Flow cell and method

Abstract

An example of a flow cell includes a substrate, a plurality of reaction regions extending along the substrate, and a non-reaction region separating one of the plurality of reaction regions from an adjacent one of the plurality of reaction regions. Each of the plurality of reaction regions includes alternating first and second regions positioned along the reaction region. Each of the first regions includes a first set of primers and each of the second regions includes a second set of primers different from the first set of primers. Either of the adjacent first and second regions directly abut each other, or) the first region is positioned on a convex portion and the second region is positioned in a concave portion adjacent to the convex portion.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 195,123, filed May 31, 2021, the contents of which are incorporated by reference in their entirety herein.

[0002] (Reference to sequence listing) The sequence listing submitted via EFS-Web is incorporated herein by reference in its entirety. The file name is ILI213BPCT_IP-2091-PCT_Sequence_Listing_ST25.txt, the file size is 3,002 bytes, and the file creation date is May 26, 2022. [Background technology]

[0003] Some available platforms for sequencing nucleic acids utilize a sequencing-by-synthesis approach, in which a nascent strand is synthesized and the addition of each monomer (e.g., nucleotide) to the growing strand is detected optically and / or electronically. Because the template strand directs the synthesis of the nascent strand, the sequence of the template DNA can be inferred from the series of nucleotide monomers added to the growing strand during synthesis. In some instances, sequential paired-end sequencing can be used, where the forward strand is sequenced and removed, and then the reverse strand is constructed and sequenced. Summary of the Invention

[0004] Some of the examples disclosed herein are flow cells that contain different primer sets in adjacent reaction regions. The different primer sets are orthogonal to each other. The orthogonal primer sets allow different template strands to be amplified on each reaction region without allowing template strands from adjacent reaction regions to seed and amplify. Thus, the orthogonal primers reduce or eliminate indexing or pad hopping, which is the contamination of a cluster of amplicons of one library template in one reaction region with a different amplicon from another reaction region. The orthogonal primers also allow the reaction regions to be placed close to each other with little or no gap area separating them. This increases the reaction area density, and therefore the cluster density, and also reduces the non-functional space on the flow cell surface. The increased reaction area density increases the signal intensity during sequencing. [Brief description of the drawings]

[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and the drawings in which like reference numbers correspond to similar, but perhaps not identical, components. For purposes of brevity, reference numbers or features having previously described functions may or may not be described in conjunction with the other drawings in which they appear. [Figure 1A] FIG. 1 is a schematic diagram of an exemplary active region comprising different primer sets. [Figure 1B] FIG. 1 is a schematic diagram of a primer set that allows the generation of forward and reverse strands on adjacent active regions. [Figure 1C] FIG. 1 is a schematic diagram of a primer set that allows the generation of forward and reverse strands on adjacent active regions. [Figure 1D] FIG. 1 is a schematic diagram of a primer set that allows the generation of forward and reverse strands on adjacent active regions. [Figure 1E] FIG. 1 is a schematic diagram of a primer set that allows the generation of forward and reverse strands on adjacent active regions. [Diagram 2] FIG. 2 is a top view of the flow cell. [Figure 3A] 1A-1D are semi-schematic perspective views of different examples of surface chemistry structures within a flow cell, each of which includes reactive regions separated by non-reactive regions. [Figure 3B] FIG. 3B is a cross-sectional view of one of the reactive reactions taken along line 3B-3B of FIG. 3A. [Figure 3C] 1A-1D are semi-schematic perspective views of different examples of surface chemistry structures within a flow cell, each of which includes reactive regions separated by non-reactive regions. [Figure 4A] 1A-1C are semi-schematic perspective views of different examples of surface chemistry structures within flow cells, each of which includes rows and columns of alternating first and second reaction regions. [Figure 4B] 4B is a cross-sectional view of one of the rows of alternating first and second reaction regions taken along line 4B-4B of FIG. 4A. [Figure 4C] 1A-1C are semi-schematic perspective views of different examples of surface chemistry structures within flow cells, each of which includes rows and columns of alternating first and second reaction regions. [Diagram 5] FIG. 1 is a semi-schematic perspective view of another example of a surface chemistry structure in a flow cell, including alternating regions of first and second heights and alternating first and second reaction regions extending along the regions. [Figure 6] FIG. 13 is a semi-schematic perspective view of another example of a surface chemistry structure in a flow cell containing three different reaction regions. [Figure 7A] FIG. 13 is a top view of yet another example of a surface chemistry within a flow cell, containing capture primers at designated locations. [Figure 7B] FIG. 7B is a cross-sectional view of a different example of the structure of FIG. 7A. [Figure 7C] FIG. 7B is a cross-sectional view of a different example of the structure of FIG. 7A. [Figure 7D] FIG. 7B is a cross-sectional view of a different example of the structure of FIG. 7A. [Figure 8A] 1A-1D together generally depict example methods for making some example surface chemistries disclosed herein. [Figure 8B] 1A-1D together generally depict example methods for making some example surface chemistries disclosed herein. [Figure 8C]1A-1D together generally depict example methods for making some example surface chemistries disclosed herein. [Figure 9A] 1A-1D, together generally depict another example method for making some example surface chemistries disclosed herein. [Figure 9B] 1A-1D, together generally depict another example method for making some example surface chemistries disclosed herein. [Figure 9C] 1A-1D, together generally depict another example method for making some example surface chemistries disclosed herein. [Figure 9D] 1A-1D, together generally depict another example method for making some example surface chemistries disclosed herein. [Figure 10A] 1A-1D, together generally depict yet another example method for making other example surface chemistries disclosed herein. [Figure 10B] 1A-1D, together generally depict yet another example method for making other example surface chemistries disclosed herein. [Figure 10C] 1A-1D, together generally depict yet another example method for making other example surface chemistries disclosed herein. [Figure 11A] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 11B] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 11C] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 11D] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12A] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12B] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12C] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12D] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12E] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12F] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12G] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12H] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12I] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12J] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12K] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 12L] 1A-1D, together generally depict further exemplary methods for making some of the example surface chemistries disclosed herein. [Figure 13A] 12A-12L are top views of surface chemistry structures formed by the method of FIGS. 12A-12L. [Figure 13B]FIG. 12A is a schematic perspective view of a portion of a multi-depth substrate used in the method of FIGS. 12A-12L illustrating the hexagonal shaped geometry of the surfaces onto which different surface chemistries are introduced. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0006] Some of the flow cells disclosed herein contain orthogonal primer sets in adjacent reaction regions. The orthogonal primer sets allow different template strands to be amplified on each reaction region without allowing template strands from adjacent reaction regions to seed and amplify. Thus, the orthogonal primers reduce or eliminate index or pad hopping. The orthogonal primers also increase the reaction area density, thus increasing signal intensity during sequencing.

[0007] Other flow cells disclosed herein include orthogonal capture primers arranged in rows and offset columns across the substrate that allow different template strands to be seeded in respective regions across the substrate surface, and surrounding primer sets that allow the seeded template strands to be amplified.

[0008] definition Terms used herein should be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are described below.

[0009] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0010] The terms comprising, including, containing, and the various forms of these terms are synonymous with each other and are intended to be equally broad.

[0011] Terms such as top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and / or various components of the flow cell. It should be understood that these directional terms are not meant to indicate a particular orientation, but are used to specify the relative orientation between components. The use of directional terms is not to be construed as limiting the examples disclosed herein to any particular orientation.

[0012] The terms first, second, etc. also are not meant to denote a particular orientation or order, but rather are used to distinguish one component from another.

[0013] "Acrylamide monomer" has the structure

[0014] [ka] or a monomer containing an acrylamide group. An example of a monomer containing an acrylamide group is azidoacetamidopentylacrylamide:

[0015] [ka] and N-isopropylacrylamide:

[0016] [ka] Other acrylamide monomers may also be used.

[0017] As used herein, the term "activation" refers to a process of generating reactive groups on the surface of a base support or on the outermost layer of a multi-layer structure. Activation can be accomplished using silanization or plasma ashing. Although activation can be performed in each of the methods disclosed herein, the figures do not depict the reactive groups. It should be understood that a silanized layer or -OH groups (from plasma ashing) are present to covalently attach the polymer hydrogel to the underlying support or layer. Suitable silanes that may be used in the silanization process include (3-aminopropyl)trimethoxysilane (APTMS), (3-aminopropyl)triethoxysilane (APTES), N-(6-aminohexyl)aminomethyltriethoxysilane (AHAMTES), N-(2-aminoethyl)-3-aminopropyltriethoxysilane (AEAPT silanes such as N-(2-aminoethyl)-3-aminopropyltrimethoxysilane (AEAPTMS), O-propargyl-N-(triethoxysilylpropyl)carbamate, alkynylsilanes such as cyclooctyne, cyclooctyne derivatives, or bicyclononyne (e.g., bicyclo[6.1.0]non-4-yne or derivatives thereof, bicyclo[6.1.0]non-2-yne, or bicyclo[6.1.0]non-3-yne), or norbornene silanes such as [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane.

[0018] An aldehyde, as used herein, is an organic compound that contains a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double bonded to an oxygen) with a carbon atom that is also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:

[0019] [ka] It is.

[0020] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation "C1-4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0021] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have from 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0022] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have from 2 to 20 carbon atoms.

[0023] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent carbon atoms) that contains only carbon in the ring backbone. When aryl is a ring system, all rings in the system are aromatic rings. Aryl groups can have from 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0024] The "amino" functional group is -NR a R bR a and R b are each independently selected from hydrogen (e.g.,

[0025] [ka] ), C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle.

[0026] As used herein, the term "attached" refers to the state in which two things are joined, fastened, adhered, connected, or bonded to one another, either directly or indirectly. For example, a nucleic acid can be attached to a polymer hydrogel by covalent or non-covalent bonds. Covalent bonds are characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0027] An "azide" or "azido" functional group refers to an --N3.

[0028] As used herein, a "bonding region" refers to a region of a patterned structure that is bonded to another material, which may be, by way of example, a spacer layer, a lid, another patterned structure, etc., or a combination thereof (e.g., a spacer layer and a lid, or a spacer layer and another patterned structure). The bond formed in the bonding region may be a chemical bond (as described above) or a mechanical bond (e.g., using fasteners, etc.).

[0029] As used herein, "carbocycle" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When a carbocycle is a ring system, two or more rings can be joined together in a fused, bridged, or spiro-linked manner. Carbocycles can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocycles include cycloalkyl, cycloalkenyl, and cycloalkynyl. Carbocyclic groups can have from 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.

[0030] As used herein, the term "carboxylic acid" or "carboxyl" as used herein refers to --COOH.

[0031] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the remainder of the molecule through two points of attachment.

[0032] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbocyclic ring or ring system having at least one double bond, and none of the rings in the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also, as used herein, "heterocycloalkenyl" or "heterocycloalkene" refers to a carbocyclic ring or ring system having at least one double bond, and at least one heteroatom in the ring backbone, and none of the rings in the ring system are aromatic.

[0033] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, and none of the rings in the ring system are aromatic. An example is cyclooctyne. Another example is biclononyne. As used herein, "heterocycloalkynyl" or "heterocycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, and at least one heteroatom in the ring backbone, and none of the rings in the ring system are aromatic.

[0034] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases results in the modification of surface properties. In general, deposition may be performed using deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0035] As used herein, the term "recess" refers to a discrete concave feature in a base support or a layer of a multilayer stack. Recesses can have a variety of shapes at the opening of the surface, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0036] The term "each," when used in reference to a collection of items, is intended to identify each individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur where express disclosure or context clearly dictates otherwise.

[0037] As used herein, the term "epoxy" (also referred to as a glycidyl or oxirane group) refers to

[0038] [ka] Refers to...

[0039] As used herein, the term "flow cell" is intended to mean a vessel having a flow channel in which a reaction can take place, an inlet for delivering a reagent to the flow channel, and an outlet for removing a reagent from the flow channel. In some examples, the flow cell accommodates detection of a reaction occurring within the flow cell. For example, the flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, and the like.

[0040] As used herein, a "flow channel" or "channel" may be an area defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between two patterned structures and thus in fluid communication with the surface chemistry of each of the patterned structures. In other examples, a flow channel may be defined between a patterned structure and a lid and thus in fluid communication with the surface chemistry of one patterned structure.

[0041] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) containing one or more heteroatoms, i.e., elements other than carbon, including but not limited to nitrogen, oxygen, and sulfur, in the ring backbone. When a heteroaryl is a ring system, all rings in the system are aromatic rings. Heteroaryl groups can have from 5 to 18 ring members.

[0042] As used herein, "heterocycle" refers to a non-aromatic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in fused, bridged, or spiro-linked fashions. Heterocycles may have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Within the ring system, the heteroatom may be present in either the non-aromatic ring or the aromatic ring. Heterocycle groups may have 3 to 20 ring members (i.e., the number of atoms forming the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N, or S.

[0043] As used herein, the term "hydrazine" or "hydrazinyl" refers to the group -NHNH.

[0044] As used herein, the term "hydrazone" or "hydrazonyl" as used herein means

[0045] [ka] R a and R b are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.

[0046] As used herein, "hydroxy" or "hydroxyl" refers to an --OH group.

[0047] As used herein, the term "gap region" refers to a region of a base support or a layer of a multilayer stack that separates, for example, recesses (concave regions) or protrusions (protruding regions). In the examples disclosed herein, some of the recesses and / or protrusions directly abut each other, and therefore there is no gap region between two abutting recesses and / or protrusions. In other examples, the gap region may be formed between recesses and / or protrusions positioned diagonally to each other, or may be formed at the intersection of three of four abutting recesses and / or protrusions. The gap region has a surface material that is different from the surface material of the recesses or protrusions. For example, the recesses and / or protrusions may have a polymer hydrogel and a primer set thereon, but the gap region does not include this surface chemistry.

[0048] As used herein, "negative photoresist" refers to a photosensitive material in which the portions exposed to light of a particular wavelength become insoluble in a developer. In these examples, an insoluble negative photoresist has a solubility of less than 5% in the developer. In a negative photoresist, light exposure changes the chemical structure such that the exposed portions of the material are less soluble in the developer (than the unexposed portions). An insoluble negative photoresist is not soluble in the developer, but may be at least 99% soluble in a remover that is different from the developer. The remover may be, for example, a solvent or solvent mixture used in a lift-off process.

[0049] In contrast to insoluble negative photoresists, any portion of the negative photoresist that is not exposed to light is at least 95% soluble in the developer. In some examples, the portion of the negative photoresist that is not exposed to light is at least 98%, e.g., 99%, 99.5%, 100% soluble in the developer.

[0050] As used herein, "nitrile oxide" refers to "R a C≡N + O - " group, wherein R ais defined herein. Examples of preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloramide-T, or by the action of base on imidoyl chlorides [RC(Cl)=NOH], or by reaction of hydroxylamine with aldehydes.

[0051] As used herein, "nitrone" refers to

[0052] [ka] R 3 except that it is not hydrogen (H). 1 , R 2 , and R 3 is R as defined herein. a and R b It can be any of the groups.

[0053] As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are monomeric units of nucleic acid sequences. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group present at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) may be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of the deoxyribose is attached to the N-1 of a pyrimidine or the N-9 of a purine. Nucleic acid analogs may have changes in either the phosphate backbone, the sugar, or the nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA).

[0054] In some examples, the term "over" can mean that one component or material is located directly on top of another component or material. When one is directly on top of the other, the two are in contact with each other. In Figure 3A, layer 44 is applied over base support 42 such that it is directly on top of and in contact with base support 42.

[0055] In other examples, the term "over" can mean that one component or material is indirectly positioned on another component or material. Indirectly means that a gap or additional component or material can be positioned between the two components or materials. In FIG. 3A, the polymer hydrogel 12A is positioned over the base support 42 such that the two are in indirect contact. More specifically, the polymer hydrogel 12A is indirectly over the base support 42 because the resin layer 44 is positioned between the two components 12A and 42.

[0056] "Patterned resin" refers to any polymer that can have recesses and / or protrusions defined therein. Specific examples of resins and techniques for patterning resins are further described below.

[0057] "Patterned structure" refers to a monolayer base support that includes a layer or includes a multilayer stack that includes a surface chemistry in a pattern, e.g., within recesses, on protrusions, or otherwise positioned on the support or layer surface. The surface chemistry may include a polymer hydrogel and a primer. In some examples, the monolayer base support or a layer of a multilayer stack is exposed to a patterning technique (e.g., etching, lithography, etc.) to generate a pattern of surface chemistry. However, the term "patterned structure" is not intended to imply that such a patterning technique must be used to generate the pattern. For example, the base support may be a substantially flat surface having a pattern of polymer hydrogel thereon. The patterned structure may be generated via any of the methods disclosed herein.

[0058] As used herein, a "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers, referred to herein as capture primers, serve as seeds for library templates. Some other primers, referred to herein as amplification primers, serve as initiation points for template amplification and cluster generation. In some instances, amplification primers may also serve as capture primers for seeding library templates. Still other primers, referred to herein as sequencing primers, serve as initiation points for DNA synthesis. The 5' end of the primer may be modified to allow for coupling reactions with functional groups on the polymer. The length of the primer can be any number of bases long and can include a variety of non-naturally occurring nucleotides. In one example, the sequencing primer is a short strand ranging from 10 to 60 bases, or 20 to 40 bases.

[0059] As used herein, "positive photoresist" refers to a photosensitive material in which the portion exposed to light of a particular wavelength becomes soluble in a developer. In these examples, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. In some examples, the portion of the positive photoresist exposed to light is at least 98%, e.g., 99%, 99.5%, 100% soluble in the developer. In a positive photoresist, light exposure changes the chemical structure such that the exposed portion of the material becomes more soluble (than the unexposed portion) in the developer.

