Method for amplifying DNA using CARE elements

Abstract

The present invention relates to a method for amplifying a nucleotide sequence, the nucleotide sequence to be amplified being flanked by a plurality of CARE elements. The present invention provides nucleic acid molecules (e.g., plasmids and vectors) comprising a first and a second CARE element flanking the nucleotide sequence to be amplified. The present invention also provides host cells comprising said nucleic acid molecules and amplification methods using said nucleic acid molecules. The present invention is particularly applicable to the amplification of viral genes and the production of recombinant adeno-associated viruses (AAV).

Description

[Technical field]

[0001] The present invention relates to a method for amplifying a nucleotide sequence, the nucleotide sequence to be amplified being flanked by a plurality of CARE elements. The present invention provides nucleic acid molecules (e.g., plasmids and vectors) comprising a first and a second CARE element flanking the nucleotide sequence to be amplified. The present invention also provides host cells comprising said nucleic acid molecules and amplification methods using said nucleic acid molecules. The present invention is particularly applicable to the amplification of viral genes and the production of recombinant adeno-associated viruses (AAV).

[0002] It has been reported that transfection and adenovirus infection of HeLa cell lines in which the AAV rep and cap genes are integrated into the chromosome with an AAV vector results in 100-fold amplification of the integrated rep-cap sequences (Tessier, J., et al. J. Virol. 2001; 375-383; Chadeuf, G., et al., J. Gene Med. 2000; 2: 260-268). These amplified sequences were present extrachromosomally. In the paper, it was said that the adenovirus DNA-binding protein (DBP) is essential for this amplification. This phenomenon was further described in US2004 / 0014031 and involved a cis-acting replication element (CARE) that was said to be located in a region of 171 nucleotides corresponding to nucleotides 190-361 of the AAV2 genome (Example 12), which includes the AAV p5 promoter. Furthermore, US2004 / 0014031 reports that the CARE element can induce amplification of adjacent heterologous genes (Example 11), ie, one CARE element can act as a replication origin.

[0003] These reports raised the possibility of using CARE elements to amplify operably associated nucleotide sequences. Summary of the Invention

[0004] It has been found that a single CARE element is not sufficient to promote CARE-dependent replication; two CARE elements are required, which must flank the nucleotide sequence to be amplified, and which must be oriented in the same direction (5' to 3') relative to each other in the DNA molecule. Identifying the exact mechanism of action of such CARE elements will facilitate the creation of new methods for amplifying nucleotide sequences.

[0005] Accordingly, one object of the present invention is to provide nucleic acid molecules (e.g., plasmids and vectors) that contain first and second CARE elements flanking a region of a nucleotide sequence to be amplified, such as a promoter-driven gene of interest, etc. Further objects of the present invention include providing host cells that contain said nucleic acid molecules and amplification methods using said nucleic acid molecules.

[0006] The present invention is particularly applicable to the amplification of viral genes and the production of recombinant adeno-associated viruses (AAV).Accordingly, it is yet another object of the present invention to provide a method for producing AAV, which achieves high expression levels of Rep and / or Cap polypeptides to form AAV particles.

[0007] In one embodiment, the invention provides a method for amplifying a first nucleotide sequence in a host cell, the method comprising: (a) culturing a host cell, the host cell comprising: (i) a first nucleic acid molecule, said first nucleic acid molecule comprising: (a) a first CARE element comprising or consisting of an AAV p5 promoter; (b) a first nucleotide sequence; and (c) a second CARE element comprising or consisting of the AAV p5 promoter; (a), (b) and (c) are operably associated in that order (5'-3') in the nucleic acid molecule, and the first CARE element and the second CARE element are both in the same 5'-3' orientation; The host cell optionally comprises: (ii) further comprising one or more second nucleic acid molecules comprising one or more promoters operably associated with one or more adenoviral early genes or adenoviral late genes; and culturing the host cell under conditions such that AAV Rep and one or more adenoviral early gene products and / or adenoviral late gene products are present in the host cell, thereby promoting amplification of the first nucleotide sequence.

[0008] In another embodiment, the present invention provides a process for producing a recombinant viral particle comprising a transgene, the process comprising the steps of: (a) culturing a host cell, the host cell comprising: (i) a transfer plasmid containing the 5'-viral ITR and the 3'-viral ITR flanking the transgene; (ii) a nucleic acid molecule of the invention, wherein the first nucleotide sequence comprises a viral rep gene and a viral cap gene, and the nucleic acid molecule is present in the host cell on an episomal plasmid or vector or integrated into the host cell genome; (iii) AV helper genes sufficient to facilitate amplification of the rep and cap genes and to package the transfer plasmid, wherein the helper genes are present on an episomal helper plasmid in the host cell, present on an adenoviral vector, or integrated into the host cell genome; culturing said host cells under conditions such that the viral rep gene and viral cap gene are amplified by said host cells and viral particles are assembled; (b) recovering packaged viral particles from said host cells or from said medium.

[0009] In a further embodiment, the present invention provides a nucleic acid molecule comprising: (a) a first CARE element comprising an AAV p5 promoter; (b) a first nucleotide sequence; and (c) a second CARE element comprising an AAV p5 promoter; one or both of the first CARE element and / or the second CARE element each independently further comprises a pre-AAV p5 promoter region; (a), (b) and (c) are operably associated in this order (5'-3') in the nucleic acid molecule, and the first CARE element and the second CARE element are both in the same 5'-3' orientation.

[0010] In a further embodiment, the present invention provides a host cell comprising a nucleic acid molecule of the present invention.

[0011] In a further embodiment, the present invention provides a process for producing the modified host cell, the process comprising: (a) introducing into a host cell a nucleic acid molecule of the invention, This is the process by which modified host cells are produced.

[0012] The nucleic acid molecule of the present invention is preferably DNA. It may be single-stranded or double-stranded.

[0013] As used herein, the term "CARE element" refers to a cis-acting replication element. A CARE element is a sequence of nucleotides that can promote the replication of a first nucleotide sequence in the presence of adenovirus and AAV Rep protein when the first nucleotide sequence is flanked by a first and a second CARE element, where both the first and the second CARE elements are in the same 5'-3' orientation. Examples of CARE elements have been previously described in Tessier, J., et al. J. Virol. 2001; 375-383; Chadeuf, G., et al. J. Gene Med. 2000; 2: 260-268; US2004 / 0014031; Nony, P. et al. J. Virol. 2001. The CARE element is preferably an AAV CARE element.

[0014] The first and second CARE elements used in the present invention each independently contain an AAV p5 promoter. The p5 promoter sequences of the first and second CARE elements may be the same or different.

[0015] The wild-type AAV p5 promoter is (a) MLTF / USF1 binding site; (b) a YY1-60 binding site; and (c) a TATA box; (d) an AAV Rep binding site; (e) a trs element; and (f) a YY1+1 binding site. Preferably, the AAV p5 promoter in the first and second CARE elements of the present invention each independently comprises 1, 2, 3, 4, 5 or 6 of the above (a) to (f), more preferably 4 to 6 or 5 to 6 of the above (a) to (f), and most preferably all of the above (a) to (f). When present in the p5 promoter, each of (a) to (f) is preferably in the above order (5'-3').

[0016] The wild-type AAV p5 promoter drives the expression of Rep78 and Rep68 polypeptides. The p5 promoter is located at the 5' end of the wild-type rep gene. The wild-type AAV2 p5 promoter has the nucleotide sequence shown in SEQ ID NO:1: [ka] has.

[0017] In the above sequence, the MLTF / USF1 binding site, the YY1-60 binding site, the TATA box, the AAV Rep binding site and the YY1+1 binding site are underlined in that order. The trs element is within the YY1+1 binding site. The core promoter sequence is highlighted in bold.

[0018] In the CARE element used in the present invention, the p5 promoter is generally a functional p5 promoter. As used herein, the term "functional p5 promoter" refers to a nucleotide sequence that is preferably comprised of or includes the nucleotide sequence of SEQ ID NO: 1 or a variant thereof, said variant having at least 80%, 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 1, and that is capable of promoting the transcription of a first nucleotide molecule encoding one or more AAV Rep polypeptides in operable association, preferably a first nucleotide molecule encoding a Rep78 polypeptide and a Rep68 polypeptide. The activity level of the p5 promoter may be determined by operably associating the test p5 promoter sequence with a suitable transgene and analyzing the expression level of the transgene. If the expression level is less than 5% (preferably less than 1%) of the expression level of the wild-type AAV p5 promoter when operably associated with the same transgene, it is considered not functional.

[0019] MLTF / USF1 is a member of the basic helix-loop-helix (bHLH) leucine zipper family. It is a ubiquitously expressed transcription factor that binds to DNA enhancer box response elements. The sequence of the MLTF / USF1 binding site is aggtcacgtgagtg (SEQ ID NO: 2). The invention includes variants of the above sequence (e.g., variants with one, two or three nucleotide substitutions) that are capable of binding MLTF / USF1. MLTF / USF1 has been implicated as important for CARE-mediated amplification, but may not be essential.

[0020] YY1 (Yin-Yang1) is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. This protein is involved in the repression and activity of a variety of promoters. The sequence of the YY1-60 binding site is cgacatttt. The present invention includes variants of the above sequence (e.g., variants with one, two or three nucleotide substitutions) that are capable of binding YY1. The YY1-60 binding site has been shown to be important for amplification by CARE, but may not be essential. Alternatively, the YY1+1 binding site may be used instead of the YY1-60 site.

[0021] The p5 TATA box has the sequence tatttaa. The TATA box of the p5 promoter within the CARE element is believed to be necessary for amplification by CARE. The present invention includes variants of the above sequences (e.g., variants with one, two or three nucleotide substitutions).

[0022] Rep binding sites (RBSs) are also known as Rep recognition sequences (RRSs) or Rep binding elements (RBEs). There are three RBSs in the AAV genome: one in each of the inverted terminal repeats (ITRs) and one in a region containing the p5 promoter, called the P5 integration efficiency element (P5IEE).

[0023] The AAV RBS has the sequence gcccgagtgagcacgc (SEQ ID NO:3). The 16-mer core sequence of the RRS in the AAV ITR (AAV-ITR-RBS) is shown in SEQ ID NO:4: 5'-GAGCGAGCGAGCGCGC-3' (SEQ ID NO:4). The 16-mer core sequence of the RRS in AAVS1 (AAVS1-RBS) is shown in SEQ ID NO:5: 5'-CAGCGAGCGAGCGAGC-3' (SEQ ID NO:5). The invention includes variants of the above sequences (e.g., variants with one, two or three nucleotide substitutions) that can bind AAV Rep polypeptides, and most preferably, variants of the above sequences (e.g., variants with one, two or three nucleotide substitutions) that can bind AAV Rep78 polypeptides. The presence of an RBS site within the CARE element is believed to be necessary for amplification by CARE.

[0024] The terminal resolution site (trs) is targeted by Rep78 or Rep68, which has endonuclease activity, and is cleaved in a site-specific and strand-specific manner. By this mechanism, the double-stranded AAV molecules generated during replication are degraded into single-stranded viral genomes that can be packaged. In the AAV p5 promoter, the trs element has a ccattt sequence. The present invention includes mutants (e.g., mutants with one, two or three nucleotide substitutions) of the above sequences (e.g., mutants with one, two or three nucleotide substitutions) that can bind Rep78 or Rep68. The trs element may be essential.

