Screening System

Abstract

Described herein are nucleic acid constructs comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein the promoter and / or enhancer is inducible by an olfactory receptor, cells and populations comprising the constructs, and methods for expressing olfactory receptors and for identifying novel olfactory receptors and receptor-ligand interactions.

Description

[Technical field]

[0001] Field Aspects and embodiments described herein relate to the field of olfactory receptors, and to nucleic acid constructs, host cells, and methods for expressing olfactory receptors and for identifying novel olfactory receptors and receptor-ligand interactions. [Background technology]

[0002] background Olfactory or odorant receptors (ORs) are expressed in olfactory neurons of the olfactory epithelium and are responsible for the detection of odorant molecules. Olfactory receptors belong to the G protein-coupled receptor superfamily (GPCR). Activation of ORs by odorant molecules (ligands) activates olfactory-specific G proteins, which then promote the production of cyclic AMP (cAMP) via type III adenylate cyclase. Increased levels of intracellular cAMP lead to the opening of cyclic nucleotide-gated ion channels, which allow calcium ions to flow into the cell, depolarizing the olfactory neuron and triggering action potentials that carry information to the brain.

[0003] The human genome encodes about 400 different functional olfactory receptors. A particular olfactory receptor may be activated by more than one ligand molecule, and a particular ligand molecule may activate multiple olfactory receptors, creating a highly complex network of interactions between ORs and the repertoire of ligands. Elucidation of the above interactions may allow the discovery of novel flavor and fragrance ingredients, or compounds such as odor enhancers that are more sustainable and / or easier to produce than currently used compounds.

[0004] Efficient screening of olfactory receptors requires their expression in cultured cell lines, which generally involves the introduction of olfactory receptor genes into cells followed by their stable or transient overexpression. Expression of functional heterologous olfactory receptors using expression systems currently available in the art generally requires the co-expression of accessory proteins of the receptor transportin G protein (RTP) family, namely RTP1S and RTP2 (Yu et al. (2017) PLoS One 12(6): e0179067), which are usually expressed in olfactory neurons and facilitate the transport of ORs to the cell surface membrane. However, more than half of the known olfactory receptors cannot be functionally expressed using currently available nucleic acid constructs, cell lines and methods. This results in a currently limited scope of the available receptor-ligand space, the existence of multiple receptors without identified ligands (orphan receptors), and limited industrial application of the methods. Thus, there is a need for improved nucleic acid constructs, cell lines and methods for expressing olfactory receptors, and for identifying novel cognate receptor-ligand interactions.

[0005] Classical OR screening assays rely on an approach in which a population of clonal cells generally receives one receptor and / or accessory molecule at a time, and then is tested for functional activation by a variety of ligands. The assays more generally include co-expression of a luciferase gene used as a reporter gene, operably linked to a promoter inducible by cAMP (Saito et al. (2004) Cell 119(5): 679-691). Activation of olfactory receptors and the subsequent increase in intracellular cAMP results in the expression of luciferase. Cleavage of luciferin by luciferase results in the emission of light, which can then be detected and quantified. Classical OR screening assays are limited by the number of olfactory receptors, accessory molecules, and / or ligands that can be screened at once, are time-consuming and cumbersome, and are not compatible with high-throughput screening and selection methods, such as the screening of libraries of volatile flavor and fragrance compounds. Therefore, there is still a need for an improved screening assay for ORs that does not have the aforementioned weaknesses. Summary of the Invention

[0006] Abstract Aspects of the invention relate to methods for selecting for cells expressing functional olfactory receptors and / or for accessory molecules required for functional expression in said cells, said methods comprising the steps of: A) providing a cell, said cell comprising: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, and wherein the encoded polypeptide confers resistance to an antibiotic, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence (half CRE), or a NFAT response element (NFAT-RE); and A second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor. Including, B) culturing the cells in the presence of a ligand for the olfactory receptor; C1) Selecting for cells functionally expressing the olfactory receptor by culturing them in the presence of an antibiotic and a ligand.

[0007] Another aspect of the invention relates to a method for selecting for cells expressing a functional olfactory receptor and / or for accessory molecules required for functional expression in said cells, said method comprising the steps of: A) subjecting a cell to a mutagenesis step, said cell comprising: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half-sequence, or a NFAT response element (NFAT-RE); and A second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor. Including, B) culturing the mutated cells in the presence of a ligand for the olfactory receptor; C1) Selecting for mutant cells that functionally express the olfactory receptor by culturing them in the presence of an antibiotic and a ligand.

[0008] In some embodiments, the mutagenesis step is carried out using insertion mutagenesis, where the nucleic acid sequence is inserted into the genome of the cell using a plasmid, a linear DNA sequence, a transposon, a retrovirus, a lentivirus or CRISPR-Cas mediated recombination.In some embodiments, the inserted nucleic acid sequence comprises an enhancer and / or promoter sequence suitable for activating the expression of endogenous genes.In some embodiments, the insertion site of the inserted nucleic acid sequence in the selected cell is mapped and / or identified.In some embodiments, the mutagenesis step is carried out using CRISPR-Cas mediated mutagenesis using CRISPR interference (CRISPRi) or CRISPR activation (CRISPRa).

[0009] Another aspect of the present invention relates to a method for identifying an olfactory receptor that is bound to a given ligand, said method comprising the steps of: A) providing a heterogeneous population of cells, said cells comprising: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half-sequence, or a NFAT response element (NFAT-RE); and A second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor. Including, wherein the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct contained in at least one of the cells is distinguishable from the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct in at least one of the other cells of the population; B) culturing said population of cells in the presence of said given ligand; C1) selecting cells that functionally express an olfactory receptor that binds to the given ligand by culturing them in the presence of an antibiotic and a ligand; D) determining the nucleotide sequence encoding the receptor in the selected cells.

[0010] In some embodiments, the method according to the present invention is as follows: step C1) additionally includes a subculture step, in which cells having improved functional expression of olfactory receptors are enriched in culture.

[0011] In some embodiments, the method according to the invention is as follows: the nucleic acid sequence encoding a polypeptide that confers resistance to an antibiotic is a puromycin-N-acetyltransferase gene or a blasticidin-S deaminase gene.

[0012] Another aspect of the present invention relates to a nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide that confers resistance to an antibiotic, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE). In some embodiments, the nucleic acid sequence encoding a polypeptide that confers resistance to an antibiotic is a puromycin-N-acetyltransferase gene or a blasticidin-S deaminase gene.

[0013] Another aspect of the present invention relates to a cell comprising the nucleic acid construct as defined above and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor, preferably wherein said nucleic acid constructs are fused to constitute a single nucleic acid construct.In some embodiments, the cell is a eukaryotic cell, preferably a human cell.

[0014] Another aspect of the present invention relates to a population of cells as defined above, wherein the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct contained in at least one of the cells can be distinguished from the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct in at least one of the other cells in the population, and defines a pool of cells expressing a distinguishable olfactory receptor.In some embodiments, the population of cells is as follows: at least one olfactory receptor is functionally expressed in the population of cells.

[0015] Another aspect of the present invention relates to an olfactory receptor, the amino acid sequence of which comprises an amino acid sequence having at least 60% identity or similarity to SEQ ID NO: 62, preferably wherein SEQ ID NO: 62 is located at the C-terminus of the olfactory receptor.

[0016] Another aspect of the present invention relates to an olfactory receptor, preferably comprising an amino acid sequence having at least 60% identity or similarity to SEQ ID NO: 62, more preferably wherein SEQ ID NO: 62 is located at the C-terminus of the olfactory receptor and wherein the amino acid sequence comprises, essentially consists of, or consists of an amino acid sequence having at least 60% identity or similarity to SEQ ID NO: 20.

[0017] definition The present invention provides nucleic acid constructs, cells and methods useful in the functional expression of olfactory receptors (ORs) that are difficult to express using conventional approaches, and in the identification of novel cognate receptor-ligand pairs.The present invention further provides olfactory receptors with improved functional expression and / or improved accessory molecules.The nucleic acid constructs, cells and methods described herein exhibit at least one, at least two, at least three, at least four, at least five, or all of the following advantages over known nucleic acid constructs, cells and methods.

[0018] Enablement of functional expression of olfactory receptors that is otherwise not possible using conventional approaches The feasibility of selecting or screening and sorting cells that functionally express olfactory receptors and / or accessory molecules Possible identification of improved accessory molecules and / or genetic and / or epigenetic modifications required for functional or improved functional expression of olfactory receptors. Feasibility of identifying novel cognate receptor-ligand pairs Increased throughput capacity for screening olfactory receptors, accessory molecules and ligands

[0019] As also shown in the Examples section herein, significant improvements over conventional approaches are anticipated from the application of the nucleic acid constructs, cells and methods of the present invention. Thus, aspects and embodiments of the present invention as described herein address at least some of the problems and needs as discussed herein.

[0020] Nucleic Acid Constructs In a first aspect, the present invention provides a nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE). In some embodiments, the promoter and / or enhancer comprises one or more copies of a cAMP response element (CRE). In some embodiments, the promoter and / or enhancer comprises one or more copies of a CRE half sequence. In some embodiments, the promoter and / or enhancer comprises one or more copies of a NFAT response element (NFAT-RE). Definitions of cAMP response element (CRE), CRE half sequence, and NFAT response element (NFAT-RE) are provided elsewhere herein.

[0021] The term "olfactory receptor" or "odor molecule receptor" (OR), as used herein, has its customary meaning as commonly understood by those skilled in the art in light of the present disclosure. It refers to a receptor belonging to the seven-transmembrane domain G protein-coupled receptor superfamily (GPCR), which is typically expressed in the cell membrane of olfactory receptor neurons. The seven predicted transmembrane (TM) domains TM I-TM VII are connected by three predicted internal (IC) loop domains (IC I-IC III), and three predicted external (EC) loop domains (EC I-EC III). ORs typically contain olfactory receptor-specific amino acid motifs. Examples of such motifs are the N-MAYDRYVAIC-C motif that overlaps with TM III and IC II, the N-FSTCSSH-C motif that overlaps with IC III and TM VI, the N-PMLNPFIY-C motif in TM VII, as well as the presence of three conserved C residues in EC II and a highly conserved GN residue in TM I, discussed in Zhang and Firestein (2002) Nature Neurosci 5(2): 124-33 and Malnic et al. (2004) PNAS 101(8):2584-9, all of which are incorporated by reference in their entireties. Mammalian and human olfactory receptors are discussed in publications such as Mainland et al. (2015) Sci Data 2:150002, which is incorporated by reference in its entirety, and in publicly available databases such as the HORDE (The Human Olfactory Data Explorer) database maintained by the Weizmann Institute of Science, as described in Olender et al. (2013) Methods Mol Biol 1003:23-38, which is incorporated by reference in its entirety.

[0022] Activation of olfactory receptors in olfactory neurons by odor molecules (ligands) is typically mediated by olfactory-specific G proteins (Gα olf ), which in turn promotes the production of cyclic adenosine monophosphate (cAMP) via type III adenylate cyclase. Increased levels of intracellular cAMP induce calcium influx into olfactory receptor neurons through the opening of cAMP-dependent calcium channels. Calcium influx triggers the opening of another channel that causes chloride ion efflux, triggering an action potential that results in a signal to the corresponding area of ​​the brain. Olfactory receptors may interact with multiple ligands, and one ligand may activate multiple olfactory receptors.

[0023] As used herein, the term "expression" of a DNA molecule by a cell includes any step involved in the production of a polypeptide by a cell, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, transport to the cell membrane, and secretion. Expression may be evaluated by any method known to those skilled in the art. For example, expression may be evaluated by measuring the level of gene expression in transduced cells at the mRNA or protein level by standard assays known to those skilled in the art, such as qPCR, RNA sequencing, Northern blot analysis, Western blot analysis, mass spectrometry of peptides derived from proteins, or ELISA.

[0024] As used herein, the term "functional expression" refers to the production of a polypeptide by a cell in which the polypeptide exhibits biological activity. For example, an olfactory receptor is functionally expressed by a cell if the receptor, after its production, is transported to and integrated into the cell membrane, and can trigger its corresponding signal transduction cascade and its subsequent activation by a ligand. A conventional method for evaluating the functional expression of an olfactory receptor includes the expression of the OR with the co-expression of a luciferase gene used as a reporter gene, operably linked to a cAMP-inducible promoter (Saito et al. (2004) Cell 119(5): 679-691). When an olfactory receptor is functionally expressed, its activation and the resulting increase in intracellular cAMP will result in the expression of luciferase. The cleavage of luciferin by luciferase in a standard assay will result in the emission of light, which can then be detected and quantified. A similar approach can be utilized to evaluate the functional expression of an accessory molecule of an OR. A definition of "accessory molecule" is provided later in this specification.

[0025] The present invention provides improved methods for selecting or screening for functional expression of olfactory receptors and / or accessory molecules, as described hereinafter and shown in the experimental section.

[0026] The functional expression of a polypeptide, such as an olfactory receptor or an accessory molecule, may be improved (increased) compared to baseline functional expression, which may result in improved (increased) biological activity. The improved (increased) functional expression may result, for example, from the occurrence of genetic and / or epigenetic modifications in cells expressing ORs, compared to unmodified corresponding cells. The functional expression may be improved (increased) by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%, compared to unmodified corresponding cells. Improved functional expression may also mean that functional expression of an olfactory receptor that is otherwise not possible using conventional approaches is achieved using the nucleic acid constructs, cells and methods of the present invention.

[0027] As used herein, "nucleic acid construct" refers to a DNA molecule that includes a region (coding region or ORF) that is transcribed into an RNA molecule (e.g., an mRNA molecule) in a cell, operably linked to suitable regulatory regions, such as, but not limited to, a promoter and / or enhancer sequence. A nucleic acid construct will generally include multiple operably linked fragments, such as a promoter, an enhancer, a 5' leader sequence, a coding region, and / or a 3' untranslated region (3' end), including, for example, a polyadenylation and / or transcription termination site. A nucleic acid construct may be recombinant, i.e., one that is not normally found in nature, such as a nucleic acid construct in which a promoter is not naturally associated with some or all of the coding region. Molecular toolbox techniques for the preparation of nucleic acid constructs are well known in the art and are discussed in standard handbooks such as Ausubel et al., Current Protocols in Molecular Biology, 3rd Edition (2003), John Wiley & Sons Inc and Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012), Cold Spring Harbor Laboratory Press, all of which are incorporated herein by reference in their entirety. Non-limiting examples of such techniques, some of which are presented herein in the experimental section, are fusion PCR, restriction enzyme digestion, Golden-gate cloning, etc.

