Recombinant viral genome and viral vector encoding TERT

Abstract

Described herein are recombinant viral genomes comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a tissue-specific promoter and / or an organ-specific promoter. The embodiments described herein may be used in the treatment of conditions associated with shortened telomere length, such as pulmonary fibrosis, myocardial infarction, and conditions associated therewith.

Description

[Technical field]

[0001] Aspects and embodiments described herein relate to the field of medicine, in particular gene therapy. [Background technology]

[0002] Telomeres are special structures at the ends of chromosomes that serve to protect the ends of chromosomes from DNA repair and degradation activities (Non-Patent Document 1). Mammalian telomeres consist of TTAGGG repeats bound by a multiprotein complex known as shelterin. Telomere protection requires the presence of a minimum length of TTAGGG repeats and the integrity of the shelterin complex. When telomeres are significantly shortened, they lose their protective function, inducing a persistent DNA damage response at the telomere, which subsequently triggers a cellular senescence response.

[0003] Telomerase is a cellular reverse transcriptase (TERT, telomerase reverse transcriptase, also known as TP2, TRT, EST2, TCS1) that can compensate for telomere attrition by de novo addition of TTAGGG repeats to the ends of chromosomes by using a related ncRNA element (Terc, telomerase RNA element) as a template (Non-Patent Document 2). Telomerase is expressed in most adult stem cell compartments, but in most somatic cells, telomerase is silenced after birth and telomeres are progressively shortened. This is evidenced by the fact that telomere shortening occurs with age in most human and mouse tissues (Non-Patent Document 3).

[0004] Shortened telomeres are associated with many diseases, such as dyskeratosis congenita, aplastic anemia, myelodysplastic syndromes, Fanconi anemia, pulmonary fibrosis, and cardiovascular disease (CVD). Given the severity of these diseases and the poor prognosis of patients affected by them, improved therapies to treat diseases associated with shortened telomere length are needed.

[0005] Therapeutic intervention with telomerase represents a potential treatment for pathologies associated with shortened telomeres, aiming to prevent telomere loss beyond a significantly shorter length. AAV-based TERT gene therapy, such as using an AAV9 vector (AAV9-CMV-mTert) encoding telomerase under the control of a CMV promoter, has previously been shown to be effective in extending the healthy lifespan of mice (Non-Patent Document 4) and treating pathologies associated with shortened telomere length, such as aplastic anemia and pulmonary fibrosis (Patent Document 1, Non-Patent Document 5, Non-Patent Document 6) and cardiovascular disease (Patent Document 2, Non-Patent Document 7), and according to Non-Patent Document 8, the recovery of doxorubicin toxicity in mouse heart and human cardiomyocytes was demonstrated using an AAV9 vector encoding telomerase under the control of a chicken troponin promoter. Existing AAV vectors are associated with disadvantages that affect their efficacy in TERT gene therapy, such as low gene expression in target tissues, off-target gene expression in tissues other than the tissue to be treated, and the generation of intermediate vector species containing defective viral genomes. In view of the above, there is a need to provide improved recombinant viral genomes and vectors for gene therapy utilizing TERT. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2016 / 020345 [Patent Document 2] International Publication No. 2016 / 020346 [Non-patent literature]

[0007] [Non-Patent Document 1] Blackburn et al. Cell 2001; 106(6):661-673 [Non-Patent Document 2] Greider & Blackburn. Cell 1985; 43:405-413 [Non-Patent Document 3] Blasco, Nat Chem Biol. 2007; 3:640-649 [Non-Patent Document 4] Bernardes de Jesus et al. EMBO Mol Med 2012; 4:691-704 [Non-Patent Document 5] Beier et al. Blood 2012; 120(15):2990-3000 [Non-Patent Document 6] Povedano et al. eLife 2018; 7: e31299 [Non-Patent Document 7] Baer et al. Nat Comm 2014; 5:5863 [Non-Patent Document 8] Chatterjee et al. Mol Ther 2021; 29(4): 1-16) Summary of the Invention

[0008] One aspect of the present invention relates to a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a tissue-specific and / or organ-specific promoter, wherein the total length of the viral genome is less than 4700 nucleotides. In some embodiments, the recombinant viral genome according to the present invention is such that the tissue-specific and / or organ-specific promoter is a lung-specific promoter or a heart-specific promoter. In some embodiments, the recombinant viral genome according to the present invention is an adeno-associated viral genome. In some embodiments, the promoter is selected from the group consisting of SpB promoter, CMVenh-MLC2V promoter, troponin promoter, and derivatives thereof. In some embodiments, the sequence encoding TERT is codon-optimized, preferably for expression in human cells. In some embodiments, the recombinant viral genome according to the present invention comprises: a) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence encoding a polypeptide represented by an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity or similarity to any one of SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10, preferably SEQ ID NO:7 or SEQ ID NO:10; or b) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9; or c) The sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence which differs from the nucleotide sequence of a) or b) due to the degeneracy of the genetic code.

[0009] In some embodiments, the recombinant viral genome according to the invention is such that the promoter comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity to any one of the nucleotide sequences having SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:16, preferably SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:16. In some embodiments, the recombinant viral genome further comprises a Kozak consensus sequence operably linked to the nucleotide sequence encoding TERT. In some embodiments, the recombinant viral genome further comprises a polyA sequence operably linked to the nucleotide sequence encoding TERT.

[0010] Another aspect of the invention relates to an adeno-associated viral vector comprising a recombinant viral genome of the invention. In some embodiments, the adeno-associated viral vector of the invention is such that the viral vector is serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype rh10, serotype rh8, serotype Cb4, serotype rh74, serotype DJ, serotype 2 / 5, serotype 2 / 1, serotype 1 / 2, or serotype Anc80, preferably serotype 6 or serotype 9.

[0011] Another aspect of the present invention relates to a pharmaceutical composition comprising a recombinant viral genome of the present invention or an adeno-associated viral vector of the present invention, optionally further comprising one or more pharma- ceutically acceptable ingredients.

[0012] Another aspect of the present invention relates to a recombinant viral genome of the present invention, an adeno-associated viral vector of the present invention, or a pharmaceutical composition of the present invention for use as a medicament. In some embodiments, the recombinant viral genome of the present invention, the adeno-associated viral vector of the present invention, or the pharmaceutical composition of the present invention is used in the treatment and / or prevention of a condition associated with shortened telomere length. In some embodiments, the recombinant viral genome of the present invention, the adeno-associated viral vector of the present invention, or the pharmaceutical composition of the present invention is used in the treatment and / or prevention of pulmonary fibrosis, myocardial infarction, or a condition associated therewith.

[0013] Detailed Description The present invention provides recombinant viral genomes and recombinant viral vectors useful in gene therapy utilizing telomerase reverse transcriptase (TERT). The recombinant viral genomes and recombinant viral vectors described herein exhibit at least one, at least two, at least three, or all of the following advantages over known viral genomes and viral vectors: Increased TERT expression in target tissues, Decreased TERT expression in off-target tissues, Preventing the formation of intermediate species containing defective viral genomes associated with the use of viral vectors with reduced encapsidation ability; Improved treatment effectiveness.

[0014] As also demonstrated in the Examples section herein, application of the recombinant viral genomes and recombinant viral vectors of the present invention in gene therapy utilizing TERT is expected to provide significant improvements in efficacy over existing treatment strategies. Thus, aspects and embodiments of the present invention described herein address at least some of the problems and needs discussed herein.

[0015] Recombinant viral genome In a first aspect, a recombinant viral genome is provided, comprising a nucleotide sequence encoding a telomerase reverse transcriptase (TERT) operably linked to a tissue-specific promoter and / or an organ-specific promoter, wherein the total length of the viral genome is less than 4700 nucleotides.

[0016] The viral genome may consist of a DNA molecule or an RNA molecule. The molecule may be single-stranded or double-stranded. The molecule may be linear, circular, segmented (composed of multiple nucleic acid pieces), or non-segmented. The viral genome termini may contain repetitive sequences, chemical modifications, and / or secondary structures, which may have regulatory functions such as aiding in viral genome replication in the respective host. In the context of the present invention, any viral genome may be contemplated, as long as it allows expression of the TERT-encoding nucleotide sequence contained therein when the viral genome is introduced into a cell. In some embodiments, the viral genome is derived from a lentivirus, adenovirus, herpesvirus, polyomavirus, vaccinia virus, or adeno-associated virus (AAV).

[0017] In a preferred embodiment, the recombinant viral genome is derived from an adeno-associated virus (AAV). Thus, in a preferred embodiment, a recombinant AAV genome is provided, comprising a nucleotide sequence encoding a telomerase reverse transcriptase (TERT) operably linked to a tissue-specific promoter and / or an organ-specific promoter, wherein the total length of the viral genome is less than 4700 nucleotides.

[0018] The term "adeno-associated virus genome" (AAV genome) refers to the genome of a virus belonging to the genus Dependoparvovirus (also called Dependovirus) of the Family Parvoviridae. The naturally occurring (wild-type) AAV genome is approximately 4.7 kb in length. The genome contains inverted terminal repeats (ITRs) at both ends of the DNA strand.

[0019] A "recombinant" (alternatively termed "chimeric" or "engineered") viral genome is a viral genome that is not normally found in nature (a wild-type viral genome), such as a viral genome in which native regulatory sequences and / or transcribed DNA regions have been removed, modified, or otherwise juxtaposed in a manner that does not occur in nature, and / or in which non-native regulatory sequences and / or transcribed DNA regions have been incorporated.

[0020] The recombinant viral genome according to the invention optionally comprises inverted terminal repeats (ITRs) derived from the AAV genome. Such sequences can enhance the maintenance of the recombinant viral genome in the respective host. The inverted terminal repeats may be included at the 5' and 3' ends of the recombinant viral genome (5'ITR and 3'ITR, respectively). Suitable inverted terminal repeats may be derived from any adeno-associated virus serotype, such as, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, etc. The preferred ITRs are those of AAV2, represented by sequences comprising, consisting essentially of, or consisting of SEQ ID NO:19 (5'ITR) and SEQ ID NO:20 (3'ITR). The present invention also relates to a sequence having preferably at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 19 as a 5' ITR. These include the use of sequences having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:20 as a 3' ITR.

[0021] In some embodiments, the preferred recombinant viral genome is a recombinant adeno-associated virus genome (AAV genome). The genome may or may not include its naturally associated inverted terminal repeats (ITRs). Preferably, the genome includes the ITRs of adeno-associated virus serotype 2 (AAV2), more preferably SEQ ID NO: 19 (5'ITR) and SEQ ID NO: 20 (3'ITR).

[0022] The recombinant viral genome according to the present invention has a total length of less than 4700 nucleotides. The inventors have surprisingly found that when viruses with low encapsidation ability, such as but not limited to adeno-associated viruses, are used as expression vectors, not exceeding the above-mentioned length makes it possible to prevent the formation of intermediate species containing defective viral genomes, resulting in improved therapeutic efficacy of the vector. In some embodiments, the recombinant viral genome has a total length of less than 4680 nucleotides, less than 4660 nucleotides, less than 4640 nucleotides, less than 4620 nucleotides, less than 4600 nucleotides, less than 4580 nucleotides, less than 4560 nucleotides, less than 4540 nucleotides, less than 4520 nucleotides, or less than 4500 nucleotides, preferably less than 4680 nucleotides.

[0023] In some embodiments, the recombinant viral genome has a length of 4400 nucleotides to 4700 nucleotides, 4420 nucleotides to 4700 nucleotides, 4440 nucleotides to 4700 nucleotides, 4460 nucleotides to 4700 nucleotides, 4480 nucleotides to 4700 nucleotides, 4500 nucleotides to 4700 nucleotides, 4520 nucleotides to 4700 nucleotides, 4540 nucleotides to 4700 nucleotides, 4560 nucleotides to 4700 nucleotides, 4580 nucleotides to 4700 nucleotides, 4600 nucleotides to 4700 nucleotides, 4620 nucleotides to 4700 nucleotides, 4640 nucleotides to 4700 nucleotides, 4660 nucleotides to 4700 nucleotides, or 4680 nucleotides to 4700 nucleotides, preferably 4400 nucleotides to 4700 nucleotides in length.

[0024] In some embodiments, the recombinant viral genome is between 4400 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4420 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4440 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4460 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4480 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4500 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4520 nucleotides and 4700 nucleotides ± 10 nucleotides, between 4540 nucleotides and 4700 nucleotides ± 10 nucleotides. tide, having a length of 4560 nucleotides to 4700 nucleotides ± 10 nucleotides, 4580 nucleotides to 4700 nucleotides ± 10 nucleotides, 4600 nucleotides to 4700 nucleotides ± 10 nucleotides, 4620 nucleotides to 4700 nucleotides ± 10 nucleotides, 4640 nucleotides to 4700 nucleotides ± 10 nucleotides, 4660 nucleotides to 4700 nucleotides ± 10 nucleotides, or 4680 nucleotides to 4700 nucleotides ± 10 nucleotides, and preferably having a length of 4400 nucleotides to 4700 nucleotides ± 10 nucleotides.

[0025] "Telomerase reverse transcriptase" (TERT) (alternatively known as TP2, TRT, EST2, or TCS1) (EC 2.7.7.49) is a catalytic component of the telomerase holoenzyme complex whose primary activity is to extend telomeres by acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template sequence within the ncRNA component of the enzyme (Terc, the telomerase RNA component). TERT catalyzes the RNA-dependent extension of 3' chromosome ends with the 6-nucleotide telomeric repeat unit 5'-TTAGGG-3'. Those skilled in the art will appreciate that the term also encompasses modified forms of TERT, such as, but not limited to, TERT fragments, provided that such modified forms are still functional. In this context, functional refers to the modified protein exhibiting at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% catalytic activity compared to the unmodified protein. Modified TERT may also exhibit increased functionality compared to the unmodified protein. In this context, increased functionality refers to the modified protein exhibiting at least 105%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, or at least 200% catalytic activity compared to the unmodified protein. As discussed elsewhere herein, the catalytic activity of TERT can be measured according to standard methods in the art.

[0026] The nucleotide sequence encoding TERT according to the present invention preferably comprises, consists essentially of, or consists only of the coding sequence (CDS) of the TERT gene. "Coding sequence" or "coding region" refers to the portion of a gene that encodes a protein. The nucleotide sequence may be modified or unmodified compared to the naturally occurring (alternatively referred to as "wild type") sequence. Suitable non-limiting modifications may be selected from nucleotide insertions, deletions, mutations, and / or substitutions. It will be understood by those skilled in the art that modifications resulting in the expression of modified forms of TERT as discussed above are also encompassed. The nucleotide sequence encoding TERT may or may not include non-coding regions of the TERT gene, such as introns and / or 5' untranslated regions and / or 3' untranslated regions, and preferably does not include non-coding regions. Thus, in some embodiments, the nucleotide sequence encoding TERT comprises, consists essentially of, or consists only of the coding region of the TERT gene. In some embodiments, the nucleotide sequence encoding TERT consists only of the coding sequence of the TERT gene. In some embodiments, preferred nucleotide sequences encoding TERT do not include the 3'UTR region naturally associated with the TERT gene.

[0027] Modification of the nucleotide sequence can be carried out using any recombinant DNA technique known in the art, for example, in standard handbooks such as Ausubel et al., Current Protocols in Molecular Biology, 3rd edition (2003), John Wiley & Sons Inc, and Sambrook and Green, Molecular Cloning. A Laboratory Manual, 4th Edition (2012), Cold Spring Harbor Laboratory Press, both of which are incorporated herein by reference in their entirety. See also Kunkel (1985) Proc. Natl. Acad. Sci. 82:488 (describing site-directed mutagenesis) and Roberts et al. (1987) Nature 328:731-734 or Wells, JA, et al. (1985) Gene 34: 315 (describing cassette mutagenesis).

[0028] The nucleotide sequence encoding TERT contained in the recombinant viral genome according to the invention may or may not correspond to the native nucleotide sequence of the cell into which the recombinant viral genome containing said gene is introduced. The nucleotide sequence may be derived from any TERT-encoding sequence. In some embodiments, the nucleotide sequence encoding TERT is of mammalian origin. In some embodiments, the nucleotide sequence encoding TERT is of murine, lagomorph, porcine, equine, ovine, bovine, feline, canine, or human origin. In humans, there are two TERT isoforms that differ in length: a long isoform (NCBI CCDS ID:3861.2) and a short isoform (NCBI CCDS ID:54831.1). In some embodiments, the nucleotide sequence encoding TERT is of murine (such as mouse or rat) or human origin, preferably of human origin, more preferably the nucleotide sequence is the long or short isoform of human TERT or a modified version thereof.

[0029] The modification of the nucleotide sequence encoding TERT may include codon optimization. Thus, in some embodiments, the nucleotide sequence encoding TERT is codon optimized for expression, preferably in a human cell or a mouse cell, preferably a human cell. An explanation of "codon optimization" is provided herein below in the section entitled "General Information."

[0030] In some embodiments, a preferred nucleotide sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence encoding a polypeptide represented by the amino acid sequence of SEQ ID NO:4, or an amino acid sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity or similarity to SEQ ID NO:4. SEQ ID NO: 4 shows the amino acid sequence of mouse TERT (Uniprot accession number: O70372-1).

[0031] In some embodiments, a preferred nucleotide sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence encoding a polypeptide represented by the amino acid sequence of SEQ ID NO:7 or SEQ ID NO:10, or an amino acid sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity or similarity to SEQ ID NO:7 or SEQ ID NO:10. SEQ ID NO: 7 shows the amino acid sequence of the long isoform of human TERT (Uniprot accession number: O14746-1). SEQ ID NO: 10 shows the amino acid sequence of the short isoform of human TERT (Uniprot accession number: O14746-3).

[0032] In some embodiments, a preferred nucleotide sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9.

[0033] Thus, in a preferred embodiment, the recombinant viral genome according to the invention comprises a nucleotide sequence encoding telomerase reverse transcriptase (TERT), a) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence encoding a polypeptide represented by the amino acid sequence of any one of SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10, preferably SEQ ID NO:7 or SEQ ID NO:10, or an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity or similarity to any one of SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10, preferably SEQ ID NO:7 or SEQ ID NO:10; b) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9; or c) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence that differs from the nucleotide sequence of a) or b) due to the degeneracy of the genetic code.

[0034] The nucleotide sequence encoding the telomerase reverse transcriptase (TERT) according to the present invention is operably linked to a tissue-specific promoter and / or an organ-specific promoter. An explanation of "operably linked" is given hereinafter in the section entitled "General Information". Throughout this disclosure, the terms "promoter" and "promoter sequence" are used interchangeably and may be replaced by "transcriptional regulatory sequence" or "regulatory sequence". Definitions of these terms are given in the "General Information" section.

[0035] A "tissue-specific" or "organ-specific" promoter is a promoter that is active in a particular type of tissue or organ, respectively. The promoter may be constitutive or inducible. Definitions of these terms are given in the "General Information" section. The term also encompasses promoters that are active in specific cells of the tissue or organ (cell-specific promoters). In this context, the term "promoter activity" refers to the ability of the promoter to initiate transcription of a coding nucleotide sequence operably linked to the promoter. Tissue-specific and organ-specific promoters regulate the expression of one or more genes primarily in one tissue or organ and / or in specific cells of a tissue or organ. In some embodiments, tissue-specific and organ-specific promoters may still allow detectable levels of ("leaky") expression in other tissues or organs. Leaky expression in other tissues or organs means expression that is at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold lower compared to tissue-specific or organ-specific expression, but still detectable, as assessed at the mRNA or protein level by standard assays known to those of skill in the art (e.g., qPCR, Western blot analysis, ELISA).

[0036] Evaluation of the tissue-specific and / or organ-specific properties of the promoter can be performed by standard molecular toolbox techniques, for example as described in Sambrook and Green (see above). As a non-limiting example, any expression vector can be generated that contains any of the recombinant viral genomes described herein, in which the nucleotide sequence encoding TERT is replaced by a nucleotide sequence encoding GFP. Cells, tissues, and organs transduced as described herein can then be evaluated for expression based on RNA or protein levels, or immunostaining and / or microscopy (e.g., fluorescence microscopy, light microscopy, bright field microscopy, etc.), according to standard protocols, for example as described in the Examples section of this disclosure.

[0037] The promoter sequence operably linked to a nucleotide sequence encoding TERT according to the present invention may or may not correspond to the native promoter sequence of the cell into which the recombinant viral genome containing said promoter is introduced. In some embodiments, the promoter sequence is of mammalian origin. In some embodiments, the promoter sequence is of murine, lagomorph, porcine, equine, ovine, bovine, feline, or canine origin. In some embodiments, the promoter sequence is of murine (such as mouse or rat) or human origin, preferably of human origin.

[0038] As demonstrated in the Examples, the inventors have surprisingly found that the tissue- and organ-specific promoters described herein allow for increased gene expression in target tissues and decreased gene expression in off-target tissues.

[0039] In some embodiments, the tissue-specific and / or organ-specific promoter according to the present invention is a lung-specific promoter or a cardiac-specific promoter, preferably a lung-specific promoter.

[0040] A "lung-specific promoter" is a promoter capable of initiating transcription in lung and / or lung tissue and / or lung cells. The promoter may or may not still allow leaky expression in other organs and body parts. "Lung-specific" also encompasses promoters that drive preferential or predominant expression of a nucleotide sequence in lung and / or lung tissue and / or lung cells compared to other organs, tissues, or cells, as described herein below. Lung transcription may be detected in relevant areas such as the trachea, bronchi, pleura, diaphragm, bronchioles, alveoli, or epithelium. Promoters capable of initiating transcription in lung epithelial cells are advantageous. Promoters capable of initiating transcription in alveolar type II epithelial cells (ATII cells) are particularly advantageous. Thus, in some embodiments, the lung-specific promoter is an alveolar type II epithelial cell-specific (ATII cell-specific) promoter. In some embodiments, the preferred lung-specific promoter is selected from the group consisting of a surfactant protein A (SpA) promoter, a surfactant protein B (SpB) promoter, and derivatives thereof, preferably an SpB promoter or a derivative thereof.

[0041] A "cardiac specific promoter" (alternatively known as a "cardiac specific promoter") is a promoter capable of initiating transcription in the heart and / or cardiac tissue and / or cardiac cells. Such promoters may or may not still allow leaky expression in other organs and body parts. "Cardiac specific" also encompasses promoters that drive preferential or predominant expression of a nucleotide sequence in the heart and / or cardiac tissue and / or cardiac cells compared to other organs, tissues, or cells, as described herein below. Transcription in the heart may be detected in relevant regions such as the tricuspid valve, pulmonary valve, mitral valve, aortic valve, left atrium, right atrium, left ventricle, right ventricle, epithelium, or myocardium. Promoters capable of initiating transcription in cardiac muscle cells are advantageous. Promoters capable of initiating transcription in cardiac muscle cells are particularly advantageous. Thus, in some embodiments, the cardiac specific promoter is a cardiac muscle specific promoter. In some embodiments, the cardiac specific promoter is a cardiac muscle cell specific promoter. In some embodiments, the preferred cardiac specific promoter is selected from the group consisting of myosin light chain 2v (MLC2v), troponin (TNT) promoter, and derivatives thereof, preferably troponin (TNT) promoter or derivatives thereof. In some embodiments, the preferred cardiac or cardiomyocyte specific promoter is selected from the group consisting of myosin light chain 2v (MLC2v), troponin (TNT) promoter, and derivatives thereof, preferably troponin (TNT) promoter or derivatives thereof.

[0042] In the context of the present invention, a tissue-specific promoter and / or organ-specific promoter may be a promoter capable of driving expression of a nucleotide sequence in a particular tissue and / or organ that is preferential or predominant (at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, or more) compared to other tissues or organs. The other organs or tissues may be liver, CNS, brain, adipose tissue (white and / or brown), skeletal muscle, heart, kidney, colon, hematopoietic tissue, lung, ovary, spleen, stomach, pancreas, testis, epididymis, intestine, etc. Preferably, the other organs or tissues are liver and adipose tissue (white and / or brown).

[0043] A lung-specific promoter may preferably be a promoter capable of driving expression of a nucleotide sequence preferentially or predominantly in the lung compared to one or more tissues and / or organs selected from the brain, adipose tissue (white and / or brown), heart, and / or liver, preferably the brain, brown adipose tissue, and / or heart. A heart-specific promoter may preferably be a promoter capable of driving expression of a nucleotide sequence preferentially or predominantly in the heart compared to one or more tissues and / or organs selected from the adipose tissue (white and / or brown), liver, intestine, testis, and / or skeletal muscle. Expression may be assessed as described in the "General Information" section.

[0044] The nucleotide sequence of the promoter according to the invention may be modified compared to the corresponding naturally occurring sequence. Such modified promoters may alternatively be referred to herein as "derivatives" of their naturally occurring (wild type) forms. Suitable non-limiting modifications may be selected from nucleotide insertions, deletions, mutations, and / or substitutions. As discussed elsewhere herein, suitable modifications also include, but are not limited to, fusions of the promoter sequence with other nucleotide sequences, such as enhancers or other promoter sequences. Particularly advantageous are modifications that result in a promoter sequence that is minimized in length compared to the corresponding naturally occurring promoter sequence ("truncated promoter" or "promoter fragment"). A truncated promoter may preferably comprise at least 5%, at least 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28%, 30%, 32%, 34%, 36%, 38%, or 40% of the sequence length of the corresponding naturally occurring promoter sequence.

[0045] In some embodiments, the tissue-specific promoters and / or organ-specific promoters described herein may have a length of less than 1000 nucleotides, less than 900 nucleotides, less than 800 nucleotides, less than 700 nucleotides, or less than 650 nucleotides.

[0046] In some embodiments, the tissue-specific promoters and / or organ-specific promoters described herein can have a length of between 100 nucleotides and 1000 nucleotides, between 200 nucleotides and 900 nucleotides, between 300 nucleotides and 800 nucleotides, between 400 nucleotides and 700 nucleotides, or between 350 nucleotides and 650 nucleotides.

[0047] In preferred embodiments, the lung-specific promoter is an SpB promoter, preferably a truncated version of the human SpB promoter. In some embodiments, preferred lung-specific promoters include at least 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28%, 30%, 32%, 34%, 36%, 38%, or 40% of the sequence length of SEQ ID NO: 11, preferably at least 38% or 40%, more preferably SEQ ID NO: 12, or at least 60%, 61%, 62% thereof. , 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence.

[0048] In some embodiments, a preferred cardiac-specific promoter is the MLC2v promoter, preferably a truncated version of the human MLC2v promoter, more preferably a 296 nucleotide fragment of the human MLC2v promoter. In some embodiments, the 296 nucleotide fragment of the human MLC2v promoter has a sequence of SEQ ID NO: 13, or a sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto.

[0049] In some embodiments, the cardiac-specific promoter is not the 250 nucleotide fragment of the rat MLC2v promoter described in Henderson et al. J Biol Chem 264;30:18142-8, (1989) (incorporated herein by reference in its entirety) and / or the cardiac-specific promoter is not the 281 nucleotide fragment of the rat MLC2v promoter described in Ian Phillips et al. Hypertension 39:651-655, (2002) (incorporated herein by reference in its entirety) (corresponding to nucleotides -264 to +17 of Genebank Accession No. U26708).

[0050] In some embodiments, the preferred cardiac specific promoter is a troponin promoter, preferably a truncated version of the human troponin promoter, more preferably the cardiac specific promoter described in Werfel et al. Cardiovasc Res 104;1:15-23, (2014) (herein incorporated by reference in its entirety), or a sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto.

