In Vitro Assembly of RNA-Encapsidated Anellovirus Capsids

Abstract

The present invention relates generally to compositions and uses thereof for generating anelovectors.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 130,360, filed December 23, 2020, and U.S. Provisional Patent Application No. 63 / 147,064, filed February 8, 2021, the contents of which are incorporated by reference in their entireties herein.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on December 21, 2021, is entitled V2057-7017WO_SL.txt, and is 286,720 bytes in size. [Background technology]

[0003] There remains a need to develop compositions and methods for generating suitable vectors for delivering therapeutic effectors to patients. Summary of the Invention

[0004] The present disclosure provides compositions and methods for producing anellovectors (e.g., synthetic anellovectors) that can be used as delivery vehicles, e.g., to deliver genetic material, to deliver effectors, e.g., payloads, or to deliver therapeutic agents or effectors, to eukaryotic cells (e.g., human cells or tissues). While naturally occurring anelloviruses have DNA genomes, the present disclosure provides anellovectors with genetic elements that include RNA.

[0005] Anellovectors (e.g., produced using compositions or methods as described herein) generally include a genetic element (e.g., a genetic element that includes or encodes an effector, e.g., an exogenous or endogenous effector, e.g., a therapeutic effector) encapsidated in a proteinaceous outer layer (e.g., a proteinaceous outer layer comprising an Anellovirus capsid protein, e.g., a polypeptide encoded by an Anellovirus ORF1 protein or an Anellovirus ORF1 nucleic acid as described herein), which can introduce the genetic element into a cell (e.g., a mammalian cell, e.g., a human cell). The genetic element can include RNA. In some embodiments, an anellovector is an infectious vesicle or particle that comprises a proteinaceous outer layer that comprises a polypeptide encoded by an Anellovirus ORF1 nucleic acid (e.g., an ORF1 nucleic acid of an Alphatorquevirus, Betatorquevirus, or Gammatorquevirus, e.g., an ORF1 nucleic acid of Alphatorquevirus clade 1, Alphatorquevirus clade 2, Alphatorquevirus clade 3, Alphatorquevirus clade 4, Alphatorquevirus clade 5, Alphatorquevirus clade 6, or Alphatorquevirus clade 7, as described herein). The genetic elements of the anaerovectors of the present disclosure are typically circular and / or single-stranded RNA molecules (e.g., circular and single-stranded) and have a protein binding sequence that binds to the proteinaceous outer layer that confines it, or a polypeptide bound thereto, which may facilitate confinement of the genetic element within the proteinaceous outer layer and / or enrichment of the genetic element relative to other nucleic acids within the proteinaceous outer layer.In some embodiments, the genetic elements of the anaerovector are produced using Baculovirus, nucleic acid constructs (e.g., bacmid and / or donor vectors), insect cells, and / or animal cell lines, e.g., as described herein.

[0006] In some cases, the genetic element includes or encodes an effector (e.g., including a nucleic acid effector such as a non-coding RNA, or a polypeptide effector, e.g., encoding a protein) that can be expressed in the target cell. In some embodiments, the effector is a therapeutic or therapeutic effector, e.g., as described herein. In some embodiments, the effector is an endogenous or exogenous effector, e.g., exogenous to the wild-type Anellovirus or the target cell. In some embodiments, the effector is exogenous to the wild-type Anellovirus or the target cell. In some embodiments, the anaerovector can deliver an effector into a cell by introducing a genetic element encoding the effector into the cell such that upon contact with the cell, the effector is produced or expressed by the cell. In certain cases, the effector is an endogenous effector (e.g., endogenous to the target cell, but provided in increased amounts, e.g., by the anerosome). In other cases, the effector is an exogenous effector. The effector can, in some cases, regulate the function of a cell or regulate the activity or level of a target molecule in a cell. For example, the effector can reduce the level of a target protein in a cell (e.g., as described in Examples 3 and 4 of WO 19 / 65995). In another example, the anelovector can deliver and express an effector, e.g., an exogenous protein, in vivo (e.g., as described in Examples 19 and 28 of WO 19 / 65995). The anelovector can be used, for example, to deliver genetic material to a target cell, tissue, or subject; to deliver an effector to a target cell, tissue, or subject; or to treat a disease or disorder, for example, by delivering an effector that can act as a therapeutic agent to a desired cell, tissue, or subject.

[0007] In some embodiments, the compositions and methods described herein can be used to produce, for example, in a host cell, a genetic element of a synthetic anaerovector. A synthetic anaerovector has at least one structural difference, e.g., a deletion, insertion, substitution, modification (e.g., an enzymatic modification), compared to a wild-type virus (e.g., a wild-type Anellovirus, e.g., as described herein). Generally, a synthetic anaerovector comprises an exogenous genetic element enclosed within a proteinaceous envelope, which can be used to deliver the genetic element or an effector (e.g., an exogenous or endogenous effector) (e.g., a polypeptide or nucleic acid effector) encoded therein into a eukaryotic (e.g., human) cell. In embodiments, the anellovectors do not elicit a detectable and / or unwanted immune or inflammatory response, e.g., do not elicit greater than a 1%, 5%, 10%, 15% increase in molecular markers of inflammation, e.g., TNF-α, IL-6, IL-12, IFN, and B cell responses, e.g., reactive or neutralizing antibodies, e.g., the anellovectors can be substantially non-immunogenic to target cells, tissues, or subjects.

[0008] In some embodiments, the compositions and methods described herein can be used to produce genetic elements of anelovectors comprising: (i) a proteinaceous outer layer comprising an ORF1 molecule; and (ii) a genetic element comprising an RNA; wherein the genetic element is encased within the proteinaceous outer layer. In some embodiments, the genetic element is comprised of at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% RNA. In some embodiments, the genetic element does not comprise DNA. In some embodiments, the genetic element does not comprise ssDNA. Alternatively, in some embodiments, the genetic element comprises a DNA region. In some embodiments, the DNA or RNA described herein comprises one or more modified nucleotides (e.g., base modifications, sugar modifications, or backbone modifications). In some embodiments, the genetic element is single stranded. In some embodiments, the genetic element comprises a double stranded region. In some embodiments, the genetic element is a linear polypeptide. Alternatively, in some embodiments, the genetic element is a circular polynucleotide. In some embodiments, the nucleic acid sequence is codon-optimized, e.g., for expression in an insect cell. In some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the nucleic acid sequence are codon-optimized, e.g., for expression in an insect cell. In some embodiments, the nucleic acid sequence is codon-optimized, e.g., for expression in a mammalian (e.g., human) cell. In some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the nucleic acid sequence are codon-optimized, e.g., for expression in a mammalian (e.g., human) cell.In some embodiments the genetic element is about 10-20, 20-30, 30-40, 50-60 60-70, 70-80, 80-90, 90-100, 100-125, 125-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, or 4000-4500 nucleotides in length. In some embodiments the genetic element is at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, or 4500 nucleotides in length.

[0009] In some embodiments, the compositions and methods described herein can be used to produce infectious (e.g., for human cells) anaerovectors, vehicles, or particles that contain a capsid (e.g., a capsid that contains an Anellovirus ORF, e.g., ORF1, a polypeptide) that encapsidates a genetic element that contains a protein binding sequence that binds to the capsid and a heterologous (for Anellovirus) sequence that encodes a therapeutic effector. In some embodiments, the anaerovectors can deliver the genetic element into mammalian, e.g., human, cells.

[0010] In one aspect, the invention features a method of making an anaerovector by in vitro assembly. In some embodiments, the method of making an anaerovector includes: (a) providing a mixture including: (i) a genetic element including an RNA, and (ii) an ORF1 molecule; and (b) incubating the mixture under conditions suitable for entrapment of the genetic element within a proteinaceous molecule including the ORF1 molecule, thereby making an anaerovector; optionally, the mixture is not contained within a cell. In some embodiments, the method further includes expressing the ORF1 molecule, e.g., in a host cell (e.g., an insect cell or a mammalian cell), prior to providing (a). In some embodiments, the expressing step includes incubating a host cell (e.g., an insect cell or a mammalian cell) that includes a nucleic acid molecule (e.g., a baculovirus expression vector) encoding the ORF1 molecule, under conditions suitable for producing the ORF1 molecule. In some embodiments, the method further includes purifying the ORF1 molecule expressed by the host cell prior to providing (a).

[0011] In some embodiments, the anellovectors described herein can be used as effective delivery vehicles for introducing agents, such as the effectors described herein, into target cells, e.g., target cells of a subject to be treated for therapeutic or prophylactic purposes.

[0012] In one aspect, the invention features a pharmaceutical composition that includes an annelovector (e.g., a synthetic annelovector) as described herein. In some embodiments, the pharmaceutical composition further includes a pharma- ceutical acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is administered at a dose of about 10 per kilogram of a subject. 5 ~10 14 (For example, about 10 6 ~10 13 , 10 7 ~10 12 , 10 8 ~10 11 or 10 9 ~10 10In some embodiments, the pharmaceutical composition comprising the preparation is stable for an acceptable period of time and temperature, and / or is compatible with the desired route of administration and / or any device required by this route, e.g., a needle or syringe. In some embodiments, the pharmaceutical composition is formulated for administration as a single dose or multiple doses. In some embodiments, the pharmaceutical composition is formulated at the site of administration, e.g., by a medical professional. In some embodiments, the pharmaceutical composition comprises a desired concentration of anellovector genomes or genome equivalents (e.g., defined by the number of genomes per volume).

[0013] In one aspect, the invention features a method of treating a disease or disorder in a subject, the method includes administering to the subject an annelovector, e.g., a synthetic annelovector as described herein.

[0014] In one aspect, the invention features a method of delivering an effector or payload (e.g., an endogenous effector or an exogenous effector) to a cell, tissue, or subject, the method includes administering to the subject an anaerovector, e.g., a synthetic anaerovector as described herein, where the anaerovector includes a nucleic acid encoding the effector. In some embodiments, the payload is a nucleic acid. In some embodiments, the payload is a polypeptide.

[0015] In one aspect, the invention features a method of delivering an annelovector to a cell, including contacting an annelovector, e.g., a synthetic annelovector as described herein, with a cell, e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., in vivo or ex vivo.

[0016] Further features of any of the anellovectors, compositions or methods described above include one or more of the embodiments listed below.

[0017] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, various equivalents to the specific embodiments of the invention described herein which equivalents are intended to be included in the embodiments recited below.

[0018] Enumeration of embodiments 1. The following: a) a proteinaceous outer layer containing the ORF1 molecule; b) RNA-containing genetic elements; wherein the genetic elements are encapsulated within a proteinaceous outer layer.

[0019] 2. The anaerovector of embodiment 1, wherein the genetic element is composed of at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% RNA.

[0020] 3. The anaerovector of embodiment 1 or 2, wherein the RNA comprises one or more chemical modifications.

[0021] 4. The anaerovector of any of the preceding embodiments, wherein the genetic element consists or consists essentially of RNA.

[0022] 5. The anaerovector of any of the preceding embodiments, wherein the anaerovector does not comprise DNA.

[0023] 6. The anaerovector of any of the preceding embodiments, wherein the anaerovector does not comprise ssDNA.

[0024] 7. The anaerovector of any of the preceding embodiments, wherein the genetic element comprises a DNA region.

[0025] 8. The anaerovector of any of the preceding embodiments, wherein all nucleotides of the DNA region are chemically modified.

[0026] 9. The anaerovector of embodiment 7 or 8, wherein the DNA region is covalently linked to the RNA of the genetic element.

[0027] 10. The anaerovector of any of the preceding embodiments, wherein at least a portion of the DNA region hybridizes to at least a portion of the RNA of the genetic element.

[0028] 11. The anaerovector according to any of the preceding embodiments, wherein the DNA region is 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1000 nucleotides in length.

[0029] 12. The anaerovector of any of the preceding embodiments, wherein the genetic element is single stranded.

[0030] 13. The anaerovector of any of the preceding embodiments, wherein the genetic element comprises a double-stranded region (e.g. a region of RNA paired with RNA, or DNA paired with RNA).

[0031] 14. The anaerovector of any of the preceding embodiments, wherein the genetic element is linear.

[0032] 15. The anellovector of any of the preceding embodiments, wherein the genetic element is circular.

[0033] 16. The anaerovector of any of the preceding embodiments, wherein the genetic element comprises a first region and a second region capable of hybridizing with the first region.

[0034] 17. The anaerovector of any of the preceding embodiments, wherein the genetic element does not comprise a 5' or 3' end.

[0035] 18. The anaerovector of any of embodiments 15 to 17, wherein the genetic element does not contain free phosphates and / or free sugars.

[0036] 19. The anaerovector according to any of embodiments 15 to 18, wherein every phosphate in the genetic element is covalently bound to a first sugar by a first oxygen atom contained in the phosphate and to a second sugar by a second oxygen atom contained in the phosphate.

[0037] 20. An anaerovector according to any of embodiments 15 to 19, wherein all sugars in the genetic element are covalently linked to a first phosphate by a first carbon atom in the sugar and to a second phosphate by a second carbon atom in the sugar.

[0038] 21. The anaerovector according to any of embodiments 15 to 20, wherein the genetic element is produced by circularizing linear RNA.

[0039] 22. The anaerovector of any of the preceding embodiments, wherein the genetic element is about 10-20, 20-30, 30-40, 50-60 60-70, 70-80, 80-90, 90-100, 100-125, 125-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, or 4000-4500 nucleotides in length.

[0040] 23. The anaerovector of any of the preceding embodiments, wherein the genetic element is at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, or 4500 nucleotides in length.

[0041] 24. The anelovactor of any of the preceding embodiments, wherein the genetic element is linked to the ORF1 molecule.

[0042] 25. The anaerovector of any of the preceding embodiments, wherein the genetic element is linked to a jellyroll domain contained in the ORF1 molecule.

[0043] 26. The anelovvector of any of the preceding embodiments, wherein the genetic element is linked to an arginine-rich domain contained in the ORF1 molecule.

[0044] 27. The anaerovector of any of the preceding embodiments, wherein the anaerovector comprises a plurality of genetic elements, for example at least 2, 3, 4, 5, 10, 20, 30, 40, 50, or 60 genetic elements.

[0045] 28. The anaerovector of embodiment 27, wherein each of the multiple genetic elements comprises the same sequence.

[0046] 29. The anaerovector of embodiment 27, wherein the genetic elements comprise different sequences.

[0047] 30. The anellovector of any of the preceding embodiments, wherein the genetic element encodes an exogenous effector.

[0048] 31. The anaerovector of embodiment 30, wherein the sequence encoding the exogenous effector is at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, or 3000 nucleotides in length.

[0049] 32. The anaerovector according to any of embodiments 30 to 31, wherein the exogenous effector comprises a therapeutic effector (e.g., a polypeptide or a nucleic acid molecule).

[0050] 33. The anaerovector according to any of embodiments 30 to 32, wherein the exogenous effector comprises a human protein or a polypeptide comprising an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0051] 34. The anelovactor of any one of embodiments 30 to 33, wherein the exogenous effector comprises a nucleic acid molecule.

[0052] 35. The anaerovector according to any of embodiments 30 to 34, wherein the exogenous effector comprises a non-coding nucleic acid molecule, such as a functional RNA, such as an mRNA, miRNA, or siRNA.

[0053] 36. An anaerovector according to any of embodiments 30 to 35, wherein the genetic element is an mRNA molecule encoding an exogenous effector (e.g. a peptide or polypeptide, e.g. a therapeutic peptide or polypeptide).

[0054] 37. The anaerovector of embodiment 36, wherein the non-coding nucleic acid molecule is a human non-coding nucleic acid molecule or a nucleic acid molecule comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0055] 38. An anaerovector according to any of embodiments 30 to 37, wherein the exogenous effector comprises a cytosolic polypeptide or peptide (e.g., a DPP-4 inhibitor, an activator of GLP-1 signaling, or an inhibitor of neutrophil elastase, or a functional fragment thereof).

[0056] 39. The anelovactor of embodiment 38, wherein the exogenous effector comprises a regulatory intracellular polypeptide.

[0057] 40. An anaerovector according to any of embodiments 30 to 39, wherein the exogenous effector comprises a secreted polypeptide or peptide (e.g., a cytokine, an antibody molecule, a hormone, a growth factor, or a coagulation-related factor, or a functional fragment thereof).

[0058] 41. The anelovactor of any one of embodiments 30 to 40, wherein the exogenous effector comprises a protein replacement therapy.

[0059] 42. The anaerovector of any of embodiments 30 to 41, wherein the exogenous effector comprises an enzyme.

[0060] 43. The anelovactor according to any of embodiments 30 to 42, wherein the exogenous effector comprises erythropoietin (EPO) or human growth hormone (hGH), or a functional fragment thereof.

[0061] 44. An anaerovector according to any of embodiments 30 to 43, wherein the exogenous effector comprises a component of a gene editing system (e.g., a component of a CRISPR system, such as Cas9, Cpf1, or a functional fragment thereof).

[0062] 45. The anellovector of any of the previous embodiments, wherein the RNA comprises chemically modified RNA, e.g., as described herein.

[0063] 46. ​​The anelovactor of any of the preceding embodiments, wherein the RNA comprises a cap.

[0064] 47. The anelovactor of any of the preceding embodiments, wherein the RNA comprises a poly-A tail, e.g., at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 adenosines in length.

[0065] 48. The anelovactor of any of the previous embodiments, wherein the RNA lacks a poly-A tail and comprises, for example, no more than 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 consecutive adenosines.

[0066] 49. The anaerovector of any of the previous embodiments, wherein the proteinaceous outer layer comprises about 60 (e.g., about 40, 50, 60, 70, or 80) copies of the ORF1 molecule.

[0067] 50. The anaerovector of any of the preceding embodiments, wherein the jellyroll domain of the ORF1 molecule faces the interior of the proteinaceous outer layer.

[0068] 51. The anaerovector of any of the preceding embodiments, wherein the ORF1 molecule comprises an amino acid sequence listed in any of Tables N-S and 37A-37C, or an amino acid sequence having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0069] 52. The anaerovector of any of the preceding embodiments, wherein the ORF1 molecule comprises an arginine-rich region, e.g., an arginine-rich region comprising an amino acid sequence of an arginine-rich region listed in any of Tables N-S and 37A-37C, or an amino acid sequence having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0070] 53. The anaerovector of embodiment 52, wherein the arginine-rich region comprises at least about 70% (e.g., at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100%) basic residues (e.g., arginine or lysine).

[0071] 54. The anaerovector of any of the preceding embodiments, wherein the ORF1 molecule comprises a jelly-roll domain, e.g., a jelly-roll domain comprising an amino acid sequence of a jelly-roll domain listed in any of Tables N-S and 37A-37C, or an amino acid sequence having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0072] 55. The Jellyroll domain has the following characteristics: (i) at least 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, or more) of the amino acids of the jelly-roll domain are part of one or more β-sheets; (ii) the secondary structure of the jellyroll domain comprises at least four (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) β-strands; and / or (iii) the tertiary structure of the jelly-roll domain comprises at least two (e.g., two, three, or four) β-sheets; and / or (iv) the jelly-roll domain comprises a ratio of β-sheets:α-helices of at least 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. 55. The anaerovector of embodiment 54, comprising one or more (e.g., 1, 2, 3, or 4) of:

[0073] 56. The anellovector of embodiment 54, wherein the jelly-roll domain comprises two beta sheets, for example arranged in an antiparallel orientation to each other.

[0074] 57. The anellovector of embodiment 54, wherein the jellyroll domain comprises eight beta strands.

[0075] 58. An anaerovector described in any of embodiments 52 to 57, wherein the jellyroll domain comprises a region having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence of the Dβ chain, for example as shown in Figure 3.

[0076] 59. The anelovactor of embodiment 52, wherein the Dβ chain comprises one, two, or three or more basic residues (e.g., arginine or lysine).

[0077] 60. An anaerovector described in any of embodiments 52 to 59, wherein the jellyroll domain comprises a region having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence of a Gβ chain, for example as shown in Figure 3.

[0078] 61. The anelovactor of embodiment 52, wherein the Gβ chain comprises at least one, two, or three, or more basic residues (e.g., arginine or lysine).

[0079] 62. The anaerovector of any of the preceding embodiments, wherein the ORF1 molecule comprises an N22 domain, e.g., an N22 domain comprising an amino acid sequence of an N22 domain listed in any of Tables N-S and 37A-37C, or an amino acid sequence having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0080] 63. The N22 domain has the amino acid sequence YNPX 2 DXGX 2 N(X n wherein each of n is independently a contiguous sequence of any n amino acids.

[0081] 64. The N22 domain has the amino acid sequence YNPX 2 DXGX 2The first beta strand has the amino acid sequence YNPX 2 DXGX 2 and / or the second beta strand comprises the amino acid sequence YNPX 2 DXGX 2 2. The anaerovector of any of the preceding embodiments, comprising a second asparagine (N) residue of N (N to C).

[0082] 65. The anaerovector of any of the preceding embodiments, wherein the ORF1 molecule comprises a C-terminal domain comprising an amino acid sequence of a C-terminal domain listed in any of Tables N-S and 37A-37C, or an amino acid sequence having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0083] 66. The anellovector of any of the previous embodiments, wherein the genetic element lacks a sequence encoding an Anellovirus ORF1 protein (e.g., as described herein).

[0084] 67. The anellovector of any of the previous embodiments, wherein the genetic element lacks a sequence encoding an Anellovirus ORF2 protein (e.g., as described herein).

[0085] 68. The anellovector of any of the previous embodiments, wherein the genetic element lacks a sequence encoding an Anellovirus ORF3 protein (e.g., as described herein).

[0086] 69. The annellvector of any of the preceding embodiments, wherein the annellvector is configured to deliver a genetic element to a cell (e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell).

[0087] 70. The anaerovector of embodiment 69, wherein a population of at least 1000 anaerovectors is capable of delivering at least 100 copies (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 5000, 10,000, 50,000, 100,000, 500,000, or 1,000,000 copies) of a genetic element into one or more cells.

[0088] 71. The anaerovector of embodiment 69 or 70, wherein the population of anaerovectors (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 genome equivalents of genetic elements per cell) is capable of delivering genetic elements to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the population of cells.

[0089] 72. A population of anellovectors (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 genome equivalents of genetic elements per cell) is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, 8,000, 1 x 10 4 , 1×10 5 , 1×10 6 , 1×10 7 72. The anaerovector of any of embodiments 69-71, capable of delivering one or more copies of the genetic element to a population of cells.

[0090] 73. A population of anellovectors (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 genome equivalents of genetic elements per cell) is 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 5-10, 10-20, 20-50, 50-100, 100-1000, 1000-10 4 , 1×10 4 ~1×10 5 , 1×10 4 ~1×10 6 , 1×10 4 ~1x10 7 , 1x10 5 ~1x10 6 , 1x10 5 ~1x10 7 , or 1x10 6 ~1x10 7 73. An anaerovector according to any of embodiments 69 to 72, capable of delivering copies of a genetic element of said vector to a population of cells.

[0091] 74. The anaerovector of any of the preceding embodiments, wherein the anaerovector selectively delivers or is present at higher levels (preferably accumulates) in a desired cell type, tissue, or organ (e.g., bone marrow, blood, heart, GI, skin, retinal photoreceptors, epithelial lining, or pancreas).

[0092] 75. The anaerovector of any of the previous embodiments, wherein the genetic element is protected from or resistant to digestion by RNases (e.g. by a proteinaceous outer layer).

[0093] 76. The anaerovector of any of the previous embodiments, wherein the genetic elements encapsulated within the proteinaceous outer layer are resistant to endonuclease digestion, such as RNase digestion.

[0094] 77. The anaerovector of any of the previous embodiments, wherein the genetic element comprises a promoter element.

[0095] 78. The anellovector of any of the previous embodiments, wherein the genetic element comprises a protein-binding sequence.

[0096] 79. The anaerovector of embodiment 78, wherein the protein binding sequence is capable of binding to the ORF1 molecule.

[0097] 80. A composition comprising a plurality of anellovectors according to any of the preceding embodiments.

[0098] 81. The composition described in embodiment 80, wherein at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the proteinaceous outer layer comprising the ORF1 molecule in the composition contains at least one copy of the genetic element.

[0099] 82. The composition described in embodiment 80, wherein at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the proteinaceous outer layer comprising the ORF1 molecule in the composition comprises at least one copy of the anaerovector genetic element.

[0100] 83. The composition comprises at least 10 2 , 10 3 , 10 4 , 10 4 , 10 5 , 10 6 , or 10 7 83. The composition of any of embodiments 80 to 82, comprising the same anellovectors.

[0101] 84. Multiple, at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 1013 , 10 14 , or 10 15 or the composition comprises at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 84. The composition of any one of embodiments 80 to 83, comprising an allovector genome.

[0102] 85. The following characteristics: a) the composition meets pharmaceutical or Good Manufacturing Practice (GMP) standards; b) the composition is manufactured in accordance with Good Manufacturing Practice (GMP); c) the composition has a pathogen level below a predetermined threshold, e.g., is substantially free of pathogens; d) the composition has a contaminant level below a predetermined threshold, e.g., is substantially free of a contaminant (e.g., a denaturing agent, e.g., urea); e) the composition has a predetermined level of non-infectious particles or a predetermined ratio of particles:infectious units (e.g., <300:1, ≦200:1, ≦100:1, or <50:1); or f) the pharmaceutical composition has low immunogenicity or is substantially non-immunogenic, e.g., as described herein; and optionally the composition comprises urea at a concentration of less than 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1M, 1.1M, 1.2M, 1.3M, 1.5M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, or 2M.

[0103] 86. The composition of any of embodiments 80-85, wherein the pharmaceutical composition has a contaminant level below a predetermined standard value, e.g., is substantially free of contaminants.

[0104] 87. The composition of any of embodiments 80-86, wherein the composition comprises urea at a concentration of less than 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1M, 1.1M, 1.2M, 1.3M, 1.5M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, or 2M.

[0105] 88. The composition of embodiment 86 or 87, wherein the contaminants include one or more of the following: mycoplasma, exotoxins, host cell nucleic acids (e.g., host cell DNA and / or host cell RNA), animal-derived process impurities (e.g., serum albumin or trypsin), replicating organisms (RCA), such as replicating viruses or unwanted anaerovectors (anaerovectors other than a desired anaerovector, e.g., an anaerovector other than an anaerovector as described herein), free viral capsid proteins, adventitious contaminating organisms, and / or aggregates.

[0106] 89. The composition of any of embodiments 80-88, wherein the composition contains less than 10% by weight (e.g., less than about 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1%) of contaminants.

[0107] 90. A composition according to any of embodiments 80 to 89, wherein at least 90% of the proteinaceous outer layer comprises the same genetic elements (e.g., genetic elements of an anellovector).

[0108] 91. A composition according to any of embodiments 80 to 90, wherein at least 90% of the proteinaceous outer layer comprises the same ORF1 molecule.

[0109] 92. A pharmaceutical composition comprising an anellovector or composition according to any of the preceding embodiments, and a pharma- ceutically acceptable carrier or excipient.

[0110] 93. A method for producing an annelovector, comprising: (a) Below: (i) a genetic element comprising RNA, and (ii)ORF1 molecule providing a mixture comprising: (b) incubating the mixture under conditions suitable for encasing the genetic elements within a proteinaceous outer layer that includes the ORF1 molecule, thereby generating an annelovector. and optionally wherein the mixture is not contained in a cell.

[0111] 94. The method of embodiment 93, further comprising expressing the ORF1 molecule, for example in a host cell (e.g., an insect cell or a mammalian cell), prior to providing (a).

[0112] 95. The method of embodiment 94, wherein the expressing step comprises incubating a host cell (e.g., an insect cell or a mammalian cell) containing a nucleic acid molecule (e.g., a baculovirus expression vector) encoding the ORF1 molecule under conditions suitable for producing the ORF1 molecule.