[0028] The term nucleic acid construct also encompasses expression vectors. "Expression vector", alternatively referred to herein as "vector" or "delivery vector", refers to a molecular biology tool used to obtain expression of a coding region (such as a gene) in a host cell, for example by introducing a nucleotide sequence that can result in expression of the gene or coding sequence in a host cell compatible with said sequence. The expression vector may be stable in the host cell or may remain episomal. Alternatively, the vector may be one that can be integrated into the genome of the host cell, for example, through homologous recombination, non-homologous end joining, or otherwise. The definition of "host cell" is provided elsewhere herein.

[0029] Suitable expression vectors can be selected from any genetic element known in the art that can facilitate the transfer of nucleic acid between cells, such as, but not limited to, plasmids, phages, transposons, cosmids, chromosomes, artificial chromosomes, viruses (such as, but not limited to, retroviruses, lentiviruses, etc.), virions, etc. Expression vectors can also be chemical vectors, such as lipid complexes or naked DNA. "Naked DNA" or "naked nucleic acid" refers to a nucleic acid molecule that is not contained in an encapsulation means that facilitates the delivery of the nucleic acid to the cytoplasm of a target host cell. Naked DNA can be circular or linear (linear DNA sequence). Optionally, naked nucleic acid can be associated with standard means used in the art to facilitate its delivery of the nucleic acid to the target host cell, for example, to facilitate the transport of the nucleic acid through a cell membrane. A preferred expression vector is a plasmid. Suitable plasmids are known in the art and are described in standard handbooks, such as Ausubel et al., and Sambrook and Green (supra). Suitable plasmids may also be selected from commercially available vectors such as the pcDNA3.1(+) series (Invitrogen, MA, USA) or the pGL4.29 series of vectors (Promega, WI, USA).

[0030] As used herein, the term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are generally contiguous, and where necessary, contiguous and in reading frame to join the coding regions of two proteins. Linking can be accomplished by ligation at convenient restriction sites or at adapters or linkers inserted instead, or by gene synthesis.

[0031] The nucleic acid construct according to the present invention comprises a promoter and / or enhancer sequence operably linked to the nucleic acid sequence encoding a polypeptide.As used herein, the term "promoter" or "transcriptional regulatory sequence" refers to a nucleic acid sequence that functions to control the transcription (i.e., expression) of one or more coding sequences, and is located upstream in the direction of transcription of the transcriptional start site of the coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, a transcriptional start site, and any other DNA sequence (including, but not limited to, a transcription factor binding site, a repressor and activator protein binding site, and any other nucleotide sequence known to those skilled in the art to act to directly or indirectly control the amount of transcription from the promoter, such as a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE), as described later herein).

[0032] As used herein, the term "enhancer" refers to a nucleic acid sequence that can stimulate the transcription of a sequence to which it is operably linked. An operably linked enhancer does not necessarily have to be contiguous with the coding sequence whose transcription it controls. Enhancers can be used as single sequences or can be included in fusion nucleotide sequences with other enhancers and / or promoters as described herein.

[0033] The promoters and enhancers as described herein may be modified compared to the corresponding naturally occurring sequences. Such modified promoters and enhancers may alternatively be referred to herein as "derivatives" of their naturally occurring (wild type) versions. Suitable non-limiting modifications may be selected from nucleotide insertions, deletions, mutations and / or substitutions. Suitable modifications also include, but are not limited to, the fusion of promoter sequences with other nucleotide sequences, such as enhancers and / or other promoter sequences. Promoter-enhancer fusions may be particularly suitable. Modification of nucleotide sequences, i.e., genetic modifications, may be performed using any recombinant DNA technique as known in the art, for example as described in standard handbooks such as Ausubel et al. and Sambrook and Green (supra).

[0034] The promoter and / or enhancer as described herein may be inducible by olfactory receptors. The term "inducible promoter" as used herein refers to a promoter or derivative thereof that initiates transcription only by contact with a physiological or chemical inducer. Those skilled in the art will understand that an inducible promoter or derivative thereof may still allow transcription of a coding sequence at a detectable level in the absence of an inducer ("leaky" expression). Leaky expression may mean that an inducible promoter or derivative thereof allows transcription of a coding sequence at a level at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 100-fold lower in the absence of an inducer compared to the presence of said inducer. Expression may be assessed at the mRNA or protein level by standard assays known to those skilled in the art (e.g., qPCR, Western blotting, ELISA).

[0035] Olfactory receptors can induce promoters and / or enhancers as described herein through inducer molecules produced by the activation of said receptors by ligands. The inducer molecules can induce promoters and / or enhancers directly (i.e., by directly binding to the respective nucleic acids) or indirectly by triggering a G protein signaling cascade that results in said promoter and / or enhancer activation. Inducer molecules associated with the activation of ORs include inositol triphosphate (IP3), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), Ca 2+ Preferably, the inducer molecule is selected from signaling molecules such as cAMP or Ca 2+ It is.

[0036] Preferred promoters and / or enhancers according to the present invention include one or more copies of a cAMP responsive element (CRE), a CRE half-sequence, or a NFAT responsive element (NFAT-RE). In some embodiments, the promoters and / or enhancers include two or more copies of a cAMP responsive element (CRE), a CRE half-sequence, or a NFAT responsive element (NFAT-RE). In some embodiments, the promoters and / or enhancers include three or more copies of a cAMP responsive element (CRE), a CRE half-sequence, or a NFAT responsive element (NFAT-RE). In some embodiments, the promoters and / or enhancers include four or more copies of a cAMP responsive element (CRE), a CRE half-sequence, or a NFAT responsive element (NFAT-RE).

[0037] In some embodiments, the promoter and / or enhancer comprises one or more copies of a cAMP responsive element (CRE) in combination with one or more copies of a CRE half-sequence.

[0038] In some embodiments, the promoter and / or enhancer comprises one or more copies of a cAMP responsive element (CRE) in combination with one or more copies of a NFAT responsive element (NFAT-RE).

[0039] In some embodiments, the promoter and / or enhancer comprises one or more copies of a CRE half-sequence in combination with one or more copies of a NFAT-responsive element (NFAT-RE).

[0040] In some embodiments, the promoter and / or enhancer comprises a combination of one or more copies of a cAMP responsive element (CRE), one or more copies of a CRE half-sequence, and one or more copies of a NFAT responsive element (NFAT-RE).

[0041] A cAMP responsive element (CRE) or CRE half-sequence is a nucleic acid sequence that, when contained in a promoter and / or enhancer, renders said promoter and / or enhancer inducible by cAMP. Such promoters and / or enhancers may be referred to as cAMP-responsive promoters and / or enhancers. The mechanism of activation of a CRE or CRE half-sequence is known in the art. Typically, in cells that functionally express olfactory receptors, activation of the olfactory receptor by a ligand results in activation of a G protein (the G protein is Gα in the case of olfactory neurons). olf In some cell types, the activation of cAMP-binding protein kinase A (PKA) results in the phosphorylation of the 43 kDa stimulus-inducible transcription factor (TF), cAMP response element-binding G protein 1 (CREB). CREB can bind to the cAMP response element or CRE half-sequence, which results in the transcription of a nucleic acid sequence encoding an operably linked polypeptide.

[0042] The cAMP responsive element (CRE) may be represented by the nucleic acid sequence 5'-TGACGTCA-3' (SEQ ID NO:1). The CRE half sequence may be represented by the nucleic acid sequence 5'-TGACG-3' (SEQ ID NO:2). Thus, in some embodiments, the promoter and / or enhancer comprises one or more copies of SEQ ID NO:1. In some embodiments, the promoter and / or enhancer comprises two or more copies of SEQ ID NO:1. In some embodiments, the promoter and / or enhancer comprises three or more copies of SEQ ID NO:1. In some embodiments, the promoter and / or enhancer comprises four or more copies of SEQ ID NO:1. In some embodiments, the preferred promoter and / or enhancer comprises one or more copies of SEQ ID NO:2. In some embodiments, the promoter and / or enhancer comprises two or more copies of SEQ ID NO:2. In some embodiments, the promoter and / or enhancer comprises three or more copies of SEQ ID NO:2. In some embodiments, the promoter and / or enhancer comprises four or more copies of SEQ ID NO:2.

[0043] The promoter and / or enhancer according to the present invention may comprise a combination of one or more copies of a cAMP responsive element (CRE) and one or more copies of a CRE half-sequence. Exemplary nucleic acid sequences are represented by SEQ ID NOs: 3 and 4. Thus, in some embodiments, preferred promoters and / or enhancers comprise, consist essentially of, or consist of one or more copies of a nucleic acid sequence represented by SEQ ID NO:3 or SEQ ID NO:4, preferably SEQ ID NO:4, or one or more copies of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:3 or SEQ ID NO:4, preferably SEQ ID NO:4.

[0044] Mechanisms of NFAT response element activation are known in the art. When contained in a promoter and / or enhancer, the NFAT-RE (nuclear factor of activated T cells response element) is typically activated by Ca 2+ Typically, in olfactory sensory neuron cells that functionally express olfactory receptors, a signal transduction cascade caused by activation of the olfactory receptor by a ligand leads to the incorporation of Ca into cells expressing ORs. 2+ In cells with exogenous functional expression of olfactory receptors, Ca influx into the cytosol 2+The influx of calcium may be caused by the introduction of a nucleotide sequence encoding a cyclic nucleotide-gated ion channel (CNG channel), which allows calcium to enter the cell after the formation of cAMP. The definition of "exogenous" expression is provided later in this specification. Non-limiting examples of cyclic nucleotide-gated ion channels are CNGA1 (NCBI Genbank Gene ID: 1259), CNGA2 (NCBI Genbank Gene ID: 1260), CNGA3 (NCBI Genbank Gene ID: 1261), CNGA4 (NCBI Genbank Gene ID: 1262), CNGB1 (NCBI Genbank Gene ID: 1258), and CNGB3 (NCBI Genbank Gene ID: 54714). Alternatively, the chimeric G protein described in Conklin et al. (1993) Nature 363:274-276, herein incorporated by reference in its entirety, may be used, which in the presence of cAMP can activate phospholipase C (PLC) leading to the production of IP3, which requires Ca2+ from internal stores. 2+ In the protein, G q The three C-terminal amino acids of α are G i The corresponding residues in α are replaced by those in α. 2+An increase in leads to activation of calmodulin, which in turn leads to activation of nuclear factor of activated T cells (NFAT). NFAT is a family of transcription factors (TFs) including NFATc1, NFATc2, NFATc3, NFATc4 and NFAT5. NFATc1-NFATc4 are regulated by calcium signaling and are known as classical members of the NFAT family. Activation of NFAT leads to activation of NFAT-RE, which leads to transcription of a nucleic acid sequence encoding an operably linked polypeptide. Thus, a promoter and / or enhancer that includes one or more copies of a NFAT-responsive element (NFAT-RE) may also be referred to as a NFAT-responsive promoter and / or enhancer. Those skilled in the art will appreciate that a promoter and / or enhancer according to the present invention may also be cAMP-responsive and NFAT-responsive at the same time.

[0045] An NFAT-RE typically contains one or more NFAT binding sites, which may be represented by the nucleic acid sequence 5'-GGAAAA-3' (SEQ ID NO:5). Thus, in some embodiments, the promoter and / or enhancer contains one or more copies of SEQ ID NO:5. In some embodiments, the promoter and / or enhancer contains two or more copies of SEQ ID NO:5. In some embodiments, the promoter and / or enhancer contains three or more copies of SEQ ID NO:5. In some embodiments, the promoter and / or enhancer contains four or more copies of SEQ ID NO:5.

[0046] NFAT-responsive promoters and / or enhancers typically further comprise one or more binding sites for the transcription factor AP-1 (activator protein 1). An exemplary sequence is represented by SEQ ID NO:6. Thus, in some embodiments, preferred promoters and / or enhancers comprise, consist essentially of, or consist of one or more copies of a nucleic acid sequence represented by SEQ ID NO:6, or one or more copies of a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:6.

[0047] The nucleic acid construct according to the present invention comprises a nucleic acid sequence encoding a polypeptide. In some embodiments, the nucleic acid sequence is a selectable marker, i.e. a sequence encoding a polypeptide that can be used for the selection of host cells expressing the nucleic acid sequence by conferring a selective advantage to the cells upon exposure to selective conditions. A selectable marker may allow for positive or negative selection. Suitable selectable markers are known in the art, and such markers and selection methods are discussed in standard publications, such as, for example, Mortensen and Kingston (2009) Curr Protoc Mol Biol 86:9.5.1-9.5.13, which is incorporated by reference in its entirety. The skilled artisan will appreciate that the application of a particular selectable marker may allow for positive or negative selection, depending on the host cell and / or the selective conditions applied. A positive selectable marker is a marker that allows for the survival and / or growth of a host cell upon exposure to selective conditions where survival and / or growth would not otherwise occur. Non-limiting examples of such markers are markers that confer resistance to toxic compounds such as antibiotics, markers that allow utilization of uncommon carbon and / or nitrogen sources, markers that complement auxotrophy for carbon, nitrogen, and / or micronutrients resulting from mutation or application of selective conditions (such as, but not limited to, cytosine deaminase (EC 3.5.4.1), dihydrofolate reductase (EC. 1.5.1.3), histidinol dehydrogenase (EC 1.1.1.23), thymidine kinase (2.7.1.21), or xanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)). A preferred selectable marker is a nucleic acid sequence that encodes a polypeptide that confers resistance to an antibiotic.Non-limiting examples of such nucleic acid sequences include the puromycin-N-acetyltransferase gene (pac, e.g., as represented by SEQ ID NO: 7), which confers resistance to puromycin, the hygromycin-B-phosphotransferase gene (hph, e.g., as represented by SEQ ID NO: 8), which confers resistance to hygromycin B (hygrovetine), the aminoglycoside 3'-phosphotransferase gene (neo, e.g., from Klebsiella pneumoniae, UniprotKB Ref: N0DR31), which confers resistance to geneticin (G418), the Sh ble gene (e.g., from Streptoalloteichus hindustanus, UniprotKB Ref: P17493), which confers resistance to zeocin and other antibiotics of the bleomycin family, and the blasticidin-S deaminase gene (bsd, e.g., from Aspergillus Another example of a blasticidin-S deaminase is represented by the amino acid sequence of SEQ ID NO: 65 and / or encoded by the nucleotide sequence represented by SEQ ID NO: 64. In some embodiments where the selectable marker encodes a polypeptide that confers resistance to an antibiotic, the puromycin-N-acetyltransferase gene is preferred. Thus, in some embodiments, the polypeptide that confers resistance to an antibiotic is puromycin-N-acetyltransferase.