[0025] The sequence of the YY1+1 binding site is ctccatttt. The present invention includes mutants of the above sequence (e.g., mutants with one, two or three nucleotide substitutions) that can bind YY1. The YY1+1 binding site is believed to be important for amplification by CARE, but may not be essential. Alternatively, the YY1-60 binding site may be used instead of the YY1+1 site.

[0026] In some embodiments, the p5 promoter of the first CARE element is modified so that the rep gene is not expressed from the p5 promoter of the first CARE element, preferably by inserting a repressor binding site into the p5 promoter of the first CARE element so that the rep gene is not expressed from the p5 promoter of the first CARE element.

[0027] In other embodiments, the rep gene is operably associated with a heterologous inducible or repressible promoter.

[0028] The first and / or second CARE element may each independently comprise a pre-AAV p5 promoter region. The sequences of the pre-AAV p5 promoter regions in the first and second CARE elements may be the same or different. As used herein, the term "pre-AAV p5 promoter region" refers to a stretch of consecutive nucleotides having a sequence corresponding to the sequence of the DNA region upstream of the AAV p5 promoter.

[0029] In the wild-type AAV2 genome, nucleotides 1-145 encode the AAV left inverted terminal repeat (ITR), and nucleotides 191-320 relate to the p5 promoter. Thus, in the AAV2 genome, the pre-AAV p5 promoter region is a stretch of contiguous nucleotides that includes some or all of nucleotides 146-190.

[0030] In one embodiment, the pre-AAV p5 promoter region comprises or consists of: (i), (ii) or (iii) below: (i) AAV2 nucleotides 146-190, or the corresponding nucleotides thereof, from a different AAV serotype (e.g., AAV5); (ii) a nucleotide sequence having at least 80%, 90%, or 95% sequence identity to (i); (iii) A fragment of (i), which is at least 80%, 90%, or 95% of the length of (i).

[0031] The function of the pre-AAV p5 promoter region is to increase the degree of DNA amplification of the first nucleotide sequence compared to the degree of DNA amplification obtained when a nucleic acid molecule of the invention that does not contain the pre-AAV p5 promoter region is used as a control.

[0032] In the present invention, the pre-AAV p5 promoter region is upstream (5') of the AAV p5 promoter and operably linked to the AAV p5 promoter. Preferably, the pre-AAV p5 promoter region is contiguously linked to the AAV p5 promoter. The AAV CARE element can be found in the 5' portion of the AAV rep gene, e.g., atgccggggttttacgagattgtgattaaggtccccagcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagttgccgccagattctgacatggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtgtgagtaaggccc (SEQ ID NO: 24). may include:

[0033] The above sequence comprises nucleotides 321 to 541 of the AAV2 genome (i.e., 221 nucleotides of the AAV2 rep gene). The corresponding sequence in a different AAV genome may also be used. Preferably, the 5' portion of the AAV rep gene consists of or comprises nucleotides 321 to 353 of the AAV2 genome (i.e., 33 nucleotides of the AAV rep gene), such as (AAV2)atgccggggttttacgagattgtgattaaggtc (SEQ ID NO: 25). The corresponding sequence in a different AAV genome may also be used. In some embodiments, the CARE element does not comprise the 5' portion of the AAV rep gene.

[0034] In some embodiments of the invention (e.g., where the first nucleotide sequence comprises the rep gene), the 5' portion of the AAV rep gene (within the CARE element) does not contain an ATG codon (thereby minimizing expression of the Rep polypeptide). For example, the ATG codon may be mutated to an ATA codon.

[0035] As used herein, the term "5' portion of the AAV rep gene" preferably refers to a nucleotide sequence consisting of or comprising SEQ ID NO: 24 or 25 or a variant thereof, said variant having at least 80%, 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 24 or 25.

[0036] In some preferred embodiments, the CARE element consists of or comprises one of the following: - a region of the AAV genome corresponding to nucleotides 146 to 320 of the AAV2 genome as set forth in SEQ ID NO: 6: ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgaca ccatgtggtcacgctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc (SEQ ID NO: 6), - a region of the AAV genome corresponding to nucleotides 191 to 353 of the AAV2 genome as set forth in SEQ ID NO: 7: gtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgccatgccggggttttacgagattgtgattaaggtc (SEQ ID NO: 7), - a region of the AAV genome corresponding to nucleotides 146 to 190 of the AAV2 genome as set forth in SEQ ID NO: 8: ggaggggtggagtcgtgacgtgaattacgtcatagggttagggag (SEQ ID NO: 8), - a region of the AAV genome corresponding to nucleotides 191 to 542 of the AAV2 genome as set forth in SEQ ID NO: 9: [ka] (p5 promoter is underlined), - a region of the AAV genome corresponding to nucleotides 191 to 320 of the wild-type AAV2 genome as set forth in SEQ ID NO: 10: gtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc (SEQ ID NO: 10), - a region of the AAV genome corresponding to nucleotides 146 to 542 of the wild-type AAV2 genome as set forth in SEQ ID NO: 11: Ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtgg tcacgctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgccatgccggggttttacgagattgtg attaaggtccccagcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagttgccgccagattct gacatggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtgtgagtaaggccccg, - a region of the AAV genome corresponding to nucleotides 146 to 353 of the wild-type AAV2 genome as set forth in SEQ ID NO: 12: Ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacg ctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgccatgccggggttttacgagattgtgattaaggtc.

[0037] Preferably, the first and / or second CARE element has a nucleotide sequence as set forth in any one of SEQ ID NOs: 6-12 or a variant thereof, said variant having at least 50%, 60%, 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 6-12 and capable of promoting amplification of a first nucleotide sequence flanked by the first and second variants in the presence of adenovirus and AAV Rep proteins, wherein both the first and second variants are in the same 5'-3' orientation.

[0038] In some embodiments, the first and / or second CARE element is a functional fragment of a nucleotide sequence set forth in any one of SEQ ID NOs: 6-12, wherein the functional fragment is at least 80%, 90% or 95% of the length of the nucleotide sequence.

[0039] As used herein, a "functional fragment" is a sequence of nucleotides that is capable of promoting replication of a first nucleotide sequence in the presence of adenovirus and AAV Rep proteins when the first nucleotide sequence is flanked by a first and a second fragment, where both the first and second fragments are in the same 5'-3' orientation.

[0040] In any CARE element, (c) TATA box, (d) the AAV Rep binding site, and (e) trs element It is preferred that the relative positions, absolute positions and / or nucleotide sequences of (a) MLTF / USF1 binding site, (b) the YY1-60 binding site, and (f)YY1+1 binding site Preferably, the relative positions, absolute positions and / or alignment of are also maintained.

[0041] In a nucleic acid molecule, (a) a first CARE element; (b) a first nucleotide sequence, and (c) the second CARE element The first and second CARE elements are positioned upstream and downstream, respectively, of the first nucleotide sequence such that they are operably associated in this 5'-3' order.

[0042] Furthermore, both the first and second CARE elements have the same 5'-3' orientation. The 5'-3' orientation of a CARE element is determined according to its natural (wild-type) environment.

[0043] The distance between the 3' end of the first CARE element and the 5' end of the second CARE element can be, for example, 1-5 Kb, 5-10 Kb, 10-15 Kb, 15-50 Kb, or 50-100 Kb. In other embodiments (e.g., a CARE-GOI-CARE cassette containing a gene of interest GOI), the distance may be 5-1000 nucleotides, 5-500 nucleotides, or 5-50 nucleotides. In some embodiments, the distance is less than 1000 nucleotides, less than 100 nucleotides, or less than 50 nucleotides. In other embodiments, the distance is at least 50, 100, or 1000 nucleotides.

[0044] The first and second CARE elements may or may not have the same nucleotide sequence.

[0045] The first nucleotide sequence is a sequence of contiguous nucleotides. The first nucleotide sequence may generally be any nucleic acid molecule that one wishes to amplify.

[0046] The first nucleotide sequence (e.g., its coding sequence) may be in a 5'-3' or 3'-5' orientation, i.e., the 3' end of the first CARE element may be attached to the 3' end of the first nucleotide sequence.

[0047] In one embodiment, the first nucleotide sequence is a nucleotide sequence encoding a gene of interest (GOI) or transgene and, optionally, an operably associated promoter (e.g., a polymerase II promoter), which may be constitutive or inducible.

[0048] In some embodiments, the first nucleotide sequence comprises a transgene. The first nucleotide sequence may be a coding sequence or a non-coding sequence. The first nucleotide sequence may be genomic DNA or cDNA. Preferably, the nucleotide sequence encodes a polypeptide or a fragment thereof.

[0049] In some embodiments, the first nucleotide sequence encodes a therapeutic polypeptide or a fragment thereof. Preferred therapeutic polypeptides include, for example, antibodies, CAR-T molecules, scFVs, BiTEs, DARPins, and T cell receptors. In some embodiments, the therapeutic polypeptide is a G protein-coupled receptor (GPCR), such as DRD1. In some embodiments, the therapeutic polypeptide is a functional copy of a gene involved in human vision or retinal function, such as a functional copy of RPE65 or REP. In some embodiments, the therapeutic polypeptide is a functional copy of a gene involved in human blood production, or a blood component, such as factor IX, or one involved in beta and alpha thalassemia or sickle cell anemia. In some embodiments, the therapeutic polypeptide is a functional copy of a gene involved in immune function, such as in severe combined immunodeficiency (SCID) or adenosine deaminase deficiency (ADA-SCID). In some embodiments, the therapeutic polypeptide is a protein that increases / decreases cell proliferation, such as a growth factor receptor. In some embodiments, the therapeutic polypeptide is an ion channel polypeptide. In some preferred embodiments, the therapeutic polypeptide is an immune checkpoint molecule. Preferably, the immune checkpoint molecule is PD1, PDL1, CTLA4, Lag1 or GITR.

[0050] In some preferred embodiments, the first nucleotide sequence encodes a CRISPR enzyme (e.g., Cas9, dCas9, Cal2, or a mutant or derivative thereof) or a CRISPR sgRNA.

[0051] In some embodiments, the first nucleotide sequence comprises a gene from a virus known to infect mammals.The gene encoded in the first nucleotide sequence can code for a polypeptide that can self-assemble into a virus-like particle that may or may not be used as a vaccine.In a preferred embodiment, the first nucleotide sequence codes for a Norovirus capsid protein.

[0052] In other embodiments, the first nucleotide sequence may encode one or more polypeptides that can self-assemble to form a multimeric complex and are known to induce a human immune response as a vaccine. A preferred embodiment may encode the five genes required for the cytomegalovirus (CMV) pentameric complex. These include CMV gH / gL / UL128 / UL130 / UL131.

[0053] In other embodiments, the first nucleotide sequence may encode a protein that does not self-assemble to form a virus-like particle and is known to induce a human immune response as a vaccine. Preferred embodiments may encode the Ebola F protein, the influenza F and H proteins, or the coronavirus S, E, or M proteins. In some embodiments, the first nucleotide sequence comprises a gene from a retrovirus, more preferably a gene from a lentivirus, including but not limited to the Gag-Pol gene, the Rev gene and the Env gene.

[0054] In some embodiments, the first nucleotide sequence comprises a gene from a rhabdovirus, more preferably comprises a gene from a vesicular stomatitis virus (VSV).The gene includes, but is not limited to, a VSV glycoprotein gene (i.e., a VSV G gene).