[0113] 96. The method of embodiment 94 or 95, further comprising the step of purifying the ORF1 molecule expressed by the host cell prior to providing (a).

[0114] 97. A method for purifying an anellovector, comprising: (a) Below: (i) a genetic element, e.g., a genetic element comprising RNA, and (ii) a proteinaceous outer layer comprising an ORF1 molecule, the proteinaceous outer layer encapsulating the genetic element; providing an anaerovector (e.g., as described herein) comprising: (b) Purifying the anaerovector A method comprising:

[0115] 98. The method of embodiment 96 or 97, wherein the purifying step (e.g., purification of the ORF1 molecule or purification of the anellovector) comprises affinity purification, e.g., heparin affinity purification.

[0116] 99. The method of any of embodiments 96 to 98, wherein the purifying step (e.g., purification of the ORF1 molecule or purification of the anellovector) comprises size exclusion chromatography (e.g., using a Tris buffer mobile phase).

[0117] 100. The method of any of embodiments 96 to 99, wherein the purifying step (e.g., purification of the ORF1 molecule or purification of the anaerovector) comprises affinity purification (e.g., heparin affinity purification) followed by size exclusion chromatography.

[0118] 101. The method of any of embodiments 96 to 100, wherein the purifying step (e.g., purification of the ORF1 molecule or purification of the anellovector) comprises anion exchange chromatography (e.g., Mustang Q membrane chromatography).

[0119] 102. The method of any of embodiments 96 to 101, wherein the purifying step (e.g., purification of the ORF1 molecule or purification of the anellovector) comprises mixed-mode chromatography (e.g., using a mixed-mode resin, e.g., Cato700 resin).

[0120] 103. The method of any of embodiments 96-102, wherein the purifying step (e.g., purification of the ORF1 molecule or purification of the anellovector) produces one or more compositions comprising virus-like particles (VLPs) comprising at least about 20, 30, 40, 50, or 60 copies, or 20-30, 30-40, 40-50, or 50-60 copies of the ORF1 molecule.

[0121] 104. The method of embodiment 103, wherein at least 75%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the virus-like particles comprise a proteinaceous outer layer that is a 60-mer or a particle at least 30, 31, 32, 33, 34, or 35 nm in diameter.

[0122] 105. The composition comprises at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 Contains particles / mL or 10 5 ~10 6 , 10 6 ~10 7 , 10 7 ~10 9 , 10 8 ~10 9 , 10 9 ~10 10 , or 10 10 ~10 11 The method of embodiment 103, comprising particles / mL (e.g., as measured by electron microscopy).

[0123] 106. A method according to any of embodiments 93 to 105, further comprising, prior to providing (a), incubating the ORF1 molecule under conditions suitable for disassembly of a proteinaceous outer layer (e.g., a virus-like particle (VLP)) comprising the ORF1 molecule.

[0124] 107. The method according to embodiment 106, wherein the conditions suitable for degradation of the proteinaceous outer layer comprising the ORF1 molecule comprise incubation in the presence of a denaturing agent.

[0125] 108. The method of any of embodiments 106-107, wherein the denaturing agent comprises a chaotropic agent (e.g., urea) or a detergent (e.g., SDS (e.g., 0.1% SDS), Tween®, or Triton®).

[0126] 109. The method of any of embodiments 106 to 108, wherein the conditions suitable for degradation of the proteinaceous outer layer comprising the ORF1 molecule comprise a predetermined conductivity, a high salt solution (e.g., a solution comprising NaCl, e.g., a solution comprising NaCl at a concentration of at least about 1 M, e.g., at least about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 2, 3, 4, or 5 M), heat (e.g., a temperature greater than about 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, or 95° C.), or pH (e.g., an acidic or basic pH).

[0127] 110. The method according to any of embodiments 106 to 109, wherein the conditions suitable for degradation of the proteinaceous outer layer comprising the ORF1 molecule comprise incubation in a solution comprising urea at a concentration of at least 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1M, 1.1M, 1.2M, 1.3M, 1.5M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, or 2M.

[0128] 111. A method according to any of embodiments 106 to 110, wherein the incubating step (b) achieves degradation of at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 96%, or 100% of the population of particles containing ORF1 molecules or copies thereof.

[0129] 112. The method of any of embodiments 106-111, wherein the conditions suitable for degrading the proteinaceous outer layer are sufficient to degrade a complex (e.g., a proteinaceous outer layer) comprising at least about 20, 30, 40, 50, or 60 copies, or 20-30, 30-40, 40-50, or 50-60 copies of ORF1 molecules.

[0130] 113. Conditions favorable for the decomposition of the proteinaceous outer layer 8 The method of any of embodiments 106-112, wherein a number of particles that remain intact of less than particles / mL is achieved.

[0131] 114. A method according to any of embodiments 106 to 113, further comprising the step of removing the ORF1 molecule from conditions suitable for degradation of the proteinaceous outer layer (e.g., subjecting the ORF1 molecule to non-denaturing conditions) prior to providing (a).

[0132] 115. The method of embodiment 114, wherein the step of removing the ORF1 molecule from conditions suitable for degradation of the proteinaceous outer layer comprises reducing the concentration of the denaturant, e.g., reducing the concentration of denaturant (e.g., urea) to less than 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1M, 1.1M, 1.2M, 1.3M, 1.5M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, or 2M.

[0133] 116. The method of embodiment 114 or 115, wherein the removal step results in the formation of one or more anaerovectors, each of which confines at least one copy (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, or 1000 copies) of a genetic element (e.g., mRNA).

[0134] 117. The number of anaerovectors encapsulating at least one copy of a genetic element in the resulting solution is at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , or 10 11 or 10 5 ~10 6 , 10 6 ~10 7 , 10 7 ~10 9 , 10 8 ~10 9 , 10 9 ~10 10 , or 10 10~10 11 117. The method of embodiment 116, wherein the number of nuclei is 1 or less (e.g., as measured by electron microscopy).

[0135] 118. The number of anaerovectors encapsulating at least one copy of a genetic element in the resulting solution is at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , or 10 11 anellovectors / mL; or 10 5 ~10 6 , 10 6 ~10 7 , 10 7 ~10 9 , 10 8 ~10 9 , 10 9 ~10 10 , or 10 10 ~10 11 The method of embodiment 116, wherein the anellovectors / mL (e.g., as measured by electron microscopy).

[0136] 119. By removing at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , or 10 11 anerovectors / mL; or 10 5 ~10 6 , 10 6 ~10 7 , 10 7 ~10 9 , 10 8 ~10 9 , 10 9 ~10 10 , or 10 10 ~10 11The method of any of embodiments 114-118, wherein a solution containing anaerovectors / mL (e.g., as measured by electron microscopy) is achieved, and the anaerovectors each encapsulate at least one copy (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, or 1000 copies) of a genetic element (e.g., mRNA).

[0137] 120. The method of any of embodiments 114-119, wherein at least 75%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the anellovectors comprise a proteinaceous outer layer that is a 60-mer or particle, or is a particle with a diameter of at least 30, 31, 32, 33, 34, or 35 nm.

[0138] 121. The method of any of embodiments 93 to 120, wherein the genetic elements of the anellovector are resistant to endonucleases (e.g., RNases).

[0139] 122. The method of any of embodiments 93-121, wherein (a) comprises mixing (i) and (ii).

[0140] 123. The method according to any of embodiments 93 to 122, which is carried out in a cell-free system.

[0141] 124. A method for producing an anellovector composition, comprising: (a) providing a plurality of anellovectors or compositions according to any of the preceding embodiments; (b) optionally evaluating the plurality of anerosomes for one or more of the following: contamination as described herein, optical density measurements (e.g., OD260), particle counts (e.g., by HPLC), infectivity (e.g., particle:infectious unit ratio, e.g., as determined by fluorescence and / or ELISA); and (c) formulating the plurality of anellovectors, e.g., as a pharmaceutical composition suitable for administration to a subject, e.g., if one or more of the parameters of (b) meet a specified threshold value. A method comprising:

[0142] 125. A method for treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject an anellovector or composition described in any of the preceding embodiments, thereby treating the disease or disorder (e.g., as described herein) in the subject.

[0143] 126. A method for regulating, e.g., enhancing or inhibiting, a biological function (e.g., as described herein) in a subject, the method comprising administering to the subject an anellovector or composition described in any of the preceding embodiments.

[0144] 127. A method of delivering a genetic element to a cell, the method comprising contacting an anelovvector or composition of any of the preceding embodiments with a cell, e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell.

[0145] 128. Use of an anellovector or composition according to any of the preceding embodiments for treating a disease or disorder (e.g., as described herein) in a subject.

[0146] 129. The anellovector or composition of any of the preceding embodiments for use in a method for treating a disease or disorder (e.g., as described herein) in a subject.

[0147] 130. The anellovector or composition of any of the preceding embodiments for use in the manufacture of a medicament for the treatment of a disease or disorder (e.g., as described herein) in a subject.

[0148] Other features, objects, and advantages of the invention will become apparent from the description and drawings, and from the claims.

[0149] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0150] The following detailed description of the embodiments of the invention will be more clearly understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, the drawings show embodiments that are illustrated herein. It should be understood, however, that the invention is not limited to the precise arrangement and utility of the embodiments shown in the drawings. [Brief description of the drawings]

[0151] [Figure 1] 1 is a series of electron micrographs showing that recombinant capsid proteins from Anellovirus strains form virus-like particles (VLPs) in vitro. As observed by negative stain electron microscopy, capsid proteins produced in different cell lines form VLPs in vitro. (A) Ring2 ORF1 VLP purified from insect cells with an observed diameter of approximately 35 nm. (B) Ring10 ORF1 VLP purified from insect cells with an observed diameter of approximately 35 nm. (C) CAV VP1 VLP purified from mammalian cells with an observed diameter of approximately 20 nm. [Diagram 2] Figure 1 shows the eight beta strand jelly-roll domains (or jelly-roll fold) observed in the structure of Beak and Feather Disease Virus (BFDV). By convention, the beta strands are designated B through I. The strands form four antiparallel beta sheets with a BIDG and CHEF orientation. The BIDG sheets form the interior of the viral capsid. [Diagram 3]FIG. 1 is an amino acid sequence alignment showing the jellyroll sequence of the Anellovirus ORF1 protein compared to the jellyroll domain of the Beak and Feather Disease Virus (BFDV) / Hepatitis E capsid protein (HepE). [Figure 4] A series of diagrams depicting an exemplary method for producing Anellovirus ORF1 protein-based virus-like particles (VLPs) encapsulating mRNA molecules encoding eGFP. (A) ORF1 protein was produced intracellularly and isolated as described herein. (B) VLPs formed from ORF1 protein were then disassembled in a 2M urea solution. (C) Upon removal of urea in the absence of mRNA, VLPs were barely reformed (titers below 108 particles / mL as detected by electron microscopy). (D, E) Upon removal of urea in the presence of mRNA encoding eGFP, substantial amounts of VLPs (titers between 1x109 and 1x1010 particles / mL) were detected by electron microscopy (EM). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0152] definition The present invention will be described with respect to specific embodiments and with reference to certain figures but the invention is not limited thereto except as claimed. The terms set forth below should generally be understood in their ordinary meaning unless otherwise indicated.

[0153] When the term "comprising" is used in the present specification and claims, it does not exclude other elements. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising". Hereinafter, when a group is defined to include at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of these embodiments.

[0154] Where an indefinite or definite article is used to indicate a singular noun, e.g. "a", "an" or "the", this includes a plural of that noun, unless specifically stated otherwise.

[0155] The phrase "compounds, compositions, products, etc. for the purpose of treatment, regulation, etc." should be understood to refer, by itself, to compounds, compositions, products, etc. that are suitable for the stated purpose, such as treatment, regulation, etc. The phrase "compounds, compositions, products, etc. for the purpose of treatment, regulation, etc." also discloses, as an embodiment, that such compounds, compositions, products, etc. are used for treatment, regulation, etc.

[0156] The phrases "compounds, compositions, products, etc. for use in...", "use of compounds, compositions, products, etc. in the manufacture of a medicament, pharmaceutical composition, veterinary composition, diagnostic composition, etc. for...", or "compounds, compositions, products, etc. for use as a medicament..." indicate that such compounds, compositions, products, etc. are intended to be used in a method of treatment that may be performed on the human or animal body. They are considered as equivalent disclosures of embodiments and claims relating to methods of treatment, etc. If an embodiment or claim thus refers to a "compound for use in the treatment of a human or animal suspected of suffering from a disease", this is also considered to be a disclosure of "use of a compound in the manufacture of a medicament for the treatment of a human or animal suspected of suffering from a disease" or "method of treatment by administering a compound to a human or animal suspected of suffering from a disease". The phrase "compounds, compositions, products, etc. for treatment, modulation, etc." should be understood to refer to a compound, composition, product, etc. suitable for the stated purpose of treatment, modulation, etc. as such.

[0157] Hereinafter, when an example of a term, value, number, etc. is given in parentheses, this should be understood as indicating that the example described in parentheses may constitute an embodiment. For example, when it is described that "in some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 encoding the nucleotide sequence of Table 1 (e.g., nucleotides 571-2613 of the nucleic acid sequence of Table 1)," some embodiments relate to a nucleic acid molecule comprising a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotides 571-2613 of the nucleic acid sequence of Table 1.

[0158] As used herein, the term "amplification" refers to the duplication of a nucleic acid molecule or a portion thereof (e.g., a genetic element or a genetic element region) to produce one or more additional copies of the nucleic acid molecule or a portion thereof. In some embodiments, amplification achieves partial duplication of a nucleic acid sequence. In some embodiments, amplification occurs via rolling circle replication.

[0159] As used herein, the term "anellovector" refers to a vehicle that includes a genetic element, e.g., RNA, e.g., circular RNA, encased within a proteinaceous outer layer. In some embodiments, the genetic element is substantially protected from digestion by RNases by the proteinaceous outer layer. "Synthetic anaellovector" as used herein generally refers to an anaellovector that does not occur in nature, e.g., has a sequence that differs from a wild-type virus (e.g., a wild-type Anellovirus described herein). In some embodiments, a synthetic anaellovector is engineered or recombinant, e.g., includes a genetic element that includes differences or modifications relative to a wild-type viral genome (e.g., a wild-type Anellovirus genome described herein). In some embodiments, encased within a proteinaceous outer layer includes 100% coverage by the proteinaceous outer layer, as well as less than 100% coverage, e.g., 95%, 90%, 85%, 80%, 70%, 60%, 50% or less coverage. For example, gaps or discontinuities (e.g., that render the proteinaceous outer layer permeable to water, ions, peptides, or small molecules) may be present in the proteinaceous outer layer, so long as the genetic elements are retained within the proteinaceous outer layer or protected from digestion by RNases, e.g., prior to entry into a host cell. In some embodiments, an anaerovector is purified, e.g., it is separated from its original source, and / or is substantially free (>50%, >60%, >70%, >80%, >90%) of other constituents. In some embodiments, an anaerovector is capable of introducing genetic elements into a target cell (e.g., via infection). In some embodiments, an anaerovector is an infectious synthetic viral particle that contains a specific Anellovirus element, such as an Anellovirus ORF1 molecule.

[0160] As used herein, the term "antibody molecule" refers to a protein, e.g., an immunoglobulin chain or fragment thereof, that comprises at least one immunoglobulin variable domain sequence. The term "antibody molecule" encompasses full-length antibodies and antibody fragments (e.g., scFv). In some embodiments, an antibody molecule is a multispecific antibody molecule, e.g., an antibody molecule comprises a plurality of immunoglobulin variable domain sequences, where a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In some embodiments, a multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody molecule is generally characterized by a first immunoglobulin variable domain sequence that has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.

[0161] As used herein, the term "backbone" or "backbone region" refers to a region within a nucleic acid molecule (e.g., within a bacmid or donor vector, e.g., as described herein) that includes one or more elements involved (e.g., necessary and / or sufficient) in replicating and / or maintaining the nucleic acid molecule in a host cell. In some embodiments, a backbone region, such as a "Baculovirus backbone region," includes one or more Baculovirus elements (e.g., a Baculovirus genome or a functional fragment thereof) suitable for replicating a nucleic acid construct, for example, in an insect cell (e.g., an Sf9 cell). In some embodiments, the backbone further includes a selection marker. In some embodiments, the nucleic acid molecule includes a genetic element region and a backbone region (e.g., a Baculovirus backbone region and / or a backbone region suitable for replicating in a bacterial cell).

[0162] As used herein, the term "bacmid" refers to a nucleic acid molecule that is suitable for replication in an insect cell and contains sufficient Baculovirus backbone elements such that it is further suitable for replication in a bacterial cell. In some embodiments, the nucleic acid molecule is suitable for replication in a bacterial cell (e.g., an E. coli cell, e.g., a DH 10Bac cell).

[0163] As used herein, a "circular" nucleic acid refers to a nucleic acid that forms a structure with no free 5' or 3' ends. In some embodiments, a circular nucleic acid is closed by covalent or non-covalent bonds. For example, a circular nucleic acid can be created by covalently linking the ends of a linear nucleic acid, for example, using a phosphate-sugar bond or a synthetic linker moiety. In other embodiments, a circular nucleic acid comprises two ends that are adjacent and not free (substantially inaccessible to exonucleases). For example, a circular nucleic acid can be created by hybridizing the ends of a linear nucleic acid directly or via a nucleic acid splint.

[0164] As used herein, a "DNA region" refers to a portion of a polynucleotide strand that includes multiple DNA nucleotides. For example, in some embodiments, a DNA region is multiple DNA nucleotides incorporated into an RNA strand. For example, a DNA region includes about 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 DNA nucleotides within a polynucleotide strand.

[0165] As used herein, a "nucleic acid that encodes" refers to a nucleic acid sequence that encodes an amino acid sequence or a polynucleotide, such as an mRNA or a functional polynucleotide (e.g., a non-coding RNA, such as an siRNA or miRNA).

[0166] As used herein, an "exogenous" agent (e.g., effector, nucleic acid (e.g., RNA), gene, payload, protein) refers to an agent not contained in or encoded by a corresponding wild-type virus, e.g., an Anellovirus described herein. In some embodiments, an exogenous agent is not naturally occurring, such as a protein or nucleic acid that has a sequence that is altered (e.g., by insertion, deletion, or substitution) relative to a naturally occurring protein or nucleic acid. In some embodiments, an exogenous agent is not naturally occurring in a host cell. In some embodiments, an exogenous agent is naturally occurring in a host cell but is exogenous to the virus. In some embodiments, an exogenous agent is naturally occurring in a host cell but not at a desired level or at a desired time.

[0167] A "heterologous" substance or element (e.g., effector, nucleic acid sequence, amino acid sequence), as used herein with respect to another substance or element (e.g., effector, nucleic acid sequence, amino acid sequence), refers to a substance or element that is not naturally present together in, for example, a wild-type virus, e.g., an Anellovirus. In some embodiments, a heterologous nucleic acid sequence can be present in the same nucleic acid as a naturally occurring nucleic acid sequence (e.g., a sequence that is naturally present in an Anellovirus). In some embodiments, a heterologous substance or element is exogenous to the Anellovirus that is the substrate for other (remaining) elements of the Anellovector.

[0168] As used herein, the term "genetic element" refers to a nucleic acid molecule that is or can be enclosed within a proteinaceous outer layer (e.g., protected from RNase digestion), for example to form an anaerovector as described herein. It is understood that a genetic element can be produced as naked RNA and, optionally, further assembled into a proteinaceous outer layer. It is also understood that an anaerovector can insert its genetic element into a cell, such that the genetic element resides within the cell, and therefore the proteinaceous outer layer does not necessarily enter the cell.

[0169] As used herein, "genetic element construct" refers to a nucleic acid construct (e.g. a plasmid, bacmid, donor vector, cosmid, or minicircle) that comprises a genetic element sequence or a fragment thereof. In some embodiments, a bacmid or donor vector as described herein is a genetic element construct that comprises a genetic element sequence or a fragment thereof.

[0170] As used herein, the term "genetic element region" refers to a region of a construct that includes the sequence of a genetic element. In some embodiments, the genetic element region includes a sequence with sufficient identity to a wild-type Anellovirus sequence or a fragment thereof that is enclosed by a proteinaceous outer layer, thereby forming an annelovector (e.g., a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a wild-type Anellovirus sequence or a fragment thereof). In some embodiments, the genetic element region includes a protein binding sequence (e.g., a 5'UTR, 3'UTR, and / or a GC-rich region as described herein, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto), e.g., as described herein. In some embodiments, the construct comprising the genetic element region is not enclosed in a proteinaceous outer layer, but the genetic element produced from the construct may be enclosed in a proteinaceous outer layer. In some embodiments, the construct comprising the genetic element region further comprises a vector backbone (e.g., a bacmid backbone or a donor vector backbone). In some embodiments, the construct (e.g., a bacmid) comprises one or more Baculovirus elements (e.g., a Baculovirus genome, e.g., comprising the genetic element region).

[0171] As used herein, the term "mutant," when used with respect to a genome (e.g., an Anellovirus genome) or a fragment thereof, refers to a sequence that has at least one change compared to the corresponding wild-type Anellovirus sequence. In some embodiments, a mutant genome or a fragment thereof comprises at least one single nucleotide polymorphism, addition, deletion, or frameshift compared to the corresponding wild-type Anellovirus sequence. In some embodiments, a mutant genome or a fragment thereof comprises a deletion of at least one Anellovirus ORF (e.g., one or more of ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2) compared to the corresponding wild-type Anellovirus sequence. In some embodiments, the mutant genome or fragment thereof comprises a deletion of all Anellovirus ORFs (e.g., all of ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and ORF1 / 2) compared to the corresponding wild-type Anellovirus sequence. In some embodiments, the mutant genome or fragment thereof comprises a deletion of at least one Anellovirus non-coding region (e.g., one or more of the 5'UTR, 3'UTR, and / or GC-rich region) compared to the corresponding wild-type Anellovirus sequence. In some embodiments, the mutant genome or fragment thereof comprises or encodes an exogenous effector.

[0172] As used herein, the term "ORF molecule" refers to a polypeptide having an activity and / or structural characteristics of an Anellovirus ORF protein (e.g., Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2 protein), or a functional fragment thereof. As used generally (i.e., "ORF molecule"), a polypeptide can include an activity and / or structural characteristics of any of the Anellovirus ORFs described herein (e.g., any of Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2), or a functional fragment thereof. When used in conjunction with a modifier indicating a particular open reading frame (e.g., "ORF1 molecule," "ORF2 molecule," "ORF2 / 2 molecule," "ORF2 / 3 molecule," "ORF1 / 1 molecule," or "ORF1 / 2 molecule"), this generally means that the polypeptide contains an activity and / or structural characteristics of the corresponding Anellovirus ORF protein, or a functional fragment thereof (e.g., as defined below for "ORF1 molecule"). For example, an "ORF2 molecule" contains an activity and / or structural characteristics of an Anellovirus ORF2 protein, or a functional fragment thereof.

[0173] As used herein, the term "ORF1 molecule" refers to a polypeptide having activity and / or structural characteristics of an Anellovirus ORF1 protein (e.g., an Anellovirus ORF1 protein described herein), or a functional fragment thereof. The ORF1 molecule, in some cases, comprises one or more (e.g., 1, 2, 3, or 4) of the following: a first region comprising at least 60% basic residues (e.g., at least 60% arginine residues), a second region comprising at least about 6 beta strands (e.g., at least 4, 5, 6, 7, 8, 9, 10, 11, or 12 beta strands), a third region comprising an Anellovirus N22 domain (e.g., as described herein, e.g., an N22 domain from an Anellovirus ORF1 protein described herein), and / or a fourth region comprising an Anellovirus C-terminal domain (CTD) (e.g., as described herein, e.g., a CTD from an Anellovirus ORF1 protein described herein). In some cases, the ORF1 molecule comprises, in order from the N-terminus to the C-terminus, the first, second, third, and fourth regions. In some cases, the anaerovector comprises an ORF1 molecule comprising, in order from N-terminus to C-terminus, a first, second, third, and fourth region. The ORF1 molecule may, in some cases, comprise a polypeptide encoded by an Anellovirus ORF1 nucleic acid. The ORF1 molecule may, in some cases, further comprise a heterologous sequence, e.g., a hypervariable region (HVR), e.g., an HVR from an Anellovirus ORF1 protein, e.g., as described herein. As used herein, "Anellovirus ORF1 protein" refers to an ORF1 protein having an amino acid sequence encoded by an Anellovirus genome (e.g., as described herein, e.g., a wild-type Anellovirus).

[0174] As used herein, an "ORF2 molecule" refers to a polypeptide having an activity and / or structural characteristics of an Anellovirus ORF2 protein (e.g., an Anellovirus ORF2 protein described herein), or a functional fragment thereof. As used herein, an "Anellovirus ORF2 protein" refers to an ORF2 protein having an amino acid sequence encoded by an Anellovirus genome (e.g., a wild-type Anellovirus, e.g., described herein).

[0175] As used herein, the term "proteinaceous outer layer" refers to an outer component that is primarily (e.g., >50%, >60%, >70%, >80%, >90%) protein.

[0176] As used herein, the term "regulatory nucleic acid" refers to a nucleic acid sequence that modulates the expression, e.g., transcription and / or translation, of a DNA sequence that encodes an expression product. In some embodiments, the expression product comprises an RNA or a protein.

[0177] As used herein, the term "regulatory sequence" refers to a nucleic acid sequence that modulates the transcription of a target gene product. In some embodiments, a regulatory sequence is a promoter or enhancer.

[0178] As used herein, a "substantially non-pathogenic" organism, particle, or construct refers to, for example, an organism, particle (e.g., a virus or anellovector, as described herein, for example), or construct thereof, that does not induce or induce an unacceptable disease or pathology in a host organism, e.g., a mammal, e.g., a human. In some embodiments, administration of an anellovector to a subject may result in some reactions or side effects that are acceptable as part of standard treatment.

[0179] As used herein, "non-pathogenic" refers to an organism or component thereof that does not induce or cause an undesirable condition (e.g., disease or pathology) in a host organism, e.g., a mammal, e.g., a human.

[0180] As used herein, a "substantially non-integrating" genetic element refers to a genetic element, e.g., a genetic element within a virus or anellovector (e.g., those described herein), in which less than about 0.01%, 0.05%, 0.1%, 0.5%, or 1% of the genetic elements entering a host cell (e.g., a eukaryotic cell) or organism (e.g., a mammal, e.g., a human) are integrated into the genome. In some embodiments, the genetic element is not detectably integrated, e.g., into the genome of the host cell. In some embodiments, integration of the genetic element into the genome can be detected using techniques described herein, e.g., nucleic acid sequencing, PCR detection, and / or nucleic acid hybridization. In some embodiments, integration frequency is determined by quantitative gel purification assay of genomic DNA isolated from free vector, e.g., as described in Wang et al. (2004, Gene Therapy 11:711-721, incorporated herein by reference in its entirety).

[0181] As used herein, a "substantially non-immunogenic" organism, particle, or construct refers to an organism, particle (e.g., a virus or anaerovector, as described herein, for example), or construct thereof, that does not induce or induce an unwanted or non-targeted immune response in a host tissue or organism (e.g., a mammal, e.g., a human). In some embodiments, a substantially non-immunogenic organism, particle, or construct does not generate a clinically significant immune response. In some embodiments, a substantially non-immunogenic anaerovector does not generate a clinically significant immune response against a protein that comprises an amino acid sequence encoded by a nucleic acid sequence of the anaerovector or an anaerovector genetic element. In some embodiments, an immune response (e.g., an unwanted or non-targeted immune response) is determined by assaying the subject for the presence or level of antibodies (e.g., the presence or level of anti-anellovector antibodies, e.g., the presence or level of antibodies (e.g., neutralizing antibodies) against an anaellovector described herein), for example, according to the anti-TTV antibody detection methods described in Tsuda et al. (1999; J. Virol. Methods 77:199-206; incorporated herein by reference) and / or the methods for measuring anti-TTV IgG levels described in Kakkola et al. (2008; Virology 382:182-189; incorporated herein by reference). Antibodies (e.g., neutralizing antibodies) against anellovirus or anellovectors based thereon can also be detected by methods in the art for detecting anti-viral antibodies, such as the methods for detecting anti-AAV antibodies described in Calcedo et al. (2013; Front. Immunol. 4(341):1-7; incorporated herein by reference).

