Cell specific transcriptional regulatory sequences and uses thereof

Abstract

To provide, generally, targeted expression of genes in specific cell subtypes, e.g., immune cells, such as T cells, B cells and natural killer (NK) cells, which may be used in hematopoietic stem cell (HSC) engineering and cell-based therapy.SOLUTION: Disclosed herein are new synthetic expression cassettes comprising a minimal promoter and a cell-specific enhancer for expression of a nucleic acid of interest in one or more specific cell subtypes. Vectors and host cells comprising the synthetic expression cassettes are also disclosed. The application also discloses methods for expressing a nucleic acid of interest, such as a nucleic acid encoding a chimeric antigen receptor (CAR), in a cell and for treating diseases or conditions such as cancers and genetic diseases using the synthetic expression cassettes, vectors and cells.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application Serial No. 62 / 796,254, filed January 24, 2019, which is incorporated herein by reference in its entirety.

[0002] The present invention relates generally to targeted expression of genes in specific cell subtypes, e.g., immune cells, such as T cells, B cells and natural killer (NK) cells, and can be used in engineering hematopoietic stem cells (HSCs) and cell-based therapies. [Background technology]

[0003] Targeted expression of transduced genes in a given cell subtype or tissue is challenging. In the growing field of stem cell engineering and induced pluripotent stem cell (iPS) research, there is a demand for the ability to express a given protein only in a targeted population arising from a parent cell. However, the use of conventional / natural promoters faces technical challenges of size and sometimes specificity. For example, currently, gene therapy for hematopoietic-related disorders relies on transducing transgenes into HSCs under the control of strong promoters. 1、2 This type of construct would result in cells originating from the modified stem cells expressing the new gene regardless of the cell subtype, which could have dangerous consequences.

[0004] Chimeric antigen receptor (CAR) immune cell therapy has emerged as a promising new therapeutic approach for various cancers. In CAR immune cell therapy, a patient's immune cells (e.g., T cells, NK cells) are engineered to express CARs that bind to tumor antigens, which allow specific killing of tumor cells expressing the antigen. Currently, this strategy, although powerful, is usually not sustained due to T cell exhaustion and loss of engineered T cells in vivo. Furthermore, infusion of large amounts of CAR-T cells can lead to high toxicity due to the release of large amounts of cytokines (cytokine release syndrome). Therefore, there is a need for an approach that allows continuous and progressive replenishment of CAR-modified cells in the blood circulation and restricts the expression of CARs to only certain cells (e.g., T cells, NK cells).

[0005] This specification makes reference to several documents, the contents of which are incorporated herein by reference in their entireties. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] U.S. Provisional Application Serial No. 62 / 796,254 Summary of the Invention [Means for solving the problem]

[0007] The present disclosure provides the following: 1. A synthetic expression cassette for expressing a nucleic acid of interest in a cell, comprising: (i) a minimal promoter; (ii) a synthetic expression cassette comprising a transcription enhancer operably linked to the minimal promoter for expressing the target nucleic acid in the cell, the transcription enhancer comprising a sequence having at least 70% sequence identity to at least 50 contiguous nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0008] 2. The synthetic expression cassette described in Item 1, wherein the transcription enhancer comprises a sequence having at least 70% sequence identity with at least 100 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0009] 3. The synthetic expression cassette according to Item 2, wherein the transcription enhancer comprises a sequence having at least 70% sequence identity with any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0010] 4. The synthetic expression cassette described in Item 1, wherein the transcription enhancer comprises a sequence having at least 80% sequence identity with at least 50 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0011] 5. The synthetic expression cassette described in item 4, wherein the transcription enhancer comprises a sequence having at least 80% sequence identity with at least 100 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0012] 6. The synthetic expression cassette according to item 5, wherein the transcription enhancer comprises a sequence having at least 80% sequence identity with any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0013] 7. The synthetic expression cassette described in item 1, wherein the transcription enhancer comprises a sequence having at least 90% sequence identity to at least 50 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0014] 8. The synthetic expression cassette described in Item 7, wherein the transcription enhancer comprises a sequence having at least 90% sequence identity with at least 100 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0015] 9. The synthetic expression cassette according to item 8, wherein the transcription enhancer comprises a sequence having at least 90% sequence identity to any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0016] 10. The synthetic expression cassette described in item 1, wherein the transcription enhancer comprises a sequence having at least 95% sequence identity to at least 50 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0017] 11. The synthetic expression cassette of claim 10, wherein the transcription enhancer comprises a sequence having at least 95% sequence identity to at least 100 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0018] 12. The synthetic expression cassette according to item 11, wherein the transcription enhancer comprises a sequence having at least 95% sequence identity to any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0019] 13. The synthetic expression cassette according to item 1, wherein the transcription enhancer comprises or consists of at least 50 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0020] 14. The synthetic expression cassette according to item 13, wherein the transcription enhancer comprises or consists of at least 100 consecutive nucleotides from any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0021] 15. The synthetic expression cassette according to item 13, wherein the transcription enhancer comprises or consists of any one of the sequences set forth in SEQ ID NOs: 7 to 47.

[0022] 16. The synthetic expression cassette of any one of paragraphs 1 to 15, wherein the minimal promoter is a human cytomegalovirus CMV minimal promoter (miniCMV).

[0023] 17. The synthetic expression cassette described in paragraph 16, wherein the minimal promoter comprises or consists of the sequence of SEQ ID NO:6.

[0024] 18. The synthetic expression cassette of any one of paragraphs 1 to 17, wherein the transcription enhancer is upstream of the minimal promoter in the synthetic expression cassette.

[0025] 19. The synthetic expression cassette of any one of paragraphs 1 to 18, further comprising a polyadenylation (poly(A)) signal.

[0026] 20. The synthetic expression cassette of any one of paragraphs 1 to 19, further comprising a transcription termination signal.

[0027] 21. The synthetic expression cassette of any one of paragraphs 1 to 20, further comprising a nucleic acid of interest operably linked to a minimal promoter and a transcriptional enhancer.

[0028] 22. The synthetic expression cassette of any one of paragraphs 1 to 21, further comprising a selectable marker.

[0029] 23. The synthetic expression cassette of any one of paragraphs 1 to 22, wherein the cell is a stem cell.

[0030] 24. The synthetic expression cassette according to item 23, wherein the stem cell is a hematopoietic stem cell (HSC), an embryonic stem cell, a totipotent stem cell, a pluripotent stem cell, a tissue stem cell (multipotent stem cell) or an induced pluripotent stem cell (iPSC).

[0031] 25. The synthetic expression cassette of any one of paragraphs 1 to 22, wherein the cell is an immune cell.

[0032] 26. The synthetic expression cassette of paragraph 25, wherein the immune cell is a T cell, a natural killer (NK) cell, or a B cell.

[0033] 27. The synthetic expression cassette of any one of paragraphs 1 to 26, wherein the subject nucleic acid encodes a chimeric antigen receptor (CAR).

[0034] 28. A vector comprising the synthetic expression cassette according to any one of paragraphs 1 to 27.

[0035] 29. The vector according to item 28, wherein the vector is a viral vector.

[0036] 30. A host cell comprising the synthetic expression cassette of any one of paragraphs 1 to 27 or the vector of paragraph 28 or 29.

[0037] 31. The host cell described in paragraph 30, wherein the cell is a hematopoietic stem cell, a T cell, a natural killer (NK) cell, or a B cell.

[0038] 32. A composition comprising the host cell of item 30 or 31.

[0039] 33. A method for inducing expression of a target nucleic acid by a cell, the method comprising introducing into the cell a synthetic expression cassette described in any one of paragraphs 1 to 27 or a vector described in paragraph 28 or 29.

[0040] 34. The method of paragraph 33, wherein the nucleic acid of interest encodes a protein that is missing or defective in the cell.

[0041] 35. The method of claim 33 or 34, wherein the target nucleic acid encodes a chimeric antigen receptor (CAR).

[0042] 36. The method of any one of paragraphs 33 to 35, wherein the cell is a hematopoietic stem cell, a T cell, a natural killer (NK) cell, or a B cell.

[0043] 37. A method for treating a disease, condition or disorder in a subject, comprising administering to the subject an effective amount of a cell of paragraph 30 or 31 or a composition of paragraph 32.

[0044] 38. The method of paragraph 37, wherein the disease, condition or disorder is associated with lack of expression of a protein or expression of a defective protein, and the subject nucleic acid encodes a functional form of the protein.

[0045] 39. The method of paragraph 37, wherein the disease, condition, or disorder is associated with expression of an antigen and the subject nucleic acid encodes a recombinant receptor that specifically binds to the antigen.

[0046] 40. The method of claim 39, wherein the recombinant receptor is a chimeric antigen receptor (CAR).

[0047] 41. The method according to paragraph 39 or 40, wherein the disease, condition or disorder is cancer, an autoimmune or inflammatory disease, or an infectious disease.

[0048] 42. The method according to claim 41, wherein the disease, condition or disorder is cancer.

[0049] 43. The method according to paragraph 42, wherein the cancer is blood cancer.

[0050] 44. The method of any one of paragraphs 37 to 43, wherein the cell is a hematopoietic stem cell, a T cell, a natural killer (NK) cell, or a B cell.

[0051] 45. The above method is at least 1 × 10 2 , 1×10 3 Or 1×10 4 45. The method of any one of paragraphs 37 to 44, comprising administering to the subject a cell.

[0052] 46. ​​The above method is 1×10 6 ~1×10 8 46. ​​The method of claim 45, comprising administering to the subject a cell.

[0053] 47. The method of any one of paragraphs 37 to 46, wherein the cells are autologous cells.

[0054] 48. The method of any one of paragraphs 37 to 46, wherein the cells are allogeneic cells.

[0055] 49. The cell of paragraph 30 or 31, or the composition of paragraph 32, for use in treating a disease, condition, or disorder in a subject.

[0056] 50. The cell or composition for use described in paragraph 50, wherein the disease, condition or disorder is associated with lack of expression of a protein or expression of a defective protein, and the subject nucleic acid encodes a functional form of the protein.

[0057] 51. The cell or composition for use described in paragraph 50, wherein the disease, condition or disorder is associated with expression of an antigen and the subject nucleic acid encodes a recombinant receptor that specifically binds to the antigen.

[0058] 52. The cell or composition for use according to paragraph 51, wherein the recombinant receptor is a chimeric antigen receptor (CAR).

[0059] 53. The cell or composition for use according to paragraph 51 or 52, wherein the disease, condition or disorder is cancer, an autoimmune or inflammatory disease, or an infectious disease.

[0060] 54. The cell or composition for use according to paragraph 53, wherein the disease, condition or disorder is cancer.

[0061] 55. The cell or composition for use according to item 54, wherein the cancer is a blood cancer.

[0062] 56. The cell or composition for use according to any one of paragraphs 49 to 55, wherein the cell is a hematopoietic stem cell, a T cell, a natural killer (NK) cell, or a B cell.

[0063] 57. The above method is at least 1 × 10 2 , 1×10 3 Or 1×10 457. The cell or composition for use according to any one of paragraphs 49 to 56, comprising administering to said subject said cell.

[0064] 58. The above method is 1×10 6 ~1×10 8 58. The cell or composition for use according to claim 57, comprising administering the cells to the subject.

[0065] 59. The cell or composition for use according to any one of paragraphs 49 to 58, wherein the cell is an autologous cell.

[0066] 60. The cell or composition for use according to any one of paragraphs 49 to 58, wherein the cell is an allogeneic cell.

[0067] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.

[0068] In the accompanying drawings: [Brief description of the drawings]

