 min at room temperature. vi. Pellet the beads on the magnetic stand and then remove the supernatant. Wash the beads once with 400 μl of Buffer OW2. vii.Add 31 μl Buffer OEB heated to 70° C. and mix. Pellet the beads on the magnetic stand. viii. Take 29 μl (which contains the mRNA). ix. Proceed to Step 2 below for QIAseq Stranded Total RNA Library Kit.

[0188] D. No Treatment: Mix 100 ng UHRR and water together for a total volume of 29 μl. Proceed to step 2 below for QIAseq Stranded Total RNA Library Kit.

[0189] 2.QIAseq Stranded Total RNA Library Kit: All ingredients listed below are taken from this kit.

[0190] RNA Fragmentation and Reverse Transcription: i. Take samples from steps 1.A, 1.B, 1.C and 1.D and add 8 μl of 5×RT buffer and water to a total volume of 37 μl.

[0191] ii. For samples from step 1.A., fragment RNA, hybridize blockers, and run the annealing program described in Example 1 by incubating at 95° C. for 15 minutes followed by immediate ramping to 75° C. Go to step iii. For samples 1.B., 1.C. and 1.D., fragment the RNA by incubating at 95 °C for 15 min and hold at 4 °C. Go to step iii.

[0192] iii. Add 1 μl RT enzyme, 1 μl RNase inhibitor, 1 μl 0.4 M DTT. Incubate at 25° C. for 10 min, 42° C. for 15 min, 70° C. for 15 min, hold at 4° C.

[0193] After reverse transcription, add 56 μl of QIAseq beads and mix. After the cDNA binds to the beads, wash twice with 200 μl of 80% EtOH. After drying the beads, elute with 38.5 μl of water.

[0194] Second strand synthesis / end-repair / A-addition: v. Mix 38.5 μl of sample with 5 μl Second Strand Buffer and 6.5 μl Second Strand Enzyme Mix. Incubate at 25° C. for 30 minutes, 65° C. for 15 minutes, hold at 4° C.

[0195] vi.Add 70 μl of QIAseq beads and mix. After the DNA binds to the beads, wash twice with 200 μl of 80% EtOH. After drying the beads, elute with 50 μl of water.

[0196] Adapter ligation: vii. Dilute the adapter 1:100 and then add 2 μl of adapter to 50 μl of sample. For a total volume of 100 μl, add 25 μl 4× Ultralow Input Ligation Buffer, 5 μl Ultralow Input Ligase, 6.5 μl Ligation Initiator, 11.5 μl water. Mix and then incubate at 25° C. for 10 minutes.

[0197] viii.Add 80 μl QIAseq beads and mix. After DNA binds to the beads, wash twice with 200 μl 80% EtOH. After beads dry, elute with 90 μl water. Add 108 μl beads to 90 μl sample and mix. After DNA binds to the beads, wash twice with 200 μl 80% EtOH. After beads dry, elute with 23.5 μl water.

[0198] Universal PCR Amplification: iv.To 23.5 μl sample, add 1.5 μl CleanStart PCR primer mix, and 25 μl CleanStart PCR mix 2x for Illumina, for a total volume of 50 μl.

[0199] x. Incubate at 37°C for 15 minutes, 98°C for 2 minutes, 15 cycles of (98°C for 20 seconds, 60°C for 30 seconds, 72°C for 30 seconds), 72°C for 1 minute, and hold at 4°C.

[0200] xi.Add 60μl of QIAseq beads and mix. After the DNA binds to the beads, wash twice with 200μl of 80% EtOH. After the beads are dried, elute with 22μl of water.

[0201] xii. The 22 μl sample is the final library ready for sequencing on an Illumina NextSeq 500 system.

[0202] Sequencing parameters: 150 cycles (75x2 paired-end) High Output v2 by Illumina NextSeq 500 System. Load 1.4 pM library.

[0203] Analysis was performed using Galaxy (http: / / usegalaxy.org). Alignment of paired-end reads to the reference genome b37 hg19 using the HISAT2 alignment program (Galaxy version 2.1.0). Gene counting was performed with the featureCounts counting program (Galaxy version 1.6.0.2), and reference genome b37 hg19 and rRNA gtf files were obtained from the UCSC table browser. [Table 6]

[0204] Summary of sequencing results: Examination of the percent of total reads that are rRNA reveals that the Blocker 193 pool is superior to Ribo-zero.