[0051] Derivatives of promoters according to the invention preferably exhibit at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the transcription initiation ability of the corresponding naturally occurring sequence. Methods for sequence modification and for assessing transcription initiation ability ("promoter strength") are discussed elsewhere herein.

[0052] The promoters discussed herein or derivatives thereof may be present in single or multiple copies in the recombinant viral genome.

[0053] The recombinant viral genome according to the invention may further comprise additional nucleotide sequences operably linked to the nucleotide sequence encoding TERT, such as, but not limited to, a signal sequence, a nuclear localization signal, an expression enhancer, a polyadenylation signal, a Kozak sequence, etc. Said sequences may or may not correspond to native sequences of the cell into which the recombinant viral genome containing said promoter is introduced.

[0054] An "enhancer" is a sequence that can stimulate the transcription of an operably linked sequence. Generally, operably linked DNA sequences are contiguous, and in the case of a signal sequence, contiguous and in common reading frame. However, an enhancer does not have to be contiguous with the coding sequence whose transcription it controls. Linkage is achieved by ligation at a convenient restriction site, or by ligation at an adapter or linker inserted instead, or by gene synthesis. Enhancers may be used as single sequences or may be included in fusion nucleotide sequences with other enhancers and / or any of the tissue-specific and / or organ-specific promoters described herein. Enhancer-promoter fusions may be particularly advantageous in enhancing transcription driving capacity when a promoter derivative that is shortened compared to a naturally occurring promoter is utilized to drive the expression of a nucleotide sequence encoding TERT.

[0055] In some embodiments, a recombinant viral genome of the invention comprises a CMV enhancer (SEQ ID NO: 14). In some embodiments, a recombinant viral genome of the invention comprises a fusion between the CMV enhancer and a truncated version of the MLC2v promoter (hereinafter alternatively referred to as CMVenh-MLC2v promoter). Preferably, the fusion is between the CMV enhancer and a 296 nucleotide fragment of the human MLC2v promoter (SEQ ID NO: 15), as discussed elsewhere herein.

[0056] Thus, in some embodiments, a recombinant viral genome according to the present invention comprises a promoter selected from the group consisting of SpB, CMVenh-MLC2v, troponin promoters, and derivatives thereof, preferably, the promoter is an SpB promoter or a derivative thereof.

[0057] In some embodiments, the cardiac specific promoter, more particularly the troponin promoter, is not a chicken troponin promoter. In some embodiments, the cardiac specific promoter, more particularly the troponin promoter, is not a 411 nucleotide fragment of the chicken troponin promoter described in Prasad et al. Gene Ther 18(1):43-52, (2011), which is incorporated herein by reference in its entirety. In some embodiments, the cardiac specific promoter, more particularly the troponin promoter, is not a chicken troponin promoter described in Prasad et al. Gene Ther 18(1):43-52, (2011), which is incorporated herein by reference in its entirety.

[0058] In some embodiments, the lung-specific promoter comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:11 or SEQ ID NO:12, preferably SEQ ID NO:12.

[0059] In some embodiments, the cardiac specific promoter comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:16, preferably SEQ ID NO:15 or SEQ ID NO:16, more preferably SEQ ID NO:16.

[0060] Thus, in a preferred embodiment, the recombinant viral genome according to the present invention is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109, 109, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 110, 111, 112, 12, 13, 14, 15, 16, preferably SEQ ID NO: 12, SEQ ID NO: 15, or SEQ ID NO: 16, more preferably SEQ ID NO: 12 or SEQ ID NO: 16, most preferably SEQ ID NO: 12. "In some embodiments, the promoter comprises, consists essentially of, or consists of a nucleotide sequence having at least 7%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleic acid sequence of the present invention.

[0061] A Kozak sequence (alternatively referred to herein as a Kozak consensus sequence) is a nucleic acid motif that functions as a protein translation initiation site and can enhance expression of a nucleotide sequence to which it is operably linked. In some embodiments, a recombinant viral genome according to the invention comprises a Kozak consensus sequence operably linked to a nucleotide sequence encoding TERT. Preferably, the Kozak consensus sequence is of human origin. In some embodiments, preferred Kozak consensus sequences comprise, consist essentially of, or consist of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:17.

[0062] A polyadenylation sequence (alternatively referred to herein as a "poly A sequence" or "poly A tail") is a nucleotide sequence consisting of a stretch of multiple adenosine monophosphates that can enhance expression of an operably linked nucleotide sequence by enhancing the nuclear export, translation, and / or stability of an mRNA sequence. In some embodiments, a recombinant viral genome according to the invention comprises a poly A sequence operably linked to a nucleotide sequence encoding TERT. Preferably, the poly A sequence is selected from an SV40 poly A sequence, a rabbit β-globin poly A sequence, or a bovine growth hormone poly A sequence, more preferably a bovine growth hormone poly A sequence. In some embodiments, preferred polyA sequences comprise, consist essentially of, or consist of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:18.

[0063] In some embodiments, the preferred recombinant viral genome comprises a lung specific promoter, preferably an SpB promoter or derivative thereof, more preferably SEQ ID NO:11 or SEQ ID NO:12, preferably SEQ ID NO:12 and at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109%, 11109, 1120 ... , 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to a nucleotide sequence encoding a telomerase reverse transcriptase (TERT) operably linked to a promoter comprising, consisting essentially of, or consisting of a nucleotide sequence having ... having 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to a nucleotide sequence encoding a telomerase reverse transcriptase (TERT) operably linked to a promoter having 86%, 87%, 88%, 89%, 90%, 91%, In some embodiments, such a recombinant viral genome comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:21, or a sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0064] In some embodiments, the preferred recombinant viral genome comprises a cardiac specific promoter, preferably a CMVenh-MLC2v promoter or derivative thereof, more preferably a CMVenh-MLC2v promoter or derivative thereof, and ... A recombinant AAV genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a promoter comprising, consisting essentially of, or consisting of a nucleotide sequence having 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to a nucleotide sequence encoding a telomerase reverse transcriptase (TERT), wherein the total length of the viral genome is less than 4700 nucleotides. Optionally, the genetic construct further comprises 5' and 3' inverted terminal repeats (ITRs) derived from the genome of an AAV, preferably an AAV2. In some embodiments, such a recombinant viral genome comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:22, or a sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0065] In some embodiments, the preferred recombinant viral genome comprises a cardiac specific promoter, preferably a troponin promoter or derivative thereof, more preferably a troponin promoter or derivative thereof, and ... , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a promoter comprising, consisting essentially of, or consisting of a nucleotide sequence having a sequence identity of at least 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, wherein the total length of the viral genome is less than 4700 nucleotides. Optionally, the genetic construct further comprises 5' and 3' inverted terminal repeats (ITRs) derived from an AAV, preferably an AAV2 genome. In some embodiments, such a recombinant viral genome comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:23, or a sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0066] The tissue-specific promoters and / or organ-specific promoters described herein are useful for tissue-specific gene expression and / or organ-specific gene expression. Thus, in a further aspect, a tissue-specific promoter and / or organ-specific promoter as described herein is provided. In some embodiments, the tissue-specific promoter and / or organ-specific promoter is a lung-specific promoter, preferably an SpB promoter or a derivative thereof as described herein, more preferably an SpB promoter as described herein, even more preferably a truncated version of the human SpB promoter as described herein. In some embodiments, a preferred lung-specific promoter comprises at least 5%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28%, 30%, 32%, 34%, 36%, 38%, or 40% of the sequence length of SEQ ID NO: 11, preferably at least 38% or 40%, more preferably SEQ ID NO: 12. In some embodiments, the tissue-specific promoter and / or organ-specific promoter is a cardiac-specific promoter, preferably the MLC2v promoter described herein or a derivative thereof, more preferably the MLC2v promoter described herein, even more preferably a truncated version of the human MLC2v promoter described herein. In some embodiments, the cardiac-specific promoter comprises SEQ ID NO: 13. In some embodiments, the cardiac-specific promoter comprises SEQ ID NO: 15.

[0067] For any sequence described herein, in some embodiments, the level of sequence identity or sequence similarity used herein is preferably 70%. Another preferred level of sequence identity or sequence similarity is 80%. Another preferred level of sequence identity or sequence similarity is 90%. Another preferred level of sequence identity or sequence similarity is 95%. Another preferred level of sequence identity or sequence similarity is 99%.

[0068] Expression vector The recombinant viral genomes described herein can be placed into an expression vector. Thus, in a further aspect, there is provided an expression vector comprising a recombinant viral genome as described herein.

[0069] A description of "expression vectors" is provided in the section entitled "General Information." The term "expression vector" is understood by those skilled in the art to include non-viral and viral vectors. Suitable expression vectors can be selected from any genetic element capable of facilitating the transfer of genes or nucleic acids between cells, such as, but not limited to, plasmids, phages, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like. Suitable expression vectors can also be chemical vectors, such as lipid complexes or naked DNA. "Naked DNA" or "naked nucleic acid" refers to a nucleic acid molecule that is not housed within a viral particle, bacterial cell, or other encapsulation means that facilitates delivery of the nucleic acid to the cytoplasm of a target cell. Optionally, the naked nucleic acid can be associated with standard means used in the art to facilitate delivery of the nucleic acid to a target cell, for example, to facilitate transport of the nucleic acid through the digestive tract, to protect the nucleic acid from stomach acid and / or nucleases, and / or to aid in penetration of intestinal mucus.

[0070] In a preferred embodiment, the expression vector is a viral expression vector. A description of "viral expression vectors" is provided in the section entitled "General Information." The viral vector may be a viral vector selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, and a lentiviral vector.

[0071] In a preferred embodiment, the expression vector comprising the recombinant viral genome, preferably the recombinant AAV genome, described herein is an adeno-associated viral vector. The adeno-associated viral vector may alternatively be referred to herein as an adeno-associated vector or an adeno-associated virus-derived vector or an AAV vector. A description of "adeno-associated viral vector" is provided in the section entitled "General Information". The vector typically has a nucleotide sequence of approximately 4700 nucleotides (4.7 kb) capable of encapsidation. As demonstrated in the Examples, the inventors have surprisingly found that the recombinant viral genome of the present invention exhibits significant and unexpected advantages when utilizing an AAV vector as an expression vector, since the formation of intermediate species containing defective viral genomes is prevented, increasing the therapeutic efficacy of the vector. Preferred AAV vectors include AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype rh10 (AAVrh10), AAV serotype rh8 (AAVrh8), AAV serotype Cb4 (AAVCb4), AAV serotype rh74 (AAVrh74), AAV serotype D (AAVD), AAV serotype E (AAVE), AAV serotype F (AAVF ... It may be selected from the group consisting of AAV J (AAVDJ), AAV serotype 2 / 5 (AAV2 / 5), AAV serotype 2 / 1 (AAV2 / 1), AAV serotype 1 / 2 (AAV1 / 2), and AAV Anc80 (AAVAnc80), and is preferably selected from the group consisting of AAV serotype 6, serotype 8, or serotype 9 (AAV6, AAV8, or AAV9), more preferably AAV serotype 6 (AAV6) or AAV serotype 9 (AAV9), and even more preferably AAV serotype 9 (AAV9).

[0072] In some embodiments, the preferred expression vector is AAV6 or AAV9, preferably AAV9, and comprises a recombinant AAV genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a lung-specific promoter, wherein the total length of the viral genome is less than 4700 nucleotides as previously described herein. Optionally, the recombinant AAV genome further comprises 5' and 3' inverted terminal repeats (ITRs) derived from the genome of an AAV, preferably AAV2. The expression vector preferably comprises a nucleotide sequence encoding TERT that comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9.

[0073] In some embodiments, the preferred expression vector is AAV6 or AAV9 and comprises a recombinant AAV viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to an SpB promoter or a derivative thereof, wherein the total length of the viral genome is less than 4700 nucleotides as previously described herein. Preferably, the promoter sequence comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:11 or SEQ ID NO:12, preferably SEQ ID NO:12. Optionally, the recombinant AAV viral genome further comprises 5' and 3' inverted terminal repeats (ITRs) derived from the genome of an AAV, preferably AAV2. The expression vector preferably comprises a nucleotide sequence encoding TERT that comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9.

[0074] In some embodiments, the preferred expression vector is AAV6 or AAV9, preferably AAV9, and comprises a recombinant AAV viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a cardiac-specific promoter, wherein the total length of the viral genome is less than 4700 nucleotides as previously described herein. Optionally, the recombinant AAV viral genome further comprises 5' and 3' inverted terminal repeats (ITRs) derived from the genome of an AAV, preferably AAV2. The expression vector preferably comprises a nucleotide sequence encoding TERT that comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9.

[0075] In some embodiments, the preferred expression vector is AAV6 or AAV9 and comprises a recombinant AAV viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to an MLC2v promoter or a derivative thereof, wherein the total length of the viral genome is less than 4700 nucleotides as described herein above. Preferably, the promoter sequence comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:13 or SEQ ID NO:15, preferably SEQ ID NO:15. Optionally, the recombinant AAV viral genome further comprises 5' and 3' inverted terminal repeats (ITRs) derived from the genome of an AAV, preferably AAV2. The expression vector preferably comprises a nucleotide sequence encoding TERT that comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9.

[0076] In some embodiments, the preferred expression vector is AAV6 or AAV9 and comprises a recombinant AAV viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a troponin promoter or a derivative thereof, wherein the total length of the viral genome is less than 4700 nucleotides as previously described herein. Preferably, the promoter sequence comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 16. Optionally, the recombinant AAV viral genome further comprises 5' and 3' inverted terminal repeats (ITRs) derived from the genome of an AAV, preferably AAV2. The expression vector preferably comprises a nucleotide sequence encoding TERT that comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:9, preferably any one of SEQ ID NO:3, SEQ ID NO:6, or SEQ ID NO:9, more preferably SEQ ID NO:6 or SEQ ID NO:9.

[0077] The generation of recombinant AAV vectors (also called "rAAV") vectorizing nucleotide sequences has been previously described, see Ayuso E, et al., Curr. Gene Ther. 2010; 10:423-436; Okada T, et al., Hum. Gene Ther. 2009; 20:1013-1021; Zhang H, et al., Hum. Gene Ther. 2009; 20:922-929; and Virag T, et al., Hum. Gene Ther. 2009; 20:807-817, all of which are incorporated herein by reference in their entirety. These protocols can be used or adapted to generate AAV vectors according to the present invention. Thus, in another aspect, a method for generating the adeno-associated virus vectors described herein is provided.

[0078] Briefly, the method generally involves (a) introducing into a cell a recombinant AAV genome comprising a nucleotide sequence to be expressed, (b) the presence or introduction of an AAV helper construct in the cell, where the helper construct comprises the viral functions missing from the recombinant AAV genome, and, optionally, (c) introducing into the host cell a helper virus and / or a helper virus plasmid. To achieve AAV vector replication and packaging of the genome into the AAV vector, all components for AAV vector replication and packaging must be present. These components typically include the AAV cap protein, the AAV rep protein, and, optionally, viral proteins on which AAV depends for replication. The rep and cap regions are known in the art, see for example Chiorini et al. (1999, J. of Virology, Vol 73(2): 1309-1319, incorporated herein by reference in its entirety, or U.S. Pat. No. 5,139,941, incorporated herein by reference in its entirety. The AAV cap and rep proteins may be derived from the same AAV serotype or from a combination of different serotypes, preferably they are derived from AAV6 or AAV9 serotypes. The viral proteins on which AAV depends for replication may be derived from any virus, such as herpes simplex virus (such as HSV types 1 and 2), vaccinia virus, adeno-associated virus, or adenovirus, preferably adenovirus.

[0079] In some embodiments, the producer cell line is transiently transfected with a recombinant AAV genome according to the invention (comprising a TERT expression cassette flanked by ITRs) and a construct(s) encoding rep and cap proteins and providing helper functions (helper construct(s)). In some embodiments, the cell line stably provides helper functions and is transiently transfected with a recombinant AAV genome according to the invention (comprising a TERT expression cassette flanked by ITRs) and a construct(s) encoding rep and cap proteins. In some embodiments, the cell line stably provides rep and cap proteins and is transiently transfected with a recombinant AAV genome according to the invention that stably provides rep and cap proteins and helper functions. In other embodiments, the cell line stably provides rep and cap proteins and is transiently transfected with a recombinant AAV viral genome according to the invention and a polynucleotide encoding helper functions. In some embodiments, the cell line stably provides the recombinant AAV genome, rep and cap proteins, and helper functions according to the invention. Methods for making and using these and other AAV production systems have been described in the art.No. 5,139,941 to Muzyczka N et al., U.S. Pat. No. 5,741,683 to Zhou X et al., U.S. Pat. No. 6,057,152 to Samulski R et al., U.S. Pat. No. 6,204,059 to Samulski R et al., U.S. Pat. No. 6,268,213 to Samulski R et al., U.S. Pat. No. 6,491,907 to Rabinowitz J et al., U.S. Pat. No. 6,660,514 to Zolotukhin S et al., U.S. Pat. No. 6,951,753 to Shenk T et al., U.S. Pat. No. 7,094,604 to Snyder R et al., U.S. Pat. No. 7,172,893 to Rabinowitz J et al., U.S. Pat. No. 7,201,898 to Monahan P et al., U.S. Pat. No. 7,229,823 to Samulski R et al., and Ferrari See US Pat. No. 7,439,065 to F et al., both of which are incorporated herein by reference in their entireties.

[0080] The recombinant AAV (rAAV) genome present in the rAAV vector typically comprises at least the nucleotide sequence of the inverted terminal repeat region (ITR) of an AAV serotype genome (preferably the genome of serotype AAV2 disclosed herein), or a nucleotide sequence substantially identical thereto, or having at least 60%, 70%, 80%, 90%, 95%, or 99% identity thereto, and a nucleotide sequence encoding TERT operably linked to a tissue-specific promoter and / or organ-specific promoter described herein, inserted between the two ITRs. The vector genome generally requires the use of flanking 5'ITR and 3'ITR sequences to enable efficient packaging of the vector genome into the rAAV capsid. The ITR sequences do not necessarily have to be from the same AAV serotype as the rAAV vector.

[0081] The complete genome and corresponding ITRs of several AAV serotypes have been sequenced (Chiorini et al. 1999, J. of Virology Vol. 73, No.2, p1309-1319, which is incorporated herein by reference in its entirety). They can be cloned or produced by chemical synthesis known in the art, for example using an oligonucleotide synthesizer provided by Applied Biosystems Inc. (Fosters, CA, USA), or by standard molecular biology techniques. The ITRs can be cloned from the AAV genome or excised from a vector containing the ITRs of AAV. The ITR nucleotide sequences can be ligated to either end of the nucleotide sequence encoding TERT operably linked to a tissue-specific and / or organ-specific promoter described herein using standard molecular biology techniques, or alternatively, the AAV sequences between the ITRs can be replaced with the desired nucleotide sequence.

[0082] Preferably, the rAAV genome present in the rAAV vector does not contain any nucleotide sequences encoding viral proteins, such as the AAV rep (replication) or capsid genes, and may further include marker or reporter genes, such as, for example, antibiotic resistance genes known in the art, genes encoding fluorescent proteins (e.g., GFP), or genes encoding chemically, enzymatically, or otherwise detectable and / or selectable products (e.g., lacZ, aph, etc.).

[0083] Introduction into the production cells can be achieved using standard virological techniques such as transformation, transduction, and transfection. Most vectors do not replicate in the production cells that they infect. Examples of possible combinations of cell lines and expression vectors are described in Sambrook and Green (see above), and Metzger et al (1988) Nature 334: 31-36, which are incorporated herein by reference in their entirety. For example, suitable expression vectors can be expressed in yeast, such as S. cerevisiae, insect cells, such as Sf9 cells, mammalian cells, such as CHO cells, and bacterial cells, such as E. coli. Thus, the cells can be prokaryotic or eukaryotic production cells. The cells can be cells suitable for culture in liquid medium or on solid medium. Finally, the producer cells are cultured under standard conditions known in the art to generate assembled AAV vectors, which are then purified using standard techniques such as polyethylene glycol precipitation or CsCl gradients (Xiao et al. 1996, J. Virol. 70: 8098-8108, incorporated herein by reference in its entirety). Residual helper virus activity can be inactivated using known methods, such as, for example, heat inactivation.

[0084] The recombinant viral genomes and expression vectors described herein can then be introduced into host cells using standard molecular techniques, as discussed in standard handbooks such as Current Protocols in Molecular Biology (Ausubel et al., supra) and Sambrook and Green (supra). In the case of viral vectors, it is preferred to use transduction. The transduced host cell may or may not contain the protein shell of the viral vector. "Host cell" or "target cell" (alternatively referred to as "cell" or "engineered cell") refers to the cell into which DNA delivery is to be made, such as a lung cell or a cardiac cell of a mammalian subject, as described elsewhere herein. In particular, AAV vectors can transduce both dividing and non-dividing cells.

[0085] Thus, the present invention further provides a host cell transduced with any of the recombinant viral genomes or expression vectors described herein. In some embodiments, the host cell transduced with any of the recombinant viral genomes or expression vectors described herein is a lung cell, such as a vertebrate lung cell, preferably a mammalian lung cell, more preferably a mammalian alveolar type II epithelial cell (ATII cell). In some embodiments, the host cell transduced with any of the recombinant viral genomes or expression vectors described herein is a rat, mouse, dog, or human, preferably a mouse or human, more preferably a human lung cell, preferably an alveolar type II epithelial cell (ATII cell). In some embodiments, the host cell transduced with any of the recombinant viral genomes or expression vectors described herein is a cardiac (heart) cell, such as a vertebrate cardiac cell, preferably a mammalian cardiac cell, more preferably a mammalian cardiomyocyte. In some embodiments, the host cell transduced with any of the recombinant viral genomes or expression vectors described herein is a rat, mouse, dog, or human, preferably a mouse or human, more preferably a human cardiac cell, preferably a cardiomyocyte.

[0086] The provided host cells do not necessarily have to be present in an individual. It is understood by those skilled in the art that the introduction of the recombinant viral genome and expression vector described herein can be performed in cell culture. In some embodiments, the provided host cells are present in an artificial organ, preferably an artificial lung or an artificial heart. In some embodiments, the provided host cells are present in an organoid, preferably a lung organoid or a heart organoid. An "organoid" as defined herein is a miniature and simplified version of an in vitro three-dimensionally generated organ that exhibits realistic microanatomy. Those skilled in the art can use the host cells of the present invention to arrive at such artificial organs and / or organoids by applying procedures generally known in the art. The transduced host cells present in the artificial organs and / or organoids can be transplanted into a vertebrate, preferably a mammal, more preferably a mouse, rat, dog, or human, more preferably a mouse or human, most preferably a human, using procedures generally known in the art.

[0087] composition In a further aspect, a composition is provided comprising a recombinant viral genome as described herein and / or an expression vector as described herein, preferably an adeno-associated viral vector, and optionally further comprising one or more pharma- ceutically acceptable components. Such compositions may be referred to as gene therapy compositions. Preferably, the composition is a pharmaceutical composition. A composition, such as a pharmaceutical composition, may be formulated to suit a particular mode of administration. Suitable modes of administration are described elsewhere herein. The methods of formulation as well as the types of formulations that are most suitable for the compositions described herein as being suitable for a particular mode of administration are well within the skill of the art and are described in standard handbooks such as Remington: The Science and Practice of Pharmacy, 23rd edition, Elsevier (2020), which are incorporated herein by reference in their entirety.

[0088] As used herein, "a pharma- ceutically acceptable ingredient" includes a pharma- ceutically acceptable carrier, filler, stabilizer, preservative, solubilizer, vehicle, diluent, and / or additive. Thus, one or more pharma- ceutically acceptable ingredients may be selected from the group consisting of a pharma- ceutically acceptable carrier, filler, stabilizer, preservative, solubilizer, vehicle, diluent, and / or additive. Such pharma- ceutically acceptable carriers, fillers, stabilizers, preservatives, solubilizers, vehicles, diluents, and / or additives can be found, for example, in Remington: The Science and Practice of Pharmacy (see above).

[0089] Additional compounds may be present in the compositions of the present invention. The compounds may be useful for the delivery of the compositions. Examples of suitable compounds in this context are compounds capable of forming complexes, nanoparticles, micelles, and / or liposomes that deliver the components described herein complexed or entrapped in vesicles or liposomes through cell membranes. Many of these compounds are known in the art. Suitable compounds may include polyethyleneimine (PEI) or similar cationic polymers including polypropyleneimine or polyethyleneimine copolymers (PEC) and derivatives, synthetic amphiphiles (SAINT-18), Lipofectin™, DOTAP. Additional examples of suitable compounds are inert carriers (e.g., calcium carbonate and sugars such as sucrose, mannitol, lactose, or dextrose), solvents (e.g., water, saline, etc.), and propellant gases (e.g., chlorofluorocarbons (CFCs), fluorocarbons (FCs), or hydrofluoroalkanes (HFAs), etc.).

[0090] In some embodiments, the compositions, preferably pharmaceutical compositions, are formulated to be suitable for a particular mode of administration, such as, but not limited to, intranasal, intratracheal, intrapulmonary, or via inhalation, of the recombinant viral genomes described herein and / or expression vectors, preferably adeno-associated viral vectors, described herein. Non-limiting examples of exemplary formulations are aerosols, solutions, and / or suspensions of particles in a carrier suitable for delivery to the airways and / or lungs, and dry powders.

[0091] In some embodiments, the composition, preferably the pharmaceutical composition, is contained within a delivery device. In some embodiments, the composition, preferably the pharmaceutical composition, is contained within a delivery device (inhalation device) suitable for delivery via inhalation. Such devices are generally known in the art and many are commercially available, including inhalers (e.g., fixed dose inhalers, metered dose inhalers, dry powder inhalers, etc.) and nebulizers (e.g., jet nebulizers, ultrasonic nebulizers, mesh nebulizers, etc.). Nebulizers typically operate by generating aerosol particles. Exemplary nebulizers for delivery of the aerosolized compositions described herein include AERx™ (Aradigm), Ultravent™ (Mallinkrodt), Pari LC Plus™ or Pari LC Star™ (Pari GmbH, Germany), DeVilbiss Pulmo-Aide, and Acorn II™ (Marquest Medical Products).

[0092] Methods and Uses Also provided herein are the recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and compositions described herein for use in therapy. In some embodiments, the recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and compositions described herein are used as medicaments.

[0093] The recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and compositions described herein are particularly effective in treating and / or preventing conditions associated with shortened telomere length. A definition of "shortened telomere length" is provided in the section entitled "General Information." Thus, in a further aspect, the recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and / or compositions described herein are provided for use in treating and / or preventing conditions associated with shortened telomere length. In some embodiments, the recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and / or compositions described herein are provided for use in treating and / or preventing pulmonary conditions associated with shortened telomere length. Non-limiting examples of such conditions are pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), emphysema syndrome, and conditions associated therewith. In some embodiments, the recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and / or compositions described herein are provided for use in the treatment and / or prevention of cardiac conditions associated with shortened telomere length. Non-limiting examples of such conditions are coronary artery disease, peripheral artery disease, myocardial infarction, and conditions related thereto. In preferred embodiments, the recombinant viral genomes, expression vectors (preferably adeno-associated viral vectors), and / or compositions described herein are provided for use in the treatment and / or prevention of pulmonary fibrosis, myocardial infarction, or conditions related thereto.