[0055] In some embodiments, the first nucleotide sequence encodes genes necessary to assemble a gene therapy viral vector or contains genes necessary to generate a viral packaging cell line encoding a gene therapy transfer vector.

[0056] In some embodiments, the first nucleotide sequence contains all of the genes necessary to produce a gene therapy vector and the genes necessary to generate a virus-producing cell line that encodes the transfer vector.

[0057] In yet other embodiments, the first nucleotide sequence may include one or more genes for a lentiviral vector (e.g., Gag-Pol, REV, VSV-G, RD114), or one or more genes for an adenoviral vector (e.g., Hexon, Fibre, Penton, pVII or pVI).

[0058] In some embodiments, the first nucleotide sequence comprises a rep gene sequence and / or a cap gene sequence, or a fragment thereof. Preferably, the rep gene and the cap gene are AAV genes.

[0059] In some embodiments, the first nucleic acid molecule or the first nucleotide sequence does not include the rep gene sequence or a fragment thereof.

[0060] In other embodiments, the first nucleic acid molecule or first nucleotide sequence does not include the cap gene sequence, or a fragment thereof.

[0061] In some embodiments, the first nucleotide sequence is a nucleotide sequence encoding a polypeptide selected from the group consisting of luciferase, herceptin heavy chain, herceptin light chain, TGFβ1, and BMP2.

[0062] As used herein, the term "rep gene" refers to a gene encoding one or more open reading frames (ORFs), each of which encodes an AAV Rep nonstructural protein or a variant or derivative thereof that is involved in AAV genome replication and / or packaging.

[0063] The wild-type rep gene contains three promoters: p5, p19, and p40. Two overlapping messenger ribonucleic acids (mRNAs) of different lengths can be produced from p5 and from p19. Each of these mRNAs contains an intron that can be spliced ​​out or cannot be spliced ​​out using one splice donor site and two different splice acceptor sites. Thus, six different mRNAs can be formed, of which only four are functional. The two mRNAs that do not have the intron removed (one transcribed from p5 and one transcribed from p19) read through to a consensus polyadenylation terminator sequence and encode Rep78 and Rep52, respectively. Removal of the intron and use of the 5'most splice acceptor site would not result in the production of any functional Rep proteins - it would not produce the correct Rep68 or Rep40 proteins because the frame of the rest of the sequence would be shifted, nor would it produce the correct C-terminus of Rep78 or Rep52 because the terminators would be spliced ​​out. Conversely, removal of the intron and use of the 3'splice acceptor would include the correct C-terminus of Rep68 and Rep40 and splice out the terminators of Rep78 and Rep52. Thus, functional splicing alone would either avoid splicing out the intron altogether (producing Rep78 and Rep52) or use the 3'splice acceptor (producing Rep68 and Rep40). As a result, four different functional Rep proteins with overlapping sequences can be synthesized from these promoters.

[0064] In the wild-type rep gene, the p40 promoter is located at the 3' end. Transcription of the Cap proteins (VP1, VP2 and VP3) is initiated from this promoter in the wild-type AAV genome.

[0065] The four wild-type Rep proteins are Rep78, Rep68, Rep52 and Rep40. Thus, the wild-type rep gene is a gene encoding the four Rep proteins Rep78, Rep68, Rep52 and Rep40.

[0066] As used herein, the term "rep gene" includes the wild-type rep gene and its derivatives, as well as artificial rep genes having equivalent functions.

[0067] In one embodiment, the rep gene encodes a functional Rep78 polypeptide, a functional Rep68 polypeptide, a functional Rep52 polypeptide, and a functional Rep40 polypeptide. In another embodiment, the rep gene encodes a functional Rep78 polypeptide and a functional Rep68 polypeptide. In some embodiments, the rep gene p19 promoter is non-functional.

[0068] The wild-type AAV (serotype 2) rep gene nucleotide sequence is set forth in SEQ ID NO: 13. In one embodiment, the term "rep gene" refers to a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 13 and encoding one or more of a Rep78 polypeptide, a Rep68 polypeptide, a Rep52 polypeptide and a Rep40 polypeptide.

[0069] In some embodiments, the first nucleotide sequence encoding the AAV Rep polypeptide or the rep gene is not operably associated with a functional promoter. In this way, a low level of expression of the Rep polypeptide is obtained, which is low enough not to interfere with the growth of adenovirus, and is not sufficiently toxic to cells to interfere with AAV production.

[0070] In wild-type AAV, expression of the rep gene product is driven by the p5 and p19 promoters.

[0071] As used herein, the phrase "the rep gene is not operably associated with a functional promoter" means that the rep gene does not contain a functional p5 promoter or a functional p19 promoter, and that the rep gene is not operably associated with any other functional promoter, e.g., only baseline or minimal transcription of the rep gene is obtained.

[0072] In some preferred embodiments of the present invention, the transcription of the rep gene is driven by a polymerase II promoter. The promoter may be inducible or constitutive. If the promoter is inducible, an inducer (chemical, protein or both) can be added preferably at the same time that the amplification by CARE is induced. If the promoter is constitutive, the strength of the promoter should not be so strong that the rep gene is toxic to cells when the CARE element is not amplified.

[0073] In some embodiments, the p5 promoter contained in one of the CARE elements can drive the rep gene. However, when used in this configuration, the cell will not stably encode and express adenovirus E1A. It is known that the presence of E1A protein activates the P5 promoter, causing toxicity to cells. In a preferred embodiment, the rep gene is not driven by the p5 promoter in the CARE element.

[0074] As used herein, the term "cap gene" refers to a gene that encodes one or more open reading frames (ORFs), each of which encodes an AAV Cap structural protein or a variant or derivative thereof that forms the AAV capsid. The three Cap proteins must function to allow the production of infectious AAV viral particles that can infect suitable cells. The three Cap proteins are VP1, VP2 and VP3, which are generally 87 kDa, 72 kDa and 62 kDa in size, respectively. Thus, the AAV cap gene is a gene that encodes the three Cap proteins VP1, VP2 and VP3.

[0075] In wild-type AAV, these three proteins are translated from the p40 promoter to form a single mRNA, which can then be synthesized and the long or short intron can be excised, resulting in the formation of a 2.3 kb or 2.6 kb mRNA.

[0076] The AAV capsid is composed of 60 capsid protein subunits (VP1, VP2 and VP3) arranged in icosahedral symmetry in a 1:1:10 ratio with a predicted size of 3.9 MDa.

[0077] As used herein, the term "cap gene" includes wild-type cap genes and their derivatives, as well as artificial cap genes having equivalent functions. The AAV (serotype 2) cap gene nucleotide sequence and Cap polypeptide sequence are shown in SEQ ID NOs: 14 and 15, respectively. As used herein, the term "cap gene" preferably refers to a nucleotide sequence having the sequence shown in SEQ ID NO: 14, or a nucleotide sequence encoding SEQ ID NO: 15, or a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 14, or a nucleotide sequence having at least 80%, 90%, 95% or 99% sequence identity to the nucleotide sequence encoding SEQ ID NO: 15, and encoding VP1, VP2 and VP3 polypeptides.

[0078] The rep gene and the cap gene are preferably viral genes or derived from viral genes. More preferably, they are AAV genes or derived from AAV genes. In some embodiments, the AAV is adeno-associated dependoparvovirus A. In other embodiments, the AAV is adeno-associated dependoparvovirus B.

[0079] Eleven different AAV serotypes are known. All of the known serotypes can infect cells of a wide variety of tissue types. Tissue specificity is determined by the capsid serotype. AAV can be derived from serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10 or serotype 11. Preferably, AAV is serotype 1, serotype 2, serotype 5, serotype 6, serotype 7, serotype 8 or serotype 9. Most preferably, the AAV serotype is 5 (i.e., AAV5).

[0080] The rep and cap genes (and each of the protein-coding ORFs therein) can be derived from one or more different viruses (e.g., two, three, or four different viruses). For example, the rep gene can be from AAV2, while the cap gene can be from AAV5.

[0081] It will be appreciated by those of skill in the art that the AAV rep and cap genes vary among strains and isolates, and the sequences of these genes from all such strains and isolates, along with their derivatives, are included herein.

[0082] In other embodiments, the first nucleotide sequence does not include an AAV rep gene sequence, does not include an AAV cap gene sequence, or does not include an AAV inverted terminal repeat (ITR). In other embodiments, the first nucleotide sequence does not include an AAV sequence. In some embodiments, the CARE element is not linked (contiguous or non-contiguous) to the AAV rep gene or the AAV cap gene.

[0083] In a preferred embodiment, the first nucleotide sequence comprises a recombinant AAV genome, preferably the recombinant AAV genome comprises terminal inverted repeat sequences flanking the transgene.

[0084] As used herein, the term "recombinant AAV genome" refers to an AAV genome that includes AAV inverted terminal repeats (ITRs) flanked by (non-wild type) intervening sequences. Preferably, the intervening sequences are greater than 100 bp in length.

[0085] In particular, the intervening sequence may be the first nucleotide sequence defined above, for example, the nucleotide sequence that codes for: gene of interest (GOI) or transgene; therapeutic polypeptide or fragment thereof; CRISPR enzyme or sgRNA; gene from a virus known to infect mammals; one or more polypeptides known to induce human immune response; gene from retrovirus or rhabdovirus; gene required to assemble gene therapy viral vector or gene required to generate virus packaging cell line that codes for gene therapy transfer vector; gene required to generate virus production cell line that codes for all genes and transfer vector required to produce gene therapy vector; or one or more genes for lentivirus vector or adenovirus vector.Preferably, the recombinant AAV genome comprises a transgene.

[0086] The recombinant AAV genome preferably does not include the AAV rep gene or the AAV cap gene.

[0087] As used herein, the terms "recombinant AAV genome," "AAV transfer vector," and "transfer plasmid" are used interchangeably and all refer to a vector that contains 5'- and 3'-viral (preferably AAV) inverted repeats (ITRs) flanking an intervening nucleotide sequence, preferably a vector that contains 5'- and 3'-viral (preferably AAV) inverted repeats (ITRs) flanking a transgene.

[0088] In this specification, the terms "operably associated" and "operably linked" are used interchangeably. Both terms refer to the association of polynucleotides on a single nucleic acid fragment such that the function of one polynucleotide affects the function of the other. The polynucleotides may be juxtaposed, adjacent or contiguously linked, one located upstream of the other. The terms refer to the physical connection of polynucleotides within a distance such that the function of one polynucleotide can affect the function of the other. For example, a promoter is operably linked to a coding polynucleotide or functional RNA if the promoter can affect the expression of the coding polynucleotide or functional RNA (i.e., the coding polynucleotide or functional RNA is under the transcriptional control of the promoter). A coding polynucleotide in a sense or antisense orientation can be operably linked to a regulatory polynucleotide.

[0089] The multiple CARE elements and the first nucleotide sequence are operably linked.In the present specification, the term "operably linked" in the context of multiple CARE elements and the first nucleotide sequence means that the multiple CARE elements are linked to the first nucleotide sequence so that the multiple CARE elements promote the amplification of the first nucleotide sequence in the presence of adenovirus and AAV.This means that the multiple CARE elements and the first nucleotide sequence are present in the same nucleic acid molecule, for example, they are juxtaposed, adjacent or consecutively linked, with the multiple CARE elements adjacent to the first nucleotide sequence.

[0090] Preferably, the first nucleotide sequence comprises one or more transcriptional and / or translational control elements (eg, enhancer, promoter, terminator sequences, etc.).