[0205] Scatter plots (Figures 1-5) compare the relative gene expression of non-rRNA genes for each method. Each point represents the log2 of the reads of each unique non-rRNA gene normalized to the average of two housekeeping genes GAPDH and ACTB. In each scatter plot, there are 16,000 genes. Examination of the scatter plots shows that both Blocker and Ribo-zero produced similar gene expression profiles (Figure 1, R 2 = 0.9123), thus revealing that the blocking method did not alter the gene expression profile beyond that with Ribo-zero. Indeed, the blocking method showed a slight improvement over Ribo-zero in the similarity of gene expression profiles of non-rRNA genes compared to no treatment (compare Figures 4 and 5). A low correlation between ribo-erasure or no treatment and poly(A) enrichment is expected (Figures 2 and 3).

[0206] Example 3 Blocker performance at different RNA levels This example tested the performance of blockers at different amounts of RNA.

[0207] Step-by-step workflow: The workflow included the same steps as in Example 2, except adjusted for different input amounts, different blocker pools, different adapter dilutions, and cycles of PCR amplification (see the qPCR data table below for details of these variations that were present in the QIAseq Stranded RNA Library Kit protocol described in Example 2). For each condition, two replicates were performed. [Table 7-1] [Table 7-2] [Table 8]

[0208] Summary of qPCR data: 5ng input and 25ng input Blocking rRNA with 8.75 pmol of blocker (samples 1 and 7) worked as well as 100 ng input (sample 13). Blocking rRNA with 4.38 pmol had only a slight reduction (compare sample 3 to sample 1, and sample 9 to sample 7). For the three housekeeping genes (GADPH, ACTB, and RPLP0), inclusion of blockers significantly improved detection and quantification of these genes, as shown by the reduction in Ct values ​​for samples 1 and 3 compared to sample 5, and for samples 7 and 9 compared to sample 11.

[0209] 500ng and 1000ng input When a pool of 193 blockers was used, blocking of rRNA with 8.75 pmol of blocker (samples 19 and 27) worked as well as 100 ng input (sample 13). Again, there was only a slight reduction in blocking of rRNA with 4.38 pmol (compare sample 23 with sample 19 and sample 27 with sample 31). There was no additional negative effect on the three housekeeping genes (samples 19 and 27) compared to 100 ng input (sample 13).

[0210] When the pool of 96 blockers was used, there was a more substantial negative impact on rRNA blocking (compare Ct values ​​of the 18S rRNA assay between samples 21 and 19, between samples 22 and 23, between samples 29 and 27, and between samples 30 and 31), but there was no additional negative impact on housekeeping genes compared to the 100 ng input (compare Ct values ​​of the housekeeping gene assay between samples 20, 21, 29, and 30 with sample 13).

[0211] Sequencing parameters: 150 cycles (75x2 paired-end) High Output v2 by Illumina Sequencing was performed using a NextSeq 500 system, loading 1.6 pM of library.

[0212] Analysis was performed using Galaxy (http: / / usegalaxy.org). Alignment of paired-end reads to the reference genome b38 hg38 was performed using the HISAT2 alignment program (Galaxy version 2.1.0). Gene counting was performed with the featureCounts counting program (Galaxy version 1.6.0.2), and the reference genome b38 hg38 and rRNA gtf files were obtained from the UCSC table browser. [Table 9-1] [Table 9-2]

[0213] Summary of the above table At all RNA input amounts tested, 8.75 pmol of each of the 193 blocker pools worked best at reducing the amount of reads that were rRNA (see samples 1, 2, 7, 8, 13, 14, 19, 20, 27, and 28). 4.38 pmol of each of the 193 pools also worked well, but there was some reduction in rRNA blocking performance (see samples 3, 4, 9, 10, 15, 16, 23, 24, 31, and 32).