[0182] As used herein, a "subsequence" refers to a nucleic acid sequence or amino acid sequence contained within a larger nucleic acid sequence or amino acid sequence, respectively. In some cases, a subsequence may comprise a domain or functional fragment of the larger sequence. In some cases, a subsequence may comprise a fragment of the larger sequence that, when isolated from the larger sequence, can form a secondary and / or tertiary structure similar to the secondary and / or tertiary structure formed by the subsequence when present with the remainder of the larger sequence. In some cases, a subsequence can be replaced with another sequence (e.g., a subsequence that comprises a foreign or heterologous sequence relative to the remainder of the larger sequence, e.g., a corresponding subsequence from a different Anellovirus).

[0183] The present invention generally relates to anaerovectors, e.g., synthetic anaerovectors, and uses thereof. The present disclosure provides anaerovectors, compositions comprising anaerovectors, and methods of making or using anaerovectors. Anellovectors are generally useful as delivery vehicles, for example, for delivering therapeutic agents to eukaryotic cells. In general, an anaerovector as described herein may contain a genetic element comprising an RNA sequence (e.g., an RNA sequence encoding an effector, e.g., an exogenous effector or an endogenous effector) encased in a proteinaceous outer layer. An anaerovector may comprise one or more deletions of a sequence (e.g., a region or domain as described herein) compared to an anaerovirus sequence (e.g., as described herein). An anaerovector can be used as a substantially non-immunogenic vehicle for delivering a genetic element, or an effector encoded therein (e.g., a polypeptide or nucleic acid effector as described herein, for example) to a eukaryotic cell, for example, to treat a disease or disorder in a subject comprising the cell.

[0184] table of contents I. Compositions and methods for generating anellovectors by in vitro assembly A. Constructs and Assembly of Anellovectors i. ORF1 molecule for assembly of anellovector ii. ORF2 molecule for assembly of annelovector B. Genetic elements i. RNA-containing genetic elements A RNA-only genetic element B Hybridized RNA-ssDNA genetic elements c RNA / DNA complex C. Genetic element constructs D. Production of RNA-Based Genetic Elements E. Production of protein components i. Baculovirus Expression System ii. Insect cell system iii.Mammalian cell lines F. Effector G. In Vitro Assembly Method H. Concentration and Purification II. Anellovector A. Anellovirus B.ORF1 molecule C.ORF2 molecule D. Genetic elements E. Protein Binding Sequences F.5'UTR region G.GC rich region H. Effector I. Regulatory Sequences J. Other Sequences K. Proteinaceous outer layer III.How to use IV. Administration / Delivery

[0185] I. Compositions and methods for generating anellovectors by in vitro assembly The present disclosure provides, in some aspects, compositions and methods that can be used to produce anaerovectors, e.g., anaerovectors having genetic elements comprising RNA as described herein. In some embodiments, the compositions and methods described herein can be used to produce genetic elements or genetic element constructs. In some embodiments, the compositions and methods described herein can be used to produce genetic elements or genetic element constructs by in vitro assembly. In some embodiments, the compositions and methods described herein can be used to produce one or more Anellovirus ORF molecules (e.g., ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1 or ORF1 / 2 molecules, or functional fragments or splice variants thereof). In some embodiments, the compositions and methods described herein can be used to produce a proteinaceous outer layer or a component thereof (e.g., an ORF1 molecule), for example, in a host cell (e.g., an insect cell, e.g., an Sf9 cell).

[0186] Construct and assembly of anellovectors The compositions and methods herein can be used to produce anaerovectors. As described herein, anaerovectors generally comprise genetic elements (e.g., RNA molecules) enclosed within a proteinaceous outer layer (e.g., comprising a polypeptide encoded by an Anellovirus ORF1 nucleic acid (e.g., as described herein). In some embodiments, the genetic elements comprise one or more sequences encoding an Anellovirus ORF (e.g., one or more of Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2). As used herein, an Anellovirus ORF or ORF molecule (e.g., Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2) comprises a polypeptide comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a corresponding Anellovirus ORF sequence, e.g., as described in PCT / US2018 / 037379 or PCT / US19 / 65995, each of which is incorporated by reference in its entirety. In some embodiments, the genetic element comprises a sequence encoding Anellovirus ORF1, or a splice variant or functional fragment thereof (e.g., a jellyroll region, e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises a polypeptide encoded by an Anellovirus ORF1 nucleic acid (eg, an Anellovirus ORF1 molecule or a splice variant or functional fragment thereof).

[0187] In some embodiments, an annelovector is constructed by encapsulating genetic elements (e.g., as described herein) within a proteinaceous envelope (e.g., as described herein). In some embodiments, the genetic elements are encapsulated within the proteinaceous envelope of a host cell (e.g., an insect cell, e.g., an Sf9 cell). In some embodiments, the host cell expresses one or more polypeptides (e.g., a polypeptide encoded by an Anellovirus ORF1 nucleic acid, e.g., an ORF1 molecule) comprised in the proteinaceous envelope. For example, in some embodiments, the host cell comprises a nucleic acid sequence encoding an Anellovirus ORF1 molecule, e.g., a splice variant or functional fragment of an Anellovirus ORF1 polypeptide (e.g., a wild-type Anellovirus ORF1 protein, or a polypeptide encoded by a wild-type Anellovirus ORF1 nucleic acid, e.g., as described herein). In some embodiments, the nucleic acid sequence encoding the Anellovirus ORF1 molecule is contained in a nucleic acid construct (e.g., a plasmid, a viral vector, a virus, a minicircle, a bacmid, or an artificial chromosome) contained in the host cell. In some embodiments, the nucleic acid sequence encoding the Anellovirus ORF1 molecule is integrated into the genome of the host cell.

[0188] In some embodiments, the host cell comprises a nucleic acid construct comprising a genetic element and / or a sequence of a genetic element. In some embodiments, the nucleic acid construct is selected from a plasmid, a viral nucleic acid, a minicircle, a bacmid, or an artificial chromosome. In some embodiments, the genetic element is excised from the nucleic acid construct (e.g., a bacmid) and optionally converted (e.g., by denaturation) from a double-stranded form to a single-stranded form. In some embodiments, the genetic element is generated by a polymerase based on a template sequence in the nucleic acid construct (e.g., a bacmid). In some embodiments, the polymerase produces a single-stranded copy of the genetic element sequence, which can optionally be circularized to form a genetic element as described herein.

[0189] In some embodiments, the host cell comprises a genetic element construct (e.g., a bacmid, a plasmid, or a minicircle) and the bacmid comprising one or more sequences encoding an Anellovirus ORF molecule (e.g., ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, and / or ORF1 / 2 ORF molecules) or a functional fragment thereof. In some embodiments, a proteinaceous outer layer protein is expressed from the bacmid. In embodiments, the proteinaceous outer layer protein expressed from the bacmid encapsulates the genetic element, thereby forming an anellovector. In some embodiments, the bacmid comprises a backbone suitable for replication of the nucleic acid construct in an insect cell (e.g., an Sf9 cell), e.g., a Baculovirus backbone region. In some embodiments, the bacmid comprises a backbone region suitable for replication of the genetic element construct in a bacterial cell (e.g., an E. coli cell, e.g., a DH10Bac cell). In some embodiments, the genetic element construct comprises a backbone suitable for replication of the nucleic acid construct in an insect cell (e.g., an Sf9 cell), such as a Baculovirus backbone region. In some embodiments, the genetic element construct comprises a backbone region suitable for replication of the genetic element construct in a bacterial cell (e.g., an E. coli cell, such as a DH10Bac cell). In some embodiments, the bacmid is introduced into the host cell via a Baculovirus particle. In some embodiments, the bacmid is produced by a producer cell, such as an insect cell (e.g., an Sf9 cell) or a bacterial cell (e.g., an E. coli cell, such as a DH10Bac cell). In some embodiments, the producer cell comprises the bacmid and / or donor vector, for example as described herein. In some embodiments, the producer cell further comprises sufficient cellular machinery for replication of the bacmid vector and / or donor vector.

[0190] For example, the ORF1 molecule for the assembly of an annelovector Anellovectors can be generated, for example, by encapsulating genetic elements within a proteinaceous envelope. In some embodiments, encapsulation occurs in a cell-free system or within a cell. The proteinaceous envelope of an anaellovector generally comprises a polypeptide encoded by an Anellovirus ORF1 nucleic acid (e.g., an Anellovirus ORF1 molecule or a splice variant or functional fragment thereof, e.g., as described herein). The ORF1 molecule, in some embodiments, may comprise one or more of the following: a first region comprising an arginine-rich region, e.g., a region having at least 60% basic residues (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% basic residues; e.g., 60%-90%, 60%-80%, 70%-90%, or 70-80% basic residues), and a second region comprising a jelly-roll domain, e.g., at least six beta strands (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12 beta strands). In some embodiments, the proteinaceous outer layer comprises one or more (e.g., one, two, three, four, or all five) of the Anellovirus ORF1 arginine-rich region, jelly-roll region, N22 domain, hypervariable region, and / or C-terminal domain. In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 jellyroll region (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 arginine-rich region (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 N22 domain (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus hypervariable region (e.g., as described herein). In some embodiments, the proteinaceous outer layer comprises an Anellovirus ORF1 C-terminal domain (e.g., as described herein).

[0191] In some embodiments, the anaerovector comprises an ORF1 molecule and / or a nucleic acid encoding an ORF1 molecule. Generally, the ORF1 molecule comprises a polypeptide having the structural features and / or activity of an Anellovirus ORF1 protein (e.g., an Anellovirus ORF1 protein described herein), or a functional fragment thereof. In some embodiments, the ORF1 molecule comprises a truncation relative to an Anellovirus ORF1 protein (e.g., an Anellovirus ORF1 protein described herein). In some embodiments, the ORF1 molecule is truncated by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 amino acids of an Anellovirus ORF1 protein. In some embodiments, the ORF1 molecule comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to an Alphatorquevirus, Betatorquevirus, or Gammatorquevirus ORF1 protein, e.g., as described herein. The ORF1 molecule is generally capable of binding to DNA (e.g., a genetic element, e.g., as described herein). In some embodiments, the ORF1 molecule is localized to the nucleus of the cell. In certain embodiments, the ORF1 molecule is localized to the nucleolus.

[0192] Without intending to be bound by theory, an ORF1 molecule can bind to other ORF1 molecules to form, for example, a proteinaceous outer layer (e.g., as described herein). Such an ORF1 molecule may be described as having the ability to form an encapsid. In some embodiments, the proteinaceous outer layer can entrap a nucleic acid molecule (e.g., a genetic element described herein). In some embodiments, multiple ORF1 molecules can form multimers to, for example, generate a proteinaceous outer layer. In some embodiments, the multimers can be homomultimers. In other embodiments, the multimers can be heteromultimers.

[0193] For example, for the assembly of annelovectors, the ORF2 molecule Production of an anaerovector using the compositions or methods described herein may involve expression of an Anellovirus ORF2 molecule (e.g., as described herein), or a splice variant or functional fragment thereof. In some embodiments, an anaerovector comprises an ORF2 molecule, or a splice variant or functional fragment thereof, and / or a nucleic acid encoding an ORF2 molecule, or a splice variant or functional fragment thereof. In some embodiments, an anaerovector does not comprise an ORF2 molecule, or a splice variant or functional fragment thereof, and / or a nucleic acid encoding an ORF2 molecule, or a splice variant or functional fragment thereof. In some embodiments, production of an anaerovector involves expression of an ORF2 molecule, or a splice variant or functional fragment thereof, but the ORF2 molecule is not incorporated into the anaerovector.

[0194] Genetic elements RNA-containing genetic elements In some embodiments, the genetic element is or comprises a nucleic acid. In some embodiments, the genetic element is a single stranded polynucleotide. In some embodiments, the genetic element comprises one or more double stranded regions. In some embodiments, the genetic element comprises RNA. In some embodiments, the genetic element comprises an RNA hairpin structure. In some embodiments, the genetic element is an mRNA, e.g., a chemically modified mRNA. In some embodiments, the genetic element is at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% RNA. In some embodiments, the genetic element comprises a DNA strand and an RNA strand, e.g., at least a portion of the DNA strand hybridizes to at least a portion of the RNA strand.

[0195] In some embodiments, the genetic element does not encode any of Anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3.

[0196] In some embodiments, the RNA genetic element encodes an effector, e.g., an effector protein.

[0197] In some embodiments, the RNA genetic element is or includes an effector, e.g., functional RNA. In some embodiments, the RNA is selected from the group consisting of mRNA, rRNA, tRNA (e.g., TREM), regulatory RNA, non-coding RNA, long non-coding RNA (lncRNA), circular RNA (circRNA), double-stranded RNA (dsRNA), guide RNA (gRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), piwi-binding RNA (piRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), extracellular RNA (exRNA), Cajal body-specific small RNA (scaRNA), microRNA (miRNA), and other RNAi molecules.

[0198] In some embodiments, the genetic element comprises an RNA, for example, a chemically modified RNA. In some embodiments, one or more nucleotides of the RNA of the genetic element are chemically modified. In some embodiments, the RNA comprises one or more chemical modifications to one or more bases. In some embodiments, the RNA comprises one or more chemical modifications to one or more sugars. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of the RNA of the genetic element are chemically modified. In some embodiments, the RNA comprises one or more backbone modifications. In some embodiments, the modifications comprise non-naturally occurring modifications, for example, modifications set forth in any one of Tables 5-9. Non-naturally occurring modifications can be made according to methods known in the art.

[0199] In some embodiments the genetic elements described herein comprise a non-naturally occurring modification provided in Table 5, or a combination thereof.

[0200] [Table 1]

[0201] [Table 2]

[0202] [Table 3]

[0203] [Table 4]

[0204] [Table 5]

[0205]

Table 6

[0206]

Table 7

[0207]

Table 8

[0208]

Table 9

[0209]

Table 10

[0210]

Table 11

[0211]

Table 12

[0212]

Table 13

[0213]

Table 14

[0214]

Table 15

[0215]

Table 16

[0216] [Table 17]

[0217] [Table 18]

[0218] [Table 19]

[0219] In some embodiments, the genetic elements described herein comprise a modification provided in Table 6, or a combination thereof. The modifications provided in Table 6 occur naturally in RNA and may be used in the genetic elements herein at non-naturally occurring positions.

[0220] [Table 20]

[0221] [Table 21]

[0222] [Table 22]

[0223] [Table 23]

[0224] [Table 24]

[0225] In one embodiment the genetic elements described herein comprise a non-naturally occurring modification provided in Table 7, or a combination thereof.

[0226] [Table 25]

[0227] [Table 26]

[0228] [Table 27]

[0229] [Table 28]

[0230] In one embodiment the genetic elements described herein comprise a non-naturally occurring modification provided in Table 8, or a combination thereof.

[0231] [Table 29]

[0232] In one embodiment the genetic elements described herein comprise a non-naturally occurring modification provided in Table 9, or a combination thereof.

[0233] [Table 30]

[0234] In some embodiments, the genetic element comprises a cap. The cap is typically placed at the 5' end of the mRNA, but can also be placed at the 3' end of the RNA. In some embodiments, the cap protects the genetic element from exonuclease degradation and can aid in delivery and / or localization within a cell. The cap can be present at the 5' end (5' cap) or the 3' end (3' cap), or at both ends. Non-limiting examples of 5'-caps include glyceryl, inverted deoxy abasic residues (moieties); 4',5'-methylene nucleotides; 1-(beta-D-erythrofuranosyl) nucleotides, 4'-thionucleotides; carbocyclic nucleotides; 1,5-anhydrohexitol nucleotides; L-nucleotides; alpha nucleotides; modified base nucleotides; phosphorodithioate linkages; threo-pentofuranosyl nucleotides; acyclic 3',4'-seconucleotides; acyclic 3,4-dihydro These include, but are not limited to, 3'-3'-inverted nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol phosphate; 3'-phosphoramidate; hexyl phosphate; aminohexyl phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate; or a bridged or non-bridged methylphosphonate moiety.

[0235] Non-limiting examples of 3'-caps include glyceryl, inverted deoxy abasic residues (moieties), 4',5'-methylene nucleotides; 1-(beta-D-erythrofuranosyl) nucleotides; 4'-thionucleotides, carbocyclic nucleotides; 5'-amino-alkyl phosphates; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotides; L-nucleotides; alpha nucleotides; modified base nucleotides; phosphorodithioates; threo-pentofuranosyl nucleotides. bridged and / or non-bridged 5'-phosphoramidates, phosphorothioates and / or phosphorodithioates, bridged or non-bridged methylphosphonates, and 5'-mercapto moieties (for further details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925; incorporated herein by reference).

[0236] In some embodiments, the genetic element comprises a poly-A tail. In some embodiments, the poly-A tail comprises at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 adenosines in length. In some embodiments, the RNA lacks a poly-A tail. In some embodiments, when the RNA lacks a poly-A tail, the RNA comprises no more than about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 consecutive adenosines.

[0237] In some embodiments, the genetic element is linear. In some embodiments, the genetic element is circular. In some embodiments, the genetic element comprises a first region and a second region capable of hybridizing with the first region. In some embodiments, the genetic element comprises a first region and a second region capable of hybridizing with the first region to form a circle. In some embodiments, the genetic element does not comprise a 5' end or a 3' end. In some embodiments, the genetic element does not comprise one or both of a free phosphate and a free sugar. In some embodiments, every phosphate in the genetic element is covalently bound to a first sugar by a first oxygen atom in the phosphate and to a second sugar by a second oxygen atom in the phosphate. In some embodiments, every sugar in the genetic element is covalently bound to a first phosphate by a first carbon atom in the sugar and to a second phosphate by a second carbon atom in the sugar. In some embodiments, the genetic element is produced by circularizing linear RNA. Circular RNAs are described, for example, in US Patent Publication No. 20200306286, which is incorporated by reference in its entirety.

[0238] In some embodiments the genetic element is about 10-20, 20-30, 30-40, 50-60 60-70, 70-80, 80-90, 90-100, 100-125, 125-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, or 4000-4500 nucleotides in length. In some embodiments the genetic element is at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, or 4500 nucleotides in length.

[0239] RNA-only genetic elements In some embodiments, the genetic element consists or consists essentially of RNA. For example, in some embodiments, the genetic element is substantially free of DNA. In some embodiments, the genetic element comprises single stranded RNA. In some embodiments, the genetic element comprises at least one double stranded region. In some embodiments, the double stranded region of the genetic element comprises a region of RNA that pairs with RNA.

[0240] Hybridized RNA-ssDNA genetic elements In some embodiments, the genetic element comprises a DNA region. In some embodiments, the genetic element comprising RNA further comprises a DNA region. For example, the genetic element may be single-stranded, where a first portion of the single strand comprises ribonucleotides and a second portion of the single strand comprises deoxyribonucleotides. In some embodiments, the genetic element comprising a DNA region comprises one or more DNA nucleotides that are chemically modified. In some embodiments, the genetic element comprises a DNA region, where all nucleotides of the DNA region are chemically modified.

[0241] In some embodiments, at least a portion of the genetic element is single stranded. In some embodiments, the genetic element is single stranded. In some embodiments, the genetic element comprises ssDNA. In some embodiments, the genetic element comprises a double stranded region. In some embodiments, the double stranded region of the genetic element comprises a region of RNA that pairs with the RNA. In some such embodiments, the double stranded region of the genetic element comprises a region of DNA that pairs with the RNA. In some embodiments, at least a portion of the DNA region hybridizes to at least a portion of the RNA of the genetic element.

[0242] In some embodiments, the DNA region is about 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1000 nucleotides in length.

[0243] RNA / DNA complex In some embodiments, the genetic element comprises a DNA region. In some embodiments, the genetic element comprising RNA further comprises a DNA region. In some embodiments, the genetic element comprising a DNA region comprises one or more DNA nucleotides that are chemically modified. In some embodiments, the genetic element comprises a DNA region, wherein all nucleotides of the DNA region are chemically modified.

[0244] In some embodiments, at least a portion of the genetic element is single stranded. In some embodiments, the genetic element is single stranded. In some embodiments, the genetic element comprises ssDNA. In some embodiments, the genetic element comprises a double stranded region. In some embodiments, the double stranded region of the genetic element comprises a region of RNA that pairs with the RNA. In some such embodiments, the double stranded region of the genetic element comprises a region of DNA that pairs with the RNA. In some embodiments, when the genetic element comprises RNA, the DNA region is covalently linked to the RNA of the genetic element.

[0245] In some embodiments, the DNA region is about 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1000 nucleotides in length.

[0246] Genetic element constructs In some embodiments the genetic element is produced from a genetic element construct, for example in some embodiments the genetic element construct is DNA, for example double stranded DNA, and the genetic element may be produced by transcription to generate an RNA genetic element.

[0247] Genetic elements of an anaerovector as described herein may be produced from a genetic element construct comprising a genetic element region and optionally other sequences such as a bacmid (e.g. a Baculovirus genome or fragment thereof, e.g. comprising one or more Baculovirus elements) or a donor vector backbone. In some embodiments the genetic element construct comprises an Anellovirus 5'UTR (e.g. as described herein). The genetic element construct may be any nucleic acid construct suitable for delivery of the sequence of the genetic element to a host cell or cell-free system capable of encapsulating the genetic element within a proteinaceous outer layer. In some embodiments the genetic element construct comprises a promoter. In some embodiments transcription from the genetic element construct produces an RNA genetic element.

[0248] In some embodiments the genetic element construct is a linear nucleic acid molecule. In some embodiments the genetic element construct is a circular nucleic acid molecule (e.g. a plasmid, bacmid, donor vector, or minicircle, e.g. as described herein). In some embodiments the genetic element construct may be double stranded. In other embodiments the genetic element is single stranded. In some embodiments the genetic element construct comprises DNA. In some embodiments the genetic element construct comprises RNA. In some embodiments the genetic element construct comprises one or more modified nucleotides.

[0249] Plasmids In some embodiments, the genetic element construct is a plasmid. A plasmid generally comprises a sequence of genetic elements as described herein, as well as an origin of replication suitable for replication in a host cell (e.g., a bacterial origin of replication for replication in a bacterial cell) and a selection marker (e.g., an antibiotic resistance gene). In some embodiments, the sequence of the genetic elements can be excised from the plasmid. In some embodiments, the plasmid can replicate in a bacterial cell. In some embodiments, the plasmid can replicate in a mammalian cell (e.g., a human cell). In some embodiments, the plasmid is at least 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 bp in length. In some embodiments, the plasmid is less than 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10,000 bp in length. In some embodiments, the plasmid is 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-4000, or 4000-5000 bp in length.

[0250] Small circular nucleic acid constructs In some embodiments, the genetic element construct is a circular nucleic acid construct, e.g., lacking a vector backbone (e.g., lacking a bacterial origin of replication and / or a selection marker). In embodiments, the genetic element is a single-stranded or double-stranded circular nucleic acid construct. In embodiments, the circular nucleic acid construct is produced by in vitro circularization (IVC), e.g., as described herein. In embodiments, the double-stranded circular nucleic acid construct can be introduced into a host cell, which can be converted into or used as a template to produce a single-stranded circular genetic element, e.g., as described herein. In some embodiments, the circular nucleic acid construct does not comprise a plasmid backbone or a functional fragment thereof. In some embodiments, the circular nucleic acid construct is at least 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, or 4500 bp in length. In some embodiments, the circular nucleic acid construct is less than 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5500, or 6000 bp in length. In some embodiments, the circular nucleic acid construct is 2000-2100, 2100-2200, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700-2800, 2800-2900, 2900-3000, 3000-3100, 3100-3200, The length is 3200-3300, 3300-3400, 3400-3500, 3500-3600, 3600-3700, 3700-3800, 3800-3900, 3900-4000, 4000-4100, 4100-4200, 4200-4300, 4300-4400, or 4400-4500 bp. In some embodiments, the circular nucleic acid construct is a minicircle.

[0251] Cis / trans constructs In some embodiments, a genetic element construct as described herein (e.g. a bacmid or donor vector) comprises one or more sequences encoding one or more Anellovirus ORFs, e.g. a proteinaceous outer layer component (e.g. a polypeptide encoded by an Anellovirus ORF1 nucleic acid, e.g. as described herein). For example, a genetic element construct may comprise a nucleic acid sequence encoding an Anellovirus ORF1 molecule. Such a genetic element construct may be suitable for introducing the genetic element and an Anellovirus ORF in cis into a host cell. In other embodiments, a genetic element construct as described herein does not comprise a sequence encoding one or more Anellovirus ORFs, e.g. a proteinaceous outer layer component (e.g. a polypeptide encoded by an Anellovirus ORF1 nucleic acid, e.g. as described herein). For example, the genetic element construct may not include a nucleic acid sequence encoding an Anellovirus ORF1 molecule. Such a genetic element construct may be suitable for introducing a genetic element into a host cell in which one or more Anellovirus ORFs are provided in trans (e.g. via the introduction of a second nucleic acid construct encoding one or more Anellovirus ORFs, or via an Anellovirus ORF cassette integrated into the genome of the host cell). In some embodiments, the genetic element construct comprises a backbone suitable for replication of the nucleic acid construct in an insect cell (e.g. Sf9 cells), for example a Baculovirus backbone region. In some embodiments, the genetic element construct comprises a backbone region suitable for replication of the genetic element construct in a bacterial cell (e.g. E. coli cells, e.g. DH10Bac cells).

[0252] In some embodiments, the genetic element construct (e.g. bacmid or donor vector) comprises a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g. a jelly roll region, e.g. as described herein). In embodiments, the portion of the genetic element that does not comprise the sequence of the genetic element comprises a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g. in a cassette comprising a promoter and a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof). In further embodiments, the portion of the construct that comprises the sequence of the genetic element comprises a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g. a jelly roll region, e.g. as described herein). In some embodiments, encasement of such genetic elements in a proteinaceous outer layer (e.g., as described herein) produces a replication-competent anaellovector (e.g., an anaellovector that, upon infection of a cell, enables the cell to produce additional copies of the anaellovector without introducing into the cell additional nucleic acid constructs encoding, e.g., one or more Anellovirus ORFs as described herein).

[0253] In other embodiments, the genetic element does not include a sequence encoding an Anellovirus ORF1 molecule, or a splice variant or functional fragment thereof (e.g., a jellyroll region, e.g., as described herein). In some embodiments, the confinement of such genetic elements in a proteinaceous outer layer (e.g., as described herein) produces a replication-incompetent anaerovector (e.g., an anaerovector that, upon infection of a cell, does not allow the infected cell to produce additional anaerovectors, e.g., in the absence of one or more additional constructs, e.g., encoding one or more Anellovirus ORFs, e.g., as described herein).