[0048] Another preferred selectable marker encoding a polypeptide that confers resistance to an antibiotic is the blasticidin-S deaminase gene. Thus, in some embodiments, the polypeptide that confers resistance to an antibiotic is blasticidin-S deaminase.

[0049] The use of blasticidin-S deaminase as a selectable marker and the associated resistance to blasticidin may be particularly advantageous in combination with the methods described herein.As shown in the experimental section herein, and compared to other antibiotic selection, blasticidin selection can provide an enhanced dynamic range, i.e., a large difference in viability measured between cells that functionally express OR in the presence of ligand and cells that survive without functional OR expression or in the absence of ligand.Cell viability and its measurement will be further discussed later in this specification.

[0050] In some embodiments, the nucleic acid construct comprises, consists essentially of, or consists of a nucleic acid sequence represented by SEQ ID NO:7 or 8, or a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:7 or 8. In some embodiments, the nucleic acid construct comprises, consists essentially of, or consists of a nucleic acid sequence represented by SEQ ID NO:7, 8 or 64, preferably SEQ ID NO:64, or a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:7, 8 or 64, preferably SEQ ID NO:64.

[0051] Negative selectable markers are markers that eliminate or inhibit growth upon exposure to selective conditions where growth would otherwise occur. Non-limiting examples of such markers are Herpes simplex thymidine kinase (UniprotKB Ref:Q9QNF7), which renders host cells sensitive to ganciclovir selection, and cytosine deaminase (EC 3.5.4.1), which renders host cells sensitive to 5-fluorocytosine selection.

[0052] In some embodiments, the nucleic acid construct according to the present invention comprises a nucleic acid sequence encoding a polypeptide, wherein said polypeptide is a reporter polypeptide. The expression of said polypeptide is an indication of the activation of an olfactory receptor. The expression may be directly or indirectly detectable. A "reporter polypeptide" is a polypeptide whose expression results in a measurable signal. "Direct detection" refers to the measurable signal being directly measurable. A non-limiting example of a directly measurable reporter polypeptide is any variant of a fluorescent protein, such as green fluorescent protein (GFP), or any variant with a different fluorescence spectrum, such as red fluorescent protein. Such polypeptides are known to those skilled in the art and are discussed in standard handbooks such as Chalfie and Kain, Green Fluorescent Protein: Properties, Applications and Protocols (Methods of Biochemical Analysis), 2nd Edition (2005), Wiley-Liss (incorporated herein by reference in its entirety), and in publicly available databases such as FPbase (www.fpbase.org), described in Lambert (2019) Nature Methods 16:277-278, which is incorporated herein by reference in its entirety. Expression of such polypeptides and subsequent activation of olfactory receptors results in the emission of a fluorescent signal, which can be detected and utilized to enrich cells using commercially available devices such as a fluorescence activated cell sorting device (FACS) or a device capable of automatically picking up colonies of fluorescent clones, such as the ClonePix2 colony picker (Molecular Devices, CA, USA). Alternatively, any enzyme known to those of skill in the art that can form a fluorescent product that is retained intracellularly, thereby allowing detection of a fluorescent signal by commercially available devices as discussed above, may be used.Thus, in some embodiments, the encoded polypeptide is detectable by a fluorescence activated cell sorting device.

[0053] "Indirect detection" will typically require additional steps before a measurable signal resulting from expression of the reporter polypeptide is obtained. A non-limiting example of an indirectly detectable reporter polypeptide is an antigen that can be recognized by a fluorescently labeled antibody. Expression of such a polypeptide and subsequent activation of the olfactory receptor using standard protocols followed by incubation with such an antibody will allow detection of the fluorescent signal using a commercially available device as described above. Alternatively, reporter polypeptides such as, but not limited to, β-galactosidase (EC 3.2.1.23), β-lactamase (EC 3.5.2.6), and calatase (EC 1.11.1.6) may be used, which catalyze a reaction that results in the formation of a detectable color product when contacted with their corresponding substrate in a standardly used assay, for example as described in Kasper et al. (2016) Methods Mol Biol 1453:123-36, which is incorporated herein by reference in its entirety. Expression of the reporter polypeptide may be combined with a commercially available substrate, such as CellEvent™ (ThermoFisher Scientific, MA, USA), for ease of detection.

[0054] The functional relationship between the promoter and / or enhancer that can be induced by the olfactory receptor as described herein and the nucleic acid sequence that encodes a polypeptide, such as a selectable marker or reporter polypeptide, may be confirmed experimentally without the activation of the olfactory receptor, using standard methods in the art, for example, as described in standard publications such as Alasbahi and Melzig, (2012) Pharmazie 67(1):5-13, which is incorporated herein by reference in its entirety. As a non-limiting example, a selectable marker that confers resistance to antibiotics may be introduced into the genome of a host cell, operably linked to a promoter and / or enhancer that comprises one or more copies of a cAMP response element (CRE) and / or a CRE half sequence. The cells may then be cultured in the presence of the cAMP inducer forskolin and an antibiotic according to standard methods and conditions. The resistance to antibiotics induced by forskolin (caused by the increase in intracellular cAMP, such as that resulting from the activation of the olfactory receptor) demonstrates the functional relationship.

[0055] In the context of the present invention, the olfactory receptor can be expressed by a host cell. The olfactory receptor can be a variant (alternatively referred to herein as a mutant), i.e. an olfactory receptor modified compared to the corresponding naturally occurring sequence. Preferably, said expression is functional expression. The expression of the olfactory receptor can be endogenous or exogenous. Endogenous expression refers to the expression of the olfactory receptor by a cell that can express it natively, i.e. a cell that contains the genetic information required for its expression, for example an olfactory neuron cell. Exogenous expression typically refers to the expression of the olfactory receptor by a different organism and / or cell in which the olfactory receptor is not natively expressed and whose ability has been introduced via recombinant DNA technology means. Within the context of the present invention, the term exogenous expression also includes cases in which the native expression of the olfactory receptor is increased compared to the corresponding native expression via recombinant DNA technology means using standard molecular toolbox techniques (e.g., overexpression). Said increase can be achieved by modification of any of the steps of expression of the olfactory receptor, including transcription, post-transcriptional modification, translation, post-translational modification, and transport to the cell membrane. The increase may be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, or at least 200% compared to the corresponding native expression. Expression may be assessed at the mRNA or protein level by standard assays known to those of skill in the art (e.g., qPCR, Western blotting, ELISA).

[0056] Therefore, the present invention further provides a nucleic acid construct comprising a nucleic acid sequence encoding an olfactory receptor as defined herein above. The nucleic acid sequence encoding an olfactory receptor may be operably linked to a promoter and / or enhancer. The promoter may be one that allows constitutive, i.e. constant expression, such as, but not limited to, the CMV promoter (SEQ ID NO: 15). The promoter may be one that is inducible. The nucleic acid construct comprising the nucleic acid molecule encoding an olfactory receptor may be another nucleic acid construct or may be fused with a nucleic acid construct comprising a nucleic acid sequence comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein the promoter and / or enhancer is inducible by the olfactory receptor as described herein above, and preferably the two constructs are fused to constitute a single nucleic acid construct. Non-limiting examples of nucleic acid sequences encoding olfactory receptors are OR10G9 (NCBI Genbank Gene ID: 219870), OR5AN1 (NCBI Genbank Gene ID: 390195, SEQ ID NO: 70), OR5A2 (NCBI Genbank ID: 219981), OR5A1 (NCBI Genbank Gene ID: 219982), OR6Y1 (NCBI Genbank Gene ID: 391112), OR10G4 (NCBI Genbank Gene ID: 390264, SEQ ID NO: 72), and OR10G7 (NCBI Genbank Gene ID: 390265, SEQ ID NO: 71). Further examples of nucleic acid sequences encoding olfactory receptors can be found in publications such as Mainland et al. (supra) and in publicly available databases such as the HORDE (The Human Olfactory Data Explorer) database (supra).

[0057] In some embodiments, the nucleic acid construct, preferably a plasmid, comprises a nucleic acid sequence encoding an olfactory receptor and a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, preferably a selectable marker, more preferably a selectable marker that confers resistance to an antibiotic, wherein the promoter and / or enhancer sequence is inducible by the olfactory receptor, preferably wherein the promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE). Preferably, the selectable marker is a puromycin-N-acetyltransferase gene or a blasticidin-S deaminase gene, more preferably a blasticidin-S deaminase gene.

[0058] Optionally, additional nucleic acid sequences may be operably linked to the nucleotide sequence contained in any of the nucleic acid constructs described herein.Non-limiting examples of such sequences include nucleic acid sequences encoding signal peptides such as N-terminal LUCY-tag (SEQ ID NO:9, SEQ ID NO:10), FLAG-tag (SEQ ID NO:11) and rho-tag (SEQ ID NO:12), described in Shepard et al. (2013) PLoS One 8(7): e68758, Zhuang and Matsunami (2007) J Biol Chem 282(20): 15284-15293, and WO2014 / 037800 (each of which is incorporated herein by reference in its entirety).Another example of a nucleic acid sequence encoding a signal peptide is represented by SEQ ID NO:13. Further non-limiting examples of nucleic acid sequences include nuclear localization signals, Kozak sequences, polyA tails, transcription terminators such as the bovine growth hormone (bgh) terminator sequence (SEQ ID NO: 16), and the like.

[0059] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a polypeptide represented by SEQ ID NO: 9, 10, 11, 12 or 14, preferably SEQ ID NO: 14, or a nucleic acid sequence encoding a polypeptide represented by SEQ ID NO: 9, 10, 11, 12 or 14, Preferably, the polypeptide comprises, consists essentially of, or consists of a nucleotide sequence encoding a polypeptide having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity or similarity to SEQ ID NO:14.

[0060] In some embodiments, the nucleic acid construct comprises, consists essentially of, or consists of a nucleic acid sequence represented by SEQ ID NO:13, or a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:13.

[0061] Optionally, a nucleic acid sequence encoding additional accessory molecules or other proteins may be included in any of the nucleic acid constructs described herein. An "accessory molecule" or "chaperone" is a protein or peptide that can assist in the expression of an olfactory receptor, transport to the surface of a cell expressing said olfactory receptor, and / or signal transduction. An accessory molecule may be a variant (alternatively referred to herein as a mutant), i.e., an accessory molecule that is modified compared to the corresponding naturally occurring sequence. Non-limiting examples of accessory molecules or other proteins include RTPL1, RTP1S, RTP2, REEP, RTP1S V227I variant, RTP2 L220R variant, β-adrenergic receptor, heat shock protein 70, Ric8b, Gα olf , G i α, or variants thereof, and are further described in WO2006 / 002161 and WO2014 / 037800, which are incorporated by reference in their entireties. Preferred accessory molecules are the human RTP1S V227I variant (SEQ ID NO: 17) and the human RTP2 L220R variant (SEQ ID NO: 18). In some embodiments, the nucleic acid construct comprises, consists essentially of, or consists of a nucleic acid sequence encoding a polypeptide represented by SEQ ID NO:17 or 18, or a nucleotide sequence encoding a polypeptide having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity or similarity to SEQ ID NO:17 or 18.

[0062] Additional nucleic acid sequences that may be included in the nucleic acid constructs described herein are constitutively expressed additional selectable markers, such as selectable markers that confer resistance to antibiotics. Such markers may be used, for example, in selecting host cells that contain the nucleic acid constructs of the present invention, prior to application of the methods described herein. A non-limiting example of such a marker is the hygromycin-B-phosphotransferase gene (hph, e.g., as represented by SEQ ID NO: 8), which confers resistance to hygromycin B (hygrobetin).

[0063] In some embodiments, the nucleic acid construct, preferably a plasmid, comprises a nucleic acid sequence encoding an olfactory receptor, a promoter and / or an enhancer sequence, which comprises one or more copies of NFAT-responsive element (NFAT-RE) operably linked to a nucleic acid sequence encoding a polypeptide, preferably a selectable marker, more preferably a selectable marker that confers resistance to antibiotics, and a nucleic acid sequence encoding a cyclic nucleotide-gated ion channel as described herein above.Preferably, the selectable marker is puromycin-N-acetyltransferase gene or blasticidin-S deaminase gene, more preferably blasticidin-S deaminase gene.

[0064] In some embodiments, the nucleic acid construct, preferably a plasmid, comprises a nucleic acid sequence encoding an olfactory receptor, a promoter and / or enhancer sequence, which comprises one or more copies of a NFAT-responsive element (NFAT-RE) operably linked to a nucleic acid sequence encoding a polypeptide, preferably a selectable marker, more preferably a selectable marker that confers resistance to an antibiotic, a nucleic acid sequence encoding a chimeric G protein that can activate phospholipase C as described herein above. Preferably, the selectable marker is a puromycin-N-acetyltransferase gene or a blasticidin-S deaminase gene, more preferably a blasticidin-S deaminase gene.