[0094] Pulmonary fibrosis refers to a condition characterized by scarring of lung tissue. Pulmonary fibrosis can be caused by many factors, including, but not limited to, telomere shortening of lung cells, chronic inflammatory processes, infections, environmental compounds, ionizing radiation (e.g., radiation therapy to treat tumors in the chest), genetic predisposition, or chronic medical conditions (lupus, rheumatoid arthritis, etc.). Pulmonary fibrosis includes idiopathic pulmonary fibrosis (IPF), which refers to pulmonary fibrosis without an identifiable cause. Symptoms of pulmonary fibrosis include, but are not limited to, lung scarring, development of fibrotic volumes, loss of lung volume, shortness of breath, dry cough, fatigue, weight loss, and clubbing. Conditions associated with pulmonary fibrosis include, but are not limited to, pulmonary hypertension, respiratory failure, pneumothorax, and lung cancer. In some embodiments, the pulmonary fibrosis can be idiopathic pulmonary fibrosis (IPF).

[0095] Myocardial infarction refers to a condition characterized by tissue death (infarction) of the heart muscle (myocardium). Myocardial infarction can be caused by many factors, including but not limited to, telomere shortening of cardiac cells, atherosclerosis, high blood pressure (hypertension), hypercholesterolemia, diabetes, coronary heart disease, smoking, obesity, physical inactivity, environmental compounds, infections, genetic predisposition, or chronic inflammation and other conditions. Symptoms of myocardial infarction include but are not limited to cardiac scarring, heart failure, arrhythmia, fatigue, cardiac pain, cardiogenic shock, or cardiac arrest. Conditions associated with myocardial infarction include but are not limited to myocardial infarction events (heart attacks), tissue damage (including loss of cardiomyocytes) resulting from myocardial infarction, fibrosis of the myocardium resulting from myocardial infarction, and reduced cardiac function resulting from myocardial infarction.

[0096] In some embodiments, a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a lung-specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector is provided for use in the treatment and / or prevention of a lung condition associated with shortened telomere length, preferably pulmonary fibrosis or a condition associated therewith. Preferably, the lung-specific promoter is the SpB promoter or a derivative thereof as described herein.

[0097] In some embodiments, a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a cardiac specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector is provided for use in the treatment and / or prevention of a cardiac condition associated with shortening of telomere length, preferably myocardial infarction or a condition associated therewith. Preferably, the cardiac specific promoter is the CMVenh-MLC2v promoter, a troponin promoter or a derivative thereof as described herein, preferably a troponin promoter or a derivative thereof.

[0098] In a further aspect, there is provided a method of treating and / or preventing a condition associated with shortened telomere length, comprising administering to a subject, such as a subject in need thereof, a therapeutically effective amount of a recombinant viral genome, expression vector (preferably an adeno-associated viral vector), and / or composition described herein. In some embodiments, the condition associated with shortened telomere length is a pulmonary condition, preferably pulmonary fibrosis or a condition associated therewith. In some embodiments, the condition associated with shortened telomere length is a cardiac condition, preferably myocardial infarction or a condition associated therewith.

[0099] In some embodiments, there is provided a method of treating and / or preventing a lung condition associated with shortened telomere length, preferably pulmonary fibrosis or a condition associated therewith, comprising administering to a subject, such as a subject in need thereof, a therapeutically effective amount of a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a lung-specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector. Preferably, the lung-specific promoter is the SpB promoter or a derivative thereof as described herein.

[0100] In some embodiments, there is provided a method of treating and / or preventing a cardiac condition associated with shortened telomere length, preferably a myocardial infarction or a condition associated therewith, comprising administering to a subject, such as a subject in need thereof, a therapeutically effective amount of a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a cardiac specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector. Preferably, the cardiac specific promoter is the CMVenh-MLC2v promoter, a troponin promoter, or a derivative thereof as described herein, preferably a troponin promoter or a derivative thereof.

[0101] As used herein, an "effective amount" is an amount sufficient to exert a beneficial or desired result. Thus, a "therapeutically effective amount" is an amount sufficient to exert any therapeutic effect described herein, such as, but not limited to, reducing the intensity of at least one symptom of and / or improving at least one parameter of a condition associated with shortened telomere length, preferably pulmonary fibrosis, myocardial infarction, or a condition associated therewith, as described elsewhere herein, when administered to a subject in need thereof. A "therapeutically effective" amount will vary from subject to subject, depending on the individual's age, disease progression, and overall general condition. The appropriate "therapeutically effective" amount in any individual case can also be determined by one of skill in the art using routine experimentation, such as the methods described herein below and / or the methods in the experimental part of this specification. A "subject in need" can be any individual suffering from and / or at risk of developing a condition associated with shortened telomere length.

[0102] In a further aspect, there is provided a use of a recombinant viral genome, expression vector (preferably an adeno-associated viral vector), or composition as described herein for the manufacture of a medicament for treating and / or preventing a condition associated with shortened telomere length. In some embodiments, the condition associated with shortened telomere length is a pulmonary condition, preferably pulmonary fibrosis or a condition associated therewith. In some embodiments, the condition associated with shortened telomere length is a cardiac condition, preferably myocardial infarction or a condition associated therewith.

[0103] In some embodiments, there is provided a use of a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a lung-specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector, for the manufacture of a medicament for treating and / or preventing a lung condition associated with shortened telomere length, preferably pulmonary fibrosis or a condition associated therewith. Preferably, the lung-specific promoter is the SpB promoter or a derivative thereof as described herein.

[0104] In some embodiments, there is provided a use of a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a cardiac specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector, for the manufacture of a medicament for treating and / or preventing a cardiac condition associated with shortened telomere length, preferably myocardial infarction or a condition associated therewith. Preferably, the cardiac specific promoter is the CMVenh-MLC2v promoter, a troponin promoter or a derivative thereof as described herein, preferably a troponin promoter or a derivative thereof.

[0105] In a further aspect, there is provided a use of a recombinant viral genome, expression vector, preferably an adeno-associated viral vector, or composition as described herein for treating and / or preventing a condition associated with shortened telomere length. In some embodiments, the condition associated with shortened telomere length is a pulmonary condition, preferably pulmonary fibrosis or a condition associated therewith. In some embodiments, the condition associated with shortened telomere length is a cardiac condition, preferably myocardial infarction or a condition associated therewith.

[0106] In some embodiments, there is provided a use of a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a lung-specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector, for treating and / or preventing a lung condition associated with shortened telomere length, preferably pulmonary fibrosis or a condition associated therewith. Preferably, the lung-specific promoter is the SpB promoter or a derivative thereof as described herein.

[0107] In some embodiments, there is provided a use of a recombinant viral genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a cardiac specific promoter as described herein, an expression vector (preferably an adeno-associated viral vector) comprising said genome, and / or a composition comprising said genome and / or vector, for treating and / or preventing a cardiac condition associated with shortened telomere length, preferably myocardial infarction or a condition associated therewith. Preferably, the cardiac specific promoter is the CMVenh-MLC2v promoter, a troponin promoter or a derivative thereof as described herein, preferably a troponin promoter or a derivative thereof.

[0108] Within the context of the recombinant viral genome used, the expression vector used (preferably adeno-associated viral vector), the composition used, the method and the use according to the invention, the therapy and / or medicine may include expression, preferably specific expression, of TERT in the lung. Within the context of the recombinant viral genome used, the expression vector used (preferably adeno-associated viral vector), the composition used, the method and the use according to the invention, the therapy and / or medicine may include expression, preferably specific expression, of TERT in the heart. A description of the expression is given in the section entitled "General Information". In some embodiments, the expression of TERT does not include expression in at least one, at least two, at least three, at least four organs selected from the group consisting of liver, CNS, brain, adipose tissue (white and / or brown), skeletal muscle, heart, kidney, colon, hematopoietic tissue, lung, ovary, spleen, stomach, pancreas, testis, epididymis, intestine, etc.

[0109] In preferred embodiments, the administration of the treatment or therapy or use or medicament described herein does not need to be repeated. In some embodiments, the administration of the treatment or therapy or use or medicament described herein can be repeated every year, or every 2, 3, 4, 5, 6, 7, 8, 9, or 10 years (including the intervals between any two of the listed values).

[0110] The subject to be treated may be a vertebrate, preferably a mammal such as a cat, mouse, rat, dog, or human. In a preferred embodiment, the subject to be treated is a human. The application of the treatment may be performed on an individual, a cell, a tissue, and / or an organ of the individual suffering from and / or at risk of developing a pathology associated with shortening of telomere length, preferably pulmonary fibrosis, myocardial infarction, or a pathology associated therewith. The application of the treatment may be performed directly or indirectly in vivo, ex vivo, or in vitro using suitable means known in the art. Improvements in the means of providing the recombinant viral genome and / or expression vector (preferably adeno-associated viral vector) and / or composition of the present invention to an individual or a cell, tissue, and / or organ of said individual are expected in view of the progress already achieved so far. Of course, such future improvements may be realized in achieving the above-mentioned effects of the present invention. Depending on the disease or pathology, the cell, tissue, and / or organ of said individual may be as described hereinbefore. When administering recombinant viral genomes and / or expression vectors, preferably adeno-associated viral vectors, and / or compositions of the invention, it is preferred to dissolve such genetic constructs and / or expression vectors and / or compositions in a solution compatible with the delivery method. Such solutions are generally known in the art, see, for example, Remington: The Science and Practice of Pharmacy (see above).

[0111] The application of the treatment can be carried out using various modes of administration generally known in the art. The modes of administration can be intravenous, intranasal, intramuscular, intraperitoneal, via inhalation, intraparenchymal, subcutaneous, intraarticular, intraadipose tissue, oral, intrahepatic, intravisceral, intraaural, intrathoracic, intrapulmonary, intracardiac, transendocardial, or intratracheal. Preferred modes of administration for lung-specific expression are via inhalation, intranasal, intratracheal, intrapulmonary, and intravenous. "Intratracheal administration" or "intratracheal injection" refers to direct administration into the trachea. "Intravenous administration" refers to direct administration into a vein, typically by injection. Preferred modes of administration for cardiac-specific administration are intracardiac, transendocardial, or intravenous. "Intracardiac administration" refers to direct administration into the cardiac muscle or ventricles. "Transendocardial administration" refers to direct administration into the endocardium.

[0112] In some embodiments, administration of a treatment or therapy or use or therapeutic medicament described herein exhibits at least one, at least two, at least three, or all of the following benefits over known treatments, therapies, uses, or administration of therapeutic medicaments: Increased TERT expression in target tissues, Decreased TERT expression in off-target tissues, Preventing the formation of intermediate species containing defective viral genomes associated with the use of viral vectors with reduced encapsidation ability; Improved treatment effectiveness.

[0113] In some embodiments, the treatment or therapy or use or administration of a therapeutic medicament described herein mitigates, eliminates, prevents, and / or reverses telomere shortening.

[0114] "Shortened telomere" or "short telomere" generally refers to telomere that is below a certain length, for example, 8 kb, 7 kb, 6 kb, 5 kb, or shorter. It is understood by those skilled in the art that telomere length depends not only on whether an individual is healthy, but also on the age of the individual. Typically, shortened telomere has a length below the 20th or 10th percentile of the telomere length of a population of healthy individuals belonging to a certain age group, which indicates a telomere length below which 20% or 10% of the telomeres are. Conversely, long telomere typically has a length above the 80th or 90th percentile of the telomere length of a population of healthy individuals belonging to a certain age group. Telomere length can be evaluated in samples taken directly from the treated individual or samples taken from cells, tissues, and / or organs of the treated individual according to methods generally known in the art. For example, standard hybridization techniques such as fluorescent in situ hybridization (FISH), quantitative fluorescent in situ hybridization (Q-FISH), or high-throughput quantitative fluorescent in situ hybridization (HT Q-FISH) can be used as described in Gonzalez-Suarez et al. (2001) EMBO J 20(11): 2619-30, which is incorporated herein by reference in its entirety. Alternatively, telomere length can be measured as described in any one of U.S. Pat. No. 6,233,623, Canela et al. (2007) Methods Mol Biol 371: 45-72, or Baer et al. (2018) Nat Comm 5: 5863, which are incorporated herein by reference in their entirety. Telomere length can also be estimated by monitoring the worsening or improvement of symptoms and / or parameters of pathologies associated with shortened telomere length discussed elsewhere herein using procedures standard in the art, for example as shown in the Examples section herein.

[0115] Samples can be taken throughout the treatment period so that both absolute telomere length and the rate of telomere lengthening or shortening over the treatment period can be determined. Samples can be taken daily during the treatment period or at longer intervals. In some embodiments, samples are taken once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, or at longer intervals. Comparison of telomere length can be performed by comparing the percentage of shortened telomeres in the collected samples. The percentage of shortened telomeres can be assessed by measuring the percentage of telomeres that exhibit an intensity lower than the average intensity of the sample as measured by an in situ hybridization technique such as FISH or Q-FISH. In some embodiments, the percentage of shortened telomeres is the percentage of telomeres that exhibit an intensity lower than 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, or lower compared to the average intensity of the sample. In some embodiments, the percentage of shortened telomeres in a sample taken directly from the treated individual or from the cells, tissues, and / or organs of the treated individual is reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70% or more compared to a control sample. The control sample may be taken from the treated individual before treatment begins or from the cells, tissues, and / or organs of the treated individual and / or from an untreated individual suffering from the same condition or from the cells, tissues, and / or organs of an untreated individual suffering from the same condition.

[0116] In some embodiments, the treatment or therapy or use or administration of a medicament to treat pulmonary fibrosis or a condition associated therewith alleviates, eliminates and / or prevents symptoms and / or improves parameters associated therewith selected from the group consisting of lung scarring, development of fibrotic volume, loss of lung volume, shortness of breath, dry cough, fatigue, weight loss, and clubbing, preferably development of fibrotic volume and / or loss of lung volume.

[0117] In some embodiments, the treatment or therapy or use or administration of a medicament to treat myocardial infarction or a condition related thereto alleviates, eliminates and / or prevents symptoms and / or improves parameters associated therewith selected from the group consisting of cardiac scarring, heart failure, arrhythmia, fatigue, cardiac pain, cardiogenic shock, or cardiac arrest, preferably cardiac scarring.

[0118] Alleviation of symptoms of the pathologies discussed herein may mean that the symptoms are improved or alleviated, or the progression of typical symptoms is slowed down, in an individual, in the cells, tissues, or organs of the individual, as assessed by a physician. Alleviation or improvement of typical symptoms may mean the slowing down of the progression of symptoms or the complete disappearance of symptoms. Symptoms, and therefore alleviation of symptoms, can also be evaluated using a variety of methods, mostly the same methods used in the diagnosis of the relevant pathology, including clinical examinations and routine laboratory tests. Laboratory tests can include both macroscopic and microscopic methods, molecular methods, radiographic methods such as X-rays, CT scans, spirometry, biochemical methods, immunohistochemical methods, and the like. In this context, "alleviation" (or "improvement") means at least detectable alleviation (or detectable improvement) using assays known to those skilled in the art, such as the assays performed in the experimental part. The reduction can be at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% reduction. The reduction can be seen at least one week, one month, six months, one year, or more after treatment with a recombinant viral genome and / or expression vector (preferably an adeno-associated viral vector) and / or composition of the invention. Preferably, the reduction is observed after a single dose. In some embodiments, the reduction is preferably observed over a period of at least one week, one month, six months, one year, two years, three years, four years, five years, six years, seven years, eight years, nine years, ten years, twelve years, fifteen years, twenty years, or longer after a single dose.

[0119] An improvement in a parameter may mean that in an individual, in the cells, tissues or organs of said individual, the value of a typical parameter associated with the relevant disease (e.g. lung volume in the case of pulmonary fibrosis) is improved as assessed by a physician. In this context, an improvement in a parameter may be interpreted as meaning that said parameter takes on a value closer to that exhibited by a healthy individual. The improvement in a parameter may be seen at least one week, one month, six months, one year or more after treatment with a recombinant viral vector and / or expression vector, preferably an adeno-associated viral vector and / or composition of the invention. Preferably, the improvement is observed after a single dose. In some embodiments, the improvement is preferably observed over a period of at least one week, one month, six months, one year, two years, three years, four years, five years, six years, seven years, eight years, nine years, ten years, twelve years, fifteen years, twenty years or more after a single dose.

[0120] In some embodiments, the administration of a treatment or therapy or use or therapeutic medicament described herein results in an increase in the overall physical fitness of the treated individual compared to the same individual before treatment began or to an untreated individual suffering from the same condition. Overall physical fitness can be determined by assessing and / or measuring physical attributes related to the relevant condition in a physician's evaluation, and an increase in overall physical fitness can mean that at least one such attribute is improved. Examples of physical attributes include dry cough, fatigue, etc.

[0121] In some embodiments, the treatment or therapy or use described herein or administration of a therapeutic medicament results in an increase in longevity in a treated individual compared to an untreated individual suffering from the same condition, said increase in longevity may depend on the relevant condition being treated, and is preferably 5%, 10%, 15%, 20% or more.

[0122] General information Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood and understood by one of ordinary skill in the art to which this invention belongs and as interpreted in light of the present disclosure.

[0123] Lungs and Heart The terms "lung" and "heart" as used herein refer to organs of the respiratory system and cardiovascular system, respectively, as commonly and conventionally understood by those skilled in the art. "Epithelial" cells refer to cells of epithelial tissue, as commonly and conventionally understood by those skilled in the art. "Alveolar epithelium" refers to cells of the epithelial tissue of the alveoli, as commonly and conventionally understood by those skilled in the art. "Cardiomyocytes" refer to cells of the cardiac muscle, as commonly and conventionally understood by those skilled in the art.

[0124] Sequence identity In the context of the present invention, a nucleotide sequence, such as a nucleotide sequence encoding TERT, is represented by a nucleic acid sequence or a nucleotide sequence encoding a protein fragment or a polypeptide or a peptide or a peptide derivative. In the context of the present invention, TERT, a TERT fragment, a fragment, or a polypeptide or a peptide or a peptide derivative is represented by an amino acid sequence.

[0125] It should be understood that each nucleic acid molecule or protein fragment or polypeptide or peptide or peptide derivative or construct identified herein by a given sequence identification number (SEQ ID NO:) is not limited to this particular sequence disclosed. Each coding sequence identified herein encodes a given protein fragment or polypeptide or peptide or peptide derivative or construct, or is itself a protein fragment or polypeptide or construct or peptide or peptide derivative.

[0126] Throughout this application, whenever a particular nucleotide sequence SEQ ID NO: (take SEQ ID NO:X as an example) encoding a given protein fragment or polypeptide or peptide or peptide derivative is mentioned, this may be replaced by: i. a nucleotide sequence comprising a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% sequence identity to SEQ ID NO:X; ii. a nucleotide sequence that differs from the sequence of the nucleic acid molecule of (i) due to the degeneracy of the genetic code; or iii. A nucleotide sequence encoding an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% amino acid identity or similarity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:X.

[0127] Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.

[0128] Throughout this application, whenever a particular amino acid sequence SEQ ID NO, for example SEQ ID NO: Y, is mentioned, this may be replaced by: a polypeptide represented by an amino acid sequence comprising a sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% sequence identity or sequence similarity with amino acid sequence SEQ ID NO: Y. Another preferred level of sequence identity or sequence similarity is 70%. Another preferred level of sequence identity or sequence similarity is 80%. Another preferred level of sequence identity or sequence similarity is 90%. Another preferred level of sequence identity or sequence similarity is 95%. Another preferred level of sequence identity or sequence similarity is 99%.

[0129] Each nucleotide sequence or amino acid sequence described herein based on a percentage identity or similarity with each of the given nucleotide sequences or amino acid sequences, in further preferred embodiments, has at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 120%, at least 121%, at least 122%, at least 123%, at least 124%, at least 125%, at least 126%, at least 127%, at least 128%, at least 129%, at least 130%, at least 131%, at least 132%, at least In some embodiments, the sequence has at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to the sequence.

[0130] Each non-coding nucleotide sequence (i.e., a promoter or another regulatory region) can be replaced by a nucleotide sequence that contains a nucleotide sequence having at least 60% sequence identity or similarity with the sequence number of a specific nucleotide sequence (SEQ ID NO: A is given as an example). Preferred nucleotide sequences have at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:A. In a preferred embodiment, such a non-coding nucleotide sequence, such as a promoter, exhibits or exerts at least an activity of a non-coding nucleotide sequence, such as the activity of a promoter, known to those skilled in the art.

[0131] The terms "homology", "sequence identity" and the like are used interchangeably herein. Sequence identity is described herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred embodiment, the sequence identity is calculated based on the full length or a portion thereof of two given SEQ ID NOs. The portion preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NOs. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in Bioinformatics and the Cell: Modern Computational Approaches in Genomics, Proteomics and transcriptomics, Xia X., Springer International Publishing, New York, 2018, and Bioinformatics: Sequence and Genome Analysis, Mount D., Cold Spring Harbor Laboratory Press, New York, 2004, each of which is incorporated herein by reference in its entirety.

[0132] "Sequence identity" and "sequence similarity" can be determined by aligning two peptide sequences or two nucleotide sequences using a global alignment algorithm or a local alignment algorithm, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman-Wunsch) that optimally aligns the sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith-Waterman). Sequences can be called "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity (described below) (e.g., when optimally aligned by the EMBOSS needle or EMBOSS water programs using default parameters).

[0133] Global alignment is appropriately used to determine sequence identity when two sequences have similar lengths. When sequences have substantially different overall lengths, local alignments such as those using the Smith-Waterman algorithm are preferred. In EMBOSS needle, two sequences are aligned over their entire length (full length) using the Needleman-Wunsch global alignment algorithm, maximizing the number of matches and minimizing the number of gaps. In EMBOSS water, the Smith-Waterman local alignment algorithm is used. In general, the default parameters of EMBOSS needle and EMBOSS water are used, where gap opening penalty = 10 (nucleotide sequence) / 10 (protein) and gap extension penalty = 0.5 (nucleotide sequence) / 0.5 (protein). For nucleotide sequences, the default scoring matrix used is DNAfull, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919, incorporated herein by reference in its entirety).

[0134] Alternatively, the percentage of similarity or identity can be determined by searching against public databases using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of some embodiments of the present invention can further be used as a "query sequence" to perform searches against public databases to identify, for example, other family members or related sequences. Such searches can be performed using the BLASTn or BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10, which is incorporated herein by reference in its entirety. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecules of the present invention. BLAST protein searches can be performed with the BLASTx program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402, which is incorporated herein by reference in its entirety. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information, accessible on the World Wide Web at www.ncbi.nlm.nih.gov / .

[0135] Optionally, when determining the degree of amino acid similarity, those skilled in the art can also take into account so-called conservative amino acid substitution.As used herein, "conservative" amino acid substitution refers to residues with similar side chains that can be exchanged.Examples of classes of amino acid residues for conservative substitution are shown in the following table (herein incorporated as Table 1).

[0136] TIFF2024521063000001.tif50170

[0137] TIFF2024521063000002.tif37170

[0138] TIFF2024521063000003.tif76170

[0139] For example, the group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine, the group of amino acids with aliphatic hydroxyl side chains is serine and threonine, the group of amino acids with amide-containing side chains is asparagine and glutamine, the group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan, the group of amino acids with basic side chains is lysine, arginine, and histidine, and the group of amino acids with sulfur-containing side chains is cysteine ​​and methionine. Preferred conservative amino acid substitution groups are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequence has been removed and a different residue inserted in its place. Preferably, the amino acid changes are conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser, Arg to Lys, Asn to Gln or His, Asp to Glu, Cys to Ser or Ala, Gln to Asn, Glu to Asp, Gly to Pro, His to Asn or Gln, Ile to Leu or Val, Leu to Ile or Val, Lys to Arg, Gln or Glu, Met to Leu or Ile, Phe to Met, Leu, or Tyr, Ser to Thr, Thr to Ser, Trp to Tyr, Tyr to Trp or Phe, and Val to Ile or Leu.

[0140] Genes or coding nucleotide sequences The term "gene" refers to a DNA fragment comprising a region (transcribed region) that is transcribed in a cell into an RNA molecule (e.g., mRNA) operably linked to appropriate regulatory regions (e.g., promoters). A gene usually comprises several operably linked fragments, such as a promoter including a polyadenylation site and / or a transcription termination site, a 5' leader sequence, a coding region, and a 3' untranslated region (3' end). A chimeric or recombinant gene (e.g., TERT gene) is a gene that is not normally found in nature, e.g., a gene in which a promoter is not naturally associated with part or all of the transcribed DNA region. "Expression of a gene" refers to the process by which a DNA region operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into biologically active RNA, i.e., RNA that can be translated into a biologically active protein or peptide.

[0141] In the context of the present invention, the TERT gene may not normally be expressed in the cell or may be expressed at an insufficient level. In this context, "insufficient" means that the TERT gene is expressed in the cell, but the pathology and / or disease described herein may still occur. In this case, the present invention allows overexpression of TERT. The coding nucleotide sequence may include a sequence native to the cell, a sequence that does not naturally occur in the cell, or a combination of both. The gene may include a sequence encoding TERT and / or additional proteins as specified herein above, which may be operably linked to a regulatory sequence suitable for expression of the sequence encoding TERT in the cell. Preferably, the introduced gene is not integrated into the genome of the host cell.

[0142] promoter As used herein, the term "promoter" or "transcriptional regulatory sequence" refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, is located upstream in the direction of transcription of the transcriptional start site of the coding sequence, and is structurally specified by the presence of a binding site for DNA-dependent RNA polymerase, a transcriptional start site, and any other DNA sequences, including but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to those skilled in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, for example, by the application of a chemical inducer. As used herein, a "regulator" or "transcriptional regulator" is a protein that controls the rate of transcription of genetic information from DNA into messenger RNA by binding to a specific DNA sequence. Expression can be evaluated as described elsewhere in this section. "Transcriptional initiation ability" or "promoter strength" refers to the degree of ability of a promoter to initiate transcription of a coding nucleotide sequence to which it is operably linked.

[0143] Operable connection As used herein, the term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed in a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operable linkage means that the DNA sequences being linked are typically contiguous, and where necessary to join two protein coding regions, contiguous and in reading frame. Linkage can be achieved by ligation at convenient restriction sites, or by ligation at adapters or linkers inserted instead, or by gene synthesis.

[0144] Proteins and Amino Acids The terms "protein" or "polypeptide" or "amino acid sequence" are used interchangeably to refer to a molecule consisting of a chain of amino acids, without regard to a specific mode of action, size, three-dimensional structure, or origin. In the amino acid sequences described herein, the amino acids or "residues" are represented by their three letter codes. These three letter symbols as well as the corresponding one letter symbols are known to those skilled in the art and have the following meanings: A (Ala) is alanine, C (Cys) is cysteine, D (Asp) is aspartic acid, E (Glu) is glutamic acid, F (Phe) is phenylalanine, G (Gly) is glycine, H (His) is histidine, I (Ile) is isoleucine, K (Lys) is lysine, L (Leu) is leucine, M (Met) is methionine, N (Asn) is asparagine, P (Pro) is proline, Q (Gln) is glutamine, R (Arg) is arginine, S (Ser) is serine, T (Thr) is threonine, V (Val) is valine, W (Trp) is tryptophan, and Y (Tyr) is tyrosine. The residues may be any proteinogenic amino acid, but also non-proteinogenic amino acids, such as D-amino acids and modified amino acids formed by post-translational modifications, and any unnatural amino acid.

[0145] Expression vector The phrases "expression vector" or "vector" or "delivery vector" generally refer to a tool in molecular biology used to obtain gene expression in a cell, for example by introducing a nucleotide sequence capable of resulting in the expression of a gene or coding sequence into a host compatible with such a sequence. An expression vector can carry a genome that can be stabilized and remain episomal in the cell. Within the context of the present invention, a cell can be meant to include a cell used to make the vector or a cell into which the vector is introduced. Alternatively, the vector can be integrated into the genome of a cell, for example through homologous recombination or other methods.