[0060] In contrast to a soluble positive photoresist, any portion of the positive photoresist that is not exposed to light is insoluble (less than 5% soluble) in the developer. An insoluble positive photoresist is not soluble in the developer, but may be at least 99% soluble in a remover that is different from the developer. In some examples, the insoluble positive photoresist is at least 98% soluble in the remover, for example, 99%, 99.5%, 100% soluble. The remover may be a solvent or solvent mixture used in the lift-off process.

[0061] As used herein, a "spacer layer" refers to a material that bonds two components together. In some examples, the spacer layer can be or be in contact with a radiation absorbing material that aids in bonding.

[0062] The term "substrate" refers to a single layer base support or a multi-layer structure into which the surface chemistry is introduced.

[0063] The term "surface chemistry" refers to the polymer hydrogel and the primer set attached to the polymer hydrogel. The surface chemistry may be arranged in various configurations in the examples disclosed herein. The surface chemistry constitutes a reactive area or region of the substrate, and an area or region of the substrate that does not contain the surface chemistry may be referred to as a non-reactive area or region.

[0064] The term "tantalum pentoxide" refers to an inorganic compound having the formula Ta2O5. This compound is transparent, having a transmittance ranging from about 0.25 (25%) to 1 (100%), at a wavelength ranging from about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm). A "tantalum pentoxide-based support" or a "tantalum pentoxide layer" may comprise, consist essentially of, or consist of Ta2O5.

[0065] A "thiol" functional group refers to a -SH.

[0066] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0067] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. The tetrazole can be optionally substituted.

[0068] Primer In some of the examples described herein, the flow cell comprises different primer sets attached to immediately adjacent reaction regions. In one example, the immediately adjacent reaction regions are regions that are adjacent to each other on the substrate surface and abut each other. In another example, the immediately adjacent reaction regions are regions that are adjacent to each other on the substrate surface but do not abut each other because they are located at different heights.

[0069] An example of different primer sets attached to immediately adjacent reaction regions is shown in Figure 1. Each of reaction regions 10A, 10B, 10C includes a polymer hydrogel 12A, 12B, 12C to which a respective primer set 14A, 14B, 14C is attached. As described in more detail below, the polymer hydrogel 12A, 12B, 12C in one reaction region 10A, 10B, 10C can be the same as or different from the polymer hydrogel 12A, 12B, 12C in another reaction region 10A, 10B, 10C.

[0070] Each primer set 14A, 14B, 14C includes two different primers 16A, 18A, or 16B, 18B, or 16C, 18C, such as forward and reverse amplification primers. The primers 16A, 18A of a first set, e.g., 14A, together allow amplification of a library template having a terminal adapter complementary to the two different primers 16A, 18A in the first set 14A. The primers 16B, 18B of a second set, e.g., 16B, together allow amplification of a different library template having a terminal adapter complementary to the two different primers 16B, 18B in the second set 14B, but do not allow the library template associated with the first primer set 14A to be plated or amplified. In some examples, a third primer set 14C is used. In these examples, primers 16C, 18C of the third set 14C together allow amplification of a different library template having terminal adapters complementary to the two different primers 16C, 18C in the third set 14C, but do not allow a library template associated with the first primer set 14A or the second primer set 14B to be plated or amplified.

[0071] As an example, the first primer set 12 includes P5 and P7 primers, and the second primer set 14 includes any combination of PA, PB, PC, and PD primers described herein. In other examples, P15 and P7 may be used in the first primer set 12. As an example, the second primer set 14 may include any two (or three) PA, PB, PC, and PD primers, or any combination of one PA primer and one PB, PC, or primer PD, or any combination of one PB primer and one PC or primer PD, or any combination of one PC primer and one primer PD.

[0072] Examples of P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on, for example, HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™ and other instrument platforms. The P5 primer is as follows: P5:5'→3' AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1)

[0073] The P7 primer can be any of the following: P7#1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 2) P7#2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 3) where "n" is 8-oxoguanine or uracil in each of these sequences.

[0074] The P15 primer is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 4) where "n" is allyl-T.

[0075] Other primers (PA-PD) mentioned above include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 5) cPA(PA')5'→3' CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC (SEQ ID NO: 6) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 7) cPB(PB')5'→3' AGTTCATATCCACCGAAGCGCCATGGCAGACGACG (SEQ ID NO: 8) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 9) cPC(PC')5'→3' AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT (SEQ ID NO: 10) PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 11) cPD(PD')5'→3' GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ ID NO: 12) Although not shown in the exemplary sequence for PA-PD, it should be understood that any of these primers may contain a cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) at any point in the strand.

[0076] As another example, the first primer set 14A includes unblocked P5 and P7 primers (SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3) and the second primer set 14B includes 3' blocked P5 and P7 primers. In this example, a blocking group (e.g., a 3' phosphate) can be added that is attached to the exposed 3' ends of primers 16B, 18B of the second primer set 14B. The blocking group prevents undesired extension of these primers 16B, 18B during amplification of the first primer set 14A. The blocking group can then be removed and a round of amplification can be performed with the newly added library template and the second primer set 14B.

[0077] In yet another example, one primer set 14A, 14B, 14C described herein may be used with another primer set that allows for simultaneous paired-end sequencing. The primer set that allows for simultaneous paired-end sequencing includes primer subsets on different regions of the polymer hydrogel. Figures 1B-1E depict different configurations of primer sets 13A, 15A, 13B, 15B, 13C, 15C, and 13D, 15D attached to polymer hydrogel regions 12A1, 12A2.

[0078] Each of the first primer subsets 13A, 13B, 13C, and 13D includes a non-cleavable first primer 17 or 17' and a cleavable second primer 19 or 19', and each of the second primer subsets 15A, 15B, 15C, and 15D includes a cleavable first primer 25 or 25' and a non-cleavable second primer 27 or 27'.

[0079] The uncleavable first primer 17 or 17' and the cleavable second primer 19 or 19' are, for example, an oligonucleotide pair in which the uncleavable first primer 17 or 17' is a forward amplification primer and the cleavable second primer 19 or 19' is a reverse amplification primer, or the cleavable second primer 19 or 19' is a forward amplification primer and the uncleavable first primer 17 or 17' is a reverse amplification primer. In each example of the first primer subsets 13A, 13B, 13C, and 13D, the cleavable second primer 19 or 19' includes the cleavage site 29, but the uncleavable first primer 17 or 17' does not include the cleavage site 29.

[0080] The cleavable first primer 25 or 25' and the uncleavable second primer 27 or 27' can also be, for example, an oligonucleotide pair in which the cleavable first primer 25 or 25' is a forward amplification primer and the uncleavable second primer 27 or 27' is a reverse amplification primer, or the uncleavable second primer 27 or 27' is a forward amplification primer and the cleavable first primer 25 or 25' is a reverse amplification primer. In each example of the second primer subsets 15A, 15B, 15C, and 15D, the cleavable first primer 25 or 25' includes the cleavage site 29' or 31, while the uncleavable second primer 27 or 27' does not include the cleavage site 29' or 31.

[0081] It should be understood that the non-cleavable first primers 17 or 17' of the first primer sets 13A, 13B, 13C, and 13D and the cleavable first primers 25 or 25' of the second primer sets 15A, 15B, 15C, and 15D have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primers 25 or 25' include a cleavage site 29' or 31 integrated into the nucleotide sequence or into a linker 33' attached to the nucleotide sequence. Similarly, the cleavable second primers 19 or 19' of the first primer set 13A, 13B, 13C, and 13D and the non-cleavable second primers 27 or 27' of the second primer sets 15A, 15B, 15C, and 15D have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primers 19 or 19' include a cleavage site 29 integrated into the nucleotide sequence or into a linker 33 attached to the nucleotide sequence.

[0082] It should be understood that if the first primers 17 and 25, or 17' and 25', are forward amplification primers, then the second primers 19 and 27, or 19' and 27', are reverse primers, and vice versa.

[0083] The non-cleavable primers 17, 27 or 17', 27' can be any primers with universal sequences for capture and / or amplification purposes, such as P5, P7, and P15 primers or any combination of PA, PD, PC, PD primers (e.g., PA and PB or PA and PD, etc.). It should be understood that these primers 17, 27 or 17', 27' do not contain the cleavage sites (e.g., uracil, 8-oxoguanine, etc.) shown in the sequence. In some examples, the P5 and P7 primers are non-cleavable primers 17, 27 or 17', 27' because they do not contain uracil and 8-oxoguanine, respectively. It should be understood that any suitable universal sequence can be used as the non-cleavable primers 17, 27 or 17', 27'.

[0084] Examples of cleavable primers 19, 25 or 19', 25' include P5 and P7 primers or other universal sequence primers (e.g., PA, PB, PC, PD primers) having respective cleavage sites 29, 29', 31 incorporated in the respective nucleic acid sequence (e.g., FIG. 1B and FIG. 1D) or in the linker 33', 33 that attaches the cleavable primers 19, 25 or 19', 25' to the respective functionalized layer 24, 26 or layer pad 24', 26' (FIG. 1C and FIG. 1E). Examples of suitable cleavage sites 29, 29', 31 include enzymatically or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases), as described herein.

[0085] Each primer subset 13A and 15A, or 13B and 15B, or 13C and 15C, or 13D and 15D, is attached to a polymer hydrogel region 12A1, 12A2. The polymer hydrogel regions 12A1, 12A2 may contain different functional groups that can selectively react with the respective primers 17, 19 or 17', 19' or 25, 27 or 25', 27'.

[0086] Although not shown in Figures 1B-1E, it should be understood that one or both of primer subsets 13A, 13B, 13C, or 13D or 15A, 15B, 15C, or 15D may also include PX primers for capturing / seeding library templates. As an example, PX may be included with primer subsets 13A, 13B, 13C, and 13D, but not with primer subsets 15A, 15B, 15C, or 15D. As another example, PX may be included with primer subsets 13A, 13B, 13C, and 13D, as well as with primer sets 15A, 15B, 15C, or 15D. The density of PX motifs should be relatively low to minimize polyclonality within each recess 30 (see, e.g., Figure 3B).

[0087] 1B-1E depict different configurations of primer sets 13A, 15A, 13B, 15B, 13C, 15C, and 13D, 15D attached to polymer hydrogel regions 12A1, 12A2. More specifically, FIG. 1B-1E depict different configurations of primers 17, 19 or 17', 19', and 25, 27 or 25', 27' that may be used.

[0088] In the example shown in FIG. 1B, primers 17, 19 and 25, 27 of primer subsets 13A and 15A are directly attached to polymer hydrogel regions 12A1, 12A2, e.g., without linkers 33, 33'. Polymer hydrogel region 12A1 has surface functional groups capable of immobilizing end groups at the 5' ends of primers 17, 19. Similarly, polymer hydrogel region 12A2 has surface functional groups capable of immobilizing end groups at the 5' ends of primers 25, 27. The immobilization chemistry between polymer hydrogel region 12A1 and primers 17, 19, and between polymer hydrogel region 12A2 and primers 25, 27 are different, such that primers 17, 19 or 25, 27 selectively attach to the desired polymer hydrogel region 12A1, 12A2. The polymer hydrogel regions 12A1, 12A2 may include any of the exemplary polymer hydrogels 12A, 12B, 12C disclosed herein.

[0089] Also, in the example shown in FIG. 1B, the cleavage site 29, 29' of each of the cleavable primers 19, 25 is incorporated into the sequence of the primer. In this example, the same type of cleavage site 29, 29' is used for the cleavable primers 19, 25 of each primer subset 13A, 15A. As an example, the cleavage site 29, 29' is a uracil base and the cleavable primers 19, 25 are P5U (see SEQ ID NO: 1) and P7U (see SEQ ID NO: 2 and 3). Uracil bases or other cleavage sites can also be incorporated into any of the PA, PB, PC, and PD primers to generate the cleavable primers 19, 25. In this example, the uncleavable primer 17 of the oligonucleotide pair 17, 19 can be P7 (does not contain 8-oxoguanine) and the uncleavable primer 27 of the oligonucleotide pair 25, 27 can be P5 (does not contain uracil). Thus, in this example, the first primer subset 13A includes P7 (no 8-oxoguanine), P5U (SEQ ID NO: 1) and the second primer subset 15A includes P5 (no uracil), P7U (SEQ ID NO: 2 or 3). Primer subsets 13A, 15A have opposite linearization chemistries that allow a forward template strand to be formed on one polymer hydrogel region 12A1 and a reverse strand to be formed on the other polymer hydrogel region 12A2 after amplification, cluster generation, and linearization.

[0090] In the example shown in FIG. 1C, primers 17, 19 and 25, 27 of primer subsets 13B and 15B are directly attached to polymer hydrogel regions 12A1, 12A2, for example, via linkers 33, 33'. Polymer hydrogel regions 12A1, 12A2 include respective functional groups, and the ends of the respective linkers 33, 33' can be covalently attached to the respective functional groups. Thus, polymer hydrogel region 12A1 can have surface functional groups capable of immobilizing linker 33 at the 5' ends of primers 17', 19'. Similarly, polymer hydrogel region 12A2 can have surface functional groups capable of immobilizing linker 33' at the 5' ends of primers 25, 27. The immobilization chemistry of polymer hydrogel region 12A1 and linker 33 and the immobilization chemistry of polymer hydrogel region 12A2 and linker 33' are different so that primers 17', 19' or 25', 27' selectively graft to the desired polymer hydrogel regions 12A1, 12A2.

[0091] Examples of suitable linkers 33, 33' may include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers such as polyethylene glycol chains, alkyl or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. One example of a nucleic acid linker is a poly-T spacer, but other nucleotides may also be used. In one example, the spacer is a 6T-10T spacer. Below are some examples of nucleotides including non-nucleic acid linkers (where B is a nucleobase and "oligo" is a primer) with terminal alkyne groups:

[0092] [ka]

[0093] In the example shown in FIG. 1C, primers 17', 25' have the same sequence (e.g., P5 without uracil) and the same or different linkers 33, 33'. Primer 17' is non-cleavable, while primer 25' contains a cleavage site 29' incorporated in the linker 33'. Also in this example, primers 19', 27' have the same sequence (e.g., P7 without 8-oxoguanine) and the same or different linkers 33, 33'. Primer 27' is non-cleavable, while primer 19' contains a cleavage site 29 incorporated in the linker 33. The same type of cleavage site 29, 29' is used in each linker 33, 33' of cleavable primers 19', 25'. As an example, the cleavage site 29, 29' can be a uracil base incorporated in the nucleic acid linker 33, 33'. Primer subsets 13B, 15B have opposite linearization chemistries that allow a forward template strand to be formed on one polymer hydrogel region 12A1 and a reverse strand to be formed on the other polymer hydrogel region 12A2 after amplification, cluster generation, and linearization.

[0094] The example shown in Figure ID is similar to the example shown in Figure IB, except that different types of cleavage sites 29, 31 are used for the cleavable primers 19, 25 of the respective primer subsets 13C, 15C. By way of example, two different enzymatic cleavage sites may be used, two different chemical cleavage sites may be used, or one enzymatic cleavage site and one chemical cleavage site may be used. Examples of different cleavage sites 29, 31 that may be used for each cleavable primer 19, 25 include any combination of the following: vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

[0095] The example shown in Figure 1E is similar to the example shown in Figure 1C, except that different types of cleavage sites 29, 31 are used in the linkers 33, 33' attached to the cleavable primers 19', 25' of the respective primer sets 13D, 15D. Examples of different cleavage sites 29, 31 that may be used in the respective linkers 33, 33' attached to the cleavable primers 19', 25' include any combination of the following: vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

[0096] In yet another example, the flow cell includes different capture primers arranged in rows and offset columns across the substrate. The capture primers are orthogonal in that they allow different template strands (i.e., library templates) to be seeded in each region across the substrate surface. In one example, the capture primer is a PX primer. The PX primers described herein can be used as capture primers that seed library template molecules but do not participate in amplification because they are orthogonal to all other primers. In the case of sequential paired-end sequencing using primer sets 14A, 14B, 14C, different PX primers can be included with different primer sets 14A, 14B, 14C to capture different library template molecules.

[0097] The PX capture primer may be as follows: PX 5'→3' AGGAGGAGGAGGAGGAGGAGGAGG (SEQ ID NO: 13) cPX(PX')5'→3' CCTCCTCCTCCTCCTCCTCCTCCT (SEQ ID NO: 14)

[0098] Each of the primers disclosed herein may also include a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region includes 2 T bases to 20 T bases. As specific examples, the poly-T region may include 3, 4, 5, 6, 7, or 10 T bases.

[0099] Any of primers 16A, 18A, or 16B, 18B, or 16C, 18C (including capture primers) may be terminated at the 5' end with a functional group capable of single point covalent attachment to a functional group of polymer hydrogel 12A, 12B, 12C. Examples of terminal primers that can be used include alkyne terminated primers, tetrazine terminated primers, azide terminated primers, amino terminated primers, epoxy or glycidyl terminated primers, thiophosphate terminated primers, thiol terminated primers, aldehyde terminated primers, hydrazine terminated primers, phosphoramidite terminated primers, and triazolinedione terminated primers. In one example, the primer is hexynyl terminated. In some embodiments, succinimidyl (NHS) ester terminated primers may be reacted with the amines of the polymer hydrogels 12A, 12B, 12C, or aldehyde terminated primers may be reacted with the hydrazines of the polymer hydrogels 12A, 12B, 12C, or alkyne terminated primers may be reacted with the azides of the polymer hydrogels 12A, 12B, 12C, or azide terminated primers may be reacted with the alkynes or dibenzocyclobutene (DBCO) of the polymer hydrogels 12A, 12B, 12C. octyne, dibenzocyclooctyne), or an amino-terminated primer may be reacted with an activated carboxylate group or NHS ester of the polymer hydrogel 12A, 12B, 12C, or a thiol-terminated primer may be reacted with an alkylating reactant (e.g., iodoacetamide or maleimide) of the polymer hydrogel 12A, 12B, 12C, or a phosphoramidite-terminated primer may be reacted with a thioether of the polymer hydrogel 12A, 12B, 12C. Although several examples have been provided, it should be understood that any functional group may be used that may be attached to primers 16A, 18A or 16B, 18B or 16C, 18C, and / or capture primers and that may be attached to functional groups of the polymer hydrogel 12A, 12B, 12C. A similar functional group may be included at the 5' end of any of the primers 17, 17', 19, 19', 25, 25', 27, 27'.