[0254] Expression cassette In some embodiments, the genetic element construct (e.g., a bacmid or donor vector) comprises one or more cassettes for expression of a polypeptide or a non-coding RNA (e.g., miRNA or siRNA). In some embodiments, the genetic element construct comprises a cassette for expression of an effector (e.g., an exogenous or endogenous effector), e.g., a polypeptide or a non-coding RNA, as described herein. In some embodiments, the genetic element construct comprises a cassette for expression of an Anellovirus protein (e.g., Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment thereof). In some embodiments, the expression cassette may be located within the genetic element sequence. In embodiments, an expression cassette for an effector is located within the genetic element sequence. In embodiments, an expression cassette for an Anellovirus protein is located within the genetic element sequence. In other embodiments, the expression cassette is located at a position within the genetic element construct outside the sequence of the genetic elements (e.g., in the backbone).In some embodiments, the expression cassette for an Anellovirus protein is located at a position within the genetic element construct outside the sequence of the genetic elements (e.g., in the backbone).

[0255] A polypeptide expression cassette generally includes a promoter and a coding sequence encoding a polypeptide, e.g., an effector (e.g., an exogenous or endogenous effector as described herein) or an Anellovirus protein (e.g., a sequence encoding Anellovirus ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment thereof). Exemplary promoters that can be included in a polypeptide expression cassette (e.g., to drive expression of a polypeptide) include, for example, constitutive promoters (e.g., CMV, RSV, PGK, EF1a, or SV40), cell or tissue specific promoters (e.g., skeletal alpha-actin promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, hepatic albumin promoter, Hepatitis B virus core promoter, osteocalcin promoter, bone sialoprotein promoter, CD2 promoter, or a sequence encoding an Anellovirus protein (e.g., a sequence encoding an Anellovirus protein, e ... Examples of promoters that can be used include, but are not limited to, an enhancer, such as a chromosome-inducing promoter, an immunoglobulin heavy chain promoter, a T cell receptor chain promoter, a neuron-specific enolase (NSE) promoter, or a neurofilament light chain promoter, and an inducible promoter (e.g., a zinc-inducible sheep metallothionine (MT) promoter, a dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; a T7 polymerase promoter system, a tetracycline-repressible system, a tetracycline-inducible system, a RU486-inducible system, a rapamycin-inducible system). In some embodiments, the expression cassette further comprises an enhancer, e.g., as described herein.

[0256] Production of RNA-based genetic elements RNA-based genetic elements can be produced by a variety of methods. For example, a DNA-containing genetic element construct can be transcribed to produce an RNA-containing genetic element, for example as described above. Transcription can occur, for example, within a cell or in a cell-free system. RNA can be synthesized in vitro, for example by solid phase synthesis.

[0257] Protein component production The protein components of the annellvector, e.g., ORF1, can be produced in a variety of ways as described herein.

[0258] Baculovirus Expression System Viral expression systems, such as the Baculovirus expression system, can be used to express proteins (e.g., for the production of anellovectors), e.g., as described herein. Baculoviruses are rod-shaped viruses with a circular, supercoiled, double-stranded DNA genome. The genus Baculovirus includes Alphabaculovirus (Nucleopolyhedrovirus (NPV) isolated from Lepidoptera), Betabaculovirus (Granulovirus (GV) isolated from Lepidoptera), Gammabaculovirus (NPV isolated from Hymenoptera), and Deltabaculovirus (NPV isolated from Diptera). GVs typically contain only one nucleocapsid per envelope, while NPVs typically contain single (SNPV) or multiple (MNPV) nucleocapsids per envelope. The enveloped virion is further embedded in a granulin matrix in GVs and polyhedrin in NPVs. Baculoviruses typically have both lytic and embedded life cycles. In some embodiments, the lytic and embedded life cycles appear independently throughout three stages of viral replication: early, late, and late. In some embodiments, in the early stage, viral DNA replication occurs following virus entry into the host cell, early viral gene expression, and cessation of the host gene expression machinery. In some embodiments, in the late stage, late genes encoding viral DNA replication are expressed, viral particles are assembled, and extracellular virus (EV) is produced by the host cell. In some embodiments, in the late stage, polyhedrin and p10 genes are expressed, and occluded virus (OV) is produced by the host cell, resulting in host cell lysis.Baculovirus infects insect species and can therefore be used as a biological agent to produce foreign proteins in permissive insect cells or larvae. Different isolates of Baculovirus, such as Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) and Bombyx mori nuclear polyhedrosis virus (BmNPV), can be used for foreign protein expression. Various baculovirus expression systems are commercially available, for example from ThermoFisher.

[0259] In some embodiments, a protein described herein (e.g., an Anellovirus ORF molecule, e.g., ORF1, ORF2, ORF2 / 2, ORF2 / 3, ORF1 / 1, or ORF1 / 2, or a functional fragment or splice variant thereof) can be expressed using a Baculovirus expression vector (e.g., a bacmid) that includes one or more components described herein. For example, a Baculovirus expression vector can include one or more (e.g., all) of a selection marker (e.g., kanR), an origin of replication (e.g., one or both of a bacterial origin of replication and an insect origin of replication), a recombinase recognition site (e.g., att sites), and a promoter. In some embodiments, a Baculovirus expression vector (e.g., a bacmid as described herein) can be produced by replacing the naturally occurring wild-type polyhedrin gene that encodes the Baculovirus occlusion body with a gene encoding a protein described herein. In some embodiments, genes encoding proteins described herein are cloned into a Baculovirus expression vector (e.g., a bacmid as described herein) that contains a Baculovirus promoter. In some embodiments, the Baculovirus vector comprises one or more non-Baculovirus promoters, e.g., a mammalian promoter or an Anellovirus promoter. In some embodiments, genes encoding proteins described herein are cloned into a donor vector (e.g., as described herein), which is then contacted with an empty Baculovirus expression vector (e.g., an empty bacmid) such that genes encoding proteins described herein are transferred (e.g., by homologous recombination or transposase activity) from the donor vector to the Baculovirus expression vector (e.g., the bacmid).In some embodiments, the Baculovirus promoter flanks the Baculovirus DNA from the non-essential polyhedrin locus. In some embodiments, the proteins described herein are under the transcriptional control of the AcNPV polyhedrin promoter late in viral replication. In some embodiments, strong promoters suitable for use in Baculovirus expression in insect cells include, but are not limited to, the Baculovirus p10 promoter, the polyhedrin (polh) promoter, the p6.9 promoter, and the capsid protein promoter. Weak promoters suitable for use in Baculovirus expression in insect cells include the Baculovirus ie1, ie2, ie0, et1, 39K (also known as pp31), and gp64 promoters.

[0260] In some embodiments, recombinant Baculovirus is produced by homologous recombination between a Baculovirus genome (e.g., a wild-type or mutant Baculovirus genome) and a transfer vector. In some embodiments, one or more genes encoding a protein described herein are cloned into the transfer vector. In some embodiments, the transfer vector further contains a Baculovirus promoter flanked by DNA from a non-essential locus, e.g., the polyhedrin gene. In some embodiments, one or more genes encoding a protein described herein are inserted into the Baculovirus genome by homologous recombination between the Baculovirus genome and the transfer vector. In some embodiments, the Baculovirus genome is linearized at one or more unique sites. In some embodiments, the linearization site is located near a target site for inserting a gene encoding a protein described herein into the Baculovirus genome. In some embodiments, a linearized Baculovirus genome lacking a fragment of the Baculovirus genome downstream of a gene, e.g., the polyhedrin gene, can be used for homologous recombination. In some embodiments, the baculovirus genome and the transfer vector are co-transfected into an insect cell. In some embodiments, a method for producing a recombinant baculovirus includes preparing a baculovirus genome for homologous recombination with a transfer vector containing genes encoding one or more proteins described herein, and co-transfecting the transfer vector and the baculovirus genomic DNA into an insect cell. In some embodiments, the baculovirus genome contains regions that are homologous to regions of the transfer vector. These homologous regions may increase the probability of recombination between the baculovirus genome and the transfer vector. In some embodiments, the homologous region of the transfer vector is located upstream or downstream of a promoter.In some embodiments, to induce homologous recombination, the baculovirus genome and the transfer vector are mixed at a weight ratio of about 1:1 to 10:1.

[0261] In some embodiments, recombinant Baculoviruses are produced by methods including site-specific transposition with Tn7, e.g., whereby genes encoding proteins described herein are inserted into bacmid DNA and propagated, e.g., in bacteria, e.g., E. coli (e.g., DH10Bac cells). In some embodiments, genes encoding proteins described herein are cloned into a pFASTBAC® vector and transformed into competent cells, e.g., DH10BAC® competent cells, containing bacmid DNA with mini-attTn7 target sites. In some embodiments, the Baculovirus expression vector, e.g., pFASTBAC® vector, can have a promoter, e.g., a dual promoter (e.g., polyhedrin promoter, p10 promoter). Commercially available pFASTBAC® donor plasmids include pFASTBAC 1, pFASTBAC HT, and pFASTBAC DUAL. In some embodiments, recombinant bacmid DNA-containing colonies are identified and the bacmid DNA is isolated for transfecting insect cells.

[0262] In some embodiments, the baculovirus vector is introduced into the insect cell along with a helper nucleic acid. The introduction can be simultaneous or sequential. In some embodiments, the helper nucleic acid provides one or more baculovirus proteins, for example, to facilitate packaging of the baculovirus vector.

[0263] In some embodiments, recombinant Baculovirus produced in insect cells (e.g., by homologous recombination) are propagated and used to infect insect cells (e.g., mid-log phase) for recombinant protein expression. In some embodiments, recombinant bacmid DNA produced by site-specific transposition in bacteria, e.g., E. coli, is used to transfect insect cells with a transfection agent, e.g., Cellfectin® II. Further information regarding Baculovirus expression systems is discussed in U.S. Patent Application Nos. 14 / 447,341, 14 / 277,892, and 12 / 278,916, which are incorporated herein by reference.

[0264] insect cell system The proteins described herein can be expressed in insect cells infected or transfected with recombinant Baculovirus or bacmid DNA, for example as described above. In some embodiments, insect cells include Sf9 and Sf21 cells from Spodoptera frugiperda, and Tn-368 and High Five™ BTI-TN-5B1-4 cells (also called Hi5 cells) from Trichoplusia ni. In some embodiments, the insect cell lines Sf21 and Sf9, derived from the pupal ovaries of Spodoptera frugiperda, can be used for expression of recombinant proteins using a Baculovirus expression system. In some embodiments, Sf21 and Sf9 insect cells can be cultured in commercially available serum-supplemented or serum-free media. Media suitable for culturing insect cells include Grace's Supplemented (TNM-FH), IPL-41, TC-100, Schneider's Drosophila, SF-900 II SFM, and EXPRESS-FIVE™ SFM. In some embodiments, some serum-free media formulations utilize a phosphate buffer system to maintain the culture pH in the range of 6.0-6.4 for both culture and recombinant protein production (Licari et al. Insect cell hosts for baculovirus expression vectors contain endogenous exoglycosidase activity. Biotechnology Progress 9:146-152 (1993) and Drugmand et al. Insect cells as factories for biomanufacturing. Biotechnology Advances 30:1140-1157 (2012)). In some embodiments, a pH of 6.0-6.8 may be used to culture various insect cell lines. In some embodiments, insect cells are cultured in suspension or as a monolayer at temperatures between 25° C. and 30° C. with aeration.Further information regarding insect cells is discussed, for example, in US patent application Ser. Nos. 14 / 564,512 and 14 / 775,154, each of which is incorporated herein by reference.

[0265] mammalian cell lines In some embodiments, the proteins described herein may be expressed in vitro in animal cell lines, for example, infected or transfected with vectors encoding the proteins as described herein. Animal cell lines contemplated in the context of the present disclosure include porcine cell lines, for example, immortalized porcine cell lines, for example, but not limited to, porcine kidney epithelial cell lines PK-15 and SK, monomyeloma cell line 3D4 / 31, and testicular cell line ST. Also included are other mammalian cells, such as CHO cells (Chinese Hamster Ovary), MARC-145, MDBK, RK-13, EEL, and the like. Additionally or alternatively, certain embodiments of the methods of the present invention utilize animal cell lines that are epithelial cell lines, i.e., cell lines of epithelial cell lineage cells. Cell lines suitable for expressing the proteins described herein include, but are not limited to, human or primate derived cell lines, for example, human or primate kidney cancer cell lines.

[0266] effector The compositions and methods described herein can be used to produce genetic elements of an anelovector that include a sequence encoding an effector (e.g., an exogenous effector or an endogenous effector), e.g., as described herein. In some embodiments, the genetic element is an effector, e.g., the genetic element is a functional RNA. The effector can be an endogenous effector or an exogenous effector in some cases. In some embodiments, the effector is a therapeutic effector. In some embodiments, the effector comprises a polypeptide (e.g., a therapeutic polypeptide or peptide described herein). In some embodiments, the effector comprises a non-coding RNA (e.g., miRNA, siRNA, shRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, or gRNA). In some embodiments, the effector comprises a regulatory nucleic acid, e.g., as described herein.

[0267] In vitro assembly method Anellovectors can be produced, for example, by in vitro assembly. In some embodiments, the genetic elements are contacted with ORF1 in vitro under conditions that allow assembly.

[0268] In some embodiments, Baculovirus constructs are used to produce Anellovirus proteins. These proteins can then be used for in vitro assembly, for example, to encapsidate genetic elements, for example, genetic elements including RNA. In some embodiments, polynucleotides encoding one or more Anellovirus proteins are fused to a promoter for expression in a host cell, for example, an insect or animal cell. In some embodiments, the polynucleotides are cloned into a Baculovirus expression system. In some embodiments, host cells, for example, insect cells, are infected with the Baculovirus expression system and incubated for a period of time. In some embodiments, the infected cells are incubated for about 1, 2, 3, 4, 5, 10, 15, or 20 days. In some embodiments, the infected cells are lysed to recover the Anellovirus proteins.

[0269] In some embodiments, the isolated Anellovirus proteins are purified. In some embodiments, the Anellovirus proteins are purified using purification techniques including, but not limited to, chelating purification, heparin purification, gradient sedimentation purification, and / or SEC purification. In some embodiments, the purified Anellovirus proteins are mixed with a genetic element to encapsidate the genetic element, e.g., a genetic element comprising RNA. In some embodiments, the genetic element is encapsidated using ORF1 protein, ORF2 protein, or modified versions thereof. In some embodiments, two nucleic acids are encapsidated. For example, the first nucleic acid may be an mRNA, e.g., a chemically modified mRNA, and the second nucleic acid may be DNA.

[0270] In some embodiments, DNA encoding Anellovirus (AV) ORF1 (e.g., wild-type ORF1 protein, ORF1 protein, chimeric ORF1 protein, or fragments thereof, with mutations, e.g., to improve assembly efficiency, yield, or stability) is expressed in insect cell lines (e.g., Sf9 and / or HighFive), animal cell lines (e.g., chicken cell line (MDCC)), bacterial cells (e.g., Escherichia coli (E. coli)), and / or mammalian cell lines (e.g., 293expi and / or MOLT4). In some embodiments, DNA encoding AV ORF1 may be untagged. In some embodiments, DNA encoding AV ORF1 may contain a tag fused to the N-terminus and / or C-terminus. In some embodiments, DNA encoding AV ORF1 may have mutations, insertions, or deletions in the ORF1 protein to introduce a tag, e.g., to aid in purification and / or identity determination, e.g., by immunostaining assays (including but not limited to ELISA or Western blot). In some embodiments, DNA encoding AV ORF1 can be expressed alone or in combination with any number of helper proteins, hi some embodiments, DNA encoding AV ORF1 is expressed in combination with AV ORF2 and / or ORF3 proteins.

[0271] In some embodiments, ORF1 proteins carrying mutations to improve assembly efficiency may include, but are not limited to, ORF1 proteins carrying mutations introduced into the N-terminal arginine arm (ARG arm) (SEQ ID NOs: 3-5) to alter the pI of the ARG arm and enable pH-sensitive nucleic acid binding to trigger particle assembly. In some embodiments, ORF1 proteins carrying mutations to improve stability may include mutations between the protomers contacting beta strands F and G of a standard jelly-roll beta barrel to change the hydrophobic state of the protomer surface and improve the thermodynamic favorability of encapsidation.

[0272] In some embodiments, the chimeric ORF1 protein may include, but is not limited to, an ORF1 protein having a portion or portions of its sequence replaced with an equivalent portion of another capsid protein, such as, for example, an equivalent portion of the Beak and Feather Disease Virus (BFDV) capsid protein or Hepatitis E capsid protein, such as, for example, an ORF1 protein having the ARG arms or the F and G beta strands of Ring9 ORF1 replaced with equivalent components from the BFDV capsid protein. In some embodiments, the chimeric ORF1 protein may also include an ORF1 protein having a portion or portions of its sequence replaced with an equivalent portion of another AV ORF1 protein (e.g., a jelly-roll fragment or the C-terminal portion of Ring2 ORF1 replaced with an equivalent portion of Ring9 ORF1).

[0273] In some embodiments, the disclosure describes a method of making an anaerovector, the method comprising: (a) providing a mixture comprising: (i) a genetic element comprising an RNA, and (ii) an ORF1 molecule; and (b) incubating the mixture under conditions suitable to encase the genetic element within a proteinaceous outer layer comprising the ORF1 molecule, thereby producing an anaerovector; optionally, the mixture is not contained within a cell. In some embodiments, the method further comprises expressing the ORF1 molecule, for example in a host cell (e.g., an insect cell or a mammalian cell), prior to providing (a). In some embodiments, the expressing comprises incubating a host cell (e.g., an insect cell or a mammalian cell) that comprises a nucleic acid molecule (e.g., a baculovirus expression vector) encoding the ORF1 molecule, under conditions suitable to produce the ORF1 molecule. In some embodiments, the method further comprises purifying the ORF1 molecule expressed by the host cell prior to providing (a). In some embodiments, the method is performed in a cell-free system. In some embodiments, the disclosure describes a method of producing an anaerovector composition, comprising: (a) providing a plurality of anaerovectors or compositions as described in any of the preceding embodiments; (b) optionally evaluating a plurality of anellosomes for one or more of the following: contamination as described herein, optical density measurements (e.g., OD260), particle counts (e.g., by HPLC), infectivity (e.g., particle:infectious unit ratio, e.g., as determined by fluorescence and / or ELISA); and (c) formulating the plurality of anaerovectors, e.g., as a pharmaceutical composition suitable for administration to a subject, e.g., if one or more of the parameters in (b) meet a specified threshold.

[0274] Concentration and purification The recovered anaerovectors can be purified and / or concentrated, for example, to produce an anaerovector preparation. In some embodiments, the recovered anaerovectors are isolated from other components or contaminants present in the recovery solution, for example, using methods known in the art for purifying viral particles (e.g., purification by precipitation, chromatography, and / or ultrafiltration). In some embodiments, the recovered anaerovectors are purified by affinity purification (e.g., heparin affinity purification). In some embodiments, the recovered anaerovectors are purified by size exclusion chromatography (e.g., using a Tris buffer mobile phase). In some embodiments, the recovered anaerovectors are purified by anion exchange chromatography (e.g., Mustang Q membrane chromatography). In some embodiments, the recovered anaerovectors are purified by mixed mode chromatography (e.g., using a mixed mode resin, e.g., Cato700 resin). In some embodiments, the purification step includes removing serum, host cell DNA, host cell proteins, particles devoid of genetic elements, and / or phenol red from the preparation. In some embodiments, the recovered anellovectors are concentrated relative to other components or contaminants present in the recovery solution, e.g., using methods known in the art for concentrating viral particles.

[0275] In some embodiments, the resulting preparation or a pharmaceutical composition comprising the preparation is stable for an acceptable period of time and temperature, and / or is compatible with the desired route of administration and / or any devices required by this route of administration, such as an injection needle or syringe.

[0276] II. Anellovector In some aspects, the disclosure provides compositions and methods of using and making anaerovectors, anaerovector preparations, and therapeutic compositions. In some embodiments, an anaerovector comprises one or more nucleic acids or polypeptides that include sequences, structures, and / or functions based on an Anellovirus (e.g., an Anellovirus described herein), or a fragment or portion thereof, or other substantially non-pathogenic viruses, e.g., commensal, commensal, native viruses. In some embodiments, an Anellovirus-based anaerovector comprises at least one element exogenous to the Anellovirus, e.g., an exogenous effector, or a nucleic acid sequence encoding an exogenous effector that is disposed within a genetic element of the anaerovector. In some embodiments, an Anellovirus-based anaerovector comprises at least one element heterologous to another element derived from the Anellovirus, e.g., an effector-encoding nucleic acid sequence, such as a promoter element, that is heterologous to another linked nucleic acid sequence. In some embodiments, an anaerovector comprises a genetic element (e.g., a circular DNA, e.g., a single-stranded circular DNA) that comprises at least one element that is exogenous to the remainder of the genetic element and / or a proteinaceous outer layer (e.g., an exogenous element encoding an effector, e.g., as described herein). An anaerovector may be a delivery vehicle (e.g., a substantially non-pathogenic delivery vehicle) of a payload to a host, e.g., a human. In some embodiments, an anaerovector is capable of replicating in a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell. In some embodiments, an anaerovector is substantially non-pathogenic and / or substantially non-integrative in mammalian (e.g., human) cells. In some embodiments, the annellvector is substantially non-immunogenic in a mammal, e.g., a human. In some embodiments, the annellvector is replication-deficient. In some embodiments, the annellvector is replication-competent.

[0277] In some embodiments, the anaerovector comprises a clone, or components thereof (e.g., genetic elements including, e.g., sequences encoding effectors and / or a proteinaceous outer layer), as described in PCT Application No. US 2018 / 037379, which is incorporated by reference in its entirety. In some embodiments, the anaerovector comprises an anaerovector, or components thereof (e.g., genetic elements including, e.g., sequences encoding effectors and / or a proteinaceous outer layer), as described in PCT Application No. PCT / US19 / 65995, which is incorporated by reference in its entirety.

[0278] In one aspect, the invention includes: (i) a genetic element comprising a promoter element, a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector, e.g., a payload), and a protein binding sequence (e.g., an exogenous protein binding sequence, e.g., a packaging signal), wherein the genetic element is single stranded DNA and further has one or both of the following properties: it is circular and / or it integrates into the genome of a eukaryotic cell at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter the cell; and (ii) an anaerovector comprising a proteinaceous outer layer, wherein the genetic element is enclosed within the proteinaceous outer layer; and the anaerovector is capable of delivering the genetic element into a eukaryotic cell.

[0279] In some embodiments of the anaerovectors described herein, the genetic elements are integrated at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic elements that enter a cell. In some embodiments, less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, or 5% of the genetic elements from a plurality of anaerovectors administered to a subject are integrated into the genome of one or more host cells of the subject. In some embodiments, for example, as described herein, the genetic elements of a population of anaerovectors are integrated into the genome of a host cell at a frequency lower than that of a comparable population of AAV viruses, e.g., about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more lower than that of a comparable population of AAV viruses.

[0280] In one aspect, the invention provides a genetic element comprising: (i) a promoter element, a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector, e.g., a payload), and a protein binding sequence (e.g., an exogenous protein binding sequence), wherein the genetic element is a wild-type Anellovirus sequence (e.g., wild-type Torque Teno virus (TTV), Torque Teno minivirus (TTV), or a wild-type Torque Teno minivirus (TTV)). a genetic element having at least 75% (e.g., at least 75, 76, 77, 78, 79, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to a T. typhimurium (TTMV), or TTMDV sequence, e.g., a wild-type Anellovirus sequence described herein); and (ii) an anaellovector comprising a proteinaceous outer layer, wherein the genetic element is enclosed within the proteinaceous outer layer; and the anaellovector is capable of delivering the genetic element into a eukaryotic cell.

[0281] In one aspect, the present invention provides a method for producing a method for treating a cancer cell comprising the steps of: a) a genetic element comprising: (i) a sequence encoding a non-pathogenic foreign protein; (ii) an foreign protein binding sequence that binds the genetic element to the non-pathogenic foreign protein; and (iii) a sequence encoding an effector (e.g., an endogenous or exogenous effector); and b) a proteinaceous outer layer that is associated with, e.g., encases or confines, the genetic element The anellovector comprises:

[0282] In some embodiments, the anellovector comprises sequences or expression products derived from (or with >70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% homology to) non-enveloped, circular, single-stranded DNA viruses. Animal circular single-stranded DNA viruses generally refer to a subgroup of single-stranded DNA (ssDNA) viruses that infect eukaryotic non-plant hosts and have a circular genome. Thus, animal circular ssDNA viruses are distinguishable from ssDNA viruses that infect prokaryotes (i.e., Microviridae and Inoviridae) and ssDNA viruses that infect plants (i.e., Geminiviridae and Nanoviridae). They are also distinguishable from linear ssDNA viruses that infect non-plant eukaryotic cells (i.e., Parvoviridae).

[0283] In some embodiments, the anellovector modulates a host cell function, e.g., transiently or long term. In some embodiments, the cell function is stably altered, e.g., modulation lasts for at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any time in between. In some embodiments, the function of the cell is transiently altered, for example, modulation lasts for about 30 minutes to about 7 days or less, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days or less, or any time in between.

[0284] In some embodiments, the genetic element comprises a promoter element. In some embodiments, the promoter element is selected from an RNA polymerase II-dependent promoter, an RNA polymerase III-dependent promoter, a PGK promoter, a CMV promoter, an EF-1α promoter, an SV40 promoter, a CAGG promoter, or a UBC promoter, a TTV viral promoter, a tissue-specific, U6 (pollIII), minimal CMV promoter with an upstream DNA binding site for an activator protein (such as TetR-VP16, Gal4-VP16, dCas9-VP16, etc.). In some embodiments, the promoter element comprises a TATA box. In some embodiments, the promoter element is endogenous to, for example, a wild-type Anellovirus described herein.

[0285] In some embodiments, the genetic element comprises one or more of the following characteristics: single stranded, circular, negative stranded, and / or DNA. In some embodiments, the genetic element comprises an episome. In some embodiments, the portion of the genetic element excluding the effector has a total size of about 2.5-5 kb (e.g., about 2.8-4 kb, about 2.8-3.2 kb, about 3.6-3.9 kb, or about 2.8-2.9 kb), less than about 5 kb (e.g., less than about 2.9 kb, 3.2 kb, 3.6 kb, 3.9 kb, or 4 kb), or at least 100 nucleotides (e.g., at least 1 kb).

[0286] In some embodiments, the anaerovector, or a genetic element contained therein, is introduced into a cell (e.g., a human cell). In some embodiments, for example, once the anaerovector or genetic element is introduced into a cell, an effector (e.g., an RNA, e.g., miRNA) encoded by the genetic element of the anaerovector is expressed in the cell (e.g., a human cell). In some embodiments, introduction of the anaerovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) the level of a target molecule (e.g., a target nucleic acid, e.g., an RNA, or a target polypeptide) in the cell, for example, by modifying the level of expression of the target molecule by the cell. In some embodiments, introduction of the anaerovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) the level of an interferon produced by the cell. In some embodiments, introduction of the anaerovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) a function of the cell. In some embodiments, introduction of the anaerovector, or a genetic element contained therein, into a cell modulates (e.g., increases or decreases) the viability of the cell. In some embodiments, introduction of the anellovector, or the genetic elements contained therein, into a cell reduces the viability of the cell (e.g., a cancer cell).

[0287] In some embodiments, the anaerovectors described herein (e.g., synthetic anaerovectors) induce an antibody positivity rate of less than 70% (e.g., an antibody positivity rate of less than about 60%, 50%, 40%, 30%, 20%, or 10%). In some embodiments, the antibody positivity rate is measured according to methods known in the art. In some embodiments, the antibody positivity rate is measured by detecting antibodies against an Anellovirus (e.g., as described herein) or an anaerovector based thereon in a biological sample, for example, according to the anti-TTV antibody detection method described in Tsuda et al. (1999; J. Virol. Methods 77:199-206; incorporated herein by reference) and / or the method for determining anti-TTV IgG seropositivity described in Kakkola et al. (2008; Virology 382:182-189; incorporated herein by reference). Additionally, antibodies against anellovirus or anellovectors based thereon can also be detected by methods known in the art for detecting anti-viral antibodies, such as the methods for detecting anti-AAV antibodies described in Calcedo et al. (2013; Front. Immunol. 4(341):1-7; incorporated herein by reference).