[0069] [Figure 1A] 1A and 1B show the cloning strategy used to generate the T cell specific (Tspe)-promoter from Chr16-445, shown from bottom to top. [Figure 1B] Same as above. [Diagram 2] Figure 2 shows the cloning strategy used to generate plasmids producing lentiviral particles for Tenh(Chr16-445), shown from bottom to top. [Figure 3A]Figure 3 shows the results of in vitro experiments to evaluate the expression pattern of GFP under the control of the T cell specific synthetic promoter Chr16-445-minCMV: Figure 3A: Jurkat (T-cell) and K562 (myeloid) cell lines were transfected with a vector encoding GFP under a control promoter versus a synthetic T cell specific promoter. [Figure 3B] FIG. 3B: PBMCs were transfected with vectors encoding GFP under a control spleen focus forming virus (SFFV) promoter versus a synthetic T-cell specific promoter. [Figure 4] Figure 4 shows the results of in vitro experiments to evaluate the expression pattern of GFP under the control of a synthetic NK-cell specific promoter (NK6, SEQ ID NO: 11). Various cell lines were transfected with vectors encoding GFP under a control promoter versus a synthetic NK-cell specific promoter. [Diagram 5] Figure 5 shows the results of in vitro experiments aimed at determining the timing and functional expression of GFP under a synthetic NK cell specific (NKspe-NK8, SEQ ID NO: 14) promoter. In an in vitro differentiation system allowing maturation of CD34+ cells into NK cells (OP9-DL4 in NK specific medium, left box) or into B cells (OP9, right box), GFP was shown to be expressed early in the progeny of NK cells but not in B cells, demonstrating its NK cell specificity. [Figure 6] FIG. 6 shows expression of GFP in the Nalm6 cell line (a B cell line) when transduced with a lentivirus encoding GFP under the control of a B-cell specific promoter (B-enh-1, SEQ ID NO: 23, left panel) or, as a negative control, a minimal CMV promoter sequence (SEQ ID NO: 6, right panel). [Figure 7A]Figure 7 shows the results of in vivo experiments to evaluate the expression pattern of GFP under the control of the T cell specific synthetic promoter of Chr16-445. The in vivo validation of the synthetic promoter was evaluated by injecting human CD34+ cells transduced with GFP under the control of the synthetic promoter into sublethally irradiated NSG mice without (Figure 7A) or with (BLT model) (Figure 7B) human thymus transplantation. Blood analysis showed that the engineered HSCs were capable of giving rise to various immune populations and that only T cells expressed GFP protein, confirming the specificity of our promoter. [Figure 7B] Same as above. [Figure 7C] FIG. 7C: GFP expression in various cell types in BLT mice transplanted with GFP-transduced CD34+ cells under the control of a strong non-specific promoter. [Figure 8A] Figures 8A-B show the results of in vivo experiments aimed at testing the differentiation of CD34+ cells decorated with GFP under the control of a NK cell-specific promoter (NK8, SEQ ID NO: 14). Figure 8A shows the percentage of human CD45+ cells expressing GFP in blood (left bar), spleen (middle bar), and bone marrow (right bar) (obtained from two humanized mice). [Figure 8B] Figure 8B shows expression of GFP in human CD45+ cells isolated from the bone marrow of two humanized mice. The dot plots show that when mice were humanized with CD34+ transduced with GFP under the control of a NK8-cell specific promoter (SEQ ID NO: 14), NK cells (CD56+) but not B cells (CD19+CD3-) or T cells (CD3+CD19-) express GFP. [Figure 9]Figure 9 shows the results of an in vivo experiment aimed at testing the differentiation of CD34+ cells decorated with GFP under the control of a B-cell specific promoter (B-enh-1, SEQ ID NO: 23). GFP expression was observed in the blood of humanized mice 4 weeks after humanization. Cells were gated based on the expression of hCD45+. The dot plot shows that when mice are humanized with CD34+ transduced with GFP under the control of a B-cell specific promoter (SEQ ID NO: 23, center line), B cells (CD19+) express GFP, but monocytes (CD14+) do not express GFP. Mice humanized with CD34+ expressing GFP under the control of a strong non-specific promoter (SFFV, lower panel) show expression of GFP in all human subpopulations (hCD45+), whereas no GFP expression is observed in the untransduced CD34+ (negative control). At this time point (4 weeks) after humanization, there are no T cells in the blood of the mice. [Figure 10A] Figures 10A-D show the results of experiments to evaluate the ability of T-cell specific promoters to express functional CARs. Figure 10A: CAR-CD33 expression was measured by flow cytometry after transduction of primary T cells with CAR-CD33 constructs under the control of a non-specific SFFV promoter or a T-cell specific promoter. [Figure 10B] Figure 10B: Cytotoxicity of T-cells expressing CAR-CD33 under the control of the SFFV (strong) promoter or the T-cell specific promoter (Tspe) at a ratio of 2:1 against CD33+ or CD33- AML cells (not significant).*** is p<0.001. [Figure 10C] FIG. 10C: CAR-CD22 expressed under the Tenh Chr16-445 (Tspe) promoter induced strong enough CAR expression to result in CAR-specific cytotoxicity against the RS4;11 ALL-cell line (ratios 0.5:1 / 1:1 / 2:1 / 4:1) that was similar to that of the SFFV (strong) promoter. [Figure 10D]Figure 10D: Primary T cells transduced with CAR-GD2 under the control of a T-cell specific promoter (Chr16-445) (squares) induced cytotoxicity against a GD2+ NB cell line (SK-N-DZ) at a level similar to that of primary T cells transduced with a strong non-specific promoter (SFFV, circles). In contrast, unmodified primary T cells (diamonds) did not kill the target cell line. **** is p<0.0001. [Figure 11A] 11A-C show the results of in vitro experiments aimed at determining the T cell differentiation stage at which the T-cell specific promoter was expressed. In vitro differentiation systems allowing maturation of CD34+ cells into T cells (OP9-DL4-, FIG. 11A) or B cells (OP9, FIG. 11B) showed that the CAR was expressed early in the T cell differentiation process (CD1aCD7+ stage) but not in B cells, confirming its T cell specificity. [Figure 11B] Same as above. [Figure 11C] Figure 11C shows the expression rate of CAR-CD22 in the various subpopulations obtained with the OP9-DL4 and OP9 systems when CAR-CD22 is expressed under the control of a T-cell specific promoter (Chr16-445, each middle bar) or a strong non-specific promoter (UCOE-SFFV, each left bar). The black bars (left) show the results obtained with non-transduced cells as a negative control. DP: double positive. [Figure 12] Figure 12 shows the results of an in vivo experiment aimed at testing the differentiation of CD34+ cells transduced with CAR-CD22 under the control of a T-cell specific promoter (Chr16-445). CAR-CD22 expression was observed in hCD45+ cells of the blood of BLT mice 30 weeks after humanization. The histogram plot shows that T cells (CD3+), but not B cells (CD19+) or monocytes (CD14+), express CAR-CD22 when mice are humanized with CD34+ modified with CAR-CD22 under the control of a T-cell specific promoter (Chr16-445) (left column). This expression was not observed when CD34+ was not transduced (negative control, right column). [Figure 13] In Example 2, the results of analyzing sequences using the oPOSSUM tool (http: / / opossum.cisreg.ca / oPOSSUM3 / , Kwon AT, Arenillas DJ, Worsley Hunt R, Wasserman WW. G3. 2012 Sep;2(9):987-1002. Epub 2012 Sep 1), which allows the detection of frequent conserved transcription factor binding sites and combinations of binding sites in a set of sequences, are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0070] Unless otherwise specified herein, scientific and technical terms used in connection with this disclosure shall have the meanings commonly understood by those skilled in the art. Furthermore, unless otherwise required by context, the singular shall include the plural and the plural shall include the singular. Generally, the technical terms used in connection with or in the techniques of cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. The methods and techniques of this disclosure are generally carried out according to conventional well-known methods in the art and as described in the various general and more detailed references cited and discussed throughout this specification unless otherwise indicated. See, for example, Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3 rded., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). Any enzymatic reactions or purification techniques are performed according to manufacturer's instructions as commonly accomplished in the art or as described herein. The technical terms used in analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry and in these laboratory procedures and techniques described herein are those well known and commonly used in the art.

[0071] In the context of describing technology (particularly in the claims), the use of the words "a" and "an" and "the" and similar references are intended to cover both the singular and the plural, unless otherwise indicated in the specification or clearly contradicted by context.

[0072] The words "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise indicated.

[0073] The recitation of ranges of values ​​herein, unless otherwise stated herein, is merely intended to serve as a shorthand method of referring separately to each individual value falling within the range, and each individual value is hereby incorporated into the description as if it were individually set forth herein. Every subset of values ​​within the range is also hereby incorporated into the description as if it were individually set forth herein.

[0074] The use of any and all examples or exemplary language (such as, for example, etc.) provided herein is intended merely to better illustrate the technology and is not intended to be a limitation on the scope of the present invention unless otherwise claimed.

[0075] No language in the specification should be construed as indicating any non-claimed element as essential to the procedure of the present invention.

[0076] As used herein, the term "about" has its ordinary meaning. The term "about" is used to indicate that a value includes the inherent variation of error for the device or method being employed to determine the value, or to encompass values ​​near a stated value that are, for example, within 10% of the stated value (or range of values).

[0077] The inventors have developed an alternative strategy to the use of traditional promoters by designing specific synthetic regulators that target the expression of a gene of interest in a cell subtype-specific manner. By engineering the transduced gene to be under the control of this synthetic regulator and transducing this construct into stem cells, it is now possible to direct gene expression exclusively in a specific and targeted cell subtype (or subtypes) derived from these genetically modified stem cells, which significantly improves the practical method. Several candidate cell-specific transcriptional enhancers have been identified. As a proof of concept, we designed the first "synthetic regulator" containing a candidate T cell-specific transcriptional enhancer that specifically induced transgene expression in human T cell populations, but the same methodology has been successfully applied to design other cell-specific promoters, in particular two human NK cell-specific promoters and one B cell-specific promoter. The designed human T / NK / B cell-specific promoters are of reduced size and show good specificity, making them amenable for use in human gene therapy and HSC engineering.

[0078] Synthetic expression cassettes Accordingly, in a first aspect, the present disclosure provides a synthetic expression cassette for expressing a nucleic acid of interest (e.g. gene, gRNA, miRNA, shRNA) in a cell, comprising a minimal promoter and a transcriptional enhancer operably linked to said minimal promoter for expression of a nucleic acid of interest in said cell, wherein said transcriptional enhancer comprises a sequence having at least 70% sequence identity to at least 50 contiguous / contiguous nucleotides, preferably at least 100, 150, 200 or 250 contiguous / contiguous nucleotides from one of the sequences set forth in SEQ ID NOs: 7 to 47, preferably SEQ ID NOs: 7 to 17 and 23.

[0079] The term "enhancer" or "transcriptional enhancer" or "transcriptional regulator" refers to a cis-acting sequence that contains one or more binding sites for a transcription factor or transcriptional activator and increases the activity of a promoter (e.g., a minimal promoter) in an orientation- and position-dependent manner. A transcriptional enhancer can be located upstream or downstream of a minimal promoter. In certain embodiments, a transcriptional enhancer is located upstream of a promoter.

[0080] In certain embodiments, the transcription enhancer is a cell type or subtype specific transcription enhancer, i.e., the transcription enhancer specifically increases the activity of the promoter (and also the expression of the peptide / protein or nucleic acid of interest (e.g., miRNA, shRNA, gRNA)) in a particular cell type or subtype. As used herein, the term "specifically increases" means that the increase in activity of the minimal promoter in the targeted cell type or subtype is greater than the increase in other cell types or subtypes. In certain embodiments, the transcription enhancer is an immune cell specific transcription enhancer, i.e., it specifically increases the activity of the promoter in one or more immune cell types, e.g., T cells, NK cells, B cells, macrophages, dendritic cells, basophils, neutrophils, etc. In certain embodiments, the immune cell-specific transcription enhancer comprises a sequence having at least 70% sequence identity to at least 50 contiguous / adjacent nucleotides, preferably at least 100, 150, 200 or 250 contiguous / adjacent nucleotides, from one of the sequences set forth in SEQ ID NOs: 7-47, preferably SEQ ID NOs: 7-17 and 23, and maintains transcription enhancing activity (i.e., exhibits transcription enhancing activity that is similar to or better than the native sequence). In certain embodiments, the immune cell-specific transcription enhancer comprises a sequence having at least 70% sequence identity to one of the sequences set forth in SEQ ID NOs: 7-47, preferably SEQ ID NOs: 7-17 and 23, and maintains transcription enhancing activity (i.e., exhibits transcription enhancing activity that is similar to or better than the native sequence).

[0081] In a further embodiment, the immune cell specific transcription enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to at least 50 consecutive / contiguous nucleotides, preferably at least 100, 150, 200 or 250 consecutive / contiguous nucleotides, from one of the sequences set forth in SEQ ID NOs: 7 to 47, preferably SEQ ID NOs: 7 to 17 and 23. In a further embodiment, the immune cell specific transcription enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to one of the sequences set forth in SEQ ID NOs: 7 to 47, preferably SEQ ID NOs: 7 to 17 and 23.

[0082] In a further embodiment, the immune cell-specific transcriptional enhancer comprises or consists of at least 50 consecutive / contiguous nucleotides, preferably at least 100, 150, 200 or 250 consecutive / contiguous residues, from one of the sequences set forth in SEQ ID NOs: 7-47, preferably SEQ ID NOs: 7-17 and 23.

[0083] Some of the sequences set forth in SEQ ID NOs: 7 to 47 contain a repeat domain / motif. For example, the sequence set forth in SEQ ID NO: 7 contains a repeat domain / motif of about 50 nucleotides (sequence: GGTGTGGAGGGCCGGGTGGTGACX 1 CTX 2 AGTGACAGGTGAGGATGTGGCAX 3 (SEQ ID NO:63), where X 1 is G or A, preferably G; X 2 is G or C, preferably G, and X 3is C or T, preferably C. In one embodiment, the cell-specific transcriptional enhancer comprises at least one, preferably at least 2, 3, 4, 5, 6, 7, or 8 repeat domains / motifs. A list of putative repeat motifs present in each of the sequences set forth in SEQ ID NOs: 7-47 is provided in Table IV (SEQ ID NOs: 64-82, and AAAACCACA). That is, in one embodiment, the transcriptional enhancer sequence comprises one or more of the motifs shown in Table IV (SEQ ID NOs: 64-82, and AAAACCACA). For example, SEQ ID NO: 8 comprises one or more of motifs #3 (SEQ ID NO: 66), #4 (SEQ ID NO: 67), #17 (SEQ ID NO: 80), and 20 (AAACCACA) shown in Table IV. In further embodiments, the transcriptional enhancer sequence comprises the motifs and repeats shown in Table IV for each of SEQ ID NOs: 7-47.

[0084] In certain embodiments, the synthetic expression cassette is for expressing a nucleic acid of interest in a T cell and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 7-10, 13, 14, 18-22, 24-31, 33-43, 45 and 47, preferably SEQ ID NOs: 7-10, 13, 14. In a further embodiment, the synthetic expression cassette is for expressing a nucleic acid of interest in a T cell and the transcription enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 7, 9, 27, 33, 34, 36, 37, 42, 43 and 45, preferably SEQ ID NOs: 7 and 9. In one embodiment, the cell is a CD4 T cell. + The cell, wherein the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 22, 34, 37, 38, 43, 45 and 47.

[0085] In certain embodiments, the synthetic expression cassette is for expressing a nucleic acid of interest in a NK cell and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 8, 10-14, 18-22, 24-26, 28-31, 35, 38-41, 44 and 47, preferably SEQ ID NOs: 11, 12 and 14.

[0086] In certain embodiments, the synthetic expression cassette is for expressing a nucleic acid of interest in NK cells and T cells and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequences set forth in SEQ ID NOs: 8, 10, 13, 14, 18-21, 22, 24-26, 28-31, 35, 38, 39-41 and 47, preferably SEQ ID NOs: 8, 10, 13 and 14.

[0087] In one embodiment, the synthetic expression cassette is for expressing a nucleic acid of interest in a B cell and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 15-17, 23, 32, 44 and 46, preferably SEQ ID NOs: 15-17 and 23, and more preferably SEQ ID NO: 23.

[0088] In one embodiment, the synthetic expression cassette is for expressing a nucleic acid of interest in B cells and NK cells, and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NO:44.

[0089] In one embodiment, the synthetic expression cassette is for expressing a nucleic acid of interest in immune cells, such as NK cells, T cells, basophils, and monocytes / macrophages, and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence set forth in SEQ ID NO:14.

[0090] In one embodiment, the cells are CD4 + Cells (e.g., CD4 + T cell), and the transcriptional enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 22, 34, 37, 38, 43, 45 and 47.

[0091] In another embodiment, the cells are CD8 + Cells (e.g., CD8 + T cell), and the transcription enhancer comprises or consists of a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to one of the sequences set forth in SEQ ID NOs: 33, 35, and 39 to 41.

[0092] In some embodiments, the transcription enhancer sequence comprises one or more binding sites for the transcriptional regulator. In some embodiments, the transcription enhancer sequence comprises binding sites for at least two transcriptional regulators. In some embodiments, the transcription enhancer sequence comprises binding sites for at least three transcriptional regulators. In some embodiments, the transcription enhancer sequence comprises binding sites for at least four transcriptional regulators. For example, the sequence set forth in SEQ ID NO: 13 comprises binding sites for the transcriptional factors RUNX3, GATA2, FOS and JUN, i.e., in some embodiments, the sequence of the cell-specific transcription enhancer comprises one, two, three or all of these binding sites. The putative binding sites for the transcription factors in each of the sequences set forth in SEQ ID NOs: 7-47 are shown in Table V. That is, in some embodiments, the transcription enhancer sequence comprises one or more of the binding sites for the transcription factors shown in Table V.

[0093] The term "minimal promoter" refers to a promoter that contains only the minimal elements of a promoter, i.e., a TATA box (also called a Goldberg-Hogness box) and a transcription start site, and that is inactive (or poorly active) in inducing / driving gene expression in the absence of one or more appropriately placed (usually upstream) regulatory elements (transcription enhancers) that enhance the promoter activity. Any minimal promoter sequence known to those skilled in the art is contemplated for inclusion in the minimal promoter sequence of the present disclosure. Minimal promoter sequences are often derived from viruses or are truncated eukaryotic promoters, i.e., the minimal promoter can be a proopiomelanocortin minimal promoter (POMC), an adenovirus minimal promoter, a baculovirus minimal promoter, a CMV minimal promoter, a parvovirus minimal promoter, a herpesvirus minimal promoter, a poxvirus minimal promoter, an adeno-associated virus minimal promoter, a Semliki Forest virus minimal promoter, a SV40 minimal promoter, a vaccinia virus minimal promoter, or a retrovirus minimal promoter. Examples of minimal promoters include human simplex virus thymidine kinase (HSV TK or miniTK) minimal promoter, cauliflower mosaic virus (CaMV) 35S minimal promoter, human cytomegalovirus CMV minimal promoter (miniCMV), CMV53 (minCMV with an upstream GC box), simian virus 40 minimal promoter (minSV40), MLP (region -38 to +6 of adenovirus major late promoter), minP (synthetic minimal promoter consisting of a TATA box and a transcription start site, from Promega), pJB42CAT5 (minimal promoter derived from human junB gene), YB_TATA, and super core promoter 1 (SCP1) minimal promoter (see Table I below). Some minimal promoters (sometimes called "core promoters") are described in Ede et al., ACS Synth Biol. 2016 May 20; 5(5): 395-404.