[0100] Polymer hydrogels In any of the examples described herein, primer sets 14A, 14B, 14C are attached to polymer hydrogels 12A, 12B, 12C. Binding of primer sets 14A, 14B, 14C frees the template-specific portions of primers 16A, 18A, or 16B, 18B, or 16C, 18C to anneal to their cognate templates, freeing the 3' hydroxyl groups for primer extension. In the examples disclosed herein, it should be understood that primer subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D may be used in place of one of primer sets 14A, 14B, 14C. In these examples, a particular reaction area 10A, 10B, or 10C includes a primer 17, 19, 25, 27, or 17', 19', 25', 27' attached to a polymer hydrogel 12A, 12B, or 12C (in the manner described with reference to Figures 1B, 1C, 1D, or 1E).

[0101] In some examples, the polymer hydrogels 12A, 12B, 12C are the same in each of the reaction regions 10A, 10B, 10C. In these examples, the polymer hydrogels 12A, 12B, 12C are chemically the same, and the primers 16A, 18A, or 16B, 18B, or 16C, 18C of each set 14A, 14B, 14C may be sequentially attached to each reaction region 10A, 10B, 10C using any technique disclosed herein. When primer subsets 13A, 15A or 13B, 15B or 13C, 15C or 13D, 15D are used in one of regions 10A, 10B, 10C, primers 17, 19 or 17', 19' and 25, 27 or 25', 27' of subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D are attached sequentially using the exemplary techniques disclosed herein.

[0102] In other examples, the polymer hydrogels 12A, 12B, 12C are different in each of the reaction regions 10A, 10B, 10C. For example, the polymer hydrogels 12A, 12B, 12C in each of the reaction regions 10A, 10B, 10C may include different functional groups that can be attached to the terminal functional groups of the respective primers 16A, 18A, or 16B, 18B, or 16C, 18C. When primer subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D are used in one of regions 10A, 10B, 10C, polymer hydrogel regions 12A1, 12A2 include respective functional groups for attaching primers 17, 19 or 17', 19' and 25, 27 or 25', 27' of the particular subset 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D. In some cases, the different functional groups are functional groups introduced into the polymer hydrogel deposited on the substrate.

[0103] The polymer hydrogels 12A, 12B, 12C can be any gel material that can swell when liquid is absorbed and shrink when the liquid is removed, for example, by drying. In one example, the polymer hydrogel comprises an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0104] [ka] During the ceremony, R A is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; R B is H or optionally substituted alkyl; R C , R D , and R Eare each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally substituted, p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0105] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM).

[0106] One of skill in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative, and that the monomer subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0107] The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a particular example, may be about 312 kDa.

[0108] In some instances, the acrylamide copolymer is a linear polymer, hi other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0109] In another example, the gel material can be a variation of structure (I). In one example, the acrylamide unit is N,N-dimethylacrylamide.

[0110] [ka] In this example, the acrylamide unit of structure (I) can be replaced with

[0111] [ka] where R D , R E , and R F are each H or C1-C6 alkyl, R G and R H are each C1-C6 alkyl (not H as in acrylamide). In this example, q can be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can be used. In this example, structure (I) contains, in addition to the repeating "n" and "m" features,

[0112] [ka] wherein R D , R E , and R F are each H or C1-C6 alkyl, R G and R H is each C1 to C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0113] As another example of polymer hydrogels 12A, 12B, 12C, the repeating "n" feature of structure (I) may be replaced with a heterocyclic azide group-containing monomer having structure (II):

[0114] [ka] In the formula, R 1is H or C1-C6 alkyl, R2 is H or C1-C6 alkyl, L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon atoms and any nitrogen atoms in the chain, E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon atoms and any nitrogen atoms in the chain, A is an N-substituted amide with H or C1-C4 alkyl attached to the N, and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0115] As yet another example, polymer hydrogels 12A, 12B, 12C may include repeat units of structures (III) and (IV), respectively:

[0116] [ka] In the formula, R 1a , R 2a , R 1b and R 2b is independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; 3a and R 3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; L 1 and L 2 Each of is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0117] In yet another example, the acrylamide copolymer is formed using nitroxide-mediated polymerization, and therefore at least some of the copolymer chains have an alkoxyamine end group. In the copolymer chain, the term "alkoxyamine end group" refers to a dormant species -ONR1R2, where each of R1 and R2 can be the same or different and can be independently a straight or branched chain alkyl, or a ring structure, and the oxygen atom is bonded to the remainder of the copolymer chain. In some examples, the alkoxyamine is also attached to some of the repeating acrylamide monomers, for example, R in structure (I). A Thus, in one example, structure (I) includes an alkoxyamine end group, and in another example, structure (I) includes an alkoxyamine end group and an alkoxyamine group on at least some of the side chains.

[0118] It should be understood that other molecules can be used to form the polymer hydrogels 12A, 12B, 12C as long as they are functionalized to graft one of the oligonucleotide primer sets 14A, 14B, 14C or subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D thereto. Some examples of suitable polymer hydrogel 12A, 12B, 12C materials include functionalized silanes such as norbornene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other silane with a functional group to which the respective primer set 14A, 14B, 14C or subset 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D can be attached. Other examples of suitable polymer hydrogel 12A, 12B, 12C materials include those with colloidal structures such as agarose, or polymer mesh structures such as gelatin, or cross-linked polymer structures such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or azide decomposition versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of suitable polymer hydrogel 12A, 12B, 12C materials include mixed copolymers of acrylamide and acrylate. Various polymeric structures including acrylic monomers (e.g., acrylamide, acrylate, etc.) can be utilized in the embodiments disclosed herein, such as dendrimers (e.g., multi-arm or star polymers), branched polymers including star or star block polymers, etc. For example, monomers (e.g., acrylamide, acrylamide containing a catalyst, etc.) can be incorporated into the branches (arms) of the dendrimer, either randomly or in blocks.

[0119] The polymer hydrogels 12A, 12B, 12C may be formed using any suitable copolymerization process, such as nitroxide mediated polymerization (NMP), reversible addition-fragmentation chain-transfer (RAFT) polymerization, etc. The polymer hydrogels 12A, 12B, 12C may also be deposited using any of the methods disclosed herein.

[0120] Attachment of the polymer hydrogels 12A, 12B, 12C to the underlying substrate can be via covalent bonding. In some instances, the underlying substrate can first be activated, for example, via silanization or plasma ashing. Covalent bonding is useful for maintaining the primer sets 14A, 14B, 14C and / or subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D in desired regions throughout the life of the flow cell during various uses.

[0121] Base material The substrate of the flow cell can be a single layer base support or a multi-layer structure on which the reaction areas 10A, 10B, 10C are formed.

[0122] Examples of suitable single layer base supports include epoxy siloxanes, glass, modified or functionalized glass, plastics (including acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, etc.), nylon (polyamide), ceramics / ceramic oxides, silica, fused silica, silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metals, and inorganic glasses.

[0123] Examples of multi-layer structures include a base support and at least one other layer thereon. Some examples of multi-layer structures include a tantalum oxide (e.g., tantalum pentoxide or another tantalum oxide (TaO x )) or another ceramic oxide coating layer. Other examples of multi-layer structures include a base substrate (e.g., any of glass, silicon, tantalum pentoxide, or other base substrate materials) and a patterned resin as a coating layer. It should be understood that any material that can be selectively deposited, or deposited and patterned to form recesses, regions of different heights, etc., can be used for the patterned resin.

[0124] In one example, the patterned resin is an inorganic oxide that can be selectively applied to a base support via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), and the like.

[0125] In another example, the patterned resin is a polymeric resin that can be applied to a base support and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, droplet dispensing, ultrasonic spray coating, doctor blade coating, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, and the like. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opening epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0126] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate between silica (SiO2) and silicone (R2SiO) (e.g., RSiO 1.5 An example of a polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition has the chemical formula [RSiO 3 / 2 ] nwhere the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups. The resin compositions disclosed herein may include one or more different cage or core structures as monomer units.

[0127] In one example, the substrate may be fabricated using circular wafers having diameters ranging from about 2 mm to about 300 mm, or from rectangular sheets or panels having a maximum dimension of up to about 10 feet (about 3 meters). In one example, the substrate is fabricated using circular wafers having diameters ranging from about 200 mm to about 300 mm. In another example, a panel may be used that is a rectangular support having a larger surface area than a 300 mm circular wafer. Wafers, panels, and other large substrate materials may be diced into individual flow cell substrates. In another example, the substrate is a die having a width ranging from about 0.1 mm to about 10 mm. Although exemplary dimensions are provided, it should be understood that the substrate may be fabricated using substrate materials having any suitable dimensions.

[0128] Flow Cell Structure A top view of the flow cell 20 is shown in FIG. 2. The flow cell 20 may include two patterned structures bonded together or one patterned structure bonded to a lid. Different examples of patterned structures of the flow cell 20 are shown in FIGS. 3A-7D. Between the two patterned structures or between one patterned structure and the lid is a flow channel 21. The example shown in FIG. 2 includes eight flow channels 21. Although eight flow channels 21 are shown, it should be understood that any number of flow channels 21 may be included in the flow cell 20 (e.g., a single flow channel 21, four flow channels 21, etc.). Each flow channel 21 may be separated from another flow channel 21 such that fluids introduced into one flow channel 21 do not flow into an adjacent flow channel 21. Some examples of fluids introduced into the flow channels 21 may introduce reaction components (e.g., DNA samples, polymerases, sequencing primers, labeled nucleotides, etc.), wash solutions, deblocking agents, etc.

[0129] The flow channel 21 is at least partially defined by a patterned structure. The patterned structure can include a substrate, such as a single layer base support or a multi-layer structure. Figure 2 depicts a top view of the flow cell 20, and thus depicts the top of the substrate of one patterned structure (e.g., if the flow cell 20 includes a lid) or the bottom of the substrate of a second patterned structure (e.g., if the flow cell 20 includes two patterned structures with opposing surface chemistries).

[0130] In one example, flow channel 21 has a rectangular or substantially rectangular configuration. The length and width of flow channel 21 can be selected such that a portion of the substrate surrounds flow channel 21 and is available for attachment to a lid (not shown) or another patterned structure.

[0131] The depth of the flow channel 21 can be as little as a monolayer thickness when microcontact, aerosol, or inkjet printing is used to deposit the separate materials that define the flow channel 21 walls. In other examples, the depth of the flow channel 21 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth can range from about 10 μm to about 100 μm. In another example, the depth can range from about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of the flow channel 21 can be greater than, less than, or in between the values ​​specified above.

[0132] 3A-7D depict different example patterned structures and therefore structures within flow channel 21 of flow cell 20. Although the descriptions in these figures refer to primer sets 14A, 14B, 14C, it should be understood that any one of primer sets 14A, 14B, 14C described in these figures may be replaced with any one of primer subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D described herein.

[0133] Two examples of patterned structures 23A, 23B of a flow cell 20 are shown in Figures 3A and 3C, respectively. These examples of patterned structures 23A, 23B of a flow cell 20 include a substrate 22, a plurality of reaction regions 24, 24', 24" extending along the substrate 22, and a non-reaction region 26, 26' separating one of the plurality of reaction regions, e.g., 24, from an adjacent one of the plurality of reaction regions, e.g., 24', each of the plurality of reaction regions 24, 24', 24" that are separated by alternating first and second (reaction) regions 10 positioned along the reaction regions 24, 24', 24". 3B, each of the first regions 10A includes a first primer set 14A and each of the second regions 10B includes a second primer set 14B that is different from the first primer set 14A, and wherein i) adjacent first and second regions 10A, 10B directly abut one another (see FIG. 3C ), or ii) the first region 10A is positioned on a protruding portion 28 and the second region 10B is positioned within a recessed portion 30 adjacent to the protruding portion 28 ( FIGS. 3A and 3B ).

[0134] In Figure 3A, the substrate 22 is a multi-layer structure including a single layer base support 42 and another layer 44 positioned on the single layer base support 42. In the case of the patterned structure 23A shown in Figure 3A, the substrate 22 can alternatively be a single layer base support 42. In Figure 3C, the substrate 22 is a single layer base support 42. In the case of the patterned structure 23B shown in Figure 3C, the substrate 22 can alternatively be a multi-layer structure.

[0135] In both Figures 3A and 3C, patterned structures 23A, 23B include a plurality of reaction regions 24, 24', 24'' extending along substrate 22. In one example, reaction regions 24, 24', 24'' extend partially along the length of substrate 22 and along the entire length of flow channel 21. Each reaction region 24, 24', 24' includes alternating first and second (reaction) regions 10A, 10B. The pattern of alternating regions 10A, 10B extends along the length of each of reaction regions 24, 24', 24''.

[0136] In the example shown in Figures 3A and 3B, substrate 22 includes alternating peaks 28 and valleys 30 along reaction regions 24, 24', 24''. In this example, peaks 28 and valleys 30 are formed in layer 44. These features 28, 30 are shown in cross-section in Figure 3B. As depicted in Figures 3A and 3B, a respective active area 10A is positioned on each of the peaks 28 and a respective active area 10B is positioned within each of the valleys 30.

[0137] The protrusions 28 extend a first height H1 from the bottom of the substrate 22, and the recesses 30 extend a second height H2 from the bottom of the substrate 22, the first height H1 being greater than the second height H2. The surface of each of the protrusions 28 may be flush with the surface of the non-reacted regions 26, 26'. In this example, the surface of the non-reacted regions 26, 26' is also the surface of the substrate 22. The surface of each of the recesses 30 is positioned at a depth measured from the protrusion / non-reacted region / substrate surface (e.g., the surface of layer 44). The depth is at least 150 nm. This depth is particularly suitable for library templates that are 500 base pairs (bp) long (e.g., assuming 0.35 nm / bp). The depth should not exceed a height (depth) to width ratio of about 10:1. In some examples, the depth can range from about 150 nm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or more.

[0138] The shape of the protrusions 28 and the recesses 30 in the xy plane of the substrate 22 may be square or rectangular. The protrusions 28 and the recesses 30 may have the same shape, and therefore the same xy dimensions. Each of the length and width may be about 150 nm or more. In one example, the length and width may each be in the range of about 150 nm to about 100 μm, for example, about 0.5 μm, about 2 μm, about 10 μm, or more. The length and width may be selected not to exceed an aspect ratio of length to width of about 10:1. The width of each of the protrusions 28 and the recesses 30 is equal to the width of the reaction region 24, 24', 24''.

[0139] The size of each protrusion 28 and recess 30 can be characterized by its surface and open area, respectively. The surface area of ​​protrusion 28 and the open area of ​​recess 30 are approximately 1×10-3 μm 2 ~about 100μm 2 , for example, about 1 x 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 , or more or less.

[0140] The recess 30 may also be characterized by its volume. For example, the volume may be about 1×10 -3 μm 3 ~about 100μm 3 For example, about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , or more or less.

[0141] As shown in FIG. 3A , the alternating protrusions 28 and recesses 30 in each of the reaction areas 24, 24′, 24″ directly abut one another. Thus, the edge of one protrusion 28 is also the edge of one recess 30. In this example, the only exposed portions of the substrate 22 between the alternating protrusions 28 and recesses 30 in one of the reaction areas 24, 24′, or 24″ are the sidewalls 32 (extending along the z-axis) of the protrusions 28 and recesses 30 to which the polymer hydrogel 12A, 12B or primer set 14A, 14B is not applied. This sidewall 32 defines the gap area between the active areas 10A, 10B.

[0142] In the example shown in Figures 3A and 3B, the lack of gap regions in the xy plane of the substrate 22 between the alternating protrusions 28 and recesses 30 reduces the average pitch of the active regions 10A, 10B across the substrate 22. In this example, the average pitch is the distance from the center of one active region 10A to the center of the adjacent active region 10B (center-to-center spacing). The average pitch can range from about 50 nm to about 100 µm. In one example, the average pitch can range from about 50 nm to about 2 µm. In another example, the average pitch can be, for example, about 0.4 µm.

[0143] In this example, the active regions 10A, 10B are adjacent to each other, but do not directly abut each other, since one (10A) is positioned on the protrusion 28 and the other (10B) is positioned within the recess 30.

[0144] Active area 10A positioned on each of the protrusions 28 includes a polymer hydrogel 12A and a primer set 14A. Thus, the x and y dimensions of each active area 10A are equal to the x and y dimensions of the protrusion 28 to which the active area 10A is applied. Active area 10B positioned within each of the recesses 30 includes a polymer hydrogel 12B and a primer set 14B. Thus, the x and y dimensions of each active area 10B are equal to the x and y dimensions of the recess 30 to which the active area 10B is applied.

[0145] As described herein, the polymer hydrogels 12A, 12B may be the same or different, and the primer sets 14A, 14B are different. In one example, the first and second regions 10A, 10B each include the same polymer hydrogel 12A=12B to which the respective first and second primer sets 14A, 14B are attached. In another example, the first region 10A includes a first polymer hydrogel 12A to which the first primer set 14A is attached, and the second region 10B includes a second polymer hydrogel 12B to which the second primer set 14B is attached, and the first polymer hydrogel 12A and the second polymer hydrogel 12B include orthogonal functional groups to which the first primer set 14A and the second primer set 14B are attached, respectively.

[0146] 3C, the substrate 22 is planar and therefore does not include protrusions 28 or recesses 30. Thus, alternating active areas 10A, 10B within each reaction region 24, 24', or 24'' are positioned on the substrate surface.