[0288] In some embodiments, a replication-deficient, replication-impaired, or replication-deficient genetic element does not encode all of the machinery or components required for replication of the genetic element. In some embodiments, a replication-deficient genetic element does not encode a replication factor. In some embodiments, a replication-deficient genetic element does not encode one or more ORFs (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3, e.g., as described herein). In some embodiments, the machinery or components not encoded by the genetic element are provided in trans (e.g., encoded in a nucleic acid contained in the host cell, e.g., integrated into the genome of the host cell), e.g., such that the genetic element can undergo replication in the presence of the machinery or components provided in trans.

[0289] In some embodiments, the packaging-deficient, packaging-defective, or packageable genetic element cannot be packaged into a proteinaceous outer layer (e.g., where the proteinaceous outer layer comprises a capsid or a portion thereof that comprises a polypeptide encoded by, e.g., an ORF1 nucleic acid described herein). In some embodiments, the packaging-deficient genetic element is packaged into a proteinaceous outer layer with less than 10% (e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, or 0.001%) efficiency compared to a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packaging-defective genetic element cannot be packaged into a proteinaceous outer layer even in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that allow packaging of the genetic element of a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packaging-defective genetic elements are packaged into the proteinaceous outer layer with an efficiency of less than 10% (e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, or 0.001%) compared to a wild-type Anellovirus (e.g., as described herein), even in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that allow packaging of the genetic elements of a wild-type Anellovirus (e.g., as described herein).

[0290] In some embodiments, the packagable genetic elements may be packaged into a proteinaceous outer layer (e.g., where the proteinaceous outer layer comprises a capsid or a portion thereof that comprises, e.g., a polypeptide encoded by an ORF1 nucleic acid described herein). In some embodiments, the packagable genetic elements are packaged into the proteinaceous outer layer with an efficiency of at least 20% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more) compared to a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packagable genetic elements may be packaged into a proteinaceous outer layer in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that allow packaging of the genetic elements of a wild-type Anellovirus (e.g., as described herein). In some embodiments, the packagable genetic elements are packaged into the proteinaceous outer layer with an efficiency of at least 20% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more) compared to a wild-type Anellovirus (e.g., as described herein) in the presence of factors (e.g., ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, or ORF2t / 3) that enable packaging of the genetic elements of a wild-type Anellovirus (e.g., as described herein).

[0291] Anellovirus In some embodiments, for example, the anaerovectors described herein comprise a sequence or expression product derived from an Anellovirus. In some embodiments, the anaerovector comprises one or more sequences or expression products exogenous to the Anellovirus. In some embodiments, the anaerovector comprises one or more sequences or expression products endogenous to the Anellovirus. In some embodiments, the anaerovector comprises one or more sequences or expression products that are heterologous to one or more other sequences or expression products in the anaerovector. Anelloviruses generally have a single-stranded circular DNA genome with negative polarity.

[0292] In some embodiments the genetic element comprises a nucleic acid sequence encoding an amino acid sequence or a functional fragment thereof, or a sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences described herein, for example an Anellovirus amino acid sequence.

[0293] In some embodiments, the anaerovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to, for example, an Anellovirus sequence described herein, or a fragment thereof.

[0294] In some embodiments, the anaerovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more TATA boxes, cap sites, initiation elements, transcription start sites, 5'UTR conserved domains, ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3, 3 open reading frame regions, poly(A) signals, GC-rich regions, or any combination thereof, of an Anellovirus, e.g., as described herein. In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein, e.g., an ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3 sequence of any of the Anelloviruses described herein. In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein that comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 protein (or a splice variant or functional fragment thereof) or a polypeptide encoded by an Anellovirus ORF1 nucleic acid.

[0295] In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 2 nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 3 nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2t / 3 nucleotide sequence of Table A1.In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR conserved domain nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table A1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table A1.

[0296] In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 nucleic acid sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 1 nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 2 nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 3 nucleotide sequence of Table B1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table B1.In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR conserved domain nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table B1.

[0297] In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 2 nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 / 3 nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TAIP nucleotide sequence of Table C1.In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR conserved domain nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table C1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table C1.

[0298] In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 2 nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 3 nucleotide sequence of Table D1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TAIP nucleotide sequence of Table D1.In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR conserved domain nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table D1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table D1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table D1.

[0299] In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 nucleic acid sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 / 1 nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF1 / 2 nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 2 nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Anellovirus ORF2 / 3 nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TAIP nucleotide sequence of Table E1.In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus TATA box nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus initiator element nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus transcription start site nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR conserved domain nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 3 open reading frame region nucleotide sequence of Table E1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus poly(A) signal nucleotide sequence of Table E1. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus GC-rich nucleotide sequence of Table E1.

[0300] In some embodiments the genetic element comprises a nucleic acid sequence encoding an amino acid sequence or a functional fragment thereof, or a sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences described herein, for example an Anellovirus amino acid sequence.

[0301] In some embodiments, the anaerovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to, for example, an Anellovirus sequence described herein, or a fragment thereof. In some embodiments, the anaerovectors comprise a nucleic acid sequence selected from the sequences set forth in any of Tables A1-M2, or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments, the anellosome comprises a polypeptide comprising a sequence set forth in any of Tables A2-M2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0302] In some embodiments, the anaerovectors described herein comprise one or more nucleic acid molecules (e.g., genetic elements described herein) that comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more TATA boxes, initiation elements, cap sites, transcription start sites, 5'UTR conserved domains, ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3, 3 open reading frame regions, poly(A) signals, GC-rich regions, or any combination thereof, of any of the Anelloviruses described herein (e.g., an Anellovirus sequence annotated in any of Tables A-M or encoded by a sequence listed therein). In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein, e.g., an ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3 sequence of any of the Anellovirus described herein (e.g., an Anellovirus sequence annotated in any of Tables A-M or encoded by a sequence listed therein). In embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein that comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 or ORF2 protein (e.g., an ORF1 or ORF2 amino acid sequence set forth in any of Tables A-M, or an ORF1 or ORF2 amino acid sequence encoded by a nucleic acid sequence set forth in any of Tables A1-M1).In embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein that comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 protein (e.g., an ORF1 amino acid sequence set forth in any of Tables A2-M2, or an ORF1 amino acid sequence encoded by a nucleic acid sequence set forth in any of Tables A1-M1).

[0303] In some embodiments, an anaerovector as described herein is a chimeric anaerovector, hi some embodiments, a chimeric anaerovector further comprises one or more elements, polypeptides, or nucleic acids derived from a virus other than an Anellovirus.

[0304] In some embodiments, the chimeric anellovector comprises multiple polypeptides (e.g., anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3) that comprise sequences (e.g., as described herein) derived from multiple different anelloviruses. For example, a chimeric anellovector can contain an ORF1 molecule from one Anellovirus (e.g., a Ring1 ORF1 molecule or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto) and an ORF2 molecule from a different Anellovirus (e.g., a Ring2 ORF2 molecule or an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto). In another example, a chimeric anellovector can include a first ORF1 molecule from one Anellovirus (e.g., a Ring1 ORF1 molecule or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto) and a second ORF1 molecule from a different Anellovirus (e.g., a Ring2 ORF1 molecule or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto).

[0305] In some embodiments, the anaerovector comprises a chimeric polypeptide (e.g., anellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3), e.g., comprising at least one portion from an anellovirus (e.g., as described herein) and at least one portion from a different virus (e.g., as described herein).

[0306] In some embodiments, an anaellovector comprises a chimeric polypeptide (e.g., an anaellovirus ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, and / or ORF2t / 3), e.g., comprising at least one portion (e.g., as described herein) from one anaellovirus and at least one portion (e.g., as described herein) from a different anaellovirus. In some embodiments, the anaerovector comprises a chimeric ORF1 molecule comprising at least a portion of an ORF1 molecule from one Anellovirus (e.g., as described herein), or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF1 molecule from a different Anellovirus (e.g., as described herein), or an ORF1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the chimeric ORF1 molecule comprises an ORF1 jellyroll domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.In some embodiments, the chimeric ORF1 molecule comprises an ORF1 arginine-rich region from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, the chimeric ORF1 molecule comprises an ORF1 hypervariable domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, the chimeric ORF1 molecule comprises an ORF1 N22 domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, the chimeric ORF1 molecule comprises an ORF1 C-terminal domain from one Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an ORF1 amino acid subsequence (e.g., as described herein) from a different Anellovirus, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0307] In some embodiments, the anaerovector comprises a chimeric ORF1 / 1 molecule comprising at least a portion of an ORF1 / 1 molecule from one Anellovirus (e.g., as described herein), or an ORF1 / 1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF1 / 1 molecule from a different Anellovirus (e.g., as described herein), or an ORF1 / 1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In some embodiments, the anaerovector comprises a chimeric ORF1 / 2 molecule comprising at least a portion of an ORF1 / 2 molecule from one Anellovirus (e.g., as described herein), or an ORF1 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF1 / 2 molecule from a different Anellovirus (e.g., as described herein), or an ORF1 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In some embodiments, the anaerovector comprises a chimeric ORF2 molecule comprising at least a portion of an ORF2 molecule from one Anellovirus (e.g., as described herein), or an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF2 molecule from a different Anellovirus (e.g., as described herein), or an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.In some embodiments, the anaerovector comprises a chimeric ORF2 / 2 molecule comprising at least a portion of an ORF2 / 2 molecule from one Anellovirus (e.g., as described herein), or an ORF2 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF2 / 2 molecule from a different Anellovirus (e.g., as described herein), or an ORF2 / 2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the anaerovector comprises a chimeric ORF2 / 3 molecule comprising at least a portion of an ORF2 / 3 molecule from one Anellovirus (e.g., as described herein), or an ORF2 / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF2 / 3 molecule from a different Anellovirus (e.g., as described herein), or an ORF2 / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the anaerovector comprises a chimeric ORF2T / 3 molecule comprising at least a portion of an ORF2T / 3 molecule from one Anellovirus (e.g., as described herein), or an ORF2T / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least a portion of an ORF2T / 3 molecule from a different Anellovirus (e.g., as described herein), or an ORF2T / 3 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0308] Additional exemplary Anellovirus genomes whose sequences or subsequences contained therein may be utilized in the compositions and methods described herein are described, for example, in PCT Application Nos. PCT / US2018 / 037379 and PCT / US19 / 65995, which are incorporated by reference in their entireties. In some embodiments, exemplary Anellovirus sequences include nucleic acid sequences listed in any of Tables A1, A3, A5, A7, A9, A11, B1-B5, 1, 3, 5, 7, 9, 11, 13, 15, or 17 of PCT / US19 / 65995, which are incorporated by reference herein. In some embodiments, an exemplary Anellovirus sequence comprises an amino acid sequence listed in any of Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18 of PCT / US19 / 65995, which is incorporated herein by reference. In some embodiments, an exemplary Anellovirus sequence comprises an ORF1 molecular sequence, or a nucleic acid sequence encoding same, e.g., as listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C of PCT / US19 / 65995, which is incorporated herein by reference.

[0309] [Table 31]

[0310] [Table 32]

[0311] [Table 33]

[0312] [Table 34]

[0313]

Table 35

[0314]

Table 36

[0315]

Table 37

[0316]

Table 38

[0317]

Table 39

[0318]

Table 40

[0319]

Table 41

[0320]

Table 42

[0321]

Table 43

[0322]

Table 44

[0323]

Table 45

[0324]

Table 46

[0325]

Table 47

[0326]

Table 48

[0327]

Table 49

[0328]

Table 50

[0329]

Table 51

[0330]

Table 52

[0331]

Table 53

[0332] In some embodiments, the anaerovector comprises a nucleic acid comprising a sequence listed in PCT Application No. US 2018 / 037379, the entirety of which is incorporated herein by reference. In some embodiments, the anaerovector comprises a polypeptide comprising a sequence listed in PCT Application No. US 2018 / 037379, the entirety of which is incorporated herein by reference. In some embodiments, the anaerovector comprises a nucleic acid comprising a sequence listed in PCT Application No. PCT / US19 / 65995, the entirety of which is incorporated herein by reference. In some embodiments, the anaerovector comprises a polypeptide comprising a sequence listed in PCT Application No. PCT / US19 / 65995, the entirety of which is incorporated herein by reference.

[0333] ORF1 molecule In some embodiments, the annelovector comprises an ORF1 molecule and / or a nucleic acid encoding an ORF1 molecule. Generally, the ORF1 molecule comprises a polypeptide having structural features and / or activity of an Anellovirus ORF1 protein (e.g., an Anellovirus ORF1 protein described herein). In some embodiments, the ORF1 molecule comprises a truncation relative to an Anellovirus ORF1 protein (e.g., an Anellovirus ORF1 protein described herein). An ORF1 molecule can bind to other ORF1 molecules to form, for example, a proteinaceous outer layer (e.g., as described herein), e.g., a capsid. In some embodiments, the proteinaceous outer layer can entrap a nucleic acid molecule (e.g., a genetic element described herein). In some embodiments, multiple ORF1 molecules can form multimers to form, for example, a proteinaceous outer layer. In some embodiments, the multimers can be homomultimers. In other embodiments, the multimers can be heteromultimers.

[0334] The ORF1 molecule, in some embodiments, may include one or more of the following: a first region including an arginine-rich region, e.g., a region having at least 60% basic residues (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% basic residues; e.g., 60%-90%, 60%-80%, 70%-90%, or 70-80% basic residues), and a second region including a jellyroll domain, e.g., at least six beta strands (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12 beta strands).

[0335] In some embodiments, an ORF1 molecule as described herein comprises one or more lysine to histidine mutations compared to a wild-type ORF1 protein sequence (e.g., as described herein). In certain embodiments, the ORF1 molecule comprises one or more lysine to histidine mutations in the arginine-rich region and / or the first beta strand.

[0336] Arginine-rich region The arginine-rich region has at least 70% (e.g., at least about 70, 80, 90, 95, 96, 97, 98, 99, or 100%) sequence identity to an arginine-rich region sequence described herein or a sequence of at least about 40 amino acids that contains at least 60%, 70%, or 80% basic residues (e.g., arginine, lysine, or a combination thereof).

[0337] Jellyroll Domain Jellyroll domains or regions have the following characteristics: (i) at least 30% (e.g., at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, or more) of the amino acids of the jelly-roll domain are part of one or more β-sheets; (ii) the secondary structure of the jellyroll domain comprises at least four (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) β-strands; and / or (iii) the tertiary structure of the jelly-roll domain comprises at least two (e.g., two, three, or four) β-sheets; and / or (iv) the jelly-roll domain comprises a ratio of β-sheets:α-helices of 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. The term "antibody" refers to a polypeptide (e.g., a domain or region contained in a larger polypeptide) that comprises one or more (e.g., 1, 2, or 3) of:

[0338] In certain embodiments, the jellyroll domain comprises two beta sheets.

[0339] In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise about 8 (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise 8 beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise 7 beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise 6 beta strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise 5 beta strands. In certain embodiments, one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) beta sheets comprise four beta strands.

[0340] In some embodiments, the jellyroll domain comprises a first β-sheet in an anti-parallel orientation relative to the second β-sheet. In certain embodiments, the first β-sheet comprises about four (e.g., 3, 4, 5, or 6) β-strands. In certain embodiments, the second β-sheet comprises about four (e.g., 3, 4, 5, or 6) β-strands. In some embodiments, the first and second β-sheets comprise, in total, about eight (e.g., 6, 7, 8, 9, 10, 11, or 12) β-strands.

[0341] In certain embodiments, the jelly-roll domain is a component of a capsid protein (e.g., an ORF1 molecule described herein). In certain embodiments, the jelly-roll domain has self-assembly activity. In some embodiments, a polypeptide comprising a jelly-roll domain binds to another copy of a polypeptide comprising a jelly-roll domain. In some embodiments, the jelly-roll domain of a first polypeptide binds to the jelly-roll domain of a second copy of the polypeptide.

[0342] N22 Domain The ORF1 molecule may also include a third region that includes the structure or activity of an Anellovirus N22 domain (e.g., as described herein, e.g., an N22 domain from an Anellovirus ORF1 protein described herein), and / or a fourth region that includes the structure or activity of an Anellovirus C-terminal domain (CTD) (e.g., as described herein, e.g., a CTD from an Anellovirus ORF1 protein described herein). In some embodiments, the ORF1 molecule includes, in order from the N-terminus to the C-terminus, the first region, the second region, the third region, and the fourth region.

[0343] Hypervariable region (HVR) The ORF1 molecule, in some embodiments, further comprises a hypervariable region (HVR), e.g., an HVR from, e.g., an Anellovirus ORF1 protein, e.g., as described herein. In some embodiments, the HVR is located between the second and third regions. In some embodiments, the HVR comprises at least about 55 (e.g., at least about 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, or 65) amino acids (e.g., about 45-160, 50-160, 55-160, 60-160, 45-150, 50-150, 55-150, 60-150, 45-140, 50-140, 55-140, or 60-140 amino acids).

[0344] Exemplary ORF1 Sequences Exemplary Anellovirus ORF1 amino acid sequences, and sequences of exemplary ORF1 domains, are provided in the table below. In some embodiments, a polypeptide (e.g., ORF1 molecule) described herein comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more Anellovirus ORF1 subsequences, e.g., as set forth in any of Tables N-Z. In some embodiments, an annelovector described herein comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more Anellovirus ORF1 subsequences, e.g., as set forth in any of Tables N-Z. In some embodiments, the anellovectors described herein comprise a nucleic acid molecule (e.g., a genetic element) encoding an ORF1 molecule comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more Anellovirus ORF1 subsequences, e.g., as set forth in any of Tables N-Z.

[0345] In some embodiments, one or more Anellovirus ORF1 subsequences include one or more of an Arg-rich domain, a jelly-roll domain, a hypervariable region (HVR), an N22 domain, or a C-terminal domain (CTD) (e.g., as listed in any of Tables N-Z), or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the ORF1 molecule includes multiple subsequences from different Anelloviruses (e.g., any combination of ORF1 subsequences selected from Alphatorquevirus clades 1-7 subsequences listed in any of Tables N-Z). In some embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, a jelly-roll domain, an N22 domain, and a CTD from one Anellovirus and an HVR from another Anellovirus. In some embodiments, the ORF1 molecule comprises one or more of a jelly-roll domain, an HVR, an N22 domain, and a CTD from one Anellovirus and an Arg-rich domain from another Anellovirus. In some embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, an HVR, an N22 domain, and a CTD from one Anellovirus and a jelly-roll domain from another Anellovirus. In some embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, a jelly-roll domain, an HVR, and a CTD from one Anellovirus, and an N22 domain from another Anellovirus. In some embodiments, the ORF1 molecule comprises one or more of an Arg-rich domain, a jelly-roll domain, an HVR, and an N22 domain from one Anellovirus, and a CTD from another Anellovirus.

[0346] Additional exemplary anelloviruses from which the ORF1 molecule, or a splice variant or functional fragment thereof, can be utilized in the compositions and methods described herein (e.g., to encapsulate genetic elements, e.g., to form the proteinaceous outer layer of an anellovector) are described, for example, in PCT Application Nos. PCT / US2018 / 037379 and PCT / US19 / 65995, which are incorporated by reference in their entireties.

[0347] [Table 54]

[0348] [Table 55]

[0349] [Table 56]

[0350] [Table 57]

[0351] [Table 58]

[0352] [Table 59]

[0353] In some embodiments, the first region is capable of binding to a nucleic acid molecule (e.g., DNA). In some embodiments, the basic residue is selected from arginine, histidine, or lysine, or a combination thereof. In some embodiments, the first region comprises at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% arginine residues (e.g., 60%-90%, 60%-80%, 70%-90%, or 70-80% arginine residues). In some embodiments, the first region comprises about 30-120 amino acids (e.g., about 40-120, 40-100, 40-90, 40-80, 40-70, 50-100, 50-90, 50-80, 50-70, 60-100, or 60-80 amino acids). In some embodiments, the first region comprises a structure or activity of a viral ORF1 arginine-rich region (e.g., an arginine-rich region from an Anellovirus ORF1 protein, e.g., as described herein). In some embodiments, the first region comprises a nuclear localization signal.

[0354] In some embodiments, the second region comprises the structure or activity of a jelly-roll domain, e.g., a viral ORF1 jelly-roll domain (e.g., a jelly-roll domain from an Anellovirus ORF1 protein, e.g., as described herein). In some embodiments, the second region can combine with a second region of another ORF1 molecule to form a proteinaceous outer layer (e.g., a capsid) or portion thereof.

[0355] In some embodiments, the fourth region is exposed at the surface of a proteinaceous outer layer (eg, a proteinaceous outer layer comprising multimers of ORF1 molecules, as described herein).

[0356] In some embodiments, the first region, the second region, the third region, the fourth region, and / or the HVR each comprise three or fewer (e.g., 0, 1, 2, or 3) beta sheets.

[0357] In some embodiments, one or more of the first region, second region, third region, fourth region, and / or HVR may be replaced with a heterologous amino acid sequence (e.g., the corresponding region from a heterologous ORF1 molecule). In some embodiments, the heterologous amino acid sequence comprises a desired functional fragment, e.g., as described herein.

[0358] In some embodiments, the ORF1 molecule contains multiple conserved motifs (e.g., motifs that include about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more amino acids) (e.g., as shown in Figure 34 of International Publication No. US 19 / 65995). In some embodiments, the conserved motif is a conserved motif that is consistent with one or more wild-type Anellovirus clades (e.g., Alphatorquevirus, clade 1; Alphatorquevirus, clade 2; Alphatorquevirus, clade 3; Alphatorquevirus, clade 4; Alphatorquevirus, clade 5; Alphatorquevirus, clade 6; or Alphatorquevirus, clade 7; Betatorquevirus; and / or Gammatorquevirus, clade 8; Gammatorquevirus) ORF1 protein. In several embodiments, the conserved motifs may each exhibit 1 to 1000 (e.g., 5 to 10, 5 to 15, 5 to 20, 10 to 15, 10 to 20, 15 to 20, 5 to 50, 5 to 100, 10 to 50, 10 to 100, 10 to 1000, 50 to 100, 50 to 1000 , or 100-1000) amino acids in length. In certain embodiments, the conserved motif comprises about 2-4% (e.g., about 1-8%, 1-6%, 1-5%, 1-4%, 2-8%, 2-6%, 2-5%, or 2-4%) of the sequence of the ORF1 molecule, each exhibiting 100% sequence identity to the corresponding motif in the ORF1 protein of a wild-type Anellovirus clade.In certain embodiments, the conserved motif comprises about 5-10% (e.g., about 1-20%, 1-10%, 5-20%, or 5-10%) of the sequence of the ORF1 molecule, each exhibiting 80% sequence identity to a corresponding motif in the ORF1 protein of a wild-type Anellovirus clade. In certain embodiments, the conserved motif comprises about 10-50% (e.g., about 10-20%, 10-30%, 10-40%, 10-50%, 20-40%, 20-50%, or 30-50%) of the sequence of the ORF1 molecule, each exhibiting 60% sequence identity to a corresponding motif in the ORF1 protein of a wild-type Anellovirus clade. In some embodiments, the conserved motif comprises one or more amino acid sequences listed in Table 19.

[0359] In some embodiments, the ORF1 molecule or the nucleic acid molecule encoding it contains at least one difference (e.g., a mutation, chemical modification, or epigenetic alteration), e.g., compared to a wild-type ORF1 protein described herein.

[0360] A conserved ORF1 motif within the N22 domain In some embodiments, a polypeptide described herein (e.g., an ORF1 molecule) has the amino acid sequence YNPX 2 DXGX 2 N (SEQ ID NO: 829) (X n is any consecutive sequence of n amino acids. For example, X n represents any two consecutive amino acid sequences. 2 DXGX 2 N (SEQ ID NO: 829) is, for example, contained within the N22 domain of the ORF1 molecule described herein. In some embodiments, the genetic element described herein has the amino acid sequence YNPX 2 DXGX 2 N (SEQ ID NO: 829) (X nis a contiguous sequence of any n amino acids (e.g., a nucleic acid sequence encoding, for example, an ORF1 molecule described herein).

[0361] In some embodiments, a polypeptide (e.g., an ORF1 molecule) can have, e.g., a nucleotide sequence similar to, e.g., YNPX, e.g., in the N22 domain. 2 DXGX 2 In some embodiments, the conserved secondary structure comprises a first β strand and / or a second β strand. In some embodiments, the first β strand is about 5-6 (e.g., 3, 4, 5, 6, 7, or 8) amino acids in length. In some embodiments, the first β strand comprises a conserved secondary structure comprising a first β strand and / or a second β strand. In some embodiments, the first β strand is about 5-6 (e.g., 3, 4, 5, 6, 7, or 8) amino acids in length. In some embodiments, the first β strand comprises a conserved secondary structure comprising a first β strand and / or a second β strand. 2 DXGX 2 The N (SEQ ID NO: 829) motif contains a tyrosine (Y) residue at the N-terminus. 2 DXGX 2 The N (SEQ ID NO: 829) motif comprises a random coil (e.g., about 8-9 amino acids of a random coil). In some embodiments, the second β strand is about 7-8 (e.g., 5, 6, 7, 8, 9, or 10) amino acids in length. In some embodiments, the second β strand comprises the motif YNPX 2 DXGX 2 The N (SEQ ID NO: 829) motif contains an asparagine (N) residue at its C-terminus.

[0362] Exemplary YNPX 2 DXGX 2 The secondary structure adjacent to the N (SEQ ID NO: 829) motif is described in Example 47 and Figure 48 of PCT / US19 / 65995; the entire contents of which are incorporated herein by reference. In some embodiments, the ORF1 molecule comprises a region that includes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all) of the secondary structure elements (e.g., β-strands) shown in Figure 48 of WO 19 / 65995. In some embodiments, the ORF1 molecule comprises a region that includes YNPX 2 DXGX 2The present invention further comprises a region comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all) of the secondary structure elements (e.g., β strands) shown in Figure 48 of WO 19 / 65995, flanking an N (sequence number 829) motif (e.g., as described herein).

[0363] Conserved secondary structure within the ORF1 jelly-roll domain In some embodiments, a polypeptide described herein (e.g., an ORF1 molecule) comprises one or more secondary structure elements contained in an Anellovirus ORF1 protein (e.g., as described herein). In some embodiments, an ORF1 molecule comprises one or more secondary structure elements contained in a jellyroll domain of an Anellovirus ORF1 protein (e.g., as described herein). In general, the ORF1 jellyroll domain comprises a secondary structure comprising, in N-terminal to C-terminal order, a first β strand, a second β strand, a first α helix, a third β strand, a fourth β strand, a fifth β strand, a second α helix, a sixth β strand, a seventh β strand, an eighth β strand, and a ninth β strand. In some embodiments, the ORF1 molecule comprises a secondary structure comprising, in N-terminal to C-terminal order, a first beta strand, a second beta strand, a first alpha helix, a third beta strand, a fourth beta strand, a fifth beta strand, a second alpha helix, a sixth beta strand, a seventh beta strand, an eighth beta strand, and / or a ninth beta strand.