[0065] Coding sequences and genes as described herein may be codon-optimized for expression in host cells, preferably in eukaryotic cells, more preferably in human cells. "Codon optimization" as used herein refers to the process used to modify existing coding sequences or design coding sequences, for example to improve the translation of RNA molecules that are transcribed from coding sequences in host cells or organisms of expression, or to improve the transcription of coding sequences. Codon optimization includes, but is not limited to, selecting codons for coding sequences that are suitable for the codon preferences of host cells or organisms of expression. Codon optimization also eliminates elements that potentially negatively affect RNA stability and / or translation (e.g., termination sequences, TATA boxes, splice sites, ribosome entry sites, repeats and / or GC-rich sequences, and RNA secondary structures or instability motifs). In some embodiments, the codon optimized sequence exhibits at least 3%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more increase in gene expression, transcription, RNA stability and / or translation compared to the original non-codon optimized sequence.

[0066] host cell The nucleic acid constructs described herein are particularly useful for introduction into a host cell. Thus, in a second aspect, the present invention provides a host cell comprising a nucleic acid construct as defined herein above.

[0067] In some embodiments, the host cell comprises: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, preferably a selectable marker, more preferably a selectable marker that confers resistance to an antibiotic, wherein said promoter and / or enhancer sequence is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half-sequence, or a NFAT response element (NFAT-RE); and A second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor. Includes. Preferably, the nucleic acid constructs are fused to form a single nucleic acid construct, more preferably a single plasmid. In some embodiments, the preferred selectable marker is the puromycin-N-acetyltransferase gene or the blasticidin-S deaminase gene, more preferably the blasticidin-S deaminase gene.

[0068] "Host cells", alternatively referred to herein as "cells" or "engineered cells", refer to cells that have been engineered by the introduction of a nucleic acid construct as defined herein. Host cells may refer to isolated or cultured cells. Host cells may be "transduced cells", where the cells have been infected, for example, by modified viruses. As a non-limiting example, lentiviruses may be used, but other suitable viruses, such as retroviruses or others, may be contemplated as well. The introduction of the nucleic acid construct may also be performed by non-viral methods, for example, by transfection. "Transfection" refers to a non-viral method of introducing DNA (or RNA) into cells such that the introduced nucleic acid sequence is expressed. Transfection methods and protocols are well known in the art, non-limiting examples include calcium phosphate transfection, PEG transfection, and liposome or lipoplex transfection, and are discussed in standard handbooks such as Ausubel et al., and Sambrook and Green (supra). Further examples of transfection methods are provided in the exemplary section herein. Transfection can be transient or stable, the latter referring to the case where cells have the nucleic acid construct integrated into their genome. Host cells containing the nucleic acid construct as described herein can therefore also be "stably transfected cells" or "transiently transfected cells".

[0069] The host cell may further be genetically modified by introducing one or more genetic modifications, including, but not limited to, mutation, substitution, insertion, and / or deletion of nucleotides in its genome, and / or introduction of additional nucleic acid constructs.The modifications may be contained in the nucleotide sequence encoding the olfactory receptor, accessory molecule, and / or in another genomic region, and may result in functional expression or improved functional expression of the olfactory receptor and / or accessory molecule.The definition of functional expression is provided herein above.

[0070] Modification of nucleic acid sequences may be performed using any recombinant DNA technique as known in the art, for example, as described in standard handbooks such as Ausubel et al., and Sambrook and Green (supra). See also Kunkel (1985) Proc. Natl. Acad. Sci. 82:488 (describing site-directed mutagenesis) and Roberts et al. (1987) Nature 328:731 734 or Wells, JA, et al. (1985) Gene 34: 315 (describing cassette mutagenesis).

[0071] Alternatively, further genetic modifications can be introduced by mutagenesis techniques known in the art, such as chemical mutagenesis by irradiating cells with ultraviolet light, or exposing cells to known mutagens, such as, but not limited to, alkylating agents, such as N-ethyl-N-nitrosourea or ethyl methanesulfonate.Alternatively, further genetic modifications can be introduced by insertional mutagenesis of nucleic acid sequences, i.e., targeted or random insertion of DNA sequences, for example, near or within gene sequences, into the genome of host cells, mediated, for example, but not limited to, by plasmids, linear DNA sequences, transposons, lentiviruses, retroviruses, or CRISPR-Cas-mediated recombination (i.e., insertion of nucleic acid sequences into genome via cellular DNA repair mechanisms, such as homologous recombination or non-homologous end joining, followed by CRISPR-Cas-induced double-stranded DNA breaks).The inserted nucleic acid sequence can include a splice acceptor site and / or a polyadenylation signal. The sequence can block gene expression at the insertion site by causing incorrect splicing and / or premature transcription termination (loss-of-function mutations). The inserted nucleic acid sequence may comprise an enhancer and / or promoter sequence. The sequence may optionally also (or instead) comprise a splice donor site. The sequence can activate expression of an endogenous gene. The activation may result from promoting gene expression at the insertion site by promoting transcription and / or correct splicing (gain-of-function mutations).

[0072] Methods and protocols for insertional mutagenesis using plasmids, linear DNA sequences, transposons, lentiviruses, retroviruses, and CRISPR-Cas mediated recombination are well known in the art and can be found in Kandel et al. (2005) PNAS 102:6425-30, Montini et al. (2009) J Clin Invest 119:964-75, Ranzani et al. (2013) Curr Protoc Mol Biol Chapter 9:Unit9.5, Ranzani et al. (2014) Mol Ther 22(12):2056-2068, Feddersen et al. (2019) BMC Genomics 20:497, and Yang et al. (2014) In: Storici F. (ed.) Gene Correction. Methods in Molecular Biology (Methods and Protocols),1114. Humana Press, NJ, USA, each of which is incorporated herein by reference in its entirety.

[0073] Alternatively, further gene modification can be induced by CRISPR-Cas mediated mutagenesis, which can be used for loss-of-function or gain-of-function mutagenesis using CRISPR interference (CRISPRi) or CRISPR activation (CRISPRa), respectively.The method relies on the engineered version of inactivated Cas9 (dCas9), which can regulate gene expression when complexed with repressor protein in CRISPRi (e.g., dCas9-KRAB), which can lead to loss-of-function mutagenesis, or with activator protein in CRISPRa (e.g., dCas9-VPH), which can lead to gain-of-function mutagenesis, and then targeted to the promoter region of gene target using specifically synthesized guide RNA (sgRNA). Guide RNAs, dCas9 proteins, and protocols for gene targeting for the application of CRISPRi and CRISPRa are well known in the art, and there are many commercially available CRISPRa / CRISPRi dCas9 and sgRNA libraries and protocols, for example those provided by Cellecta Inc. (CA, USA).

[0074] Furthermore, genetic modifications may be introduced by evolutionary engineering of host cells. Evolutionary engineering typically relies on (i) generating genetic diversity in host cells, optionally by introducing genetic modifications using any recombinant DNA technique known in the art, such as mutagenesis techniques, such as those described above, and (ii) linking a selectable marker and / or trait with a phenotype of interest, followed by application of selective pressure to the host cells. When the host cells are passed over multiple generations, cells with acquired mutations resulting in an improved phenotype will have a selective advantage and will be enriched in the culture. Evolutionary engineering may result in gain-of-function and / or loss-of-function mutations, depending on the selectable marker and / or trait, and the selective pressure applied. As a non-limiting example, a nucleic acid construct may be introduced into a host cell, comprising a nucleic acid sequence encoding an antibiotic resistance gene, such as a puromycin-N-acetyltransferase gene or a blasticidin-S deaminase gene, operably linked to a promoter and / or enhancer that can be induced by an olfactory receptor, and a nucleic acid sequence encoding an olfactory receptor.Only host cells that can functionally express an olfactory receptor upon exposure to a ligand of the olfactory receptor and the corresponding antibiotic in culture will be able to induce the expression of antibiotic resistance and survive and / or grow.When multiple subculture steps are applied, host cells that have acquired mutations that allow them to express the olfactory receptor more efficiently will be enriched in the culture.This may then be isolated / selected.Further examples of such approaches are provided in the exemplary section herein.

[0075] The host cell may contain epigenetic modifications in the nucleic acid molecule encoding the olfactory receptor, the accessory molecule, and / or another genomic region, which may result in functional expression or improved functional expression of the olfactory receptor and / or the accessory molecule.As used herein, the term "epigenetic modification" has its usual meaning as generally understood by those skilled in the art in light of this disclosure.It refers to chemical modification of DNA or histone protein that does not modify the nucleotide sequence itself.Non-limiting examples of epigenetic modifications include methylation, acetylation, phosphorylation, serotonination, citrullination, ubiquitination, sumoylation, and ribosylation of nucleic acid.

[0076] Additional nucleic acid constructs that may be included in the host cell may include nucleic acid sequences encoding accessory molecules or other proteins as described herein above. Preferred such constructs include nucleic acid sequences encoding the V227I variant of human RTP1S and / or the L220R variant of human RTP2 (SEQ ID NO: 17 and / or 18), as described herein above.

[0077] The host cells may be prokaryotic or eukaryotic cells, preferably they are eukaryotic cells. Suitable prokaryotic cells may be selected from bacteria and archaea. Suitable eukaryotic cells may be selected from insect, plant, yeast, fungi, algae, mammalian and human cells, of which human cells are preferred.

[0078] Suitable host cells include, but are not limited to, HEK293, HEK293T, HeLa, CHO, OP6, HeLa-S3, HEKn, HEKa, PC-3, Calul, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, C0S-M6A, BS-C-1 monkey kidney epithelial cells, BALB / 3T3 mouse embryonic fibroblasts, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblasts, 10.1 mouse fibroblasts, 293-T, 3T3, BHK, BHK-21, BR 293, BxPC3, C3H-10T1 / 2, C6 / 36, Cal-27, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr - / - These include COS-7, HL-60, LNCap, MCF-7, MCF-IOA, MDCK II, SkBr3, Vero cells, primary olfactory cells, immortalized olfactory cells, immortalized taste cells, and transgenic variants thereof, among which HEK293T is preferred. Cell lines are available from a variety of publicly available culture collections, such as the American Type Culture Collection (VA, USA).

[0079] Within the context of the present invention, a host cell may be included in a population of cells. Thus, in a third aspect, the present invention provides a population of cells as described herein. A population of cells may be homogeneous or heterogeneous (mixed). A "homogeneous" or "clonal" population is a population in which all cells contain the same nucleic acid construct and / or gene. A "heterogeneous" or "mixed" population is a population in which at least one of the cells contains a nucleic acid construct and / or gene (e.g., a nucleic acid sequence encoding an olfactory receptor) that can be distinguished from the nucleic acid construct and / or gene contained in other cells. A heterogeneous population may be particularly advantageous, since it can define a pool of cells expressing distinguishable olfactory receptors (i.e., an olfactory receptor library). As a non-limiting example, libraries of olfactory receptors and / or accessory molecules, i.e., pools of cells expressing distinct olfactory receptors and / or accessory molecules, may be generated, which allows for high-throughput screening of novel cognate olfactory receptor-ligand pairs, and / or identification of accessory molecules and / or mutations that allow for functional expression of olfactory receptors that are typically difficult to functionally express otherwise.

[0080] In some embodiments, the population of cells comprises: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, preferably a selectable marker, more preferably a selectable marker that confers resistance to an antibiotic, wherein said promoter and / or enhancer sequence is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half-sequence, or a NFAT response element (NFAT-RE); and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor; Contains some cells, including Wherein, the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct contained in at least one of the cells can be distinguished from the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct contained in at least one of the other cells in said population, and defines a pool of cells expressing a distinguishable olfactory receptor.In some embodiments, at least one olfactory receptor is functionally expressed in said population of cells.Preferably, the selectable marker is puromycin-N-acetyltransferase gene or blasticidin-S deaminase gene, more preferably blasticidin-S deaminase gene.

[0081] In some embodiments, the population of cells comprises: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, preferably a selectable marker, more preferably a selectable marker that confers resistance to an antibiotic, wherein said promoter and / or enhancer sequence is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half-sequence, or a NFAT response element (NFAT-RE); and A nucleic acid molecule encoding an olfactory receptor, Contains some cells, including Wherein, the olfactory receptor encoded by the nucleic acid molecule in at least one of the cells can be distinguished from the olfactory receptor encoded by the nucleic acid molecule in at least one of the other cells in said population, which defines the pool of cells expressing distinguishable olfactory receptors.In some embodiments, at least one olfactory receptor is functionally expressed in said population of cells.Preferably, the selectable marker is puromycin-N-acetyltransferase gene or blasticidin-S deaminase gene, more preferably blasticidin-S deaminase gene.

[0082] method The present invention allows functional expression of olfactory receptors that is otherwise not possible using conventional approaches.The nucleic acid constructs, cells, and cell populations described herein are also particularly useful for use in methods for selecting or screening cells that functionally express olfactory receptors and / or accessory molecules required for said functional expression, for identifying improved accessory molecules and / or genetic modifications and / or epigenetic modifications required for functional or improved functional expression of olfactory receptors, or for identifying novel cognate receptor-ligand pairs.The methods of the present invention are also particularly suitable for high-throughput selection or screening and cell sorting assays.

[0083] Thus, in a fourth aspect, the present invention provides a method for selecting or screening for cells expressing a functional olfactory receptor and / or for accessory molecules required for said functional expression in a cell, said method comprising the steps of: A) providing a cell as described hereinbefore, wherein said cell comprises A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic or is a reporter polypeptide, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE); and A second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor. Including,

[0084] B) culturing the cells in the presence of a ligand for the olfactory receptor; C1) selecting cells that functionally express an olfactory receptor by culturing them in the presence of an antibiotic and a ligand; or C2) Screening for cells functionally expressing an olfactory receptor by detecting and selecting cells expressing a reporter polypeptide in the presence of a ligand.

[0085] In step A), a nucleic acid sequence encoding a polypeptide that confers resistance to an antibiotic is preferred, preferably the nucleic acid sequence is the puromycin-N-acetyltransferase gene or the blasticidin-S deaminase gene. Of steps C1) and C2), step C1) is preferred.