[0147] In the example shown in FIG. 3C, the active regions 10A, 10B are directly abutting each other. Thus, the substrate surface is not exposed between the alternating active regions 10A, 10B, and thus, there is no gap region between adjacent active regions 10A, 10B. The lack of gap regions in the xy plane of the substrate 22 between the alternating active regions 10A, 10B reduces the average pitch of the active regions 10A, 10B across the substrate 22. In this example, the average pitch is the distance from the center of one active region 10A to the center of the adjacent active region 10B (center-to-center distance) in any one reaction region 24, 24', 24''. The average pitch can range from about 50 nm to about 100 μm. In one example, the average pitch can range from about 50 nm to about 2 μm. In one example, the average pitch can be, for example, about 0.4 μm.

[0148] In this example, the shape of the active regions 10A, 10B in the xy plane of the substrate 22 may be square or rectangular. The active regions 10A, 10B may have the same shape, and therefore the same xy dimensions. The length and width may each be in the range of about 150 nm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or more. The length and width may be selected not to exceed a length-to-width aspect ratio of about 10:1. The width of each of the active regions 10A, 10B is equal to the width of the reaction regions 24, 24', 24''.

[0149] In the example shown in Figure 3C, active area 10A includes polymer hydrogel 12A and primer set 14A, and active area 10B includes polymer hydrogel 12B and primer set 14B. As described herein, polymer hydrogels 12A, 12B can be the same or different, and primer sets 14A, 14B are different. In one example, first and second areas 10A, 10B each include the same polymer hydrogel 12A=12B with respective first and second primer sets 14A, 14B attached thereto. In another example, the first region 10A includes a first polymer hydrogel 12A having a first primer set 14A attached thereto, and the second region 10B includes a second polymer hydrogel 12B having a second primer set 14B attached thereto, the first polymer hydrogel 12A and the second polymer hydrogel 12B including orthogonal functional groups to which the first primer set 14A and the second primer set 14B are attached, respectively.

[0150] In both the examples shown in FIG. 3A and FIG. 3C, the reactive regions 24, 24', 24'' are separated by respective non-reactive regions 26, 26'. The non-reactive regions 26, 26' are regions of the substrate 22 that do not contain the surface chemistry (e.g., polymer hydrogels 12A, 12B and primer sets 14A, 14B) located in the active regions 10A, 10B. The non-reactive regions 26, 26' extend in the same direction along the substrate 22 as the reactive regions 24, 24', 24''. In the examples shown in FIG. 3A and FIG. 3C, the non-reactive regions 26, 26' extend along the length of the substrate 22. As described, one non-reactive region, e.g., 26, separates one reactive region, e.g., 24, from an immediately adjacent reactive region, e.g., 24'. The width of each unreacted region 26, 26' may be large enough to reduce or eliminate pad hopping between one reacted region, e.g., active regions 10A, 10B at 24', to an immediately adjacent reacted region, e.g., active regions 10A, 10B at 24 and 24''. In one example, the width of the unreacted regions 26, 26' may be 150 nm or greater. In one example, the widths may each range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 2 μm, about 10 μm, or greater. In one example, the width of the unreacted regions 26, 26' may be about 0.3 μm.

[0151] Other non-reacted regions 26, 26' may also be located on the outermost surface of the substrate 22 (e.g., in one or more regions located at the periphery). These regions 26, 26' may be available for bonding to a non-reacted region 26, 26' of another patterned structure 23A or 23B, or to a lid.

[0152] In the example shown in Figures 3A and 3C, the number of reactive regions 24, 24', 24" and the number of active regions 10A, 10B within each reactive region 24, 24', 24" will depend on the length and width of the channel 21 in which the reactive and non-reactive regions are located, the width of each non-reactive region 26, 26', and the x and y dimensions of the active regions 10A, 10B. The lack of interstitial areas between the active regions 10A, 10B in the xy plane of the substrate 22 should increase the density (number) of the active regions 10A, 10B in a defined area. In one example, the active regions 10A, 10B are spaced apart from one another by less than 1 mm. 2 They can exist at a density of approximately 3.6 million per

[0153] Two additional examples of patterned structures 23C, 23D of a flow cell 20 are shown in Figures 4A and 4B, respectively. These examples of patterned structures 23C, 23D of a flow cell 20 include a substrate 22 and rows 34, 34', 34'' and columns 36, 36', 36'' of alternating first and second regions 10A, 10B, where each of the first regions 10A includes a first primer set 14A and each of the second regions 10B includes a second primer set 14B that is different from the first primer set 14A, and where i) adjacent first and second regions 10A, 10B directly abut each other (Figure 4C), or ii) the first region 10A is positioned on a protrusion 28 and the second region 10B is positioned within a recess 30 adjacent to the protrusion 28 (Figures 4A and 4B).

[0154] In Figure 4A, the substrate 22 is a multi-layer structure including a single layer base support 42 and another layer 44 positioned on the single layer base support 42. In the case of the patterned structure 23C shown in Figure 4A, the substrate 22 can alternatively be a single layer base support 42. In Figure 4C, the substrate 22 is a single layer base support 42. In the case of the patterned structure 23B shown in Figure 4C, the substrate 22 can alternatively be a multi-layer structure.

[0155] 4A and 4C, the patterned structures 23C, 23D include rows 34, 34', 34'' and columns 36, 36', 36'' of alternating first and second regions 10A, 10B. In one example, the rows 34, 34', 34'' extend partially along the width of the substrate 22 and along the entire width of the flow channel 21, and the columns 36, 36', 36'' extend partially along the length of the substrate 22 and along the entire length of the flow channel 21. Each row 34, 34', 34'' and each column 36, 36', 36'' includes alternating first and second (reactive) regions 10A, 10B.

[0156] In the example shown in FIG. 4A, substrate 22 (e.g., layer 44) includes protrusions 28 and recesses 30 that alternate along rows 34, 34', 34'' and along columns 36, 36', 36''. Features 28, 30 in one column 34'' are shown in cross-section in FIG. 4B. As depicted in FIGS. 4A and 4B, a respective active area 10A is positioned on each of the protrusions 28 and a respective active area 10B is positioned within each of the recesses 30.

[0157] The protrusions 28 extend a first height H1 from the bottom of the substrate 22, and the recesses 30 extend a second height H2 from the bottom of the substrate 22, the first height H1 being greater than the second height H2. A surface of each of the protrusions 28 can be coplanar with a surface of the substrate 22. A surface of each of the recesses 30 is positioned at a depth measured from the substrate surface (e.g., from the surface of the layer 44). The depth can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.

[0158] In the example of FIG. 4A, the shape of the protrusions 28 and the recesses 30 in the xy plane of the substrate 22 may be a circle, a diamond, or a rotated square. The protrusions 28 and the recesses 30 may have the same shape, and therefore the same xy dimensions. The diameter (of the circle), or the length and width (of the diamond or rotated square), may each be in the range of about 150 nm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more. The length and width may be selected not to exceed an aspect ratio of length to width of about 10:1. The width of each of the protrusions 28 and the recesses 30 is equal to the width of the reaction region 24, 24', 24''.

[0159] The size of each protrusion 28 and recess 30 may be characterized by its surface and open area, respectively, as described with reference to Figure 3 A. Recess 30 may also be characterized by its volume, as described with reference to Figure 3 A.

[0160] As shown in FIG. 4A , alternating protrusions 28 and recesses 30 in each of rows 34, 34′, 34″ directly abut one another, and alternating protrusions 28 and recesses 30 in each of rows 36, 36′, 36″ directly abut one another. Thus, some of the protrusions 28 and recesses 30 share a sidewall 32. If the protrusions 28 and recesses 30 are circles, the sidewall 32 is along the circumference of the respective circle. If the protrusions 28 and recesses 30 are diamonds or rotated squares, the sidewall 32 is along the corner of the respective diamond or rotated square. The sidewalls 32 (extending along the z-axis) of the protrusions 28 and recesses 30 do not have the polymer hydrogel 12A, 12B or primer set 14A, 14B applied thereto, and thus define gap regions between the active regions 10A, 10B.

[0161] Because the alternating protrusions 28 and recesses 30 abut one another, there is no gap area directly between the abutting portions. The lack of gap area in the xy plane of the substrate 22 directly between the abutting protrusions 28 and recesses 30 reduces the average pitch of the active regions 10A, 10B across the substrate 22. In this example, the average pitch is the distance from the center of one active region 10A to the center of an adjacent active region 10B in the same row 34, 34', 34'' or column 36, 36', 36'' (center-to-center spacing). The average pitch can range from about 50 nm to about 100 μm. In one example, the average pitch can range from about 50 nm to about 2 μm. In one example, the average pitch can be, for example, about 0.4 μm.

[0162] In this example, the active regions 10A, 10B are adjacent to each other, but do not directly abut each other, since one (10A) is positioned on the protrusion 28 and the other (10B) is positioned within the recess 30.

[0163] Active area 10A positioned on each of the protrusions 28 includes a polymer hydrogel 12A and a primer set 14A. Thus, the x and y dimensions of each active area 10A are equal to the x and y dimensions of the protrusion 28 to which the active area 10A is applied. Active area 10B positioned within each of the recesses 30 includes a polymer hydrogel 12B and a primer set 14B. Thus, the x and y dimensions of each active area 10B are equal to the x and y dimensions of the recess 30 to which the active area 10B is applied.

[0164] As described herein, the polymer hydrogels 12A, 12B may be the same or different, and the primer sets 14A, 14B are different. In one example, the first and second regions 10A, 10B each include the same polymer hydrogel 12A=12B to which the respective first and second primer sets 14A, 14B are attached. In another example, the first region 10A includes a first polymer hydrogel 12A to which the first primer set 14A is attached, and the second region 10B includes a second polymer hydrogel 12B to which the second primer set 14B is attached, and the first polymer hydrogel 12A and the second polymer hydrogel 12B include orthogonal functional groups to which the first primer set 14A and the second primer set 14B are attached, respectively.

[0165] 4C, the substrate 22 is planar and therefore does not include protrusions 28 or recesses 30. Alternating active areas 10A, 10B in rows 34, 34', 34'' or columns 36, 36', 36'' are therefore positioned on the substrate surface.

[0166] In the example shown in FIG. 4C, the active areas 10A, 10B are directly abutted against each other. Thus, the substrate surface is not directly exposed between the alternating active areas 10A, 10B, and therefore, there is no gap area between adjacent active areas 10A, 10B. The lack of gap areas in the xy plane of the substrate 22 between the alternating active areas 10A, 10B reduces the average pitch of the active areas 10A, 10B across the substrate 22. In this example, the average pitch is the distance from the center of one active area 10A to the center of the adjacent active area 10B (center-to-center distance) in any one row 34, 34', 34'' or column 36, 36', 36''. The average pitch can range from about 50 nm to about 100 μm. In one example, the average pitch can range from about 50 nm to about 2 μm. In one example, the average pitch can be, for example, about 0.4 μm.

[0167] In this example, the shape of the active regions 10A, 10B in the xy plane of the substrate 22 may be a circle, a diamond, or a rotated square. The active regions 10A, 10B may have the same shape, and therefore the same xy dimensions. The diameter (of the circle), or the length and width (of the diamond or rotated square), may each be in the range of about 150 nm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more.

[0168] In the example shown in Figure 4C, active area 10A includes polymer hydrogel 12A and primer set 14A, and active area 10B includes polymer hydrogel 12B and primer set 14B. As described herein, polymer hydrogels 12A, 12B can be the same or different, and primer sets 14A, 14B are different. In one example, first and second areas 10A, 10B each include the same polymer hydrogel 12A=12B with respective first and second primer sets 14A, 14B attached thereto. In another example, the first region 10A includes a first polymer hydrogel 12A having a first primer set 14A attached thereto, and the second region 10B includes a second polymer hydrogel 12B having a second primer set 14B attached thereto, the first polymer hydrogel 12A and the second polymer hydrogel 12B including orthogonal functional groups to which the first primer set 14A and the second primer set 14B are attached, respectively.

[0169] In both the examples shown in Figures 4A and 4C, non-reacted regions 26 are located at the intersections of four active areas 10A, 10B. These four active areas 10A, 10B are positioned in a square-like configuration such that each active area 10A is adjacent to two different active areas 10B and each active area 10B is adjacent to two different active areas 10A. Non-reacted regions 26 separate active areas 10A, 10B that are diagonally opposite each other in the square-like configuration.

[0170] Other non-reacted regions 26 may also be located on the outermost surface (e.g., along the perimeter) of substrate 22. These regions 26 may be available for bonding to non-reacted regions 26 of another patterned structure 23C or 23D, or to a lid.

[0171] In the example shown in Figures 4A and 4C, the number of rows 34, 34', 34'', columns 36, 36', 36'', and the number of active areas 10A, 10B within each row 34, 34', 34'', and column 36, 36', 36'', will depend on the length and width of the channel 21 in which the active areas 10A, 10B are located, and the x and y dimensions of the active areas 10A, 10B. The lack of direct gap areas between the active areas 10A, 10B in the xy plane of the substrate 22 should increase the density (number) of the active areas 10A, 10B in a defined area. In one example, the active areas 10A, 10B are spaced apart from one another by less than 1 mm 2 They can exist at a density of approximately 6.3 million per

[0172] Yet another example of a patterned structure 23E of a flow cell 20 is shown in Figure 5. This example of a patterned structure 23E of a flow cell 20 includes a substrate 22 having alternating regions 38, 38', 38'' of a first height H3 and regions 40, 40' of a second height H4, and alternating first and second regions 10A, 10B extending along the regions 38, 38', 38'' of the first height H3 and extending along the regions 40, 40' of the second height H4, where each of the first regions 10A includes a first primer set 14A and each of the second regions 10B includes a second primer set 14B that is different from the first primer set 14A.

[0173] 5, the substrate 22 is a multi-layer structure. As depicted, the substrate 22 includes a base support 42 and another layer 44 positioned on top of the base support 42. In this example of the patterned structure 23E, the substrate 22 can alternatively be a single layer base support.

[0174] In this example, substrate 22, and in particular layer 44, is patterned with alternating regions 38, 38', 38'' of a first height H3 and regions 40, 40' of a second height H4. Layer 44 may be any example of a patterned resin as described herein and may be patterned with various heights H3, H4 using any of the techniques described herein. In one example, layer 44 is patterned such that regions 38, 38', 38'' and regions 40, 40' extend along the length of substrate 22 and partially along the entire length of flow channel 21.

[0175] The first and second heights H3, H4 are measured from the bottom of the substrate 22, with the first height H3 being greater than the second height H4. In some examples, each of the regions 38, 38', 38'' has the same height H3, and each of the regions 40, 40' has the same height H4. In other examples, each of the regions 38, 38', 38'' has a different height H3, and each of the regions 40, 40' has a different height H4, so long as the height of each of the regions 38, 38', 38'' is greater than the height of each of the regions 40, 40'. In any of the examples, the difference between the first height H3 and the second height H4 is at least 150 nm.

[0176] The surface of each of regions 38, 38', 38'' can be flush with the substrate surface. The surface of each of regions 40, 40' is positioned at a depth measured from the surface of the substrate / regions 38, 38', 38''. The depth can range from at least 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.

[0177] 5, adjacent regions (e.g., 38 and 40, 40 and 38', 38' and 40', and 40' and 38'') share sidewalls 32. In this example, the only exposed portions of the substrate 22 between adjacent regions (e.g., 38 and 40, 40 and 38', 38' and 40', and 40' and 38'') are the sidewalls 32 extending along the z-axis. Each sidewall 32 does not have a polymer hydrogel 12A, 12B or primer set 14A, 14B applied thereto, and thus the sidewalls 32 define a gap region between the active regions 10A, 10B positioned over the regions 38, 38', 38'' and the active regions 10A, 10B positioned over the regions 40, 40'.

[0178] Each of the regions 38, 38', 38'' and the regions 40, 40' includes alternating first and second (reactive) regions 10A, 10B. In the example shown in FIG. 5, the alternating pattern of the regions 10A, 10B along each of the regions 38, 38', 38'' is 10A, 10B, 10A, 10B, etc., and the alternating pattern of the regions 10A, 10B along each of the regions 40, 40' is the opposite, e.g., 10B, 10A, 10B, etc. Thus, the alternating pattern of the regions 10A, 10B is observed both along the length of each of the regions 38, 38', 38'', 40, 40' (e.g., y direction in FIG. 5) and in a direction perpendicular to the length (e.g., x direction in FIG. 5) across the regions 38'', 40', 38', 40, 38.

[0179] In this example, the active areas 10A, 10B in each of the regions 38, 38', 38'', 40, 40' (e.g., in the y direction in FIG. 5) are adjacent to each other and directly abut one another. Thus, there are no gap regions between the active areas 10A, 10B that are part of a particular region 38, 38', 38'', 40, 40'. In contrast, the active areas 10A, 10B in adjacent regions (e.g., 38 and 40, 40 and 38', 38' and 40', and 40' and 38'') are adjacent to each other but do not directly abut one another due to the variation in heights H3, H4 between the adjacent regions. As described herein, the sidewalls 32 function as gap regions between the active areas 10A, 10B across the regions 38'', 40', 38', 40, 38.

[0180] In this example, the shape of the active regions 10A, 10B in the xy plane of the substrate 22 may be square or rectangular. The active regions 10A, 10B may have the same shape, and therefore the same xy dimensions. Each of the length and width may be in the range of about 150 nm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more. The width of each of the active regions 10A, 10B in the regions 38, 38', 38'' is equal to the width of the respective region 38, 38', 38'', and the width of each of the active regions 10A, 10B in the regions 40, 40' is equal to the width of the respective region 40, 40'.

[0181] 5, active area 10A includes polymer hydrogel 12A and primer set 14A, and active area 10B includes polymer hydrogel 12B and primer set 14B. As described herein, polymer hydrogels 12A, 12B can be the same or different, and primer sets 14A, 14B are different. In one example, first and second areas 10A, 10B each include the same polymer hydrogel 12A=12B with respective first and second primer sets 14A, 14B attached thereto. In another example, the first region 10A includes a first polymer hydrogel 12A having a first primer set 14A attached thereto, and the second region 10B includes a second polymer hydrogel 12B having a second primer set 14B attached thereto, the first polymer hydrogel 12A and the second polymer hydrogel 12B including orthogonal functional groups to which the first primer set 14A and the second primer set 14B are attached, respectively.