[0146] Viral Vectors Viral vector or viral expression vector, viral gene therapy vector generally refers to virus-derived vectors used in molecular biology to obtain gene expression in cells, e.g., by introducing nucleotide sequences capable of bringing about the expression of a gene or coding sequence into a host compatible with such sequences.

[0147] Viral vectors or viral gene therapy vectors are vectors suitable for gene therapy. Suitable vectors for gene therapy are described in Anderson 1998, Nature 392: 25-30; Walther and Stein, 2000, Drugs 60: 249-71; Kay et al., 2001, Nat. Med. 7: 33-40; Russell, 2000, J. Gen. Virol. 81: 2573-604; Amado and Chen, 1999, Science 285: 674-6; Federico, 1999, Curr. Opin. Biotechnol.10: 448-53; Vigna and Naldini, 2000, J. Gene Med. 2: 308-16; Marin et al., 1997, Mol. Med. Today 3: 396-403; Peng and Russell, 1999, Curr. Opin. Biotechnol. 10: 454-7; Sommerfelt, 1999, J. Gen. Virol. 80: 3049-64; Reiser, 2000, Gene Ther. 7: 910-3; U.S. Patent No. 5,333,636; U.S. Patent No. 5,333,636; Baer et al., 2018, Nat. Comm. 5: 5863; van Lieshout et al., 2018, Mol. Ther. Meth. Clin. Dev. 9, and references cited therein, all of which are incorporated herein by reference in their entireties.

[0148] Particularly suitable gene therapy vectors include adenoviral and adeno-associated viral (AAV) vectors. These vectors infect a wide variety of dividing and non-dividing cells, including synovial and liver cells. The episomal nature of adenoviral and AAV vectors after cell entry makes them suitable for therapeutic use, as previously described (Russell, 2000, J. Gen. Virol. 81: 2573-2604; Goncalves, 2005, Virol J. 2(1):43; U.S. Patent No. 5,313,636; Baer et al, 2018, Nat. Comm. 5: 5863; van Lieshout et al, 2018, Mol. Ther. Meth. Clin. Dev. 9, the entire contents of which are incorporated herein by reference). AAV vectors are even more preferred as they are known to provide very stable, long-term expression of transgene expression (up to 9 years in dogs (Niemeyer et al, Blood. 2009 Jan 22;113(4):797-806) and approximately 10 years in humans (Buchlis, G. et al., Blood. 2012 Mar 29;119(13):3038-41)). Preferred adenoviral vectors are modified to reduce host responses as outlined by Russell (2000, supra).Methods for performing gene therapy using AAV vectors have been described by Wang et al., 2005, J Gene Med. March 9 (Epub ahead of print), Mandel et al., 2004, Curr Opin Mol Ther. 6(5):482-90, and Martin et al., 2004, Eye 18(11):1049-55, Nathwani et al, N Engl J Med. 2011 Dec 22;365(25):2357-65, Apparailly et al, Hum Gene Ther. 2005 Apr;16(4):426-34, U.S. Patent No. 5,313,631, Baer et al, 2018, Nat. Comm. 5: 5863, van Lieshout et al, 2018, Mol. Ther. Meth. Clin. Dev. 9 (all of which are incorporated by reference in their entireties).

[0149] Another suitable gene therapy vector includes retroviral vectors. The preferred retroviral vector for application in the present invention is a lentivirus-based expression construct. Lentivirus vectors have the ability to infect and stably integrate into the genome of dividing and non-dividing cells (Amado and Chen, 1999 Science 285: 674-6, which are incorporated herein by reference in their entirety). Methods for constructing and using lentivirus-based expression constructs are described in U.S. Patent No. 6,165,782, U.S. Patent No. 6,207,455, U.S. Patent No. 6,218,181, U.S. Patent No. 6,277,633, and U.S. Patent No. 6,323,031, as well as Federico (1999, Curr Opin Biotechnol 10: 448-53) and Vigna et al. (2000, J Gene Med 2000; 2: 308-16), which are incorporated herein by reference in their entirety. Other suitable gene therapy vectors include adenovirus vectors, herpes virus vectors, polyoma virus vectors, or vaccinia virus vectors.

[0150] Adeno-associated viral vector (AAV vector) The terms "adeno-associated virus", "AAV virus", "AAV virion", "AAV virus particle" and "AAV particle" used synonymously herein refer to a viral particle composed of at least one capsid protein of AAV (preferably composed of all capsid proteins of a particular AAV serotype) and an encapsulated polynucleotide of the AAV genome. When the particle contains a heterologous polynucleotide (i.e., a polynucleotide different from the wild-type AAV genome, such as a gene or a recombinant viral genome to be delivered to a mammalian cell) flanked on both sides by AAV inverted terminal repeat sequences, they are typically known as "AAV vector particles" or "AAV viral vectors" or "AAV vectors". AAV refers to a virus belonging to the genus Dependoparvovirus (also called Dependovirus) of the Parvoviridae family. The AAV genome is approximately 4.7 kb in length and is composed of a single-stranded deoxyribonucleic acid (ssDNA) that can be detected positively or negatively. The present invention also encompasses the use of double-stranded AAV, also called dsAAV or scAAV. The genome contains inverted terminal repeats (ITRs) at both ends of the DNA strand and two open reading frames (ORFs): rep and cap. The rep frame is made up of four overlapping genes that code for the protein Rep required for the AAV life cycle. The cap frame contains overlapping nucleotide sequences with the capsid proteins VP1, VP2, and VP3, which interact to form the capsid with icosahedral symmetry (see Carter and Samulski., 2000 and Gao et al., 2004, which are incorporated by reference in their entireties).

[0151] A preferred viral vector or preferred gene therapy vector is an AAV vector. The AAV vector used herein preferably includes recombinant AAV vector (rAAV vector). As used herein, "rAAV vector" refers to a recombinant vector that includes a portion of the AAV genome encapsidated within a protein shell of capsid protein derived from an AAV serotype described herein. The portion of the AAV genome may include an inverted terminal repeat (ITR) sequence derived from an adeno-associated virus serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, etc., as described elsewhere herein.

[0152] The protein shell, which is composed of capsid proteins, can be from any AAV serotype. The protein shell is sometimes referred to as a capsid protein shell. The rAAV vector may be deleted of one or preferably all wild-type AAV genes, but may still contain functional ITR nucleic acid sequences. Functional ITR sequences are necessary for replication, rescue, and packaging of AAV virions. The ITR sequences may be wild-type sequences or may have at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the wild-type sequence, or may be modified, for example by insertion, mutation, deletion, or substitution of nucleotides, so long as functionality is maintained. In this context, functionality refers to the ability to allow expression in the host cell or target cell to be infected after direct packaging of the genome into a capsid shell. In the context of the present invention, the capsid protein shell may be of a different serotype than the ITRs of the rAAV vector genome.

[0153] The nucleic acid molecule represented by the selected nucleic acid sequence is preferably inserted between the rAAV genome or ITR sequences identified above, e.g., an expression construct comprising an expression control element operably linked to the coding sequence and a 3' termination sequence. The nucleic acid molecule may also be referred to as a transgene.

[0154] "AAV helper functions" generally refer to the corresponding AAV functions required for rAAV replication and packaging provided in trans to the rAAV vector. AAV helper functions complement the missing AAV functions in the rAAV vector, which lack the AAV ITRs (which are provided by the rAAV vector genome). AAV helper functions include the two major ORFs of AAV, namely, the rep coding region and the cap coding region, or sequences substantially functionally identical thereto. The Rep and Cap regions are known in the art, see, for example, Chiorini et al. (1999, J. of Virology, Vol 73(2): 1309-1319) or U.S. Patent No. 5,139,941, which is incorporated herein by reference in its entirety. AAV helper functions can be provided in an AAV helper construct. Introduction of the helper construct into the host cell can be by, for example, transformation, transfection, or transduction prior to or simultaneously with the introduction of the rAAV genome present in the rAAV vectors identified herein. Thus, the AAV helper constructs of the invention can be selected such that they provide the desired combination of serotypes, on the one hand, of the capsid protein shell of the rAAV vector, and on the other hand, of the rAAV genome present in the replication and packaging of said rAAV vector.

[0155] An "AAV helper virus" provides additional functions required for AAV replication and packaging. Suitable AAV helper viruses include adenovirus, herpes simplex virus (such as HSV type 1 and HSV type 2), and vaccinia virus. The additional functions provided by the helper virus can also be introduced into the host cell via a plasmid, as described in U.S. Patent No. 6,531,456, which is incorporated herein by reference in its entirety.

[0156] "Transduction" refers to the delivery of a nucleic acid molecule to a recipient host cell by a viral vector. For example, transduction of a target cell by an AAV vector according to the invention results in the introduction of the recombinant viral genome contained in the vector into the transduced cell.

[0157] Expression Expression can be assessed by any method known to one of skill in the art, for example, by measuring the level of gene expression in the transduced tissue at the mRNA or protein level by standard assays known to one of skill in the art, such as qPCR, RNA sequencing, Northern blot analysis, Western blot analysis, mass spectrometry of protein-derived peptides, or ELISA.

[0158] Expression can be assessed at any time following administration of a recombinant viral genome, expression vector, or composition described herein, in some embodiments herein, expression can be assessed 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 14 weeks, 16 weeks, 18 weeks, 20 weeks, 22 weeks, 24 weeks, 28 weeks, 32 weeks, 36 weeks, 40 weeks, or more.

[0159] Codon Optimization As used herein, "codon optimization" refers to a process used to modify existing coding sequences or design coding sequences to improve translation in an expression host cell or organism of, for example, a transcript RNA molecule transcribed from the coding sequence or to improve transcription of the coding sequence. Codon optimization includes, but is not limited to, processes that involve selecting codons for a coding sequence to match the codon preferences of the expression host organism, for example, to match the codon preferences of a mammalian, preferably murine, canine, or human, expression host. Codon optimization also eliminates elements that may adversely affect RNA stability and / or translation (e.g., termination sequences, TATA boxes, splice sites, ribosome entry sites, repeat and / or GC-rich sequences, and RNA secondary structure or instability motifs). In some embodiments, the codon-optimized sequence exhibits at least a 3%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or greater increase in gene expression, transcription, RNA stability and / or translation compared to the original non-codon-optimized sequence.

[0160] General terminology In this specification and the claims, the verb "to comprise" and its conjugations are used in an open-ended sense, meaning that what follows is included, but not that which is not specifically listed is excluded. Furthermore, the verb "to consist" can be replaced by "to consist essentially of," meaning that the compositions described herein may include additional component(s) other than those specifically specified, and that said additional component(s) do not alter the specific characteristics of the invention. Furthermore, the verb "to consist" can be replaced by "to consist essentially of," meaning that the methods or uses described herein may include additional step(s) other than those specifically specified, and that said additional step(s) do not alter the specific characteristics of the invention. Furthermore, the verb "to consist" can be replaced by "to consist essentially of," which means that the nucleotide or amino acid sequences described herein may contain additional nucleotides or amino acids other than those specifically specified, and said additional nucleotides or amino acids do not alter the unique properties of the invention.

[0161] The reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires that only one element be present. Thus, the indefinite article "a" or "an" normally means "at least one."

[0162] As used herein, the term "at least" means a particular value greater than or equal to the particular value. For example, "at least 2" is understood to be the same as "2 or greater," i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15... etc.

[0163] Moreover, the terms first, second, third, etc. in the detailed description and claims are used to distinguish between like elements and are not necessarily used to describe an order or chronological sequence. The terms so used are interchangeable under appropriate circumstances, with it being understood that the embodiments of the invention described herein are capable of operating in sequences other than those described or illustrated herein.

[0164] The words "about" or "approximately" when used in connection with a numerical value (e.g., about 10) preferably mean that the value may be 1% more or less than the specified value (10).

[0165] As used herein, the term "and / or" indicates that one or more of the specified instances may occur alone or in combination with at least one of the specified instances and / or all of the specified instances.

[0166] Various embodiments are described herein. Each embodiment specified herein can be combined with each other unless otherwise indicated.

[0167] All patent applications, patents, and printed publications cited herein are incorporated herein by reference in their entirety, except for any definitions, subject matter disclaimers or disclaimers, and except to the extent the incorporated material contradicts the explicit disclosure of this specification, in which case the language of the present disclosure shall control.

[0168] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention, and indeed the present invention is in no way limited to the methods and materials described.

[0169] This invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention. [Brief description of the drawings]

[0170] [Figure 1] Figure 1 shows a comparison of lung-specific expression between AAV9-SpB-GFP and AAV9-CMV-GFP vectors. Mice were treated with AAV9 vectors encoding the marker protein GFP under the control of a truncated SpB promoter (AAV9-SpB-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP). A dose of 1.75x1012 viral genomes (vg) of AAV9-SpB-GFP or AAV9-CMV-GFP vectors was administered intravenously (IV) via the tail vein. GFP expression levels were assessed by quantitative PCR 4 weeks after AAV administration in the lung (Figure 1A), liver, and epididymal white adipose tissue (eWAT) (Figure 1B). Results are expressed as mean relative expression (AU) + SEM. **p<0.01, ***p<0.001 for AAV9-CMV-GFP. [Diagram 2]Quantification of GFP-positive cells in tissues of mice treated with AAV9-SpB-GFP and AAV9-CMV-GFP vectors. Mice were treated with AAV9 vectors encoding the marker protein GFP under the control of a truncated SpB promoter (AAV9-SpB-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP). A dose of 1.75×1012 viral genomes (vg) of AAV9-SpB-GFP or AAV9-CMV-GFP vectors was administered intravenously (IV) via the tail vein. Saline was used as a control. The percentage of GFP-positive cells in lung, liver, heart, and brown adipose tissue (BAT) of mice treated with AAV9-SpB-GFP, AAV9-CMV-GFP, or saline was quantified. Results were assessed by quantitative PCR 4 weeks after AAV administration. Results are expressed as mean percentage + SEM. n = 3–4. ***p < 0.05, ns is non-significant. Lines connecting bars indicate comparisons. [Diagram 3] Visualization of GFP-positive cells in tissues of mice treated with AAV9-SpB-GFP and AAV9-CMV-GFP vectors. Mice were treated with AAV9 vectors encoding the marker protein GFP under the control of a truncated SpB promoter (AAV9-SpB-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP). A dose of 1.75×1012 viral genomes (vg) of the AAV9-SpB-GFP or AAV9-CMV-GFP vectors was administered intravenously (IV) via the tail vein. Results were evaluated 4 weeks after AAV administration. Saline was used as a control. GFP-positive cells in the lung, brown adipose tissue (BAT), heart, and liver were detected by immunohistochemical staining using a rabbit monoclonal antibody against GFP and visualized by light microscopy. [Figure 4]Figure 4 shows a comparison of cardiac specific expression between AAV9-CMVenh-MLC2v-GFP and AAV9-CMV-GFP vectors. Mice were treated with two different doses (5x1011 viral genomes (vg) per mouse or 2x1012 viral genomes (vg) per mouse) of AAV9 vectors encoding the marker protein GFP under the control of the CMVenh-MLC2v promoter (AAV9-CMVenhancer-MLC2v-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP) administered intravenously (IV) via the tail vein. GFP expression levels were assessed by quantitative PCR in the heart (Figure 4A), liver, and epididymal white adipose tissue (eWAT) (Figure 4B) 3 weeks after AAV administration. Results are expressed as mean relative expression (AU) + SEM. *p<0.05, **p<0.01 relative to AAV9-CMVenhancer-MLC2v-GFP at 2x1012 vg per mouse. [Diagram 5]Visualization and quantification of GFP-positive cells in tissues of mice treated with AAV9-CMVenh-MLC2v-GFP and AAV9-CMV-GFP vectors. Mice were treated with two different doses (5x1011 viral genomes (vg) per mouse (low (L) dose) or 2x1012 viral genomes (vg) per mouse (high (H) dose)) of AAV9 vectors encoding the marker protein GFP under the control of the CMVenh-MLC2v promoter (AAV9-CMVenh-MLC2v-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP) intravenously via the tail vein. Results were evaluated 3 weeks after AAV administration. Non-injected mice were used as controls. GFP-positive cells in the heart, brown adipose tissue (BAT), epididymis, intestine, kidney, liver, lung, muscle, pancreas, spleen, testis, and white adipose tissue (WAT) were detected by immunohistochemical staining using a rabbit monoclonal antibody against GFP and visualized by light microscopy. In Figure 5A, GFP-positive cells in the heart are visualized. In Figure 5B, the percentage of GFP-positive cells in brown adipose tissue (BAT), epididymis, heart, intestine, kidney, liver, lung, muscle, pancreas, spleen, testis, and white adipose tissue (WAT) is quantified. Results are expressed as mean percentage + SEM. n = 2-6. ***p < 0.05, ns is non-significant. Lines connecting the bars indicate comparisons. [Figure 6]Figure 1 shows a comparison of cardiac specific expression between AAV9-TNT-GFP and AAV9-CMV-GFP vectors. Seven-week-old male C57B16 mice were treated with AAV9 vectors encoding the marker protein GFP under the control of a truncated TNT promoter (AAV9-TNT-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP). A dose of 1.75x1012 viral genomes (vg) of AAV9-TNT-GFP or AAV9-CMV-GFP vectors was administered intravenously (IV) via the tail vein. GFP expression levels were assessed by quantitative PCR in the heart, liver, and periepididymal white adipose tissue (eWAT) 4 weeks after AAV administration. Results are expressed as mean relative expression (AU) + SEM. **p<0.01 vs. AAV9-CMV-GFP. [Figure 7] Visualization of GFP-positive cells in tissues of mice treated with AAV9-TNT-GFP and AAV9-CMV-GFP vectors. Seven-week-old male C57B16 mice were treated with AAV9 vectors encoding the marker protein GFP under the control of a truncated TNT promoter (AAV9-TNT-GFP) or AAV9 vectors encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP). A dose of 1.75×1012 viral genomes (vg) of the AAV9-TNT-GFP or AAV9-CMV-GFP vectors was administered intravenously (IV) via the tail vein. Uninjected mice were used as controls. Results were evaluated 4 weeks after AAV administration. GFP-positive cells in brown adipose tissue (BAT), heart, and liver were detected by immunohistochemical staining using a rabbit monoclonal antibody against GFP and visualized by light microscopy. [Figure 8]Figure 8: Characterization of AAV vectors by sedimentation velocity analytical ultracentrifugation. AAV9-CMV-mTert (Figure 8A, 5291 nucleotides), AAV9-CMV-mTERT-DN (Figure 8B, 5291 nucleotides), AAV9-SpB-moTERT (Figure 8C, 4638 nucleotides), AAV9-CMVenh-MLC2v-moTERT (Figure 8D, 4676 nucleotides), AA9-TNT-moTERT (Figure 8E, 4536 nucleotides). Sedimentation velocity centrifugation was performed at 20000 rpm. Particle sedimentation was recorded at 260 nm and 280 nm during the same run. The relative percentage of each peak in the C(S) distribution was calculated based on the molar concentration of each species relative to the sum of the molar concentrations of all species in the distribution. The peaks corresponding to the empty vector, intermediate species, and vector containing the full-length genome are indicated by arrows. [Figure 9] Figure 9: Characterization of AAV vectors by alkaline agarose gel electrophoresis. Purified vector DNA was subjected to agarose gel electrophoresis under denaturing conditions. Genomic integrity was assessed by checking band size and quality (presence of smears). MW indicates DNA ladder. IS indicates presence of intermediate species. (Figure 9A) AAV9-SpB-moTERT (well "1", 4638 nucleotides), AAV9-CMV-mTert (well "2", 5291 nucleotides), AAV9-CMV-mTERT-DN (well "3", 5291 nucleotides), AAV9-CMVenh-MLC2v-moTERT (well "4", 4676 nucleotides). (Figure 9B) AA9-TNT-moTERT (well "5", 4536 nucleotides), AAV9-CMV-mTert (well "2", 5291 nucleotides). [Figure 10]Figure 10: Evaluation of the therapeutic utility of AAV9-SpB-moTERT in a pulmonary fibrosis mouse model. Bleomycin (0.5 mg / kg body weight) was intratracheally instilled into 8-week-old G3-Tert- / - male mice. Two weeks after bleomycin insult, computed tomography (CT) scans were performed on each mouse to diagnose bona fide pulmonary fibrosis patterns. Mice diagnosed with pulmonary fibrosis were administered intravenously (IV) with either 2x1012 vg of AAV9-SpB-moTERT vector or AAV9-null vector (negative control). CT scans were performed to measure the reduction in affected lung volume at 1, 3, and 5 weeks after viral treatment, showing abnormal CT patterns compared to the start of treatment. (Figure 10A) Time series of the reduction (%) of abnormal fibrosis patterns measured by CT scans. (Figure 10B) Rate of regression of CT abnormal patterns one week after treatment. Results are expressed as the mean percentage of early fibrosis pattern + SEM. n=4. [Figure 11] Figure 11: Evaluation of therapeutic efficacy of pulmonary fibrosis treatment with AAV9-SpB-moTERT in a mouse model. Bleomycin (0.5 mg to 0.7 mg per kg body weight) was intratracheally instilled into 8-week-old G3-Tert- / - male mice. Mice diagnosed with pulmonary fibrosis were administered intravenously (IV) with either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT. Disease progression was followed by weekly CT scans. Weekly CT scans were performed to measure the reduction in fibrotic lung volume relative to the start of treatment. (Figure 11A) Time series of the reduction (%) of abnormal fibrotic volume measured by CT scan. (Figure 11B) Rate of reduction of affected volume calculated during the first 6 weeks of treatment. [Figure 12]Figure 12 shows the expression level and activity of TERT in lung samples from mice with pulmonary fibrosis treated with AAV9-SpB-moTERT. Bleomycin (0.5-0.7 mg / kg body weight) was instilled intratracheally into 8-week-old G3-Tert- / - male mice. Mice diagnosed with pulmonary fibrosis were administered intravenously (IV) with either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT. Mice were sacrificed 8 weeks after treatment and the expression level and activity of TERT was measured in lung samples. (Figure 12A) The activity of TERT (relative to HEK293T) was measured in lung samples. (Figure 12B) The expression level of TERT (relative to actin). Results are expressed as mean percentage + SEM. n=8-10. [Figure 13] Figure 2 shows analysis of telomere length in lung samples from mice treated with AAV9-CMV-null, AAV9-CMV-mTERT, and AAV9-SpB-moTERT. A and B. Mean nuclear intensity in SPC-positive (A) and SPC-negative (B) cells of ATII cells. C and D. Mean telomere intensity in SPC-positive (C) and SPC-negative (D) cells of ATII cells. E and F. Percentage of short telomeres below the 20th percentile of AAV9-CMV-null control samples in SPC-positive (E) and SPC-negative (F) cells of ATII cells. G and H. Percentage of short telomeres below the 20th percentile of AAV9-CMV-null control samples in SPC-positive (E) and SPC-negative (F) cells of ATII cells. G-H. Percentage of long telomeres above the 80th percentile in SPC-positive (G) and SPC-negative (H) ATII cells compared to AAV9-CMV-null control samples. I. Representative images of SPC immunofluorescence and telomere Fish in lung samples. [Figure 14]Figure 1 shows quantification of expression levels and telomerase activity (TRAP) of Tert in lung, liver, heart, and brain samples. Bleomycin (0.5-0.7 mg / kg body weight) was intratracheally instilled into 8-week-old G3-Tert- / - male mice. Mice diagnosed with pulmonary fibrosis were administered intravenously (IV) with either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT. Mice were sacrificed 8 weeks after treatment and expression levels and activity of TERT were measured in lung, liver, heart, and brain samples. [Figure 15] Figure 1: Evaluation of therapeutic efficacy of AAV9-SpB-moTERT and AAV9-CMV-mTERT in PF regression. Experimental setup. A mouse model of pulmonary fibrosis induced by short telomeres is used. This model is based on intratracheal instillation of low doses of bleomycin (0.7 mg / kg body weight) in 8-week-old G3-Tert- / - male mice, a dose that does not induce fibrosis in wild-type mice with normal length telomeres. Prior to bleomycin (bleo) insult, an initial CT scan is performed on each mouse to calculate healthy lung volume and further calculate disease progression. Two weeks after bleo insult, a computed tomography (CT) scan is performed on each mouse to diagnose bona fide pulmonary fibrosis patterns. Mice diagnosed with pulmonary fibrosis were administered either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT intravenously (IV). Disease progression was followed by CT scans. CT scans were performed 1 week, 2 weeks, 4 weeks, and 6 weeks after infection to measure the reduction in fibrotic lung volume relative to the start of treatment. Mice were sacrificed 8 weeks after infection. [Figure 16]Representative images of pulmonary fibrosis pathology with various PF scores. Representative images of histopathology of fibrosis scores. Fibrous thickening of the interalveolar septa in grades 1 and 2 was shown with Masson's Trichrome (see arrows) and Picro Sirius Red (see arrow). In grade 3, isolated fibrotic areas with thickening of the interalveolar septa (see arrow). [Figure 17] Figure 1: Lung histopathological analysis at endpoint (8 weeks after AAV9 treatment) and correlation with CT molecular imaging. Quantification of PF score (A) and CT value (B) after 8 weeks of AAV9 treatment. Correlation analysis was performed between PF score and CT value (C). Pulmonary fibrosis (PF) histological score: semi-quantitative scoring of pulmonary fibrosis based on analysis of 10 fields (200x) stained with Sirius red (Lawson et al, 2005, 2011; Degryse AL et al 2012). Grade 0: normal lung architecture; Grade 1: increase in thickness of a portion (<50%) of the interalveolar septum; Grade 2: thickening of >50% of the interalveolar septum without formation of fibrotic lesions; Grade 3: thickening of the interalveolar septum with formation of isolated fibrotic lesions; Grade 4: numerous fibrotic lesions with global or subglobal distortion of the parenchymal architecture. [Figure 18] Figure 1 shows telomerase expression (qPCR) in liver, heart, and brain samples. Bleomycin (0.7 mg / kg body weight) was intratracheally instilled into 8-week-old G3-Tert- / - male mice. Mice diagnosed with pulmonary fibrosis were administered intravenously (IV) with either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT. Mice were sacrificed 8 weeks after treatment and expression levels of TERT were measured in liver (A), heart (B), and brain (C) samples. [Figure 19]Figure 1 shows telomerase activity (TRAP) in liver, heart, and brain samples. Bleomycin (0.7 mg / kg body weight) was intratracheally instilled into 8-week-old G3-Tert- / - male mice. Mice diagnosed with pulmonary fibrosis were administered intravenously (IV) with either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT. After 8 weeks of treatment, mice were sacrificed and telomerase activity was measured in liver (A), heart (B), and brain (C) samples. [Figure 20] Representative images of Immuno qFISH CC10 and Tel probes and DAPI.Representative images of CC10 immunofluorescence and telomere Fish in lung samples from mice treated with AAV9-CMV-null, AAV9-CMV-mTERT, and AAV9-SpB-moTERT. [Figure 21] Immuno-qFISH CC10-Tel quantification (Clara cell specific). Analysis of telomere length in Clara cells in lung samples of mice treated with AAV9-CMV-null, AAV9-CMV-mTERT, and AAV9-SpB-moTERT. Mean nuclear intensity in CC10-positive Clara cells (A), mean telomere intensity in CC10-positive Clara cells (B), percentage of short telomeres below the 20th percentile of AAV9-CMV-null control samples in CC10-positive Clara cells (C), and percentage of long telomeres above the 80th percentile of AAV9-CMV-null control samples in CC10-positive Clara cells (D). [Figure 22]Figure 1 shows quantification of SMA and F4 / 80. Mice diagnosed with pulmonary fibrosis were administered either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT intravenously (IV). Eight weeks after treatment, mice were sacrificed and lung samples were analyzed for smooth muscle actin (SMA) positive areas (upper panel) and macrophage F4 / 80 positive cells (lower panel). Representative IHQ images of SMA and F4 / 80 staining are shown on the right. [Figure 23] Figure 1 shows quantification of γH2AX-, p53-, and p21-positive cells in lung samples. Mice diagnosed with pulmonary fibrosis were administered either 2x1012 vg of AAV-CMV-null, 2x1012 vg of AAV9-CMV-mTERT, or 2x1012 vg of AAV9-SpB-moTERT intravenously (IV). Eight weeks after treatment, mice were sacrificed and lung samples were analyzed for γH2AX (upper panel), p53 (middle panel), and p21 (lower panel) positive cells. Representative IHQ images of γH2AX, p53, and p21 staining are shown on the right. [Figure 24] Figure 1: Experimental setup. Healthy wild-type mice are intratracheally inoculated with AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) vectors at doses of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 3 weeks and 9 weeks post-infection. GFP expression is evaluated in five lung lobes: right upper lobe, right middle lobe, right lower lobe, post-caval lobe, and left lobe. GFP expression is also assessed in the liver, heart, and brain to address off-target tissues. [Diagram 25]Figure 1 shows q-RT-PCR analysis in lung lobes 3 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally administered AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) vectors at a dose of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 3 weeks after infection. GFP expression is evaluated by qPCR in five lung lobes: right upper lobe, right middle lobe, right lower lobe, retrocaval lobe, and left lobe. [Figure 26] Figure 1 shows q-RT-PCR analysis of lung samples 3 and 9 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally inoculated with AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) vectors at a dose of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 3 and 9 weeks after infection. GFP expression is assessed by qPCR in the lungs (part a) at 3 weeks and part b) at 9 weeks). [Figure 27]Figure 1 shows q-RT-PCR analysis of lung samples 3 and 9 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally administered AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) vectors at doses of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 3 and 9 weeks after infection and results are obtained at both time points. GFP expression is assessed by qPCR in the lungs. [Figure 28] Figure 1 shows IHC analysis in lung lobes 3 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally administered AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) vectors at a dose of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 3 weeks after infection. The percentage of GFP-positive cells is evaluated by IHQ in five lung lobes: right upper lobe, right middle lobe, right lower lobe, retrocaval lobe, and left lobe. [Figure 29]Figure 1 shows IHC analysis of lung samples 3 and 9 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally inoculated with AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) vectors at doses of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 3 weeks after infection (data shown in figure a)) and 9 weeks after infection (data shown in figure b). The percentage of GFP positive cells is assessed in the lungs by IHQ. [Diagram 30] Representative images of GFP IH. Representative IHQ images of GFP staining in lungs transduced at 1012 vg per mouse with either AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB). [Diagram 31] Representative images of double IHC staining with anti-SpC and anti-GFP. Representative IHC images of GFP and SpC staining in lungs transduced with either AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) at doses of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 9 weeks post-infection. SpC is a marker for alveolar type II cells. [Diagram 32] Representative images of double IHC staining with anti-CC10 and anti-GFP. Representative IHC images of GFP and CC10 staining in lungs transduced with either AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB), and AAV6-SpB-GFP (batch 944, UAB) at doses of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2), and 1012 vg per mouse (D3). Mice are sacrificed 9 weeks post-infection. CC10 is a marker for Clara cells. [Diagram 33] Figure 1 shows IHC analysis in lung samples 9 weeks after infection with viral vectors. Quantification of the percentage of SPC positive cells (A), the percentage of SPC-GFP double positive cells (B), the percentage of SPC positive of total GFP positive cells (C), the percentage of CC10-GFP double positive cells (D), and the percentage of CC10 positive cells of total GFP positive cells (E) in lung samples 9 weeks after infection with AAV6-SpB-GFP (Batch 944, UAB) at doses of 10 vg per mouse (D1), 5x10 vg per mouse (D2), and 10 vg per mouse (D3). [Diagram 34]Figure 1 shows IHC analysis of lung, liver and heart samples 3 and 9 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally inoculated with AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB) and AAV6-SpB-GFP (batch 944, UAB) vectors at a dose of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2) and 1012 vg per mouse (D3). Mice are sacrificed 3 and 9 weeks after infection. The percentage of GFP positive cells is assessed by IHQ in the liver (A, B), heart (C, D), and lung (E, F). [Diagram 35] Figure 1 shows GFP expression levels by q-RT-PCR in liver, heart and brain samples 3 and 9 weeks after infection with viral vectors. Healthy wild-type mice are intratracheally administered AAV9-CMV-null (batch 729, UAB), AAV9-CMV-GFP (batch 941, UAB), AAV9-SpB-GFP (batch 893, UAB), AAV6-CMV-null (batch 942, UAB), AAV6-CMV-GFP (batch 943, UAB) and AAV6-SpB-GFP (batch 944, UAB) vectors at a dose of 1011 vg per mouse (D1), 5x1011 vg per mouse (D2) and 1012 vg per mouse (D3). Mice are sacrificed 3 and 9 weeks after infection. GFP expression is assessed by qPCR in liver (A, B), heart (C, D), and lung (E, F). [Diagram 36] FIG. 1 shows an isopycnic CsCl gradient of batch AAV-953 of the AAV6-SpB-moTERT-bGH vector. [Figure 37] Figure 1 shows protein staining (Sypro Ruby staining) of AAV-953 batches. VP is viral particle. [Figure 38]FIG. 1 shows an alkaline agarose gel of AAV-953 batches. MW is molecular weight. [Figure 39] Figure 1 shows the expression of moTERT mRNA. Expression levels of mouse-optimized TERT mRNA in 2v6.11 cells infected with vector AAV-953 at three different MOIs (32000 vg per cell (32K), 64000 vg per cell (64K), and 128000 vg per cell (128K)). NI is uninfected. AU is arbitrary unit. [Diagram 40] FIG. 1 shows an alkaline agarose gel of AAV6-SpB-moTERT (AAV-953 batch). MW is molecular weight. [Diagram 41] Experimental setup: Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Ten mice are included per group. Mice are sacrificed 6 weeks after infection. [Diagram 42] Figure 1. Quantification of viral genomes. Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Ten mice are included per group. Mice are sacrificed 6 weeks after infection. The number of viral genomes per cell in lung and liver samples was analyzed by qPCR using two different primer sets: primer set 1 and primer set 2. [Diagram 43]Figure 1 shows the expression of Tert in lungs. Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Ten mice are included per group. Mice are sacrificed 6 weeks after infection. The transcriptional expression level of Tert in lungs is analyzed by q-RT-PCR using two different primer sets, set 1 and set 2. Set 1 consists of a forward primer (5'-TAG CCC TGG CAA GGA TAG A-3') and a reverse primer (5'-GCT CTC GGT GAT GTA GAA GAA G-3'). Set 2 consisted of a forward primer (5'-CAC CAG ACA CAA CGA GAG AAG-3') and a reverse primer (5'-CTC GAC CTT CAT CTT CCA CAT C-3'). [Diagram 44] Figure 1. Expression and activity of Tert in off-target organs. Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). 10 mice are included per group. Mice are sacrificed 6 weeks post-infection. Transcriptional expression levels of Tert in liver are analyzed by q-RT-PCR using primer set 1. Set 1 is composed of forward primer (5'-TAG CCC TGG CAA GGA TAG A-3') and reverse primer (5'-GCT CTC GGT GAT GTA GAA GAA G-3') (left panel). Telomerase activity in liver samples is analyzed by q-PCR-based telomeric repeat amplification protocol (TRAP) (right panel). [Diagram 45]Figure 2 shows telomerase activity in lungs. Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Mice are sacrificed 6 weeks after infection. Telomerase activity in lung samples is analyzed by telomeric repeat amplification protocol (TRAP). A correlation is shown between telomerase expression and telomerase activity in lung samples. [Figure 46] Figure 1 shows moTert RNAscope. Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Mice are sacrificed 6 weeks after infection. The percentage of lung cells expressing moTert is analyzed by moTert RNAscope positive cells. To analyze lung transduction efficiency, a probe specific for moTert RNA was designed and purchased from ACDBIO (www.acdbio.com). [Figure 47] Figure 2 shows that AAV6-SpB-moTert is expressed only in ATII and Clara cells. Healthy wild-type mice (9 weeks old) are intratracheally inoculated with AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Mice are sacrificed 6 weeks after infection. Representative images of double immunostaining with prosurfactant protein C (SP-C) and moTert RNAscope, and double immunostaining with secretoglobin family 1A member 1 (SCGB1A1 or CC10) and moTert RNAscope in lung samples. [Figure 48]Figure 2 shows that AAV6-SpB-moTert lengthens telomeres and results in a higher number of telomere spots per nucleus in transduced cells at 6 weeks. Healthy wild-type mice (9 weeks old) are intratracheally administered AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Mice are sacrificed 6 weeks after infection. Dual fluorescent in situ hybridization (q-Fish) with moTert RNAscope and telomere probe was performed to analyze telomere length in cells expressing moTert in lung samples. The mean telomere intensity, mean nuclear intensity, and mean number of telomere spots per nucleus in cells not expressing moTert and cells expressing moTert are shown. Results are expressed as mean + SEM. n=10 mice. [Figure 49] Figure 1. AAV6-SpB-Tert transduced mice. Telomere distribution: 20% and 80% percentiles. Healthy wild-type mice (9 weeks old) are intratracheally administered AAV6-SpB-null at 5x1011 vg per mouse (D2) and AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2). Mice are sacrificed 6 weeks after infection. Dual fluorescent in situ hybridization (q-Fish) with moTert RNAscope and telomere probe was performed to analyze telomere length in cells expressing moTert in lung samples. The average telomere intensity, average nuclear intensity, and average number of telomere spots per nucleus in non-moTert-expressing and moTert-expressing cells in the two experimental groups (AAV6-SpB-moTert-D1 and AAV6-SpB-moTert-D2) were obtained to calculate the 20% and 80% percentiles relative to non-transduced cells (Tert RNAScope negative cells). [Figure 50]Figure 1: Evaluation of therapeutic efficacy of AAV6-SpB-moTERT in treating pulmonary fibrosis induced by short telomeres. Experimental setup. Bleomycin (0.7 mg / kg body weight) was intratracheally instilled into 8-week-old G2-Tert- / - and G3-Tert- / - male mice. Mice diagnosed with pulmonary fibrosis were administered intratracheally (IT) with either 5x1011 vg / mouse of AAV-CMV-null or 5x1011 vg / mouse of AAV6-SpB-moTERT. Disease progression was followed by CT scans. CT scans were performed 1 week, 2 weeks, 4 weeks, and 6 weeks after infection to measure the reduction in fibrotic lung volume relative to the start of treatment. Mice are sacrificed either 6 weeks or 11 weeks after infection. 10 mice per group are left for long-term follow-up. [Figure 51] Figure 1 shows the lung transduction efficiency of AAV6-SpB-moTert in fibrotic lungs by RNAscope. Mice diagnosed with pulmonary fibrosis were intratracheally (IT) administered either AAV-CMV-null at 5x1011 vg per mouse or AAV6-SpB-moTERT at 5x1011 vg per mouse. The percentage of lung cells expressing moTert is analyzed by moTert RNAscope positive cells in lung samples 11 weeks after infection (right panel). For comparison, the percentage of lung cells 6 weeks after infection in wild-type healthy animals transduced with AAV6-SpB-null at 5x1011 vg per mouse (D2) and in wild-type healthy animals transduced with AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2) is shown (left panel). [Figure 52]Figure 1 shows quantification of viral genomes. Mice diagnosed with pulmonary fibrosis were administered intratracheally (IT) with either 5x1011 vg / mouse of AAV-CMV-null or 5x1011 vg / mouse of AAV6-SpB-moTERT. The number of viral genomes per cell in lung, liver, heart, and brain samples was analyzed by qPCR using two different primer sets, primer set 1 and primer set 2. Samples correspond to mice sacrificed 6 and 11 weeks post-infection (upper panel). For comparison purposes, the number of viral genomes per cell in lung and liver samples 6 weeks after infection from wild-type healthy animals transduced with AAV6-SpB-null at 5x1011 vg per mouse (D2) and from wild-type healthy animals transduced with AAV6-SpB-moTert at 1x1011 vg per mouse (D1) and 5x1011 vg per mouse (D2) are shown (lower panel). [Figure 53] Tert expression - qPCR. Mice diagnosed with pulmonary fibrosis were administered intratracheally (IT) with either 5x1011 vg AAV-CMV-null per mouse or 5x1011 vg AAV6-SpB-moTERT per mouse. Telomerase expression is assessed by qPCR in lung, liver, heart and brain samples 11 weeks after infection (top panel). Telomerase expression is assessed in lungs 6 weeks and 11 weeks after infection (bottom left panel) and 6 weeks after infection (bottom right panel). The three plots correspond to three different independent PCR runs analyzing individual independent mice. Lung samples from wild-type healthy mice transduced with 5x1011 vg AAV6-SpB-moTERT vg were run in parallel (first bar) as a positive control. [Figure 54] Figure 1 shows four different TERT sequences cloned into AAV vectors. The 4650 bp AAV vector genome contains the SpB promoter, the corresponding TERT CDS and the bGH polyA signal, all flanked by two AAV2 ITRs. [Figure 55]Figure 1 shows sedimentation profiles obtained by analytical ultracentrifugation of AAV6-SpB-hoTERT-ID (AAV-962 vector batch). The x-axis represents the sedimentation coefficient expressed in Svedberg units (S) and the y-axis represents the normalized values ​​of concentration (c(S)) as a function of S measured at 260 nm (solid line) and 280 nm (dashed line). [Figure 56] FIG. 1 shows an alkaline agarose gel of AAV6-SpB-hoTERT-ID (AAV-962 batch). MW is molecular weight. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS EXAMPLES