[0091] The first nucleotide sequence may further comprise a Kozak sequence (translation initiation site).

[0092] CARE amplification has been most extensively studied using adenovirus (AV) as the inducer of amplification.In some embodiments of the present invention, it is preferred that AV induces CARE amplification while not producing more AV particles.Because the produced AV particles may contaminate any material (e.g., AAV protein or vaccine particles) produced during CARE amplification.Therefore, it is preferred to prevent the formation of AV particles.

[0093] In some preferred embodiments, the first nucleotide sequence encodes an shRNA or siRNA against an AV late gene mRNA. In other embodiments of the present invention, the cell comprising the nucleic acid molecule of the present invention encodes an shRNA or siRNA against an AV late gene mRNA.

[0094] Preferred AV late gene mRNAs include hexon, penton, fiber, protein VI, protein IIIa, protein VIII, protein IX, protein Mu, protein VII, protein V, protein IX and Iva2 mRNAs. Most preferably, shRNA targets multiple AV late genes. Most preferred targets of shRNA against AV late genes are genes essential for AV icosahedron formation (e.g., hexon). Thus, targeting these genes inhibits or prevents AV particle assembly.

[0095] One or more other factors may be provided in cis or trans to facilitate amplification of the first nucleotide sequence.

[0096] In particular, one or more of the following factors may be provided in the form of a polypeptide or in the form of a gene encoding said polypeptide: (i) one or more adenoviral early gene products, (ii) one or more adenoviral late gene products, and / or (iii) one or more AAV gene products. Each of these gene products may be provided as a separate part or combination of parts, as appropriate, or may be provided by infecting the host cell with adenovirus or AAV.

[0097] Preferably, the adenovirus early gene product is selected from adenovirus E1A, adenovirus E1B, adenovirus E2A, adenovirus VA RNA and adenovirus E4. The adenovirus E1A gene product and the adenovirus E1B gene product are preferably provided using the nucleic acid molecule of the present invention in a cell line in which the E1A and E1B genes are present (e.g., a cell line in which they are integrated into the host cell genome, such as HEK293 cells, PerC6 cells or 911 cells). Preferably, the one or more adenovirus early gene products include E2A. The adenovirus VA RNA gene product and the adenovirus E4 gene product may be provided by infecting the cell line with adenovirus.

[0098] In embodiments of the invention relating to the production of AAV, one or more adenoviral early gene products may be required to effect packaging of the AAV, which gene products are preferably present in the adenoviral vector within the host cell.

[0099] Preferably, the adenovirus late gene product is selected from one or more of adenovirus L4 22K polypeptide, adenovirus L4 33K polypeptide and adenovirus L4 100K polypeptide. The adenovirus late gene products such as L4 22K, L4 33K and L4 100K may be provided in separate nucleic acid molecules or may be provided by infecting cell lines with adenovirus. The preferred L4 22K and L4 33K sequences are disclosed herein. Preferably, the AAV gene product is Rep78 / Rep68. The AAV gene product may be provided in AAV.

[0100] In some embodiments, the nucleic acid molecule contains only two CARE elements or fragments thereof. In other embodiments, the nucleic acid molecule does not contain more than 5, 10 or 20 CARE elements or fragments thereof. In other embodiments, the nucleic acid molecule contains only two CARE elements or fragments thereof in any stretch of 1000, 5000 or 10000 nucleotides of the nucleic acid molecule. In other embodiments, the nucleic acid molecule does not contain either forward or reverse CARE elements.

[0101] In some embodiments, the nucleic acid molecule of the present invention is integrated into a host cell genome, for example, a human chromosome. For example, 1-100, 1-20, or 5-10 copies of the nucleic acid molecule of the present invention may be integrated into a host cell genome, for example, a human chromosome. In some preferred embodiments, copies of the nucleic acid molecule of the present invention may be integrated into multiple (for example, 2-10 or more) different locations in a host cell chromosome. In this case, the nucleic acid molecules are not linked to each other.

[0102] In some embodiments, the nucleic acid molecule of the present invention is integrated into the AAVS1 site of human chromosome 19. Adeno-associated virus (AAV) is the only known eukaryotic virus that can target human chromosome 19 to integrate into a well-characterized site, i.e., the AAVS1 site. The site-specific integration of AAV is mediated by Rep68 and Rep78. The latter viral protein binds to both the viral genome and the AAVS1 site on chromosome 19 via the RRS located in the viral genome and the AAVS1 site. The AAVS1 site has been mapped to 19q13.4-qter of human chromosome 19 by in situ hybridization (Giraud, C., E. Winocour, and KI Berns. 1994. Site-specific integration by adeno-associated virus is directed by a cellular DNA sequence. Proc. Natl. Acad. Sci. USA 91: 10039-10043).

[0103] In some embodiments, the nucleic acid molecules of the invention are present in an episome, such as a plasmid or vector. In some embodiments, the plasmid or vector comprises a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) of the nucleic acid molecules of the invention. These nucleic acid molecules may be contiguous or non-contiguous.

[0104] In some embodiments, the first nucleic acid molecule may be pre-linked before being introduced into a cell, and the linked DNA molecule (e.g., a plasmid or vector) will be integrated into the chromosome of the cell. As used herein, the term "linked" refers to a molecule having or including the following structure: {-[CARE element]-[first nucleotide sequence]-} n However, n is 2 or more (for example, 2 or 3 to 10 or more).

[0105] For example, the molecule may have the structure: [first CARE element]-[first nucleotide sequence]-[second CARE element]-[first nucleotide sequence] (i.e., n=2). Such structures form further embodiments of the present invention. In another embodiment, the nucleic acid molecules may be designed to self-ligate before or after insertion into a cell. This self-ligation facilitates the formation of the nucleic acid of the present invention. Since the self-ligation relies on compatible cohesive ends of the DNA molecules, the DNA molecules unidirectionally assemble into a series of nucleic acid molecules of the present invention based on DNA base pairs that facilitate the self-ligation.

[0106] For example, the molecule may have or include the structure: X1-{-[CARE element]-[first nucleotide sequence]-} n -X2 wherein n is 1 or more (e.g., 1 or 2-10 or more), X1 and X2 are each independently a stretch of single-stranded DNA, and the nucleotide sequences of X1 and X2 are complementary or partially complementary to each other. Such structures form further embodiments of the present invention.

[0107] The nucleotide sequences of X1 and X2 are complementary or partially complementary to each other, such that these structures can form linear concatemers of the nucleic acid molecules of the present invention.

[0108] In some embodiments, a DNA molecule may be used to bridge components of the nucleic acid molecule of the present invention (e.g., the CARE element and the first nucleotide sequence) to promote self-assembly in vivo. This is achieved by cross-linking the CARE element and the first nucleotide sequence in a way that shares homology, thereby favoring the assembly of the nucleic acid molecule of the present invention by homology-dependent repair in cells.

[0109] The present invention also provides a host cell comprising the nucleic acid molecule of the present invention. The host cell may be an isolated cell, e.g., they are not present in a living animal or mammal. Preferably, the host cell is a mammalian cell. Mammalian cells include those derived from any organ or tissue from human, mouse, rat, hamster, monkey, rabbit, donkey, horse, sheep, cow and ape. The cell is preferably a human cell. The cell may be a primary cell or an immortalized cell.

[0110] Preferred cells include HEK-293 cell line, HEK 293T cell line, HEK-293E cell line, HEK-293 FT cell line, HEK-293S cell line, HEK-293SG cell line, HEK-293 FTM cell line, HEK-293SGGD cell line, HEK-293A cell line, MDCK cell line, C127 cell line, A549 cell line, HeLa cell line, CHO cell line, mouse myeloma cell line, PerC6 cell line, 911 cell line and Vero cell line. HEK-293 cells are modified to contain E1A and E1B proteins, so that these proteins do not need to be provided in the helper plasmid or present in the adenoviral vector used in the present invention. Similarly, PerC6 and 911 cells can also be used, containing smaller modifications. Most preferably, the human cells are HEK293, HEK293T, HEK293A, PerC6 or 911 cells. Other preferred cells include Hela, CHO and VERO cells.

[0111] Other preferred cells include HEK-293AD cells and suspension CHO-X cells.

[0112] In still other embodiments, the host cell further comprises one or both of (c) and (d) below. (c) AAV transfer plasmid containing the transgene flanked by ITRs; (d) an adenovirus helper plasmid for AAV production, comprising one or more genes selected from E1A, E1B, E2A, E4 and VA RNA; In some embodiments of the invention, the helper plasmid contains the E2A gene. In other embodiments, the helper plasmid does not contain the E2A gene. In the latter case, the absence of the E2A gene significantly reduces the amount of DNA required for the helper plasmid. Such cells are commonly known as packaging cells.

[0113] In some embodiments of the present invention, the host cell does not comprise an adenovirus or a herpesvirus. In some embodiments (e.g., the first nucleotide sequence comprises a rep gene), the host cell does not comprise an E1A gene or an E1A gene product. In some embodiments (e.g., the first nucleotide sequence comprises a rep gene), the host cell does not comprise an E1B gene or an E1B gene product. In some embodiments (e.g., the first nucleotide sequence comprises an adenovirus gene), the host cell does not comprise an AAV Rep gene product.

[0114] In some preferred embodiments, the AAV cap gene is integrated into the host cell genome under the control of a promoter that can be activated by a polypeptide (an activator) encoded within the adenoviral vector.

[0115] In yet another embodiment of the invention, the adenoviral vector of the invention encodes a polypeptide capable of transcriptionally activating a (remote) promoter, e.g., a promoter present in a host cell. Preferably, the promoter in the host cell is operably associated with (i.e., drives expression of) the AAV cap gene.

[0116] In some embodiments, the adenoviral vector encodes a polypeptide that can transcriptionally activate a promoter that is not present in the adenoviral vector.

[0117] Examples of such activators include the VP16 transcription activator from herpes simplex virus and the transactivator domain from the p53 protein. The activator may be linked to a DNA binding domain that binds to the coumate or tetracycline binding site of the cap gene promoter. This reduces the burden of expressing the AAV cap gene during adenovirus production, since transcription of the cap gene is induced only when the adenovirus vector is present in the host cell.

[0118] The nucleic acid molecules, plasmids and vectors, and host cells of the present invention can be produced by suitable techniques. Recombinant methods for producing the nucleic acid molecules and packaging cells of the present invention are well known in the art (e.g., "Molecular Cloning: A Laboratory Manual" (Fourth Edition), Green, MR and Sambrook, J., (updated 2014)).

[0119] The expression of the transgene and other desired genes (e.g., rep and cap genes) from the nucleic acid molecule of the present invention may be analyzed by a suitable analysis method. Such analysis methods include, but are not limited to, Western blot, Northern blot, enzyme-linked immunosorbent assay (ELISA), RT-QPCR, and dot blot. The amplification of the nucleic acid of the present invention may be measured by analyzing the genome copy number per ml by a suitable detection method, for example, qPCR (described in the Examples of this specification), and comparing it to a reference locus in the chromosome of the cell. Ideally, such a locus will be 1 or 2 copies per reference genome, so that the relative copy number can be used to compare the amplification.

[0120] In yet another embodiment, the present invention provides a process for producing an engineered host cell, the process comprising: (a) introducing a nucleic acid molecule of the invention into a host cell to produce a modified host cell.