[0182] The patterned structure 23E shown in Figure 5 may further include unreacted regions 26 located at least a portion of the periphery of the substrate 22, where the unreacted regions 26 are exposed portions of the substrate 22 (e.g., of layer 44). In the example shown in Figure 5, the unreacted regions 26 are on opposing edges and extend along the length of the substrate 22. These unreacted regions 26 may be used to bond to another patterned structure 23E or a lid, for example, to create a flow channel 21 (not shown in Figure 5).

[0183] 3A to 5, the positions of the active regions 10A and 10B may be reversed. For example, in FIG. 3A or 4A, the active region 10A may be formed in the recess 30, and the active region 10B may be formed on the protrusion 28.

[0184] Yet another example of a patterned structure 23F of a flow cell 20 is shown in FIG. This example of the patterned structure 23F of the flow cell 20 includes a substrate 22, a plurality of first regions 10A, each of which includes a first primer set 14A and is separated from each other of the first regions 10A, a plurality of second regions 10B, each of which includes a second primer set 14B and is separated from each other of the second regions 10B by at least one adjacent first region 10A and at least one adjacent third region 10C, and a plurality of third regions 10C, each of which includes a third primer set 14C and is separated from each other of the third regions 10C by at least one adjacent first region 10A and at least one adjacent second region 10B.

[0185] 6, the substrate 22 is a single layer base support. In this example of patterned structure 23F, the substrate 22 may alternatively be a multi-layer structure.

[0186] In this example, the substrate 22 is planar and therefore does not include protrusions 28, or recesses 30, or regions 38, 40, etc. of different heights H3, H4. Thus, the active areas 10A, 10B, 10C are positioned on the substrate surface.

[0187] In this example, the shape of the active regions 10A, 10B, 10C in the xy plane of the substrate 22 may be circular. The active regions 10A, 10B may have the same shape, and therefore the same xy dimensions. The diameter may range from about 150 nm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more.

[0188] The active areas 10A, 10B, 10C may be arranged in a number of columns 46, 46', 46'' across the substrate 22. In the example shown in FIG. 6, every other row 46' is slightly offset from its immediately adjacent row 46, 46'', such that an active area 10A, 10B, 10C in a slightly offset row 46' is between two active areas 10A, 10B, 10C in an immediately adjacent row 46, 46''. The offset positions from one row 46, 46', 46'' to the next row 46, 46', 46'' allow active area 10A to contact active areas 10B and / or 10C but not to contact other active areas 10A, each of active areas 10B to contact areas 10A and / or 10C but not to contact other active areas 10B, and each of active areas 10C to contact areas 10A and / or 10B but not to contact other active areas 10C.

[0189] The active areas 10A, 10B, 10C in a given row 46, 46', 46'' are adjacent to one another and therefore directly abut one another (e.g., in the x-direction) such that there are no gap areas between the active areas 10A, 10B, 10C in a given row 46, 46', 46''. Each active area 10A, 10B, 10C in the offset column 46' may directly abut one or two active areas 10A, 10B, 10C in the immediately diagonally adjacent row 46, 46''. In the example shown in FIG. 6, each active area 10A, 10B, 10C in the offset row 46' is at a 45° diagonal relative to two of the active areas 10A, 10B, 10C in the row 46 and relative to two of the active areas 10A, 10B, 10C in the row 46''. As one example, active area 10C in offset row 46' and two diagonal active areas 10A, 10B in row 46 are positioned in a triangle-like configuration such that active areas 10A, 10B are adjacent to each other (in row 46) and each is diagonal relative to active area 10C (in row 46'). As another example, active area 10A in offset row 46' and two diagonal active areas 10B, 10C in row 46 are positioned in a triangle-like configuration such that active areas 10B, 10C are adjacent to each other (in row 46) and each is diagonal relative to active area 10A (in row 46').

[0190] The offset positioning from one row 46, 46', 46'' to the next row 46, 46', 46'' creates non-reacted regions 26 at the intersections of each triangle-like configuration. Other non-reacted regions 26 may also be located on the outermost surface (e.g., around the periphery) of the substrate 22. These regions 26 may be available for bonding to a non-reacted region 26 of another patterned structure 23F or to a lid.

[0191] In the example shown in FIG. 6, active area 10A includes polymer hydrogel 12A and primer set 14A, active area 10B includes polymer hydrogel 12B and primer set 14B, and active area 10C includes polymer hydrogel 12C and primer set 14C. As described herein, polymer hydrogels 12A, 12B, 12C can be the same or different, and primer sets 14A, 14B, 14C are different. In one example, first primer set 14A includes P5 and P7 primers, second primer set 14B includes any combination of PX, PA, PB, PC, and / or PD primers, and third primer set 14C includes any combination of PX, PA, PB, PC, and / or PD different from second primer set 14B. Any of primer sets 14A, 14B, 14C can be replaced with primer subsets 13A, 15A, or 13B, 15B, etc. In one example, the first, second, and third regions 10A, 10B, 10C each include the same polymer hydrogel 12A=12B=12C to which a respective first, second, and third primer set 14A, 14B, 14C is attached. In another example, the first region 10A includes a first polymer hydrogel 12A to which a first primer set 14A is attached, the second region 10B includes a second polymer hydrogel 12B to which a second primer set 14B is attached, and the third region 10C includes a third polymer hydrogel 12C to which a third primer set 14B is attached, where the first polymer hydrogel 12A, the second polymer hydrogel 12B, and the third polymer hydrogel 12C include orthogonal functional groups to which the first primer set 14A, the second primer set 14B, and the third primer set 14C are attached, respectively.

[0192] Yet another example of a patterned structure 23G of a flow cell 20 is shown in FIG. 7A.

[0193] This example of a patterned structure 23G of a flow cell 20 includes a substrate 22, a plurality of capture primers 48 arranged in rows 50, 50', 50'' and offset columns 52, 52', 52'', 52''', 52'''' across the substrate 22, a continuous polymer hydrogel 12 positioned on the substrate 22 and surrounding each of the plurality of capture primers 48, and a primer set 14 attached to the continuous polymer hydrogel 12.

[0194] The PX primers described herein are suitable capture primers 48. Any of the primer sets or subsets described herein may be attached to a polymer hydrogel 12 that surrounds the capture primers 48. Each capture primer 48 hybridizes to one library template that amplifies across the primer set 14. Physical collision of different clusters of amplicons stops amplification and creates distinct active regions 10A, 10B, 10C.

[0195] Different configurations of the patterned structure 23G are shown in Figures 7B-7D. In Figures 7B-7D, the substrate 22 is a single-layer base support. In any of the examples of the patterned structure 23G, the substrate 22 can alternatively be a multi-layer structure.

[0196] In FIG. 7B, the substrate 22 is planar with a plurality of capture primers 48 and a continuous polymer hydrogel 12 attached to the substrate surface.

[0197] In FIG. 7C , the substrate 22 includes protrusions 28 arranged in rows 50, 50', 50'' and offset columns 52, 52', 52'', 52'''', 52'''' across the substrate 22, and one of the multiple capture primers 48 is positioned on each of the protrusions 28.

[0198] In FIG. 7D, the substrate 22 includes recesses 30 arranged in rows 50, 50', 50'' and offset columns 52, 52', 52'', 52'''', 52'''' across the substrate 22, and one of a plurality of capture primers 48 is positioned within each of the recesses 30.

[0199] It should be understood that in the examples shown in Figures 3A, 4A, 4C, 5, and 6, the active regions 10A, 10B, 10C formed on the substrate surface can instead be formed in recesses (e.g., 30). In these examples, the active region 10A can be positioned in a recess 30 having a depth different from the depth of the recess 30 containing the active region 10B and different from the depth of the recess 30 containing the active region 10C (if included). The difference in depth between the different recesses is at least 150 nm. When the various active regions 10A, 10B, 10C are formed in recesses having different depths (as opposed to some being formed on the substrate surface), the surface of the substrate can be cleaned of any polymer hydrogels 12A, 12B, 12C, primers 14A, 14B, etc. via polishing while leaving the surface chemistry in the recesses intact.

[0200] Methods for fabricating a flow cell structure The patterned structures 23A, 23C shown in Figures 3A and 4A may be prepared by the method illustrated in Figures 8A-8C. In this exemplary method, the patterned structures 23A, 23C include a multi-layer substrate 22. The method generally includes depositing a first polymer hydrogel 12A onto a multi-layer substrate 22 (an example of a substrate 22), the multi-layer substrate including a base support 42 including surface groups that attach to the first polymer hydrogel 12A, a layer 44 positioned on the base support 42, the layer 44 including a material that cannot attach to the first polymer hydrogel 12A, and a plurality of recesses 30 defined in the layer 44 such that a portion 60 of the base support 42 is exposed in each of the plurality of recesses 30, whereby the first polymer hydrogel 12A is supported by the base support 42 and the layer 44 is supported by the layer 4 ... the second polymer hydrogel 12B selectively adheres to the layer 44; depositing the second polymer hydrogel 12B such that the second polymer hydrogel 12B selectively adheres to the layer 44; grafting a first primer set 14A onto the first polymer hydrogel 12A; and grafting a second primer set 14B onto the second polymer hydrogel 14B, where the second primer set 14B is different from the first primer set 14A.

[0201] First polymer hydrogel 12A and primer set 14A are shown on protrusion 28 in Figures 3A and 4A, but in recess 30 in Figure 8C. Similarly, second polymer hydrogel 12B and primer set 14B are shown in recess 30 in Figures 3A and 4A, but in Figure 8C, they are shown on protrusion 28. It should be understood that the method illustrated in Figures 8A-8C can be performed such that reaction area 10A is formed in recess 30 and reaction area 10B is formed on protrusion 28, or such that reaction area 10B is formed in recess 30 and reaction area 10A is formed on protrusion 28.

[0202] 8A, the substrate 22 includes a base support 42 and a patterned layer 44 positioned thereon. In one example, the base support 42 is a resin material.

[0203] A layer 44 is formed on the base support 42. The layer 44 can be any material that can be selectively deposited or deposited and patterned to form the recesses 30 and protrusions 28. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, droplet dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, and the like. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins, non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0204] The arrangement of the recesses 30 and protrusions 28 may be as shown in FIG. 3A. Thus, in one example, layer 44 may include a plurality of first lines (similar to regions 24, 24', 24") extending along layer 44, each of the first lines including some of the plurality of recesses 30 separated by unpatterned regions of layer 44 (shown as protrusions 28 in FIG. 8A), and second lines (similar to regions 26, 26') separating one of the plurality of first lines from an adjacent one of the plurality of first lines, the second lines separating one of the plurality of first lines from the adjacent one of the plurality of first lines. and a second line comprising contiguous unpatterned areas of layer 44 extending the length of each. The arrangement of recesses 30 and protrusions 28 may alternatively be as shown in FIG. 4A. Thus, in one example, layer 44 is patterned to include rows (similar to rows 34, 34', 34") and columns (similar to columns 36, 36', 36") of alternating recesses 30 and unpatterned areas of layer 44 (shown as protrusions 28 in FIG. 8A).

[0205] Layer 44 covers base support 42 (as shown in FIGS. 3A and 4A) except for recess 30 where a portion 60 of activated base support 42 is exposed (as shown in FIG. 8A).

[0206] In one example, the exposed portion 60 of the base support 42 may be activated via plasma ashing to introduce surface groups capable of attaching to the first polymer hydrogel 12A. The layer 44 may be masked during the plasma etching process so as not to be affected. In another example, the base support 42 may be exposed to activation (e.g., via plasma ashing or silanization) before the layer 44 is formed thereon. In either case, the exposed portion 60 of the base support 42 is functionalized to selectively attach to the polymer hydrogel 12A, and the layer 44 positioned on the base support 42 cannot attach to the first polymer hydrogel 12A.

[0207] 8B, a first polymer hydrogel 12A is deposited onto the multi-layer substrate 22 using any suitable deposition technique. In this example, the first polymer hydrogel 12A selectively adheres to exposed portions 60 of the support 42 and does not adhere to exposed portions of layer 44.

[0208] Layer 44 is then washed (e.g., with NaOH) and activated with surface groups to attach second polymer hydrogel 12B. The process for activating layer 44 can depend on where it is desired to attach second polymer hydrogel 12B.

[0209] In the example shown in FIG. 3A, the non-reacted areas 26, 26' are areas where the polymer hydrogel 12A, 12B has not been applied. It is therefore not desirable to activate the continuous unpatterned areas of the layer 44 that will form the non-reacted areas 26, 26'. The continuous unpatterned areas of the layer 44 (referred to as second lines) that will eventually form the non-reacted areas 26, 26' can be masked (e.g., using photoresist) during activation of the layer 44 so that these lines cannot attach to the second polymer hydrogel 12B. In FIG. 3A, the active areas will be formed on the protrusions 28 that alternate along the (first) line of the layer 44 with the recesses 28, and therefore it is desirable to activate the protrusions 28. The protrusions 28 can be activated via silanization. Once the protrusions 28 are activated, the masking layer can be removed from the continuous unpatterned areas of the layer 44. The protrusions 28 contain surface groups for attachment of a polymer hydrogel (12A shown in FIG. 3A or 12B shown in FIG. 8C). In contrast, the continuous unpatterned areas of layer 44 that form the non-reacted regions 26, 26' do not have surface groups for attachment of a polymer hydrogel (12A shown in FIG. 3A or 12B shown in FIG. 8C).

[0210] In the example shown in FIG. 4A, before the active areas (e.g., 10A) are formed on the protrusions 28, the recesses 30 are surrounded by unpatterned areas of the layer 44. Some of these unpatterned areas are shown in FIG. 8B with reference numeral 62. In this example, activating the layer 44 includes selectively silanizing the unpatterned areas (of the layer 44) to generate rows and columns of alternating recesses 30 (having polymer hydrogel 12A (FIG. 8B) or 12B (FIG. 4A) therein) and activated areas 62 of the layer 44, where the recesses 30 and activated areas 62 are circular and have the same diameter. This activation process forms a pattern for the active areas to be formed on the protrusions 28.

[0211] Another polymer hydrogel may then be applied, for example, to the activated peaks 28. In FIG. 8C, the other polymer hydrogel is a second polymer hydrogel 12B. In one example, the second polymer hydrogel 12B adheres to the activated portions 62 on the peaks 28. The second polymer hydrogel 12B may be applied using any suitable deposition technique, and if deposition is performed under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second polymer hydrogel 12B does not deposit on or adhere to the first polymer hydrogel 12A (i.e., the polymer hydrogel in the valleys 30).

[0212] The method also includes attaching the respective primer sets 14A, 14B to the polymer hydrogels 12A, 12B. In some instances, the primer sets 14A, 14B may be pre-grafted to the respective polymer hydrogels 12A, 12B. In these instances, no additional primer grafting is performed.

[0213] In other examples, the primer sets 14A, 14B are not pre-grafted to the respective polymer hydrogels 12A, 12B. In these examples, the primer set 14A may be grafted after the polymer hydrogel 12A is applied (e.g., in FIG. 8B). In these examples, the primer set 14B may be pre-grafted to the second polymer hydrogel 12B. Alternatively, in these examples, the primer set 14B may not be pre-grafted to the second polymer hydrogel 12B. Rather, the primer set 14B may be grafted after the second polymer hydrogel 12B is applied (e.g., in FIG. 8C) so long as i) the second polymer hydrogel 12B has a different functional group (than the first polymer hydrogel 12A) for attaching to the primer set 14B, or ii) the unreacted functional groups of the first polymer hydrogel 12A are quenched using, for example, a Staudinger reduction to an amine or an addition click reaction with a passive molecule such as a hexynoic acid.

[0214] If grafting is performed during the method, it may be accomplished using any suitable grafting technique. By way of example, grafting may be accomplished by flow-through deposition (e.g., using a temporarily attached lid), dunk coating, spray coating, drop dispensing, or another suitable method. Each of these exemplary techniques may utilize a primer solution or mixture that may include primer set 14A or 14B, water, a buffer, and a catalyst. With any of the grafting methods, primer set 14A or 14B binds to the reactive groups of polymer hydrogel 12A or 12B and has no affinity for the other layer.

[0215] The patterned structures 23A, 23C shown in Figures 3A and 4A may also be prepared by the method shown in Figures 9A-9D. In this exemplary method, the patterned structures 23A, 23C include a single layer base support 42. The method generally includes depositing a mask material 64 on the sidewalls 32 of each recess 30 defined in the substrate 22, depositing a first polymer hydrogel 12A on the substrate 22, whereby the first polymer hydrogel 12A selectively adheres to portions 60 of the substrate 22 exposed at each of the plurality of recesses 30 and at regions 62' separating the plurality of recesses 30, depositing a photoresist 66 on the substrate 22, and etching to remove a first portion 66' of the photoresist 66 and a first portion 66' of the first polymer hydrogel 12A from the regions 62', whereby a second portion 66' of the photoresist 66 and a first portion 66' of the first polymer hydrogel 12A are removed from the substrate 22. activating the regions 62′ having surface groups to attach a second polymer hydrogel 12B to the regions 62; depositing the second polymer hydrogel 12B such that the second polymer hydrogel 12B selectively attaches to the regions 62; removing the mask material 64 and the second portions of the photoresist 66; grafting a first primer set 14A to the first polymer hydrogel 12A; and grafting a second primer set 14B to the second polymer hydrogel 12B, where the second primer set 14B is different from the first primer set 114A.

[0216] First polymer hydrogel 12A and primer set 14A are shown on protrusion 28 in Figures 3A and 4A, but are shown in recess 30 in Figure 9D. Similarly, second polymer hydrogel 12B and primer set 14B are shown in recess 30 in Figures 3A and 4A, but are shown on protrusion 28 in Figure 9D. It should be understood that the method illustrated in Figures 9A-9D can be performed such that reaction area 10A is formed in recess 30 and reaction area 10B is formed on protrusion 28, or such that reaction area 10B is formed in recess 30 and reaction area 10A is formed on protrusion 28.