[0214] Sequencing results of non-rRNA genes (scatter plot): Scatter plots were generated using a pool of 193 blockers at 4.38 pmol or 8.75 pmol of each blocker to show the gene expression profiles of 11,000 unique non-rRNA genes for input amounts of 25 ng, 100 ng, 500 ng and 1000 ng. Each point represents the log2 of the reads of each unique non-rRNA gene normalized to the average of two housekeeping genes GAPDH and ACTB. The scatter plots are summarized in Tables A and B below. [Table A]

[0215] [Table B-1] [Table B-2]

[0216] Summary of non-rRNA gene sequencing results (scatter plot): Since the QIASeq Stranded Total RNA Library Kit has a suggested minimum input of 100 ng of total RNA, the results for the 25 ng input showed that technical replicates had poor R2 profiling as expected. 2values ​​(see Table A, references 1 and 2). However, the inclusion of a blocker reduced R 2 Improved values ​​(R 2 (Compare values ​​with those of reference number 3). This improvement was the result of the blockers enhancing the sensitivity of detection and quantification of non-rRNA genes.

[0217] The reproducibility of technical replicates was good with inputs of 100 ng, 500 ng and 1000 ng (see Table A, refs. 4, 5, 7, 8, 10 and 11) and was again better with blockers compared to no treatment (R 2 (Compare values ​​between reference numbers 4 or 5 and 6; between reference numbers 7 or 8 and 9; and between reference numbers 10 or 11 and 12).

[0218] Scatter plots show that there was a very good correlation of non-rRNA gene expression profiles between 100 ng, 500 ng, and 1000 ng for all blocker doses (see Table B, refs. 17, 21, 25, 27, 30, 31, 33, and 34, all of which had an R of >0.96. 2 values), showing that using a pool of 193 blockers at 8.75 pmol or 4.38 pmol did not negatively alter gene expression profiles while still effectively eliminating rRNA.

[0219] Example 4 Designing blockers to block cDNA synthesis of bacterial 5S, 16S and 23S rRNA sequences This example describes the design of blockers to block cDNA synthesis of bacterial 5S, 16S and 23S rRNA sequences. The design is applicable to samples that are a single species (e.g., E. coli K12) or mixed communities, such as in complex samples such as stool, sewage, and environmental samples, where thousands of different rRNA sequences are potentially present.

[0220] For the design, 5S bacterial rRNA sequences (7,300 total sequences) were downloaded from the 5S rRNA database (http: / / combio.pl / rrna / ), 16S bacterial rRNA sequences (168,096 total sequences) were downloaded from SILVA (https: / / www.arb-silva.de / ), and 23S bacterial rRNA sequences (592,605 total sequences) were downloaded from SILVA (https: / / www.arb-silva.de / ). Because sequences can be constantly added, modified, or removed from the database, future designs may consider a modified number of sequences.

[0221] The molecular properties of the bacterial rRNA cDNA synthesis blockers are largely similar to those used to block cDNA synthesis of human, mouse and rat rRNA (see blockers B1-B193 above). The oligonucleotides are (on average) 20 bp in length and (on average) 30 bp apart when the antisense interleaved against the rRNA sequence contains LNA oligonucleotides and contains a blocking residue at the 3' end of each of the oligonucleotides. The blockers are expected to block cDNA synthesis of bacterial rRNA in a manner similar to the human, mouse and rat rRNA blockers.

[0222] Due to the sheer number of bacterial rRNA sequences, each blocker was chosen to best increase total coverage when considering all of the rRNA sequences of a particular rRNA type (whether it be 5S, 16S, or 23S). Blockers are designed to be antisense to the target rRNA sequence of interest. Specifically, after specifying the BLOCKER LENGTH (i.e., about 20 bp), the DISTANCE (i.e., about 30 bp) between adjacent blockers when annealing to a set of target rRNA sequences (e.g., bacterial 5S rRNA), and the NUMBER (e.g., 1000 or 2000) of blockers to select, the following design algorithm was used: 1. Count the frequency of all kmers with K=BLOCKER LENGTH in a set of target sequences; 2. Classify kmers by frequency; 3. Add the kmer with the highest frequency to the blocker set; 4. Find the position of the selected kmer in all target sequences; 5. Determine the kmer within DISTANCE downstream and 0.5DISTANCE upstream of the kmer position for each target sequence; 6. Reduce the kmers identified in step 5 in the frequency list, and 7. Repeat steps 2-6 until you reach the blocker's NUMBER.