[0121] In some embodiments, the nucleic acid molecule is in the form of a vector or plasmid. In some embodiments, the process is carried out under conditions such that the nucleic acid molecule is integrated into the host cell genome.

[0122] In some embodiments, the host cell is a host cell that expresses or can express an AAV Rep polypeptide and / or an AAV Cap polypeptide and / or an AAV genome.For example, the host cell may be a host cell into which one or more nucleic acid molecules of the present invention are stably integrated, comprising a first nucleotide sequence encoding an AAV Rep polypeptide and / or an AAV Cap polypeptide.The nucleotide sequence encoding the Rep polypeptide and / or the Cap polypeptide is preferably operably associated with a suitable regulatory element, for example, an inducible promoter or a constitutive promoter.

[0123] For example, the host cell may be a host cell that contains one or more DNA plasmids or DNA vectors, in which a first nucleotide sequence comprises a nucleic acid molecule of the present invention encoding an AAV Rep polypeptide and / or an AAV Cap polypeptide. The nucleotide sequence encoding the Rep polypeptide and / or the Cap polypeptide is preferably operably associated with a suitable regulatory element, such as an inducible or constitutive promoter. The host cell may be an AAV packaging cell or an AAV production cell.

[0124] As used herein, the term "introducing" one or more plasmids, vectors or nucleic acid molecules into a cell includes transformation, and in particular any form of electroporation, conjugation, infection, transduction or transfection.

[0125] In yet another embodiment, the present invention provides a method for amplifying a first nucleotide sequence in a host cell, the method comprising the steps of: (a) culturing a host cell, the host cell comprising: (i) a first nucleic acid molecule, said first nucleic acid molecule comprising: (a) a first CARE element comprising or consisting of an AAV p5 promoter; (b) a first nucleotide sequence; and (c) a second CARE element comprising or consisting of the AAV p5 promoter; (a), (b) and (c) are operably associated in that order (5'-3') in the nucleic acid molecule, and the first CARE element and the second CARE element are both in the same 5'-3' orientation; The host cell optionally comprises: (ii) further comprising one or more second nucleic acid molecules comprising one or more promoters operably associated with one or more adenoviral early genes or adenoviral late genes; Culturing the host cell under conditions in which AAV Rep and one or more adenoviral early gene products and / or late adenoviral gene products are present in the host cell to promote amplification of the first nucleotide sequence.

[0126] In some embodiments, the method may further comprise, prior to step (a), introducing the first nucleic acid molecule into the host cell.

[0127] Preferably, the adenovirus early gene product is selected from adenovirus E1A, adenovirus E1B, adenovirus E2A, adenovirus VA RNA and adenovirus E4, and most preferably is adenovirus E1A.Preferably, the adenovirus late gene product is selected from one or more of adenovirus L4 22K polypeptide, adenovirus L4 33K polypeptide and adenovirus L4 100K polypeptide.

[0128] In some embodiments, the second nucleic acid molecule is present in adenovirus or adenovirus vector in host cell.Preferably, adenovirus early gene product is selected from adenovirus E1A, adenovirus E1B, adenovirus E2A, adenovirus VA RNA and adenovirus E4, and most preferably is adenovirus E1A.Preferably, adenovirus late gene product is selected from one or more of adenovirus L4 22K polypeptide, adenovirus L4 33K polypeptide and adenovirus L4 100K polypeptide.

[0129] In some preferred embodiments, the first nucleotide sequence comprises (i) an AAV rep gene, (ii) an AAV cap gene, (iii) an AAV rep gene and an AAV cap gene, or (iv) an AAV cap gene and a transgene, any of (i)-(iv) optionally flanked by AAV ITRs.

[0130] In some embodiments in which the first nucleotide sequence does not include the AAV rep gene, a recombinant AAV containing the AAV rep gene is preferably present in the cell or introduced into the cell, such as via a plasmid or vector. In other embodiments in which the first nucleotide sequence does not include the AAV rep gene, a recombinant AV vector containing the AAV rep gene inserted into the E1 region of an E1 / E3 deleted adenoviral vector is preferably present in the cell or introduced into the cell. The rep gene may also be inserted into other locations of the AV genome, such as the E3 region.

[0131] In some embodiments, the rep gene is present in the AV vector and is not operably associated with a functional promoter.

[0132] In yet another embodiment, the present invention provides a process for producing a recombinant viral particle comprising a transgene, said process comprising the steps of: (a) culturing a host cell, the host cell comprising: (i) a transfer plasmid containing the 5'-viral ITR and the 3'-viral ITR flanking the transgene; (ii) a nucleic acid molecule of the invention, comprising a viral rep gene and a viral cap gene flanked by a first CARE element and a second CARE element, said nucleic acid molecule being present in said host cell on an episomal plasmid or vector or integrated into said host cell genome; (iii) AV helper genes sufficient to facilitate amplification of the rep and cap genes and to package the transfer plasmid, wherein the helper genes are present on an episomal helper plasmid in the host cell, present on an adenoviral vector, or integrated into the host cell genome; culturing said host cells under conditions such that the viral rep gene and viral cap gene are amplified by said host cells and viral particles are assembled; (b) recovering packaged viral particles from said host cells or from said medium.

[0133] Preferably, the virus is AAV. Preferably, the host cell is a virus packaging cell.

[0134] When the nucleic acid molecule of the present invention is in a plasmid or vector, the plasmid or vector can be introduced into the host cell before or after the introduction of the transfer plasmid.When the helper gene is in a helper plasmid or adenovirus vector, the helper plasmid or adenovirus vector can be introduced into the host cell before or after the introduction of the transfer plasmid.In the above context, the term "adenovirus vector" includes adenovirus.

[0135] The AV helper gene is preferably selected from one or more of the following: (adenovirus) E1A gene, (adenovirus) E1B gene, (adenovirus) E4 gene and (adenovirus) VA gene. In some embodiments of the present invention, the helper gene further comprises the E2A gene. In other embodiments, the helper gene does not comprise the E2A gene. The AV helper gene may comprise an AV late gene.

[0136] Preferably, the recovered viral particles are subsequently isolated and / or purified.

[0137] The host cell is cultured (in a suitable medium) under conditions such that the first nucleic acid molecule and, if present, the second nucleic acid molecule are expressed. Suitable culture conditions for host cells are well known in the art (e.g., "Molecular Cloning: A Laboratory Manual" (Fourth Edition), Green, MR and Sambrook, J., (updated 2014)). In some embodiments, the host cell can be in a medium, preferably a liquid medium.

[0138] As used herein, the term "amplify" refers to the production of multiple DNA molecules. Multiple DNA molecules are likely to include molecules of different lengths. DNA regions flanking the nucleic acid molecule of the present invention may also be amplified at a lower level (about 10-fold) than the nucleic acid molecule of the present invention when inserted into a cell chromosome.

[0139] Each DNA molecule of the plurality of DNA molecules may have a nucleotide sequence that includes a portion of the nucleotide sequence of the first and second CARE elements or fragments thereof. Without being bound by theory, it is believed that the minimal amplification region is located between the respective Rep binding sites (RBS) in the CARE element adjacent to the first nucleotide sequence, and thus a portion of each CARE element and the first nucleotide sequence are amplified. In some embodiments, the entire CARE element may be amplified. In embodiments of the present invention that are composed of repeat concatemers of the nucleic acid molecules of the present invention, DNA amplification may proceed over the plurality of nucleic acid molecules of the present invention during the amplification process.

[0140] Each DNA molecule of the plurality of DNA molecules can also have a nucleotide sequence that includes all or a portion of the first nucleotide sequence.

[0141] In some embodiments, the nucleic acid molecule of the invention may be present in a cell in 1-100 copies, preferably 1-20 copies, most preferably 5-10 copies. The plurality (amplified) DNA molecule may consist of 50-1000 or more discrete DNA molecules in a cell. The level of amplification achieved depends on the sequence length of the first nucleotide sequence, its complexity, and the number of copies of the initial nucleic acid molecule in the cell.

[0142] The plurality of amplified DNA molecules are double-stranded DNA molecules, which are generated by synthesizing single-stranded DNA molecules and then annealing the single-stranded DNA molecules to form double-stranded DNA molecules. The plurality of amplified DNA molecules are linear extrachromosomal DNA molecules.

[0143] In some embodiments, one or more methods or processes of the invention include: The method further comprises the step of isolating and / or purifying the amplified DNA molecule and / or its gene product.

[0144] For example, the amplified DNA product may be purified by DNA purification using silica resin in the presence of ethanol. The gene products (e.g., polypeptides) of the amplified DNA products may be purified by any method suitable for purification of that particular product, for example, affinity chromatography.

[0145] In some preferred embodiments, the first nucleotide sequence comprises an AAV rep gene and an AAV cap gene, the host cell comprises E1A and E1B genes integrated into the host cell genome (e.g., a HEK293 cell), and further, the rep gene is not expressed from the p5 promoter within the first CARE element.

[0146] In other preferred embodiments, the first nucleotide sequence comprises the AAV rep gene and optionally the AAV cap gene, the host cell does not express the E1A gene (and optionally the E1B gene) from the host cell chromosome, the E1A gene (and optionally the E1B gene) are expressed in the host cell from an adenoviral vector, and the rep gene is optionally expressed from the p5 promoter within the first CARE element.

[0147] In other preferred embodiments, the first nucleotide sequence comprises a transgene (e.g., an antigen, a VLP protein, or a therapeutic protein) and the host cell optionally comprises E1A and E1B genes integrated into the host cell genome (e.g., HEK293 cells).

[0148] In other preferred embodiments, the first nucleotide sequence comprises an AAV rep gene and an AAV cap gene, the host cell comprises an E1A gene and an E1B gene integrated into the host cell genome, the E1A gene and the E1B gene are not expressed from an E1 promoter (e.g., the E1A gene and the E1B gene are expressed from an inducible promoter), and further, the rep gene is not expressed from a p5 promoter within the first CARE element.

[0149] In these preferred embodiments, the first nucleotide sequence may optionally further encode an shRNA or siRNA against an AV late gene mRNA or an AV E2B gene. In these preferred embodiments, in a cell comprising a nucleic acid molecule of the invention, the cell may optionally encode an shRNA or siRNA against an AV late gene mRNA or an AV E2B gene.

[0150] WO2019 / 020992 discloses that transcription of late adenoviral genes can be regulated (e.g., inhibited) by inserting a repressor element into the major late promoter. By "switching off" expression of the late adenoviral genes, the protein manufacturing capacity of the cell can be diverted to the production of the desired recombinant protein or AAV particles.

[0151] However, the applicants subsequently found that inhibiting the late adenoviral genes by repressing the major late promoter, as described in WO2019 / 020992, has the undesirable effect of inhibiting CARE-dependent replication of the rep and cap genes when these genes are integrated into the host cell genome.

[0152] Preferably, the adenoviral vector comprises a repressible major late promoter (MLP), more preferably said MLP comprises one or more repressor elements capable of regulating or controlling transcription of adenoviral late genes, and further, one or more of said repressor elements are inserted downstream of the MLP TATA box.

[0153] Preferably, the nucleic acid molecule, the AAV cap gene and the transfer plasmid are (i) stably integrated into the host cell genome or (ii) present on an episomal plasmid or vector within the host cell.