[0094]

Table 1

[0095] The sequence identity between two nucleotide sequences can be determined by comparing the respective positions in the aligned sequences.The degree of identity between nucleotide sequences is a function of the number of matching nucleotides at the positions shared by the sequences.As used herein, a given percentage of identity between sequences indicates the degree of sequence identity in optimally aligned sequences. Optimal alignment of sequences for identity comparison can be performed using various algorithms and sequence alignment tools, such as, for example, the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math 2:482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, and computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package by the Genetics Computer Group, Madison, Wis., USA). Sequence identity can also be determined using the BLAST algorithm described in Altschul et al., 1990, J. Mol. Biol. 215:403-10 (using published default settings). Software / tools for performing BLAST analyses may be available through the National Center for Biotechnology Information. Other sequence alignment tools, such as Needle, Stretcher, Clustal Omega, and Kalign, are available through the European Bioinformatics Institute (EMBL-EBI).

[0096] The terms "operably positioned," "operably linked," and "operably associated" mean that a promoter (and / or enhancer) is in the correct functional location and orientation relative to a nucleic acid sequence to control transcription initiation and expression of that nucleic acid. An enhancer is "operably linked" to a promoter (e.g., a minimal promoter) when it is in the correct functional location and orientation to increase transcriptional activity of the promoter.

[0097] The term "synthetic" means that the expression cassette is a non-naturally occurring, man-made or recombinant construct, i.e., the combination of the minimal promoter and the transcription enhancer does not naturally occur in the native genome of the cell. In some embodiments, the minimal promoter is heterologous with the transcription enhancer, i.e., the minimal promoter is one that is not normally associated with the transcription enhancer in its native environment, e.g., they do not control the expression of the gene in the native genome of the cell. In some embodiments, the minimal promoter and the transcription enhancer are from different cell types or different organisms (e.g., eukaryotic cells versus viruses). In some embodiments, the minimal promoter and / or the transcription enhancer are heterologous with the nucleic acid of interest, i.e., they are not normally associated with the nucleic acid of interest in its native environment. In some embodiments, the transcription enhancer is of human origin. In some embodiments, the minimal promoter is of viral origin.

[0098] In some embodiments, the synthetic expression cassette further comprises a polyadenylation (poly(A)) signal. The poly(A) signal results in proper polyadenylation (transcription) of the nucleic acid of interest. The nature of the poly(A) signal is not believed to be critical to the successful practice of the invention, and therefore any such sequence may be employed. Representative examples of poly(A) signals include the SV40 poly(A) signal and / or the bovine growth hormone poly(A) signal, which are convenient and / or known to function well in a variety of target cells. In some embodiments, the synthetic expression cassette further comprises a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE). Such elements are typically used to increase the expression of genes produced by viral vectors and have been shown to increase mRNA stability and protein yield (see, e.g., Lee, YB, et al. 2005. Exp Physiol. 90(1):33-7). In some embodiments, the WPRE is used in combination with a poly(A) signal. In another embodiment, the WPRE replaces the poly(A) signal.

[0099] In some embodiments, the synthetic expression cassette further comprises a transcription termination signal. A "termination signal" or "terminator" is comprised of a DNA sequence involved in specific termination of an RNA transcript by an RNA polymerase. That is, in some embodiments, a termination signal that ends the production of an RNA transcript is contemplated.

[0100] In certain embodiments, the synthetic expression cassette further comprises a nucleic acid of interest. The term "nucleic acid of interest" or "gene of interest" is used to refer to a nucleic acid encoding a functional peptide or polypeptide (protein) of interest (natural or modified peptide / protein). In certain embodiments, the functional peptide or polypeptide is a therapeutic peptide or polypeptide, i.e., a peptide or polypeptide that can be administered to a subject for the purpose of treating or preventing a disease. Any nucleic acid encoding a peptide or polypeptide of interest known to one of skill in the art is contemplated for inclusion in the synthetic expression cassette. The peptide or polypeptide of interest can be an enzyme, a signaling molecule (e.g., kinase, phosphatase), a receptor, a growth factor (e.g., cytokine), a chemotactic protein (e.g., chemokine), a structural protein (cytoskeletal protein), a transcription factor, a cell adhesion protein, an antibody or antigen-binding fragment thereof, and the like. The peptide or polypeptide can be a naturally occurring peptide or polypeptide, a fragment or variant thereof, a chimeric version thereof, and the like.

[0101] In certain embodiments, the subject nucleic acid encodes a recombinant receptor, such as, for example, a chimeric antigen receptor (CAR). Such a CAR typically comprises a ligand binding domain (e.g., an antibody or antibody fragment, such as a single chain variable fragment (scFv)) that provides specificity for a desired antigen (e.g., a tumor antigen) linked, in some aspects via a linker and / or a transmembrane domain, to an intracellular activation domain portion, such as, for example, a T cell or NK cell activation domain, that provides the primary activation signal.

[0102] In certain embodiments, the recombinant receptor (e.g., CAR) comprises an activation cytoplasmic signaling domain (also referred to interchangeably as an intracellular signaling region), such as an activation cytoplasmic (intracellular) domain capable of inducing a primary activation signal in an immune cell (e.g., T cell, NK cell), a cytoplasmic signaling domain of a T cell receptor (TCR) component (e.g., the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof), and / or an intracellular signaling domain that comprises an immunoreceptor tyrosine-based activation motif (ITAM).

[0103] In some embodiments, the recombinant receptor (e.g., CAR) further comprises an extracellular ligand-binding domain that specifically binds to a ligand (e.g., antigen) antigen. In some embodiments, the ligand, e.g., an antigen, is a protein expressed on the cell surface. In some embodiments, the CAR is a TCR-like CAR and the antigen is a processed peptide antigen, e.g., a peptide antigen of an intracellular protein, that is recognized on the cell surface in the context of a major histocompatibility complex (MHC) molecule.

[0104] Exemplary recombinant receptors include those described in, for example, International Patent Application Publication Nos. WO 2000 / 14257, WO 2013 / 126726, WO 2012 / 129514, WO 2014 / 031687, WO 2013 / 166321, WO 2013 / 071154, WO 2013 / 123061, U.S. Patent Application Publication Nos. US2002 / 131960, US201 Nos. 3,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118, and European Patent Application No. EP 2537416, and / or Sadelain. et al., Cancer Discov. 2013 April;3(4):388-398; Davila et al. (2013) PLoS ONE 8(4):e61338; Turtle et al., Curr. Opin. Immunol, 2012 October;24(5):633-39; Wu et al., Cancer, 2012 March 18(2):160-75. In some embodiments, engineered antigen receptors include CARs described in U.S. Pat. No. 7,446,190 and those described in International Patent Application Publication WO 2014 / 055668.

[0105] In some embodiments, a recombinant receptor (e.g., a CAR) comprises an antigen- or ligand-binding domain within the extracellular portion of the recombinant receptor that binds (specifically binds) an antigen (or ligand), such as, for example, one or more antigen-binding fragments, domains or portions, or one or more antibody variable domains, and / or antibody molecules. In some embodiments, a CAR comprises, for example, a variable heavy chain (VH) of a monoclonal antibody (mAb). H ) and variable light chain (V L The term "antibody" as used herein is used in a broad sense to include polyclonal and monoclonal antibodies, and includes intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, single chain antibody fragments containing a variable heavy (VH) region capable of specific binding to an antigen, single chain variable fragments (scFv), and fragments of single domain antibodies (e.g., sdAb, sdFv, nanobodies). The term includes genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, etc., as well as heteroconjugate antibodies, such as bispecific, multispecific antibodies, diabodies, triabodies and tetrabodies, tandem di-scFvs, tandem tri-scFvs. Unless otherwise indicated, the term "antibody" should be understood to include functional antibody fragments thereof. The term also includes intact or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses IgM, IgE, IgA and IgD.

[0106] In some embodiments, the antigen-binding proteins, antibodies and antigen-binding fragments thereof specifically recognize the antigen of the full-length antibody. In some embodiments, the heavy and light chains of the antibody can be full-length or can be antigen-binding portions (Fab, F(ab')2, Fv or single chain Fv fragment (scFv)). In other embodiments, the heavy chain constant region of the antibody is selected from, for example, IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD and IgE, particularly selected from, for example, IgG1, IgG2, IgG3 and IgG4, more particularly IgG1 (e.g., human IgG1). In another embodiment, the light chain constant region of the antibody is selected from, for example, kappa or lambda, particularly kappa.

[0107] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. H and V L ) generally have a similar structure, with each domain containing four conserved framework regions (FRs) and three CDRs (see, e.g., Kindt et al. Kuby Immunology, 6 th ed., W.H. Freeman and Co., page 91 (2007). H Or V L A single domain of V may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may each have a complementary V L Or V H To screen a library of domains from antibodies that bind to an antigen, L Or V H can be isolated using domains of the IL-1 ...

[0108] A single domain antibody (sdAb) is an antibody fragment that comprises all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody. In certain embodiments, a single domain antibody is a human single domain antibody.

[0109] Antibody fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies as well as production by recombinant host cells. In some embodiments, the antibody is a recombinantly produced fragment, such as a fragment that contains a sequence that is not naturally occurring and / or cannot be produced by enzymatic digestion of a naturally occurring intact antibody, such as one that comprises two or more antibody regions or chains linked by a synthetic linker, e.g., a peptide linker. In some embodiments, the antibody fragment is an scFv.

[0110] A "humanized" antibody is one in which all or substantially all CDR amino acid residues are derived from a non-human CDR and all or substantially all FR amino acid residues are derived from a human FR. A humanized antibody may optionally contain at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of a non-human antibody refers to a variant of a non-human antibody that has been humanized to retain the specificity and affinity of the parent non-human antibody, but typically to reduce immunogenicity in humans. In some embodiments, some FR residues in a humanized antibody are replaced with the corresponding residues from the non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to retain or improve the specificity or affinity of the antibody.

[0111] In some embodiments, the CAR comprises an antibody or antigen-binding fragment (e.g., scFv) that specifically recognizes an antigen, such as an intact antigen, expressed on the cell surface.

[0112] In some embodiments, the CAR comprises a TCR-like antibody, e.g., an antibody or an antigen-binding fragment (e.g., scFv), that specifically recognizes an intracellular antigen, e.g., a tumor-associated antigen, that is present on the cell surface as an MHC-peptide complex. In some embodiments, the antibody or antigen-binding portion thereof that recognizes the MHC-peptide complex can be expressed on the cell as part of a recombinant receptor, e.g., an antigen receptor. Among the antigen receptors are functional non-TCR antigen receptors, e.g., chimeric antigen receptors (CARs). In general, a CAR comprising an antibody or antigen-binding fragment that exhibits TCR-like specificity directed against a peptide-MHC complex may also be referred to as a TCR-like CAR.

[0113] In some embodiments, the recombinant receptor comprises a recombinant T cell receptor (TCR) and / or a TCR cloned from a naturally occurring T cell. In some embodiments, the T cell receptor (TCR) comprises variable alpha and beta chains (also known as TCRalpha and TCRbeta, respectively) or variable gamma and delta chains (also known as TCRgamma and TCRdelta, respectively), or functional fragments thereof, such that the molecule can specifically bind to an antigenic peptide bound to an MHC receptor. In some embodiments, the TCR is in the alpha beta form. Typically, TCRs present in the alpha beta and gamma delta forms are generally structurally similar, although T cells expressing them may have distinctive anatomical locations or functions. TCRs may be present on the cell surface or in a soluble form. Generally, TCRs are present on the surface of T cells (or T lymphocytes), where they are generally involved in recognizing antigens bound to MHC molecules. In some embodiments, the TCR may also comprise a constant domain, a transmembrane domain, and / or a short cytoplasmic tail (see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3 rded., Current Biology Publications, p. 4:33, 1997). For example, in some embodiments, each chain of the TCR can retain an N-terminal immunoglobulin variable domain, an immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C-terminus. In some embodiments, the TCR binds to the invariant protein of the CD3 complex, which is involved in mediating signal transduction.

[0114] In some embodiments, a TCR for a target antigen (e.g., a cancer / tumor antigen) is identified and introduced into the cell. In some embodiments, a nucleic acid encoding a TCR can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of a publicly available TCR DNA sequence. In some embodiments, the TCR is obtained from a biological source, such as from a cell, such as a T cell (e.g., a cytotoxic T cell), a T cell hybridoma, or other publicly available source. In some embodiments, the T cell can be obtained from an in vivo isolated cell. In some embodiments, a high affinity T cell clone can be isolated from the patient and the isolated TCR. In some embodiments, the T cell can be a cultured T cell hybridoma or clone. In some embodiments, a TCR clone for a target antigen was generated in a transgenic mouse modified with human immune system genes (e.g., human leukocyte antigen system, or HLA). See, e.g., tumor antigens (see, e.g., Parkhurst et al. (2009) Clin Cancer Res. 15:169-180 and Cohen et al. (2005) J Immunol. 175:5799-5808). In some embodiments, phage display is used to isolate TCRs against a given target antigen (see, e.g., Varela-Rohena et al. (2008) Nat Med. 14:1390-1395 and Li (2005) Nat BioTechnol. 23:349-354). In some embodiments, the TCRs or antigen-binding portions thereof can be synthetically generated from knowledge of the sequence of the TCR of interest.

[0115] In some embodiments, the recombinant receptor (e.g., a CAR, such as an antibody or antigen-binding fragment thereof) further comprises a spacer, which may be or may include at least a portion of a constant region of an immunoglobulin or a variant or modified version thereof, such as a hinge region, such as an IgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is of a human IgG, such as IgG4 or IgG1. In some aspects, the portion of the constant region serves as a spacer region between the antigen recognition component, such as an scFv, and the transmembrane domain. The spacer may be of a length that increases the responsiveness of the cell after antigen binding compared to the absence of the spacer. Exemplary spacers include those having at least about 10 to 220 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, including any integer between the endpoints of any of the listed ranges. Exemplary spacers include an IgG4 hinge alone, an IgG4 hinge linked to a CH2 and CH3 domain, or an IgG4 hinge linked to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153, or PCT Patent Application Publication No. WO 2014 / 031687.

[0116] The antigen / ligand recognition domain is generally linked to one or more intracellular signaling components, such as signaling components that mimic activation via an antigen receptor complex, such as a TCR or NK receptor complex in the case of a CAR, and / or a signal via another cell surface receptor. That is, in some embodiments, the antigen binding component (e.g., an antibody) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In some embodiments, a transmembrane domain that naturally associates with one of the domains in the receptor, such as a CAR, is used. In some examples, the transmembrane domain is selected or modified by amino acid substitution to prevent binding of the domain to the transmembrane domain of the same or a different cell surface membrane protein, minimizing interaction with other components of the receptor complex.

[0117] The transmembrane domain in some embodiments is derived from either natural or synthetic origin. If the origin is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. The transmembrane region includes those derived from the alpha, beta, or zeta chains of TCR, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154 (i.e., including at least the transmembrane region thereof). Alternatively, the transmembrane domain in some embodiments is synthetic. In some aspects, the synthetic transmembrane domain comprises primarily hydrophobic residues, such as, for example, leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan, and valine will be present at each end of the synthetic transmembrane domain.

[0118] Some intracellular signaling domains mimic or approximate the signaling through a natural antigen receptor, through that receptor in combination with a costimulatory receptor, and / or through a costimulatory receptor alone. In some embodiments, a short oligo- or polypeptide linker, e.g., a linker 2 to 10 amino acids in length, such as one that contains a glycine and a serine, e.g., a glycine-serine doublet, is present to form the link between the transmembrane domain and the cytoplasmic signaling domain of the CAR.