[0223] An example of the above process is shown in FIG. 6. In this example, the blocker length is 6 nucleotides and the distance between adjacent blockers is 10. For the orientation of the blockers relative to each other, the blockers are designed in antisense to the target rRNA sequence of interest. The first step is to count all possible 6mers in all target sequences (only one exemplary target sequence is shown at the top of FIG. 6), determine the most frequent 6mers, and rank the 6mers based on their frequency in the target nucleic acid as shown in the table on the left. The next step is to decrement the counts of 6mers within the selected DISTANCE at each occurrence of the most frequent 6mer, update the counts and ranks, and identify a new most frequent 6mer for the second iteration.

[0224] The total percentage of rRNA sequences covered increases as the number of blockers increases (see Figures 7-9). For 5S rRNA, 96% of all rRNA sequences are covered by 10,000 blockers when the blockers are 20 bp long and the spacing is 30 bp (see Figure 7). For 16S rRNA, 90% of all rRNA sequences are covered by 6,100 blockers when the blockers are 20 bp long and the spacing is 30 bp (see Figure 8). For 23S rRNA, 96% of all rRNA sequences are covered by 10,000 blockers when the blockers are 20 bp long and the spacing is 30 bp (see Figure 9).

[0225] When attempting to block cDNA synthesis of bacterial rRNA, it is not necessary to include all blockers. Coverage was 83% for 5S rRNA (using the first 1000 blockers), 84% for 16S rRNA (using the first 2000 blockers) and 84% for 23S rRNA (using the first 1000 blockers). The sequences of the first 100 blockers for 5S rRNA, 16S rRNA and 23S rRNA are shown in the table below as exemplary blockers. 35 nmol of each oligo was synthesized using standard desalting purification. After synthesis, the four pools were combined to generate the blocker mix containing 4000 blockers and used in Examples 5-8.

[0226] The sequences of 100 exemplary blockers for each of the bacterial 5S rRNA, 16S rRNA and 23S rRNA are provided in the table below. [Table 10-1] [Table 10-2] [Table 10-3]

[0227] [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4]

[0228] [Table 12-1] [Table 12-2] [Table 12-3]

[0229] Example 5 Blocking bacterial rRNA with blockers

[0230] This example describes blocking of bacterial rRNA with a blocker mix as described in Example 4. The amounts of blocker mix described in this example are the amount of each blocker in the blocker mix. For example, 2.9 pmol of blocker mix refers to the block mix containing 2.9 pmol of each blocker.

[0231] Experiment details i.RNA (100ng Turbo DNase treated total RNA):

[0232] 1. E. coli total RNA (Thermo Fisher Scientific, Cat. No. AM7940, "E. coli sample")

[0233] 2. Gut Microbiome Whole Cell Mix (ATCC, Catalog No. MSA-2006, "ATCC Gut Sample")

[0234] ii. Blocker removal procedure

[0235] 1. Combine blocker mix (no blocker, 2.9 pmol, 1.45 pmol and 0.73 pmol) with total RNA (100 ng) and 1x FH buffer (50 mM Tris pH 8.0, 40 mM KCl, 3 mM MgCl2) in a final reaction volume of 15 μl (HO was used to bring the final reaction to 15 μl).

[0236] 2. The reaction was heated at 89°C for 8 minutes, followed by 75°C for 2 minutes, 70°C for 2 minutes, 65°C for 2 minutes, 60°C for 2 minutes, 55°C for 2 minutes, 37°C for 2 minutes and 25°C for 2 minutes.