[0171] General Procedure for Example 1 Subject characteristics Male C57Bl / 6J mice were used to evaluate the tissue specificity of the truncated human SpB, CMVenh-MLC2v, and TNT promoters. Mice were fed a standard diet (2018S Teklad Global Diets™, Harlan Labs., Inc., Madison, WI, USA) ad libitum and kept on a 12-h light / dark cycle (lights on at 8 am) and stable temperature (22°C ± 2°C). Prior to tissue sampling, mice were anesthetized with the inhalation anesthetic isoflurane (IsoFlo™, Abbott Laboratories, Abbott Park, IL, USA) and decapitated. Tissues of interest were excised and stored at -80°C or in formalin until analysis. All experimental procedures were approved by the Ethics Committee for Animal and Human Experimentation of the Universitat Autonoma de Barcelona.

[0172] Recombinant AAV vectors Serotype 9 single-stranded AAV vectors were generated by triple transfection of HEK293 cells according to standard methods (Ayuso, E. et al., 2010. Curr Gene Ther. 10(6):423-36). Cells were transfected into 10 roller bottles (850 cm 2 The cells were cultured in a 10% FBS DMEM (flat; Corning™, Sigma-Aldrich Co., St. Louis, MO, USA) until 80% confluence, and co-transfected using the calcium phosphate method with a plasmid carrying an expression cassette flanked by AAV2 ITRs, a helper plasmid carrying the AAV2 rep gene and the AAV serotype 9 cap gene, and a plasmid carrying adenovirus helper functions. The transgenes used were 1) a truncated human SpB promoter (SEQ ID NO: 12), 2) a CMV enhancer fused to a truncated human MLC2v promoter (SEQ ID NO: 15), or 3) a mouse codon-optimized (SEQ ID NO: 3) TERT coding sequence driven by a truncated human TNT promoter (SEQ ID NO: 16). A wild-type mouse TERT coding sequence (SEQ ID NO: 1) containing a 3'UTR driven by a ubiquitous CMV promoter was used as a control (Non-Patent Document 4). A non-coding plasmid was used to generate a null vector. AAV was purified with an optimized method based on a polyethylene glycol precipitation step and two successive cesium chloride (CsCl) gradients. This second generation CsCl-based protocol dramatically reduced empty AAV capsids as well as DNA and protein impurities (Ayuso, E. et al., 2010. Curr Gene Ther. 10(6):423-36). Purified AAV vectors were dialyzed against PBS, filtered and stored at -80°C. Viral vectors were determined by fluorescence using the Quant-iT™ PicoGreen™ dsDNA Assay Kit (Invitrogen). Viral vector titers were calculated using phage lambda DNA as a standard curve. Vectors were constructed according to molecular biology techniques known in the art.

[0173] Systemic administration of AAV vectors The appropriate amount of AAV solution was diluted in PBS containing 0.001% Pluronic™ and injected manually into the lateral tail vein without applying pressure at the moment of delivery. Prior to injection, the animals were placed under a 250W infrared heat lamp (Philips NV, Amsterdam, The Netherlands) for a few minutes to dilate the blood vessels and make the tail vein easier to see and more accessible. A plastic restrainer (Harvard Apparatus, Holliston, Massachusetts, USA) was used to immobilize the animals for injection. No anesthesia was used as appropriate restraining devices were used. A 30-gauge needle was utilized to inject the animals.

[0174] RNA analysis Total RNA was obtained from various tissues using isolation reagents (Tripure (Roche) for lung, liver, and heart samples, and QIAzol (Qiagen) for eWAT samples) and the RNeasy Tissue Minikit (Qiagen NV, Venlo, The Netherlands) according to the manufacturer's protocol. To remove residual viral genomes, total RNA was treated with DNAseI (Qiagen NV, Venlo, The Netherlands). The concentration and purity of the obtained RNA were determined using Nanodrop (ND-1000, ThermoCientific). For RT-PCR, 1 μg of RNA samples was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (04379012001, Roche, California, USA) according to the manufacturer's protocol. Real-time quantitative PCR was performed using LightCycle 480 SYBR Green I Master (Roche reference number 04887352001, Roche Diagnostics, Germany) in a SmartCycleII™ (Cepheid, Sunnyvale, USA). Data were normalized to Rplp0 values ​​and analyzed as previously described (Pfaffl, M., Nucleic Acids Res. 2001; 29(9):e45).

[0175] Characterization of AAV vectors by sedimentation velocity analytical ultracentrifugation AAV vectors were characterized by analytical ultracentrifugation (AUC). 450 microliters of sample was loaded into the sample compartment of a two-compartment velocity cell, and 450 μl of PBS + 0.001% PF68 was loaded into the corresponding reference compartment (Beckman-Coulter analytical ultracentrifuge Optima XLA equipped with UV-VIS absorption optics). Sedimentation velocity centrifugation was performed at 20000 rpm. Particle sedimentation was recorded at 260 nm and 280 nm during the same run. The relative percentage of each peak in the C(S) distribution was calculated based on the molar concentration of each species relative to the sum of the molar concentrations of all species in the distribution, as previously described (Burnham, B. et al., 2015, Hum Gene Ther Methods 26(6):228-42).

[0176] Determination of genomic integrity of AAV vectors by alkaline agarose gel electrophoresis The genomic integrity of the AAV vector was assessed by alkaline agarose gel electrophoresis (denaturing conditions), which allows the analysis of single-stranded DNA. First, 8 μg of vector genome was purified using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer's protocol. The extracted DNA (approximately 1 μg) was mixed with alkaline loading buffer, boiled at 95 °C for 5 min, and incubated on ice for 3 min. Then, the DNA was subjected to agarose gel electrophoresis under denaturing conditions. Finally, the size and quality of the bands were examined to assess the genomic integrity.

[0177] Visualization of expression GFP-positive cells in the heart, brown adipose tissue (BAT), epididymis, intestine, kidney, liver, lung, muscle, pancreas, spleen, testis, and white adipose tissue (WAT) were detected by immunohistochemical staining using a rabbit monoclonal antibody against GFP (D5.1, Cell Signaling, no. 2956) and visualized by light microscopy.

[0178] Computed tomography In-vivo lung imaging by computed tomography (CT) was performed in a high-resolution CT system (CT Locus, GE Healthcare) specifically designed for small laboratory animals. Mice were anesthetized with isoflurane (IsoVet Braun) at a rate of 4% during the induction period and 2% during the maintenance period (scan time). MicroCT image acquisition consisted of 400 projections collected with a 450 μA / 80 kV X-ray tube in a single bed focused on the lower extremities, with one complete rotation of the gantry in approximately 14 min. 2-D and 3-D images were acquired and analyzed using the software program MicroView (GE Healthcare).

[0179] statistical analysis All results are expressed as mean ± SEM. Differences between groups were compared by Student's t test. P < 0.05 was considered statistically significant.

[0180] Example 1.1. Lung-specific transgene expression by AAV using a truncated version of the human SpB promoter The length of the long TERT sequence typically used in the art in conjunction with AAV vectors of low encapsidation capacity (approximately 4.7 kb) greatly limits the number of promoter sequences that can be used in the expression cassette encoding telomerase without exceeding the encapsidation capacity of the AAV vector. In order not to exceed the AAV encapsidation capacity caused by utilizing a lung-specific promoter in conjunction with the TERT coding sequence and further components of the expression cassette (i.e., polyA sequence, ITR of AAV), a truncated (632 nucleotides, SEQ ID NO: 12) human surfactant protein B (SpB) promoter (size of wild-type human SpB promoter: 1597 nucleotides, SEQ ID NO: 11) was designed. The wild-type human SpB promoter drives expression in Clara cells and ATII cells in the lung.

[0181] To study whether the truncated human SpB promoter can mediate lung-specific transgene expression, an AAV9 vector encoding the marker protein GFP under the control of this truncated promoter (AAV9-SpB-GFP) or an AAV9 vector encoding the marker protein GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP) was cloned by triple transfection in HEK293 producer cells to generate 1.75 × 10 12 AAV9-SpB-GFP or AAV9-CMV-GFP vectors at a dose of 100 viral genomes (vg) were administered intravenously (IV) to mice via the tail vein. A group of mice administered saline IV was used as a control. GFP expression levels were assessed in the lung, liver, and epididymal white adipose tissue (eWAT) 4 weeks after AAV administration. GFP expression levels in the lung were lower than those mediated by the CMV promoter (Figure 1A), whereas the truncated SpB promoter prevented GFP expression in white adipose tissue and mediated an 80% reduction in GFP expression levels in the liver (Figure 1B). GFP expression in the lung, liver, heart, and brown adipose tissue (BAT) + Quantification of the percentage of cells further confirmed the lung specificity of the truncated SpB promoter (Figures 2 and 3). The use of truncated promoters could result in loss of specificity and indiscriminate transgene expression in off-target tissues other than the lung. Surprisingly, the truncated promoter used herein was able to mediate highly specific lung expression.

[0182] Example 1.2. Cardiac-specific transgene expression by AAV using a truncated cardiac-specific promoter A truncated version of the cardiomyocyte-specific MLC2v promoter (296 nucleotides, SEQ ID NO: 13) was also designed, and the CMV enhancer (380 nucleotides, SEQ ID NO: 14) was used in conjunction with the wild-type MLC2v promoter to increase the promoter strength of this truncated version (CMVenh-MLC2v, SEQ ID NO: 15).

[0183] To study whether the CMVenh-MLC2v promoter could mediate specific expression in the heart, 8-week-old male C57Bl6 mice were treated with two different doses (5 × 10 per mouse). 11 2 x 10 viral genomes (vg) per mouse (low (L) dose) 12 Each mouse was treated with 2 × 10 (high (H) dose) viral genomes (vg)) of the AAV9-CMVenh-MLC2v-GFP vector. As a control, two additional groups of mice were treated with the same dose of an AAV9 vector encoding GFP under the control of the ubiquitous CMV promoter (AAV9-CMV-GFP). Three weeks after AAV, the animals were sacrificed and the levels of GFP expression and production were assessed in various tissues. Specifically, 2 × 10 per mouse were treated with the AAV9-CMVenh-MLC2v-GFP vector. 12 Mice treated with a dose of 1 vg showed robust GFP expression in the heart (Figure 4A). + Quantification of the percentage of cells revealed that the number of transduced cells was higher in the hearts of animals treated with low and high doses of the AAV9-CMVenh-MLC2v-GFP vector than in mice administered the high dose of the AAV9-CMV-GFP vector (Figures 5A and 5B). Furthermore, the CMV-enhMLC2v promoter prevented the expression and production of GFP in the testis, epididymis, white adipose tissue, skeletal muscle, lung, intestine, brain, spleen, and kidney (Figures 4B and 5B). However, no GFP expression or production was observed in mice treated with the AAV9-CMVenh-MLC2v-GFP vector or the AAV9-CMV-GFP vector. + We were unable to restrict GFP production to pancreas, brown adipose tissue, or liver, tissues with similar cell percentages (Figures 4B and 5B). Although transgene expression mediated by the CMVenh-MLC2v promoter was not completely cardiac specific, use of this promoter prevented GFP expression in a greater number of tissues compared to the CMV promoter.

[0184] To achieve greater cardiac specificity than that exhibited by the CMVenh-MLC2v promoter, a truncated version of the human troponin (TNT) promoter (544 nucleotides, SEQ ID NO: 16) was used. To assess the strength and tissue specificity of the truncated version of the TNT promoter, 1.75×10 12 vg of AAV9-TNT-GFP vector was administered to 7-week-old male C57Bl6 mice. As a control, one group of mice was administered 1.75 × 10 12 5 vg of AAV9-CMV-GFP vector. Four weeks after AAV administration, mice were sacrificed and GFP expression levels were evaluated. The truncated form of the TNT promoter mediated GFP expression levels in the heart similar to those obtained with the CMV promoter (Figure 6). Furthermore, mice treated with the AAV9-TNT-GFP vector showed lower GFP levels in the liver (25% reduction) than animals given the AAV9-CMV-GFP vector, indicating no transgene expression in white and brown adipose tissue (Figures 6 and 7).

[0185] Example 1.3. Optimization of viral genome size prevents the generation of AAV intermediate species Telomerase expression in the lung using an AAV9 vector encoding mouse telomerase under the control of a CMV promoter (AAV9-CMV-mTert) has been reported to mediate therapeutic benefit in pulmonary fibrosis and myocardial infarction (Non-Patent Document 6, Non-Patent Document 7). However, the size of the viral genome of the AAV9-CMV-mTert vector was 5291 nucleotides, which significantly exceeded the AAV encapsidation limit of approximately 4.7 kb. Furthermore, due to the large size of the viral genome, a polyA sequence could not be included in the expression cassette. The generation of the above AAV vectors resulted in vectors containing several different intermediate species (Figure 8A). Of note, no AAV vectors containing the full-length viral genome were clearly detected (Figure 8A). Furthermore, analysis of the genome integrity of the AAV9-CMV-mTert vector revealed a band of approximately 5.3 kb corresponding to the full-length AAV genome and a broad smear corresponding to the deleted genome (Figures 9A and 9B). Similar results were obtained when evaluating the genomic integrity and generation of AAV intermediate species for an AAV9 vector (AAV9-CMV-mTERT-DN) (Non-Patent Document 4) encoding a catalytically inactive form of murine telomerase under the control of a CMV promoter and with a viral genome size of 5291 nucleotides (Figures 8B and 9A).