[0119] A receptor, e.g., a CAR, generally comprises at least one intracellular signaling component. In some embodiments, the receptor comprises an intracellular component of the TCR complex, such as the TCR CD3 chain, e.g., the CD3 zeta chain, which mediates T-cell activation and cytotoxicity. That is, in some aspects, the CAR is linked to one or more cell signaling modules. In some embodiments, the cell signaling module comprises a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or another CD transmembrane domain. In some embodiments, the receptor, e.g., a CAR, further comprises portions of one or more additional molecules, e.g., Fc receptor gamma, CD8, CD4, CD25, or CD16. In some aspects, the CAR comprises a primary cytoplasmic signaling sequence that controls the primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts upon stimulation may comprise a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs that comprise primary cytoplasmic signaling sequences include those derived from the TCR or CD3 zeta, FcR gamma, or FcR beta. In some embodiments, the cytoplasmic signaling molecule in the CAR comprises a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3 zeta. In some embodiments, components for generating a secondary or costimulatory signal, such as the signaling domains of costimulatory receptors such as CD28, 4-1BB, OX40, DAP10, and ICOS, to promote full activation, are also included in the CAR. In some aspects, additional CARs are expressed in the same cell to provide components for generating a secondary or costimulatory signal. In some cases, the CARs are referred to as first, second, and / or third generation CARs.In some embodiments, the first generation CAR provides only the signal induced by the antigen receptor (e.g., the CD3 chain) upon antigen binding; in some embodiments, the second generation CAR provides that signal as well as a costimulatory signal, such as by including an intracellular signaling domain from a costimulatory receptor, such as CD28 or CD137; in some embodiments, the third generation CAR in some embodiments includes multiple costimulatory domains from different costimulatory receptors.

[0120] In some embodiments, the CAR or other antigen receptor may further comprise a marker, or the cells may further express a marker, such as, for example, a surrogate marker, that may be used to confirm the transduction or engineering of cells expressing a receptor, such as, for example, a truncated cell surface receptor, such as, for example, a truncated EGFR (tEGFR). In some aspects, the marker comprises all or a portion of CD34 (e.g., truncated), NGFR, or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a polynucleotide encoding a linker sequence, such as, for example, a cleavable linker sequence, such as, for example, T2A. See WO 2014 / 031687. In some embodiments, introduction of a construct encoding CAR and EGFRt separated by a T2A ribosomal switch allows for the expression of the two proteins from the same construct, and thus EGFRt can be used as a marker to detect cells expressing the construct. In some embodiments, the marker and optionally the linker sequence can be any of those disclosed in published patent application WO 2014 / 031687. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence, such as a T2A cleavable linker sequence.

[0121] Among the antigens that can be targeted by the chimeric receptors are those expressed in the context of the disease, condition, or cell type targeted via adoptive cell therapy. Among the diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including cancers and tumors, including cancers of the immune system, such as blood cancers, e.g., lymphomas, leukemias, and / or myelomas (e.g., B-cell, T-cell, and myeloid leukemias, lymphomas, and multiple myelomas).

[0122] In some embodiments, the antigen (or ligand) is a polypeptide. In some embodiments, it is a carbohydrate or other molecule. In some embodiments, the antigen (or ligand) is selectively expressed or overexpressed on disease or disorder cells, e.g., tumor / cancer or pathogenic cells, compared to normal or non-target cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or expressed on modified cells.

[0123] In some embodiments, the antigen (or ligand) is a tumor antigen or a cancer marker. In certain embodiments, the antigen is an integrin (e.g., α v β6 integrin, α vβ3 integrin, integrin β7), B-cell maturation antigen (BCMA), B7-H6, carbonic anhydrase 9 (also known as CA9, CAIX or G250), cancer-testis antigen, cancer / testis antigen IB (also known as CTAG, NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), cyclin, cyclin A2, CC motif chemokine ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD138, CD171, epidermal growth factor protein (EGFR), truncated epidermal growth factor protein (tEGFR), epidermal growth factor receptor type III mutant (EGFR vIII), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrin B2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor-like 5 (FCRL5; also known as Fc receptor homolog 5 or FCRH5), fetal acetylcholine receptor (fetal AchR), folate binding protein (FBP), folate receptor alpha, fetal acetylcholine receptor, ganglioside GD2, O-acetylated GD2 (OGD2), ganglioside GD3, glycoprotein 100 (gp100), Her2 / neu (receptor tyrosine kinase erbB2), Her3 (erb-B3), Her4 (erb-B4), erbB dimer, human high molecular weight melanoma-associated antigen (HMW-MAA), hepatitis B surface antigen, human leukocyte antigen A1 (HLA-A1), human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha (IL-22Rα), IL-13 receptor alpha 2 (IL-13Rα2), kinase insert domain receptor (kdr), kappa light chain, L1 cell adhesion molecule (L1CAM), CE7 epitope of L1-CAM, leucine-rich repeat-containing 8 family member A (LRRC8A), LewisY, melanoma-associated antigen (MAGE)-A1, MAGE-A3, MAGE-A6, mesothelin, c-Met, murine cytomegalovirus (CMV), mucin 1 (MUC1), MUC16, natural killer group 2 member D (NKG2D) ligand, melan A (MART-1), neural cell adhesion molecule (NCAM), oncofetal antigen, preferentially expressed melanoma antigen (PRAME), progesterone receptor, prostate-specific antigen, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor Receptor-targeted antigens include antigens that bind to universal tags, such as receptor 1 (ROR1), survivin, trophoblast glycoprotein (TPBG, also known as 5T4), tumor-associated glycoprotein 72 (TAG72), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor receptor 2 (VEGFR2), Wilms' tumor 1 (WT-1), galectins (galectin-1, galectin-7), pathogen-specific antigens, and / or that bind to biotinylated molecules and / or that bind to molecules expressed by HIV, HCV, HBV, or other pathogens, such as bacteria and parasites. Antigens targeted by the receptor in some embodiments include antigens that bind to B cell malignancies, such as any of several known B cell markers. In some embodiments, the antigen targeted by the receptor is CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglamda, CD79a, CD79b, or CD30. In some embodiments, multiple recombinant receptors are used that target multiple antigens. In further embodiments, two recombinant receptors are used that target two antigens.

[0124] Vectors / plasmids In certain embodiments, the synthetic expression cassette is contained within a plasmid or vector. That is, the present disclosure also relates to vectors or plasmids that contain the synthetic expression cassettes described herein. The term "vector" is used to refer to a carrier into which a nucleic acid (e.g., a synthetic expression cassette as defined herein) can be inserted for introduction into a cell where it can be replicated. The term "expression vector" or "nucleic acid vector" refers to a vector that contains a nucleic acid or "expression cassette" that encodes a transcribable gene product, as well as at least a portion of the "regulatory" or "control" sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to the control sequences that govern transcription and translation, an expression vector can contain nucleic acid sequences that provide other functions as well.

[0125] In some embodiments, the vector further comprises a nucleic acid encoding a selection marker or reporter protein. Selection marker or reporter is defined herein to refer to a nucleic acid encoding a polypeptide that, when expressed, confers an identifiable characteristic on a cell (e.g., detectable signal, resistance to a selection agent) that allows cells containing the selection marker to be easily identified, isolated and / or selected from cells lacking the selection marker or reporter. The selection marker in the vector of the present disclosure is contemplated to include any selection marker or reporter known to those skilled in the art. For example, the selection marker can be a drug selection marker, an enzyme, or an immune marker. Examples of selectable markers or reporters include, but are not limited to, polypeptides that confer drug resistance (e.g., kanamycin / geneticin resistance), enzymes such as alkaline phosphatase and thymidine kinase, bioluminescent and fluorescent proteins such as luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), citrine from discosoma and red fluorescent protein (dsRED), membrane-bound proteins for which high affinity antibodies or ligands exist or can be produced by conventional methods, and fusion proteins that include membrane-bound proteins suitably fused to an antigen tag domain from hemagglutinin (HA) or Myc, among others. The nucleic acid encoding the selectable marker or reporter protein may be under the control of the same promoter / enhancer as the nucleic acid of interest or may be under the control of a different promoter / enhancer.

[0126] In certain embodiments, a vector may contain additional elements such as one or more origins of replication (often termed "ori"), restriction endonuclease recognition sites (multiple cloning sites, MCS), and / or internal ribosome entry site (IRES) elements.

[0127] In some embodiments, the vector is a viral vector. As used herein, the term "viral vector" refers to a recombinant virus that can transduce cells and introduce their genetic material into the cells. In some embodiments, the viral vector is suitable for use in gene therapy applications. Examples of viral vectors that can be used in gene therapy include retroviruses (lentiviruses), adenoviruses, adeno-associated viruses (AAV), herpes viruses (herpes simplex viruses), alphaviruses, and vaccinia viruses (poxviruses). In some embodiments, the vector is a lentiviral vector. As will be apparent to those skilled in the art, the term "lentiviral vector" is used to refer to lentiviral particles that mediate the transfer of nucleic acid. Lentiviral particles typically contain various viral components and may also contain host cell components in addition to the nucleic acid. In certain aspects, the terms "lentiviral vector" and "lentiviral expression vector" are used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles.

[0128] In one embodiment, the lentiviral vector is a pseudotyped lentiviral vector. Pseudotyped lentiviral vectors consist of vector particles that carry envelope proteins (glycoproteins, GP) from other enveloped viruses. The particles have the tropism of the virus from which the envelope proteins are derived. One glycoprotein that is widely used for pseudotyped lentiviral vectors is the vesicular stomatitis virus GP (VSV-G), due to the very broad tropism and stability of the resulting pseudotypes. Pseudotyped lentiviral vectors are well known in the art, and some examples are described, for example, in Cronin et al., Curr. Gene Ther. 5(4):387-398. Such vectors include lyssavirus GP, lymphocytic choriomeningitis virus (LCMV) GP, alphavirus GP (e.g., Ross River virus (RRV), Semliki Forest virus (SFV) and Sindbis virus GP), filovirus GP (e.g., Marburg virus and Ebola Zaire virus GP), gammaretrovirus GP (e.g., ecotropic MLV, amphotropic 4070A MLV, 10A1 MLV, xenotropic NZB MLV, mink cell focus forming virus, gibbon ape leukemia virus (GALV), RD1 14 GP), vesicular stomatitis virus type G (VSV-G), measles virus lentiviral vectors (MV-LV), baboon envelope (BaEV)-LV and lentiviral vectors pseudotyped with baculovirus GP (GP64).

[0129] In certain embodiments, the vector is an episomally maintained viral vector or a non-integrating vector, such as a Sendai virus or vector, that is not integrated into the genome but is episomally maintained through cell division due to the presence of a scaffold / matrix attachment region inside the vector (see, e.g., Giannakopoulos A et al., J Mol Biol. 2009 Apr 17;387(5):1239-49; and Haase et al., BMC BioTechnol. 2010;10:20).

[0130] In another embodiment, the vector is a non-viral vector, for example, nude DNA, a liposome, a polymerizer, or a molecular conjugate.

[0131] cell In another aspect, the disclosure provides a cell (host cell, modified cell) comprising a synthetic expression cassette or vector / plasmid described herein. In certain embodiments, the cell is a primary cell, e.g., a brain / neuronal cell, a peripheral blood cell (e.g., B or T lymphocyte, monocyte, NK cell), a cord blood cell, a bone marrow cell, a cardiac cell, an endothelial cell, an epithelial cell, an epithelial cell, a fibroblast, a hepatocyte, or a lung / pulmonary cell. In certain embodiments, the cell is a bone marrow cell, a peripheral blood cell, or a cord blood cell. In further embodiments, the cell is a primary cell, e.g., a T cell (e.g., CD8 + These are immune cells such as T cells, B cells or NK cells.

[0132] In some embodiments, the cell is a stem cell. As used herein, the term "stem cell" refers to a cell that has pluripotency such that it can be differentiated into a functional mature cell. Stem cells include undifferentiated hematopoietic cells, progenitor cells, and mature stem cells, which are undifferentiated cells present in various tissues in the human body that can regenerate themselves and give rise to the specific cell type and tissue from which they originate (e.g., muscle stem cells, skin stem cells, brain or neural stem cells, mesenchymal stem cells, lung stem cells, liver stem cells).

[0133] In certain embodiments, the cells are undifferentiated hematopoietic cells. As used herein, the term "undifferentiated hematopoietic cells" is used to refer to cells that have pluripotency that can differentiate into functional mature blood cells of myeloid and lymphoid lineages, such as T cells, B cells, NK cells, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), platelets (e.g., megakaryoblasts, megakaryocyte-producing platelets, platelets), and monocytes (e.g., monocytes, macrophages), with or without the ability to regenerate while retaining their pluripotency (self-renewal). The cells include "hematopoietic stem cells" or "HSCs," which are cells that have both pluripotency that can differentiate into functional mature cells, such as granulocytes, erythrocytes, platelets, and monocytes, and the ability to regenerate while retaining their pluripotency (self-renewal), as well as pluripotent hematopoietic cells that do not have the ability to self-renew. The cells also include embryonic stem cells (ESCs), which are pluripotent stem cells derived from the inner cell mass of the blastocyst, an early pre-implantation embryo. In one embodiment, the cell population comprises ESCs. In another embodiment, the cell population comprises HSCs. HSCs may be obtained from any body or organ in the body that contains cells of hematopoietic origin. Such sources include unfractionated bone marrow (from femur, hip, ribs, sternum and other bones), umbilical cord blood, peripheral blood, liver, thymus, lymph, and spleen. All of the foregoing unpurified or unfractionated blood products may be enriched for cells with HSC characteristics by methods known to those of skill in the art. HSCs are characterized by their small size, lack of lineage markers, such as rhodamine 123 (rhodamine 123), and lack of hematopoietic markers.DULL , rho 0 These cells are phenotypically identified by their low staining with vital dyes such as CD4+ (also called CD4+ IgG) or Hoechst 33342 (side population), and by the presence / absence of various antigenic markers on their surface, many of which belong to lineage clusters, e.g., CD34, CD38, CD90, CD133, CD105, CD45, and c-kit.

[0134] In one embodiment, the stem cells are induced pluripotent stem cells (iPSCs). The term iPSCs refers to pluripotent stem cells that can be generated directly from mature cells using appropriate factors to "reprogram" the cells.

[0135] In certain embodiments, the cell is a mammalian cell, such as a human cell.

[0136] The synthetic expression cassettes or vectors / plasmids described herein can be introduced into cells using standard techniques for introducing nucleic acids into cells, such as transfection, transduction, or transformation. In certain embodiments, the vector is a viral vector and the cell is transduced by the vector. As used herein, the term "transduction" refers to the stable transfer of genetic material from a viral particle (e.g., lentivirus) to a cell genome (e.g., hematopoietic cell genome). The term also encompasses the introduction of a non-integrating viral vector into a cell, leading to transient or episomal expression of a gene of interest present in the viral vector.

[0137] The viruses can be used to infect cells in vivo, ex vivo, or in vitro using techniques well known in the art. For example, CD34 + When cells, or stem cells, are transduced ex vivo, the vector particles are 5 1 x 10 cells per 5 ~100 or 50×105 Doses that also correspond to transducing units of viral vector, generally on the order of 1-100 or 1-50 multiplicity of infection (MOI), may be used to incubate with the cells. Of course, this includes vector amounts that correspond to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 and 50 MOI.