[0364] In some embodiments, a pair of conserved secondary structure elements (i.e., β-strands and / or α-helices) are separated by an intervening amino acid sequence, including, for example, a random coil sequence, a β-strand, or an α-helix, or a combination thereof. The intervening amino acid sequence between the conserved secondary structure elements may include, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids. In some embodiments, the ORF1 molecule may further include one or more additional β-strands and / or α-helices (e.g., within a jelly-roll domain). In some embodiments, consecutive β-strands or consecutive α-helices may be combined. In some embodiments, the first and second β-strands are included in a larger β-strand. In some embodiments, the third and fourth β-strands are included in a larger β-strand. In some embodiments, the 4th and 5th beta strands are comprised in a larger beta chain. In some embodiments, the 6th and 7th beta strands are comprised in a larger beta chain. In some embodiments, the 7th and 8th beta strands are comprised in a larger beta chain. In some embodiments, the 8th and 9th beta strands are comprised in a larger beta chain.

[0365] In some embodiments, the first β strand is about 5-7 (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) amino acids in length. In some embodiments, the second β strand is about 15-16 (e.g., 13, 14, 15, 16, 17, 18, or 19) amino acids in length. In some embodiments, the first α helix is ​​about 15-17 (e.g., 13, 14, 15, 16, 17, 18, 19, or 20) amino acids in length. In some embodiments, the third β strand is about 3-4 (e.g., 1, 2, 3, 4, 5, or 6) amino acids in length. In some embodiments, the fourth β strand is about 10-11 (e.g., 8, 9, 10, 11, 12, or 13) amino acids in length. In some embodiments, the fifth β strand is about 6-7 (e.g., 4, 5, 6, 7, 8, 9, or 10) amino acids in length. In some embodiments, the second α-helix is ​​about 8-14 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17) amino acids long. In some embodiments, the second α-helix may be truncated into two smaller α-helices (e.g., separated by a random coil sequence). In some embodiments, each of the two smaller α-helices is about 4-6 (e.g., 2, 3, 4, 5, 6, 7, or 8) amino acids long. In some embodiments, the sixth β-strand is about 4-5 (e.g., 2, 3, 4, 5, 6, or 7) amino acids long. In some embodiments, the seventh β-strand is about 5-6 (e.g., 3, 4, 5, 6, 7, 8, or 9) amino acids long. In some embodiments, the eighth β-strand is about 7-9 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, or 13) amino acids long. In some embodiments, the ninth beta strand is about 5 to 7 (eg, 3, 4, 5, 6, 7, 8, 9, or 10) amino acids in length.

[0366] Exemplary jellyroll domain secondary structures are described in Example 47 and Figure 47 of WO 19 / 65995. In some embodiments, the ORF1 molecule comprises a region that includes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all) of the secondary structure elements (e.g., β-strands and / or α-helices) of any of the jellyroll domain secondary structures shown in Figure 47 of WO 19 / 65995.

[0367] Consensus ORF1 domain sequence In some embodiments, for example, an ORF1 molecule described herein comprises one or more of a jelly-roll domain, an N22 domain, and / or a C-terminal domain (CTD). In some embodiments, the jelly-roll domain comprises an amino acid sequence having a jelly-roll domain consensus sequence described herein (e.g., listed in any of Tables 37A-37C). In some embodiments, the N22 domain comprises an amino acid sequence having an N22 domain consensus sequence described herein (e.g., listed in any of Tables 37A-37C). In some embodiments, the CTD domain comprises an amino acid sequence having a CTD domain consensus sequence described herein (e.g., listed in any of Tables 37A-37C). In some embodiments, the ORF1 molecule described herein comprises one or more of a jelly-roll domain, an N22 domain, and / or a C-terminal domain (CTD ... a-b Amino acids listed under "a" include a contiguous series of amino acids, where the series includes at least a and at most b amino acids. In certain embodiments, the amino acids in the series are all the same. In other embodiments, the series includes at least 2 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21) different amino acids.

[0368] [Table 60]

[0369] [Table 61]

[0370] [Table 62]

[0371] In some embodiments, the jellyroll domain comprises a jellyroll domain amino acid sequence listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C, or an amino acid sequence having at least about 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the N22 domain comprises an N22 domain amino acid sequence listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C, or an amino acid sequence having at least about 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the CTD domain comprises a CTD domain amino acid sequence listed in any of Tables 21, 23, 25, 27, 29, 31, 33, 35, D2, D4, D6, D8, D10, or 37A-37C, or an amino acid sequence having at least about 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0372] Identification of ORF1 protein sequence In some embodiments, an Anellovirus ORF1 protein sequence, or a nucleic acid sequence encoding an ORF1 protein, can be identified from an Anellovirus genome (e.g., a putative Anellovirus genome identified by a nucleic acid sequencing technique, e.g., a deep sequencing technique). In some embodiments, the ORF1 protein sequence is identified by one or more (e.g., one, two, or all three) of the following selection criteria:

[0373] (i) Length Selection: Protein sequences (e.g., putative Anellovirus ORF1 sequences that meet the criteria set forth in (ii) or (iii) below) may be size-selected for greater than about 600 amino acid residues to identify putative Anellovirus ORF1 proteins. In some embodiments, Anellovirus ORF1 protein sequences are at least about 600, 650, 700, 750, 800, 850, 900, 950, or 1000 amino acid residues in length. In some embodiments, Alphatorquevirus ORF1 protein sequences are at least about 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 900, or 1000 amino acid residues in length. In some embodiments, the Betatorquevirus ORF1 protein sequence is at least about 650, 660, 670, 680, 690, 700, 750, 800, 900, or 1000 amino acid residues in length. In some embodiments, the Gammatorquevirus ORF1 protein sequence is at least about 650, 660, 670, 680, 690, 700, 750, 800, 900, or 1000 amino acid residues in length. In some embodiments, the nucleic acid sequence encoding the Anellovirus ORF1 protein is at least about 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 nucleotides in length. In some embodiments, the nucleic acid sequence encoding the Alphatorquevirus ORF1 protein sequence is at least about 2100, 2150, 2200, 2250, 2300, 2400, or 2500 nucleotides in length. In some embodiments, the nucleic acid sequence encoding the Betatorquevirus ORF1 protein sequence is at least about 1900, 1950, 2000, 2500, 2100, 2150, 2200, 2250, 2300, 2400, or 2500 or 1000 nucleotides in length.In some embodiments, the nucleic acid sequence encoding the Gammatorquevirus ORF1 protein sequence is at least about 1900, 1950, 2000, 2500, 2100, 2150, 2200, 2250, 2300, 2400, or 2500 or 1000 nucleotides in length.

[0374] (ii) Presence of an ORF1 motif: Protein sequences (e.g., putative Anellovirus ORF1 sequences that meet the criteria set forth in (i) above or (iii) below) can be filtered to identify those that contain the conserved ORF1 motif in the N22 domain described above. In some embodiments, a putative Anellovirus ORF1 sequence comprises the sequence YNPXXDXGXXN. In some embodiments, a putative Anellovirus ORF1 sequence comprises the sequence Y[NCS]PXXDX[GASKR]XX[NTSVAK].

[0375] (iii) Presence of Arginine-Rich Regions: Protein sequences (e.g., putative Anellovirus ORF1 sequences that meet the criteria set forth in (i) and / or (ii) above) can be filtered for those that contain arginine-rich regions (e.g., as described herein). In some embodiments, the putative Anellovirus ORF1 sequence comprises a contiguous sequence of at least about 30, 35, 40, 45, 50, 55, 60, 65, or 70 amino acids that contain at least 30% (e.g., at least about 20%, 25%, 30%, 35%, 40%, 45%, or 50%) arginine residues. In some embodiments, the putative Anellovirus ORF1 sequence comprises a contiguous sequence of about 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, or 65-70 amino acids that contains at least 30% (e.g., at least about 20%, 25%, 30%, 35%, 40%, 45%, or 50%) arginine residues. In some embodiments, the arginine-rich region is located at least about 30, 40, 50, 60, 70, or 80 amino acids downstream of the start codon of the putative Anellovirus ORF1 protein. In some embodiments, the arginine-rich region is located at least about 50 amino acids downstream of the start codon of the putative Anellovirus ORF1 protein.

[0376] ORF2 molecule In some embodiments, the anaerovector comprises an ORF2 molecule and / or a nucleic acid encoding an ORF2 molecule. Generally, the ORF2 molecule comprises a polypeptide having structural characteristics and / or activity of an Anellovirus ORF2 protein (e.g., an Anellovirus ORF2 protein listed in any of Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18 described herein), or a functional fragment thereof. In some embodiments, the ORF2 molecule comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF2 protein sequence set forth in any of Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0377] In some embodiments, the ORF2 molecule comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to an Alphatorquevirus, Betatorquevirus, or Gammatorquevirus ORF2 protein, e.g., as described herein. In some embodiments, the ORF2 molecule (e.g., an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to an Alphatorquevirus ORF2 protein) has a length of 250 amino acids or less (e.g., about 150-200 amino acids). In some embodiments, the ORF2 molecule (e.g., an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a Betatorquevirus ORF2 protein) has a length of about 50-150 amino acids. In some embodiments, the ORF2 molecule (e.g., an ORF2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a Gammatorquevirus ORF2 protein) has a length of about 100-200 amino acids (e.g., about 100-150 amino acids). In some embodiments, the ORF2 molecule includes a helix-turn-helix motif (e.g., a helix-turn-helix motif including two alpha helices flanking a turn region). In some embodiments, the ORF2 molecule comprises the amino acid sequence of the ORF2 protein of TTV isolate TA278 or TTV isolate SANBAN. In some embodiments, the ORF2 molecule has protein phosphatase activity.In some embodiments, the ORF2 molecule or a nucleic acid molecule encoding it contains at least one difference (e.g., a mutation, chemical modification, or epigenetic alteration) compared to a wild-type ORF2 protein described herein (e.g., in Tables A2, A4, A6, A8, A10, A12, C1-C5, 2, 4, 6, 8, 10, 12, 14, 16, or 18).

[0378] Conserved ORF2 motif In some embodiments, the polypeptides described herein (e.g., ORF2 motifs) have the amino acid sequence [W / F]X 7 HX 3 CX 1 CX 5 H (SEQ ID NO: 949), where X n is a contiguous sequence of any n amino acids. In some embodiments, X 7 represents any consecutive sequence of 7 amino acids. 3 represents any consecutive sequence of 3 amino acids. 1 represents any single amino acid. In some embodiments, X 5 represents any sequence of 5 consecutive amino acids. In some embodiments, [W / F] can be either tryptophan or phenylalanine. In some embodiments, [W / F]X 7 HX 3 CX 1 CX 5 H (SEQ ID NO: 949), for example, is contained within the N22 domain of ORF2 described herein. In some embodiments, the genetic elements described herein have the amino acid sequence [W / F]X 7 HX 3 CX 1 CX 5 H(SEQ ID NO:949)(X n is a contiguous sequence of any n amino acids (eg, a nucleic acid sequence encoding an ORF2 molecule, as described herein).

[0379] Genetic elements In some embodiments, the anelovectin comprises a genetic element. In some embodiments, the genetic element has one or more of the following characteristics: does not substantially interact with the host cell genome, is an episomal nucleic acid, is single stranded DNA, is circular, is about 1-10 kb, is present in the nucleus of the cell, can be bound by endogenous proteins, produces an effector such as a polypeptide or nucleic acid (e.g., RNA, iRNA, microRNA) that targets a gene, activity, or function of the host or target cell. In one embodiment, the genetic element is substantially non-interactive. In some embodiments, the genetic element comprises a packaging signal, e.g., a sequence that binds to a capsid protein. In some embodiments, outside the packaging or capsid binding sequences, the genetic elements have less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% sequence identity to a wild-type Anellovirus nucleic acid sequence, for example, less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% sequence identity to an Anellovirus nucleic acid sequence described herein. In some embodiments, outside the packaging or capsid binding sequences, the genetic elements have less than 500, 450, 400, 350, 300, 250, 200, 150, or 100 contiguous nucleotides that are at least 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to an Anellovirus nucleic acid sequence.

[0380] In some embodiments the genetic elements have a length of less than 20kb (e.g. less than about 19kb, 18kb, 17kb, 16kb, 15kb, 14kb, 13kb, 12kb, 11kb, 10kb, 9kb, 8kb, 7kb, 6kb, 5kb, 4kb, 3kb, 2kb, 1kb). In some embodiments the genetic elements independently or in addition have a length of more than 1000b (e.g. at least about 1.1kb, 1.2kb, 1.3kb, 1.4kb, 1.5kb, 1.6kb, 1.7kb, 1.8kb, 1.9kb, 2kb, 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb). kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, 3.8 kb, 3.9 kb, 4 kb, 4.1 kb, 4.2 kb, 4.3 kb, 4.4 kb, 4.5 kb, 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5 kb or more) in length). In some embodiments the genetic element has a length of about 2.5-4.6, 2.8-4.0, 3.0-3.8 or 3.2-3.7 kb. In some embodiments the genetic element has a length of about 1.5-2.0, 1.5-2.5, 1.5-3.0, 1.5-3.5, 1.5-3.8, 1.5-3.9, 1.5-4.0, 1.5-4.5, or 1.5-5.0 kb. In some embodiments the genetic element has a length of about 2.0-2.5, 2.0-3.0, 2.0-3.5, 2.0-3.8, 2.0-3.9, 2.0-4.0, 2.0-4.5, or 2.0-5.0 kb. In some embodiments the genetic element has a length of about 2.5-3.0, 2.5-3.5, 2.5-3.8, 2.5-3.9, 2.5-4.0, 2.5-4.5, or 2.5-5.0 kb. In some embodiments, the genetic element has a length of about 3.0-5.0, 3.5-5.0, 4.0-5.0, or 4.5-5.0 kb. In some embodiments, the genetic element has a length of about 1.5-2.0, 2.0-2.5, 2.5-3.0, 3.0-3.5, 3.1-3.6, 3.2-3.7, 3.3-3.8, 3.4-3.9, 3.5-4.0, 4.0-4.5 kb, or 4.5-5.0 kb. In some embodiments, the genetic element has a length of about 3.6-3.9 kb.In some embodiments the genetic element has a length of about 2.8-2.9 kb, hi some embodiments the genetic element has a length of about 2.0-3.2 kb.

[0381] In some embodiments the genetic elements comprise one or more of the features described herein, e.g. a sequence encoding a substantially non-pathogenic protein, a protein binding sequence, one or more sequences encoding a regulatory sequence, one or more regulatory sequences, one or more sequences encoding a replication protein, and other sequences.

[0382] In some embodiments, the genetic element is produced (eg produced by transcription) from double stranded circular DNA.

[0383] In some embodiments, the genetic elements do not include one or more bacterial plasmid elements (e.g. a bacterial origin of replication or a selection marker, e.g. a bacterial resistance gene). In some embodiments, the genetic elements do not include a bacterial plasmid backbone.

[0384] In some embodiments, the disclosure includes a genetic element comprising a nucleic acid sequence (e.g., an RNA sequence) encoding (i) a substantially non-pathogenic foreign protein, (ii) an foreign protein binding sequence that binds the genetic element to the substantially non-pathogenic foreign protein, and (iii) a regulatory nucleic acid. In such embodiments, the genetic element may comprise one or more sequences having at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% nucleotide sequence identity to any one of the nucleotide sequences compared to a native viral sequence (e.g., a native Anellovirus sequence, e.g., as described herein).

[0385] Protein Binding Sequences In some embodiments, the genetic element encodes a protein binding sequence that binds to a substantially non-pathogenic protein. In some embodiments, the protein binding sequence promotes packaging of the genetic element into a proteinaceous outer layer. In some embodiments, the protein binding sequence specifically binds to an arginine-rich region of the substantially non-pathogenic protein. In some embodiments, the genetic element comprises a protein binding sequence as described in Example 8 of WO 19 / 65995.

[0386] In some embodiments the genetic element comprises a protein binding sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a 5'UTR conserved domain or GC-rich region of an Anellovirus sequence, for example as described herein.

[0387] In embodiments, the protein binding sequence has at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR conserved domain nucleotide sequence, e.g., as described herein.

[0388] 5'UTR region In some embodiments, a nucleic acid molecule as described herein (e.g. a genetic element, genetic element construct, or genetic element region) comprises a 5'UTR sequence, such as a 5'UTR conserved domain sequence as described herein (e.g. as described in any of Tables A1, B1, or C1), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0389] In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTGAAACACCGAAGTCAAGGGGCAATTCGGGCTAGGGGX1CAGTCT, or a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTGAAACACCGAAGTCAAGGGGCAATTCGGGCTAGGGGX1CAGTCT, or a nucleic acid sequence having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide differences (e.g., substitutions, deletions, or additions) compared thereto. In some embodiments, X1 is A. In some embodiments, X1 is absent.

[0390] In some embodiments, the 5'UTR sequence comprises a nucleic acid sequence of the 5'UTR of Alphatorquevirus (e.g., Ring1), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In several embodiments, the 5'UTR sequence comprises a nucleic acid sequence of a 5'UTR conserved domain listed in Table A1, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95% sequence identity to a 5'UTR conserved domain listed in Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95.775% sequence identity to a 5'UTR conserved domain listed in Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 97% sequence identity to the 5'UTR conserved domains listed in Table A1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 97.183% sequence identity to the 5'UTR conserved domains listed in Table A1. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTTTACACACCGCAGTCAAGGGGCAATTCGGGCTCGGGACTGGC, or a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTTTACACACCGCAGTCAAGGGGCAATTCGGGCTCGGGACTGGC, or a nucleic acid sequence having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide differences (e.g., substitutions, deletions, or additions) compared thereto.

[0391] In some embodiments, the 5'UTR sequence comprises a nucleic acid sequence of the 5'UTR of Betatorquevirus (e.g., Ring2), or a sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In several embodiments, the 5'UTR sequence comprises a nucleic acid sequence of a 5'UTR conserved domain listed in Table B1, or a sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 85% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 87% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 87.324% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 88% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 88.732% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 91% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 91.549% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 92% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 92.958% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 94% sequence identity to the 5'UTR conserved domains listed in Table B1.In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 94.366% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95.775% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 97% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 97.183% sequence identity to the 5'UTR conserved domains listed in Table B1. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTGAAACACCGAAGTCAAGGGGCAATTCGGGCTAGATCAGTCT, or a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTGAAACACCGAAGTCAAGGGGCAATTCGGGCTAGATCAGTCT, or a nucleic acid sequence having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide differences (e.g., substitutions, deletions, or additions) compared thereto.

[0392] In some embodiments, the 5'UTR sequence comprises a nucleic acid sequence of the 5'UTR of Gammatorquevirus (e.g., Ring4), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In several embodiments, the 5'UTR sequence comprises a nucleic acid sequence of a 5'UTR conserved domain listed in Table C1, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 97% sequence identity to a 5'UTR conserved domain listed in Table C1. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 97.183% sequence identity to a 5'UTR conserved domain listed in Table C1. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTGAAAACCACCGAGGTCTAGGGGCAATTCGGGCTAGGGCAGTCT, or a nucleic acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the 5'UTR sequence comprises the nucleic acid sequence AGGTGAGTGAAAACCACCGAGGTCTAGGGGCAATTCGGGCTAGGGCAGTCT, or a nucleic acid sequence having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide differences (e.g., substitutions, deletions, or additions) compared thereto.

[0393] In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a 5'UTR sequence of an Anellovirus, e.g., a nucleic acid sequence set forth in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence of a consensus 5'UTR sequence set forth in Table 38, where X1, X2, X3, X4, and X5 are each independently any nucleotide, e.g., X1=G or T, X2=C or A, X3=G or A, X4=T or C, and X5=A, C, or T). In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the consensus 5'UTR sequences shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the exemplary TTV 5'UTR sequences shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-CT30F 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-HD23a 5'UTR sequence shown in Table 38.In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-JA20 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-TJN02 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g. the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g. at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-tth8 5'UTR sequences shown in Table 38.

[0394] In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the Alphatorquevirus consensus 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the Alphatorquevirus clade 1 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus clade 2 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus clade 3 5'UTR sequence shown in Table 38. In embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus Clade 4 5'UTR sequence shown in Table 38.In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus Clade 5 5'UTR sequence shown in Table 38. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus Clade 6 5'UTR sequence shown in Table 38. In embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus Clade 7 5'UTR sequence shown in Table 38.

[0395] [Table 63]

[0396] [Table 64]

[0397] Identification of 5'UTR sequences In some embodiments, an Anellovirus 5'UTR sequence can be identified within an Anellovirus genome (e.g., a putative Anellovirus genome identified by a nucleic acid sequencing technique, e.g., a deep sequencing technique). In some embodiments, an Anellovirus 5'UTR sequence is identified by one or both of the following steps:

[0398] (i) Identification of circularization junction: In some embodiments, the 5'UTR will be located near the circularization junction of the full-length circularized Anellovirus genome. The circularization junction can be identified, for example, by identifying a region of sequence overlap. In some embodiments, the region of sequence overlap can be excised from the sequence to produce a circularized full-length Anellovirus genome sequence. In some embodiments, the genome sequence is circularized in this manner using software. Without intending to be bound by theory, computationally circularizing the genome can non-biologically orient the start of the sequence. Landmarks in the sequence can be used to re-orient the sequence in the appropriate direction. For example, a landmark sequence can include a sequence having substantial homology to one or more elements within an Anellovirus genome as described herein (e.g., one or more of an Anellovirus TATA box, initiation element, cap site, transcription start site, 5'UTR conserved domain, ORF1, ORF1 / 1, ORF1 / 2, ORF2, ORF2 / 2, ORF2 / 3, ORF2t / 3, 3 open reading frame regions, poly(A) signal, or GC-rich region, e.g., as described herein).

[0399] (ii) Identification of 5'UTR Sequences: Once a putative Anellovirus genomic sequence is obtained, the sequence (or a portion thereof, e.g., having a length of about 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides) can be compared to one or more Anellovirus 5'UTR sequences (e.g., as described herein) to identify sequences having substantial homology thereto. In some embodiments, a putative Anellovirus 5'UTR region has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus 5'UTR sequence as described herein.

[0400] GC-rich regions In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a nucleic acid sequence shown in Table 39. In several embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a GC rich sequence shown in Table 39.

[0401] In some embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a 36 nucleotide GC rich sequence set forth in Table 39 (e.g., a 36 nucleotide consensus GC rich region sequence 1, a 36 nucleotide consensus GC rich region sequence 2, a TTV clade 1 36 nucleotide region, a TTV clade 3 36 nucleotide region, a TTV clade 3 isolate GH1 36 nucleotide region, a TTV clade 3 sle1932 36 nucleotide region, a TTV clade 4 ctdc002 36 nucleotide region, a TTV clade 5 36 nucleotide region, a TTV clade 6 36 nucleotide region, or a TTV clade 7 36 nucleotide region). In embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence that comprises at least 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, or 36 contiguous nucleotides of a 36 nucleotide GC rich sequence set forth in Table 39 (e.g., a 36 nucleotide consensus GC rich region sequence 1, a 36 nucleotide consensus GC rich region sequence 2, a TTV clade 1 36 nucleotide region, a TTV clade 3 36 nucleotide region, a TTV clade 3 isolate GH1 36 nucleotide region, a TTV clade 3 sle1932 36 nucleotide region, a TTV clade 4 ctdc002 36 nucleotide region, a TTV clade 5 36 nucleotide region, a TTV clade 6 36 nucleotide region, or a TTV clade 7 36 nucleotide region).

[0402] In embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an Alphatorquevirus GC rich region sequence selected from, e.g., TTV-CT30F, TTV-P13-1, TTV-tth8, TTV-HD20a, TTV-16, TTV-TJN02, or TTV-HD16d, e.g., as shown in Table 39. In embodiments the genetic element (e.g. the protein binding sequence of the genetic element) comprises at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 104, 105, 108, 110, 111, 115, 120, 122, 130, 140, 145, 150, 155, or 156 contiguous nucleotides of an Alphatorquevirus GC rich region sequence selected from, e.g., TTV-CT30F, TTV-P13-1, TTV-tth8, TTV-HD20a, TTV-16, TTV-TJN02, or TTV-HD16d, e.g., as shown in Table 39.

[0403] In some embodiments, the 36 nucleotide GC rich region is (i) CGCGCTGCGCGCCGCCCAGTAGGGGGAGCCATGC (SEQ ID NO: 160); (ii) GCGCTX1CGCGCGCGCCGGGGGGCTGCGCCCCCCC (SEQ ID NO: 164) (X1 is selected from T, G, or A) (iii) GCGCTTCGCCGCCGCCCACTAGGGGGCGTTGCGCCG (SEQ ID NO: 165); (iv) GCGCTGCGCCGCCGCCCAGTAGGGGGCGCAATGCG (SEQ ID NO: 166); (v) GCGCTGCGCCGCGGCCCCCGGGGGAGGCATTGCCT (SEQ ID NO: 167); (vi)GCGCTGCGCGCGCGCGCCGGGGGGGCGCCAGCGCCC (SEQ ID NO: 168); (vii) GCGCTTCGCGCGCGCGCCGGGGGGCTCCGCCCCCCC (SEQ ID NO: 169); (viii) GCGCTTCGCGCGCGCGCCGGGGGGCTGCGCCCCCCC (SEQ ID NO: 170); (ix) GCGCTACGCGCCGCGCGCCGGGGGGCTGCGCCCCCCC (SEQ ID NO: 171); or (x) GCGCTACGCCGCGCGCCGGGGGGCTCTGCCCCCCC (SEQ ID NO: 172); is selected from.

[0404] In some embodiments the genetic element (eg the protein binding sequence of the genetic element) comprises the nucleic acid sequence CGCGCTGCGCGCGCCGCCCAGTAGGGGGAGCCATGC (SEQ ID NO: 160).

[0405] In some embodiments, the genetic element (e.g. the protein binding sequence of the genetic element) comprises a nucleic acid sequence of a consensus GC-rich sequence as shown in Table 39, wherein X4, X5, X6, X7, X8, X9, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X20, X21, X22, X23, X24, X25, X26, X27, X28, X29, X30, X31, X32, X33, X34, X35, X36, X37, X38, X40, X41, X42, X43, X44, X45, X46, X47, X48, X50, X51, X52, X53, X54, X55, X66, X77, X88, X99, X101, X112, X113, X123, X134, X145, X155, X166, X177, X189, X196, X197, X198, X199, X201, X210, X221, X235, X245, X365, X376, X48, X55, X67, X78, X89, X99, X101, X112, X113, X124, X135, X145, X156, X167, X179, X181, X199, X202, X213, X222, X235, X245, X376, X382, X390, X391, X392, X41, X42, X55, X56, X67, X78, 12 , X 13 , X 14 , X 15 , X 20 , X 21 , X 22 , X 26 , X 29、 X 30 , and X 33 are each independently any nucleotide, and X2, X3, X8, X9, X 10 , X 11 , X 16 , X 17 , X 18 , X 19 , X 23 , X 24 , X 25 , X 27 , X 28 , X 31 , X 32 , and X 34are each independently absent or any nucleotide. 34one or more (e.g. all) of are each independently a nucleotide (or absent) set forth in Table 39. In some embodiments, a genetic element (e.g. a protein binding sequence of a genetic element) comprises a nucleic acid sequence having at least about 75% (e.g. at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an exemplary TTV GC-rich sequence set forth in Table 39 (e.g. the entire sequence, fragment 1, fragment 2, fragment 3, or any combination thereof, e.g. fragments 1-3, in order). In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-CT30F GC-rich sequence shown in Table 39 (e.g., the entire sequence, fragment 1, fragment 2, fragment 3, fragment 4, fragment 5, fragment 6, fragment 7, fragment 8, or any combination thereof, e.g., fragments 1-7, in order). In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a TTV-HD23a GC-rich sequence shown in Table 39 (e.g., the entire sequence, fragment 1, fragment 2, fragment 3, fragment 4, fragment 5, fragment 6, or any combination thereof, e.g., fragments 1-6, in order). In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-JA20 GC-rich sequence shown in Table 39 (e.g., the entire sequence, fragment 1, fragment 2, or any combination thereof, e.g., fragment 1 and 2, in order).In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a TTV-TJN02 GC-rich sequence shown in Table 39 (e.g., the entire sequence, fragment 1, fragment 2, fragment 3, fragment 4, fragment 5, fragment 6, fragment 7, fragment 8, or any combination thereof, e.g., fragments 1-8, in order). In some embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the TTV-tth8 GC rich sequence shown in Table 39 (e.g., the entire sequence, fragment 1, fragment 2, fragment 3, fragment 4, fragment 5, fragment 6, fragment 7, fragment 8, fragment 9, or any combination thereof, e.g., fragments 1-6, in order). In some embodiments, the genetic element (e.g., a protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to fragment 7 shown in Table 39. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to fragment 8 shown in Table 39. In some embodiments, the genetic element (e.g., the protein binding sequence of the genetic element) comprises a nucleic acid sequence having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to fragment 9 shown in Table 39.