[0186] To avoid the generation of intermediate species in AAV vectors encoding telomerase under the control of a truncated form of the human SpB promoter, a comprehensive study of the coding sequences of mouse telomerase (mTERT) and human telomerase (hTERT) was performed. The mTERT cDNA (3786 nucleotides, SEQ ID NO:1) was modified by deleting the 3'UTR of the mRNA, without changing the amino acid sequence of the protein, resulting in a coding sequence of 3369 nucleotides in length (SEQ ID NO:2), minimizing the length of the TERT coding sequence. Furthermore, the sequence was codon-optimized to improve protein production (moTERT, SEQ ID NO:3). The reduction in size of the TERT coding sequence and the use of a truncated form of the human SpB promoter, the CMVenh-MLC2v promoter, or the TNT promoter allowed the inclusion of the bovine growth hormone polyA sequence (SEQ ID NO:18) in the expression cassette without exceeding the encapsidation limit of AAV. Specifically, the viral genome size was 4638 nucleotides for AAV9-SpB-moTERT (SEQ ID NO: 21), 4676 nucleotides for AAV9-CMVenh-MLC2v-moTERT (SEQ ID NO: 22), and 4536 nucleotides for AAV9-TNT-moTERT (SEQ ID NO: 23). Inclusion of a polyA sequence in the expression cassette may improve TERT protein production by increasing mRNA stability, translation efficiency, and promoting proper termination of the mRNA by avoiding the generation of undesired 3'UTR sequences. No AAV intermediate species were detected for these vectors (Figures 8C-8E). Analysis of genome integrity revealed a band of approximately 4.7 kb corresponding to the full-length AAV genome, further confirming the absence of truncated genomes (Figures 9A and 9B). Furthermore, the higher intensity of the bands corresponding to full-length vector genomes observed in AAV9-Spb-moTERT, AAV9-CMVenh-MLC2v-moTERT, and AAV9-TNT-moTert indicated a higher number of full-length genomes in these AAV preparations compared to AAV9-CMV-mTERT and AAV9-CMV-mTERT-DN (Figures 9A and 9B).

[0187] Example 1.4. AAV9-SpB-moTERT vector mediates therapeutic benefit in pulmonary fibrosis We next evaluated whether the AAV9-SpB-moTERT vector could mediate therapeutic benefit in pulmonary fibrosis. We used a mouse model of pulmonary fibrosis induced by short telomeres (Povedano el al (2015) Cell Rep 12, 286-299). This model involved the transfection of 8-week-old G3-Tert mice. - / - The study was based on intratracheal instillation of bleomycin (0.5 mg / kg body weight) in male mice at a low dose, a dose that does not induce fibrosis in wild-type mice with normal telomeres. Two weeks after bleomycin insult, computed tomography (CT) scans were performed on each mouse to diagnose bona fide pulmonary fibrosis patterns. Mice diagnosed with pulmonary fibrosis were treated with 2 × 10 12 Either vg of AAV9-SpB-moTERT vector or AAV9-null vector was administered intravenously (IV). CT scans were performed 1, 3, and 5 weeks after viral treatment to longitudinally follow the progression of the disease. The reduction in lung disease volume showing abnormal CT patterns compared to the start of treatment was significantly higher in mice transduced with AAV9-SpB-moTERT compared to mice transduced with AAV9-null already after 1 week (Figure 10A and Figure 10B).

[0188] Example 1.5. Comparative study of the efficacy of AAV9-CMV-mTERT and AAV9-SpB-moTERT in the regression of pulmonary fibrosis The therapeutic efficacy of AAV9-SpB-moTERT in treating pulmonary fibrosis was also evaluated compared to the AAV9-CMV-mTERT vector. - / - Male mice were intratracheally inoculated with bleomycin, and CT scans were performed on each mouse 2 weeks after bleomycin insult to determine whether the mouse had a bona fide pulmonary fibrosis pattern. 12 vg AAV-CMV-null, 2 x 10 12 1 x 10 vg AAV9-CMV-mTERT, or 2 x 1012 Mice were administered either 100-200 mg of AAV9-SpB-moTERT or 100-200 mg of AAV9-SpB-moTERT IV. Prior to bleomycin insult, an initial CT scan was performed on each mouse to calculate healthy lung volume at baseline and to further calculate disease progression.

[0189] Disease progression was followed longitudinally by CT at 1, 2, 4, 6, and 8 weeks after AAV9 treatment. No change in disease volume was detected between 6 and 8 weeks after AAV9 treatment, indicating disease chronicity (Figure 11A). Therefore, the rate of disease volume reduction was calculated during the first 6 weeks of treatment. The rate of disease lung volume reduction was similar in both AAV9-CMV-mTERT and AAV9-SpB-moTERT treatments and was faster than the control group (Figures 11A and 11B). Mice were sacrificed 8 weeks after treatment. TERT expression levels and activity (TRAP) were measured in lung samples. Telomerase expression was analyzed by qPCR. Telomerase activity was measured as previously described (Herbert et al. Nat Protoc 1;583-1590, (2006) (incorporated in its entirety by reference). The results demonstrate higher TERT expression and higher telomerase activity in animals treated with both AAV9-CMV-mTERT and AAV9-SpB-moTERT compared to untreated animals (Figures 12A and 12B).

[0190] Example 1.6. Telomere Length, Tert Expression, and Telomerase Activity Immune-q-Fish using anti-SPC, a specific antibody for ATII cells, and a telomere probe was performed to quantify telomere intensity in lung sections from AAV9-CMV-mTert (n=7), AAV9-SpB-moTert (n=7), and AAV9-CMV-null (n=6) treated mice. Both the AAV9-CMV-mTert and AAV9-SpB-moTert groups showed increased mean nuclear intensity and mean spot intensity in SPC-negative cells as well as in ATII cells compared to the AAV9-CMV-null treated group (Figures 13A-D). Furthermore, the percentage of short telomeres (below the 20th percentile of the AAV9-CMV-null control samples) was lower in AAV9-CMV-mTert and AAV9-SpB-moTert compared to the AAV9-CMV-null control samples (Figures 13E and 13F). The percentage of long telomeres (above the 80th percentile of the AAV9-CMV-null control samples) was higher in AAV9-CMV-mTert and AAV9-SpB-moTert compared to the AAV9-CMV-null control samples (Figures 13G and 13H). Representative images of the assay are shown in Figure 13I. These results indicate an increase in bona fide telomere length in lungs treated with AAV9-CMV-mTERT and AAV9-SpB-moTERT.

[0191] The expression levels of Tert and telomerase activity were determined by q-PCR and TRAP analysis in the lung, liver, brain, and heart, respectively (Figure 14). The results confirm that AAV9-SpB-moTERT is not expressed in the heart or brain.

[0192] Example 2. Comparative study of the efficacy of AAV9-CMV-mTERT and AAV9-SpB-moTERT in the regression of pulmonary fibrosis AAV9-SpB-moTERT and AAV9-CMV-mTERT were evaluated for their therapeutic efficacy in pulmonary fibrosis (PF) regression. A mouse model of short telomere-induced pulmonary fibrosis was used. This model involved 8-week-old G3-Tert- / - The method was based on intratracheal instillation of low doses of bleomycin (0.5 mg to 0.7 mg per kg of body weight) in male mice, a dose that does not induce fibrosis in wild-type mice with normal telomeres. Prior to bleomycin (BLEO) insult, an initial CT scan was performed on each mouse to calculate healthy lung volume and further calculate disease progression. Two weeks after BLEO insult, a computed tomography (CT) scan was performed on each mouse to diagnose bona fide pulmonary fibrosis patterns.

[0193] the purpose Evaluation of therapeutic efficacy in PF regression mediated by AAV9-SpB-moTert compared with AAV9-CMV-mTert vector.

[0194] Study design vector: AAV9-CMV-null (SEQ ID NO:24 represents the AAV-CMV-null recombinant adeno-associated virus genome), AAV9-CMV-Tert (SEQ ID NO:25 represents the AAV-CMV-Tert recombinant adeno-associated virus genome), AAV9-SpB-moTert (SEQ ID NO: 21 represents the AAV-SpB-moTert recombinant adeno-associated virus genome).

[0195] Dosage: 2 x 10 per mouse 12 pcs vg.

[0196] G3-Tert - / - Male mice (n=48) were administered bleomycin (0.7 mg / kg body weight) intratracheally. Prior to bleomycin (bleo) insult, an initial CT scan was performed on each mouse to calculate healthy lung volume and further calculate disease progression. Two weeks after bleo insult, computed tomography (CT) was performed on each mouse to diagnose bona fide pulmonary fibrosis patterns. Mice diagnosed with pulmonary fibrosis were administered 2×10 12 vg AAV9-CMV-null (n=7), 2 x 10 12vg AAV9-CMV-mTert (n=8), or 2 x 10 12 Patients were administered either 100- or 200-mg doses of AAV9-SpB-moTert (n=9) IV. Disease progression was followed longitudinally by CT at 1, 2, 4, 6, and 8 weeks after AAV9 treatment.

[0197] In FIG. 15, the experimental setup is shown.

[0198] Materials and Methods Test and control articles A solution of bleomycin (15361 from Sigma-Aldrich) (0.7 mg / ml) was prepared for intratracheal administration to induce pulmonary fibrosis in mice (0.7 mg / kg body weight). Mice were anesthetized by intraperitoneal (IP) injection of a solution (5 mL / g body weight) containing fentanyl, medetomidine, and midazolam (40% (v / v)-20% (v / v)-40% (v / v)). Anesthesia was reversed by IP injection of a solution (3.5 mL / g body weight) containing naloxone and atipamezole (85% (v / v)-15% (v / v)).

[0199] The viral vectors tested were AAV9-CMV-null, AAV9-CMV-Tert, and AAV9-SpB-moTert. AAV9-CMV-null was used as a negative control for telomerase expression. The viral vectors were administered intravenously (IV) by tail injection.

[0200] Test system 8-week-old G3-Tert - / -Male mice were inoculated with bleomycin (Sigma-Aldrich 15361) solution (0.7 mg / ml) by intratracheal instillation to induce pulmonary fibrosis in mice (0.7 mg / kg body weight). An intravascular catheter (24 gauge, 0.75 inches, 0.7 mm x 19 mm) was used for the instillation (BD Insyte, ref: 381212, lot: 9143584). Mice were anesthetized by intraperitoneal (IP) injection of a solution (5 mL / g body weight) containing fentanyl, medetomidine, and midazolam (40% (v / v)-20% (v / v)-40% (v / v)). Anesthesia was reversed by IP injection of a solution (3.5 mL / g body weight) containing naloxone and atipamezole (85% (v / v)-15% (v / v)).

[0201] Three weeks after bleo-injury, CT scans were performed on each mouse to determine whether it had a bona fide pulmonary fibrosis pattern. Mice diagnosed with pulmonary fibrosis were treated with 2 × 10 12 vg AAV-CMV-null, 2 x 10 12 1 x 10 vg AAV9-CMV-mTert, or 2 x 10 12 Mice were administered either 1000 or 1000 vg of AAV9-SpB-moTert IV. An initial CT scan was performed on each mouse prior to bleomycin injury to calculate baseline healthy lung volume and to further calculate disease progression. Disease progression was followed longitudinally by CT scan at 1, 2, 4, 6, and 8 weeks after AAV9 treatment. Eight weeks after virus treatment, mice were sacrificed for biochemical and histopathological studies.

[0202] Experimental protocol The aim of this work was to address the therapeutic efficacy in the regression of pulmonary fibrosis mediated by AAV9-SpB-moTert compared to AAV9-CMV-mTert vector. After 8 weeks, animals were sacrificed and samples (lung, liver, heart, and brain) were harvested. Tissue samples analyzed by qPCR or TRAP were collected on dry ice, while tissue samples for immunohistochemistry analysis were collected directly in formalin and further embedded in paraffin blocks. Tissue samples (lung, liver, heart, and brain) were collected for comparative analysis of telomerase expression (q-RT-PCR) and activity (TRAP) levels. Paraffin blocks of mouse tissues are also collected for toxicity evaluation. Immunohistopathological studies of lungs were performed by immunohistochemistry and immunofluorescence staining. Furthermore, telomere length studies were performed by quantitative fluorescence in situ hybridization technique (q-Fish) in Clara cells and alveolar type II cells.

[0203] Telomerase Expression The transcriptional expression level of Tert was analyzed by q-RT-PCR using forward primer (5'-CTTCTTCCTGCACTTCCTGC-3') and reverse primer (5'-GGGATGCCCTGGCACTG-3'). RNA samples were extracted using Trizol and zirconium beads. cDNA was synthesized using the iScript Adv cDNA Kit for RT-qPCR (Bio-Rad, ref: 1725037, batch: 64375699).

[0204] Telomerase activity Telomerase activity was analyzed by the telomeric repeat amplification protocol (TRAP) described by Herbert et al., 2006 (Herbert et al., Nature Protocols, 2006).

[0205] immunohistochemistry Tissue samples were fixed in 10% buffered formalin, dehydrated, embedded in paraffin wax, and sectioned at 2.5 μm. Tissue sections were deparaffinized in xylene and rehydrated through a graded series of ethanol to water. Immunohistochemistry (IHC) was performed on deparaffinized tissue sections treated with 10 mM sodium citrate (pH 6.5) boiled under pressure for 2 min. Masson's trichrome and picrosirius red staining were performed to quantify collagen deposits. IHC staining of SMA, F4 / 80, gH2AX, p53, and p21 in lung sections was performed with mouse monoclonal (1a4) DAKO IR611, rat monoclonal (CI:A3-1) ABD serotec MCA497, mouse monoclonal (JBW301) Millipore 05-636, rat monoclonal (POE316 A / E9) CNIO monoclonal antibody core unit AM (POE316), and rat monoclonal (291H / B5) CNIO monoclonal antibody core unit, respectively. Slides were counterstained with hematoxylin and analyzed by light microscopy.

[0206] immno q-Fish Immunostaining of prosurfactant protein C (SP-C) and secretoglobin family 1A member 1 (SCGB1A1 or CC10) in lung sections was performed using rabbit polyclonal anti-proSP-C (Merck, AB3786) and mouse monoclonal anti-CC10 (Santa Cruz, sc-365992) conjugated to Alexa Fluor 488. After immunostaining, telomere length in alveolar type II cells and Clara cells was analyzed by quantitative telomere fluorescence in situ hybridization technique (q-Fish) after fixation with 4% paraformaldehyde for 20 min.

[0207] Data Analysis and Management Statistical significance is addressed by unpaired two-tailed Student's test.

[0208] result A total of 48 mice were administered 0.7 mg bleomycin per kg body weight. CT scans were performed 3 weeks later and pulmonary fibrosis was diagnosed (Figure 15). Twenty-four mice showed abnormal CT patterns consistent with a fibrotic phenotype. Mice diagnosed with pulmonary fibrosis (n=24) were administered 2×10 12 vg AAV-CMV-null (n = 7), 2 × 10 12 vg AAV9-CMV-mTert (n=8), or 2 x 10 12 Each subject received either one of the following immunizations IV: one vg of AAV9-SpB-moTert (n=9);

[0209] Molecular imaging results Disease progression was followed longitudinally by CT at 1, 2, 4, 6, and 8 weeks after AAV9 treatment (Figure 15). No change in disease volume was detected between 6 and 8 weeks after AAV9 treatment, indicating that the disease was chronic. Therefore, the rate of disease volume reduction was calculated during the first 6 weeks of treatment. The rate of disease lung volume reduction was similar in both AAV9-CMV-mTert and AAV9-SpB-moTert treatments, and reduced faster than the control group (Figure 11A, Figure 11B). After 8 weeks of treatment, mice were sacrificed and formalin and fresh tissue samples (liver, heart, brain, and lung) were collected for immunohistochemistry and expression / activity analysis.

[0210] Results of histopathological analysis Histopathological analysis was performed blindly by a mouse pathologist. All lung samples were given a histologic score for pulmonary fibrosis. Semiquantitative scoring of pulmonary fibrosis (grade 0 to grade 4) was based on the analysis of 10 fields (200x) stained with Sirius Red (Lawson et al., 2005, 2011; Degryse AL et al., 2012) (Figure 16). The definition of each grade is as follows: Grade 0: normal lung structure; Grade 1: Increase in thickness of part (50% or less) of the interalveolar septum; Grade 2: thickening of more than 50% of the interalveolar septa without the formation of fibrotic lesions; Grade 3: thickening of the interalveolar septa with the formation of isolated fibrotic lesions; Grade 4: numerous fibrotic lesions with total or subtotal distortion of the parenchymal architecture.

[0211] The results are presented in Figure 16. The AAV9-CMV-null treated control group showed a 2-fold higher PF score compared to both the AAV9-CMV-Tert and AAV9-SpB-Tert treated groups (Figure 17A). Of note, no significant difference was observed between the AAV9-CMV-Tert and AAV9-SpB-Tert treated groups, indicating that both vectors were equally effective in reversing the fibrotic phenotype. These results are consistent with the CT values ​​8 weeks after treatment (Figure 17B). Indeed, Pearson correlation analysis between the CT values ​​and the PF scores shows a highly significant correlation (p<0.0001) (Figure 17C).

[0212] A complete histopathological analysis of all organs was also performed, revealing no secondary effect of telomerase gene therapy in the 8-week treatment time window. Pathological findings are listed in Table 2. The observed pneumonia was induced by bleomycin treatment. The pathology observed in the liver, kidney, and intestine in some mice was sporadic and common in mice. Tubular atrophy in the testes is characteristic of telomerase-deficient mice.

[0213] TIFF2024521063000004.tif60170

[0214] Results of telomerase expression and telomerase activity Telomerase expression levels (q-RT-PCR) and activity (TRAP) were measured in lung samples. Results show higher Tert expression and higher telomerase activity in both AAV9-CMV-mTert and AAV9-SpB-moTert treated animals compared to untreated animals (Figures 12A and 12B).

[0215] Expression levels (q-RT-PCR) (Figures 18A-C) and activity (TRAP) of telomerase were measured in liver, heart, and brain samples (Figures 19A-C). Telomerase was detected with both AAV9-CMV-Tert and AAV9-SpB-Tert vectors in the liver, and only with AAV9-CMV-Tert in the heart. In brain samples, telomerase was detected with both AAV9-CMV-Tert and AAV9-SpB-Tert vectors, but at very low levels compared to other analyzed tissues. After 8 weeks of treatment, no significant differences in telomerase activity were detected among the three vectors in the liver, heart, and brain, with the only exception of the liver sample infected with AAV9-CMV-Tert (Figures 19A-C). The results confirm that AAV9-SpB-moTERT is not expressed in either the heart or the brain.

[0216] Analysis of telomere length by quantitative fluorescence in situ hybridization (q-Fish) Immune-q-Fish using anti-SPC, a specific antibody for ATII cells, and a telomere probe was performed to quantify telomere intensity in lung sections from AAV9-CMV-null (n=6), AAV9-CMV-mTert (n=7), and AAV9-SpB-moTert (n=7) treated mice. Representative images of the assay are shown in Figure 13. Both the AAV9-CMV-mTert and AAV9-SpB-moTert groups showed increased mean nuclear intensity and mean spot intensity in ATII cells compared to the AAV9-CMV-null treated group (Figure 13). Furthermore, the percentage of short telomeres (below the 20th percentile of the AAV9-CMV-null control sample) was lower in the AAV9-CMV-mTert and AAV9-SpB-moTert compared to the AAV9-CMV-null control sample (Figure 13). The percentage of long telomeres (above the 80th percentile of the AAV9-CMV-null control samples) was higher in AAV9-CMV-mTert and AAV9-SpB-moTert compared to the AAV9-CMV-null control samples (Figure 13). These results indicate an increase in bona fide telomere length in lungs treated with AAV9-CMV-moTERT and AAV9-SpB-moTERT.

[0217] Immune-q-Fish using anti-CC10, a Clara cell specific antibody, and a telomere probe was performed to quantify telomere intensity in lung sections from AAV9-CMV-null (n=6), AAV9-CMV-mTert (n=7), and AAV9-SpB-moTert (n=7) treated mice. Representative images of the assay are shown in Figure 20. No differences were detected in the mean nuclear intensity, mean spot intensity, percentage of short telomeres (below the 20th percentile of AAV9-CMV-null control samples), or percentage of long telomeres (above the 80th percentile of AAV9-CMV-null control samples) among the three groups (Figures 21A-D). These results indicate that neither the AAV9-CMV-mTert nor the AAV9-SpB-moTert vectors are expressed in Clara cells.

[0218] Immunohistochemical analysis results Histological examination of the lungs at the endpoint (8 weeks after AAV9 treatment) showed that AAV9-SpB-moTert-treated lungs displayed less collagen accumulation, reduced presence of activated myofibroblasts (SMA), and less macrophage infiltration (F4 / 80) compared to AAV9-CMV-null controls (Figure 22). Furthermore, AAV9-SpB-moTert-treated lungs showed a lower number of damaged cells (gH2AX-positive cells), and therefore a reduced number of p53-positive and p21-positive cells (Figure 23).

[0219] conclusion Fewer fibrotic lesions at endpoint in Tert-treated mice The presence of activated fibroblasts and reduced macrophage infiltration (SMA and F4 / 80), Reduced DNA damage and attenuated DDR, Increased number of ATII cells, Immuno qFISH Spc / Tel and CC10 / Tel. Longer telomeres in ATII cells in Tert-treated mice. No effect on telomere length in Clara cells.

[0220] Example 3. Evaluation of intratracheal delivery route and selection of the best AAV serotype and promoter for genetic engineering of the lung Localized delivery of AAV vectors to the airways has been reported via intranasal or intratracheal administration (Limberis, MP., et al. Proc Natl AcadSci USA 2006 Aug 29;103(35):12993-8; Lisa A Santry. BMC Biotechnol. 2017 May 15;17(1):43; Laura P. van Lieshout, Methods Mol Biol. 2019;1950:361-372; Katz, MG. et al. J Cardiovasc Dev Dis. 2019 Feb 15;6(1):8; Kang, M. et al., Nat Commun. 2020 Aug6;11(1):3929). The development of neutralizing antibodies is a key barrier for all gene therapies, including viral vectors. In this sense, the lung is one organ that can be repeatedly administered. In this regard, rechallenge of AAV vectors upon localized delivery to the airways has been reported in mice, rabbits, non-human primates, and patients with cystic fibrosis (CF) (Limberis, MP., et al. Proc Natl AcadSci USA 2006 Aug 29;103(35):12993-8; Guggino, BW., et al. Expert OpinBiolTher. 2017 Oct;17(10):1265-1273). Rechallenge was possible as early as one month after the initial exposure, even in the presence of high levels of serum circulating neutralizing antibodies, with minimal effect on overall transgene expression (Limberis, MP., et al. Proc Natl AcadSci USA 2006 Aug 29;103(35):12993-8, Guggino, BW., et al. Expert OpinBiolTher. 2017 Oct;17(10):1265-1273).

[0221] Purpose of this Example Pulmonary transduction efficiency of AAV9 and AAV6 serotypes by intratracheal local administration route, pulmonary tropism of AAV6 versus AAV9 serotypes; Comparative study between CMV promoter and SpB promoter Lung transduction efficiency with various viral titers Biodistribution and tissue specificity of the SpB promoter.

[0222] Study design vector: AAV9-CMV-null (SEQ ID NO:24 represents the AAV-CMV-null recombinant adeno-associated virus genome), AAV9-CMV-GFP (SEQ ID NO:26 represents the AAV-CMV-GFP recombinant adeno-associated virus genome), AAV9-SpB-GFP (SEQ ID NO:27 represents the AAV-SpB-GFP recombinant adeno-associated virus genome), AAV6-CMV-null (SEQ ID NO:24 represents the AAV-CMV-null recombinant adeno-associated virus genome), AAV6-CMV-GFP (SEQ ID NO:26 represents the AAV-CMV-GFP recombinant adeno-associated virus genome), AAV6-SpB-GFP (SEQ ID NO:27 represents the AAV-SpB-GFP recombinant adeno-associated virus genome).

[0223] Dosage: 10 per mouse 11 VG, 5 x 10 per mouse 11 VG, 10 per mouse 12 pcs vg.

[0224] Healthy wild-type mice were intratracheally administered vectors at the doses mentioned above. Mice were sacrificed 3 weeks or 9 weeks after infection. GFP expression was evaluated in five lung lobes: right upper lobe, right middle lobe, right lower lobe, retrocaval lobe, and left lobe. GFP expression was also evaluated in liver, heart, and brain to address off-target tissues. GFP expression was analyzed by quantitative PCR and immunohistochemistry. The experimental setup is shown in Figure 24.

[0225] Materials and Methods Test and control articles The viral vectors tested were AAV9-CMV-null, AAV9-CMV-GFP, AAV9-SpB-GFP, AAV6-CMV-null, AAV6-CMV-GFP, and AAV6-SpB-GFP. AAV9-CMV-null and AAV6-CMV-null were used as negative controls for GFP expression.

[0226] Test system Nine-week-old wild-type mice with a genetic background of C57BL / 6J.OlaHsd were inoculated by intratracheal instillation with 30 mL of PBS 0.001% Pluronic F-68 (Gibco, ref. no.: 240-032, lot: 1836664) containing the viral vector. An intravascular catheter (24 gauge, 0.75 in., 0.7 mm x 19 mm) was used for the instillation (BD Insyte, ref. no.: 381212, lot: 9143584). Mice were anesthetized by inhalation using 1%–3% isoflurane in oxygen.

[0227] Experimental protocol The objective of this embodiment was to address the following: 1. Pulmonary transduction efficiency of AAV9 and AAV6 serotypes by intratracheal local administration route, 2. Lung tropism of AAV6 versus AAV9 serotypes; 3. Comparative study between CMV promoter and SpB promoter. 3. Lung transduction efficiency with various viral titers 4. Biodistribution and tissue specificity of the SpB promoter.

[0228] Six different vectors (AAV9-SpB-GFP, AAV6-SpB-GFP, AAV9-CMV-GFP, AAV6-CMV-GFP, AAV9-CMV-nul, and AAV6-CMV-null) were transfected at three different viral doses (10 11 , 5×10 11 , or 10 12 ) in healthy wild-type mice. A total of 120 mice were assigned to this assay. After 3 and 9 weeks, animals were sacrificed and samples (lungs, liver, heart, and brain) were collected.

[0229] Five lung lobes were sampled separately to assay whether viral spread was uniform between lobes. Lung samples analyzed by qPCR were collected on dry ice, and lung samples for immunohistochemistry were collected directly in formalin and embedded in paraffin blocks.

[0230] The transcriptional expression level of GFP was analyzed by q-RT-PCR using the forward primer (5'-AGC TGG ACG GCG ACG TAA-3') and reverse primer (5'-GTG CAG ATG AAC TTC AGG GTC A-3'). RNA samples were extracted using Trizol and zirconium beads. cDNA was synthesized using the iScript Adv cDNA Kit for RT-qPCR (Bio-Rad, ref: 1725037, batch: 64375699).

[0231] Immunohistochemical detection of GFP, SPC, and CC10 Tissue samples were fixed in 10% buffered formalin, dehydrated, embedded in paraffin wax, and sectioned at 2.5 μm. Tissue sections were deparaffinized in xylene and rehydrated through a graded series of ethanol to water. Immunohistochemistry (IHC) was performed on deparaffinized tissue sections treated with 10 mM sodium citrate (pH 6.5) boiled under pressure for 2 min. IHC staining of GFP in lung, liver, brain, and heart sections was performed with rabbit monoclonal (D5.1) anti-GFP (1:100, Cell Signaling Technology). IHC staining of prosurfactant protein C (SP-C) in lung sections was performed with rabbit monoclonal (EPR19839) anti-SPC (1:100, ABCAM, ref: ab211326). IHC staining of secretoglobin family 1A member 1 (SCGB1A1 or CC10) in lung sections was performed using goat polyclonal (EPR19839) anti-CC10 (1:100, ABCAM, ref: ab211326). Slides were counterstained with hematoxylin and analyzed by light microscopy.