[0138] The cells may be cultured in a medium suitable for the maintenance, growth or proliferation of the cells before, during and / or after transduction. The culture conditions of the cell population will vary depending on various factors, especially on the starting cell population. Suitable culture media and conditions are well known in the art. The culture may be carried out in a natural, semi-synthetic or synthetic medium in terms of composition and in terms of form, in a solid, semi-solid or liquid medium, and in any nutrient medium used in cell culture, such as for example stem cell culture, to which one or more growth factors may be added. Such media typically contain sodium, potassium, calcium, magnesium, phosphorus, chlorine, amino acids, vitamins, cytokines, hormones, antibiotics, serum, fatty acids, sugars, etc. In the culture medium, other chemical or biological components may be incorporated, alone or in combination, if necessary in the case. The components incorporated into the medium can be fetal bovine serum, human serum, horse serum, insulin, transferrin, lactoferrin, cholesterol, ethanolamine, sodium selenite, monothioglycerol, 2-mercaptoethanol, bovine serum albumin, sodium pyruvate, polyethylene glycol, various vitamins, various amino acids, agar, agarose, collagen, methylcellulose, various cytokines, various growth factors, and the like.Examples of such basal media suitable for methods of expanding stem cells include StemSpan™ Serum-Free Expansion Medium (SFEM) (StemCell Technologies®, Vancouver, Canada), StemSpan™ H3000-Defined Medium (StemCell Technologies®, Vancouver, Canada), CellGro™, SCGM (CellGenix™, Freiburg, Germany), StemPro™-34 SFM (Invitrogen®), Dulbecco's Modified Eagle's Medium (DMEM), Ham's Nutrient Mixture H12 Mixture F12, McCoy's 5A Medium, Eagle's Minimum Essential Medium (EMEM), MEM Medium (alpha modified Eagle's Minimum Essential Medium), RPMI 1640 Medium, Isocove's Modification of Dulbecco's Medium (IMDM), StemPro34™ (Invitrogen®), X-VIVO™ Examples of such antibodies include, but are not limited to, X-VIVO™ 10 (Cambrex®), X-VIVO™ 15 (Cambrex®), and Stemline™ II (Sigma-Aldrich®).

[0139] After transduction, the transduced cells can be cultured under conditions suitable for their maintenance, growth and / or proliferation, hi certain embodiments, the transduced cells are cultured for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days prior to transplantation.

[0140] Culture conditions for maintaining and / or expanding stem cells are well known in the art. Typically, the culture conditions include the use of factors such as cytokines and growth factors generally known in the art of stem cell expansion. Such cytokines and growth factors can be biologics or small molecules and include, but are not limited to, IL-1, IL-3, IL-6, IL-11, G-CSF, GM-CSF, SCF, FIT3-L, thrombopoietin (TPO), erythropoietin, and analogs thereof. As used herein, "analog" includes any structural variant of cytokines and growth factors that have biological activity as the naturally occurring form, including variants with enhanced or decreased biological activity compared to the naturally occurring form, or cytokine receptor agonists such as agonistic antibodies against the TPO receptor (e.g., VB22B sc(Fv)2, as detailed in WO 2007 / 145227, etc.). The combination of cytokines and growth factors are selected to maintain / expand stem cells while limiting the production of terminally differentiated cells. In one particular embodiment, the one or more cytokines and growth factors are selected from the group consisting of SCF, Flt3-L and TPO.

[0141] Human IL-6 or interleukin-6, also known as B-cell stimulatory factor 2, has been described in (Kishimoto, Ann. review of Immunol. 23:1, 2005) and is also commercially available. Human SCF or stem cell factor, mast cell growth factor, or hematopoietic stem cell factor (Steel factor), also known as c-kit ligand, has been described in (Smith, MA et al., ACTA Haematologica, 105(3):143, 2001) and is also commercially available. Flt3-L or FLT-3 ligand, also called FL, is a factor that binds to the flt3-receptor. It has been described in (Hannum C, Nature 368(6472):643-8) and is also commercially available. TPO or thrombopoietin, also known as megakaryocyte growth factor (MGDF) or c-Mpl ligand, has been described (Kaushansky K (2006). N. Engl. J. Med. 354(19):2034-45) and is commercially available.

[0142] The chemical and biological components mentioned above can be used not only by adding them to the culture medium, but also by immobilizing them on the surface of the substrate or support used for the culture, specifically by dissolving a certain component to be used in a suitable solvent and coating the substrate or support with the resulting solution and then washing away the excess of the component. The component to be used may also be added to a substrate or support that is previously coated with a substance that binds to this component.

[0143] Stem cells may be cultured in culture vessels commonly used for animal cell culture, such as Petri dishes, flasks, plastic bags, Teflon bags, etc., optionally after pre-coating with extracellular matrix or cell adhesion molecules. Materials for such coating may include collagen types I to XIX, fibronectin, vitronectin, laminins 1 to 12, nitrogen, tenascin, thrombospondin, von Willebrand factor, osteoponin, fibrinogen, various elastins, various proteoglycans, various cadherins, desmocolin, desmoglein, various integrins, E-selectin, P-selectin, L-selectin, immunoglobulin superfamily, Matrigel®, poly-D-lysine, poly-L-lysine, chitin, chitosan, Sepharose®, alginate gel, hydrogel or fragments thereof. Such coating materials may be recombinant materials with artificially modified amino acid sequences. Stem cells may be cultured using bioreactors that allow mechanical control of medium composition, pH, etc. to obtain high-density cultures (Schwartz RM, Proc. Natl. Acad. Sci. USA, 88:6760, 1991; Koller MR, Bone Marrow Transplant, 21:653, 1998; Koller, MR, Blood, 82:378, 1993; Astori G, Bone Marrow Transplant, 35(1) 101, 2005).

[0144] The cell population can then be washed to remove the compound or composition of the invention and / or any other components of the cell culture and resuspended in a cell suspension medium appropriate for short-term use medium or in a medium for long-term storage, e.g., a medium suitable for cryopreservation, e.g., DMEM containing 40% FCS and 10% DMSO. Other methods of preparing cryopreservation for cells after culture are also available to the skilled artisan.

[0145] composition In another aspect, the disclosure provides a composition comprising a synthetic expression cassette, vector or cell described herein. The composition may include one or more carriers or excipients, such as, for example, a buffer, saline, a preservative, etc. In some embodiments, the composition is a pharmaceutical composition comprising at least one pharmacologically acceptable carrier or excipient. As used herein, an "excipient" has its ordinary meaning in the art and is any component that is not an active ingredient (drug) itself. Excipients include, for example, binders, lubricants, diluents, fillers, thickeners, disintegrants, plasticizers, coatings, barrier layer formulations, lubricants, stabilizers, delayed release agents, and other components. As used herein, a "pharmaceutical acceptable excipient" refers to any excipient that does not interfere with the effectiveness of the biological activity of the active ingredient and is not toxic to the subject, i.e., is a type of excipient and / or is used in an amount that is not toxic to the subject. Excipients are well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 2012, 22 by Loyd V Allen, Jr. nd Handbook of Pharmaceutical Excipients, 2012, 7 edition, Pharmaceutical Press; Rowe et al. th (See, for example, the American Journal of Clinical Chemistry, vol. 13, no. 1, pp. 1171-1175, Pharmaceutical Press). Pharmaceutical compositions can be prepared using standard methods known in the art by mixing the active ingredient, which is of the desired purity, with one or more optional pharmacologically acceptable carriers, excipients and / or stabilizers. Excipients can be selected for administration of the composition by any route, e.g., intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, intraocular, intraventricular, intraarticular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal or intrapulmonary (e.g., aerosol) administration. In certain embodiments, the pharmaceutical compositions are formulated for injection, including local, catheter, systemic, intravenous, intraperitoneal, subcutaneous, or parenteral administration, e.g., as a solution, suspension, or emulsion.

[0146] The pharmaceutical composition in some embodiments is provided as a sterile liquid preparation, e.g., an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which may be buffered to a selected pH in some aspects. Liquid preparations are usually easier to prepare than gels, other viscous compositions, and solid compositions. In addition, liquid compositions are somewhat more convenient to administer, especially by injection. On the other hand, viscous compositions can be prepared within a suitable viscosity range to provide longer contact periods with certain tissues. The liquid or viscous composition can include a carrier, which can be a solvent or dispersion medium, including, for example, water, saline, phosphate buffered saline, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and suitable mixtures thereof.

[0147] Sterile injectables can be prepared by incorporating the cells in a solvent, in a mixture with a suitable carrier, diluent or excipient, e.g., sterile water, saline, glucose, dextrose, and the like. The composition can also be lyophilized. The composition can contain auxiliary substances, such as wetting agents, dispersing or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling agents, or viscosity enhancing additives, preservatives, flavoring agents, dyes, and the like, depending on the desired route of administration and preparation. In some embodiments, suitable preparations may be prepared according to standard texts.

[0148] Various additives that enhance the stability and sterility of the composition can be added, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, such as aluminum monostearate and gelatin.

[0149] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semitransparent matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, eg, films, or microcapsules.

[0150] Formulations to be used for in vivo administration are generally sterile. Sterility is readily accomplished, for example, by filtration through sterile filtration membranes.

[0151] Method / Usage The present disclosure also relates to a method of inducing expression of a gene of interest by a cell, the method comprising introducing into said cell a synthetic expression cassette or vector as described herein. The present disclosure also relates to the use of a synthetic expression cassette or vector as described herein to induce expression of a gene of interest by a cell. In certain embodiments, the cell is a primary cell, e.g., a brain / neuronal cell, a peripheral blood cell (e.g., B or T lymphocyte, monocyte, NK cell), a cord blood cell, a bone marrow cell, a cardiac cell, an endothelial cell, an epithelial cell, an epithelial cell, a fibroblast, a hepatocyte, or a lung / pulmonary cell. In certain embodiments, the cell is a bone marrow cell, a peripheral blood cell, or a cord blood cell. In further embodiments, the cell is a primary cell, e.g., a T cell (e.g., CD8 + These are immune cells such as T cells, B cells or NK cells.

[0152] In some embodiments, the gene of interest encodes a protein that is missing or absent in the cell. In some embodiments, the gene of interest encodes a recombinant receptor, such as a chimeric antigen receptor (CAR). In some embodiments, the gene of interest encodes a differentiation factor (for reprogramming the cell).

[0153] The disclosure also relates to a method of treating a disease, condition, or disorder in a subject, the method comprising administering a cell comprising a synthetic expression cassette or vector described herein. The disclosure also relates to the use of a cell comprising a synthetic expression cassette or vector described herein in a method of treating a disease, condition, or disorder in a subject. The disclosure also relates to the use of a cell comprising a synthetic expression cassette or vector described herein in a method of manufacturing a medicament for treating a disease, condition, or disorder in a subject. In certain embodiments, the disease, condition, or disorder is associated with absent or defective (e.g., mutated) protein expression, and the synthetic expression cassette or vector comprises a nucleic acid encoding a functional (e.g., naturally occurring) protein (e.g., gene therapy).

[0154] Examples of diseases / disorders (e.g., genetic diseases / disorders) associated with absent or defective (e.g., mutated) protein expression include certain hematological and lysosomal storage diseases, such as Wiskott-Aldrich syndrome (WAS) (Aiuti et al., Science 341(6148)), metachromatic leukodystrophy (MLD) (Biffi et al., Science 341(6148)), leukocyte adherence deficiency, X-linked CGD, Fanconi anemia, adrenoleukodystrophy, mucopolysaccharidosis IIIA, and immunodeficiencies, such as severe combined immunodeficiency (SCID) and adenosine deaminase (ADA) deficiency.

[0155] The disease or condition to be treated may be any in which expression of an antigen is associated with and / or involved in the pathogenesis of the disease condition or disorder, e.g., causes, exacerbates, or is otherwise involved in the disease, condition, or disorder. Exemplary diseases and conditions may include cellular malignancies or transformations (e.g., cancer), autoimmune or inflammatory diseases (e.g., arthritis, rheumatoid arthritis (RA), type I diabetes, systemic lupus erythematosus (SLE), inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, Graves' disease, Crohn's disease, multiple sclerosis, asthma, and / or transplant-related diseases or conditions), or diseases or conditions associated with infectious diseases caused, e.g., by bacteria, viruses, or other pathogens. In certain embodiments, a recombinant receptor, e.g., a CAR, specifically binds to an antigen associated with the disease or condition. In some embodiments, the disease, condition or disorder is cancer or infectious disease, and the nucleic acid of interest present in the synthetic expression cassette or vector encodes a recombinant receptor, such as a chimeric antigen receptor (CAR), that recognizes an antigen expressed by a tumor cell or an infected cell. The tumor can be a solid tumor or a hematological tumor (hematoma). In some embodiments, the cancer is a blood cancer, such as lymphoma, leukemia, and / or myeloma (e.g., B-cell, T-cell and myeloid leukemia, lymphoma, and multiple myeloma). The infectious disease can be a disease caused by any pathogenic infection, such as a viral, bacterial, parasitic (e.g., protozoan), or fungal infection, such as a human immunodeficiency virus (HIV) or cytomegalovirus (CMV) infection.

[0156] The cells (modified cells comprising the synthetic expression cassettes or vectors described herein) or compositions comprising the same can be administered to a subject or patient having a particular disease or condition to be treated, for example, via adoptive cell therapy, such as adoptive T cell therapy or stem cell therapy. Methods of administering modified cells for adoptive cell therapy are known and may be used in conjunction with the provided methods and compositions. For example, adoptive T cell therapy is described, for example, in U.S. Patent Application Publication No. 2003 / 0170238 to Gruenberg et al.; U.S. Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85). See, e.g., Themeli et al. (2013) Nat BioTechnol. 31(10):928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1):84-9; Davila et al. (2013) PLoS ONE 8(4):e61338.

[0157] As used herein, "treatment" (and grammatical variations thereof, such as "treat" or "treating") refers to the complete or partial amelioration or alleviation of a disease or condition or disorder, or symptoms, adverse effects or consequences, or phenotypes associated therewith. Desirable effects of treatment include, but are not limited to, prevention of onset or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of a disease, prevention of metastasis, slowing down the rate of progression of the disease, amelioration or alleviation of the disease, and remission or improved prognosis. The term does not imply a complete cure of a disease, or complete elimination of any symptoms, or an effect on all symptoms or consequences.

[0158] In some embodiments, cell therapy, e.g., adoptive T cell therapy or stem cell therapy, is performed by autologous transplantation, where the cells are isolated and / or otherwise prepared from the subject to receive the cell therapy or from a sample derived from the subject, i.e., in some aspects, the cells are derived from a subject, e.g., a patient, in need of treatment, and the cells are isolated and processed before being administered to that same subject.

[0159] In some embodiments, cell therapy, such as adoptive T cell therapy or stem cell therapy, is performed by allogeneic transplantation, where the cells are isolated and / or otherwise prepared from a subject other than the subject to receive cell therapy, e.g., the first subject, or the subject who will ultimately receive cell therapy. In such embodiments, the cells are then administered to a different subject of the same species, e.g., the second subject. In some embodiments, the first subject and the second subject are genetically identical. In some embodiments, the first subject and the second subject are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject. The cells can be administered by any suitable means. Dosing and administration can depend in part on whether the administration is brief or chronic. Various dosing schedules include, but are not limited to, a single dose or multiple doses over various time points, a bolus dose, and a pulse infusion.

[0160] In certain embodiments, individual populations of cells or cell subtypes are in the range of about 1 million to about 100 billion cells and / or in amounts of cells per kilogram of body weight, e.g., 1 million to about 5 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), e.g., about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 800 million cells, or a range defined by any two of the foregoing values). 0 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the preceding values), and in some cases, about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells), or any value therebetween and / or per kilogram of body weight to the subject. Dosages may vary depending on the characteristics, particularly the disease or disorder and / or the patient and / or other treatments.