[0086] In a fifth aspect, the present invention provides a method for selecting or screening for cells expressing a functional olfactory receptor and / or for accessory molecules required for said functional expression in a cell, said method comprising the steps of: A) applying a mutagenesis step to a cell as previously described herein, wherein said cell comprises: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic or is a reporter polypeptide, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE); and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor; Including,

[0087] B) culturing the mutated cells in the presence of a ligand for the olfactory receptor; C1) selecting for mutant cells that functionally express an olfactory receptor by culturing them in the presence of an antibiotic and a ligand; or C2) Screening for mutant cells functionally expressing an olfactory receptor by detecting and selecting cells expressing a reporter polypeptide in the presence of a ligand.

[0088] In step A), a nucleic acid sequence encoding a polypeptide that confers resistance to an antibiotic is preferred, and preferably the nucleic acid sequence is the puromycin-N-acetyltransferase gene or the blasticidin-S deaminase gene. Of steps C1) and C2), step C1) is preferred.

[0089] The term "selection" or "cell selection" as used herein has its usual meaning as normally understood by those skilled in the art in view of the present disclosure. It refers to the segregation and / or isolation of cells exhibiting a phenotype of interest from a mixed population by applying selective culture conditions and / or culture media, i.e. conditions and / or media that favor the survival and / or growth of cells exhibiting said phenotype of interest while inhibiting the survival and / or growth of all other cells. The term "screening" or "cell screening" as used herein has its usual meaning as normally understood by those skilled in the art in view of the present disclosure. It refers to the identification of cells exhibiting a phenotype of interest by detection of a measurable signal associated with said phenotype (e.g. expressing a fluorescent reporter polypeptide). The term "screening" also encompasses the sorting after identification of cells exhibiting a phenotype of interest, i.e. their separation and / or isolation from a mixed population.

[0090] Unless otherwise indicated herein, the description provided below of the characteristics of each of the individual steps is applicable to both the fourth and fifth methods; the only difference is that in the method of the fifth aspect, step A) comprises the application of a mutagenesis step.

[0091] In step A) of the fourth and fifth aspects, a cell is provided. The cell may be any cell as described herein above, preferably they are eukaryotic cells, more preferably human cells. The cell comprises a nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide. The promoter and / or enhancer sequence is inducible by an olfactory receptor as described herein above. The encoded polypeptide may preferably confer resistance to an antibiotic as described herein above. The encoded polypeptide may be a reporter polypeptide as described herein above. The cell comprises a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor as described herein above. Preferably, the nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide and the second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor are fused to constitute a single nucleic acid construct, preferably a single plasmid.

[0092] The cells of step A) of the fourth and fifth aspects may optionally comprise further nucleic acid constructs and / or nucleotide sequences as described herein above, preferably they comprise a nucleic acid construct comprising a nucleic acid sequence encoding an accessory molecule required for functional expression of an olfactory receptor in the cells as described herein above, more preferably a nucleic acid sequence encoding the V227I variant of human RTP1S and / or the L220R variant of human RTP2 (SEQ ID NO: 17 or 18).

[0093] Step A) of the fourth and fifth aspects may include culturing cells. Cell culture may be performed using a culture medium that contains suitable nutrients such as carbon and nitrogen sources, as well as additional compounds such as inorganic salts, trace elements and vitamins. Those skilled in the art will understand that suitable nutrients (as well as culture conditions such as temperature, pH, CO2 levels) will vary depending on the cells being cultured. Suitable culture media and culture conditions are available from commercial suppliers and are further discussed in standard handbooks and in cell line information found in publicly available microbial collections, such as the American Type Culture Collection (VA, USA). A non-limiting example of a suitable culture medium is Dulbecco's Modified Eagle's Medium (DMEM, commercially available, for example, by ThermoFisher Scientific (MA, USA)).

[0094] The cell culture may be carried out at a temperature value which may vary depending on the cells being cultured. In some embodiments in which human cells are cultured, the cell culture is preferably carried out in a temperature range of 34-39° C., more preferably in a temperature range of 35-38° C., even more preferably in a temperature range of 36-37° C. In some most preferred embodiments in which human cells are cultured, a temperature value of 37° C. or about 37° C. is used.

[0095] The cell culture may be carried out at a pH value that may vary depending on the cells being cultured. In some embodiments in which human cells are cultured, the cell culture is preferably carried out at a pH value range of 7.0 to 7.7, more preferably at a pH value range of 7.2 to 7.6, even more preferably at a pH value range of 7.4 to 7.5. In some most preferred embodiments in which human cells are cultured, a pH value of 7.5 or about 7.5 is used.

[0096] Cell culture may be performed at % values ​​of CO2 that may vary depending on the cells being cultured and the culture medium. Those skilled in the art will appreciate that supplying exogenous CO2, for example by flushing the cell culture with a CO2-air mixture, may be required in some cases, for example when a medium buffered with a CO2-bicarbonate based buffer is used. In some embodiments in which human cells are cultured and exogenous CO2 is supplied, the CO2 may preferably be 4-10% in air, more preferably 4-7% in air, even more preferably 5-6% in air. In some more preferred embodiments in which human cells are cultured, a CO2 value of 5% or about 5% in air is used.

[0097] The duration of cell culture can vary depending on the cells being cultured.In some embodiments, the duration can be at least 30 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 31 hours, at least 38 hours, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 1 week.

[0098] Step A) of the method of the fifth aspect comprises a mutagenesis step. Said mutagenesis step may comprise any step in which the cell is genetically modified, for example by introducing mutations, substitutions, insertions and / or deletions of one or more nucleotides in its genome, and / or by introducing additional nucleic acid constructs as described hereinbefore. In some embodiments, the mutagenesis step is carried out using insertion mutagenesis, where a nucleic acid sequence is inserted into the genome of the cell using a plasmid, a linear DNA sequence, a transposon, a retrovirus, a lentivirus or CRISPR-Cas mediated recombination, preferably where the inserted nucleic acid sequence comprises an enhancer and / or promoter sequence suitable for activating the expression of the endogenous gene as described hereinbefore. The insertion site of the inserted nucleic acid sequence may optionally be mapped and / or identified in the selected or sorted cell using genome mapping and / or sequencing methods as described hereinbelow. The skilled person will understand that the mutagenesis step may be repeated multiple times as will be understood. In some embodiments, the mutagenesis step is carried out using CRISPR interference or CRISPR activation CRISPR-Cas mediated mutagenesis. The application of the mutagenesis step to cells can allow improved functional expression. For example, since the mutagenesis step is not limited to the nucleic acid molecule encoding olfactory receptor, it can be particularly useful in selecting cells that contain additional genetic and / or epigenetic modifications in olfactory receptors, nucleic acid molecules encoding accessory molecules, and / or other genomic regions that allow improved functional expression of olfactory receptors, especially in the case of olfactory receptors that are difficult to express using conventional methods. The modifications can then be mapped and / or identified using genome mapping, epigenetic assays, and / or sequencing methods, as described later herein.

[0099] In step B) of the method of the fourth and fifth aspects, the cells are cultured in the presence of a ligand of the olfactory receptor. The culture medium, conditions and duration correspond to those described in step A), with the difference being the addition of the ligand. The ligand may be added to an existing culture, or alternatively, the culture medium of an existing culture may be replaced with fresh culture medium containing said ligand. Suitable ligands may be selected from any chemical compound known in the art that can activate olfactory receptors (alternatively referred to as "aroma compounds" or "odor molecules"), which are discussed in standard handbooks such as Buettner (2017), Springer Handbook of Odor, Springer International publishing (CH), which is incorporated herein by reference in its entirety.Non-limiting examples of suitable ligands include: esters (e.g., geranyl acetate, methyl formate, methyl acetate, methyl propionate, methyl butyrate, ethyl acetate, ethyl butyrate, isoamyl acetate, pentyl butyrate, pentyl pentanoate, octyl acetate, benzyl acetate, methyl anthranilate, hexyl acetate), linear terpenes (e.g., myrcene, geraniol, nerol, citral, citronellal, citronellol, linalool, nerolidol, ocimene), cyclic terpenes (e.g., limonene, camphor, methyl ether ... , carvone, terpineol, alpha-ionone, thujone, eucalyptol, jasmine), aromatic compounds (e.g., benzaldehyde, eugenol, isoeugenol, cinnamaldehyde, ethyl maltol, ethyl vanillin, anisole, anethole, estragole, thymol), amines (e.g., trimethylamine, putrescine, cadaverine, pyridine, indole, skatole), alcohols (e.g., furaneol, 1-hexanol, ethanol), aldehydes (e.g., acetal, aldehydes (e.g., hexanal, furfural, hexylcinnamaldehyde, isovaleraldehyde, anisaldehyde, cuminaldehyde), ketones (e.g., dihydrojasmone, 2-acetyl-1-pyrroline, 6-acetyl-2,3,4,5-tetrahydropyridine), lactones (e.g., gamma-decalactone, gamma-nonalactone, delta-octalactone, jasmine lactone, massoialactone, wine lactone, sotolone), thiols (e.g., thioacetone, allylthiol, ethanethiol, 2 -methyl-2-propanethiol, butane-1-thiol, mercaptan, methanethiol, furan-2-ylmethanethiol, benzyl mercaptan), musks (e.g., nitromusks, polycyclic musks, macrocyclic musks, linear / alicyclic musks, musk ketone, musk ambrette, musk moskene, musk tibetene, musk xylene), cresols (e.g., vanilla cresol (ultravanil)), propenyl guaethol (vanitrope), and the like.

[0100] One skilled in the art will appreciate that the amount of ligand required for activation of an olfactory receptor may vary depending on the olfactory receptor and the ability of the ligand to physically associate with said olfactory receptor. A ligand may be used that has an EC 50 EC values ​​are typically between 10 nM and 1 mM 50 An olfactory receptor may be considered to be "of" (i.e., specific for) a given olfactory receptor if it is able to physically associate with (i.e., bind to) said receptor at an EC 50 With respect to a ligand for an olfactory receptor, refers to the concentration of the ligand at which a given activation of the olfactory receptor is 50% of the maximum value for that olfactory receptor that can be measured using the methods described elsewhere herein.

[0101] In some embodiments, the ligand may be present in the culture at a concentration value between 0.1 nM and 1 mM, between 1 nM and 1 mM, between 10 nM and 1 mM, between 100 nM and 500 μM, between 250 nM and 100 μM, between 500 nM and 50 μM, or between 10 μM and 30 μM.

[0102] Those skilled in the art will understand that the duration of cell culture in the presence of olfactory receptor ligand can vary depending on the olfactory receptor and the ability of the ligand to physically associate with said olfactory receptor. In some embodiments, cells are cultured for at least at least 30 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, or at least 24 hours.

[0103] In step C1) of the method of the fourth and fifth aspects, cells functionally expressing olfactory receptors are selected by cell culture in the presence of antibiotics and ligands. The presence of antibiotics in the culture exposes the cells to selective conditions (i.e., it applies selective pressure). As discussed earlier in this specification, only cells that can functionally express olfactory receptors will be able to exhibit antibiotic resistance and survive and / or grow. This facilitates their selection. The culture medium, conditions and duration correspond to those described in step A) or B), with the difference being the addition of antibiotics (compared to step B). Antibiotics may be added to existing cultures, or alternatively, the culture medium of an existing culture may be replaced with fresh culture medium containing said antibiotics.

[0104] One of skill in the art will appreciate that the choice of antibiotic will vary depending on the antibiotic resistance conferred by the encoded polypeptide, including, but not limited to, penicillins (β-lactams), aminonucleosides, nucleoside analogs, tetracyclines, cephalosporins, quinolones, lincomycin, macrolides, sulfonamides, polypeptides, glycopeptides, glycolipeptides, aminoglycosides, fluoroquinolones, monobactams, oxazolidinones, streptogramins, rifamycins, carbapenems, chloramphenicol, clindamycin, daptomycin, fosfomycin, lefamulin, metronidazole, mupirocin, nitrofurantoin, tigecycline, puromycin, hygromycin B (hygrobetin), geneticin (G418), bleomycin, zeocin, and blasticidin. In some embodiments, the antibiotic may be any antibiotic, including a compound selected from puromycin, hygromycin B (hygrobetin), geneticin (G418), zeocin, and blasticidin. In some embodiments, the antibiotic is puromycin or blasticidin (blasticidin S), preferably blasticidin.

[0105] Those skilled in the art will understand that the amount of antibiotic present in the culture to achieve selective conditions may vary depending on the antibiotic and / or the cells. The minimum inhibitory concentration (MIC) of a given antibiotic for a given cell may be used to select an appropriate amount that will inhibit the survival and / or growth of cells that do not functionally express olfactory receptors. The term "minimum inhibitory concentration" refers to the minimum concentration of antibiotic that prevents visible growth of a given cell. The MIC value of an antibiotic for a given cell is available in public databases and may further be determined using methods known in the art, such as those described in standard handbooks such as Schwalbe R. et al., Antimicrobial susceptibility testing protocols, Boca Raton: CRC Press (2007), which is incorporated by reference in its entirety herein, and / or using commercially available kits and protocols such as ETEST® (Biomerieux, NC, USA). Alternatively, the concentration of antibiotic that results in a 50% reduction in cell viability (EC of a given antibiotic) may be determined. 50 ) may be used. Alternatively, exposure of cells to antibiotics followed by incubation with a commercially available cell viability reagent, such as PrestoBlue® (ThemoFisher Scientific, MA, USA), according to the supplier's protocol, may be used to select an appropriate amount of antibiotic that will inhibit the survival and / or proliferation of cells that do not functionally express olfactory receptors. Examples of application of such reagents to determine cell viability after exposure to antibiotics are further provided in the experimental section herein.

[0106] In some embodiments, the antibiotic may be present in the culture at a concentration value of 10 ng / ml to 1 mg / ml, 15 ng / ml to 500 μg / ml, 20 ng / ml to 250 μg / ml, 25 ng / ml to 125 μg / ml, 50 ng / ml to 100 μg / ml, 0.1 μg / ml to 90 μg / ml, 0.5 μg / ml to 80 μg / ml, 1 μg / ml to 70 μg / ml, 2 μg / ml to 60 μg / ml, 3 μg / ml to 50 μg / ml, 4 μg / ml to 30 μg / ml, or 5 μg / ml to 20 μg / ml. In some embodiments, the cell culture in the presence of the antibiotic may have a period of at least 30 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 31 hours, at least 38 hours, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, or longer.