[0154] Preferred features of the process for producing viral (preferably AAV) particles include the following. The one or more repressor elements are inserted between the -MLP TATA box and the transcription +1 position. said repressor element is capable of binding to a repressor protein; a gene encoding a repressor protein capable of binding to said repressor element is encoded within the adenoviral genome. - The repressor protein is transcribed under the control of the MLP. said repressor protein is a tetracycline repressor, a lactose repressor or an ecdysone repressor, preferably a tetracycline repressor (TetR). said repressor element is a tetracycline repressor binding site which comprises or consists of the sequence shown in SEQ ID NO: 16. the nucleotide sequence of said MLP comprises or consists of the sequence shown in SEQ ID NO: 17 or 18. the presence of said repressor element does not affect the production of the adenoviral E2B protein. The transgene is inserted into one of the adenovirus early regions, preferably into the adenovirus E1 region instead of into a transfer plasmid. - said transgene contains a tripartite leader (TPL) in its 5'-UTR. - said transgene encodes a therapeutic polypeptide. said transgene encodes a viral protein, preferably a protein that can assemble into or out of a cell to produce a virus-like particle, preferably said transgene encodes Norovirus VP1 or Hepatitis B HBsAG.

[0155] Particularly preferably, one or more of said repressor elements are inserted downstream of the MLP TATA box.

[0156] There are many established algorithms that can be used to align two amino acid or nucleic acid sequences. Typically, one sequence is a reference sequence, and the test sequence can be compared to the reference sequence. Sequence comparison algorithm calculates the percentage sequence identity of the test sequence to the reference sequence based on designated program parameters. The alignment of the amino acid or nucleic acid sequence for comparison can be performed, for example, by computer-implemented algorithms (for example, GAP, BESTFIT, FASTA or TFASTA), or BLAST and BLAST 2.0 algorithms, etc.

[0157] Percentage amino acid sequence identity and percent nucleotide sequence identity may be determined using the BLAST method of alignment (Altschul et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: 3389-3402; and http: / / www.ncbi.nlm.nih.gov / BLAST). Preferably, standard or default alignment parameters are used.

[0158] Standard protein-protein BLAST (blastp) may be used to find similar sequences in protein databases. Like other BLAST programs, blastp is designed to be able to find local regions of similarity. If the sequence similarity spans the entire sequence, blastp also reports a global alignment, which is the preferred result for protein identification purposes. Preferably, standard or default alignment parameters are used. In some cases, the "low complexity filter" may be removed.

[0159] BLAST protein searches may be performed with the BLASTX program, score=50, wordlength=3. To obtain gapped alignments for comparison purposes, Gapped BLAST (included in BLAST 2.0) can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389. Alternatively, PSI-BLAST (included in BLAST 2.0) can be used to perform iterative searches that detect distant relationships between molecules (Altschul et al. (1997) supra). When using BLAST, Gapped BLAST, or PSI-BLAST, the default parameters of the respective programs can be used.

[0160] For nucleotide sequence comparison, MEGABLAST, discontinuous megablast and blastn may be used to achieve this goal. Preferably, standard or default alignment parameters are used. MEGABLAST is specifically designed to efficiently find long alignments between highly similar sequences. Discontinuous MEGABLAST can be used to find nucleotide sequences that are similar but not identical to the nucleic acid of the present invention. The BLAST nucleotide algorithm finds similar sequences by breaking down a query into short subsequences called words. The program first identifies exact matches to the query words (word hits). The BLAST program then expands these word hits in multiple stages to generate a final gap match. In some embodiments, BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12.

[0161] One of the important parameters governing the accuracy of BLAST searches is the word size. The most important reason why blastn is more sensitive than MEGABLAST is that it uses a shorter default word size (11). This makes blastn better than MEGABLAST at finding matches to related nucleotide sequences from other organisms. The word size can be adjusted in blastn, shortening it from the default to a minimum of 7, to increase the search sensitivity.

[0162] More sensitive searches can be performed using the newly introduced discontinuous megablast page (www.ncbi.nlm.nih.gov / Web / Newsltr / FallWinter02 / blastlab.html), which uses an algorithm similar to that reported by Ma et al. (Bioinformatics. 2002 Mar; 18(3): 440-5). Discontinuous megablast uses non-contiguous words in a longer window of the template as seeds for match extension, rather than requiring exact word matches. In coding mode, it takes into account third base wobble by focusing on finding matches at the first and second codon positions while ignoring mismatches at the third position. Searches in discontinuous MEGABLAST with the same word size are more sensitive and efficient than standard blastn with the same word size. Parameters specific to discontinuous megablast are word size: 11 or 12; template: 16, 18 or 21; template type: coding (0), non-coding (1) or both (2).

[0163] In some embodiments, the BLASTP2.5.0+ algorithm (such as that available from NCBI) may be used with default parameters. In other embodiments, the BLAST Global Alignment program (such as that available from NCBI) may be used with a Needleman-Wunsch alignment of two protein sequences with gap costs: Existence 11 and Extension 1.

[0164] As used herein, the term "sequence identity" in the context of amino acid sequences may be interchanged with "sequence similarity." The term "similarity" allows for conservative substitution of amino acid residues with similar physicochemical properties over a defined length of a given sequence. The percentage of similarity is determined with an appropriate similarity scoring matrix.

[0165] In yet another embodiment, (a) a first CARE element or a fragment thereof; (b) a first nucleotide sequence; and (c) a second CARE element or a fragment thereof, The present invention provides a nucleic acid molecule, wherein (a), (b) and (c) are operably associated in this order in the nucleic acid molecule, and the first CARE element and the second CARE element or fragments thereof are both in the same 5'-3' orientation.

[0166] In some embodiments, the first and / or second CARE element comprises: (i) an AAV p5 promoter; and (ii) the 5' portion of the AAV rep gene.

[0167] In some embodiments, the first and / or second CARE element comprises: (iii) a region of the AAV genome corresponding to nucleotides 146 to 190 of the AAV2 genome, or a variant of said region having at least 80% (preferably, at least 85%, 90%, 95% or 99%) sequence identity to said region, or a fragment of said region that is at least 50% (preferably, at least 60%, 70%, 80%, 90% or 95%) of the length of said region.

[0168] The disclosure of each reference cited in this application is specifically incorporated herein by reference in its entirety. [Brief description of the drawings]

[0169] [Figure 1] FIG. 1 shows examples of three CARE amplification cassettes of the invention. [Diagram 2] FIG. 2 shows the results of CARE-directed amplification in HeLa cells using a CARE amplification cassette of the invention and controls. [Diagram 3] FIG. 3 shows the use of siRNA targeting the Ad5 E2B gene to reduce replication of TERA-E1 and Ad5-E1 genomes in HeLaRC32 cells. [Figure 4] Figure 4 shows the use of siRNA targeting the Ad5 E2B gene, which increases AAV2 rep DNA amplification from HeLaRC32 cells infected with Ad5-E1 and TERA-E1 during MLP suppression (DMSO-treated group). [Diagram 5] Figure 5 shows the use of siRNA targeting the Ad5 E2B unit, which increases AAV2 cap DNA amplification from HeLaRC32 cells infected with Ad5-E1 and TERA-E1 during MLP suppression (DMSO-treated group). [Figure 6] FIG. 6 shows the use of a Rep78 expression plasmid to induce CARE-directed amplification in 293AD cells using a CARE amplification cassette of the invention and controls. [Figure 7]FIG. 7 shows the results of CARE-directed amplification in 293AD cells using a CARE amplification cassette of the invention and controls. [Figure 8] FIG. 8 shows the results of CARE-directed amplification in CHO-X cells using a CARE amplification cassette of the invention and controls. [Figure 9] FIG. 9 shows the results of CARE-directed amplification in 293AD cells using a CARE amplification cassette embodying the invention.

[0170] Working Example The present invention is further illustrated by the following examples, in which parts and percentages are by weight and temperatures are in degrees Celsius unless otherwise stated. It should be understood that these examples, while showing preferred embodiments of the present invention, are presented for illustrative purposes only. From the above discussion and these examples, one skilled in the art can ascertain the essential characteristics of the present invention and make various modifications and variations to the present invention to suit various applications and conditions without departing from the spirit and scope thereof. Thus, in addition to those shown and described herein, various variations of the present invention will become apparent to those skilled in the art from the preceding description. It is intended that such variations fall within the scope of the appended claims.

[0171] Example 1: Creation of a CARE-driven amplification cassette As a reporter cassette, we generated an enhanced green fluorescent (eGFP) expression cassette, which contained a Kozak-Shine-Dalgarno sequence and an SV40 polyadenylation sequence (poly(A) signal) flanking the eGFP gene. As shown in Figure 1, fragments of the wild-type AAV2 sequence (NC_001401.2) were cloned upstream and downstream of the eGFP expression cassette, maintaining the 5'-3' orientation of all components, to generate three CARE-eGFP-CARE amplification cassettes. The first amplification cassette contained AAV2 nucleotides 191-320 ("191-320CARE"). The second amplification cassette contained AAV2 nucleotides 146-353 ("146-353CARE"). The third amplification cassette contained AAV2 nucleotides 146-542 ("146-542CARE"). The third amplification cassette further contained the AAV rep gene. In this cassette, the AAV Rep open reading frame (starting at nt position 321) was mutated by substitution to remove the ATG start codon. The native AAV p5 promoter region was maintained in all cases, including the TATA box, Rep binding site (RBS), and terminal separation site (trs) to initiate transcription of the eGFP ORF. An "eGFP control" cassette was also generated that did not contain the AAV2 (CARE) nucleotide region. A "CARE control" cassette was also generated that did not contain the eGFP cassette.

[0172] Example 2: CARE-directed DNA amplification of integrated CARE-eGFP-CARE vectors The CARE-eGFP-CARE amplification cassette generated in Example 1 was cloned into an integration plasmid encoding puromycin resistance and ΦC31 integrase attB recognition sites (Thyagarajan et al. 2001. Mol. Cell. Biol. 21, 3926-3934). HeLa cells were seeded at 9.6e5 cells / well in 6-well plates 16 hours prior to transfection with ΦC31 expression plasmid and the desired integration construct at a ratio of 10:1 for a total of 2.5 μg of DNA to be transfected. The cells were placed under 0.5 μg / mL puromycin selection and after 2-3 weeks were transfected into T75cm 2 Stable pooled cell lines were grown in flasks. To test for CARE-directed amplification, cell lines were seeded at 9.6e5 cells / well in 6-well plates without selection 16 hours prior to transfection with 0.25μg Rep78 expression plasmid and 2.25μg stuffer DNA. 24 hours post-transfection medium was changed. After another 24 hours Rep78-transfected cells were counted and seeded in sextuplicate at 9.6e4 cells / well in 48-well plates. The next day, three wells of each cell line were inoculated with TERA-E1 (see Example 3) at a multiplicity of infection of 50 in the presence of 0.5 μg / mL doxycycline. The remaining three uninfected wells (labeled "None" in Figure 2) were treated with an equivalent volume of DMSO only. Genomic DNA was harvested from each well 96 hours after infection and quantified by qPCR in triplicate using 10 ng of DNA per reaction. SYBR qPCR was performed for eGFP, the internal host genes RPPH1 and TERT. Relative eGFP values ​​were calculated for each sample by geometric normalization of the internal host genes (Vandesompele et al. 2002. Genome Biol. 2002 Jun 18; 3(7): RESEARCH0034). Figure 2 shows the relative fold change for each cell line compared to the uninfected sample. "eGFP control" and "CARE control" represent HeLa cell lines produced in the same manner as the CARE-eGFP-CARE cell line, except that they lack the AAV sequences or the eGFP cassette, respectively. These results indicate that a significant level of amplification of the eGFP cassette occurred in an amplified cassette containing an eGFP gene flanked by multiple CARE elements.