[0161] In some embodiments, for example, when the subject is a human, the dose of recombinant receptor (e.g., CAR)-expressing cells, stem cells, T cells, or peripheral blood mononuclear cells (PBMCs) is at least 1×10 2 , 1×10 3 , 1×10 4 Or 1×10 5 cells, e.g., about 1 x 10 6 From 1×10 8 A range of cells of interest, e.g. 2 x 10 6 , 5×10 6 , 1×10 7 , 5×10 7 Or 1×10 8the number or total of said cells, or a range between any two of the preceding values.

[0162] In some embodiments, the cells are administered as part of a combination therapy, either simultaneously with another therapeutic intervention, such as an antibody, or modified cells, or receptor, or agent, such as a cytotoxic or therapeutic drug, or sequentially with the other therapeutic intervention in any order. In some embodiments, the cells are co-administered with one or more additional therapeutic agents or administered simultaneously with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, the cells are administered simultaneously with another therapy close enough in time that the cell population enhances the effect of the one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered before the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents include a cytokine, such as IL-2, for example to enhance persistence. In some embodiments, the method includes administration of a chemotherapeutic agent.

[0163] The cells may be used in combination with other therapies, such as other chemotherapy, immunotherapy, radiation therapy, or surgery, depending on the disease to be treated.

[0164] In some embodiments, the synthetic expression cassettes are used as research tools, e.g., as reporter tools, or in commercial detection methods (assay development). For example, the synthetic expression cassettes may be operably linked to a nucleic acid encoding a reporter protein, which can be used to detect the expression of a gene of interest in a particular cell type, e.g., to confirm that the gene of interest has been taken up and expressed by cells of that cell type. The term "reporter protein" refers to enzymes that can generate a detectable product from a substrate (e.g., luciferase), as well as proteins that can be easily identified and measured, such as fluorescent and luminescent proteins (e.g., GFP, YFP). The synthetic expression cassettes can also be used for cell-specific expression of a gene of interest in vitro, e.g., to evaluate the effect of expression of the gene of interest in target cells.

[0165] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The invention is further illustrated by the following non-limiting examples.

[0166] Example 1: Materials and Methods Experimental design The experimental strategy for generating a synthetic specific promoter (enhancer + minimal CMV promoter) was to first select a specific enhancer sequence in silico, amplify the sequence by PCR, and then clone the endogenous enhancer sequence upstream of a minimal promoter, i.e., the CMV minimal promoter (minCMV). 5 To confirm the specificity of the synthetic promoter (enhancer + minCMV) through expression pattern assays, the synthetic promoter was cloned upstream of a GFP reporter gene. As a proof of concept for functional use, the synthetic promoter was cloned upstream of a chimeric antigen receptor (CAR).

[0167] Design of specific promoter sequences Enhancer sequences that are specific to certain cell types and located upstream of the transcription start site were selected in silico. To this end, the in silico selection method was based on the “Functional ANnotation Of The Mammalian Genome” FANTOM5 database (created by RIKEN). 3、4 The FANTOM5 database has been systematically and precisely surveyed to determine the set of genes that are practically active in all cell types throughout the human body, and the genomic regions that determine where genes are read. Thus, the database contains a large number of active enhancer sequences of various subtypes. With reference to this data, we used PrESSTo (Promoter Enhancer Slider Selector Tool) for human enhancers (http: / / enhancer.binf.ku.dk / enhancers.php) to select enhancers. PrESSTo allows the selection of enhancers expressed in one of a number of cells or tissues based on sliders.

[0168] The first step of selecting specific enhancer sequences was based on the Cap Analysis of Gene Expression (CAGE) score reported in the FANTOM5 database. The percentage of the cell type of interest (T cells or NK cells) was selected, i.e., 60% for T cells and 30% for NK cells. The percentage number for each cell type refers to the proportion of CAGE tags in a given cell population relative to the count of CAGE tags from all cells. The percentage number returned only enhancers with an expression rate equal to or greater than the following "lowest bound" value, i.e., a set value for that cell type. The percentage was selected according to the number of hits in the result box. On average, the percentage was set to be less than 20 hits.

[0169] The identified enhancer sequence candidates were then selected based on the following criteria: A high score (>0.15 tags / million) in the sample representing the cell population of interest (e.g., T cells or NK cells) Low scores (less than 0.15 tags / million) for all other populations Significantly frequent only in a given population, as defined by PreSSTo

[0170] Selected enhancer sequence candidates were then confirmed based on ChIP-Seq data available through the UCSC genome browser tool (Kent WJ, et al. The human genome browser at UCSC. Genome Res. 2002 Jun;12(6):996-1006 - link available specifically for selected sequences via the "View in UCSC" tab in the PrESSTo tool or at https: / / genome.ucsc.edu / cgi-bin / hgGateway). The presence of transcription factor anchoring sites associated with the lineage of interest (e.g. POU2F2 in hematopoietic system, GATA3 for T cells) or indicative of active regions (e.g. POLR2A) were analyzed. The presence of such sites in the vicinity (within 2000-3000 bp) of the selected enhancers was considered indicative of transcriptionally active regions. 7 .

[0171] Further bioinformatics analysis was used to impose more stringent selection criteria on the remaining candidate control regions using the following cell-specific epigenetic features (ENCODE database): (1) chromatin accessibility (i.e., DNase-seq, FAIRE-seq) and (2) histone modifications of differentiation active from inactive enhancer regions (ChiP-Seq for H3K27ac). For illustrative purposes, the following strategy was used to select B-cell specific enhancer candidates. After using the PrESSTo tool to select B-cell specific control regions (i.e., CAGE signals that are specific in the genomic regions of B cells and not elsewhere), the genomic coordinates of those candidate control regions were submitted to the Galaxy bioinformatics web portal (https: / / usegalaxy.org / , Enis Afgan et al., Nucleic Acids Research, Volume 46, Issue W1, 2 July 2018, Pages W537-W544). B cells, T cells, CD4 cells, CD8 cells, NK cells, monocytes and / or neutrophils and / or CD34 +The same procedure was followed to upload epigenomic data obtained from ENCODE for chromatin accessibility (FAIRE-Seq or / and DNase-Seq) and H3K27ac modification (ChIP-Seq) to the Galaxy portal for the human cell type of interest, which is cells. The next step was to intersect the ensemble of B cell regulatory regions discovered by PrESSTo for the presence of B cell specific H3K27Ac enrichment peaks, which restricts the list to CAGE regions that show an active H3K27Ac signature. The latter regions were then examined for the presence of open chromatin in B cells (occurrence of DNA-seq peaks), which restricts CAGE B cell enhancers to those that show evidence of an open chromatin state in B cells in addition to the concomitant H3K27Ac modification (an epigenetic signature of transcriptional activity; strongly correlated with active enhancers). The latter list was further purged to successively remove regions showing evidence of chromatin opening and H3K27 acetylation in unwanted cell types, e.g., T cells, NK cells, monocytes, and CD34+ cells. The final list obtained was manually refined in the CAGE database for tag signal intensity and cell specificity, including further analysis of transcription factor binding, occurrence of frequent DNA motifs (MEME tool), and proximity to known cell-specific genes.

[0172] Enhancer Amplification for Cloning Once selected using the methodology described above, enhancer sequence candidates were amplified by PCR from genomic DNA of cell lines (Jurkat T cell line or NK92 cells) and then inserted into cloning plasmids. To design PCR primers, a pair of primers of 18 to 22 nucleotides with similar melting temperatures and at least 10 nucleotides away from the enhancer sequence was chosen to minimize PCR amplicon size. The specificity of the PCR primers was confirmed using the UCSC genome browser tool. The primers were designed to add randomly selected 6 bp restriction enzyme sites to allow efficient cleavage (lowercase letters in Table II).

[0173] Table II lists all PCR primers (uppercase letters), their flanking restriction sites (lowercase letters), and their PCR amplification conditions designed to amplify enhancer sequences from genomic DNA extracts of Jurkat T cells. PCR was performed using Q5 polymerase according to the manufacturer's instructions (New England Biolabs, Massachusetts). Amplification conditions were as follows: Denaturation: 98°C for 30 s; Amplification (35 cycles): 98°C for 10 sec / Tm°C* for 30 sec / 72°C for 30 sec; and Extension: 2 min at 72°C *Appropriate Tms for each reaction are shown in Table I).

[0174] [Table 2]

[0175] The length of the PCR products was checked on an agarose gel and purified using a QIAquick™ PCR Purification Kit (Qiagen, Federal Republic of Germany). The PCR products were then digested with the corresponding restriction enzymes (see Table 1) for cloning.

[0176] A cloning strategy for generating synthetic promoters from in silico selected enhancers. To generate specific promoters from the selected and PCR amplified enhancers, the endogenous enhancer sequences were cloned upstream of a minimal promoter, i.e., CMV minimal promoter (minCMV: GTAGGCGTGTACGGTGGGAGG TCTATATAAGCAGAGC TCGTTTAGTGAACCGTCAGATC, SEQ ID NO: 6). 5 To confirm the specificity of the synthetic promoter (enhancer + minCMV) through expression pattern assays, the synthetic promoter was cloned upstream of a GFP reporter gene. To carry out these tests, the backbone of pENTR1a vector (Addgene, #11813-011) was used, which was digested with appropriate restriction enzymes and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs, MA) to prevent self-ligation of the pENTR1a vector. A ligation reaction using T3 ligase enzyme (New England Biolabs, MA) was carried out to generate the final plasmid.

[0177] The detailed cloning strategy for Tenh(Chr16-445) is shown in Figure 1A-B (showing the progression from bottom to top). Briefly, pENTR1A-IRES-GFP was obtained by inserting the IRES-GFP sequence from pIRES2-AcGFP (ClonTech / Takara) into pENTR1a gateway plasmid (Addgene, #11813-011). minCMV was also cut from (ClonTech / Takara) and inserted using NotI and XhoI enzymes to obtain pENTR1A-minCMV-IRES-GFP. The IRES sequence was then removed by digestion XhoI-NcoI to prevent this sequence from interfering with the function and specificity of the synthetic promoter, generating pENTR1A-minCMV-GFP. The SV40 poly(A) signal was inserted downstream of GFP to stabilize the mRNA, generating pENTR1A-minCMV-GFP-SV40polyA. The SV40 poly(A) sequence was amplified by PCR using the plasmid (Addgene #45461) as a template. This pENTR1A-minCMV-GFP-SV40polyA plasmid was the plasmid used to clone all enhancer sequences and perform in vitro expression pattern analysis experiments. As above, the PCR amplicons of the selected enhancers were digested with the appropriate restriction enzymes (listed in Table II) and inserted upstream of the minCMV sequence in pENTR1A-minCMV-GFP-SV40polyA. The plasmids were sequenced to confirm that the constructs corresponded to the designed sequences.

[0178] Lentiviral particles were then produced to perform expression pattern studies in vivo and / or in NK cells. To produce the particles, we first used the pHR-SIN vector backbone. The cloning strategy is shown in Figure 2. Briefly, the pHR-SIN-Dest vector, which lacks the spleen focus forming virus (SFFV)-GFP sequence originally contained in the pHR-SIN-SFFV-GFP vector (kindly provided by Els Veroheyen, France), was generated by introducing the LR cloning sites (attB1 / attB2) amplified from pLenti CMV / TO Puro DEST (Addgene, #17293) to replace the SFFV-GFP fragment. This plasmid was used to insert the "ENH-minCMV-GFP-SV40polyA" sequence from pENTR1a (described above) using the Gateway LR clonase kit (Invitrogen, Canada) according to the manufacturer's instructions. To produce viral particles, this vector was co-transfected with three others: p8.91, which provides the packaging enzyme; and CD34. + It was co-transfected into HEK293T cells (ATCC, CRL-3216) with two vectors, pHδ30 and pFδ24, encoding measles virus proteins that optimize transduction. 8、9 For NK cell transfection, lentiviral particles carrying baboon retroviral envelope glycoproteins (pBaEV vector, kindly provided by Els Veroheyen) were produced. 10 .

[0179] In vitro validation of Tenh (Chr16-445), NKspe (NK6) and Benh (B1, SEQ ID NO: 23) To evaluate the specificity of the constructs, the vectors were transfected into various human cell lines of hematopoietic origin. First, for Tenh(Chr16-445), Jurkat T cells (T cell line, ATCC IB-152) and K-562 cells (erythroid myeloid cell line, CCL-243) were transfected. pENTR1A-Tenh-minCMV-GFP-SV40polyA was transfected using Lipofectamine™ 3000 (Invitrogen, Canada) according to the manufacturer's instructions. GFP signals were analyzed by flow cytometry (BD LSRII-Fortessa). It was observed that GFP was expressed only in Jurkat cells. These findings were then confirmed in primary human cells. Peripheral blood mononuclear cells (PBMCs) from a healthy control with informed consent (REB#3527) were nucleofected by electroporation using the Lonza Human Monocyte Nucleofector Kit, and GFP-expressing subpopulations were identified by flow cytometry. Anti-CD19 antibodies were used to identify B cells (anti-CD19 PE clone HIB19, Biolegend), anti-CD3 antibodies were used to identify T cells (anti-CD3 PE clone HIT3a, BD Pharmingen), and anti-CD14 antibodies were used to identify monocytes (anti-CD14 APC-Cy7, clone HCD14, Biolegend).

[0180] To test the specificity of the NKspe enhancer (NK6), a similar strategy was used. The vector pENTR1a-NK6-minCMV-GFP-SV40polyA was transfected into cell lines of various hematopoietic origin. For this experiment, NK-92 (NK cell line, ATCC, CRL-2407), Jurkat (T cell line, ATCC IB-152), 697 (B cell line, DSMZ ACC42) and K-562 (myeloid lineage, CCL-243) cells were transfected.

[0181] The ability of the B cell specific enhancer (Benh, SEQ ID NO: 23) to induce protein expression in B cell lines was tested by transducing BaEV lentiviral particles encoding Benh-minCMV-GFP-SV40polyA into the Nalm6 cell line (B cell line, ATCC, CRL-3273). GFP expression patterns were analyzed by flow cytometry using anti-CD19 antibody co-staining B cells (anti-CD19 PE clone HIB19, Biolegend).

[0182] In vivo validation of T cell-specific (T-specific / Chr16-445), NK cell-specific (NK8), and B cell-specific promoter constructs To assess whether the GFP expression pattern was similar in vivo, human HSCs isolated from umbilical cord blood (CD34 MicroBead Kit UtlraPure, MiltenyI Biotec, Germany) were transduced with measles or BaEV lentiviral particles encoding either Tenh-minCMV-GFP-SV40polyA, Tenh-minCMV-CAR-CD22-SV40polyA, NK8-minCMV-GFP-SV40polyA or Benh-minCMV-GFP-SV40polyA. Cord blood was obtained from the CHU Sainte-Justine Biobank of Cord Blood for research with maternal informed consent. Briefly, 200 μL of concentrated measles lentiviral particles were coated in 12-well plates containing RetroNectin (Takara Bio, USA) for 4 h at 37°C. 250,000 purified CD34 cells in 150 μL StemSpan (StemCell, Canada) containing 5 nM rapamycin and 3 μM CIHR99021 + HSCs were added to maintain stemness 12 The plates were then centrifuged at 1,000g for 1 hour, after which 700μL of StemSpan / rapamycin / CIHR99021 medium was added. The cells were cultured for 3 days and then injected into mice. NOD-scid IL2Rγnull NSG mice were obtained from the Jackson Laboratory (#005557) and were bred and maintained under specific pathogen-free conditions. Mice were primed by gamma irradiation at 2 Gy. 5 CD34 + Cells were injected intravenously (IV) into 7- to 11-week-old NSG mice.