[0232] Data Analysis and Management Statistical significance is addressed by unpaired two-tailed Student's test.

[0233] Deviations Any deviations from the protocol, either planned or unplanned, will be documented in this study report.

[0234] Planned deviation Lung samples corresponding to mice sacrificed 9 weeks after infection were collected as follows: the left lung lobe was collected on dry ice and stored at -80 °C for q-RT-PCR analysis; the right lobe was fixed in formalin and placed in a single cassette for paraffin embedding for IHC analysis. This deviation was planned based on the results from the analysis of GFP expression levels 3 weeks after infection, taking into account that no significant differences in the spread of the virus were detected between the different lung lobes.

[0235] result Quantification of GFP expression in lung samples by q-RT-PCR at 3 and 9 weeks after infection with viral vectors Results from q-RT-PCR analysis in different lung lobes 3 weeks after infection are shown in Figure 25. No difference in viral spread between different lobes was observed for any of the vectors used. Therefore, all data from 5 different lobes from each lung were pooled (Figure 26A). In Figure 26B, data corresponding to q-RT-PCR analysis in the left lung lobe 9 weeks after infection are shown. Expression levels were maintained from 3 weeks after infection to 9 weeks after infection. This observation prompted us to pool data from mice sacrificed at 3 and 9 weeks to increase the sample size (Figure 27). The results show that the AAV6 serotype leads to higher expression levels than the AAV9 serotype at all virus doses studied, and that the SpB and CMV promoters give similar expression levels. Furthermore, at 5 x 10 per mouse, 11 10 per vg and mouse 12 No difference in GFP expression levels was observed between the 5×10 vg and 5×10 virus titers per mouse. 11 This indicates that infectivity saturates at virus titers below 1 vg.

[0236] Quantification of GFP-positive cells in lung samples by IHC at 3 and 9 weeks after infection with viral vectors Results from IHC analysis in different lung lobes 3 weeks after infection are shown in Figure 28. No difference in viral spread was observed between the different lobes for any of the vectors used, indicating a homogeneous distribution of viral particles throughout the lobes (Figure 28). Therefore, all data from the five different lobes from each lung were pooled (Figure 29A). In Figure 29B, data corresponding to IHC analysis in the left lung lobe 9 weeks after infection are shown. The percentage of GFP-positive cells was maintained from 3 weeks after infection to 9 weeks after infection for all viral vectors, except for AAV9-CMV-GFP, which was not detectable 9 weeks after infection at triplicate titers in the assay (Figure 29). This result points out that the AAV6 serotype shows a higher lung tropism than the AAV9 serotype at all viral doses studied. Also, viral vectors driving GFP expression under the SpB promoter lead to a higher number of infected cells than viral vectors with the CMV promoter, independent of serotype. Moreover, 5 × 10 per mouse 11 10 per vg and mouse 12 No difference in the percentage of GFP-positive cells was observed between the 5 × 10 vg and 5 × 10 virus titers per mouse. 11 The percentage of GFP-positive cells was maintained from 3 to 9 weeks after infection with AAV9-SpB-GFP and AAV6-SpB-GFP vectors for the three virus doses studied, indicating saturation of infectivity at viral titers of 1 vg or less.

[0237] AAV9-CMV-GFP and AAV6-CMV-GFP transduced lungs revealed very few GFP-positive cells, less than 0.3% and 1% of total lung cells, respectively, 9 weeks after infection.

[0238] 10 per mouse with all vectors studied 12 Representative images corresponding to individual vg titers are shown in FIG.

[0239] Identification and quantification of alveolar type II cells and Clara cells targeted by viral vectors in lung samples To determine the percentage of alveolar type II cells (ATII) and Clara cells targeted by the various viral vectors studied in this example, double staining by IHC with anti-GFP and either anti-SpC or anti-CC10, specific markers for ATII and Clara cells, respectively, was performed. The lungs analyzed correspond to mice sacrificed 9 weeks after infection. Representative images of these stainings are shown in Figures 31 and 32. Lungs infected with AAV9-CMV-GFP show less than 0.3% GFP-positive cells (Figure 29B). Lungs infected with AAV6-CMV-GFP show less than 1% GFP-positive cells (Figure 29B), none of which were CC10 positive, indicating that this vector does not target Clara cells. GFP-positive cells were mainly SPC-positive, but some GFP-positive cells were also found to be SPC / CC10 negative, indicating that this vector also targets other cell types besides Clara and ATII cells.

[0240] Lungs infected with AAV9-SpB-GFP showed 5.7%, 4%, and 10% GFP-positive cells (Figure 29B), of which 100% were SPC positive, indicating that this vector targets only ATII cells.

[0241] Quantification data in lungs transduced with AAV6-SpB-GFP at three different viral titers are shown in Figure 33. The percentage of SpC-positive cells, i.e., ATII cells, represents 14% to 17% of total lung cells at the three different viral titers analyzed (Figure 33A). Of the total ATII cells, 36%, 45%, and 55% were present at 10 ng / mouse, respectively. 11 vg, 5 x 10 per mouse 11 vg, and 10 per mouse 12 Of the total GFP-positive cells, 73%, 78%, and 73% 78% were GFP-positive at 10 ng / vg / mouse, respectively. 11vg, 5 x 10 per mouse 11 vg, and 10 per mouse 12 The percentage of CC10-positive cells, i.e., Clara cells, targeted by AAV6-SpB-GFP was 10 per mouse. 11 vg, 5 x 10 per mouse 11 vg, and 10 per mouse 12 In the vg, these correspond to 7%, 15.5%, and 20.2%, respectively (Figure 33D). Of the total GFP-positive cells, 11.5%, 21.4%, and 32.2% correspond to Clara cells (Figure 33E). Thus, AAV6-SpB-GFP targets ATII cells (approximately 80%) and Clara cells (approximately 20%).

[0242] Off-target organs: viral tropism to liver, heart, and brain Quantification of GFP-positive cells by IHC in the liver and heart 3 and 9 weeks after infection with viral vectors Results from IHC analysis in liver and heart samples 3 and 9 weeks after infection are presented in Figure 34. For comparison purposes, results from lung samples are also shown. AAV6 serotypes did not target either liver or heart, since no GFP-positive cells were detected at either time point. AAV9-CMV-GFP and AAV9-SpB-GFP led to GFP-positive cells in liver 3 and 9 weeks after infection, with the percentage of GFP-positive cells being higher with AAV9-CMV-GFP than with AAV9-SpB-GFP at a given viral titer. The number of GFP-positive cells was significantly reduced at 9 weeks compared to 3 weeks after infection (Figure 34A, Figure 34B). In heart samples from mice transduced with AAV9-CMV-GFP, 10 per mouse was detected. 11 5 x 10 per vg and mouse 11 Only a small number of GFP-positive cells, less than 0.1% of total cardiac cells, were detected 3 weeks after infection with higher viral titers of 1 vg (FIGS. 34C, 34D).

[0243] Clearly, these results confirm not only the specificity of the SpB promoter for lung cells, particularly ATII and Clara cells, but also the fewer off-target organs when AAV6 was used compared to the AAV9 serotype (Figure 34E, Figure 34F).

[0244] Quantification of GFP expression levels by q-RT-PCR in the liver, heart, and brain at 3 and 9 weeks after infection with the viral vector. The results of GFP expression levels by q-RT-PCR in liver, heart, and brain samples at 3 and 9 weeks post-infection are shown in Figure 35. GFP expression was negligible in these three organs at both time points.

[0245] conclusion The AAV6 serotype and SpB promoter were selected for further assays (see Examples 5 and 6), and AAV6 outperformed the AAV9 serotype, but the AAV9 serotype should not be discarded for further analysis. The selected virus titer was 10 per mouse. 11 5 x 10 per vg and mouse 11 The AAV6 serotype and SpB promoter were highly specific for the lung and showed no tropism in off-target organs when administered intratracheally.

[0246] Example 4. Generation and characterization of research grade AAV6-SpB-moTERT vector The objective of this example was to generate and characterize a research-grade AAV6-SpB-moTERT vector. For this purpose, the plasmid pAAV-SpB-moTERT-bGH was co-transfected into HEK293 cells with pRepCap6 and the pAdHelper plasmid, which contains the helper genes required for the generation of AAV serotype 6. The AAV6-SpB-moTERT vector was purified by PEG precipitation and double CsCl gradient, formulated in PBS (2x) + 0.001% PF68, and sterile filtered. After purification, several quality attributes were determined to characterize the generated AAV vector.

[0247] method Generation of AAV vectors Adherent HEK-293 cells in roller bottles were triple transfected with PEI-MAX (Polyscience) as the transfection agent and the following plasmids: 1) the optimized packaging plasmid pREPCAP encoding the REP2 and CAP genes, 2) the optimized adenovirus helper plasmid pAdHelper encoding the E2, E4, and VA-RNA genes, providing all adenovirus functions required for AAV vector production in a minimal plasmid size, and 3) a plasmid containing an expression cassette flanked on both sides by AAV2 ITR sequences.

[0248] HEK-293 cells were harvested 72 hours after transfection. The cells were separated from the medium (containing the AAV vector) by centrifugation and lysed by sonication. The lysed cells were centrifuged to remove cell debris, and the supernatant (containing the AAV vector) was retained and added to the medium containing the AAV vector. All AAV particles were then concentrated by PEG precipitation (1). After resuspension of the AAV-PEG pellet, the supernatant was treated with benzonase (Merk) at a final concentration of 100 U / ml. Two rounds of CsCl gradient centrifugation were then performed to separate the complete AAV capsid from the empty AAV capsid. In the first CsCl gradient (discontinuous gradient, 16 hours, swinging bucket rotor SW32 (Beckman), 27000 rpm), the complete AAV vector was separated from most protein impurities and the empty AAV capsid. In a second gradient (isopycnic gradient, 48 h, swinging bucket rotor SW40Ti (Beckman), 32000 rpm), the intact AAV vector was separated from protein impurities, intermediate species, and remaining empty AAV capsids. The intact AAV vector was then dialyzed against the desired formulation buffer using a Slide-A-Lyser Cassette (Life Technologies). Finally, the AAV vector was sterile filtered using a Millex GV 0.2 μm syringe filter (Millipore) and stored at less than -60°C.

[0249] Quantification of vector genome titers by digital droplet PCR Quantification of vector genome titers by digital droplet PCR was performed using the Digital Droplet PCR (ddPCR) system by Bio Rad. Prior to the qPCR reaction, samples were digested with 10 units of DNAseI (cat. no. 04716728001, Roche) to remove any DNA contaminants that may be present on the outside of the AAV capsid. AAV particles were then lysed by adding SDS to a final concentration of 0.1% and incubating at 70°C for 1 h. EDTA was then added to a final concentration of 5 mM to inhibit DNAseI activity. Samples were then diluted to 5 × 10 per ml to ensure that samples were within the quantification range of this technique. 6 The sample was then mixed with a PCR mix solution containing a fluorescent probe and a primer targeting the moTERT sequence (forward: CACCAGACACAACGAGAGAAG, reverse: CTCGACCTTCATCTTCCACATC, FAM-probe: AGGGACAGCTTGCCGTACTTCC) and a primer targeting the ITR2 sequence (forward: GGAACCCCTAGTGATGGAGTT, reverse: CGGCCTCAGTGAGCGA, HEX-probe: HEX-CACTCCCTCTCTGCGCGCTCG-BBQ).

[0250] Subsequently, droplets were formed by adding a probe-specific droplet generation oil (cat. no. 1863005, Bio Rad) and using a QX100 droplet generator by Bio Rad (cat. no. 186-3002). The droplets were then transferred to a PCR plate, placed in a thermocycler, and subjected to PCR amplification (40 cycles at 60° C.). Finally, the droplets were counted for positive or negative amplification using a QX100 droplet reader (cat. no. 186-3001, Bio Rad).

[0251] Data analysis was performed using QuantaSoft software version 1.7.4 (Bio Rad). Final titers were calculated by correcting the copies per μl value provided by the software with the various dilutions performed during the procedure.

[0252] Quantification of vector genome titer by PicoGreen assay AAV vectors were quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Cat. No. P11496, Invitrogen), which allows for the determination of dsDNA concentration by fluorometric analysis using lambda DNA (included in the kit) as a standard. AAV vectors were incubated at 70°C for 1 hour with 0.1% SDS to dissolve capsids, or incubated at room temperature without 0.1% SDS as a negative control. Samples were then gradually cooled to 25°C to form dsDNA and diluted in Tris-EDTA buffer. The diluted samples were mixed with PicoGreen dye and loaded into a black 96-well assay plate. Fluorescence was measured using a Synergy™ HTX Multi-Mode Microplate Reader.

[0253] To quantify vector genome titers, the fluorescent signal of undissolved AAV vector was subtracted from that of dissolved AAV vector to obtain delta fluorescence. A standard curve generated by serial dilutions of the Lambda Standard was used to interpolate the delta fluorescence values ​​of the rAAV samples, thus obtaining the vector genome concentration in ng / ml. The vector titer was calculated from ng / ml to vg / ml using the following formula: vg / ml = (ng / ml) x 1.85 x 10 12 × dilution / (AAV vector length).

[0254] Analysis of AAV vector protein staining The AAV vector was treated with Laemmli buffer at 95°C for 5 minutes to denature the capsid. Polyacrylamide gel electrophoresis was used to separate the proteins that form the AAV vector capsid from proteins that may have contaminated the batch. The proteins were stained with Sypro Ruby stain (Invitrogen). The presence of the three viral proteins (VP1, VP2, and VP3) that form the AAV vector capsid, their exact proportions (VP1 and VP2 bands with similar intensity, and VP3 band with the highest intensity), and the presence of impurities were confirmed by fluorescence analysis (Syngene Gene Genius bioimaging system).

[0255] Quantification of vector genome and viral particle titers by optical density The absorbance of the samples at 260 nm and 280 nm was measured using a Take3 microvolume plate in a Synergy™ HTX multimode microplate reader. The titers of vector genomes and viral particles were calculated according to the formula described by Sommer et al. (2), which changes the extinction coefficient of dsDNA to ssDNA. vp / vg=MW DNA ×(ε ssDNA260 -ε ssDNA280 × Absorbance 260 / absorbance 280 ) / ((absorbance 260 / absorbance 280 )×ε カプシド280 -ε カプシド260 )) vg / ml=absorbance 260 ×(6.02×10 20 / (ε ssDNA260 ×MW+ε カプシド260 ×vp / vg) During the ceremony, ε ssDNA260 (Extinction coefficient ssDNA260 )=27g -1 xLxcm -1 ε ssDNA280 (Extinction coefficient ssDNA280 )=15g -1 xLxcm -1 MW DNA (Molecular weight of packaged DNA) = Number of nucleotides x MW ヌクレオチド MW ssDNA =n゜A×312.2Da+n゜C×288.2Da+n゜G×328.2Da+n゜T×303.2Da ε カプシド260 (Molar extinction coefficient of AAV capsid at 260 nm) ε カプシド280 (molar extinction coefficient of AAV capsid at 280 nm).

[0256] Determination of genomic integrity of AAV vectors by alkaline gel electrophoresis The genomic integrity of the AAV vectors was assessed by alkaline agarose gel electrophoresis (denaturing conditions) which allows for the analysis of single-stranded DNA. 11 Each batch of vg was mixed with alkaline loading buffer and boiled at 95°C for 5 min to dissolve the AAV particles. The DNA was then subjected to agarose gel electrophoresis under denaturing conditions. Finally, the size and quality of the bands were examined to assess the genome integrity. Although the same amount of vector genome was processed and loaded onto the alkaline agarose gel, differences in band intensity may be observed due to the nature of this technique. These putative differences in band intensity may not explain the differences in vector concentration.

[0257] The genome of the AAV vector is a single-stranded DNA, but is formed by a sense and an antisense strand (approximately 50% of each strand). Double-stranded DNA (such as DNA ladders) or single-stranded DNA with plus and minus strands may show double bands (or diffuse bands) corresponding to the sense and antisense strands that run separately in denaturing agarose gels (Eva Hegedues et al., 2009).

[0258] Quantification of viral particle titers by ELISA AAV viral particles (full and empty) were quantified using an AAV titration ELISA kit (AAV6 Titration ELISA kit, Progen, product no. PRAAV6). The capture antibody detects a conformational epitope not present in the unassembled capsid protein. The assay is based on a sandwich ELISA technique. Monoclonal antibodies specific for conformational epitopes on assembled AAV capsids were coated onto strips of a microtiter plate and used to capture AAV particles from the sample. The captured AAV particles were detected in two steps. First, a biotin-conjugated monoclonal antibody against AAV was bound to the immune complex. Second, a streptavidin peroxidase conjugate reacted with the biotin molecule. Addition of a substrate solution resulted in a color reaction that was proportional to the amount of specifically bound viral particles. The absorbance was measured at 450 nm.

[0259] In vitro potency assay: mRNA expression In this study, we used 2v6.11 cells to demonstrate enhanced transduction by AAV vectors. In this cell line, derived from HEK293 cells, Ad5 E4 is expressed under the control of an ecdysone-inducible promoter, allowing induction of E4 expression by the ecdysone analog, ponasterone A.

[0260] The day before infection, plate 2v6.11 cells at 2 × 10 per well. 5 Cells were seeded into 24-well plates at a density of 1000 U / ml and 10000 μg / ml of growth medium (DMEM + 10% FBS) supplemented with antibiotics (penicillin = 10000 U / ml, streptomycin = 10000 μg / ml) and 1 μg / ml of ponasterone A at 37°C and 5% CO2.

[0261] Prior to infection, cells were assessed for accurate cell confluence (70%-80%) under a brightfield microscope. To determine cell number, cells from 4 wells were trypsinized and cell numbers were quantified using a Scepter 2.0 Handheld Automated Cell Counter (Merck-Millipore). Cells were infected with AAV-953 vectors at MOIs of 32000 vg per cell, 64000 vg per cell, and 128000 vg per cell. Cells were infected in triplicate. Non-infected 2v6.11 cells (NI) were used as negative controls.

[0262] 48 hours after infection and after assessing cell viability, cells were gently washed with 500 μl 1×PBS and collected in 350 μl RLT+β-mercaptoethanol (10 μl / ml) (RNeasy Mini Kit, Qiagen). RNA was extracted using the RNeasy Mini Kit (Qiagen) and RNase-free DNase I (Qiagen) according to the protocol provided by the manufacturer, except that the on-column DNAse I digestion was extended from the standard 15 min to 30 min to ensure adequate degradation of the infected AAV vector genome. 1 μg of each RNA sample was reverse transcribed using the Transcriptor FirstStrand cDNA Synthesis kit (Roche). qPCR was performed in triplicate using primers and 2 μl of sample (1 / 10 dilution). Expression was quantified using a primer-probe mix targeting moTERT (forward primer: GGA AGT GTT CTG CGA CTA CAG, reverse primer: CAG CTT GTT CCT CAT GGT CTT, probe: / 56-FAM / CTACGCCCA / ZEN / GACCAGCATCAAGAC / 3IABkFQ / ) and normalized using a primer-probe mix for the housekeeping gene hRplp0 (forward primer: CAG ACA GAC ACT GGC AAC AT, reverse primer: GCA GCA TCT ACA ACC CTG AA, probe: / 5HEX / AA CTC TGC A / ZEN / TT CTC GCT TCC TGG A / 3IABkFQ).

[0263] Quality control: results Generation of AAV vectors To generate a batch of AAV-953, 50 roller bottles were transfected.

[0264] After PEG precipitation and the first cesium chloride run, a second CsCl gradient of batch AAV-953 showed a strong band corresponding to the complete vector (Figure 36). Empty particles were removed in the first gradient run.

[0265] The AAV vector was dialyzed in PBS (2x) + 0.001% Pluronic F68. After sterile filtration, 2.695 ml of AAV6-SpB-moTERT-bGH was stored at -80°C.

[0266] Quantifying vector genome titers by digital droplet PCR Two quantifications were performed on two independent days. AAV vectors were quantified with a duplex ddPCR assay targeting the transgene (moTERT) and ITR2 present in all AAV vectors.

[0267] TIFF2024521063000005.tif26170

[0268] TIFF2024521063000006.tif25170

[0269] Similar titers were obtained with the two primer sets used for AAV vector quantification.

[0270] The titers obtained using a primer set targeting the transgene (moTERT) were selected and reported as batch titers and used for in vitro and in vivo experiments.

[0271] Quantification of vector genome titer by PicoGreen assay The PicoGreen assay was used as an orthogonal method to the ddPCR assay to determine the titer of the AAV vector.

[0272] TIFF2024521063000007.tif20170

[0273] Similar titers were obtained between the PicoGreen and ddPCR assays.

[0274] Analysis of AAV vector protein staining Vector batch purity was determined by Sypro Ruby protein staining. AAV-953 batch protein staining showed 3 viral particles (VP) and excellent purity (Figure 37).

[0275] Quantification of viral particle titers by ELISA AAV particles in the AAV-953 batch were quantified using an AAV6 ELISA kit from Progen (product no. PRAAV6).

[0276] TIFF2024521063000008.tif21170

[0277] Similar titers of vector genomes and viral particles were obtained, indicating that the batches consisted mainly of intact particles.

[0278] Quantification of vector genome and viral particle titers by optical density The optical density assay was used both as an orthogonal method to the ddPCR assay to determine AAV vector titer and to the ELISA to determine viral particle concentration.

[0279] TIFF2024521063000009.tif25170

[0280] Similar titers of vector genomes and viral particles were obtained, indicating that the batches consisted mainly of intact particles.

[0281] Determination of genomic integrity of AAV vectors The integrity of the vector genome was determined by alkaline agarose gel (Figure 38). The AAV-953 batch showed a major band around 4500 bases, corresponding to the full-length vector genome.

[0282] In vitro potency assay: mRNA expression Infection of 2v6.11 cells with vector AAV-953 resulted in expression of moTERT mRNA, and the expression level of moTERT was proportional to the vector dose (MOI) (Figure 39).

[0283] The vector genome integrity of the AAV6-Spb-moTERT vector used in the present invention was determined by alkaline agarose gel (Figure 40). Analysis of genome integrity revealed an approximately 4.7 kb band corresponding to the full-length AAV genome, further confirming the absence of truncated genomes (Figure 40). Similar to the observations made for AAV9-Spb-moTERT, AAV9-CMVenh-MLC2v-moTERT, and AAV9-TNT-moTERT (Figures 9A and 9B), the higher intensity of the band corresponding to the full-length vector genome observed in AAV6-Spb-moTERT indicated a higher number of full-length genomes in this AAV preparation compared to AAV vectors containing an oversized expression cassette encoding TERT (AAV9-CMV-mTERT and AAV9-CMV-mTERT-DN) (Figures 9A and 9B).

[0284] Example 5. Evaluation of telomerase expression levels in the lungs upon intratracheal administration of AAV6-SpB-moTert in healthy mice In this example, telomerase expression and activity were measured in AAV6-SpB-moTert transduced mice by intratracheal administration, and 10 11 5 x 10 per vg and mouse 11 Comparison was made between individual vg.

[0285] Study design vector: AAV6-SpB-null (SEQ ID NO:28 represents the AAV-SpB-null recombinant adeno-associated virus genome), AAV6-SpB-moTert (SEQ ID NO: 21 represents the AAV-SpB-moTert recombinant adeno-associated virus genome).

[0286] Dosage: D1. 10 per mouse 11 VG, D2. 5 x 10 per mouse 11 pcs vg.

[0287] Healthy wild-type mice (9 weeks old) were inoculated with AAV6-SpB-null at 5 × 10 per mouse. 11 vg, and 1 x 10 per mouse for AAV6-SpB-moTert. 11 5 x 10 per vg and mouse 11 Vg of AAV6 was administered intratracheally. Ten mice were included per group. Mice were sacrificed 6 weeks after infection. Viral genome, telomerase expression levels, and telomerase activity were evaluated in lung and off-target tissues. Telomere length as well as the percentage of AAV6 infected cells were analyzed. The experimental setup is shown in Figure 41.

[0288] Materials and Methods Test and control articles The viral vectors tested were AAV6-SpB-null and AAV6-SpB-moTert. AAV6-SpB-null was used as a negative control for telomerase expression.

[0289] Test system Nine-week-old wild-type mice with a genetic background of C57BL / 6J.OlaHsd were inoculated by intratracheal instillation with 30 mL of 2x PBS 0.001% Pluronic F-68 (Gibco, ref. no.: 240-032, lot: 1836664) containing the viral vector. An intravascular catheter (24 gauge, 0.75 in., 0.7 mm x 19 mm) was used for the instillation (BD Insyte, ref. no.: 381212, lot: 9143584). Mice were anesthetized by inhalation using 1%–3% isoflurane in oxygen.

[0290] Experimental protocol The purpose of this assay was to address the following: Two different vectors (AAV6-SpB-null and AAV6-SpB-moTert) were administered at two different virus doses (10 per mouse). 11 vg, 5 x 10 per mouse 11 The mice were intratracheally delivered at 100 ng / mL (vg) in healthy wild-type mice. A total of 30 mice were assigned to this assay. After 6 weeks, the animals were sacrificed and samples (lungs, liver, heart, and brain) were collected. Tissue samples analyzed by qPCR were collected on dry ice, whereas tissue samples for immunohistochemistry were collected directly in formalin and further embedded in paraffin blocks.

[0291] Telomerase Expression The transcriptional expression level of Tert was analyzed by q-RT-PCR using two different primer sets, set 1 and set 2. Set 1 consisted of a forward primer (5'-TAG CCC TGG CAA GGA TAG A-3') and a reverse primer (5'-GCT CTC GGT GAT GTA GAA GAA G-3'). Set 2 consisted of a forward primer (5'-CAC CAG ACA CAA CGA GAG AAG-3') and a reverse primer (5'-CTC GAC CTT CAT CTT CCA CAT C-3'). RNA samples were extracted using Trizol and zirconium beads. cDNA was synthesized using the iScript Adv cDNA Kit for RT-qPCR (Bio-Rad, ref: 1725037, batch: 64375699).

[0292] Viral genome quantification DNA from the indicated tissues was extracted using a commercial kit based on salting out (MasterPure™ DNA Purification Kit, Epicentre, Ref. 113·6 / 2012 EPILIT113 Rev.A, Cat. No. MCD85201). The number of viral genomes per cell was analyzed by qPCR using primer set 1 and primer set 2 (see above). A standard curve was generated by serial dilutions of a linearized plasmid carrying the moTert gene.

[0293] Telomerase activity Telomerase activity was analyzed by the telomeric repeat amplification protocol (TRAP) described by Herbert et al., 2006 (Herbert et al., Nature Protocols, 2006) and Blasco et al 1997 (Blasco et al., Cell 1997).

[0294] Telomerase RNA Scope To analyze lung transduction efficiency and identify specific cell types expressing moTert, a probe specific for moTert RNA was designed and purchased from ACDBIO (www.acdbio.com). Double immunostaining with rabbit monoclonal (EPR19839) anti-SPC (1:100, ABCAM, ref. ab211326) and moTert RNA scope for prosurfactant protein C (SP-C) was performed to quantitatively analyze the percentage of alveolar type II cells expressing moTert. Double immunostaining with goat polyclonal (EPR19839) anti-CC10 (1:100, ABCAM, ref. ab211326) and moTert RNA scope for secretoglobin family 1A member 1 (SCGB1A1 or CC10) in lung sections was performed to quantitatively analyze the percentage of Clara cells expressing moTert.