[0107] In some embodiments, functional expression of an olfactory receptor by a cell cultured in the presence of an antibiotic and a ligand results in an increase in the viability of the cell of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% compared to a comparable cell that does not express the olfactory receptor or a comparable cell cultured in the presence of an antibiotic alone. In some embodiments, the increase in viability of the cells is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, at least 40-fold, at least 45-fold, at least 50-fold, or at least 100-fold compared to comparable cells that do not express an olfactory receptor or compared to comparable cells cultured in the presence of antibiotics alone.

[0108] In some embodiments, the concentration of antibiotic required to reduce cell viability by 50% of cells functionally expressing olfactory receptors cultured in the presence of the antibiotic and ligand (EC of a given antibiotic) 50) is increased by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% compared to comparable cells that do not express olfactory receptors or comparable cells cultured in the presence of antibiotics alone. In some embodiments, the concentration of antibiotic required is increased by at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 25 times, at least 30 times, at least 35 times, at least 40 times, at least 45 times, at least 50 times, or at least 100 times compared to comparable cells that do not express olfactory receptors or comparable cells cultured in the presence of antibiotics alone.

[0109] In some cases, % viability may alternatively or additionally be determined in comparison to the viability of a control without cells (corresponding to 0% viability) and / or the viability of cells treated with only an olfactory ligand (no antibiotics, corresponding to 100% viability).

[0110] Step C1) of the method of the fourth and fifth aspects may optionally include subculturing cells under selective conditions (i.e., selective pressure) for multiple generations (evolutionary manipulation as described herein above). The subculturing includes the removal of the (nutrient) depleted culture medium after the proliferation of cells and its replacement with a medium containing the same or different ligand and / or antibiotic concentration. Nutrient depletion of the culture medium can be assessed by a person skilled in the art using methods standard in the art, for example, HPLC. Continuous passaging, i.e., constant supply and removal of culture medium to achieve a stationary state in the culture, can alternatively be applied. Since the selectable phenotype (i.e., antibiotic resistance resulting from olfactory receptor activation) is associated with the proliferation of cells, the subculturing can be advantageous for selecting cells with improved functional expression of olfactory receptors. Because the cells will have a selective growth advantage and will be enriched in culture, for example, in cases where the baseline functional expression of a given olfactory receptor is too low to be detectable. Said enrichment can be further enhanced by applying gradually increasing antibiotic concentration in culture medium, gradually decreasing ligand concentration in culture medium, or a combination of the two.Such an approach is particularly useful in selecting cells that contain additional genetic and / or epigenetic modifications in olfactory receptors, nucleic acid molecules encoding accessory molecules, and / or other genomic regions that allow improved functional expression of olfactory receptors, especially in the case of olfactory receptors that are difficult to express using conventional methods.Modifications can then be mapped and / or identified using genome mapping, epigenetic assays, and / or sequencing methods, as described later herein.

[0111] In step C2) of the method of the fourth and fifth aspects, cells functionally expressing the olfactory receptor are screened by detecting and selecting cells expressing the reporter polypeptide in the presence of a ligand. As discussed herein above, only cells capable of functionally expressing the OR will express the reporter polypeptide. This allows their detection and selection. The cells may be detected directly or indirectly as discussed herein above. Any reporter polypeptide and detection method as discussed herein above may be used. Those skilled in the art will understand that the exact method of detection and selection will depend on the reporter polypeptide and the equipment used. The selected individual cells may then be cultured. Any genetic and / or epigenetic modifications in the olfactory receptor, the nucleic acid molecule encoding the accessory molecule, and / or other genomic regions that allow for functional expression of the olfactory receptor may then be mapped and / or identified using genome mapping, epigenetic assays, and / or sequencing methods as described herein below.

[0112] As a non-limiting example, in the case where GFP is used as the reporter polypeptide, the cell culture from step B) may be loaded onto a commercially available fluorescence activated cell sorter (e.g., BD-FACS™ available from BD, NJ, USA). The cell culture may then be exposed to a wavelength of light of about 488 nm, and GFP may optionally be detected at a wavelength of 510 nm. Cells expressing GFP may then be screened and sorted according to the manufacturer's protocol.

[0113] Genetic and / or epigenetic modifications in the olfactory receptors, nucleic acid molecules encoding accessory molecules, and / or other genomic regions that allow functional or improved functional expression of the olfactory receptors may be mapped and / or identified using genome mapping, epigenetic assays, and / or sequencing methods. The mapping and / or identification may be performed after any step of the method of the fourth and fifth aspects, preferably after step C1) or C2).

[0114] In some embodiments of the methods of the fourth and fifth aspects, genetic and / or epigenetic modifications contained in nucleic acid molecules encoding olfactory receptors, accessory molecules, and / or other genomic regions that enable functional or improved functional expression of the olfactory receptor by the selected or sorted cells are mapped and identified.

[0115] Mapping refers to the identification of the location of nucleic acid sequences, such as genes, as well as the distance between nucleic acid sequences in the genome of a cell. Mapping can be particularly useful in embodiments in which insertion mutagenesis is performed in step A) of the method of the fifth aspect, as described herein above. Because it allows the identification of the insertion site of the inserted nucleic acid sequence in the selected or sorted cells. Mapping can be performed via genetic mapping, i.e., mapping using genetic linkage information based on genetic markers, physical mapping, or a combination of both. Mapping methods are known in the art and are discussed in standard handbooks such as Brown, Genomes, 4th Edition, Garland Science, NY, USA (2017), which is incorporated herein by reference in its entirety. Non-limiting examples of mapping methods include circular PCR (which involves digestion of chromosomal DNA followed by ligation to form a circular DNA followed by PCR amplification thereof) and chromosome walking (e.g., which involves digestion of chromosomal DNA followed by ligation to one or more adaptors followed by nested PCR directed to the one or more adaptors and the inserted sequence).

[0116] Identification of genetic modification may be performed using any nucleic acid sequencing method known to those skilled in the art.Non-limiting examples include Sanger sequencing, single molecule real-time sequencing, ion torrent sequencing, pyrosequencing, Illumina sequencing, combinatorial probe anchor synthesis (cPAS), sequencing by ligation (SOLiD sequencing), Nanopore sequencing, GenapSys sequencing, etc.Sequencing sample preparation, equipment, and protocols are discussed in standard handbooks such as Head, Ordoukhanian and Salomon (eds.), Next Generation Sequencing: Methods and Protocols, Humana Press, NJ, USA (2018), which is incorporated herein by reference in its entirety, and many are commercially available, for example, from Illumina (CA, USA), Pacific Biosciences (CA, USA), and others.

[0117] Epigenetic modifications of nucleic acid molecules encoding olfactory receptors, accessory molecules, or other genomic regions as described herein above may be identified using any standard epigenetic assay known in the art, such as those described in standard handbooks and publications such as Tollefsbol, Handbook of Epigenetics: The New Molecular and Medical Genetics, 2nd Edition, Academic Press, USA (2017) and DeAngelis and Woodrow (2008) Mol Biotechnol 38(2): 179-183, both of which are incorporated herein by reference in their entirety. Non-limiting examples of epigenetic assays are chromatin immunoprecipitation (ChIP, together with its large scale variants ChIP-on-chip and ChIP-Seq), fluorescent in situ hybridization, methylation-sensitive restriction enzyme digestion, DNA adenine methyltransferase identification (DamID), bisulfite sequencing, RNA immunoprecipitation (RIP), cross-linking immunoprecipitation. Many epigenetic assays are commercially available, such as epigenetic assays and kits provided by Abcam (Cambridge, UK).

[0118] The method of the present invention is further suitable for the identification of novel cognate receptor-ligand pairs. In particular, for many ligands of interest, the cognate olfactory receptors are unknown ("orphan receptors") or are poorly characterized, for example in terms of their affinity for the ligand of interest.

[0119] Thus, in a sixth aspect, the present invention provides a method for identifying an olfactory receptor bound to a given ligand, said method comprising the steps of: A) providing a heterogeneous population of cells as described hereinbefore, wherein said cells comprise: A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic or is a reporter polypeptide, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP response element (CRE), a CRE half sequence, or a NFAT response element (NFAT-RE); and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor, wherein the olfactory receptor encoded by the nucleic acid molecule contained in said second nucleic acid construct contained in at least one of the cells is distinguishable from the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct in at least one of the other cells of the population; Including,

[0120] B) culturing said population of cells in the presence of said given ligand; C1) selecting cells that functionally express an olfactory receptor that binds to the given ligand by culturing them in the presence of an antibiotic and a ligand; or C2) screening for cells that functionally express an olfactory receptor that binds to the given ligand by detecting and selecting cells that express a reporter polypeptide in the presence of the ligand; D) determining the nucleotide sequence encoding the receptor in the selected or sorted cells. In step A), a nucleic acid sequence encoding a polypeptide that confers resistance to an antibiotic is preferred, preferably the nucleic acid sequence is the puromycin-N-acetyltransferase gene or the blasticidin-S deaminase gene. Of steps C1) and C2), step C1) is preferred.

[0121] The description of step A) of the fourth aspect provided herein above also applies to step A) of the sixth aspect, with the difference being that in step A) of the sixth aspect, a population of cells is provided. The population is heterogeneous (mixed), as described herein above. Preferably, the nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to the nucleic acid sequence encoding the polypeptide and the second nucleic acid construct comprising the nucleic acid molecule encoding the olfactory receptor are fused to constitute a single nucleic acid construct, preferably a single plasmid.

[0122] Providing a heterogeneous population can be particularly advantageous because it allows for high-throughput identification of olfactory receptors that bind to ligands of interest without requiring prior knowledge of the characteristics of the olfactory receptor, or of the accessory molecules required, or of any particular genetic and / or epigenetic modifications that may be required to achieve functional expression of the olfactory receptor.

[0123] The description of step B) of the fourth and fifth aspects provided herein above also applies to step B) of the sixth aspect, with the difference being that in step B) of the sixth aspect, the olfactory receptor to which a given ligand is bound has not yet been identified.Any desired ligand, culture medium and culture conditions as described herein above may be selected and utilized.

[0124] The description of steps C1) and C2) of the fourth and fifth aspects provided herein above also applies to steps C1) and C2) of the sixth aspect, with the difference being that in steps C1) and C2) of the sixth aspect, the olfactory receptor that binds to the given ligand has not yet been identified, so steps C1) and C2) of the sixth aspect simultaneously allow for the selection or screening and sorting of cells that functionally express the olfactory receptor to which the given ligand binds. In step C1) of the sixth aspect, as described herein above, the selectable phenotype (i.e., antibiotic resistance resulting from olfactory receptor activation) is associated with the survival and / or growth of cells that functionally express the olfactory receptor to which the given ligand binds, so that subculture of cells under selective pressure can be advantageous for selecting cells with improved functional expression of the olfactory receptor, since said cells will have a selective growth advantage and will be enriched in culture.

[0125] Thus, in some embodiments of the methods of the fourth, fifth and sixth aspects, step C1) additionally comprises a subculture step, in which cells having improved functional expression of olfactory receptors are enriched in culture.

[0126] In step D) of the method of the sixth aspect, the nucleotide sequence encoding the olfactory receptor in the selected or sorted cells is determined. Thus, the receptor may be identified ("de-orphanized"), and the cognate olfactory receptor-ligand relationship may be resolved. Optionally, the nucleotide sequence encoding the accessory molecule that may be required to achieve functional expression of the olfactory receptor is determined. Optionally, any specific genetic and / or epigenetic modifications that may be required to achieve functional expression of the olfactory receptor are identified.

[0127] Suitable nucleic acid sequences encoding polypeptides that confer resistance to antibiotics have been discussed herein above. In some embodiments, the nucleic acid sequence is a puromycin-N-acetyltransferase gene or a blasticidin-S deaminase gene, preferably a blasticidin-S deaminase gene.

[0128] Non-limiting examples of olfactory receptors, optionally including genetic modifications as described above, that can be identified using the methods of the present invention include, consist essentially of, or consist of, and preferably include, a polypeptide comprising the amino acid sequence of SEQ ID NO: 20, 36-62.

[0129] Determining the sequence of the olfactory receptor or accessory molecule, or identifying any genetic and / or epigenetic modifications, may be performed by any of the genome mapping, epigenetic assay, and / or sequencing methods discussed herein above.

[0130] Olfactory receptors The nucleic acid constructs, cells and methods of the present invention allow the identification and / or selection of olfactory receptors and / or accessory molecules that contain genetic and / or epigenetic modifications required for functional expression or improved functional expression of said olfactory receptors.

[0131] Thus, in a seventh aspect, the present invention provides a variant olfactory receptor and / or accessory molecule. The definitions of "variant", "functional expression" and "improved functional expression" are provided herein above. The variant olfactory receptor may be functionally expressed in a cell as described herein above, while the naturally occurring sequence is not functionally expressed by said cell. The variant olfactory receptor may have improved functional expression in a cell compared to the functional expression of the naturally occurring sequence in said cell. Genetic modification at the C-terminus and / or N-terminus of the olfactory receptor may be advantageous, since said regions are typically not responsible for ligand selectivity, but are typically important for OR transport and / or integration into cell surface membranes. In some embodiments, the olfactory receptor comprises a genetic modification at the N-terminus. In some embodiments, the olfactory receptor comprises a genetic modification at the C-terminus. In some embodiments, the olfactory receptor comprises a genetic modification at the N-terminus and a genetic modification at the C-terminus. Said genetic modification includes, but is not limited to, amino acid insertion, deletion and / or substitution resulting from nucleotide insertion, deletion and / or substitution in the nucleotide sequence encoding said olfactory receptor as described herein above.In some embodiments, the olfactory receptor is synthetic.

[0132] A variant of the human OR5A2 receptor (NCBI Genbank ID: 219981, row number 19) is particularly advantageous. The wild-type sequence of human OR5A2 encodes a difficult-to-express receptor, which typically cannot be functionally expressed in cells expressing the chaperones RTP1S and RTP2. It requires unknown accessory factors for functional expression. OR5A2 was inferred to be a musk receptor in WO2019110630A1, which is incorporated by reference in its entirety herein. As shown in the experimental section herein, the inventors have been able to select and isolate a variant of OR5A2 (SEQ ID NO: 20) that can be functionally expressed in cells, including, but not limited to, HEK293T cells. The variant includes a modified C-terminus (SEQ ID NO: 62).