[0237] 3.1.3x (beads to sample v / v ratio) bead purification was performed (this was not performed in the experimental condition marked "No purification"): Add 19.5 μl of QIAseq beads (pre-warmed to room temperature) to the 15 μl reaction. Mix thoroughly by vortexing and incubate at room temperature for 5 minutes. b. Centrifuge in a tabletop centrifuge until the beads are completely pelleted (approximately 2 minutes). c. Place the tubes / plate on the magnetic rack for 2 minutes. Once the solution is clear, carefully remove and discard the supernatant while keeping the beads on the magnetic stand. d. With the beads still on the magnetic stand, add 200 μl of 80% ethanol. Wash the beads by rotating the tube (2-3 times) or by moving the plate side-to-side between the two column positions on the magnet. Carefully remove and discard the wash solution. e. Repeat the ethanol wash, being sure to completely remove any traces of ethanol wash after this second wash. f. Allow the beads, still on the magnetic stand, to air dry at room temperature for 10 minutes. g. Remove the beads from the magnetic stand and elute the nucleic acids from the beads by adding 31 μl of nuclease-free water. Mix well by pipetting. h. Place the tubes / plate back on the magnetic rack until the solution is clear. i. Transfer 29 μl of supernatant to a clean tube / plate.

[0238] iii. QIAseq stranded RNA library preparation

[0239] 1. Set up and run the first strand synthesis reaction associated with the QIAseq Strand Total RNA Library Kit: [Table 13]

[0240] 2. Prepare remaining QIAseq strand libraries according to user manual

[0241] iv. Perform next generation sequencing 1. Use an Illumina NextSeq 500 system with 150 cycles (75x2 paired-end).

[0242] Data analysis is performed using v.CLC Genomics Workbench.

[0243] result The results are shown in the table below. [Table 14] FPKM: Fragments per kilobase of exon per million reads

[0244] The results show that: No blocker in both samples (E. coli and ATCC Intestine) resulted in a high percentage of rRNA.

[0245] 2.9 pmol of blocker gave the best performance for rRNA blocking with E. coli and ATCC intestinal samples.

[0246] For the E. coli samples, decreasing the amount of blocker had a negligible effect on rRNA blocking, but for the ATCC intestinal samples, the amount of reads mapping to rRNA increased when the amount of blocker was reduced.

[0247] rRNA blocking led to an increase in the number of genes detected.

[0248] The blocking efficiency does not match that predicted by the blocker design algorithm: for the E. coli sample, the design algorithm predicted blocking efficiency to be 93% for 5S, 99% for 16S and 99% for 23S. The results above show that this was indeed achieved, as 97% of all rRNA was removed.

[0249] conclusion Bacterial rRNA blockers reduced reads that mapped to rRNA from .about.97% to .about.3% for E. coli samples and from .about.95% to .about.12% for ATCC Intestinal samples.

[0250] Example 6 Blocking bacterial rRNA with different amounts of blocker and different bead purification steps This example describes the blocking of bacterial rRNA at different concentrations of the blocker mix and different bead purification steps described in Example 4. As with Example 5, the amounts associated with the blocker mix described in this example are the amount of each blocker in the blocker mix.

[0251] In this example, the ATCC intestinal sample described in Example 5 was used as the RNA sample. The methods and materials were the same as in Example 5, except that the amount of block mix used in this example was 2.9 pmol and 5.8 pmol, and two versions of bead purification were performed: one ("1x") was the same as Example 5, and the other ("2x") had the following additional step between steps 3.c. and 3.d.:

[0252] (i) Add 15 μl nuclease-free water and 19.5 μl QIAseq NGS Bead Binding Buffer. Mix thoroughly by vortexing and incubate at room temperature for 5 minutes.

[0253] (ii) Centrifuge in a tabletop centrifuge until the beads are completely pelleted (approximately 2 minutes).

[0254] (iii) Place the tubes / plate on the magnetic rack for 2 minutes. Once the solution is clear, carefully remove and discard the supernatant while keeping the beads on the magnetic stand.

[0255] result The results are shown in the table below. [Table 15]

[0256] The results show that: Doubling the amount of blocker from 2.9 pmol to 5.8 pmol improved elimination of rRNA.

[0257] The NGS libraries prepared when 5.8 pmol of blocker mix was used had a low concentration.

[0258] Use of 5.8 pmol of blocker mix resulted in improved rRNA elimination, but it resulted in fewer genes being positively called, regardless of whether the cutoff was 0.3 or 3.0 FPKM.

[0259] Two 1.3x bead cleanups had a neutral effect.

[0260] conclusion Although 5.8 pmol of the blocker mix was more effective in rRNA elimination, 2.9 pmol may be more preferable when considering both rRNA elimination and positively expressed genes.