[0295] Telomere length analysis Dual fluorescence in situ hybridization (q-Fish) using moTert RNAscope and telomere probes was performed to analyze telomere length in cells expressing moTert.

[0296] Data Analysis and Management Statistical significance is addressed by unpaired two-tailed Student's test.

[0297] result Lungs (6 weeks after infection) Increased telomerase activity in the lung. Good correlation between expression and TRAP. More than 20% of cells in the lungs stained positively for moTERT (RNAscope) (see FIG. 46). Co-staining with SPC (ATII cells) and CC10 (Clara cells) (see FIG. 47). Telomere quantification (length). Comparison of cells in the same animal (infected vs. non-infected cells). Telomere lengthening is on average 4.5% (D1) and 7.5% (D2) (see Figure 48). Mean nuclear intensity. Another reading for telomere length (7.8%) (see Figure 48). Increased number of spots. Lengthening of short telomeres (8%-10%) (see Figure 48). The distribution of telomeres showed that the percentage of short telomeres (20% percentile of non-transduced cells) decreased and the percentage of long telomeres (80% percentile of non-transduced cells) increased in cells transduced with AAV6-SpB-Tert. Furthermore, the number of telomere spots also increased in cells transduced with AAV6-SpB-Tert compared to non-transduced cells in the same mice. These results indicate that short telomeres are indeed elongated (see Figure 49).

[0298] liver No telomerase expression was detected in the liver in vivo (see FIG. 44).

[0299] Example 6. Evaluation of telomerase expression levels in the lungs upon intratracheal administration of AAV6-SPB-MOTERT In this example, we aim to address the efficacy of AAV6-SpB-moTert treatment in the regression and / or healing of pulmonary fibrosis in the short and long term. The effect of AAV6-SpB-moTert treatment on survival of mice diagnosed with PF (pulmonary fibrosis). In this example, the same mouse model of pulmonary fibrosis was used as described in Povedano et al., 2015, Non-Patent Document 6. 20-30 male mice were used per experimental group. PF mice were cultured at 5 × 10 per mouse. 11 As a control, a separate cohort of PF mice was treated IT (intratracheally) with AAV6-SpB-moTert at a dose of 5 × 10 vg per mouse. 11 Three weeks after bleo injury, computed tomography (CT) was performed on each mouse to determine abnormal lung patterns as a readout for pulmonary fibrosis.

[0300] Mice diagnosed with pulmonary fibrosis were treated with AAV6-SpB-moTert vector using intratracheal administration. CT was performed 1, 2, 4, 6, and 10 weeks after AAV6 treatment to follow short-term disease progression longitudinally. Ten mice per group were left for survival and long-term analysis. Lung immunohistopathological studies were performed by immunohistochemistry. In addition, telomere length studies were performed by quantitative fluorescent in situ hybridization technique (q-Fish). Expression levels of Tert were determined in lung and liver by q-PCR, and telomerase activity was evaluated in HEP ​​by TRAP analysis.

[0301] The objectives of this embodiment are summarized below: Telomerase expression and activity in AAV6-SpB-moTert transduced mice by intratracheal administration in telomerase-deficient fibrotic mice. 5 x 10 per mouse 11Comparison between healthy and fibrotic mice at 5 vg. Telomere lengthening. Efficacy of telomerase gene therapy for the treatment of PF (pulmonary fibrosis).

[0302] Study design vector: AAV6-SpB-null (SEQ ID NO: 28), AAV6-SpB-moTert (sequence number 21).

[0303] Dosage: 5 x 10 per mouse 11 pcs vg.

[0304] Materials and Methods Test and control articles The viral vectors tested were AAV6-SpB-null and AAV6-SpB-moTert. AAV6-SpB-null was used as a negative control for telomerase expression.

[0305] Tissue samples analyzed by qPCR were collected on dry ice, whereas tissue samples for immunohistochemistry were collected directly in formalin and further embedded in paraffin blocks.

[0306] Telomerase Expression The transcriptional expression level of Tert was analyzed by q-RT-PCR using primer set 1 consisting of forward primer (5'-TAG CCC TGG CAA GGA TAG A-3') and reverse primer (5'-GCT CTC GGT GAT GTA GAA GAA G-3'). RNA samples were extracted using Trizol and zirconium beads. cDNA was synthesized using the iScript Adv cDNA Kit for RT-qPCR (Bio-Rad, ref: 1725037, batch: 64375699).

[0307] Viral genome quantification DNA from the indicated tissues was extracted using a commercial kit based on precipitation (MasterPure™ DNA Purification Kit, Epicentre, Ref. 113·6 / 2012 EPILIT113 Rev.A, Cat. No. MCD85201). The number of viral genomes per cell was analyzed by qPCR using primer set 1 and primer set 2. Set 1 is composed of forward primer (5′-TAG CCC TGG CAA GGA TAG A-3′) and reverse primer (5′-GCT CTC GGT GAT GTA GAA GAA G-3′). Set 2 is composed of forward primer (5′-CAC CAG ACA CAA CGA GAG AAG-3′) and reverse primer (5′-CTC GAC CTT CAT CTT CCA CAT C-3′). A standard curve was generated by serial dilutions of a linearized plasmid carrying the moTert gene.

[0308] Telomerase activity Telomerase activity was measured using the telomere repeat amplification protocol described in Herbert et al., 2006 (Herbert BS, Hochreiter AE, Wright WE, Shay JW. Nonradioactive detection of telomerase activity using the telomeric repeat amplification protocol. Nat Protoc. 2006;1(3):1583-90. Epub 2007 / 04 / 05. doi: 10.1038 / nprot.2006.239. PubMed PMID: 17406450) and Blasco et al 1997 (Blasco MA, Lee HW, Hande MP, Samper E, Lansdorp PM, DePinho RA, et al. Telomere shortening and tumor formation in mouse cells lacking telomerase RNA. (by mouse cells lacking telomerase RNA.) Cell. 1997;91(1):25-34. Epub 1997 / 10 / 23. doi: 10.1016 / s0092-8674(01)80006-4. PubMed PMID: 9335332.

[0309] Telomerase RNA Scope To analyze lung transduction efficiency and identify specific cell types expressing moTert, a probe specific for moTert RNA was designed and purchased from ACDBIO (www.acdbio.com). Double immunostaining with rabbit monoclonal (EPR19839) anti-SPC (1:100, ABCAM, ref. ab211326) and moTert RNA scope for prosurfactant protein C (SP-C) was performed to quantitatively analyze the percentage of alveolar type II cells expressing moTert. Double immunostaining with goat polyclonal (EPR19839) anti-CC10 (1:100, ABCAM, ref. ab211326) and moTert RNA scope for secretoglobin family 1A member 1 (SCGB1A1 or CC10) in lung sections was performed to quantitatively analyze the percentage of Clara cells expressing moTert.

[0310] Telomere length analysis Dual fluorescence in situ hybridization (q-Fish) using moTert RNAscope and telomere probes was performed to analyze telomere length in cells expressing moTert.

[0311] result Similar transduction efficiency in Tert knockout fibrotic mice compared to wild type mice. More than 20% of cells in the lungs stained positive for moTERT (RNAscope) (Figure 51). Similar levels of viral genomes in Tert knockout fibrotic mice compared to wild type mice (Figure 52). No viral genome was detected in the liver (FIG. 52). Telomerase expression was readily detected in the lungs 6 and 11 weeks after AAV6-SpB-moTert treatment (FIG. 53). No telomerase expression was detected in the liver, heart, or brain (Figure 53).

[0312] Example 7. Design and construction of a codon-optimized human telomerase coding sequence To improve gene expression and increase the translation efficiency of the human TERT transgene, the mRNA sequence was optimized. Codons represent the genetic code that transfers information from mRNA to protein. This process is mediated by the codon recognition of tRNA, thus incorporating a specific amino acid into the polypeptide chain. Since one single amino acid may be coded by different codons, there are several tRNAs that code for the same amino acid. This results in the preferential use of one codon over another for the same amino acid in a species-specific manner. This phenomenon is known as codon bias. Therefore, optimizing codon usage for a particular species is widely used to increase protein production from a transgene. In addition, there are parameters that have a significant effect on protein expression that are also incorporated into the codon optimization algorithm, such as GC content, RNA secondary structure, repeats, etc. Many websites and software contain codon optimization algorithms with various approaches. Due to the complex nature of the optimization process, there is no clear advantage to using one particular one over another, so several parallel optimizations are required to identify the best one.

[0313] hsoTERT_ID was generated using the codon optimization tool for variant 1, hsoTERT_GS was generated using the codon optimization tool for variant 2, and hsoTERT_GA was generated using the codon optimization tool for variant 3. Finally, all sequences contain specific restriction sites at 3' and 5' for cloning into the final AAV vector (Figure 54) and are sequenced by gene synthesis.

[0314] Example 8. Characterization of AAV6-SpB-hoTERT-ID vector The AAV6-SpB-hsoTERT-ID vector showed a major band of intact vector and minor bands with lower and higher sedimentation coefficients that may correspond to intermediate species and aggregates, respectively (Figure 55). There were no empty particles in this batch. Analysis of vector genome integrity revealed that the AAV6-SpB-hsoTERT-ID vector showed a major band around 4700 that corresponds to the full-length vector genome (Figure 56).

[0315] TIFF2024521063000010.tif248170TIFF2024521063000011.tif65170

[0316] SEQ ID NO:6 (long isoform of hoTERT) atgcctagag cacctagatg tagagctgtg cggagcctgc tgcggagcca ctatagagaa gttctgcccc tggccacctt cgtgcgtaga cttggacctc aaggatggcg gctggtgcag agaggcgatc ctgctgcttt tagagccctg gtggcccagt gtctcgtgtg cgttccatgg gatgctagac ctccaccagc tgctcccagc ttcagacagg tgtcctgcct gaaagaactg gtggccagag tgctgcagcg gctgtgtgaa aggggcgcca aaaatgtgct ggccttcggc tttgctctgc tggatggtgc tagaggcgga cctcctgagg cctttacaac aagcgtgcgg agctacctgc ctaacaccgt gacagatgcc ctgagaggat ctggcgcttg gggactgctg ctgagaagag tgggagatga cgtgctggtg catctgctgg ctagatgcgc cctgtttgtg ctggtggctc ctagctgtgc ctaccaagtc tgtggccctc cactgtatca gctgggcgct gctacacagg ctagaccacc tccacatgcc agcggaccta gaagaaggct gggctgcgaa agagcctgga accactctgt tagagaagcc ggcgtgccac tgggattgcc tgcacctggt cgaagagaa gaggcggcag cgcctctaga tctctgcctc tgcctaagag gcctcggaga ggtgctgctc ctgagcctga gagaacacct gttggccaag gctcttgggc ccatcctggc agaagaag gccctagcga tagaggcttc tgcgtggtgt ctcctgccag acctgccgag gaagccacat ctcttgaagg cgccctgagc ggcacaagac actctcaccc atctgtgggc agacagcacc atgccggacc tccaagcaca agcagaccac ctagaccttg ggacacccct tgtcctccag tgtacgccga gacaaagcac ttcctgtaca gcagcggcga caaagagcag ctgaggccta gcttcctgct gtcctctctg aggccatctc tgaccggtgc tcggagactg gtggaaacca tcttcctggg cagcagacct tggatgcccg gcacacctag aaggctgcct agactgccac agcggtactg gcaaatgagg cccctgttcc tggaactgct gggcaatcac gctcagtgcc cttatggcgt gctgctgaaa acccactgtc ctctgagagc cgccgtgaca ccagcagctg gcgtttgtgc cagagaag cctcaaggct ctgtggctgc ccctgaggaa gaggacag atcctagacg actggtgcag ctcctgcggc agcattctag tccatggcag gtctacggat tcgtgcgggc ctgtctgaga aggcttgttc ctcctggact gtggggctcc agacacaacg agcggcggtt tctgcggaac accaagaagt tcatcagcct gggaaagcac gccaagctga gcctgcaaga gctgacctgg aagatgagcg tgcgggattg tgcatggctg agaagtccc caggcgtggg atgtgttcct gccgctgaac agaactgcg ggaagagatc ctggccaagt tcctgcactg gctgatgtcc gtgtacgtgg tcgaactgct tcggagcttc ttctacgtga ccgagaac cttccagaag aaccggctgt tcttctaccg gaagtccgtg tggtccaagc tgcagagcat cggcattcgg cagcacctga agagagtgca gctgagagag ctgagcgagg ctgaagtccg gcagcacaga gaagctagac cagctctgct gaccagcagg ctgagattca tccccaagcc tgatggcctg cggcctatcg tgaacatgga ctatgttgtg ggcgccagaa cctttcggag agagaagaga gccgagcgg tgacctctag agtgaaggcc ctgttcagcg tgctgaacta cgagagagcc agaaggcctg gactgctcgg agcctctgtt ctgggcctcg acgatatcca cagagcttgg cggacctttg tgctgagagt cagagcccag gatcctccac ctgagctgta cttcgtgaag gtggacgtga ccggcgccta cgacacaatc cctcaggaca gactgaccga agtgatcgcc agcatcatca agccccagaa cacctactgt gtgcggagat acgccgtggt gcagaaagcc gctcatggac atgtgcgcaa ggccttcaag tcccacgtgt ccacactgac cgacctgcag ccttacatga gacagttcgt ggcccatctg caagagacaa gccctctgag ggatgccgtg gtcatcgaac agagcagcag cctgaatgag gccagctccg gcctgtttga cgtgttcctc agattcatgt gccaccacgc cgtgcggatc agaggcaaga gctatgtgca gtgccagggc attccacagg gcagcatcct gagcacactg ctgtgcagcc tgtgctacgg cgacatggaa aacaagctgt tcgccggcat cagacgcgac ggcctgcttc tgagactggt cgacgatttc ctgctcgtga cccctcacct gacacacgcc aagacctttc tgagaacact cgtgcggggc gtgccagagt atggctgtgt ggtcaacctg agaaagaccg tggtcaactt ccccgtcgag gatgaagccc ttggcggcac agctttcgtg cagatgcctg ctcacggact gttcccttgg tgcggactgc tcctggacac cagaacactg gaagtgcaga gcgactacag cagctacgcc cggacatcta tcagagccag cctgaccttc aaccggggct ttaaggccgg cagaaacatg cggagaaagc tgtttggagt gctgcggctg aagtgccact ctttgtttct ggacctgcaa gtgaacagcc tgcagaccgt gtgcaccaac atctacaaga ttctgctgct gcaagcctac cggttccacg cctgtgttct gcagctgccc ttccaccagc aagtgtggaa gaaccctaca ttcttcctgc gcgtgatcag cgacaccgcc agcctgtgtt actccatcct gaaggccaag aacgccggca tgtctctggg agctaaaggc gctgctggac ctctgccttc tgaagcagtg cagtggctct gccaccaggc ctttctgctg aagctgacca gacacagagt gacctacgtg cccctgctgg gctcactgag aacagctcag acacagctga gcagaaagct gcctggcaca accctgacag ccctggaagc tgcagcaaac cctgctctgc ccagcgactt caagaccatc ctggattga

[0317] Sequence number 9 (short isoform of hoTERT) atgcctcggg ctcctagatg tagagccgtc agaagcctgc tgcggagcca ctatagagag gtgctgcctc tggccacctt cgtgcgtaga cttggacctc areatggcg gctggtgcag agaggcgatc ctgctgcttt tagagccctg gtggcccagt gtctcgtgtg cgttccatgg gatgctagac ctccaccagc tgctcccagc ttcagacagg tgtcctgcct gaagaactg gtggccaggg tgctgcagag actgtgtgaa aggggcgcca agaacgtgct ggcctttgga tttgctctgc tggatggcgc tagaggcgga cctcctgagg cctttacaac aagcgtgcgg agctacctgc ctaacaccgt gacagatgcc ctgagaggat ctggcgcttg gggactgctg ctgagaagag tgggagatga cgtgctgggtg catctgctgg ccagatgcgc tctgtttgtg ctggtggctc ctagctgcgc ctaccaagtt tgtggccctc cactgtatca gctgggcgct gctacacagg ctagaccacc tccacatgcc agcggaccta gaagaaggct gggctgcgaa agagcctgga accactctgt tagagaagcc ggcgtgccac tgggattgcc tgcaccaggt cgaagagaa gaggcggcag cgcctctaga tctctgcctc tgcctaagag gcctagaaga ggggctgcccc ctgagcctga gagaacacct gttggccaag gctcttgggc ccatcctggc agaagaag gccctagcga tagaggcttc tgcgtggtgt ctcctgccag acctgccgag gaagccacat ctcttgaagg cgccctgagc ggcacaagac actctcaccc atctgtgggc agcagcacc atgccggacc tccaagcaca agcagcac ctagaccttg ggacacccct tgtcctccag tgtacgccga gacaaagcac ttcctgtaca gcagcggcga caaagagcag ctgaggccta gcttcctgct gtcctctctg aggccatctc tgaccggtgc tcggagactg gtggaaacca tcttcctggg cagcagacct tggatgcccg gcacacctag aaggctgcct agactgccac agcggtactg gcaaatgagg cccctgttcc tggaactgct gggcaatcac gctcagtgcc cttatggcgt gctgctgaaa acccactgtc ctctgagagc cgccgtgaca ccagcagctg gcgtttgtgc cagagagag cctcaaggct ctgtggccgc tcctgagga gaggacacag atcctagcg actggtgcag ctcctgagac agcacagctc tccatggcag gtctacggat ttgtgcgggc ctgtctgaga aggctcgttc ctcctggact gtggggctcc agacacaacg agcggcggtt tctgcggac accaagagt tcatcagcct gggaaagcac gccaagctga gcctgcaaga gctgacctgg aagatgagcg tgcgggattg tgcatggctg agaagtccc caggcgtggg atgtgttcct gccgctgaac agaactgcg ggaagagatc ctggccaagt tcctgcactg gctgatgtcc gtgtacgtgg tcgaactgct tcggagcttc ttctacgtga ccgagaac cttccagaag aaccggctgt tcttctaccg gaagtccgtg tggtccaagc tgcagagcat cggcatccgg cagcatctga agagagtgca gctgagagag ctgagcgaag ccgaagtgcg gcagcacaga gaagctagac cagctctgct gaccagcagg ctgagattca tccccaagcc tgatggcctg cggcctatcg tgaacatgga ctatgttgtg ggcgccagaa cctttcggag agagaagaga gccgagcgg tgacctctag agtgaaggcc ctgttcagcg tgctgaacta cgagagagcc agaaggccag gactgctggg agcctctgtt ctgggcctcg acgatatcca cagagcttgg cggacctttg tgctgagagt gcgagcccaa gatcctccac ctgagctgta cttcgtgaag gtggacgtga ccggcgccta cgacacaatc cctcaggaca gactgaccga agtgatcgcc agcatcatca agccccagaa cacctactgt gtgcggagat acgccgtggt gcagaaagcc gctcatggac atgtgcgcaa ggccttcaag tcccacgtgt ccacactgac cgacctgcag ccttacatga gacagttcgt ggcccatctg caagagacaa gccctctgag ggatgccgtg gtcatcgaac agagcagcag cctgaatgag gccagctccg gcctgtttga cgtgttcctc agattcatgt gccaccacgc cgtgcggatc agaggcaaga gctatgtgca gtgccagggc attcctcagg gcagcatcct gagcacactg ctgtgcagcc tgtgctacgg cgacatggaa aacaagctgt tcgccggcat cagacgcgac ggcctgcttc tgagactggt cgacgatttc ctgctcgtga cccctcacct gacacacgcc aagacctttc tgagctacgc ccggacctct atcagagcca gcctgacctt caaccggggc tttaaggccg gcagaaacat gcggagaaag ctgtttggag tgctgcggct gaagtgccac tctttgtttc tggacctgca agtgaacagc ctgcagaccg tgtgcaccaa catctacaag attctgctgc tgcaagccta ccggttccac gcctgtgttc tgcagctgcc ctttcaccag caagtgtgga agaaccctac attcttcctg cgcgtgatca gcgacaccgc cagcctgtgt tactccatcc tgaaggccaa aaacgccggc atgagcctgg gagctaaagg cgctgctgga cctctgcctt ctgaagcagt gcagtggctg tgtcaccagg cctttctgct gaagctgacc cggcacagag tgacatatgt gcctctgctg ggctccctga gaaccgctca aacacagctg agcagaaagc tgcctggcac aaccctgaca gccctggaag ctgcagcaaa ccctgctctg cccagcgact tcaagaccat cctggattga

[0318] SEQ ID NO: 12 (Short form of SpB promoter) ATAGGGCTGTCTGGGAGCCACTCCAGGGCCACAGAAATCTTGTCTCTGACTCAGGGTATTTTGTTTTCTGTTTTGTGTAAATGCTCTTCTGACTAATGCAAACCATGTGTCCATAGAACCAGAAGATTTTTCCAGGGGAAAAGGTAAGGAGGTGGTGAGAGTGTCCTGGGTCTGCCCTTCCAGGGCTTGCCCTGGGTTAAGAGCCAGGCAGGAAGCTCTCAAGAGCATTGCTCAAGAGTAGAGGGGGCCTGGGAGGCCCAGGGAGGGGATGGGAGGGGAACACCCAGGCTGCCCCCAACCAGATGCCCTCCACCCTCCTCAACCTCCCTCCCACGGCCTGGAGAGGTGGGACCAGGTATGGAGGCTTGAGAGCCCCTGGTTGGAGGAAGCCACAAGTCCAGGAACATGGGAGTCTGGGCAGGGGGCAAAGGAGGCAGGAACAGGCCATCAGCCAGGACAGGTGGTAAGGCAGGCAGGAGTGTTCCTGCTGGGAAAAGGTGGGATCAAGCACCTGGAGGGCTCTTCAGAGCAAAGACAAACACTGAGGTCGCTGCCACTCCTACAGAGCCCCCACGCCCCGCCCAGCTATAAGGGGCCATGCACCAAGCAGGGTACCCAGGCTGCAGAGGTGC

[0319] SEQ ID NO: 15 (CMVenh-MLC2v promoter) GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTTAACGTTTAAACTTAGACAATGGCAGGACCCAGAGCACAGAGCATCGTTCCCAGGCCAGGCCCCAGCCACTGTCTCTTTAACCTTGAAGGCATTTTTGGGTCTCACGTGTCCACCCAGGCGGGTGTCGGACTTTGAACGGCTCTTACTTCAGAAGAACGGCATGGGGTGGGGGGGCTTAGGTGGCCTCTGCCTCACCTACAACTGCCAAAAGTGGTCATGGGGTTATTTTTAACCCCAGGGAAGAGGTATTTATTGTTCCACAGCAGGGGCCGGCCAGCAGGCTCCTTGAATTC

[0320] Sequence number 16 (shortened TNT promoter) CTCAGTCCATTAGGAGCCAGTAGCCTGGAAGATGTCTTTACCCCCAGCATCAGTTCAAGTGGAGCAGCACATAACTCTTGCCCTCTGCCTTCCAAGATTCTGGTGCTGAGACTTATGGAGTGTCTTGGAGGTTGCCTTCTGCCCCCCAACCCTGCTCCCAGCTGGCCCTCCCAGGCCTGGGTTGCTGGCCTCTGCTTTATCAGGATTCTCAAGAGGGACAGCTGGTTTATGTTGCATGACTGTTCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGGCGTGGGGTACATGTTCCTGTAGCCTTGTCCCTGGCACCTGCCAAAATAGCAGCCAACACCCCCCACCCCCACCGCCATCCCCCTGCCCCACCCGTCCCCTGTCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCCCCAGCCCACATGCCTGCTTAAAGCCCTCTCCATCCTCTGCCTCACCCAGTCCCCGCTGAGACTGAGCAGACGCCTCCAGGATCTGTCGGCAG

[0321] SEQ ID NO: 21 (AAV-SpB-moTERT recombinant adeno-associated virus genome)

[0322] SEQ ID NO: 22 (AAV9-CMVenh-MLC2v-moTERT viral genome)

[0323] SEQ ID NO: 23 (AAV9-TNT-moTert viral genome)

[0324] SEQ ID NO: 24 (AAV9-CMV-null genome and AAV6-CMV-null viral genome)

[0325] SEQ ID NO: 25 (AAV9-CMV-mTERT viral genome)

[0326] SEQ ID NO: 26 (AAV-CMV-GFP recombinant adeno-associated virus genome)

[0327] SEQ ID NO: 27 (AAV-SpB-GFP recombinant adeno-associated virus genome)

[0328] SEQ ID NO: 28 (AAV6-SpB-null genome and AAV9-SpB-null viral genome)

Claims

1. A recombinant adeno-associated virus genome comprising a nucleotide sequence encoding telomerase reverse transcriptase (TERT) operably linked to a tissue-specific promoter, wherein the total length of the viral genome is less than 4,700 nucleotides, and the tissue-specific promoter consists solely of SEQ ID NO:

12.

2. The recombinant adeno-associated virus genome of claim 1 , wherein the sequence encoding TERT is codon-optimized.

3. a) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence encoding a polypeptide represented by an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity or similarity to any one of SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10; or b) the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO:9; or A recombinant adeno-associated virus genome as described in claim 1 or 2, wherein the sequence encoding TERT comprises, consists essentially of, or consists of a nucleotide sequence that differs from the nucleotide sequence of a) or b) due to the degeneracy of the genetic code.

4. The recombinant adeno-associated virus genome of claim 1 or 2, wherein the recombinant virus genome further comprises a Kozak consensus sequence operably linked to the nucleotide sequence encoding the TERT.

5. The recombinant adeno-associated virus genome of claim 1 or 2, wherein the recombinant virus genome further comprises a polyA sequence operably linked to the nucleotide sequence encoding the TERT.

6. An adeno-associated virus vector comprising a recombinant adeno-associated virus genome as defined in claim 1.

7. The adeno-associated virus vector of claim 6, wherein the virus vector is of serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype rhlO, serotype rh8, serotype Cb4, serotype rh74, serotype DJ, serotype 2 / 5, serotype 2 / 1, serotype 1 / 2, or serotype Anc80.

8. The adeno-associated viral vector of claim 7 , wherein the viral vector is of serotype 6 or serotype 9.

9. The adeno-associated viral vector of claim 8 , wherein the viral vector is of serotype 6.

10. The adeno-associated viral vector of claim 9, wherein the viral vector is of serotype 6 and the tissue-specific promoter is as defined in claim 1.

11. A pharmaceutical composition comprising a recombinant adeno-associated virus genome according to claim 1 or 2 or an adeno-associated virus vector according to any one of claims 6 to 9, and optionally further comprising one or more pharma- ceutically acceptable ingredients.

12. A recombinant adeno-associated virus genome according to claim 1 or 2, or an adeno-associated virus vector according to any one of claims 6 to 9, for use as a medicine.

13. A recombinant adeno-associated virus genome according to claim 1 or 2, or an adeno-associated virus vector according to any one of claims 6 to 9, for use in the treatment and / or prevention of pathologies associated with shortened telomere length.

14. A recombinant adeno-associated virus genome according to claim 1 or 2, or an adeno-associated virus vector according to any one of claims 6 to 9, for use in the treatment and / or prevention of pulmonary fibrosis.

15. A recombinant adeno-associated virus genome according to claim 1 or 2, or an adeno-associated virus vector according to any one of claims 6 to 9, for use in the treatment and / or prevention of pulmonary fibrosis via intratracheal administration.

Images