[0133] Thus, in one aspect, the present invention relates to an olfactory receptor comprising an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO:62, preferably wherein SEQ ID NO:62 is located at the C-terminus of the olfactory receptor.

[0134] In a preferred embodiment, the amino acid sequence of the olfactory receptor comprises, essentially consists of, or consists of, preferably comprises, an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO:20.

[0135] In a preferred embodiment, the amino acid sequence of the olfactory receptor comprises, essentially consists of, or consists of, preferably comprises, an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO: 20, and an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO: 62, preferably wherein SEQ ID NO: 62 is located at the C-terminus of the olfactory receptor.

[0136] Identity or similarity may be at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0137] Such olfactory receptor is assumed to be functionally expressed in cells. In one embodiment, such functional expression is improved by comparing with the expression of a control or reference olfactory receptor. In some embodiments, the control or reference olfactory receptor may be OR5A2, for example, human OR5A2.

[0138] Thus, in a further aspect, the present invention relates to an amino acid sequence of an olfactory receptor comprising a polypeptide encoded by a nucleic acid molecule encoding an amino acid sequence represented by an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO: 62, preferably wherein SEQ ID NO: 62 is located at the C-terminus of the olfactory receptor.

[0139] In a preferred embodiment, the amino acid sequence of the olfactory receptor is encoded by a nucleic acid molecule, which encodes an amino acid sequence that comprises, essentially consists of, or consists of, preferably comprises, an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO:20.

[0140] In a preferred embodiment, the amino acid sequence of the olfactory receptor is encoded by a nucleic acid molecule, which comprises, essentially consists of, or consists of, preferably comprises, an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO: 20, and encodes an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity to SEQ ID NO: 62, preferably wherein SEQ ID NO: 62 is located at the C-terminus of the olfactory receptor.

[0141] Identity or similarity may be at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0142] Table 1: List of sequences [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8]

[0143] General information Unless otherwise defined, all technical and scientific terms used herein have the same meaning as customarily and commonly understood by one of ordinary skill in the art to which this invention belongs and as read in light of the present disclosure.

[0144] Sequence identity It should be understood that each nucleic acid molecule, or protein fragment, or polypeptide, or peptide, or derived peptide, or construct as defined herein by a given sequence identity number (SEQ ID NO:) is not limited to this particular sequence as disclosed. Each coding sequence as defined herein encodes a given protein fragment, or polypeptide, or peptide, or derived peptide, or construct, or is itself a protein fragment, or polypeptide, or construct, or peptide, or derived peptide.

[0145] Throughout this application, whenever a particular nucleotide sequence SEQ ID NO: (eg, SEQ ID NO:X) encoding a given protein fragment, or polypeptide, or peptide, or derived peptide is mentioned, it may be replaced by: i. a nucleotide sequence comprising a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95% or 99% sequence identity to SEQ ID NO:X; ii. a nucleotide sequence the sequence of which differs from that of the nucleic acid molecule of (i) due to the degeneracy of the genetic code; or iii. A nucleotide sequence encoding an amino acid sequence having at least 60%, 70%, 80%, 90%, 95% or 99% amino acid identity or similarity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:X.

[0146] Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.

[0147] Throughout this application, whenever a particular amino acid sequence SEQ ID NO:Y is mentioned, it may be replaced by a polypeptide represented by an amino acid sequence comprising a sequence having at least 60%, 70%, 80%, 90%, 95% or 99% sequence identity or similarity with the amino acid sequence of SEQ ID NO:Y. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.

[0148] Each nucleotide sequence or amino acid sequence described herein by its percentage of identity or similarity to a given nucleotide sequence or amino acid sequence, respectively, is in further preferred embodiments a sequence that is at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 109%. In some embodiments, the nucleic acid has at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity or similarity to the nucleic acid.

[0149] Each non-coding nucleotide sequence (i.e., that of a promoter or that of another regulatory region) can be replaced with a nucleotide sequence, including a nucleotide sequence having at least 60% sequence identity or similarity with the sequence number of a particular nucleotide sequence (e.g., sequence number A). Preferred nucleotide sequences have at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:A. In a preferred embodiment, such a non-coding nucleotide sequence, such as a promoter, exhibits or exerts at least one activity of such a non-coding nucleotide sequence as known to those skilled in the art, such as the activity of a promoter.

[0150] The terms "homology", "sequence identity" and the like are used interchangeably herein. Sequence identity is described herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences as determined by comparing the sequences. In a preferred embodiment, sequence identity is calculated based on the full length of two given SEQ ID NOs, or a portion thereof. The portion preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NOs. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between the strings of such sequences. The "similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutions of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods, including, but not limited to, those described in Bioinformatics and the Cell: Modern Computational Approaches in Genomics, Proteomics and transcriptomics, Xia X., Springer International Publishing, New York, 2018; and Bioinformatics: Sequence and Genome Analysis, Mount D., Cold Spring Harbor Laboratory Press, New York, 2004, each of which is incorporated by reference in its entirety herein.

[0151] "Sequence identity" and "sequence similarity" can be determined by aligning two peptides or two nucleotide sequences using a global or local alignment algorithm, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman-Wunsch) that optimally aligns sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith-Waterman). Sequences may then be referred to as "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity (as described below) (e.g., when optimally aligned by the programs EMBOSS needle or EMBOSS water, using default parameters).

[0152] Global alignment is preferably used to determine sequence identity when two sequences have similar lengths. When sequences have substantially different overall lengths, local alignment, such as that using the Smith-Waterman algorithm, is preferred. EMBOSS needle uses the Needleman-Wunsch global alignment algorithm to align two sequences over their overall length (full length), maximizing the number of matches and minimizing the number of gaps. EMBOSS water uses the Smith-Waterman local alignment algorithm. Generally, the default parameters of EMBOSS needle and EMBOSS water are used, with gap opening penalty = 10 (nucleotide sequence) / 10 (protein) and gap extension penalty = 0.5 (nucleotide sequence) / 0.5 (protein). For nucleotide sequences, the default scoring matrix used is DNAfull; for proteins the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919, incorporated herein by reference in its entirety).

[0153] Alternatively, percentage similarity or identity may be determined by searching against public databases using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of some embodiments of the present invention can further be used as "query sequences" to perform searches against public databases, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10, which is incorporated by reference in its entirety. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the oxidoreductases of the present invention. BLAST protein searches can be performed with the BLASTx program, score=50, wordlength=3, to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402, which is incorporated by reference in its entirety. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information, accessible on the world wide web at www.ncbi.nlm.nih.gov / .

[0154] Optionally, in determining the degree of amino acid similarity, those skilled in the art may also take into account so-called conservative amino acid substitutions. As used herein, "conservative" amino acid substitution refers to the interchangeability of residues with similar side chains. Examples of classes of amino acid residues for conservative substitution are provided in the table below. [Table 2]

[0155] Alternative conservative amino acid residue substitution classes: [Table 3]

[0156] Alternative physical and functional classifications of amino acid residues: [Table 4]

[0157] For example, the group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine and isoleucine; the group of amino acids with aliphatic-hydroxyl side chains is serine and threonine; the group of amino acids with amide-containing side chains is asparagine and glutamine; the group of amino acids with aromatic side chains is phenylalanine, tyrosine and tryptophan; the group of amino acids with basic side chains is lysine, arginine and histidine; and the group of amino acids with sulfur-containing side chains is cysteine ​​and methionine. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequence is removed and a different residue is inserted in its place. Preferably, the amino acid changes are conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0158] Gene or coding nucleotide sequence The term "gene" refers to a fragment of DNA that contains a region that is transcribed in a cell into an RNA molecule (e.g., mRNA) (the transcribed region), operably linked to a suitable regulatory region (e.g., a promoter). The coding nucleotide sequence may contain a sequence that is native to the cell, a sequence that does not naturally occur in the cell, or it may contain a combination of both.

[0159] Proteins and Amino Acids The terms "protein" or "peptide" or "polypeptide" or "amino acid sequence" are used interchangeably and refer to a molecule consisting of a chain of amino acids, regardless of a particular mode of action, size, three-dimensional structure, or origin. In amino acid sequences as described herein, amino acids or "residues" are represented by their three letter symbols. These three letter symbols, as well as the corresponding one letter symbols, are well known to those skilled in the art and have the following meanings: A (Ala) is alanine, C (Cys) is cysteine, D (Asp) is aspartic acid, E (Glu) is glutamic acid, F (Phe) is phenylalanine, G (Gly) is glycine, H (His) is histidine, I (Ile) is isoleucine, K (Lys) is lysine, L (Leu) is leucine, M (Met) is methionine, N (Asn) is asparagine, P (Pro) is proline, Q (Gln) is glutamine, R (Arg) is arginine, S (Ser) is serine, T (Thr) is threonine, V (Val) is valine, W (Trp) is tryptophan, and Y (Tyr) is tyrosine. The residues may be any proteinogenic amino acid, but also any non-proteinogenic amino acid, such as D-amino acids, and modified amino acids formed by post-translational modifications, and also any unnatural amino acids.

[0160] common terms In this document and in the claims, the verb "to comprise" and its conjugations are used in their open-ended sense to mean that the items following the term are included, but not excluding items not specifically mentioned. In addition, the verb "to consist" may be replaced by "to consist essentially of", meaning that the composition as described herein may include additional component(s) other than those specifically identified, and said additional component(s) do not modify the unique features of the invention. In addition, the verb "to consist" may be replaced by "to consist essentially of", meaning that the method or use as described herein may include additional step(s) other than those specifically identified, and said additional step(s) do not modify the unique features of the invention. In addition, the verb "consisting of" may be replaced by "consisting essentially of," meaning that the nucleotide or amino acid sequences as described herein may contain additional nucleotides or amino acids other than those specifically identified, which do not alter the unique characteristics of the invention.

[0161] The reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires that one, and only one, element is present. The indefinite article "a" or "an" therefore normally means "at least one."

[0162] As used herein, by "at least" a particular value means the particular value or more. For example, "at least 2" is understood to be the same as "2 or more," i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, etc.

[0163] Moreover, in the specification and in the claims, the terms first, second, third, etc. are used to distinguish between similar elements and not necessarily to describe a sequential or chronological order. It is to be understood that the terms so used are used interchangeably, under appropriate circumstances, and that the embodiments of the invention described herein are capable of operation in sequences other than those described or illustrated herein.

[0164] The terms "about" or "approximately," when used in connection with a numerical value (e.g., about 10), preferably mean that the value in question may be 1% more or less than the given (out of 10) value.

[0165] As used herein, the term "and / or" indicates that more than one of the stated cases may occur alone or in combination with at least one of the stated cases and up to all of the stated cases.

[0166] Various embodiments are described herein. Each embodiment as described herein may be combined together unless otherwise indicated.

[0167] All patent applications, patents, and printed publications cited herein are incorporated by reference in their entirety, except for any definitions, subject matter, disclaimers, or disavowals, and except to the extent the incorporated material is inconsistent with an explicit disclosure herein, in which case the language of the present disclosure will control.

[0168] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. The present invention is further described by the following examples, which should not be construed as limiting the scope of the invention. [Brief description of the drawings]