[0217] In the example shown in Figure 9A, the recess 30 is defined in a single layer base support 42. In this example, a multi-layer substrate may be used. If a multi-layer substrate is used, the recess 30 is formed in the outermost (top) layer such that the underlying layers are not exposed. Thus, regardless of whether a single layer base support 42 or a multi-layer substrate is used, the exposed portions 60 and regions 62' within the recess 30 have the same surface groups.

[0218] The recess 30 may be formed in the single layer base support 42 using any suitable technique, such as photolithography, nanoimprint lithography (NIL), stamping techniques, laser-assisted direct imprinting (LADI) embossing techniques, molding techniques, microetching techniques, etc. The technique used will depend, in part, on the type of material used. By way of example, the recess 30 may be microetched into a glass single layer substrate or nanoimprinted into a nanoimprint lithography resin. If a multi-layer substrate is used, the recess 30 may be formed in the outermost (top) layer using any suitable technique, such as nanoimprint lithography (NIL) or photolithography. The technique used will depend, in part, on the type of material used and will be performed such that any underlying layers are not exposed at the bottom of the recess 30.

[0219] The arrangement of the recesses 30 and protrusions 28 may be as shown in FIG. 3A. Thus, in one example, the single layer base support 42 may include a plurality of first lines (similar to regions 24, 24', 24") extending along the single layer base support 42, each of the first lines including some of the plurality of recesses 30 separated by unpatterned regions of the single layer base support 42 (shown as protrusions 28 in FIG. 9A), and a second line (similar to regions 26, 26') separating one of the plurality of first lines from an adjacent one of the plurality of first lines, the second line separating one of the plurality of first lines from the adjacent one of the plurality of first lines. and a second line comprising contiguous unpatterned areas of the single layer base support 42 extending the length of each. The arrangement of the recesses 30 and protrusions 28 may alternatively be as shown in FIG. 4A. Thus, in one example, the single layer base support 42 is patterned to include rows (similar to rows 34, 34', 34") and columns (similar to columns 36, 36', 36") of alternating recesses 30 and unpatterned areas of the single layer base support 42 (shown as protrusions 28 in FIG. 9A).

[0220] The exemplary method continues by applying a mask material 64 onto the sidewalls 32 of each recess 30. This is depicted in FIG. 9B. Examples of materials suitable for the mask material 64 include semi-metals, such as silicon, or metals, such as aluminum, copper, titanium, gold, silver, or negative or positive photoresist. In some examples, the semi-metals or metals may be at least substantially pure (<99% pure). In other examples, molecules or compounds of the listed elements may be used to provide a desired etch stop or other function in a particular method. For example, any of the listed semi-metal oxides (e.g., silicon dioxide) or metal oxides (e.g., aluminum oxide) may be used alone or in combination with the listed semi-metals or metals.

[0221] Mask material 64 may be applied to sidewalls 32 using a photolithography process combined with either lift-off or etching techniques. In other examples, selective deposition techniques such as chemical vapor deposition (CVD) and its variants (e.g., low pressure CVD or LPCVD), atomic layer deposition (ALD), and angled deposition may be used to deposit mask material 64 in desired areas. Alternatively, mask material 64 may be applied across substrate 22 and then selectively removed (e.g., by masking and etching) from portions 60 and regions 62' to define a pattern on sidewalls 32.

[0222] The single layer base support 42 may then be activated via plasma ashing, which introduces surface groups for attaching the polymer hydrogel 12A or 12B to the exposed portions 60 and regions 62' of the single layer base support 42.

[0223] 9B, a first polymer hydrogel 12A is deposited, using any suitable deposition technique, on the single layer base support 42. In this example, the first polymer hydrogel 12A selectively adheres to the exposed portions 60 and areas 62' of the single layer base support 42 and does not adhere to the mask material 64.

[0224] 9B, a photoresist 66 is applied to the single layer base support 42 over the mask 64 and the first polymer hydrogel 12A. In this example, the entire photoresist 66 can be developed to form insoluble portions so that it can be exposed to an etching process.

[0225] In one example, the photoresist 66 is a negative photoresist (exposed areas are insoluble in a developer). An example of a suitable negative photoresist includes the NR series of photoresists (available from Futurrex). Other suitable negative photoresists include the SU-8 series and the KMPR series (both available from Kayaku Advanced Materials, Inc.), or the UVN series (available from DuPont). When a negative photoresist is used, it is selectively exposed to a certain wavelength of light to make it insoluble. In these examples, there are no soluble portions, so no developer solution is utilized. In another example, the photoresist 66 is a positive photoresist (exposed areas are soluble in a developer). An example of a suitable positive photoresist includes the MICROPOSIT S1800 series or the AZ 1500 series, both of which are available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR™-220 (manufactured by DuPont). When a positive photoresist is used, it is desirable for the entire photoresist 66 to be insoluble, and therefore not exposed to certain wavelengths of light that would create soluble regions.

[0226] A timed dry etch process may then be used to remove the photoresist 66 and portions of the first polymer hydrogel 12A from the region 62' of the single layer base support 42. The timed dry etch is stopped so that a portion of the polymer hydrogel 12A and a portion 66' of the photoresist 66 remain in the recess 30, as shown in FIG. 9C. In one example, the timed dry etch may involve a reactive ion etch (e.g., with CF4), where the photoresist 66 is etched at a rate of about 17 nm / min. In another example, the timed dry etch may involve a 100% O2 plasma etch, where the photoresist 66 is etched at a rate of about 98 nm / min.

[0227] As will be described, polymer hydrogel 12A over area 62' may also be removed during etching of photoresist 66. A combustion reaction may occur and polymer hydrogel 12A is converted to carbon dioxide and water, which is exhausted from the etching chamber.

[0228] Regions 62' of the single layer base support 42 can then be activated with surface groups to allow attachment of the second polymer hydrogel 12B. The process for activating the single layer base support 42 can depend on where it is desired to attach the second polymer hydrogel 12B.

[0229] In the example shown in FIG. 3A, the non-reacted areas 26, 26' are areas where the polymer hydrogels 12A, 12B have not been applied. It is therefore not desirable to activate the continuous unpatterned areas of the monolayer base support 42 that will form the non-reacted areas 26, 26'. The continuous unpatterned areas of the monolayer base support 42 (referred to as second lines) that will eventually form the non-reacted areas 26, 26' can be masked during activation of the monolayer base support 42, for example, using a mask material 64, so that these lines cannot attach to the second polymer hydrogel 12B. Thus, the mask material 64 is also deposited on the second lines so that they are covered during activation. In FIG. 3A, the active areas will be formed on the protrusions 28 that alternate along the (first) line of the monolayer base support 42 with the recesses 28, and therefore it is desirable to activate the protrusions 28. The protrusions 28 can be activated by plasma ashing or silanization. After activation, the protrusions 28 contain surface groups for attachment to a polymer hydrogel (12A shown in FIG. 3A or 12B shown in FIG. 9C). In contrast, the continuous unpatterned areas of the single layer base support 42 that form the non-reacted regions 26, 26' are coated with a mask material 64.

[0230] In the example shown in FIG. 4A, before the active areas (e.g., 10A) are formed on the protrusions 28, the recesses 30 are surrounded by unpatterned areas of the monolayer base support 42. In this example, activating the monolayer base support 42 includes selectively silanizing the unpatterned areas 62' (of the monolayer base support 42) to generate rows and columns of alternating recesses 30 (having polymer hydrogels 12A (FIG. 9C) or 12B (FIG. 4A) therein) and activated areas 62 of the monolayer base support 42, where the recesses 30 and activated areas 62' are circular and have the same diameter. This activation process forms a pattern for the active areas to be formed on the protrusions 28.

[0231] Another polymer hydrogel may then be applied, for example, to the activated protrusions 28 (regions 62'). In Figure 9C, the other polymer hydrogel is a second polymer hydrogel 12B. In one example, the second polymer hydrogel 12B adheres to the activated portions 62' on the protrusions 28 and is applied over the mask material 64 and portions 66' of the photoresist 66. The second polymer hydrogel 12B may be applied using any suitable deposition technique.

[0232] Removal of photoresist portions 66' and mask material 64 may then be performed.

[0233] The photoresist portions 66' may be lifted off with a positive or negative photoresist remover, such as dimethylsulfoxide (DMSO) using sonication, or acetone, or an NMP (N-methyl-2-pyrrolidone) based stripper. The positive photoresist portions 66' may also be removed with propylene glycol monomethyl ether acetate. This lift-off process removes i) at least 99% of the insoluble photoresist portions 66' and ii) the second polymer hydrogel 12B thereon. This lift-off process exposes the polymer hydrogel 12A in the recesses 30.

[0234] The mask material 64 may then also be exposed to a lift-off process. Any suitable wet lift-off process may be used, such as immersion, sonication, or spinning and dispensing a lift-off liquid. This lift-off process removes i) the mask material 64, and ii) the second polymer hydrogel 12B thereon. When this method is used to form the example shown in FIG. 3A, removal of the mask material 64 exposes the unreacted regions 26, 26′.

[0235] The method also includes attaching the respective primer sets 14A, 14B to the polymer hydrogels 12A, 12B. In some instances, the primer sets 14A, 14B may be pre-grafted to the respective polymer hydrogels 12A, 12B. In these instances, no additional primer grafting is performed.

[0236] In other examples, the primer sets 14A, 14B are not pre-grafted to the respective polymer hydrogels 12A, 12B. In these examples, the primer set 14A may be grafted after the polymer hydrogel 12A is applied (e.g., in FIG. 9B). In these examples, the primer set 14B may be pre-grafted to the second polymer hydrogel 12B. Alternatively, in these examples, the primer set 14B may not be pre-grafted to the second polymer hydrogel 12B. Rather, the primer set 14B may be grafted after the second polymer hydrogel 12B is applied (e.g., in FIG. 9C) and before the lift-off process is performed. If grafting is performed during the method, the grafting may be accomplished using any suitable grafting technique.

[0237] The patterned structures 23B, 23D shown in Figures 3C and 4C may be prepared by the method illustrated in Figures 10A-10C. The method generally includes depositing a first polymer hydrogel 12A onto a multilayer stack, the multilayer stack including a substrate 22 and a mask material 64 patterned on the substrate 22 to define alternating first regions 68 and second regions 70, the first regions 68 exposing portions of the substrate 22 including surface groups that attach to the first polymer hydrogel 12A and the second regions 70 being covered by the mask material 64, whereby the first polymer hydrogel 12A selectively attaches to portions of the substrate 22 exposed in the first regions 68, and then lifting off the mask material 64. to expose the second regions 70; activating the second regions 70 with surface groups to attach the second polymer hydrogel 12B; depositing the second polymer hydrogel 12B such that the second polymer hydrogel 12B selectively attaches to the second regions 70; grafting a first primer set 14A onto the first polymer hydrogel 12A; and grafting a second primer set 14B onto the second polymer hydrogel 12B, where the second primer set 14B is different from the first primer set 14A.

[0238] In this exemplary method, a mask material 64 is applied to the substrate 22 (which may be a single layer base support 42 or a multi-layer structure including both the base support 42 and an overlying layer 44 ).

[0239] The placement of the mask material 64 depends on the desired structure for the active areas 10A, 10B being formed.

[0240] To produce the patterned structure shown in FIG. 3C, first regions 68 and second regions 70 are defined along a plurality of first lines (corresponding to regions 24, 24', 24" in FIG. 3C) extending along substrate 22, and the method further includes applying a second mask material (not shown) along second lines (corresponding to regions 26, 26' in FIG. 3C) separating one of the plurality of first lines from an adjacent one of the plurality of first lines, the second lines defining continuous unpatterned regions of substrate 22 extending the length of each of the plurality of first lines. Thus, mask material 64 is deposited on regions 70 but not on regions 68 along the plurality of first lines, and a second mask material is deposited along the second lines.

[0241] In this example, mask material 64 and the second mask material are different materials that may be lifted off under different conditions. Thus, removal of mask material 64 will not remove the second mask material. Thus, the second mask material remains in place during activation of second regions 70 and may be lifted off in a separate lift-off process.

[0242] In this example, with mask material 64 covering portions 70 and a second mask material covering the lines (corresponding to regions 26, 26' in FIG. 3C), exposed portions 68 of substrate 22 (layer 44 in FIG. 10A) may be activated via plasma ashing to introduce surface groups capable of attaching to first polymer hydrogel 12A. First polymer hydrogel 12A is deposited onto the activated exposed portions 68 using any suitable deposition technique. In this example, first polymer hydrogel 12A selectively attaches to the activated exposed portions 68 and also deposits over mask material 64 and the second mask material.

[0243] To produce the patterned structure shown in FIG. 4C, first regions 68 and second regions 70 are formed to extend in rows (corresponding to rows 34, 34', 34" in FIG. 4C) and columns (corresponding to columns 36, 36', 36" in FIG. 4C) across substrate 22. Mask material 64 is thus deposited in a circular pattern on regions 70 and not on regions 68. To form the circular pattern of regions 68, these regions 68 may be activated. This activation process is selectively performed such that the periphery of substrate 22 (e.g., region 26 in FIG. 4C) and the regions at the intersections of the four first regions 68 and second regions 70 are not activated. Activation of the first regions 68 includes selectively ashing the first regions 68 such that the activated first regions 68 are circular and have the same diameter as the second regions 70 (covered by mask material 64). The selective plasma ashing introduces surface groups in the regions 68 that can attach to the first polymer hydrogel 12A. In this example, the periphery of the substrate 22 (e.g., region 26 in FIG. 4C) and the regions at the intersections of the four first regions 68 and the second regions 70 are not activated and therefore cannot attach to the first polymer hydrogel 12A. The first polymer hydrogel 12A is deposited on the activated exposed portions 68 using any suitable deposition technique. In this example, the first polymer hydrogel 12A selectively attaches to the activated exposed portions 68 and also deposits on the mask material 64.

[0244] The deposited polymer hydrogel 12A is shown in FIG. 10B.

[0245] In this exemplary method, the mask material 64 is lifted off to expose the second region 70. If a second mask material is used along the second lines (corresponding to regions 26, 26' in FIG. 3C), the second mask material remains in place during lift-off of the mask material 64. Examples of suitable lift-off conditions include basic (pH) conditions for silicon, acidic or basic conditions for aluminum, iodine and iodide mixtures for gold, iodine and iodide mixtures for silver, H2O2 for titanium, or iodine and iodide mixtures for copper. Removal of the mask material 64 also removes the first polymer hydrogel 12A positioned thereon.

[0246] The exposed second regions 70 may then be activated. When the second mask material is still in place over the second lines (corresponding to regions 26, 26' in FIG. 3C), plasma ashing or silanization may be used to activate the second regions 70. When the mask material 64 has been removed, thus exposing the second regions 70, the periphery of the substrate 22 (e.g., region 26 in FIG. 4C), and the regions at the intersections of the four first regions 68 and the second regions 70, selective plasma ashing or selective silanization may be used to activate the second regions 70 without activating the periphery of the substrate 22 (e.g., region 26 in FIG. 4C), and the regions at the intersections of the four first regions 68 and the second regions 70.

[0247] Another polymer hydrogel may then be applied, for example, to the activated regions 70. In FIG. 10C, the other polymer hydrogel is a second polymer hydrogel 12B. The second polymer hydrogel 12B selectively adheres to the activated portions 70. The second polymer hydrogel 12B may be applied using any suitable deposition technique, and if the deposition is performed under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second polymer hydrogel 12B will not deposit on or adhere to the first polymer hydrogel 12A attached in region 68.

[0248] If a second mask material is used (e.g., to form the structure shown in FIG. 3C), then a second polymer hydrogel 12B may also be applied over the second mask material. However, the second mask material may be removed using any suitable wet lift-off process for the material, which will remove both the mask material and the second polymer hydrogel 12B.

[0249] When the method is used to form the structure of Figure 4C, the second polymer hydrogel 12B may be deposited on the periphery of the substrate 22 (e.g., region 26 in Figure 4C) as well as on the regions at the intersections of the four first regions 68 (wherein polymer hydrogel 12A is attached) and second regions 70 (wherein polymer hydrogel 12B is attached). Because these substrate regions have not been activated, polymer hydrogel 12B is not covalently attached and may be easily removed by sonication, washing, wiping, etc.

[0250] The method also includes attaching the respective primer sets 14A, 14B to the polymer hydrogels 12A, 12B. In some instances, the primer sets 14A, 14B may be pre-grafted to the respective polymer hydrogels 12A, 12B. In these instances, no additional primer grafting is performed.

[0251] In other examples, the primer sets 14A, 14B are not pre-grafted to the respective polymer hydrogels 12A, 12B. In these examples, the primer set 14A may be grafted after the polymer hydrogel 12A is applied (e.g., in FIG. 10B). In these examples, the primer set 14B may be pre-grafted to the second polymer hydrogel 12B. Alternatively, in these examples, the primer set 14B may not be pre-grafted to the second polymer hydrogel 12B. Rather, the primer set 14B may be grafted after the second polymer hydrogel 12B is applied (e.g., in FIG. 10C). If grafting is performed during the method, the grafting may be accomplished using any suitable grafting technique.

[0252] The structure of patterned structure 23E shown in FIG. 5 may be prepared by the method shown and described with reference to FIGS. 10A-10C, except that substrate 22 includes alternating regions of a first height (e.g., 38, 38', 38" shown in FIG. 5) and regions of a second height (e.g., 40, 40' shown in FIG. 5), and alternating first regions 68 and second regions 70 (FIG. 10A) extend across each of the regions of the first height (e.g., 38, 38', 38" shown in FIG. 5) and regions of the second height (e.g., 40, 40' shown in FIG. 5). In one example, if a second mask material is used, the second mask material may be applied to the periphery of substrate 22 (since there are no other unreacted regions 26, 26'). In another example, if a second mask material is not used, selective plasma ashing or selective silanization may be used to activate second regions 70 without activating the periphery of substrate 22.