[0406] [Table 65]

[0407] [Table 66]

[0408] [Table 67]

[0409] [Table 68]

[0410] [Table 69]

[0411] [Table 70]

[0412] [Table 71]

[0413] [Table 72]

[0414] effector In some embodiments, the genetic element may be, for example, a functional effector, for example an endogenous or exogenous effector, for example a therapeutic polypeptide or nucleic acid, for example a cytotoxic or cytolytic RNA or protein, or may include one or more sequences encoding an effector. In some embodiments, the functional nucleic acid is a non-coding RNA. In some embodiments, the functional nucleic acid is a coding RNA. The effector may modulate a biological activity, for example, increasing or decreasing an enzyme activity, gene expression, cell signaling, and cell or organ function. Effector activity may also include binding to a regulatory protein to modulate the activity of a regulator, such as transcription or translation. Effector activity may also include activator or inhibitor function. For example, an effector may induce an enzyme activity by triggering increased substrate affinity in an enzyme, for example fructose 2,6-bisphosphate activates phosphofructokinase 1 to increase the rate of glycolysis in response to insulin. In another example, an effector can inhibit the substrate from binding to the receptor, blocking its activation, for example, naltrexone and naloxone bind to opioid receptors without activating them, blocking the receptor's ability to bind opioids. Effector activity can also include modulation of protein stability / degradation and / or transcript stability / degradation. For example, proteins can be targeted for degradation by a polypeptide cofactor, ubiquitin, on the protein, marking them for degradation. In another example, an effector inhibits enzyme activity by blocking the active site of the enzyme, for example, methotrexate is a structural analog of tetrahydrofolate, i.e., a coenzyme of the enzyme dihydrofolate reductase, which binds to dihydrofolate reductase more than 1000-fold stronger than the natural substrate, inhibiting nucleotide base synthesis.

[0415] In some embodiments, the sequence encoding the effector comprises 100-2000, 100-1000, 100-500, 100-200, 200-2000, 200-1000, 200-500, 500-1000, 500-2000, or 1000-2000 nucleotides. In some embodiments, the effector is a nucleic acid or protein payload, e.g., as described herein.

[0416] regulatory nucleic acids In some embodiments, the effector is a regulatory nucleic acid. The regulatory nucleic acid modulates the expression of an endogenous gene and / or an exogenous gene. In one embodiment, the regulatory nucleic acid targets a host gene. Regulatory nucleic acids include, but are not limited to, nucleic acids that hybridize with an exogenous gene (e.g., miRNA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, gRNA, as described elsewhere herein), nucleic acids that hybridize with an exogenous nucleic acid such as viral DNA or RNA, nucleic acids that hybridize with RNA, nucleic acids that disrupt gene transcription, nucleic acids that disrupt RNA translation, nucleic acids that stabilize or destabilize RNA, such as by targeting degradation, and nucleic acids that regulate DNA or RNA binding factors. In some embodiments, the regulatory nucleic acid encodes a miRNA. In some embodiments, the regulatory nucleic acid is endogenous to the wild-type Anellovirus. In some embodiments, the regulatory nucleic acid is exogenous to the wild-type Anellovirus.

[0417] In some embodiments, the regulatory nucleic acid comprises an RNA or RNA-like structure that typically contains 5-500 base pairs (depending on the particular RNA structure, e.g., miRNA 5-30 bp, lncRNA 200-500 bp) and may have a nucleobase sequence that is identical (or complementary) or nearly identical (or substantially complementary) to a coding sequence in an expressed target gene in a cell, or a sequence that encodes an expressed target gene in a cell.

[0418] In some embodiments, the regulatory nucleic acid comprises a nucleic acid sequence, e.g., a guide RNA (gRNA). In some embodiments, the DNA targeting moiety comprises a guide RNA or a nucleic acid encoding a guide RNA. The short synthetic RNA of the gRNA may consist of a "scaffold" sequence required to bind to the incomplete effector moiety and a user-defined targeting sequence of about 20 nucleotides to the genomic target. In practice, guide RNA sequences are generally designed to have a length of 17-24 nucleotides (e.g., 19, 20, or 21 nucleotides) and are complementary to the targeting nucleic acid sequence. Custom gRNA generation machines and algorithms are commercially available for use in designing effective guide RNAs. Gene editing has also been achieved using chimeric "single guide RNAs" ("sgRNAs"), which are engineered (synthetic) single RNA molecules that mimic the naturally occurring crRNA-tracrRNA complex and contain both tracrRNA (which binds to nucleases) and at least one crRNA (which guides the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective for genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985-991.

[0419] Regulatory nucleic acids include gRNAs that recognize specific DNA sequences (e.g., sequences adjacent to or within a gene's promoter, enhancer, silencer, or repressor).

[0420] Some regulatory nucleic acids can inhibit gene expression by the biological process of RNA interference (RNAi). RNAi molecules typically contain 15-50 base pairs (e.g., about 18-25 base pairs) and comprise RNA or RNA-like structures with identical (complementary) or nearly identical (substantially complementary) nucleobase sequences to coding sequences in expressed target genes in cells. RNAi molecules include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), small hairpin RNA (shRNA), meroduplex, and dicer substrates (U.S. Pat. Nos. 8,084,599, 8,349,809, and 8,513,207).

[0421] Long non-coding RNAs (lncRNAs) are defined as non-protein-coding transcripts longer than 100 nucleotides. This somewhat arbitrary restriction distinguishes lncRNAs from small regulatory RNAs such as microRNAs (miRNAs), small interfering RNAs (siRNAs), and other small RNAs. In general, the majority of lncRNAs (about 78%) are characterized as tissue-specific. Branched lncRNAs (which account for a significant proportion of all lncRNAs in mammalian genomes, about 20%) that are transcribed in the opposite direction to adjacent protein-coding genes are likely to regulate the transcription of adjacent genes.

[0422] A genetic element encodes a regulatory nucleic acid having a sequence that is substantially complementary or completely complementary to all or a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acid can complement sequences at boundaries between introns and exons to prevent the nascent nuclear RNA transcript of a particular gene from maturing into an mRNA for transcription. A regulatory nucleic acid complementary to a particular gene hybridizes with the mRNA of that gene to prevent its translation. An antisense regulatory nucleic acid can be DNA, RNA, or derivatives or hybrids thereof.

[0423] The length of the regulatory nucleic acid that hybridizes to the transcript of interest can be 5-30 nucleotides, about 10-30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The percent identity of the regulatory nucleic acid to the target transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0424] The genetic element may encode a regulatory nucleic acid, e.g., a microRNA (miRNA) molecule identical to about 5 to about 25 contiguous nucleotides of the target gene. In some embodiments, the miRNA sequence targets an mRNA, starts with the dinucleotide AA, contains about 30-70% (about 30-60%, about 40-60%, or about 45%-55%) GC content, and does not have a high percent identity to any non-target nucleotide sequences in the genome of the mammal into which it is to be introduced, as determined, e.g., by a standard BLAST search.

[0425] siRNA and shRNA are similar to intermediates in the processing pathway of endogenous microRNA (miRNA) genes (Bartel, Cell 116:281-297, 2004). In some embodiments, siRNA can function as miRNA and vice versa (Zeng et al., Mol Cell 9:1327-1333, 2002; Doench et al., Genes Dev 17:438-442, 2003). MicroRNAs, like siRNAs, use RISC to downregulate target genes, but unlike siRNAs, most animal miRNAs do not cleave mRNAs. Instead, miRNAs reduce protein production by translational repression or polyA removal and mRNA degradation (Wu et al., Proc Natl Acad Sci USA 103:4034-4039, 2006). Known miRNA binding sites are within the mRNA 3'UTR; miRNAs appear to target sites with near perfect complementarity to nucleotides 2-8 from the 5' end of the miRNA (Rajewsky, Nat Genet 38 Suppl:S8-13, 2006; Lim et al., Nature 433:769-773, 2005). This region is known as the seed region. Because siRNAs and miRNAs are replaceable, exogenous siRNAs downregulate mRNAs with seed complementarity to the siRNA (Birmingham et al., Nat Methods 3:199-204, 2006. Multiple target sites within the 3'UTR confer stronger downregulation (Doench et al., Genes Dev 17:438-442, 2003).

[0426] Lists of known miRNA sequences can be found in databases maintained by research institutions such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, the Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well described in the relevant literature. RNAi molecules are easily designed and produced by techniques known in the art. In addition, there are computational tools that increase the chances of finding effective and specific sequence motifs (Lagana et al., Methods Mol. Bio., 2015, 1269:393-412).

[0427] The regulatory nucleic acid can regulate the expression of the RNA encoded by the gene. In some embodiments, since multiple genes share a degree of sequence homology with each other, the regulatory nucleic acid can be designed to target a class of genes with sufficient sequence homology. In some embodiments, the regulatory nucleic acid can include a sequence that is shared among various gene targets or has complementarity to a sequence that is unique for a particular gene target. In some embodiments, the regulatory nucleic acid can be designed to target a conserved region of RNA sequence that has homology among several genes, thereby targeting several genes within a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the regulatory nucleic acid can be designed to target a sequence that is unique to a particular RNA sequence of a single gene.

[0428] In some embodiments the genetic elements may comprise one or more sequences encoding regulatory nucleic acids that regulate expression of one or more genes.

[0429] In some embodiments, gRNA described elsewhere herein is used as part of a CRISPR system for gene editing.For gene editing purposes, anellovectors can be designed to contain one or more guide RNA sequences corresponding to desired target DNA sequences; see, for example, Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308.Generally, at least about 16 or 17 nucleotides of gRNA allow Cas9-mediated DNA cleavage; in the case of Cpf1, at least about 16 nucleotides of gRNA sequence are required to achieve detectable DNA cleavage.

[0430] Therapeutic effectors (e.g., peptides or polypeptides) In some embodiments, the genetic element comprises a therapeutic expression sequence, e.g., a sequence encoding a therapeutic peptide or polypeptide, e.g., an intracellular peptide or polypeptide, a secreted polypeptide, or a protein replacement therapeutic. In some embodiments, the genetic element comprises a sequence encoding a protein, e.g., a therapeutic protein. Some examples of therapeutic proteins include, but are not limited to, hormones, cytokines, enzymes, antibodies (e.g., one or more polypeptides encoding at least a heavy or light chain), transcription factors, receptors (e.g., membrane receptors), ligands, membrane transporters, secreted proteins, peptides, carrier proteins, structural proteins, nucleases, or components thereof.

[0431] In some embodiments, the genetic element comprises a peptide, for example a therapeutic peptide. The peptide may be linear or branched. The peptide has a length of about 5 to about 500 amino acids, about 15 to about 400 amino acids, about 20 to about 325 amino acids, about 25 to about 250 amino acids, about 50 to about 200 amino acids, or any range therebetween.

[0432] In some embodiments, the polypeptide encoded by the therapeutic expression sequence may be a functional variant of any of the above or a fragment thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in the tables herein with reference to the UniProt ID.

[0433] In some embodiments, the therapeutic expression sequence may encode an antibody or antibody fragment that binds to any of the above, for example, an antibody to a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to the protein sequences disclosed in the tables herein with reference to the UniProt ID. The term "antibody" herein is used in the broadest sense to encompass a variety of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity. An "antibody fragment" refers to a molecule that contains at least one heavy or light chain and binds to an antigen. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.

[0434] Exemplary Intracellular Polypeptide Effectors In some embodiments, the effector comprises a cytosolic polypeptide or a cytosolic peptide. In some embodiments, the effector comprising a cytosolic peptide is a DPP-4 inhibitor, an activator of GLP-1 signaling, or an inhibitor of neutrophil elastase. In some embodiments, the effector increases the level or activity of a growth factor or its receptor (e.g., an FGF receptor, e.g., FGFR3). In some embodiments, the effector comprises an inhibitor of n-myc interacting protein activity (e.g., an n-myc interacting protein inhibitor); an inhibitor of EGFR activity (e.g., an EGFR inhibitor); an inhibitor of IDH1 and / or IDH2 activity (e.g., an IDH1 inhibitor and / or an IDH2 inhibitor); an inhibitor of LRP5 and / or DKK2 activity (e.g., an LRP5 and / or a DKK2 inhibitor); an inhibitor of KRAS activity; an activator of HTT activity; or an inhibitor of DPP-4 activity (e.g., a DPP-4 inhibitor).

[0435] In some embodiments, the effector comprises a regulatory intracellular polypeptide. In some embodiments, the regulatory intracellular polypeptide binds to one or more molecules (e.g., proteins or nucleic acids) endogenous to the target cell. In some embodiments, the regulatory intracellular polypeptide increases the level or activity of one or more molecules (e.g., proteins or nucleic acids) endogenous to the target cell. In some embodiments, the regulatory intracellular polypeptide decreases the level or activity of one or more molecules (e.g., proteins or nucleic acids) endogenous to the target cell.

[0436] Exemplary Secreted Polypeptide Effectors Exemplary secreted therapeutic agents are described herein, for example, in the Table below.

[0437] [Table 73]

[0438] [Table 74]

[0439] [Table 75]

[0440] In some embodiments, the effector described herein comprises a cytokine listed in Table 50, or a functional variant thereof, such as a homologue (e.g., ortholog or paralog) or fragment thereof. In some embodiments, the effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 50 with reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding cytokine receptor with a Kd that is 10%, 20%, 30%, 40%, or 50% or less higher or lower than the Kd of the corresponding wild-type cytokine for the same receptor under the same conditions. In some embodiments, the effector comprises a fusion protein comprising a first region (e.g., a cytokine polypeptide of Table 50 or a functional variant or fragment thereof) and a second heterologous region. In some embodiments, the first region is a first cytokine polypeptide of Table 50. In some embodiments, the second region is a second cytokine polypeptide of Table 50, where the first and second cytokine polypeptides form a cytokine heterodimer with each other in a wild-type cell. In some embodiments, the polypeptide of Table 50, or a functional variant thereof, comprises a signal sequence, e.g., a signal sequence endogenous to the effector, or a heterologous signal sequence. In some embodiments, an annelovector encoding a cytokine listed in Table 50, or a functional variant thereof, is used to treat a disease or disorder described herein.

[0441] In some embodiments, the effectors described herein comprise an antibody molecule (e.g., an scFv) that binds to a cytokine in Table 50. In some embodiments, the effectors described herein comprise an antibody molecule (e.g., an scFv) that binds to a cytokine receptor in Table 50. In some embodiments, the antibody molecule comprises a signal sequence.

[0442] Exemplary cytokines and cytokine receptors are described, for example, in Akdis et al., “Interleukins (from IL-1 to IL-38), interferons, transforming growth factor β, and TNF-α: Receptors, functions, and roles in diseases,” October 2016, Vol. 138, No. 4, pp. 984-1010, which is incorporated by reference herein in its entirety, including Table 1 therein.

[0443] [Table 76]

[0444] In some embodiments, the effectors described herein comprise a hormone listed in Table 51, or a functional variant thereof, e.g., a homologue (e.g., an ortholog or paralog) or fragment thereof. In some embodiments, the effectors described herein comprise a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 51, with reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd that is 10%, 20%, 30%, 40%, or 50% or less higher than the Kd of the corresponding wild-type hormone for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 51 or a functional variant thereof comprises a signal sequence, e.g., a signal sequence endogenous to the effector or a heterologous signal sequence. In some embodiments, an anelovectin encoding a hormone listed in Table 51, or a functional variant thereof, is used to treat a disease or disorder described herein.

[0445] In some embodiments, the effectors described herein comprise an antibody molecule (e.g., an scFv) that binds to a hormone in Table 51. In some embodiments, the effectors described herein comprise an antibody molecule (e.g., an scFv) that binds to a hormone receptor in Table 51. In some embodiments, the antibody molecule comprises a signal sequence.

[0446] [Table 77]

[0447] [Table 78]

[0448] [Table 79]

[0449] In some embodiments, the effectors described herein include a growth factor listed in Table 52, or a functional variant thereof, such as a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, the effectors described herein include a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 52 with reference to its UniProt ID. In some embodiments, a functional variant binds to a corresponding receptor with a Kd that is 10%, 20%, 30%, 40%, or 50% or less higher than the Kd of the corresponding wild-type growth factor for the same receptor under the same conditions. In some embodiments, a polypeptide of Table 52 or a functional variant thereof includes a signal sequence, e.g., a signal sequence endogenous to the effector or a heterologous signal sequence. In some embodiments, an anaerovector encoding a growth factor listed in Table 52, or a functional variant thereof, is used to treat a disease or disorder described herein.

[0450] In some embodiments, the effectors described herein comprise an antibody molecule (e.g., an scFv) that binds to a growth factor in Table 52. In some embodiments, the effectors described herein comprise an antibody molecule (e.g., an scFv) that binds to a growth factor receptor in Table 52. In some embodiments, the antibody molecule comprises a signal sequence.

[0451] Exemplary growth factors and growth factor receptors are described, for example, in Bafico et al., "Classification of Growth Factors and Their Receptors" Holland-Frei Cancer Medicine. 6th Edition, which is incorporated herein by reference in its entirety.

[0452] [Table 80]

[0453] In some embodiments, the effectors described herein comprise a polypeptide listed in Table 53, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, the effectors described herein comprise a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 53, with reference to its UniProt ID. In some embodiments, a functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at least 10%, 20%, 30%, 40%, or 50% slower than the wild-type protein. In some embodiments, a polypeptide of Table 53 or a functional variant thereof comprises a signal sequence, e.g., a signal sequence endogenous to the effector or a heterologous signal sequence. In some embodiments, an anaerovector encoding a polypeptide listed in Table 53, or a functional variant thereof, is used to treat a disease or disorder listed in Table 53.

[0454] Exemplary Protein Replacement Therapeutics Exemplary protein replacement therapeutics are described herein, for example, in the Table below.

[0455] [Table 81]

[0456] [Table 82]

[0457] [Table 83]

[0458] [Table 84]

[0459] [Table 85]

[0460] [Table 86]

[0461] [Table 87]

[0462] In some embodiments, the effectors described herein comprise an enzyme listed in Table 54, or a functional variant thereof, such as a homologue (e.g., ortholog or paralog) or fragment thereof. In some embodiments, the effectors described herein comprise a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 54, with reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at least 10%, 20%, 30%, 40%, or 50% slower than the wild-type protein. In some embodiments, an anaerovector encoding an enzyme in Table 54, or a functional variant thereof, is used to treat a disease or disorder in Table 54. In some embodiments, an anaerovector is used to deliver uridine diphosphate glucuronyl-transferase or a functional variant thereof to a target cell, e.g., a hepatocyte. In some embodiments, anellovectors are used to deliver OCA1 or a functional variant thereof to target cells, such as retinal cells.

[0463] [Table 88]

[0464] [Table 89]

[0465] [Table 90]

[0466] In some embodiments, the effector described herein comprises erythropoietin (EPO), e.g., human erythropoietin (hEPO), or a functional variant thereof. In some embodiments, an anelovectin encoding erythropoietin, or a functional variant thereof, is used to stimulate erythropoiesis. In some embodiments, an anelovectin encoding erythropoietin, or a functional variant thereof, is used to treat a disease or disorder, e.g., anemia. In some embodiments, an anelovectin is used to deliver EPO or a functional variant thereof to a target cell, e.g., an erythrocyte.

[0467] In some embodiments, the effectors described herein comprise a polypeptide as set forth in Table 55, or a functional variant thereof, e.g., a homolog (e.g., an ortholog or paralog) or fragment thereof. In some embodiments, the effectors described herein comprise a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 55, by reference to its UniProt ID. In some embodiments, an anelovectin encoding a polypeptide as set forth in Table 55, or a functional variant thereof, is used to treat a disease or disorder as set forth in Table 55. In some embodiments, the anelovectin is used to deliver SMN or a functional variant thereof to a target cell, e.g., a spinal cord and / or a motor neuron. In some embodiments, the anelovectin is used to deliver micro-dystrophin to a target cell, e.g., a muscle cell.

[0468] Exemplary micro-dystrophins are described in Duan, “Systemic AAV Micro-dystrophin Gene Therapy For Duchenne Muscular Dystrophy.” Mol Ther. 2018 Oct 3;26(10):2337-2356. doi:10.1016 / j.ymthe.2018.07.011. Epub 2018 Jul 17.

[0469] In some embodiments, an effector described herein comprises a clotting factor, e.g., a clotting factor listed in Table 54 or Table 55 herein. In some embodiments, an effector described herein comprises a protein that, when mutated, causes a lysosomal storage disease, e.g., a protein listed in Table A or Table B herein. In some embodiments, an effector described herein comprises a transport protein, e.g., a transport protein listed in Table B herein.

[0470] In some embodiments, a functional variant of a wild-type protein comprises a protein having one or more activities of the wild-type protein, e.g., a functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate at least 10%, 20%, 30%, 40%, or 50% lower than the wild-type protein. In some embodiments, a functional variant binds to the same binding partner as that bound by the wild-type protein, e.g., with a Kd that is at most 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type protein for the same binding partner under the same conditions. In some embodiments, a functional variant has a polypeptide sequence that is at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to that of the wild-type polypeptide. In some embodiments, a functional variant comprises a homolog (e.g., an ortholog or paralog) of the corresponding wild-type protein. In some embodiments, a functional variant is a fusion protein. In some embodiments, the fusion comprises a first region having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to a corresponding wild-type protein and a second, heterologous region. In some embodiments, the functional variant comprises or consists of a fragment of the corresponding wild-type protein.

[0471] Regeneration, repair, and fibrosis factors Therapeutic polypeptides described herein also include, for example, growth factors as disclosed in Table 56, or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to the protein sequences disclosed in Table 56 with reference to the UniProt ID. Also included are antibodies or fragments thereof to such growth factors, or miRNAs that promote regeneration and repair.

[0472] [Table 91]

[0473] Transforming factors Therapeutic polypeptides described herein also include transforming factors, e.g., protein factors that transform fibroblasts into differentiated cells, e.g., factors disclosed in Table 57 or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to the protein sequences disclosed in Table 57 by reference to the UniProt ID.

[0474] [Table 92]

[0475] Proteins that stimulate cell regeneration Therapeutic polypeptides described herein also include proteins that stimulate cell regeneration, e.g., proteins disclosed in Table 58, or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to the protein sequences disclosed in Table 58 by reference to the UniProt ID.

[0476] [Table 93]

[0477] STING Modulator Effector In some embodiments, the secreted effectors described herein modulate STING / cGAS signaling. In some embodiments, the STING modulator is a polypeptide, e.g., a viral polypeptide or a functional variant thereof. For example, the effector may include a STING modulator (e.g., an inhibitor) described in Maringer et al. "Message in a bottle: lessons learned from antagonism of STING signalling during RNA viral infection" Cytokine & Growth Factor Reviews Vol. 25, No. 6, December 2014, pp. 669-679, which is incorporated herein by reference in its entirety. Additional STING modulators (e.g., activators) can be used in a variety of applications, including, for example, those described in Wang et al. “STING activator c-di-GMP enhances the anti-tumor effects of peptide vaccines in melanoma-bearing mice.” Cancer Immunol Immunother. 2015 Aug;64(8):1057-66.doi:10.1007 / s00262-015-1713-5.Epub 2015 May 19; Bose “cGAS / STING Pathway in Cancer: Jekyll and Hyde Story of Cancer Immune Response” Int J Mol Sci. 2017 Nov;18(11):2456; and Fu et al. “STING agonist formulated cancer vaccines can cure established tumors resistant to PD-1 blockade” Sci Transl. Med. 2015 Apr. 15;7(283):283ra52, each of which is incorporated by reference in its entirety.

[0478] Some examples of peptides include, but are not limited to, fluorescent tags or markers, antigens, peptide therapeutics, synthetic or analog peptides derived from natural bioactive peptides, agonist or antagonist peptides, antimicrobial peptides, targeting or cytotoxic peptides, degradative or self-destructive peptides, and degradative or self-destructive peptides. Peptides useful in the invention described herein also include antigen-binding peptides, such as antigen-binding antibodies or antibody-like fragments, such as single-chain antibodies, nanobodies (see, e.g., Steeland et al. 2016. Nanobodies as therapeutics: big opportunities for small antibodies. Drug Discov Today: 21(7): 1076-113). Such antigen-binding peptides may bind to cytosolic, nuclear, or intraorganellar antigens.

[0479] In some embodiments, the genetic elements include sequences encoding small peptides, peptidomimetics (e.g., peptoids), amino acids, and amino acid analogs. Such therapeutic agents generally have a molecular weight of less than about 5,000 grams per mole, less than about 2,000 grams per mole, less than about 1,000 grams per mole, less than about 500 grams per mole, as well as salts, esters, and other pharma- ceutically acceptable forms of such compounds. Such therapeutic agents include, but are not limited to, neurotransmitters, hormones, drugs, toxins, viral or microbial particles, synthetic particles, and agonists or antagonists thereof.

[0480] In some embodiments, a composition or anellovector described herein comprises a polypeptide linked to a ligand capable of targeting a specific location, tissue, or cell.

[0481] Gene editing constructs The genetic elements of the anaerovector may include one or more genes encoding a component of a gene editing system. Exemplary gene editing systems include the clustered regulatory interspaced short palindromic repeat (CRISPR) system, zinc finger nucleases (ZFNs), and transcription activator-like effector-based nucleases (TALENs). ZFN-, TALEN-, and CRISPR-based methods are described, for example, in Gaj et al. Trends Biotechnol. 31.7(2013):397-405; CRISPR methods of gene editing are described, for example, in: Guan et al., Application of CRISPR-Cas system in gene therapy: Pre-clinical progress in animal model. DNA Repair 2016 Oct;46:1-8. doi:10.1016 / j.dnarep.2016.07.004; Zheng et al., Precise gene deletion and replacement using the CRISPR / Cas9 system in human cells. BioTechniques, Vol. 57, No. 3, September 2014, pp. 115-124.

[0482] The CRISPR system is an adaptive defense system originally discovered in bacteria and archaea. CRISPR systems cleave foreign DNA using RNA-guided nucleases called CRISPR-associated or "Cas" endonucleases (e.g., Cas9 or Cpf1). In a typical CRISPR / Cas system, the endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome where sequence editing is to be performed) by a sequence-specific non-coding "guide RNA" that targets a single-stranded or double-stranded DNA sequence. Three classes (I-III) of CRISPR systems have been identified. Class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). Some class II CRISPR systems include a type II Cas endonuclease, such as Cas9, a CRISPR RNA ("crRNA"), and a trans-activating crRNA ("tracrRNA"). The crRNA includes a "guide RNA," typically a roughly 20-nucleotide RNA sequence that corresponds to the target DNA sequence. The crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure, which is cleaved by RNaseIII to form a crRNA / tracrRNA hybrid. The crRNA / tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be adjacent to a "protospacer adjacent motif" ("PAM") that is specific for a given Cas endonuclease; however, PAM sequences occur throughout a given genome.