[0173] Example 3: Reduction of adenovirus genome replication by siRNA knockdown of the Ad5 E2B transcription unit WO2019 / 020992 discloses that transcription of late adenoviral genes can be regulated (e.g., inhibited) by inserting a repressor element into the major late promoter (MLP). By "switching off" expression of the late adenoviral genes, the protein manufacturing capacity of the cell can be diverted to the production of the desired recombinant protein or AAV particles. An MLP-inhibitory adenovirus with a deleted E3 region ("TERA-E1") was produced according to the method disclosed in WO2019 / 020992. Ad5-E1, a serotype 5 adenovirus with a deletion of the viral E3 region, was generated by molecular cloning methods and produced in HEK293 cells. HeLaRC32 cells were seeded at 9.0e4 cells / well in 48-well tissue culture plates and cells were transfected with siRNA targeting the Ad5 E2B unit (Kneidinger et al. 2012. Antiviral Res, 94: 195-207), scrambled siRNA (NC) or mock transfection. 24 hours after transfection, cells were infected with TERA-E1 or Ad5-E1 at an MOI of 50 and transfected with a plasmid encoding the AAV transfer genome (pAAV-EGFP). Cells were treated with doxycycline 0.5 μg / mL or DMSO 4 hours after infection. Total DNA was extracted 72 hours after infection and quantified by qPCR using primers and probes against Ad5 hexon. The results are shown in Figure 3. Figure 3 shows that siRNA targeting the Ad5 E2B gene reduces the replication of TERA-E1 and Ad5-E1 genomes in HeLaRC32 cells. The same principle can be applied to the AAV production of the process of the present invention to suppress the production of AV particles.

[0174] Example 4: siRNA knockdown of the Ad5 E2B transcription unit increases AAV rep DNA amplification from stable AAV packaging HeLaRC32 cells As described in Example 3, TERA E1 and Ad5 E1 recombinant adenoviruses were generated. HeLaRC32 cells were seeded at 9.0e4 cells / well in 48-well tissue culture plates and cells were transfected with siRNA targeting the Ad5 E2B unit (Kneidinger et al. 2012. Antiviral Res, 94: 195-207), scrambled siRNA (NC) or mock transfection. 24 hours after transfection, cells were infected with TERA-E1 or Ad5-E1 at an MOI of 50 and transfected with a plasmid encoding the AAV transfer genome (pAAV-EGFP). Cells were treated with doxycycline 0.5 μg / mL or DMSO 4 hours after infection. Total DNA was extracted 72 hours after infection and quantified by qPCR using primers and probes against the AAV2 rep gene. The results are shown in Figure 4. Figure 4 shows that siRNA targeting Ad5 E2B gene increases AAV2 rep DNA amplification from Ad5-E1 and TERA-E1 infected HeLaRC32 cells during MLP suppression (DMSO treatment group). The same principle can be applied to AAV production in the process of the present invention to enhance the production of AAV rep gene.

[0175] Example 5: siRNA knockdown of the Ad5 E2B transcription unit increases AAV cap DNA amplification from stable AAV packaging HeLaRC32 cells As described in Example 3, TERA E1 and Ad5 E1 recombinant adenoviruses were generated. HeLaRC32 cells were seeded at 9.0e4 cells / well in 48-well tissue culture plates and cells were transfected with siRNA targeting the Ad5 E2B unit (Kneidinger et al. 2012. Antiviral Res, 94: 195-207), scrambled siRNA (NC) or mock transfection. 24 hours after transfection, cells were infected with TERA-E1 or Ad5-E1 at an MOI of 50 and transfected with a plasmid encoding the AAV transfer genome (pAAV-EGFP). Cells were treated with doxycycline 0.5 μg / mL or DMSO 4 hours after infection. Total DNA was extracted 72 hours after infection and quantified by qPCR using primers and probes against the AAV2 cap. The results are shown in Figure 5. Figure 5 shows that siRNA targeting Ad5 E2B unit increases AAV2 cap DNA amplification from Ad5-E1 and TERA-E1 infected HeLaRC32 cells during MLP suppression (DMSO treatment group). The same principle can be applied to the AAV production of the process of the present invention to enhance the production of AAV cap gene.

[0176] Example 6: CARE-directed DNA amplification of integrated CARE-eGFP-CARE vectors by transfection of Rep78 into 293AD cell line The CARE-eGFP-CARE amplification cassette was cloned into an integration plasmid encoding puromycin resistance and ΦC31 integrase attB recognition sites (Thyagarajan et al. 2001. Mol. Cell. Biol. 21, 3926-3934). 293AD cells were seeded at 9.6e5 cells / well in 6-well plates 16 hours prior to transfection with ΦC31 expression plasmid and the desired integration construct at a ratio of 10:1 for a total of 2.5 μg of DNA to be transfected. The cells were placed under 0.5 μg / mL puromycin selection and after 2-3 weeks were transfected into T75cm 2 Stable pooled cell lines were grown in flasks. To test for CARE-directed amplification, cell lines were seeded at 9.6e5 cells / well in 6-well plates without selection 16 hours before transfection with 0.25 μg of Rep78 expression plasmid and 2.25 μg of stuffer DNA (labeled "Rep" in Figure 6), or 2.5 μg of stuffer DNA alone (labeled "Stuffer" in Figure 6). Medium was changed 24 hours after transfection. After another 24 hours, transfected cells were counted and seeded in triplicate at 9.6e4 cells / well in 48-well plates. Genomic DNA was harvested from each well 144 hours after transfection and quantified by qPCR in triplicate using 10 ng of DNA per reaction. qPCR with SYBR was performed for eGFP, internal host genes RPPH1 and TERT. Relative eGFP values ​​were calculated for each sample by geometric normalization of the internal host gene (Vandesompele et al. 2002. Genome Biol. 2002 Jun 18; 3(7): RESEARCH0034). Figure 6 shows the relative fold change in each cell line compared to the stuffer DNA transfection sample. "eGFP control" and "CARE control" represent 293AD cell lines produced in the same manner as the CARE-eGFP-CARE cell line, except that they lack the AAV sequences or the eGFP cassette, respectively. The results in FIG. 6 show that the AAV Rep78 protein alone is sufficient to induce significant CARE-directed amplification in the 293AD cell line, which naturally encodes and expresses the adenoviral E1A and E1B genes.

[0177] Example 7: CARE-directed DNA amplification of integrated CARE-eGFP-CARE vectors in 293AD cell lines The CARE-eGFP-CARE amplification cassette was cloned into an integration plasmid encoding puromycin resistance and ΦC31 integrase attB recognition sites (Thyagarajan et al. 2001. Mol. Cell. Biol. 21, 3926-3934). 293AD cells were seeded at 9.6e5 cells / well in 6-well plates 16 hours prior to transfection with ΦC31 expression plasmid and the desired integration construct at a ratio of 10:1 for a total of 2.5 μg of DNA to be transfected. The cells were placed under 0.5 μg / mL puromycin selection and after 2-3 weeks were transfected into T75cm 2 Stable pooled cell lines were grown in flasks. To test for CARE-directed amplification, cell lines were seeded at 9.6e5 cells / well in 6-well plates without selection 16 hours before transfection with 0.25μg Rep78 expression plasmid and 2.25μg stuffer DNA, or 2.5μg stuffer DNA alone. Medium was changed 24 hours after transfection. After another 24 hours, transfected cells were counted and seeded in 48-well plates in sextuplicate at 9.6e4 cells / well. The next day, three wells of each cell line were inoculated with TERA-E1 in the presence of 0.5 μg / mL doxycycline at a multiplicity of infection of 50. The remaining three uninfected wells (labeled “None” in Figure 7 ) were treated with an equivalent volume of DMSO only. Genomic DNA was harvested from each well 96 hours post-infection and quantified by qPCR in triplicate using 10 ng DNA per reaction. SYBR qPCR was performed for eGFP, the endogenous host genes RPPH1 and TERT. Relative eGFP values ​​were calculated for each sample by geometric normalization of the endogenous host genes (Vandesompele et al. 2002. Genome Biol. 2002 Jun 18; 3(7): RESEARCH0034). Figure 7 shows the relative fold change for each cell line compared to uninfected samples transfected with stuffer alone. "eGFP control" and "CARE control" represent 293AD cell lines produced in the same manner as the CARE-eGFP-CARE cell line, except that they lack the AAV sequences or the eGFP cassette, respectively. The results in Figure 7 show that the 293 cell line achieves higher levels of CARE-directed amplification of the eGFP cassette in the presence of Rep78 and adenoviral helper functions than in the presence of Rep78.

[0178] Example 8: CARE-directed DNA amplification of integrated CARE-eGFP-CARE vectors in suspension CHO-X cells The CARE-eGFP-CARE amplification cassette was cloned into an integration plasmid encoding puromycin resistance and ΦC31 integrase attB recognition sites (Thyagarajan et al. 2001. Mol. Cell. Biol. 21, 3926-3934). Suspension CHO-X cells were seeded at 3e6 cells / well in 24 deep-well plates 16 hours prior to transfection with ΦC31 expression plasmids and the desired integration constructs at a ratio of 10:1 for a total of 4.5 μg of DNA to be transfected. The cells were placed under 5.0 μg / mL puromycin selection and after 2-3 weeks, stable pooled cell lines were expanded in E125 flasks. To test for CARE-directed amplification, cell lines were seeded at 3e6 cells / well in 24 deep-well plates without selection 16 hours before transfecting them with 0.45μg of Rep78 expression plasmid and 4.05μg of stuffer DNA, or 4.5μg of stuffer DNA alone. After a further 48 hours, transfected cells were counted and seeded in duplicate at 6e5 cells / well in 24 deep-well plates. The next day, cells were inoculated with TERA-E1 at a multiplicity of infection of 10 in the presence of 0.5 μg / mL doxycycline or mock infected by treating with an equivalent volume of DMSO alone. Genomic DNA was harvested from each well 72 hours post-infection and quantified by qPCR in triplicate using 10 ng of DNA per reaction. SYBR qPCR was performed for eGFP. Figure 8 shows the relative fold change for each cell line relative to uninfected samples transfected with stuffer only. "CARE control" represents a CHO-X cell line produced in the same manner as the CARE-eGFP-CARE cell line, except that it lacks the eGFP cassette. The results in Figure 8 demonstrate that CARE-directed amplification is achievable in Chinese Hamster Ovary (CHO) cells, a non-human derived cell line that is widely used for large-scale industrial production of therapeutic proteins.