[0183] To test the activity of T-cell-specific promoters in a more physiological context, where maturation of engineered T-progeny occurs in the human thymus, a group of mice was also transplanted into the quadriceps with three pieces of precultured human thymus. 13 Thymus fragments were obtained from cardiac surgery procedures (the thymus was removed for the procedure) after approval of the study protocol by the Sainte-Justine Hospital Institutional Review Board (and informed consent from the donor). Thymus fragments (2–5 mm 3 ) were cultured for 10 days on GelFoam sponges and 0.8 μm Isopore membranes in Ham's F-12 nutrient mix 1X medium (F12) supplemented with 0.025 M HEPES, pH 7.5, and 10% fetal bovine serum (FBS) (Life Technologies). 13、14 .

[0184] Mice were kept in a regular household and monitored for human cell reconstitution. Reconstitution and GFP expression were analyzed by flow cytometry using anti-mouse CD45-PerCP-Cy5.5 (clone 30F11), anti-human CD45-PE-Cy7 (clone HI31), anti-human CD19-PE (clone HIB19), anti-human CD14-APC-Cy7 (clone HCD14), and anti-human CD3-APC (clone HIT3a) (all from Biolegend). All mice were maintained in the animal facility of the CHU Sainte-Justine Research Center.

[0185] Functional validation of the T-specific promoter construct (T-specific / Chr16-445) To evaluate the potential therapeutic use of the Tenh-promoter, the eGFP sequence was replaced with sequences encoding CAR-CD33 or CAR-CD22. 15 CAR-CD33 was generated by synthesizing the ScFv sequence from (IDT Technologies) and cloning the sequence into a second generation CAR construct (CD28-CD3ζ). The CAR-CD22 construct was based on the m971 ScFv sequence fused to 28z and BBz (Haso W et al. Blood. 2013; 121(7): 1165-1174). The CAR-GD2 construct was based on the 14g2a ScFv sequence (Louis CU et al., Blood. 2011; 118: 6050-6) cloned into a second generation CAR construct (CD28-CD3ζ). To produce VSVg lentiviral particles, the constructs were cloned into the pHRSIN vector and particles were produced in HEK293 as described above.

[0186] Primary T cells were isolated from 10 ml blood samples of healthy donors. PBMCs were isolated by Ficoll™ and T cells were purified using a T cell enrichment kit (#19051, StemCell Technologies, Canada). Five hundred thousand (500,000) T cells were then cultured in 900 μL RPMI / 10% FBS supplemented with 30 U / mL human recombinant IL-2 and Dynabeads (12.5 μL / well; Life Technologies) at a 1:1 ratio. On day 2, 100 μL of concentrated lentiviral particles were added with 8 μg / mL protamine sulfate and cultured for the next 6 days. Recombinant human IL-2 (30 U / mL) was added every other day. The expression of CAR-CD33 on the T cell surface was verified using soluble CD33-Fc chimeric protein (Siglec3 / CD33 Fc, R&D Systems, MI) and detected by flow cytometry with secondary staining using polyclonal anti-IgG PE (Jackson Immunoresearch). Similarly, the detection of CAR-CD22 expression was performed by incubating cells with 2 μl of Siglec2 (CD22)-Fc chimera (50 mg / ml, R&D) for 30 min at 4° C., washing, and staining with anti-Fc-PE (Jackson Immune), anti-CD56-APC, and anti-CD3-FITC (Biolegend). The detection of CAR-GD2 was performed with anti-mouse Fab (Jackson Immune 115-065-006) for 30 min at 4° C., washing, and then staining with streptavidin-PE (Biolegend).

[0187] The functionality of CAR-CD33-transduced T cells was then evaluated using native CD33 + (ATCC #CCL-240) or CD33 -Cytotoxicity assays were performed against the HL-60 cell line (generated using CRISP technology). Similarly, functionality of CAR-CD22-transduced T cells was tested in cytotoxicity assays against RS4;11 (a B-ALL cell line expressing CD22, ATCC #CRL-1873), and functionality of CAR-GD2-transduced T cells was evaluated against the SK-N-DZ neuroblastoma cell line expressing GD2 (ATCC, CRL-2149). Briefly, HL-60 (for CAR-CD33), RS4;11 (for CAR-CD22) or SK-N-DZ (for CAR-GD2) target cells were stained with the membrane-labeling dye PKH26, which has a long aliphatic tail that stably stains the cell membrane. After incubation with effector T cells, absolute counts of viable targets were calculated using CountBright™ absolute counting beads (ThermoFisher) as well as a viability dye (7-AAD). Briefly, 2×10 6 Target cells were washed twice in RPMI 1640 or D-PBS and resuspended in 100 μL Diluent C, after which 100 μL PKH26 (8 μM in Diluent C) was added and the cells were incubated for 5 min at room temperature. Staining was stopped by adding FBS. Cells were then plated at various ratios of effector:target (1:8, 1:4, 1:2, 1:1, 2:1, 4:1) and incubated for 24 h. After 24 h, cells were harvested, stained with 7-AAD (BD Biosciences) and analyzed by flow cytometry. Cytotoxicity was calculated as follows: % specific lysis = 100 - [(PKH26 after incubation with effector cells)] + 7-AAD - Absolute count of target) / (PKH26 after incubation alone + 7-AAD - absolute target count) × 100].

[0188] Kinetics of expression of CAR under T-specific promoter construct (T-specific / Chr16-445) during in vitro T-cell differentiation First, human HSCs isolated from umbilical cord blood (CD34 MicroBead Kit UtlraPure™, MiltenyI Biotec, Germany) were transduced with BaEV lentiviral particles encoding Tenh-minCMV-CAR-CD22-SV40polyA as described above. + To test for expression of the CAR by cell progeny, modified CD34 + The cells were co-cultured with OP9-DL4 cells or OP9 (without DL4) to express CD34 +Differentiation into T and B cells was induced from the OP9-1000 cells, respectively (La Motte-Mohs RN et al., Blood. 2005;105(4):1431-9. Epub 2004 Oct 19). Cells were co-cultured in medium containing alphaMEM (Gibco), 20% HyClone™ Characterized FBS (GE Healthcare), GlutaMAX-I™, PenStrep, 5ng / mL IL-7 (Perpotech), 5ng / mL FLT-3L (Peprotech) and 800uM L-Ascorbic acid 2-phosphate (Sigma). Cells were co-cultured for 2 weeks, with medium changed twice a week and feeder cells (OP9 or OP9-DL4) changed weekly. CAR expression in the different subpopulations was assessed by flow cytometry using two antibody panels: 1) anti-CD1a-BV421 (clone HI49, Biolegend), anti-CD7-FITC (clone M-T701, BD Biosciences), anti-CD45-PeCy7 (clone HI30, Biolegend), anti-CD34-APC (clone 581, Biolegend), anti-CD19-APC-Cy7 (clone HIB19, Biolegend); and 2) anti-CD4-APC-Cy7 (clone RPA-T4, Biolegend), anti-CD8-APC (RPA-T8, BD Biosciences), anti-CD3-FITC (clone UCHT1, Biolegend), anti-CD45-PeCy7 (clone HI30, Biolegend). In both panels, detection of CAR-CD22 expression was performed by incubating with 2 μl of Siglec2(CD22)-Fc chimera (50 mg / ml, R&D) for 30 min at 4°C, washing, and staining with anti-Fc-PE (Jackson Immune), and DAPI was used as a viability stain.

[0189] Assessment of NK8 promoter specificity The specificity of the NK8 promoter was also evaluated in an OP9 co-culture system under conditions favorable for the differentiation of NK cells (Beck RC et al., Biol Blood Marrow Transplant. 2009, 15(9):1026-37). Human HSCs isolated from umbilical cord blood (CD34 MicroBead Kit UtlraPure™, MiltenyI Biotec, Germany) were transduced with BaEV lentiviral particles encoding NK8-minCMV-GFP-SV40polyA as described above. Transduced cells were co-cultured with OP9 cells as described above, but with the addition of IL-15 (10 ng / mL) for the differentiation of NK cells. GFP expression was evaluated by flow cytometry. Co-staining with anti-CD56, anti-CD45, anti-CD4 and anti-CD8 (Biolegend) was performed to identify cell subpopulations.

[0190] Example 2: Testing and validation of promoter sequences The first step was to identify a specific enhancer to create a synthetic promoter for T cells. Five enhancer sequence candidates that fulfilled the above criteria were identified (Chr16-445 (SEQ ID NO: 7); Chr14-591 (SEQ ID NO: 13); Chr8-438 (SEQ ID NO: 8); Chr8-230 (SEQ ID NO: 9); Chr12-199 (SEQ ID NO: 10). Among them, Chr16-445 sequence was thoroughly examined because each confirmation step was robust. This sequence, detailed in Table III, contains highly repeated motifs and is significantly overexpressed only in T cells (tags / million score is 0.511 in T cells). It is located on chromosome 16 (positions 88536883-88537327) and is 445 nucleotides long. Within 2.5 kb upstream of the enhancer sequence, 23 putative binding sites for transcription factors, such as Gata1, POLR2A, POU2F2 and MYC, were identified, providing compelling evidence that it is located in a transcriptionally active region.

[0191] Similarly, two potential NK-specific enhancer sequences were selected (NK6 and NK20 - see Table IIIa), of which one (NK6) resulted in a consistent pattern of expression in preliminary data. This sequence is located on chromosome 6, is 379 nucleotides long, and contains highly repeated motifs. It was significantly overexpressed only in NK cells (tag score in NK cells is 0.719). This sequence has 19 transcription factor binding sites within less than 2 kb of sequence. The second NK-specific candidate (NK20), located on chromosome 20, has a tag score of 1.823 in NK cells.

[0192] Enhancer sequences that would drive transgene expression in both T and NK cells would be of interest in the context of cytotoxic cell gene therapy. A putative T and NK cell specific promoter sequence was identified on chromosome 14, position 61804524-61805115 (591 nucleotides). Its tags / million score is high in T cells (6.629) and NK cells (3.327), with significant expression only in these two cell subtypes. Four transcription binding sites - RUNX3, GATA2, FOS and JUN - are located within the enhancer sequence itself.

[0193] Four putative specific enhancers for B cells were also identified (B-spe candidates #1, 2, 3 and 4 - see Table IIIa), located in chromosomes 1, 3, 10 and 13 that met the selection criteria.

[0194] Finally, several other candidate enhancers for different cell types were also identified (Table IIIb).

[0195] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

[0196] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

[0197] To further characterize the enhancer candidates listed in Tables IIIa and IIIB, bioinformatics analysis was performed. First, sequences were analyzed using the Multiple Em for Motif Elicitation (MEME) tool (Timothy L. Bailey and Charles Elkan, Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994) to identify repetitive motifs within the sequences of the enhancer candidates. The results are shown in Table IV.

[0198] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0199] Motif ID sequence 1. CGGTGTGGAGGGCCGGGTGGTGACGCTGAGTGACAGGTGAGGATGTGGCA (SEQ ID NO: 64) 2. GTGGACACCCATCATCTTACCACATCACATCGTCACTGCC (SEQ ID NO: 65) 3. YSCCTYCCCCWCCYCYTYCCH (SEQ ID NO: 66) 4. AAAADAAANAAARWA (SEQ ID NO:67) 5. YTGGKGGSHRGGSGKSTGTG (SEQ ID NO: 68) 6. CTCVGVSCDGGNDGCCHGGCHMANVCCGGGCCWGBBBCGCGGVSG (SEQ ID NO: 69) 7. TCWSTKTTCTG (SEQ ID NO:70) 8. GTGDMASGTGCCTG (SEQ ID NO: 71) 9. GCAGCCRCCYCRCKGKCTGAG (SEQ ID NO: 72) 10. CCCCTGCRGAGCAYRGGACGCTTCCTGCC (SEQ ID NO: 73) 11. TGKCCTCTMCCCACM (SEQ ID NO: 74) 12. GCCYTBHTGTYASRCAMAASM (SEQ ID NO: 75) 13. SWMTGACACMCTGTGKGTGTGMSYYWGMMSYCASYWG (SEQ ID NO: 76) 14. ACYTKCTGCWCWGCCTTMTTT (SEQ ID NO: 77) 15. CGGGAGCGCC (SEQ ID NO: 78) 16. AGGHAGCAVAGKCACCCTC (SEQ ID NO: 79) 17. TBTGGCGAGBCDCCTTNGNHTTCWGYGBGCCHCACT (SEQ ID NO: 80) 18. TGTGCCCAGGG (SEQ ID NO: 81) 19. GAGGTGTCCCC (SEQ ID NO: 82) 20. AAAACCACA *Motifs 1 and 2 are highly repeated in SEQ ID NO:7 and SEQ ID NO:11, respectively (bold in table)

[0200] The sequences were then analyzed using the oPOSSUM tool (http: / / opossum.cisreg.ca / oPOSSUM3 / , Kwon AT, Arenillas DJ, Worsley Hunt R, Wasserman WW. G3. 2012 Sep;2(9):987-1002. Epub 2012 Sep 1), which allows the detection of frequent conserved transcription factor binding sites and binding site combinations in a set of sequences. The results are shown in Table V and Figure 13.

[0201] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11]

[0202] Example 3: In vitro validation of T cell specific promoter construct (Chr16-445, SEQ ID NO: 7) A T cell specific synthetic promoter was created by juxtaposing the above identified selected enhancer sequence and a minimal promoter such as CMV. The pENTR1A-Chr16-445-minCMV-GFP-SV40polyA vector was transfected into a T cell line (Jurkat) and a myeloid cell line (K562), and GFP expression was detected by flow cytometry only in the Jurkat T cell line. In contrast, when transfected with a vector encoding a non-specific strong promoter (spleen focus forming virus (SFFV) promoter) instead of the Chr16-445-minCMV promoter, both cell lines expressed GFP (Figure 3A). Human PBMCs were then transfected with the T cell specific synthetic promoter, and it was observed that the GFP protein was expressed only in T cells, but not in monocytes or B cells (Figure 3B), whereas when the PBMCs were transfected with a non-specific promoter, all cell types expressed GFP.

[0203] Example 4: In vitro validation of NK-specific promoter construct (NK6, SEQ ID NO: 11) NK cell line (NK92), myeloid cell line (K562), B cell line (697) and T cell line (Jurkat) were transfected with pENTR1A-NK6-minCMV-GFP-SV40polyA vector. The NK6 synthetic promoter induced GFP expression only in NK92 cells, whereas the SFFV strong promoter resulted in GFP expression in all cell lines (Figure 4), confirming the specificity of the NK6 promoter.

[0204] Example 5: In vitro validation of another NK-specific promoter construct (NK8, SEQ ID NO: 14) The specificity of the NK8 sequence was confirmed by CD34 transduced with NK8-minCMV-GFP-SV40polyA or SFFV-GFP-SV40polyA. + Cells or non-transduced CD34 + The NK8-transduced cells were then tested in an OP9 co-culture system with NK cells. GFP expression was observed in NK cells, but not in B cells, recovered after co-culture in wells containing NK8-transduced cells (Figure 5). Transduction of cells with a strong non-specific promoter (SFFV) led to the expression of GFP in both NK and B cells, whereas untransduced cells were not GFP positive. These results provide strong evidence that the NK8-based synthetic promoter is specific for NK cells.