[0261] Example 7 Blocking bacterial rRNA with different amounts of blocker and different bead purification steps This example also describes blocking of bacterial rRNA at different concentrations of the blocker mix and different bead purification steps described in Example 4. As with Example 5, the amounts associated with the blocker mix described in this example are the amounts of each blocker in the blocker mix.

[0262] In this example, the ATCC intestine sample described in Example 5 was used as the RNA sample. The methods and materials were the same as in Example 6, except that the amounts of block mix used in this example were 2.9 pmol, 4.35 pmol and 5.8 pmol.

[0263] result The results are shown in the table below. [Table 16]

[0264] The results show that: Increasing the blocker from 2.9 pmol to 4.35 pmol to 5.8 pmol improved elimination of rRNA.

[0265] NGS libraries prepared using 5.8 pmol of blocker mix had low concentrations regardless of the number of bead cleanups.

[0266] Two 1.3x bead cleanups improved the number of genes detected, but also increased the rRNA percentage. Ultimately, it is more desirable to have an increased number of genes detected.

[0267] Pairwise mapped reads also increase with two rounds of 1.3x bead cleanup.

[0268] conclusion The combination of 2.9 pmol of blocker mix and two 1.3x bead cleanups provides the most desirable results.

[0269] Example 8 Blocking bacterial rRNA with blockers at different bead purification steps This example also describes blocking of bacterial rRNA at different bead purification steps using the blocker mix described in Example 4. As with Example 5, the amounts associated with the blocker mix described in this example are the amounts of each blocker in the blocker mix. In this example, two different RNA samples were used. One was the ATCC intestine sample described in Example 5, which was used as the RNA sample. The other ("ATCC 3 mix") was a mixture of the following: a. 20 strains Equal Mix Whole Cell Material (ATCC, Catalog No. MSA-2002) b. Skin Microbiome Whole Cell Mix (ATCC, Catalog No. MSA-2005) c. Oral Microbiome Whole Cell Mix (ATCC, Catalog No. MSA-2004)

[0270] The methods and materials were the same as in Example 6, except that the amount of block mix used in this example was 2.9 pmol.

[0271] result The results are shown in the table below. [Table 17-1] [Table 17-2]

[0272] The results show that: For the ATCC intestinal samples, 2.9 pmol of blocker mix cleared rRNA from approximately 95% to approximately 13% or 20%, depending on whether one or two rounds of 1.3x bead purification were used. Between one and two rounds of bead purification, additional rounds allowed for increased gene detection.

[0273] For the ATCC3 mix sample (consisting of 28 bacterial species when accounted for by overlapping species), 2.9 pmol of blocker mix cleared rRNA from about 95% to about 10% or about 15%, depending on whether one or two 1.3x bead cleanups were used. Between one and two bead cleanups, additional rounds allowed for increased gene detection. Increasing the amount of blocker mix from 2.9 pmol to 4.35 pmol and then to 5.8 pmol improved rRNA clearing.

[0274] conclusion When considering both rRNA deletion and gene expression results, the combination of 2.9 pmol of blocker mix and two 1.3x bead cleanups provides the most desirable results.

[0275] The results of Examples 5-8 show that for bacterial rRNA elimination, 2.9 pmol of each blocker was the optimal amount with two bead purifications, but for rRNA elimination, even when one bead purification was used, 1.45 pmol and even 5.8 pmol of each blocker worked to eliminate rRNA.

[0276] The various embodiments described above can be combined to provide further embodiments. All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned in this specification and / or listed in the Application Data Sheet are fully incorporated herein by reference. Aspects of the embodiments can be modified as necessary to employ concepts from various patents, applications, and publications to provide still other embodiments.

[0277] These and other changes can be made to the embodiments in light of the description detailed above. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and claims, but should be construed to include all possible embodiments, along with the full range of equivalents to which such claims are entitled. Thus, the claims are not limited by this disclosure.

[0278] This application claims priority to U.S. Provisional Patent Application No. 62 / 736,006, filed Sep. 25, 2018, which is incorporated by reference in its entirety.

Claims

[Claim 1] The invention described herein.

Images