[0253] The structure of the patterned structure 23F shown in FIG. 6 can be prepared by the method shown in FIGS. 11A-11D.The method generally comprises depositing a first polymer hydrogel 12A onto a multi-layer stack, the multi-layer stack comprising a substrate 22, a first mask material 64 and a different second mask material 64′, a plurality of first regions 68, each of the first regions 68 exposing a portion of the substrate 22 and separated from each other of the first regions 68, a plurality of second regions 70, each of the second regions 70 covered by the first mask material 64 and separated from each other of the second regions 70, and a plurality of third regions 70. and a first mask material 64 and a different second mask material 64′ patterned on the substrate 22 to define third regions 72, each third region 72 being covered by a different second mask material 64′ and separated from each other third region 72, whereby a first polymer hydrogel 12A selectively adheres to portions of the substrate 22 exposed in each of the plurality of first regions 68; depositing the first mask material 64 and the different second mask material 64′; lifting off the first mask material 64 to expose the plurality of second regions 70; and activating the surface groups to attach a second polymer hydrogel 12B; depositing the second polymer hydrogel 12B such that the second polymer hydrogel 12B selectively attaches to the plurality of second regions 70; lifting off the different second mask material 64' to expose the plurality of third regions 72; activating the plurality of third regions 72 with surface groups to attach a third polymer hydrogel 12C; and depositing the third polymer hydrogel such that the third polymer hydrogel 12C selectively attaches to the plurality of third regions 72. grafting a first primer set 14A onto the first polymer hydrogel 12A, grafting a second primer set 14B onto the second polymer hydrogel 12B, where the second primer set 12B is different from the first primer set 12A, and grafting a third primer set 14C onto the third polymer hydrogel 12C, where the third primer set 14C is different from the first primer set 14A and the second primer set 14B.

[0254] In this exemplary method, a mask material 64, 64' is applied to the substrate 22 (which may be a single layer base support 42 or a multi-layer structure including both the base support 42 and an overlying layer 44).

[0255] The placement of the mask material 64, 64' will depend on the desired structure for the active areas 10A, 10B, 10C being formed.

[0256] In this example, the shape of the mask materials 64, 64' in the xy plane of the substrate 22 may be circular. In this example, the mask materials 64, 64' are different materials that may be lifted off under different conditions. Thus, removal of the mask material 64 will not remove the mask material 64'. Thus, the mask material 64' may remain in place during activation of the second regions 70 and be lifted off in a separate lift-off process.

[0257] In this example, with mask material 64 covering portion 70 and mask material 64' covering region 72, exposed portions 68 of substrate 22 (layer 44 in FIG. 11A) may be activated via plasma ashing to introduce surface groups capable of attaching to first polymer hydrogel 12A. In this example, the periphery of substrate 22 (e.g., region 26 in FIG. 6) and the regions at the intersections of the three first regions 68, 70, 72 are not activated and therefore cannot attach to first polymer hydrogel 12A. First polymer hydrogel 12A is deposited on the activated exposed portions 68 using any suitable deposition technique. In this example, first polymer hydrogel 12A selectively attaches to the active exposed portions 68 and also deposits on top of mask material 64, 64' as shown in FIG. 11B.

[0258] In this exemplary method, the mask material 64 is lifted off to expose the second region 70. Examples of suitable lift-off conditions include basic (pH) conditions for silicon, acidic or basic conditions for aluminum, iodine and iodide mixtures for gold, iodine and iodide mixtures for silver, H2O2 for titanium, or iodine and iodide mixtures for copper. Removal of the mask material 64 also removes the first polymer hydrogel 12A located thereon.

[0259] 11C, the exposed second region 70 may then be activated. Selective plasma ashing or selective silanization may be used to activate the second region 70 without activating the periphery of the substrate 22 (e.g., region 26 in FIG. 6) and the region at the intersection of the first region 68, the second region 70, and the third region 72.

[0260] A second polymer hydrogel 12B may then be applied, for example, to the activated regions 70. This is shown in FIG. 11C. The second polymer hydrogel 12B selectively adheres to the activated portions 70. The second polymer hydrogel 12B may be applied using any suitable deposition technique, and if the deposition is carried out under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second polymer hydrogel 12B will not deposit on or adhere to the first polymer hydrogel 12A attached in region 68.

[0261] A second polymer hydrogel 12B may be deposited on the periphery of the substrate 22 (e.g., region 26 in FIG. 6), as well as on the areas at the intersection of the first region 68 (where polymer hydrogel 12A is attached), the second region 70 (where polymer hydrogel 12B is attached), and the third region 72. Because these substrate regions have not been activated, the polymer hydrogel 12B is not covalently attached and may be easily removed by sonication, washing, wiping, etc.

[0262] In this exemplary method, the mask material 64 is lifted off to expose the third region 72. Any suitable lift-off conditions may be used, depending on the mask material 64'. Removal of the mask material 64' also removes the second polymer hydrogel 12B positioned thereon.

[0263] 11D, the exposed third region 72 may then be activated. Selective plasma ashing or selective silanization may be used to activate the third region 72 without activating the periphery of the substrate 22 (e.g., region 26 in FIG. 6) and the region at the intersection of the first region 68, the second region 70, and the third region 72.

[0264] A third polymer hydrogel 12C may then be applied, for example, to the activated regions 72. This is shown in FIG. 11D. The third polymer hydrogel 12C selectively adheres to the activated portions 72. The third polymer hydrogel 12C may be applied using any suitable deposition technique, and if the deposition is carried out under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the third polymer hydrogel 12C will not deposit on or adhere to the first polymer hydrogel 12A attached at regions 68 or the second polymer hydrogel at portions 72.

[0265] A third polymer hydrogel 12C may be deposited on the periphery of the substrate 22 (e.g., region 26 in FIG. 6), as well as on the areas at the intersection of the first region 68 (where polymer hydrogel 12A is attached), the second region 70 (where polymer hydrogel 12B is attached), and the third region 72. Because these substrate regions have not been activated, the polymer hydrogel 12C is not covalently attached and may be easily removed by sonication, washing, wiping, etc.

[0266] The method also includes attaching the respective primer sets 14A, 14B, 14C to the polymer hydrogels 12A, 12B, 12C. In some instances, the primer sets 14A, 14B, 14C may be pre-grafted to the respective polymer hydrogels 12A, 12B, 12C. In these instances, no additional primer grafting is performed.

[0267] In other examples, primer sets 14A, 14B, 14C are not pre-grafted to the respective polymer hydrogels 12A, 12B, 12C. In these examples, primer set 14A may be grafted after polymer hydrogel 12A is applied (e.g., in FIG. 11B). In these examples, primer set 14B may be pre-grafted to second polymer hydrogel 12B and primer set 14C may be pre-grafted to third polymer hydrogel 12C. Alternatively, in these examples, primer set 14B may not be pre-grafted to second polymer hydrogel 12B and primer set 14C may not be pre-grafted to third polymer hydrogel 12C. Rather, primer set 14B may be grafted after second polymer hydrogel 12B is applied (e.g., in FIG. 11C) and primer set 14C may be grafted after third polymer hydrogel 12C is applied (e.g., in FIG. 11D). If grafting is performed during the method, it may be accomplished using any suitable grafting technique.

[0268] The structure shown in FIG. 6 can also be prepared using a multi-depth substrate having recesses 30 of different depths. Active region 10A can be formed in recesses 30 having a first depth, active region 10B can be formed in recesses 30 having a second depth (e.g., first depth minus 150 nm), and active region 10C can be formed in recesses 30 or on the substrate surface having a third depth (e.g., second depth minus 150 nm). In one example, the recesses are hexagonal, and thus active regions 10A, 10B, 10C are also hexagonal (see, e.g., FIG. 13A, which shows a top view of a portion of a substrate, and FIG. 13B, which shows a perspective view). This structure can be formed by the method shown in FIG. 12A-L. The method utilizes a resin (e.g., layers 44, 44' of a multi-layer structure) that can vary UV absorbance with thickness. In these examples, the thinner portions can be UV transparent and the thicker portions can be UV absorbing. This allows the resin to be used as a mask for backside patterning of a photoresist material.

[0269] In the method of Figures 12A-12L, the UV absorbance of the resin layer 44' can be varied by adjusting its thickness. Any of the resins listed above can be used, so long as the thicker portions absorb UV light and the thinner portions transmit the desired amount of UV light for patterning when the resin is exposed to a given UV dose. In one example, a polyhedral oligomeric silsesquioxane-based resin having a thicker portion of about 500 nm and a thinner portion of about 150 nm has a UV absorbance of about 30 mJ / cm. 2 ~about 60mJ / cm 2 will effectively absorb and transmit, respectively, UV light when exposed to a dose in the range of 1000 nm to 1500 nm. Other thicknesses may be used, and the UV dose adjusted accordingly to achieve the desired absorption in the thicker regions and transmission in the thinner regions.

[0270] 12A-12L, the resin layer 44' may be supported by any example of the base support 42 described herein that is capable of transmitting UV light. In this example, the thick and thin portions of the resin layer 44' are adjusted to achieve the desired absorption and transmittance.

[0271] The correlation between UV dose, UV absorption constant, and resin layer thickness can be expressed as follows:

[0272]

number

[0273]

number

[0274] In Figures 12A-12C, the method illustrated generally includes depositing a first polymer hydrogel 12A on a resin layer 44' that includes a plurality of multi-depth recesses 30' separated by gap regions 74, each multi-depth recess 30' including a deep portion 76 and a shallow portion 78 adjacent to the deep portion 76 (Figure 12B), depositing and curing a photoresist 66 on the first functionalized layer 24, and timed dry etching to remove the photoresist 66 and the first polymer hydrogel 12A from the shallow portions 78 and the gap regions 74 (Figure 12C).

[0275] The multi-depth recesses 30' shown in FIG. 3A may be etched, imprinted, or defined in the resin layer 44' using any suitable technique. In one example, nanoimprint lithography is used. In this example, a working stamp is pressed into the resin layer 44 while the material is soft, creating an imprint (negative replica) of the features of the working stamp in the resin layer 44. The resin layer 44 may then be cured in place with the working stamp. Curing may be accomplished by exposure to actinic radiation, such as visible light or ultraviolet (UV) radiation, if a radiation curable resin material is used, or by exposure to heat, if a thermosetting resin material is used. Curing may promote polymerization and / or crosslinking. By way of example, curing may include multiple stages, including a soft bake (e.g., to drive any liquid carrier that may be used to deposit the resin) and a hard bake. The soft bake may be performed at a low temperature in the range of about 50° C. to about 150° C., for greater than 0 seconds to about 3 minutes. The duration of the hard bake may last from about 5 seconds to about 10 minutes at a temperature ranging from about 100° C. to about 300° C. Examples of devices that can be used for soft baking and / or hard baking include hot plates, ovens, and the like.

[0276] After curing, the working stamp is removed, thereby creating a topographical feature in the resin layer 44'. In this example, the topographical feature of the multi-depth recess 30' includes a shallow portion 78 and a deep portion 76.

[0277] Although two multi-depth recesses 30' are shown in FIG. 12A, it should be understood that the method may be performed to produce an array of multi-depth recesses 30' across the surface of the resin layer 44', each including a deep portion 76 and a shallow portion 78 separated by a gap region 74.

[0278] As shown in FIG. 12B, the first polymer layer 12A is deposited on top of the resin layer 44'. The first polymer layer 12A can be any of the gel materials described herein and can be applied using any suitable deposition technique. A curing process can be performed after deposition. The first polymer layer 12A is covalently attached to the resin layer 44'. The covalent bond helps to maintain the primer set 14A within the desired region throughout the life of the flow cell 20 during various uses.

[0279] To arrive at the structure of FIG. 12C, a positive or negative photoresist 66 is applied over the first polymer hydrogel 12A. In this example, the photoresist 66 may be developed throughout to form insoluble portions so that it may be exposed to a timed dry etch process. The timed dry etch process is used to remove the photoresist 66 and portions of the first polymer hydrogel 12A from the gap regions 74 and from the shallow portions 78 of the multi-depth recesses 30'. The timed dry etch is stopped such that a portion of the polymer hydrogel 12A and a portion 66' of the photoresist 66 remain in the deep portions 76 of the recesses 30', as shown in FIG. 12C. In one example, the timed dry etch may involve reactive ion etching (e.g., with CF4), and the photoresist 66 is etched at a rate of about 17 nm / min. In another example, the timed dry etch may involve 100% O2 plasma etching, and the photoresist 66 is etched at a rate of about 98 nm / min.

[0280] As described, during etching of the photoresist 66, the polymer hydrogel 12A over the gap regions 74 and within the shallow portions 78 may also be removed. A combustion reaction may occur and the polymer hydrogel 12A is converted to carbon dioxide and water, which is exhausted from the etching chamber.

[0281] The portions 66' of the photoresist 66 may then be lifted off. The photoresist portions 66' may be lifted off with a positive or negative photoresist remover, such as dimethylsulfoxide (DMSO) using sonication, or acetone, or an NMP (N-methyl-2-pyrrolidone) based stripper. The positive photoresist portions 66' may also be removed with propylene glycol monomethyl ether acetate. This lift-off process: i) removes at least 99% of the insoluble photoresist portions 66', leaving the polymer hydrogel 12A in the deep portions 76 of the multi-depth recesses 30' (as shown in FIG. 12D).

[0282] A negative photoresist 80 is then applied over the resin layer 44', including over the gap regions 74, in the shallow portions 78, and over the first polymer hydrogel 12A in the deep portions 76. The negative photoresist 80 is then patterned by irradiating ultraviolet light through the backside of the resin layer 44' to produce an insoluble photoresist 80' and a soluble photoresist 80". Although not shown, any base support used can be transparent to the UV light used for backside exposure.

[0283] The first thickness t1 of the resin layer 44' is selected to allow a dose of UV light to penetrate the resin layer 44', and the second and third thicknesses t2, t3 are selected to block the dose of UV light from penetrating the resin layer 44'. Thus, the portion of the negative photoresist 80 covering the thickness t1 becomes insoluble (80') upon exposure to UV light, and the portion of the negative photoresist 80 covering the thicknesses t2, t3 becomes soluble (80'') upon lack of exposure to UV light. In other words, upon exposure to a dose of ultraviolet light, an insoluble negative photoresist 80' is formed in the deep portions 76, and a soluble negative photoresist 80'' is formed over the shallow portions 78 and the gap regions 74.

[0284] The soluble negative photoresist 80'' is then removed using any suitable developer as described herein for negative photoresists. Removal of the soluble negative photoresist 80'' exposes the resin layer 44' in the shallow portions 78 and gap areas 74. This is shown in FIG. 12F.

[0285] As shown in FIG. 12F, a second polymer layer 12B is deposited on top of the resin layer 44'. The second polymer layer 12B may be any of the gel materials described herein and may be applied using any suitable deposition technique. A curing process may be performed after deposition. The second polymer layer 12B covalently adheres to the resin layer 44'.

[0286] FIG. 12G depicts the removal of the insoluble negative photoresist 80′. The insoluble negative photoresist 80′ may be removed via a lift-off process. The lift-off process may be any suitable lift-off process described herein and may include a removal agent suitable for the type of negative photoresist 80 used. As shown in FIG. 12G, the removal process removes i) at least 99% of the insoluble photoresist 80′ and ii) the second polymer hydrogel 12B applied thereon. This removal process leaves the second polymer hydrogel 12B located within the shallow portion 78 and over the gap region 74 intact, and also leaves the first polymer hydrogel 12A intact. These portions of the polymer hydrogels 12A, 12B remain intact in part because they are covalently attached to the resin layer 44′.

[0287] To arrive at the structure of FIG. 12H, another positive or negative photoresist 66 is applied over the resin layer 44', including over the first and second polymer hydrogels 12A, 12B. In this example, the entire photoresist 66 may be developed to form insoluble portions so that it may be exposed to a timed dry etching process. The timed dry etching process is used to remove the photoresist 66 and portions of the second polymer hydrogel 12B from the gap region 74. The timed dry etching is stopped such that portions of the polymer hydrogel 12B remain in the shallow portions 78, portions of the polymer hydrogel 12A remain in the deep portions 76, and portions 66' of the photoresist 66 remain on both the polymer hydrogels 12A, 12B, as shown in FIG. 12H. In one example, the timed dry etching may involve reactive ion etching (e.g., using CF4), and the photoresist 66 is etched at a rate of about 17 nm / min. In another example, the timed dry etch may involve a 100% O2 plasma etch, in which the photoresist 66 is etched at a rate of approximately 98 nm / min.

[0288] As described, during etching of the photoresist 66, the second polymer hydrogel 12B over the gap areas 74 may also be removed. A combustion reaction may occur and the polymer hydrogel 12B is converted to carbon dioxide and water, which is exhausted from the etching chamber.

[0289] The photoresist portions 66' may then be lifted off. The photoresist portions 66' may be lifted off with a positive or negative photoresist remover, such as dimethylsulfoxide (DMSO) using sonication, or acetone, or an NMP (N-methyl-2-pyrrolidone) based stripper. The positive photoresist portions 66' may also be removed with propylene glycol monomethyl ether acetate. This lift-off process: i) removes at least 99% of the insoluble photoresist portions 66', leaving polymer hydrogel 12A in the deep portions 76 and polymer hydrogel 12B in the shallow portions 78 of the multi-depth recesses 30' (as shown in FIG. 12H).

[0290] Another negative photoresist 80 is then applied over the resin layer 44', including over the gap regions 74, over the second polymer hydrogel 12B in the shallow portion 78, and over the first polymer hydrogel 12A in the deep portion 76. This is shown in FIG. 12J. The negative photoresist 80 is then patterned by irradiating ultraviolet light through the backside of the resin layer 44' to produce an insoluble photoresist 80' and a soluble photoresist 80".