[0483] In some embodiments, the annelovector comprises a gene for a CRISPR endonuclease. For example, several CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), and 5'-NNNGATT (Neisseria meningiditis). Some endonucleases, such as the Cas9 endonuclease, bind to G-rich PAM sites, such as 5'-NGG, and perform blunt-end cleavage of the target DNA at three nucleotide positions upstream from the PAM site (5' side of it). Another class II CRISPR system contains a V-type endonuclease Cpf1, which is smaller than Cas9; examples include AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp.). Cpf1 endonuclease binds to T-rich PAM sites, such as 5'-TTN. Cpf1 can also recognize 5'-CTA PAM motifs. Cpf1 cleaves target DNA by introducing offset or staggered double-stranded breaks with 4- or 5-nucleotide 5' overhangs, for example, cleaving the target DNA at a 5-nucleotide offset or staggered cut located 18 nucleotides downstream from the PAM site (on its 3' side) on the coding strand and 23 nucleotides downstream from the PAM site on the complementary strand; the 5-nucleotide overhangs generated by such offset cleavage allow for precise genome editing by DNA insertion via homologous recombination compared to insertion with blunt-end cut DNA. See, e.g., Zetsche et al. (2015) Cell, 163:759-771.

[0484] Various CRISPR-associated (Cas) genes may be contained in the annellvector. Specific examples of genes are those encoding Cas proteins from class II systems, including Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cpf1, C2C1, or C2C3. In some embodiments, the annellvector comprises a gene encoding a Cas protein, e.g., a Cas9 protein, which may be from any of a variety of prokaryotic species. In some embodiments, the annellvector comprises a gene encoding a specific Cas protein, e.g., a specific Cas9 protein, which is selected to recognize a specific protospacer adjacent motif (PAM) sequence. In some embodiments, the annellvector comprises a nucleic acid encoding two or more different Cas proteins, or two or more Cas proteins, and the annellvector may be introduced into a cell, zygote, embryo, or animal, for example, to allow recognition and modification of sites containing the same, similar, or different PAM motifs. In some embodiments, the annelovector comprises a gene encoding a modified Cas protein, including an inactivated nuclease, e.g., a nuclease-deleted Cas9.

[0485] Wild-type Cas9 protein generates double-strand breaks (DSBs) at the specific DNA sequence targeted by the gRNA, but several CRISPR endonucleases with modified functionality are known, for example, the "nickase" version of Cas endonucleases (e.g., Cas9) only generates single-strand breaks; catalytically inactive Cas endonucleases, e.g., Cas9 ("dCas9"), do not cleave the target DNA. Genes encoding dCas9 can be fused to genes encoding effector domains to suppress (CRISPRi) or activate (CRISPRa) expression of target genes. For example, genes can encode Cas9 fusions with transcriptional silencers (e.g., KRAB domains) or transcriptional activators (e.g., dCas9-VP64 fusions). A gene encoding catalytically inactive Cas9 (dCas9) fused to FokI nuclease ("dCas9-FokI") can be included to generate DSBs at target sequences homologous to the two gRNAs. See, for example, the numerous CRISPR / Cas9 plasmids disclosed and publicly available in the Addgene repository (Addgene, 75 Sidney St., Suite 550A, Cambridge, MA 02139; addgene.org / crispr / ). "Double-nickase" Cas9, which introduces two separate double-strand breaks, each directed by a separate guide RNA, has been described by Ran et al. (2013) Cell, 154:1380-1389 to achieve more precise genome editing.

[0486] CRISPR technology for editing genes in eukaryotic cells has been disclosed in the following: U.S. Patent Application Publication Nos. 2016 / 0138008A1 and 2015 / 0344912A1, and U.S. Pat. Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. The Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication No. 2016 / 0208243A1.

[0487] In some embodiments, the annelovector comprises a gene encoding a polypeptide described herein, e.g., a targeted nuclease, e.g., Cas9, e.g., wild-type Cas9, nickase Cas9 (e.g., Cas9 D10A), inactive Cas9 (dCas9), eSpCas9, Cpf1, C2C1, or C2C3, and a gRNA. The choice of gene encoding the nuclease and gRNA is determined by whether the targeted mutation is a deletion, substitution, or addition of nucleotides, e.g., a deletion, substitution, or addition of nucleotides to the targeted sequence. A gene encoding a catalytically inactive endonuclease, e.g., inactive Cas9 (dCas9, e.g., D10A; H840A), tethered with all or a portion (e.g., a biologically active portion thereof) of an effector domain(s) (e.g., VP64), produces a chimeric protein capable of modulating the activity and / or expression of one or more target nucleic acid sequences.

[0488] In some embodiments, the annellvector comprises a gene encoding a fusion of one or more effector domains, all or a portion thereof (e.g., a full-length wild-type effector domain, or a fragment or variant thereof, e.g., a biologically active portion thereof), with dCas9 to generate a chimeric protein useful in the methods described herein. Thus, in some embodiments, the annellvector comprises a gene encoding a dCas9-methylase fusion. In some other embodiments, the annellvector comprises a gene encoding a dCas9-enzyme fusion that includes a site-specific gRNA that targets an endogenous gene.

[0489] In other embodiments, the annelovector comprises a gene encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more effector domains (all or biologically active portions) fused to dCas9.

[0490] Regulatory Sequences In some embodiments the genetic element comprises a regulatory sequence, e.g. a promoter or enhancer, and is operably linked to a sequence encoding an effector. In some embodiments, the promoter may be absent from the genetic element, for example when the genetic element is an mRNA. In some embodiments the genetic element construct comprises a promoter that is used to drive production of the RNA genetic element.

[0491] In some embodiments, a promoter comprises a DNA sequence located adjacent to the DNA encoding the expression product. A promoter may be operably linked to adjacent DNA sequences. A promoter typically increases the amount of product expressed from a DNA sequence compared to the amount of product expressed in the absence of the promoter. A promoter from one organism can be used to increase the expression of a product from a DNA sequence from another organism. For example, a vertebrate promoter can be used to express jellyfish GFP in vertebrates. Thus, one promoter element can increase the expression of one or more products. A number of promoter elements are well known to those skilled in the art.

[0492] In one embodiment, high levels of constitutive expression are desired. Examples of such promoters include, but are not limited to, the retroviral Rous sarcoma virus (RVS) long terminal repeat (LTR) promoter / enhancer, the cytomegalovirus (CMV) intermediate-early promoter / enhancer (see, e.g., Boshart et al., Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the cytoplasmic β-actin promoter, and the phosphoglycerol kinase (PGK) promoter.

[0493] In another embodiment, an inducible promoter may be desired, which may be provided either in cis or trans and regulated by an exogenously supplied compound, including, but not limited to, the zinc-inducible sheep metallothionine (MT) promoter; the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; the T7 polymerase promoter system (WO 98 / 10088); the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)); the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995); see also, Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)); the RU486-inducible system (Wang et al., J. Immunol. 1999, 11:111-111 (1998 ...Wang et al., J. Immunol. 1999, 11:111-111 (1998)); the tetracycline-inducible system (Wang et al., J. Immunol. 1999, 11:111-111 (1998)); the tetra al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)]; as well as the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997); Rivera et al., Nat. Medicine. 2:1028-1032 (1996)). Other types of inducible promoters that may be useful in the context of the present invention are those that are regulated by specific physiological conditions, e.g., temperature, acute phase, or only in replicating cells.

[0494] In some embodiments, the native promoter of the gene or nucleic acid sequence of interest is used. The native promoter can be used when it is desired that the expression of the gene or nucleic acid sequence should mimic the native expression. The native promoter can be used when the expression of the gene or other nucleic acid sequence must be regulated transiently or developmentally, or tissue-specifically, or in response to a specific transcriptional stimulus. In another embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, can be used to mimic the native expression.

[0495] In some embodiments, the genetic element comprises a gene operably linked to a tissue-specific promoter. For example, if expression in skeletal muscle is desired, a promoter active in muscle can be used. These include promoters from genes encoding skeletal alpha actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters that have higher activity than natural promoters. See Li et al., Nat.Biotech., 17:241-245 (1999). Examples of promoters that are tissue-specific are known, among others, for: liver albumin, Miyatake et al. J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al., Gene Ther. 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)], bone (osteocalcin, Stein et al., Mol. Biol. Rep., 24:185-96 (1997); bone sialoprotein, Chen et al., J. Bone Miner. Res. 11:654-64 (1996)), lymphocytes (CD2, Hansal et al. al., J. Immunol., 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor a chain), neuronal (neuron-specific enolase (NSE) promoter, Andersen et al. Cell. Mol. Neurobiol., 13:503-15 (1993); neurofilament light chain gene, Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991); neuron-specific vgf gene, Piccioli et al., Neuron, 15:373-84 (1995)].

[0496] A genetic element construct may include an enhancer, e.g., a DNA sequence located adjacent to a DNA sequence encoding a gene. Enhancer elements are typically located upstream of a promoter element, or may be located downstream or within a coding DNA sequence (e.g., a DNA sequence that is transcribed or translated into one or more products). Thus, an enhancer element may be located 100, 200, or 300 or more base pairs upstream or downstream of a DNA sequence encoding a product. Enhancer elements can increase the amount of recombinant product expressed from a DNA sequence over and above the increased expression provided by a promoter element. Multiple enhancer elements are readily available to one of skill in the art.

[0497] In some embodiments, the genetic element comprises one or more inverted terminal repeats (ITRs) flanking the sequence encoding the expression product described herein. In some embodiments, the genetic element comprises one or more long terminal repeats (LTRs) flanking the sequence encoding the expression product described herein. Examples of promoter sequences that can be used include, but are not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, and Rous sarcoma virus promoter.

[0498] Other Arrays In some embodiments, the genetic element further comprises a nucleic acid encoding a product (eg, a ribozyme, a therapeutic mRNA encoding a protein, an exogenous gene).

[0499] In some embodiments, the genetic elements include one or more sequences that affect the species and / or tissue and / or cellular tropism (e.g., capsid protein sequences), infectivity (e.g., capsid protein sequences), immune suppression / activation (e.g., regulatory nucleic acids), viral genome binding and / or packaging, immune evasion (non-immunogenicity and / or tolerance), pharmacokinetics, endocytosis and / or cell attachment, nuclear entry, subcellular regulation and localization, exocytosis regulation, proliferation, and nucleic acid protection of the anellovector in a host or host cell.

[0500] In some embodiments, the genetic element may comprise DNA, RNA, or other sequences including artificial nucleic acids. Other sequences may include, but are not limited to, genomic DNA, cDNA, or sequences encoding tRNA, mRNA, rRNA, miRNA, gRNA, siRNA, or other RNAi molecules. In one embodiment, the genetic element comprises a sequence encoding an siRNA to target a different locus of the same gene expression product as the regulatory nucleic acid. In one embodiment, the genetic element comprises a sequence encoding an siRNA to target a different gene expression product than the regulatory nucleic acid.

[0501] In some embodiments, the genetic elements include one or more of the following: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding an exogenous gene, a sequence encoding a therapeutic agent, a regulatory sequence (e.g., promoter, enhancer), a sequence encoding one or more regulatory sequences targeting an endogenous gene (siRNA, lncRNA, shRNA), and a sequence encoding a therapeutic mRNA or protein.

[0502] Other sequences may have a length of about 2 to about 5000 nt, about 10 to about 100 nt, about 50 to about 150 nt, about 100 to about 200 nt, about 150 to about 250 nt, about 200 to about 300 nt, about 250 to about 350 nt, about 300 to about 500 nt, about 10 to about 1000 nt, about 50 to about 1000 nt, about 100 to about 1000 nt, about 1000 to about 2000 nt, about 2000 to about 3000 nt, about 3000 to about 4000 nt, about 4000 to about 5000 nt, or any range therebetween.

[0503] Encoded Genes For example, the genetic element may include a gene associated with a signal transduction biochemical pathway, such as a signal transduction biochemical pathway-related gene or polynucleotide. An example is a disease-related gene or polynucleotide. A "disease-related" gene or polynucleotide refers to any gene or polynucleotide that results in a transcription or translation product at an abnormal level or in an abnormal form in cells from disease-affected tissues compared to non-disease control tissues or cells. This may be a gene that is expressed at an abnormally high level; or a gene that is expressed at an abnormally low level, where the altered expression correlates with the development and / or progression of the disease. A disease-related gene is also referred to as a gene processing mutation or genetic mutation, which is in a state of linkage imbalance with a gene that is the direct cause of the disease or is causative of the disease.

[0504] Disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.). Examples of disease-associated genes or polynucleotides are listed in Tables A and B of U.S. Pat. No. 8,697,359, which are incorporated herein by reference in their entireties. Disease-specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.). Examples of signal transduction biochemical pathway-associated genes and polynucleotides are listed in Tables A-C of U.S. Pat. No. 8,697,359, which are incorporated herein by reference in their entireties.

[0505] Additionally, the genetic element may encode a targeting moiety, as described elsewhere herein. This may be achieved, for example, by inserting a polynucleotide encoding a sugar, a glycolipid, or a protein such as an antibody. Those skilled in the art will be familiar with further methods of generating targeting moieties.

[0506] Viral sequences In some embodiments, the genetic element comprises at least one viral sequence, which in some embodiments has homology or identity to one or more sequences from single-stranded DNA viruses, such as Anellovirus, Bidnavirus, Circovirus, Geminivirus, Genomovirus, Inovirus, Microvirus, Nanovirus, Parvovirus, and Spiravirus. In some embodiments, the sequence has homology or identity to one or more sequences from a double-stranded DNA virus, such as Adenovirus, Ampullavirus, Ascovirus, Asfarvirus, Baculovirus, Fusellovirus, Globulovirus, Guttavirus, Hytrosavirus, Herpesvirus, Iridovirus, Lipothrixvirus, Nimavirus, and Poxvirus. In some embodiments, the sequence has homology or identity to one or more sequences from an RNA virus, such as an Alphavirus, Furovirus, Hepatitis virus, Hordeivirus, Tobamovirus, Tobravirus, Tricornavirus, Rubivirus, Birnavirus, Cystovirus, Partitivirus, and Reovirus.

[0507] In some embodiments, the genetic element may comprise one or more sequences from a non-pathogenic virus, e.g., a commensal virus, e.g., a native virus, e.g., an Anellovirus. Three Anelloviruses, which have recently undergone nomenclature changes and can infect human cells, have been classified into the genera Alphatorquevirus (TT), Betatorquevirus (TTM), and Gammatorquevirus (TTMD) of the Anelloviridae viruses. In some embodiments, the genetic element may comprise sequences with homology or identity to Torque Teno Virus (TT), a non-enveloped single-stranded DNA virus with a circular negative-sense genome. In some embodiments, the genetic element may comprise sequences with homology or identity to SEN virus, Sentinel virus, TTV-like minivirus, and TT virus. Various types of TT viruses have been described, including TT virus genotype 6, TT virus group, TTV-like virus DXL1, and TTV-like virus DXL2. In some embodiments, the genetic element may include a sequence with homology or identity to a smaller virus, a third virus with a genome size intermediate between TTV and TTMV, called Torque Teno-like Mini Virus (TTM) or Torque Teno-like Midi Virus (TTMD). In some embodiments, the genetic element may include one or more sequences or fragments of a sequence from a non-pathogenic virus having, for example, at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% and 99% nucleotide sequence identity to any one of the nucleotide sequences herein.

[0508] In some embodiments, the genetic elements may comprise one or more sequences or fragments of sequences derived from a substantially non-pathogenic virus having at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% nucleotide sequence identity to any one of the nucleotide sequences listed herein, e.g., in Table 41.

[0509] [Table 94]

[0510] [Table 95]

[0511] [Table 96]

[0512] [Table 97]

[0513] [Table 98]

[0514] [Table 99]

[0515] [Table 100]

[0516] [Table 101]

[0517] [Table 102]

[0518] [Table 103]

[0519] In some embodiments, the genetic elements comprise one or more sequences that are homologous or identical to one or more sequences from one or more non-Anelloviruses, e.g., Adenovirus, Herpesvirus, Poxvirus, Vaccinia virus, SV40, papilloma virus, RNA viruses such as retroviruses, e.g., lentivirus, single-stranded RNA viruses, e.g., Hepatitis virus, or double-stranded DNA viruses, e.g., rotavirus. In some embodiments, the recombinant retrovirus is defective and therefore capable of providing assistance to produce infectious particles. Such assistance can be provided, for example, by using helper cells that contain a plasmid encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. Suitable cell lines for replicating the anellovectors described herein include cell lines known in the art, such as A549, which can be modified as described herein. The genetic elements may further include a gene encoding a selectable marker so that the desired genetic element can be identified.

[0520] In some embodiments, the genetic elements contain non-silent mutations, such as base substitutions, deletions, or additions that result in amino acid changes in the encoded polypeptide, so long as the sequence is at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptide encoded by the initial nucleotide sequence or is otherwise useful in practicing the invention. In this regard, it is recognized that some conservative amino acid substitutions can be made, which generally do not inactivate the overall protein function, for example, for positively charged amino acids (and vice versa), i.e., lysine, arginine and histidine; for negatively charged amino acids (and vice versa), i.e., aspartic acid and glutamic acid; and for some groups of neutrally charged amino acids (and vice versa, in all cases, as well), i.e., (1) alanine and serine, (2) asparagine, glutamine and histidine, (3) cysteine ​​and serine, (4) glycine and proline, (5) isoleucine, leucine and valine, (6) methionine, leucine and isoleucine, (7) phenylalanine, methionine, leucine and tyrosine, (8) serine and threonine, (9) tryptophan and tyrosine, (10) and, for example, tyrosine, tryptophan and phenylalanine. Amino acids can be classified according to their physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as the replacement of one amino acid with another amino acid that has similar properties.

[0521] The identity of two or more nucleic acid or polypeptide sequences having identical or a specified percentage of nucleotides or identical (about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over a specified region when compared and aligned for maximum correspondence over a comparison window or specified region) amino acid residues can be measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters as described below, or by manual alignment and visual inspection (see, for example, the NCBI website www.ncbi.nlm.nih.gov / BLAST / , etc.). Identity may also refer to or be applied to the complement of a test sequence. Identity also includes sequences having deletions and / or additions, as well as sequences having substitutions. As described herein, the algorithm takes into account gaps, etc. Identity may exist over a region that is at least about 10 amino acids or nucleotides in length, about 15 amino acids or nucleotides in length, about 20 amino acids or nucleotides in length, about 25 amino acids or nucleotides in length, about 30 amino acids or nucleotides in length, about 35 amino acids or nucleotides in length, about 40 amino acids or nucleotides in length, about 45 amino acids or nucleotides in length, about 50 amino acids or nucleotides in length, or more. Because the genetic code is degenerate, homologous nucleotide sequences can contain any number of silent base changes, i.e., nucleotide substitutions that still encode the same amino acid.

[0522] Proteinaceous outer layer In some embodiments, the anaerovector, e.g., a synthetic anaerovector, comprises a proteinaceous outer layer that encases the genetic element. The proteinaceous outer layer can comprise substantially undesirable, non-pathogenic, external proteins that are incapable of eliciting an immune response in a mammal. The proteinaceous outer layer of an anaerovector typically comprises substantially non-pathogenic proteins that can self-assemble to form icosahedrons that make up the proteinaceous outer layer.

[0523] In some embodiments, the proteinaceous outer layer protein is encoded by a sequence of a genetic element of the anaerovector (e.g., in cis with the genetic element), while in other embodiments, the proteinaceous outer layer protein is encoded by a nucleic acid sequence separate from the genetic element of the anaerovector (e.g., in trans with the genetic element).

[0524] In some embodiments, a protein, e.g., a substantially non-pathogenic protein and / or a proteinaceous outer layer protein, comprises one or more, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more glycosylated amino acids.

[0525] In some embodiments, the protein, e.g., the substantially non-pathogenic protein and / or the proteinaceous outer layer protein, comprises at least one hydrophilic DNA-binding region, an arginine-rich region, a threonine-rich region, a glutamine-rich region, an N-terminal polyarginine sequence, a variable region, a C-terminal polyglutamine / glutamic acid sequence, and one or more disulfide bridges.

[0526] In some embodiments, the protein has a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence encoding a capsid protein described herein, e.g., a protein encoded by any one of the Anellovirus ORF1 molecules and / or capsid protein sequences listed in any of Tables 1-18, A1-A12, B1-B5, C1-C5, D1-D10, or 20-37. In some embodiments, the protein or functional fragment of a capsid protein is encoded by a nucleotide sequence having at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence described herein, e.g., any one of the Anellovirus capsid sequences or capsid protein sequences listed herein.

[0527] In some embodiments, the anaerovector comprises a nucleotide sequence encoding a capsid protein or a functional fragment of a capsid protein, or a sequence having at least about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Anellovirus ORF1 molecule as described herein.

[0528] In some embodiments, the stretches of amino acids with lower sequence identity may result in differences in one or more of the properties described herein and cell / tissue / species specificity (e.g., tropism).

[0529] In some embodiments, the anaerovector is free of lipids in the proteinaceous outer layer. In some embodiments, the anaerovector is free of a lipid bilayer, e.g., a viral envelope. In some embodiments, the interior of the anaerovector is completely (e.g., 100%) covered by the proteinaceous outer layer. In some embodiments, the interior of the anaerovector is covered by the external protein with less than 100%, e.g., 95%, 90%, 85%, 80%, 70%, 60%, 50% or less coverage. In some embodiments, the proteinaceous outer layer contains gaps or discontinuities (e.g., that allow permeability to water, ions, peptides, or small molecules) so long as the genetic elements are retained within the anaerovector.

[0530] In some embodiments the proteinaceous outer layer comprises one or more proteins or polypeptides, e.g. complementary proteins or polypeptides, that specifically recognize and / or bind to a host cell to mediate entry of the genetic element into the host cell.

[0531] In some embodiments, the proteinaceous outer layer comprises one or more of the Anellovirus ORF1 arginine-rich region, jelly-roll region, N22 domain, hypervariable region, and / or C-terminal domain, e.g., of an ORF1 molecule, e.g., as described herein. In some embodiments, the proteinaceous outer layer comprises one or more of the following: one or more glycosylated proteins, a hydrophilic DNA-binding region, an arginine-rich region, a threonine-rich region, a glutamine-rich region, an N-terminal polyarginine sequence, a variable region, a C-terminal polyglutamine / glutamic acid sequence, and one or more disulfide bridges. For example, the proteinaceous outer layer comprises a protein encoded by an Anellovirus ORF1 nucleic acid, e.g., as described herein.

[0532] In some embodiments, the proteinaceous outer layer comprises one or more of the following characteristics: icosahedral symmetry, recognition and / or binding to molecules that interact with one or more host cells and mediate entry into the host cell, lack of lipid molecules, lack of carbohydrates, pH and temperature lability, detergent resistance, and being substantially non-immunogenic or substantially non-pathogenic in host cells.

[0533] III.How to use The anaerovectors and compositions comprising an anaerovectors described herein can be used, for example, in methods of treating a disease, disorder, or condition in a subject (e.g., a mammalian subject, e.g., a human subject) in need thereof. Administration of the pharmaceutical compositions described herein can be performed, for example, by parenteral (including intravenous, intratumoral, intraperitoneal, intramuscular, intracavity, and subcutaneous) administration. The anaerovectors can be administered alone or can be formulated as a pharmaceutical composition.

[0534] The anellovector may be administered in the form of a unit dose composition, such as a unit dose parenteral composition. Such compositions are generally suitable for parenteral administration after preparation by mixing. Such compositions may...

Claims

1. a) a proteinaceous outer layer comprising an ORF1 molecule; b) a genetic element comprising RNA; wherein said genetic element is encased within said proteinaceous outer layer.

2. The particle described in claim 1, wherein the genetic element comprises mRNA.

3. A particle described in claim 1 or 2, wherein the genetic element encodes an exogenous effector.

4. The exogenous effector (a) a therapeutic polypeptide, (b) a human protein, and / or (c) (i) a cytosolic polypeptide or peptide, (ii) a regulatory intracellular polypeptide; (iii) a secreted polypeptide or peptide, (iv) Protein Replacement Therapy (v) an enzyme, (vi) a component of a gene editing system; (vii) a membrane receptor, or (viii) Membrane transporter The particle of claim 3 comprising:

5. The genetic element (a) consists of at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% mRNA; (b) comprising chemically modified ribonucleotides; (c) consisting of or consisting essentially of RNA; (d) is cyclic; (e) is about 50-60, 60-70, 70-80, 80-90, 90-100, 100-125, 125-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, or 4000-4500 nucleotides in length; (f) binding to the ORF1 molecule; (g) comprising an mRNA cap, and / or a polyA-tail, optionally wherein the polyA-tail is at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 adenosines in length; and / or (h) comprising a wild-type anellovirus 5'UTR conserved domain; The particle according to any one of claims 1 to 4.

6. A particle described in any one of claims 3 to 5, wherein the sequence encoding the exogenous effector is at least about 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, or 3000 nucleotides in length.

7. A particle described in any of the preceding claims, wherein the particle comprises a plurality of genetic elements, for example at least 2, 3, 4, 5, 10, 20, 30, 40, 50, or 60 genetic elements, optionally each of the plurality of genetic elements comprising the same sequence.

8. A particle described in any of the preceding claims, wherein the ORF1 molecule comprises an amino acid sequence of any one of SEQ ID NOs: 21, 58, 891, 1005, or 1012, or an amino acid sequence having at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

9. The genetic element comprising: (i) lacking a sequence encoding the Anellovirus ORF1 protein; (ii) lacking a sequence encoding the Anellovirus ORF2 protein; and / or (iii) lacking a sequence encoding the Anellovirus ORF3 protein; A particle according to any of the preceding claims.

10. A composition comprising particles described in any one of the preceding claims.

11. A pharmaceutical composition comprising the composition of claim 10 and a pharma- ceutically acceptable carrier or excipient.

12. A method of making a particle, the method comprising: (a) (i) a genetic element comprising RNA, and (ii) ORF1 molecule providing a mixture comprising: (b) incubating said mixture under conditions suitable to entrap said genetic elements within a proteinaceous outer layer comprising said ORF1 molecule, thereby producing said particles. Including, Optionally, the mixture is free of cells.

13. The method of claim 12, wherein the genetic element comprises mRNA.

14. A method for purifying particles, the method comprising: (i) providing a particle according to any one of claims 1 to 9; and (ii) purifying the particles A method comprising:

15. A method for producing a pharmaceutical composition, the method comprising: Providing a plurality of particles according to any one of claims 1 to 9; and Formulating the plurality of particles into a pharmaceutical composition suitable for administration to a subject. Including, Optionally, between the providing step and the formulating step, (i) Contaminants; (ii) optical density measurement; (iii) particle count, and / or (iv) Infectivity evaluating the plurality of particles for one or more of: method.

16. The method of claim 15, wherein if one or more of (i) to (iv) meet specified thresholds, the pharmaceutical composition is suitable for administration to a subject.

17. A composition comprising a particle according to claims 1 to 9, or a composition according to claim 10, for treating a disease or disorder in a subject in need of such treatment.

18. A composition comprising a particle as described in claims 1 to 9, or a composition as described in claim 10, for regulating, e.g., enhancing or inhibiting, a biological function (e.g., as described in the present specification) in a subject.

19. 10. A composition for use in a method of delivering a genetic element to a cell, the composition comprising a particle according to any one of claims 1 to 9, the method comprising the step of contacting the particle with a cell, such as a eukaryotic cell, such as a mammalian cell.

20. The composition of claim 19, wherein the cell is a human cell, and optionally the cell is a bone marrow cell, a blood cell, a heart cell, a GI cell, a skin cell, a retinal cell, a liver cell, a cell of the spinal cord, a motor neuron, a muscle cell, a cell of the epithelial lining, or a pancreatic cell.