[0179] Example 9: CARE-directed DNA amplification of integrated CARE-GOI-CARE vectors in 293AD cell lines Various genes of interest (GOI) were cloned into CARE-GOI-CARE integration plasmids encoding puromycin resistance and ΦC31 integrase attB recognition sites (Thyagarajan et al. 2001. Mol. Cell. Biol. 21, 3926-3934). Each GOI reporter cassette contained a heterologous promoter upstream of a Kozak-Shine-Dalgarno sequence, the GOI of interest, and an SV40 polyadenylation sequence (poly(A) signal), except in the case of the luciferase cassette, which lacked a heterologous promoter. Each reporter cassette was flanked by multiple CARE elements that maintained the 5'-3' orientation. 293AD cells were seeded at 9.6e5 cells / well in 6-well plates 16 hours prior to transfection with ΦC31 expression plasmid and desired integration constructs at a 10:1 ratio for a total of 2.5 μg of DNA to be transfected. The cells were placed under 0.5 μg / mL puromycin selection and after 2–3 weeks, were transfected into T75cm2 Stable pooled cell lines were grown in flasks. To test for CARE-directed amplification, cell lines were seeded at 9.6e5 cells / well in 6-well plates without selection 16 hours before transfecting them with 0.25 μg of Rep78 expression plasmid and 2.25 μg of stuffer DNA (denoted as "Rep / " in Figure 9), or 2.5 μg of stuffer DNA alone (denoted as "Stuffer / " in Figure 9). Media was changed 24 hours after transfection. After another 24 hours, transfected cells were counted and seeded in duplicate at 8.4e5 cells / well in 6-well plates. The next day, one well per transfection was inoculated with TERA-E1 (indicated as " / virus" in Figure 9) at a multiplicity of infection of 10 in the presence of 0.5 μg / mL doxycycline. The remaining non-infected wells were treated with an equivalent volume of DMSO alone (indicated as " / control" in Figure 9). Genomic DNA was harvested from each well 96 hours post-infection and quantified by qPCR in triplicate using 10 ng of DNA per reaction. SYBR qPCR was performed for eGFP, the internal host genes RPPH1 and TERT. Relative eGFP values ​​were calculated for each sample by geometric normalization of the internal host genes (Vandesompele et al. 2002. Genome Biol. 2002 Jun 18; 3(7): RESEARCH0034). Figure 9 shows the relative fold change for each cell line compared to the non-infected sample transfected with stuffer alone (indicated as "Stuffer / control" in Figure 9). The results in Figure 9 demonstrate the utility of CARE-directed amplification for different GOI cassettes, including cassettes containing heterologous promoter sequences.

[0180] Example 10: Further identification of important CARE regions In order to identify the region of the CARE element responsible for high-level DNA amplification, a number of additional CARE-reporter gene-CARE plasmids were generated. Each plasmid in the table below contained a first CARE element consisting of a specific "5'AAV seq" sequence, an eGFP expression cassette and a second CARE element consisting of a specific "3'AAV seq" (sequence), similar to those shown in Figure 1. CARE-directed amplification was evaluated in a similar manner as described in Example 2. The results showed that the pre-p5 promoter sequence (AAV2 nt 146-191) plays a significant role in the achieved DNA amplification level, and that the sequence of the second CARE element is more important than that of the first CARE element. Furthermore, the above results revealed that the rep-coding sequence is not required for CARE-mediated DNA amplification.

[0181] [Table 1]

[0182] The sequence listing attached to this application is incorporated herein by reference. Description of additional sequences SEQ ID NO: 13 Rep nucleic acid sequence (AAV serotype 2) SEQ ID NO: 14 Cap nucleic acid sequence (AAV serotype 2) SEQ ID NO: 15 Cap amino acid sequence (AAV serotype 2) SEQ ID NO: 16 TetR binding site SEQ ID NO: 17 Modified MLP SEQ ID NO: 18 Modified MLP SEQ ID NO: 19 L4 22K Protein name: Human adenovirus D serotype 9 (HAdV-9) (UniProtKB - Q5TJ00) SEQ ID NO:20 Ad5 L4 22K SEQ ID NO: 21 Ad5 L4 22K SEQ ID NO:22 Ad5 L4 33K SEQ ID NO: 23 Ad5 L4 33K UniProtKB - P24940 (SF33K_ADE05) Sequence Listing Free Text <210> 16 <223> TetRR binding site <210> 17 <223> Modified MLP <210> 18 <223> Modified MLP

Claims

1. 1. A method for amplifying a first nucleotide sequence in a host cell, comprising: (a) culturing a host cell, The host cell comprises (i) a first nucleic acid molecule, The first nucleic acid molecule comprises: (a) a first CARE element comprising or consisting of an AAV p5 promoter; (b) a first nucleotide sequence; and (c) a second CARE element comprising or consisting of the AAV p5 promoter; (a), (b) and (c) are operably associated in this order (5'-3') in the nucleic acid molecule, and the first CARE element and the second CARE element are both in the same 5'-3' orientation; The host cell optionally comprises: (ii) further comprising one or more second nucleic acid molecules comprising one or more promoters operably associated with one or more adenoviral early genes or adenoviral late genes; The method of claim 1, wherein the step of culturing the host cell promotes amplification of the first nucleotide sequence by culturing the host cell under conditions such that AAV Rep and one or more adenoviral early gene products and / or adenoviral late gene products are present in the host cell.

2. 2. The method of claim 1 , wherein the first CARE element and / or the second CARE element each independently comprises or consists of: (i) a region of the AAV genome corresponding to nucleotides 191-320, 191-353, or 191-542 of the AAV2 genome; (ii) a molecule having a nucleotide sequence of one of SEQ ID NOs: 7, 9 or 10; (iii) A variant of (i) or (ii) having at least 80% or at least 90% sequence identity to (i) or (ii), or a fragment of (i) or (ii) that is at least 80% or at least 90% of the length of (i) or (ii), wherein said variant or said fragment is capable of promoting amplification of a first nucleotide sequence flanked by two variants or two fragments in the presence of adenovirus and AAV Rep proteins, and wherein said two variants or said two fragments are both in the same 5'-3' orientation.

3. (A) the first CARE element and / or the second CARE element each independently comprise a pre-AAV p5 promoter region and an AAV p5 promoter, or consist of a pre-AAV p5 promoter region and an AAV p5 promoter, and / or (B) each nucleotide sequence of the pre-AAV p5 promoter region independently comprises or consists of: (i) a region of the AAV genome corresponding to nucleotides 146 to 190 of the AAV2 genome; (ii) a molecule having the nucleotide sequence of SEQ ID NO:8; (iii) a variant of (i) or (ii) having at least 80% or at least 90% sequence identity to (i) or (ii), or a fragment of (i) or (ii) that is at least 80% or at least 90% of the length of (i) or (ii); The method of claim 1.

4. 2. The method of claim 1 , wherein the first CARE element and / or the second CARE element each independently comprises or consists of: (i) a region of the AAV genome corresponding to nucleotides 146-320, 146-353, or 146-542 of the AAV2 genome; (ii) a molecule having a nucleotide sequence of one of SEQ ID NOs: 6, 11, or 12; (iii) A variant of (i) or (ii) having at least 80% or 90% sequence identity to (i) or (ii), or a fragment of (i) or (ii) that is at least 80% or 90% of the length of (i) or (ii), wherein said variant or said fragment is capable of promoting amplification of a first nucleotide sequence that is adjacent to the two variants or the two fragments in the presence of adenovirus and AAV Rep proteins, and wherein said two variants or said two fragments are both in the same 5'-3' orientation.

5. 2. The method of claim 1, wherein the first CARE element and / or the second CARE element further comprises a 5' portion of an AAV rep gene. (A) the first nucleotide sequence (a) a therapeutic polypeptide, (b) a CRISPR enzyme or an sgRNA, or (c) a viral gene, and / or (d) Recombinant AAV genome and / or (B) the first nucleotide sequence (i) the AAV rep gene, (ii) the AAV cap gene, (iii) an AAV rep gene and an AAV cap gene, or (iv) comprises an AAV cap gene and a transgene; Any of (i)-(iv) may optionally be flanked by AAV ITRs; The method of claim 1.

7. The method of claim 6, wherein the first nucleotide sequence further encodes an shRNA or siRNA against an adenovirus late gene mRNA.

8. The method of claim 1, wherein the host cell expresses an adenovirus E1A protein and the first nucleotide sequence comprises an AAV rep gene and optionally an AAV cap gene; (i) the p5 promoter of the first CARE element is modified to repress expression of the rep gene from the p5 promoter of the first CARE element; or (ii) the rep gene is operably associated with a heterologous inducible promoter or a heterologous repressible promoter; or (B) the adenoviral E1A protein and / or the adenoviral E1B protein are not expressed from a chromosome of the host cell, and the adenoviral E1A protein and / or the adenoviral E1B protein are expressed in the host cell from an adenoviral vector, and the first nucleotide sequence comprises an AAV rep gene and optionally an AAV cap gene and / or a recombinant AAV genome; (i) the p5 promoter is capable of driving expression of the rep gene; or (ii) the p5 promoter is unable to drive expression of the rep gene; The method according to claim 6.

9. (i) the first nucleic acid molecule does not encode a functional Rep protein, and / or The method of claim 1, wherein (ii) the first nucleic acid molecule does not encode a functional Cap protein.

10. (a) the first nucleic acid molecule is integrated into the host cell genome; or 2. The method of claim 1, wherein (b) the first nucleic acid molecule is present within an episome in the host cell.

11. The first nucleic acid molecule has the following structure: {-[CARE element]-[first nucleotide sequence]-} n However, n is 2 or more.

2. The method of claim 1, comprising:

12. 1. A process for producing recombinant viral particles containing an introduced gene, comprising the steps of: (a) culturing a host cell The host cell comprises (i) a transfer plasmid containing 5'- and 3'-viral ITRs flanking a transgene; (ii) a first nucleic acid molecule as defined in claim 1, wherein the first nucleotide sequence comprises a viral rep gene and a viral cap gene, and the first nucleic acid molecule is present in the host cell on an episomal plasmid or vector or integrated into the host cell genome; (iii) sufficient AV helper genes to facilitate amplification of the rep and cap genes and to package the transfer plasmid, wherein the helper genes are present on an episomal helper plasmid in the host cell, present on an adenoviral vector, or integrated into the host cell genome; The step of culturing the host cell comprises culturing the host cell under conditions in which the viral rep gene and the viral cap gene are amplified by the host cell and viral particles are assembled; (b) recovering packaged viral particles from said host cells or from said medium.

13. The process of claim 12, wherein the helper genes of the adenovirus are provided by infecting the host cell with an adenovirus.

14. A nucleic acid molecule, the nucleic acid molecule comprising: (a) a first CARE element comprising an AAV p5 promoter; and (b) a first nucleotide sequence; and (c) a second CARE element comprising the AAV p5 promoter; one or both of the first CARE element and / or the second CARE element each independently further comprises a pre-AAV p5 promoter region; (a), (b) and (c) are operably associated in that order (5'-3') in the nucleic acid molecule, and the first CARE element and the second CARE element are both in the same 5'-3' orientation. (A) the first CARE element and / or the second CARE element are each independently as defined in claim 2; and / or (B)(i) the pre-AAV p5 promoter region is as defined in claim 3, or (ii) the first CARE element and / or the second CARE element are each independently defined in claim 4; and / or (C) the first CARE element and / or the second CARE element each independently further comprise a 5' portion of an AAV rep gene; and / or (D) the first nucleotide sequence is as defined in claim 6; and / or (E)(i) the first nucleic acid molecule does not encode a functional Rep protein, and / or (ii) the first nucleic acid molecule does not encode a functional Cap protein; and / or (F) the nucleic acid molecule has the following structure: {-[CARE element]-[first nucleotide sequence]-} n However, n is 2 or more. having The nucleic acid molecule of claim 14.

16. A host cell comprising the nucleic acid molecule of claim 14.

17. A process for producing an engineered host cell, the process comprising: (a) introducing into a host cell the nucleic acid molecule of claim 14, A process thereby producing an altered host cell.

Images