[0291] It should be understood that the UV light dose used during this process is stronger than the UV light dose used to pattern the negative photoresist 80 during the process described with reference to FIG. 12E. Thus, in FIG. 12J, both the first thickness t1 and the second thickness t2 of the resin layer 44' allow the higher dose of UV light to penetrate the resin layer 44', and the third thickness t3 blocks the higher dose of UV light from penetrating the resin layer 44'. Thus, the portions of the negative photoresist 80 covering thicknesses t1, t2 become insoluble (80') upon exposure to UV light, and the portions of the negative photoresist 80 covering thickness t3 become soluble (80") upon lack of exposure to UV light. In other words, upon exposure to the higher dose of ultraviolet light, insoluble negative photoresist 80' is formed in the deep portions 76 and shallow portions 78, and soluble negative photoresist 80'' is formed over the gap regions 74 (see FIG. 12J).

[0292] The soluble negative photoresist 80'' is then removed using any suitable developer as described herein for negative photoresists. Removal of the soluble negative photoresist 80'' exposes the resin layer 44' in the gap regions 74. This is shown in FIG. 12K.

[0293] As shown in FIG. 12K, a third polymer layer 12C is deposited on top of the resin layer 44'. The third polymer layer 12C may be any of the gel materials described herein and may be applied using any suitable deposition technique. A curing process may be performed after deposition. The third polymer layer 12C covalently adheres to the resin layer 44' (e.g., in the gap regions 74).

[0294] FIG. 12L depicts the removal of the insoluble negative photoresist 80′. The insoluble negative photoresist 80′ may be removed via a lift-off process. The lift-off process may be any suitable lift-off process described herein and may include a removal agent suitable for the type of negative photoresist 80 used. As shown in FIG. 12L, the removal process removes i) at least 99% of the insoluble photoresist 80′ and ii) the third polymer hydrogel 12C applied thereon. This removal process leaves the second polymer hydrogel 12B located in the shallow portion 78 intact and also leaves the first polymer hydrogel 12A located in the deep portion 76 intact.

[0295] The method also includes attaching the respective primer sets 14A, 14B, 14C to the polymer hydrogels 12A, 12B, 12C. In some instances, the primer sets 14A, 14B, 14C may be pre-grafted to the respective polymer hydrogels 12A, 12B, 12C. In these instances, no additional primer grafting is performed.

[0296] In other examples, primer sets 14A, 14B, 14C are not pre-grafted to the respective polymer hydrogels 12A, 12B, 12C. In these examples, primer set 14A may be grafted after polymer hydrogel 12A is applied (e.g., in FIG. 12B). In these examples, primer set 14B may be pre-grafted to second polymer hydrogel 12B and primer set 14C may be pre-grafted to third polymer hydrogel 12C. Alternatively, in these examples, primer set 14B may not be pre-grafted to second polymer hydrogel 12B and primer set 14C may not be pre-grafted to third polymer hydrogel 12C. Rather, primer set 14B may be grafted after second polymer hydrogel 12B is applied (e.g., in FIG. 12F) and primer set 14C may be grafted after third polymer hydrogel 12C is applied (e.g., in FIG. 12K). If grafting is performed during the method, it may be accomplished using any suitable grafting technique.

[0297] 7A-7D may be prepared by incorporating capture primers 48 (e.g., using a binding pair such as streptavidin and biotin, or other suitable attachment mechanism) in desired regions on substrate 22 and depositing polymer hydrogel 12 to surround capture primers 48. Primer set 14 may be pre-grafted or may be grafted after polymer hydrogel 12 is deposited.

[0298] How to use the flow cell Some examples of flow cells 20 disclosed herein, including primer sets 14A, 14B, and possibly 14C attached to polymers 12A, 12B, 12C, can be used in a sequential paired-end read sequencing method. Different library fragments introduced into the flow cell 20 can be seeded and amplified in each of the active regions 10A, 10B, 10C. Due to the different primer sets 14A, 14B, 14C, amplification of any given library fragment across each active region 10A, 10B, 10C cannot continue on adjacent but different active regions 10B, 10C, 10A. In this method, each forward strand generated on a particular active region 10A, 10B, 10C is sequenced and removed, and then each reverse strand is sequenced and removed.

[0299] If the flow cell 20 includes primer subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D attached to the polymer hydrogel regions 12A1, 12A2 of the active regions 10A, 10B, or 10A (instead of one of the primer sets 14A, 14B, 14C), the subsets can be used in a simultaneous paired-end read sequencing method. As described herein, the primer subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D are controlled to be orthogonal in the polymer hydrogel regions 12A1, 12A2 with different cleavage (linearization) chemistries. This allows for a cluster of forward strands to be generated in one region 12A1 of the active region 10A, and a cluster of reverse strands to be generated in another region 12A2 of the active region 10A. In one example, regions 12A1, 12A2 are immediately adjacent to each other and adjacent to orthogonal active regions 10B, 10C, allowing for simultaneous paired-end reads on active region 10A.

[0300] Additional Notes It should also be understood that all combinations of the foregoing and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as part of the inventive subject matter disclosed herein. It should also be understood that any features of any of the examples disclosed herein may be combined together in any desired manner and / or configuration.

[0301] It should also be understood that terms used explicitly herein and that may also appear in any disclosure incorporated by reference are to be given the meaning that most closely matches the particular concepts disclosed herein.

[0302] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. In addition, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0303] Ranges provided herein should be understood to include the stated range and any value or subrange within the stated range as if such value or subrange were expressly recited. For example, a range of about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm) should be interpreted to include not only the explicitly recited limits of about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm), but also individual values ​​such as about 0.708 μm (708 nm), about 0.9 μm (900 nm), and subranges such as about 0.425 μm (425 nm) to about 0.825 μm (825 nm), about 0.550 μm (550 nm) to about 0.940 μm (940 nm), etc. Additionally, when "about" and / or "substantially" are used to describe values, they are meant to encompass small variations (up to ±10%) from the stated values.

[0304] Although several examples have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered as non-limiting.

Claims

1. A flow cell comprising: A substrate; a plurality of reaction regions extending along the substrate; a non-reacting region separating one of the plurality of reaction regions from an adjacent one of the plurality of reaction regions; each of the plurality of reaction regions includes alternating first and second regions positioned along the reaction region; each of the first regions comprises a first primer set, and each of the second regions comprises a second primer set different from the first primer set; A flow cell, wherein i) adjacent first and second regions directly abut one another, or ii) the first region is positioned on a convex portion and the second region is positioned within a recess adjacent to the convex portion.

2. the first primer set comprises P5 and P7 primers; 2. The flow cell of claim 1, wherein the second primer set comprises any combination of PA, PB, PC, and / or PD primers.

3. the first primer set comprises unblocked P5 and P7 primers; 2. The flow cell of claim 1, wherein the second primer set comprises 3' blocked P5 and P7 primers.

4. The flow cell of claim 1 , wherein the non-reactive area is an exposed portion of the substrate.

5. 2. The flow cell of claim 1, wherein each of the first and second regions comprises a polymer hydrogel having attached thereto the respective first and second primer sets.

6. the first region comprises a first polymer hydrogel having the first primer set attached thereto; the second region comprises a second polymer hydrogel having the second primer set attached thereto; 2. The flow cell of claim 1, wherein the first polymer hydrogel and the second polymer hydrogel comprise orthogonal functional groups for attaching the first and second primer sets, respectively.

7. the first region is positioned on the protruding portion and the second region is positioned within the recessed portion adjacent to the protruding portion; The flow cell of claim 1 , wherein a sidewall of each of the recesses defines a respective interstitial region.

8. A flow cell comprising: A substrate; and rows and columns of alternating first and second regions; each of the first regions comprises a first primer set, and each of the second regions comprises a second primer set different from the first primer set; A flow cell, wherein i) adjacent first and second regions directly abut one another, or ii) the first region is positioned on a convex portion and the second region is positioned within a recess adjacent to the convex portion.

9. The flow cell of claim 8 , wherein the first and second regions are circular or diamond shaped.

10. the first primer set comprises P5 and P7 primers; 9. The flow cell of claim 8, wherein the second primer set comprises any combination of PA, PB, PC, and / or PD primers.

11. the first primer set comprises unblocked P5 and P7 primers; 9. The flow cell of claim 8, wherein the second primer set comprises 3' blocked P5 and P7 primers.

12. 9. The flow cell of claim 8, wherein each of the first and second regions comprises a polymer hydrogel having attached thereto the respective first and second primer sets.

13. the first region comprises a first polymer hydrogel having the first primer set attached thereto; the second region comprises a second polymer hydrogel having the second primer set attached thereto; 9. The flow cell of claim 8, wherein the first polymer hydrogel and the second polymer hydrogel comprise orthogonal functional groups for attaching the first and second primer sets, respectively.

14. A flow cell comprising: a substrate having alternating regions of a first height and regions of a second height; alternating first and second regions extending along the region of the first height and extending along the region of the second height; A flow cell, wherein each of the first regions comprises a first set of primers and each of the second regions comprises a second set of primers different from the first set of primers.

15. 15. The flow cell of claim 14, wherein the difference between the first height and the second height is at least 150 nm.

16. the first primer set comprises P5 and P7 primers; 15. The flow cell of claim 14, wherein the second primer set comprises any combination of PA, PB, PC, and / or PD primers.

17. the first primer set comprises unblocked P5 and P7 primers; 15. The flow cell of claim 14, wherein the second primer set comprises 3' blocked P5 and P7 primers.

18. 15. The flow cell of claim 14, further comprising a non-reacting area located on at least a portion of a periphery of the substrate, the non-reacting area being an exposed portion of the substrate.

19. 15. The flow cell of claim 14, wherein each of the first and second regions comprises a polymer hydrogel to which the respective first and second primer sets are attached.

20. the first region comprises a first polymer hydrogel having the first primer set attached thereto; the second region comprises a second polymer hydrogel having the second primer set attached thereto; 15. The flow cell of claim 14, wherein the first polymer hydrogel and the second polymer hydrogel comprise orthogonal functional groups for attaching the first and second primer sets, respectively.

21. A flow cell comprising: A substrate; a plurality of first regions, each of the first regions comprising a first primer set and separated from each other first region; a plurality of second regions, each second region comprising a second primer set and separated from each other second region by at least one adjacent first region and at least one adjacent third region; a plurality of said third regions, each third region comprising a third primer set and separated from each other third region by at least one adjacent first region and at least one adjacent second region.

22. 22. The flow cell of claim 21, wherein the first region, the second region, and the third region are circular or hexagonal in shape.

23. the first primer set comprises P5 and P7 primers; the second primer set comprises any combination of PA, PB, PC, and / or PD primers; 22. The flow cell of claim 21, wherein the third primer set comprises any combination of PA, PB, PC, and / or PD primers that are different from the second primer set.

24. 22. The flow cell of claim 21, wherein the first region, the second region, and the third region each comprise a polymer hydrogel having attached thereto the respective first and second primer sets.

25. the first region comprises a first polymer hydrogel having the first primer set attached thereto; the second region comprises a second polymer hydrogel having the second primer set attached thereto; the third region comprises a third polymer hydrogel having the third primer set attached thereto; 22. The flow cell of claim 21 , wherein the first polymer hydrogel, the second polymer hydrogel, and the third polymer hydrogel comprise orthogonal functional groups for attaching the first set of primers, the second set of primers, and the third set of primers, respectively.

26. A flow cell comprising: A substrate; a plurality of orthogonal capture primers arranged in rows and offset columns across the substrate; a continuous polymer hydrogel positioned on the substrate and surrounding each of the plurality of capture primers; a primer set attached to the continuous polymer hydrogel.

27. the substrate includes protrusions arranged in rows and offset columns across the substrate; 27. The flow cell of claim 26, wherein one of the plurality of orthogonal capture primers is positioned above each of the recesses.

28. the substrate includes recesses arranged in rows and offset columns across the substrate; 27. The flow cell of claim 26, wherein one of the plurality of orthogonal capture primers is positioned within each of the recesses.

29. 27. The flow cell of claim 26, wherein the primer set comprises P5 and P7 primers.

30. 1. A method comprising: depositing a first polymer hydrogel onto a multi-layer substrate, the multi-layer substrate comprising: a base support comprising surface groups for attachment to said first polymer hydrogel; a layer positioned over the base support, the layer comprising a material that cannot adhere to the first polymer hydrogel; and a plurality of recesses defined in the layer such that a portion of the base support is exposed in each of the plurality of recesses; depositing, whereby the first polymer hydrogel selectively adheres to the portions of the base support exposed in each of the plurality of recesses; and activating the layer with surface groups to attach a second polymer hydrogel; depositing a second polymer hydrogel such that the second polymer hydrogel selectively adheres to the layer; grafting a first primer set onto the first polymer hydrogel; grafting a second primer set onto the second polymer hydrogel, the second primer set being different from the first primer set.

31. The layer is a plurality of first lines extending along the layer, each of the first lines including some of the plurality of recesses separated by unpatterned areas of the layer; and a second line separating one of the plurality of first lines from an adjacent one of the plurality of first lines, the second line comprising a continuous unpatterned area of ​​the layer extending a length of each of the plurality of first lines.

32. 32. The method of claim 31, further comprising masking the second line during the activation of the layer such that the second line cannot adhere to the second polymer hydrogel.

33. 31. The method of claim 30, wherein the layer is patterned to include rows and columns of alternating recesses and unpatterned areas of the layer.

34. 34. The method of claim 33, wherein activating the layer comprises selectively silanizing the unpatterned areas to create rows and columns of alternating recesses and activated areas in the layer, the recesses and the activated areas being circular and having the same diameter.

35. 1. A method comprising: depositing a mask material on a sidewall of each recess defined in the substrate; depositing a first polymer hydrogel onto the substrate, whereby the first polymer hydrogel selectively adheres to portions of the substrate exposed at each of the plurality of recesses and at areas separating the plurality of recesses; depositing a photoresist on the substrate; etching to remove a first portion of the photoresist and a first portion of the first polymer hydrogel from the area, whereby a second portion of the photoresist and a second portion of the first polymer hydrogel remain within each of the plurality of recesses; activating the area with surface groups to attach a second polymer hydrogel; depositing the second polymer hydrogel such that the second polymer hydrogel selectively adheres to the area; removing the mask material and the second portion of the photoresist; and grafting a first primer set onto the first polymer hydrogel; grafting a second primer set onto the second polymer hydrogel, the second primer set being different from the first primer set.

36. The substrate is a plurality of first lines extending along the substrate, each of the first lines including some of the plurality of recesses separated by the regions; and a second line separating one of the plurality of first lines from an adjacent one of the plurality of first lines, the second line comprising a contiguous unpatterned area of ​​the substrate extending a length of each of the plurality of first lines.

37. 37. The method of claim 36, wherein the mask material is also deposited on the second lines such that the second lines are covered during activation.

38. 36. The method of claim 35, wherein the substrate is patterned to include rows and columns of alternating recesses and regions.

39. 39. The method of claim 38, wherein activating the regions comprises selectively ashing the regions to create rows and columns of alternating recesses and activated regions, the recesses and the activated regions being circular and having the same diameter.

40. 1. A method comprising: depositing a first polymer hydrogel onto the multi-layer stack, the multi-layer stack comprising: A substrate; a mask material patterned on the substrate to define alternating first and second regions, the first regions exposing portions of the substrate that include surface groups for attachment to the first polymer hydrogel, and the second regions being covered by the mask material; depositing, whereby the first polymer hydrogel selectively adheres to the portions of the substrate exposed in the first region; and lifting off the mask material to expose the second region; and activating the second region with surface groups to attach a second polymer hydrogel; depositing the second polymer hydrogel such that the second polymer hydrogel selectively adheres to the second region; grafting a first primer set onto the first polymer hydrogel; grafting a second primer set onto the second polymer hydrogel, the second primer set being different from the first primer set.

41. the substrate comprises alternating regions of a first height and regions of a second height; 41. The method of claim 40, wherein the alternating first and second regions extend across each of the region of the first height and the region of the second height.

42. the first regions and the second regions are defined along a plurality of first lines extending along the substrate; the method further comprising applying a second mask material along a second line separating one of the plurality of first lines from an adjacent one of the plurality of first lines, the second line defining a continuous unpatterned area of ​​the substrate extending a length of each of the plurality of first lines; the second mask material remains in place during the activation of the second regions; 41. The method of claim 40, wherein the method further comprises lifting off the second mask material.

43. the first regions and the second regions extend in rows and columns across the substrate; 41. The method of claim 40, wherein the activation of the first region comprises selectively ashing the first region such that the activated first region is circular and has the same diameter as the second region.

44. 1. A method comprising: depositing a first polymer hydrogel onto the multi-layer stack, the multi-layer stack comprising: A substrate; a first mask material and a different second mask material, a plurality of first regions, each first region exposing a portion of the substrate and separated from each other first region; a plurality of second regions, each second region being covered by the first mask material and separated from each other second region; and a first mask material and a different second mask material patterned on the substrate to define a plurality of third regions, each third region being covered by the different second mask material and separated from each other third region; depositing, whereby the first polymer hydrogel selectively adheres to the portions of the substrate exposed in each of the plurality of first regions; lifting off the first mask material to expose the plurality of second regions; activating the plurality of second regions with surface groups to attach a second polymer hydrogel; depositing the second polymer hydrogel such that the second polymer hydrogel selectively adheres to the plurality of second regions; lifting off the different second mask material to expose the plurality of third regions; activating the plurality of third regions with surface groups to attach a third polymer hydrogel; depositing the third polymer hydrogel such that the third polymer hydrogel selectively adheres to the plurality of third regions; grafting a first primer set onto the first polymer hydrogel; grafting a second primer set onto the second polymer hydrogel, the second primer set being different from the first primer set; grafting a third primer set onto the third polymer hydrogel, the third primer set being different from the first primer set and the second primer set.

Images