[0205] Example 6: In vitro validation of the B cell specific promoter construct (SEQ ID NO: 23) A B cell line (Nalm6) was transduced with BaEV-LV particles encoding Benh-minCMV-GFP-SV40polyA. The B cell-specific synthetic promoter was shown to drive GFP expression in B cells (Figure 6), suggesting that this promoter is capable of driving expression of a protein of interest in a B cell-specific manner.

[0206] Example 7: In vivo validation of T-specific promoter construct (Chr16-445) Human CD34 + Cells were transduced with the Chr16-445-minCMV T cell-specific promoter or the non-specific SFFV promoter and transplanted into NSG mice with or without human thymus co-transplant (huNSG and BLT models, see Methods). In both models, GFP + T cell growth was observed, whereas CD34 +No other human cells expressed GFP when transduced with our Chr16-445-minCMV T cell-specific promoter (Fig. 7A, B). In contrast, CD34 + When transduced with the non-specific strong promoter SFFV, all lineages expressed GFP (Figure 7C). These results also indicate that the engineered HSCs can differentiate into various lineages, both myeloid (monocytes) and lymphoid (T and B cells).

[0207] Example 8: In vivo validation of NK-specific promoter construct (NK8) Human CD34 + The specificity of the NK cell-specific promoter in vivo was examined by transducing cells with NK8-minCMV driving GFP expression. Human NK cells expressing GFP were found in the blood, spleen, and bone marrow of mice (Figure 8A,B). In contrast, very few human B and T cells harvested from the same mice expressed GFP, providing evidence of the specificity of the NK8 synthetic specific promoter.

[0208] Example 9: In vivo validation of the B cell specific promoter construct (SEQ ID NO: 23) Human CD34 + The specificity of the B cell-specific promoter was examined in vivo by transducing cells with Benh-minCMV driving GFP expression. Four weeks after humanization, human cells circulating in the blood were analyzed by flow cytometry. At this time point, B cells (CD19 + ) and monocytes (CD14 + ) was grown in humanized mice. While the strong non-specific promoter (SFFV) induced GFP expression in all cell subtypes, GFP-positive cells were only found in the B cell population (Figure 9). These results suggest that the B cell synthesis-specific promoter is specifically induced only in the B cell population.

[0209] Example 10: Functional validation of T-specific promoter construct (Chr16-445) The therapeutic potential of the constructs was explored via cytotoxicity assays with CAR-CD33, CAR-CD22 or CAR-GD2. The sequences encoding CAR-CD33, CAR-CD22 or CAR-GD2 were placed under the control of a strong non-specific promoter (SFFV) or under the control of a synthetic T-cell specific promoter (Tenh Chr16-445). Their ability to drive expression of a functional transgene was demonstrated by transducing primary T cells with the CAR and then expressing the CAR against human AML cell lines with or without CD33 expression, against a human ALL cell line expressing CD22 (RS4;11) or against GD2. + The effect of CAR-CD33 on the expression of CAR-CD33 was evaluated by performing a cytotoxicity assay against a neuroblastoma (NB)-cell line (SK-N-DZ). Primary T cells transduced with CAR-CD33 constructs under the control of a nonspecific SFFV promoter or a T-cell specific promoter showed CAR-CD33 expression as confirmed by flow cytometry (Figure 10A). The results of the cytotoxicity experiments showed that the CAR-CD33 constructs, even when their expression was driven by a specific T-cell promoter, did not express CD33. + The results show that CD33 effectively induced lysis of AML cells (Fig. 10B). - Non-specific lysis measured in cells (right side bar graph) was minimal and significantly lower than CAR-mediated lysis (***p<0.001). Similarly, CAR-CD22 expressed under the Tenh Chr16-445 promoter induced strong enough CAR expression to induce CAR-specific cytotoxicity against RS4;11 ALL-cell lines, similar to that of the SFFV (strong) promoter (Figure 10C). Similarly, the results shown in Figure 10D show that in the context of solid tumors, CAR-GD2 expressed under the Tenh Chr16-445 promoter construct also induced target lysis significantly higher than untransduced primary T cells (****p<0.0001) and at levels comparable to those of CAR-GD2 driven by the non-specific strong promoter SFFV.

[0210] Example 11: Kinetics of expression of CAR under a T-specific promoter construct (Chr16-445) during T-cell differentiation Using OP9-DL4 cells, which mimic thymic differentiation in vitro, and using the CAR-CD22 construct, we demonstrated that specific promoters mediate T-cell differentiation early in the T-cell differentiation process (CD7 + CD1 + It was observed that the expression of CAR-CD22 was induced at the T cell differentiation stage (immediately at the T cell differentiation stage) (Figure 11A). As a control, HSC modified cells were co-cultured with OP9 cells, which resulted in B cell differentiation and no CAR expression was detected (Figure 11B). This data further demonstrates the specificity of the T-specific / Chr16-445 synthetic promoter. The results shown in Figure 11C indicate that the Tenh Chr16-445 promoter is active at all stages of T cell differentiation: pro-T, CD7 + , CD7 + CD1a + , CD4 + CD8 + Not only double positive but also CD4 + and CD8 + Similar results were obtained when Chr16-445 was inserted in the reverse orientation, confirming that this sequence shares the relevant characteristics of a transcriptional enhancer (i.e., is not affected by orientation).

[0211] Example 12: CD34 transduced with CAR under a T-specific promoter construct + In vivo T-cell differentiation of cells CAR-transduced CD34 + In vivo T cell differentiation of transduced CD34 cells +The cells were evaluated in mice co-transplanted with human fetal thymus (BLT model). Blood samples from mice 30 weeks after humanization show that T cells expressed CAR-CD22 on their surface (Figure 12). Consistent with previous findings, B cells and monocytes did not express GFP. Similar results were again obtained when Chr16-445 was inserted in the reverse orientation. These results confirm the specificity of the T-specific / Chr16-445 promoter, but also suggest that thymic selection is not interfering with the growth of CAR-positive T cells.

[0212] Although the present invention has been described hereinabove with respect to specific embodiments thereof, the same may be modified without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the term "comprising" is used as an open-ended term and is substantially equivalent to the phrase "including, but not limited to." The singular forms "a," "an," and "the" include the corresponding plural forms unless the context clearly dictates otherwise.

[0213] References 1. Hacein-Bey-Abina S, Hauer J, Lim A, et al. Efficacy of gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 2010;363:355-64. 2. Hacein-Bey-Abina S, Pai SY, Gaspar HB, et al. A modified gamma-retrovirus vector for X-linked severe combined immunodeficiency. N Engl J Med 2014;371:1407-17. 3. Lizio M, Harshbarger J, Shimoji H, et al. Gateways to the FANTOM5 promoter level mammalian expression atlas. Genome Biol 2015;16:22. 4. Andersson R, Gebhard C, Miguel-Escalada I, et al. An atlas of active enhancers across human cell types and tissues. Nature 2014;507:455-461. 5. Boshart M, Weber F, Jahn G, et al. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 1985;41:521-30. 6. Ede C, Chen X, Lin MY, et al. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells. ACS Synth Biol 2016;5:395-404. 7. Matsuda K, Mikami T, Oki S, et al. ChIP-seq analysis of genomic binding regions of five major transcription factors highlights a central role for ZIC2 in the mouse epiblast stem cell gene regulatory network. Development 2017;144:1948-1958. 8. Levy C, Amirache F, Costa C, et al. Lentiviral vectors displaying modified measles virus gp overcome pre-existing immunity in in vivo-like transduction of human T and B cells. Mol Ther 2012;20:1699-712. 9. Humbert JM, Frecha C, Amirache Bouafia F, et al. Measles virus glycoprotein-pseudotyped lentiviral vectors are highly superior to vesicular stomatitis virus G pseudotypes for genetic modification of monocyte-derived dendritic cells. J Virol 2012;86:5192-203. 10. Girard-Gagnepain A, Amirache F, Costa C, et al. Baboon envelope pseudotyped LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and resting HSCs. Blood 2014;124:1221-31. 11. Lowe E, Truscott LC, De Oliveira SN. In Vitro Generation of Human NK Cells Expressing Chimeric Antigen Receptor Through Differentiation of Gene-Modified Hematopoietic Stem Cells. Methods Mol Biol 2016;1441:241-51. 12. Huang J, Nguyen-McCarty M, Hexner EO, et al. Maintenance of hematopoietic stem cells through regulation of Wnt and mTOR pathways. Nat Med 2012;18:1778-85. 13. Markert ML, Devlin BH, McCarthy EA. Thymus transplantation. Clin Immunol 2010;135:236-46. 14. Kalscheuer H, Danzl N, Onoe T, et al. A model for personalized in vivo analysis of human immune responsiveness. Sci Transl Med 2012;4:125ra30. 15. Laing AA, Harrison CJ, Gibson BES, et al. Unlocking the potential of anti-CD33 therapy in adult and childhood acute myeloid leukemia. Exp Hematol 2017;54:40-50. 16. La Motte-Mohs RN, Herer E, Zuniga-Pflucker JC. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood 2005;105:1431-9. 17. Halkias J, Melichar HJ, Taylor KT, et al. Tracking migration during human T cell development. Cell Mol Life Sci 2014;71:3101-17. 18. Kurd N, Robey EA. T-cell selection in the thymus: a spatial and temporal perspective. Immunol Rev 2016;271:114-26. 19. Poulin JF, Sylvestre M, Champagne P, et al. Evidence for adequate thymic function but impaired naive T-cell survival following allogeneic hematopoietic stem cell transplantation in the absence of chronic graft-versus-host disease. Blood 2003;102:4600-7. 20. Dion ML, Poulin JF, Bordi R, et al. HIV infection rapidly induces and maintains a substantial suppression of thymocyte proliferation. Immunity 2004;21:757-68. 21. Sportes C, Hakim FT, Memon SA, et al. Administration of rhIL-7 in humans increases in vivo TCR repertoire diversity by preferential expansion of naive T cell subsets. J Exp Med 2008;205:1701-14. 22. Kershaw MH, Westwood JA, Darcy PK. Gene-engineered T cells for cancer therapy. Nat Rev Cancer 2013;13:525-41. 23. Porter DL, Hwang WT, Frey NV, et al. Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci Transl Med 2015;7:303ra139. 24. Savoldo B, Ramos CA, Liu E, et al. CD28 costimulation improves expansion and persistence of chimeric antigen receptor-modified T cells in lymphoma patients. J Clin Invest 2011;121:1822-6. 25. Maude SL, Teachey DT, Porter DL, et al. CD19-targeted chimeric antigen receptor T-cell therapy for acute lymphoblastic leukemia. Blood 2015;125:4017-23. 26. Maude SL, Frey N, Shaw PA, et al. Chimeric antigen receptor T cells for sustained remissions in leukemia. N Engl J Med 2014;371:1507-17. 27. Grupp SA, Kalos M, Barrett D, et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. N Engl J Med 2013;368:1509-18. 28. Haso W, Lee DW, Shah NN, et al. Anti-CD22-chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia. Blood 2013;121:1165-74. 29. Lee DW, Kochenderfer JN, Stetler-Stevenson M, et al. T cells expressing CD19 chimeric antigen receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial. Lancet 2015;385:517-28. 30. Fitzgerald JC, Weiss SL, Maude SL, et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Crit Care Med 2017;45:e124-e131. 31. Teachey DT, Lacey SF, Shaw PA, et al. Identification of Predictive Biomarkers for Cytokine Release Syndrome after Chimeric Antigen Receptor T-cell Therapy for Acute Lymphoblastic Leukemia. Cancer Discov 2016;6:664-79. 32. Jena B, Maiti S, Huls H, et al. Chimeric antigen receptor (CAR)-specific monoclonal antibody to detect CD19-specific T cells in clinical trials. PLoS One 2013;8:e57838.

Claims

1. 1. A synthetic expression cassette for expressing a nucleic acid of interest in T cells and natural killer (NK) cells, comprising: (i) a minimal promoter; and (ii) a transcriptional enhancer operably linked to said minimal promoter for expressing said nucleic acid of interest in said cell, said transcriptional enhancer comprising a sequence having at least 95% sequence identity to a nucleotide sequence set forth in SEQ ID NO:

13.

2. The synthetic expression cassette of claim 1 , wherein the transcription enhancer comprises the sequence set forth in SEQ ID NO:

13.

3. 3. The synthetic expression cassette of claim 1 or 2, wherein the minimal promoter is the human cytomegalovirus CMV minimal promoter (miniCMV).

4. 4. The synthetic expression cassette of claim 3, wherein the minimal promoter comprises or consists of the sequence of SEQ ID NO:

6.

5. 5. The synthetic expression cassette of claim 1, wherein the transcription enhancer is upstream of the minimal promoter in the synthetic expression cassette.

6. 6. The synthetic expression cassette of claim 1, further comprising a polyadenylation (poly(A)) signal and / or a transcription termination signal.

7. 7. The synthetic expression cassette of claim 1, further comprising the nucleic acid of interest operably linked to a minimal promoter and a transcriptional enhancer.

8. 8. The synthetic expression cassette of claim 1, further comprising a selectable marker.

9. 9. The synthetic expression cassette of claim 1, wherein the cell is a stem cell.

10. 10. The synthetic expression cassette of claim 9, wherein the stem cell is a hematopoietic stem cell (HSC), an embryonic stem cell, a totipotent stem cell, a pluripotent stem cell, a tissue stem cell (multipotent stem cell) or an induced pluripotent stem cell (iPSC).

11. 9. The synthetic expression cassette of claim 1, wherein the cell is a T cell.

12. 9. The synthetic expression cassette of any one of claims 1 to 8, wherein the cell is a natural killer (NK) cell.

13. 13. The synthetic expression cassette of any one of claims 1 to 12, wherein the nucleic acid of interest encodes a chimeric antigen receptor (CAR).

14. A vector comprising a synthetic expression cassette according to any one of claims 1 to 13.

15. 15. A host cell comprising a synthetic expression cassette according to any one of claims 1 to 13 or a vector according to claim 14.

16. A composition comprising the host cell of claim 15.

17. 15. An in vitro method for inducing expression of a target nucleic acid by a T cell, comprising introducing into said T cell, or a hematopoietic stem cell, a synthetic expression cassette according to any one of claims 1 to 13, or a vector according to claim 14.

18. 18. The method of claim 17, wherein the nucleic acid of interest encodes a protein or a chimeric antigen receptor (CAR) that is missing or defective in the cell.

19. 15. Use of a synthetic expression cassette according to any one of claims 1 to 13 or a vector according to claim 14 for inducing expression of a nucleic acid of interest by a T cell.

20. 16. The synthetic expression cassette of any one of claims 1 to 13, the cell of claim 14, or the composition of claim 15 for use in treating a disease, condition or disorder in a subject.

21. 21. The synthetic expression cassette, cell or composition for use of claim 20, wherein the disease, condition or disorder is associated with (i) lack of expression of a protein or expression of a defective protein and the nucleic acid of interest encodes a functional form of the protein, or (ii) expression of an antigen and the nucleic acid of interest encodes a recombinant receptor that specifically binds to the antigen.

22. 22. The synthetic expression cassette, cell or composition for use according to claim 21 , wherein the recombinant receptor is a chimeric antigen receptor (CAR).

23. 23. The synthetic expression cassette, cell or composition for use according to any one of claims 20 to 22, wherein the disease, condition or disorder is cancer, an autoimmune or inflammatory disease, or an infectious disease.

24. 24. The synthetic expression cassette, cell or composition for use according to claim 23, wherein the cancer is a hematological cancer.

Images