[0169] [Figure 1] HEK293T cells harboring a stable insert of pGL4.29-CRE-Puro-Hygro-OR, containing the receptor OR10G7, exposed to 11 concentrations of puromycin and co-treated with various olfactory ligands. Cells expressing OR10G7 have increased resistance to puromycin in the presence of the cognate ligands eugenol, isoeugenol, vanitrope and ultravanil, whereas the odor molecule musk ketone, which does not bind to OR10G7, does not increase resistance relative to the solvent control. [Diagram 2] HEK293T cells harboring a stable insert of pGL4.29-CRE-Puro-Hygro-OR, containing the receptor OR5AN1, exposed to 11 concentrations of puromycin and co-treated with various olfactory ligands. Cells expressing OR5AN1 have increased resistance to puromycin in the presence of musk ketone, whereas eugenol, isoeugenol, and ultravanil, ligands that do not bind to OR5AN1, do not increase resistance relative to solvent control. [Diagram 3] HEK293T cells harboring a stable insert of pGL4.29-CRE-Puro-Hygro-OR, containing the receptor OR10G9, exposed to 11 concentrations of puromycin and co-treated with various olfactory ligands. Cells expressing OR10G9 have increased resistance to puromycin in the presence of the cognate ligands vanitrope and ultravanil, whereas no increased resistance is observed relative to the solvent control for succinylcholine, eugenol, and isoeugenol, which do not bind to this receptor at the given concentrations. [Figure 4]Resistance of an isolated clone ("Clone 3") containing the receptor OR5A2 in the pGL4.29-CRE-Puro-Hygro-OR construct exposed to 11 concentrations of puromycin and co-treated with various olfactory ligands as described in Example 1. It was observed that the isolated clone functionally expressing OR5A2 had increased resistance to puromycin in the presence of the cognate musk odor molecule ligands musk ambrette and serenolide, whereas no increased resistance was observed in the presence of eugenol, which does not bind to this receptor. [Figure 5A] Luciferase signal induced by odor molecules in HEK293T cells in "clone 3" cells, which contain CRE-induced luciferase and (FIG. 5A) variants of RTP1S and RTP2 and OR5A2, but have not been selected for ligand-induced puromycin resistance, and (FIG. 5B) have been stably transfected with the same three genes and selected for functional expression from a pool of 2,500,000 cells by ligand-induced puromycin resistance as described herein. "Clone 3" contains a gain mutation that confers functional expression of OR5A2, which could be selected from a pool of 2,500,000 cells by the particular selection procedure applied. [Figure 5B] Luciferase signal induced by odor molecules in HEK293T cells in "clone 3" cells, which contain CRE-inducible luciferase and (FIG. 5A) variants of RTP1S and RTP2 and OR5A2, but have not been selected for ligand-induced puromycin resistance, and (FIG. 5B) have been stably transfected with the same three genes and selected for functional expression from a pool of 2.5 million cells by ligand-induced puromycin resistance as described herein. "Clone 3" contains a gain mutation that confers functional expression of OR5A2, which could be selected from a pool of 2.5 million cells by the selection procedure specifically applied. [Figure 6] Amino acid sequence alignment of OR5A2 wild type (SEQ ID NO: 69) with the mutant form in "clone 3" (SEQ ID NO: 62). In dark grey shading the seventh transmembrane domain is shown, while in light and dark shading the wild type C-terminus is represented. The bolded amino acids in the boxed sequence are those gained by recombination events in "clone 3" and the corresponding cells containing this mutation were selected based on the selection procedure of the present invention. [Figure 7] Luciferase induction by musk ligand in HEK293T cells expressing human RTP1S functional variant V227I (sequence number 17) and RTP2 functional variant L220R (sequence number 18) and transfected with CRE-inducible luciferase and with mutant forms of OR5A2 shown in Figure 6. [Figure 8] HEK293T cells harboring a stable insert of pGL4.29-CRE-BLAST-OR, containing the receptor OR5AN1, exposed to 11 concentrations of blasticidin and co-treated with various olfactory ligands. Cells expressing OR5AN1 are highly resistant to blasticidin in the presence of the ligand musk ketone, whereas ethyl vanillin, a ligand that does not bind to OR5AN1, does not increase resistance over the solvent control. [Figure 9A] Alignment of musk ketone selected clones (SEQ ID NO: 36-44; M1 SEQ ID NO: 36, M2 SEQ ID NO: 37, M3 SEQ ID NO: 38, M4 SEQ ID NO: 39, M5 SEQ ID NO: 40, M6 SEQ ID NO: 41, M7 SEQ ID NO: 42, M8 SEQ ID NO: 43, M9 SEQ ID NO: 44) with OR5AN1 (SEQ ID NO: 70). [Figure 9B] Alignment of musk ketone selected clones (SEQ ID NO: 36-44; M1 SEQ ID NO: 36, M2 SEQ ID NO: 37, M3 SEQ ID NO: 38, M4 SEQ ID NO: 39, M5 SEQ ID NO: 40, M6 SEQ ID NO: 41, M7 SEQ ID NO: 42, M8 SEQ ID NO: 43, M9 SEQ ID NO: 44) with OR5AN1 (SEQ ID NO: 70). [Figure 9C]Alignment of musk ketone selected clones (SEQ ID NO: 36-44; M1 SEQ ID NO: 36, M2 SEQ ID NO: 37, M3 SEQ ID NO: 38, M4 SEQ ID NO: 39, M5 SEQ ID NO: 40, M6 SEQ ID NO: 41, M7 SEQ ID NO: 42, M8 SEQ ID NO: 43, M9 SEQ ID NO: 44) with OR5AN1 (SEQ ID NO: 70). [Figure 9D] Alignment of musk ketone selected clones (SEQ ID NO: 36-44; M1 SEQ ID NO: 36, M2 SEQ ID NO: 37, M3 SEQ ID NO: 38, M4 SEQ ID NO: 39, M5 SEQ ID NO: 40, M6 SEQ ID NO: 41, M7 SEQ ID NO: 42, M8 SEQ ID NO: 43, M9 SEQ ID NO: 44) with OR5AN1 (SEQ ID NO: 70). [Figure 10A] Alignment of eugenol-selected clones (SEQ ID NO: 45-53; E1 SEQ ID NO: 45, E2 SEQ ID NO: 46, E3 SEQ ID NO: 47, E4 SEQ ID NO: 48, E5 SEQ ID NO: 49, E6 SEQ ID NO: 50, E7 SEQ ID NO: 51, E8 SEQ ID NO: 52, E9 SEQ ID NO: 53) with OR10G7 (SEQ ID NO: 71). [Figure 10B] Alignment of eugenol-selected clones (SEQ ID NO: 45-53; E1 SEQ ID NO: 45, E2 SEQ ID NO: 46, E3 SEQ ID NO: 47, E4 SEQ ID NO: 48, E5 SEQ ID NO: 49, E6 SEQ ID NO: 50, E7 SEQ ID NO: 51, E8 SEQ ID NO: 52, E9 SEQ ID NO: 53) with OR10G7 (SEQ ID NO: 71). [Figure 10C] Alignment of eugenol-selected clones (SEQ ID NO: 45-53; E1 SEQ ID NO: 45, E2 SEQ ID NO: 46, E3 SEQ ID NO: 47, E4 SEQ ID NO: 48, E5 SEQ ID NO: 49, E6 SEQ ID NO: 50, E7 SEQ ID NO: 51, E8 SEQ ID NO: 52, E9 SEQ ID NO: 53) with OR10G7 (SEQ ID NO: 71). [Figure 10D] Alignment of eugenol-selected clones (SEQ ID NO: 45-53; E1 SEQ ID NO: 45, E2 SEQ ID NO: 46, E3 SEQ ID NO: 47, E4 SEQ ID NO: 48, E5 SEQ ID NO: 49, E6 SEQ ID NO: 50, E7 SEQ ID NO: 51, E8 SEQ ID NO: 52, E9 SEQ ID NO: 53) with OR10G7 (SEQ ID NO: 71). [Figure 11A] Alignment of vanitrope selected clones (SEQ ID NO:54-61; V1 SEQ ID NO:54, V2 SEQ ID NO:55, V3 SEQ ID NO:56, V5 SEQ ID NO:57, V6 SEQ ID NO:58, V7 SEQ ID NO:59, V8 SEQ ID NO:60, V9 SEQ ID NO:61) with OR10G4 (SEQ ID NO:72). [Figure 11B] Alignment of vanitrope selected clones (SEQ ID NO:54-61; V1 SEQ ID NO:54, V2 SEQ ID NO:55, V3 SEQ ID NO:56, V5 SEQ ID NO:57, V6 SEQ ID NO:58, V7 SEQ ID NO:59, V8 SEQ ID NO:60, V9 SEQ ID NO:61) with OR10G4 (SEQ ID NO:72). [Figure 11C] Alignment of vanitrope selected clones (SEQ ID NO:54-61; V1 SEQ ID NO:54, V2 SEQ ID NO:55, V3 SEQ ID NO:56, V5 SEQ ID NO:57, V6 SEQ ID NO:58, V7 SEQ ID NO:59, V8 SEQ ID NO:60, V9 SEQ ID NO:61) with OR10G4 (SEQ ID NO:72). [Figure 11D] Alignment of vanitrope selected clones (SEQ ID NO:54-61; V1 SEQ ID NO:54, V2 SEQ ID NO:55, V3 SEQ ID NO:56, V5 SEQ ID NO:57, V6 SEQ ID NO:58, V7 SEQ ID NO:59, V8 SEQ ID NO:60, V9 SEQ ID NO:61) with OR10G4 (SEQ ID NO:72). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0170] example Example 1. Construction of a vector for selection for OR-ligand-induced puromycin resistance and construction of a stable cell line containing said vector To generate a vector allowing positive selection of cell clones with functional expression of a specific OR gene, a puromycin resistance gene was placed downstream of SEQ ID NO:4.

[0171] The pGL4.29 plasmid (Promega, WI, USA) was digested with HindIII / XbaI (partial) to remove the included portion of the CRE and the complete luciferase coding sequence. The removed CRE sequence and the sequence coding for puromycin N-acetyltransferase (PAC, SEQ ID NO: 7) were amplified by PCR and joined by fusion PCR using the following primers: GCGGCCAAGCTTAGACACTAGAG (SEQ ID NO: 24), CGGTCATGGTGGCTTTACCAACAGTACC (SEQ ID NO: 25), TGGTAAAGCCACCATGACCGAGTACAAGC (SEQ ID NO: 26), and CAGTCTAGATCAGGCACCGGGCTTG (SEQ ID NO:27). The resulting DNA fragment was digested with HindIII / XbaI and ligated into pGL4.29 to generate pGL4.29-CRE-Puro.

[0172] Construction of pGL4.29-CRE-Puro-OR To generate a plasmid carrying the PAC under the control of CRE and the OR expression cassette, the OR coding sequence was PCR amplified from pcDNA3.1(+) (Invitrogen, MA, USA) together with the CMV promoter sequence (SEQ ID NO: 15), the nucleotide sequence encoding the signal peptide (mmLucy-FLAG-rho, SEQ ID NO: 13) and the bgh terminator sequence (SEQ ID NO: 16) using the following primers: CAGAGATCTCGCGTTGACATTGATTATTGACTAG (SEQ ID NO: 21) and CTGGTCGACAGAAGCCATAGAGCCCAC (SEQ ID NO: 22). The PCR product was digested with BglII / SalI and used to replace the BamHI / SalI fragment of pGL4.29-CRE-Puro. This plasmid thus contains a constitutively expressed OR gene and CRE-inducible puromycin resistance.

[0173] Construction of pGL4.29-CRE-Puro-Hygro-OR To generate a plasmid carrying a constitutive hygromycin resistance gene (SEQ ID NO: 8), a PAC under the control of CRE, and an OR expression cassette, the OR coding sequence was PCR amplified from pcDNA3.1(+) together with a CMV promoter sequence (SEQ ID NO: 15), a nucleotide sequence encoding a signal peptide (mmLucy-FLAG-rho, SEQ ID NO: 13) and a BGH terminator sequence (SEQ ID NO: 16) using the following primers: CTGGTCGACCGCGTTGACATTGATTATTGACTAG (SEQ ID NO: 23) and CTGGTCGACAGAAGCCATAGAGCCCAC (SEQ ID NO: 22). The PCR product was digested with SalI and inserted into SalI restricted pGL4.29-CRE-Puro. This plasmid thus contains a constitutively expressed OR gene, a constitutive hygromycin resistance gene and a CRE-inducible puromycin resistance.

[0174] 10 μg of the resulting plasmid pGL4.29-CRE-Puro-Hygro-OR was then linearized by digestion with PvuI in 150 μl. The linearized plasmid was purified and 7.6 μg was diluted in 0.5 ml of OptiMEM medium (Gibco™, ThermoFisher Scientific, MA, USA) containing 15 μl of P3000 reagent (Invitrogen). In parallel, 11.5 μl of Lipofectamine 3000 (Invitrogen) was diluted in 0.5 ml of OptiMEM medium, and after a 5 min preincubation, the two mixtures were combined to prepare the transfection mixture, which was incubated for another 25 min.

[0175] Expression of OR genes was generally performed in HEK293T cells stably transfected with a functional variant of human RTP1S (V227I, SEQ ID NO: 17) and a functional variant of RTP2 (L220R, SEQ ID NO: 18). The cells were grown to sub-confluence in 10 cm Petri dishes at 37°C in the presence of 5% CO2. The growth medium was replaced with 10 ml of DMEM containing 9% FBS, and the pre-incubated transfection mixture was then added to the cells, which were then incubated for 24 hours at 37°C in the presence of 5% CO2 to allow DNA uptake and chromosomal insertion. The cells were harvested and resuspended in DMEM containing 9% FBS and a mixture of penicillin and streptomycin (ThermoFisher Scientific), and they were then seeded at a density of 50 cells / well in 96-well plates (100ul / well). 24 hours after cell seeding, selective pressure was applied to select for cells with stable insertion of the vector into the chromosome. To select for chromosomal insertion, hygromycin was added to the cells at a final concentration of 100 μg / ml, and the medium was replaced with fresh medium containing the same amount of hygromycin twice a week. Wells with single, isolated, viable clones were marked, and these clones were picked and propagated as stable cell lines containing the pGL4.29-CRE-Puro-Hygro-OR construct.

[0176] Example 2. Ligand-induced OR-dependent resistance to puromycin in selected cell clones Stable clones selected by hygromycin containing stable insertions of pGL4.29-CRE-Puro-Hygro-OR constructs carrying any one of the receptors OR10G7, OR10G9 or OR5AN1 (NCBI Genbank gene IDs: 390265, 219870 and 390195) described in Example 1 were seeded in 200 μl of Dulbecco's Modified Eagle Medium (DMEM) at a density of 3000 cells / well in a polyethyleneimide-coated, white, clear-bottomed 96-well microtiter plate. After allowing the cells to adhere for 24 hours, they were exposed to various odor molecules (musk ketone at 10 μM, eugenol or isoeugenol at 1 μM, ultravanil or vanitrope at 100 μM). Seven hours after the addition of odorants, 100 μl of the medium was removed and replaced with fresh medium with the same concentration of odorants, plus puromycin to reach a final concentration of 0.015-16 μg / ml in 11 two-fold dilution steps (day 1 of selection). On days 2 and 3, 100 μl of the medium was again removed and replaced with fresh medium with the same concentrations of odorants and puromycin. On day 4 of selection, the medium from each well was completely removed, 100 ul of PrestoBlue® cell viability reagent (ThermoFisher Scientific, Catalog No: 14200-083) diluted in phosphate-buffered saline was added to each well, and the cells were incubated at 37°C until a color change in the wells containing puromycin was visible. To assess relative cell metabolic activity, which is the net result of cell proliferation and cell killing in the presence of various concentrations of puromycin, fluorescence was determined at 560 nm excitation and 590 nm emission. Results were expressed as % viability compared to a control without cells (0%) and a control with cells treated only with olfactory ligands (100%). Since cells were actively proliferating in this experiment, a partial decrease in viability may indicate (partial) cell retention without indicating cytotoxicity, while 0% viability indicates complete cytotoxicity.

[0177] Figure 1 shows the results for cells containing OR10G7 transduced with vectors as described in Example 1. When cells were selected in the presence of musk ketone, an odor molecule that is not a ligand for OR10G7, no induced puromycin resistance was observed relative to the solvent control. However, strongly enhanced puromycin resistance was observed with the ligands eugenol, isoeugenol, ultravanil, and vanitrope that bind to OR10G7, and viability was only partially reduced by puromycin.

[0178] Figure 2 shows the same experiment performed with OR5AN1, known to respond to musk compounds such as musk ketone. In this case, enhanced puromycin resistance and only a partial reduction in viable cells was observed in the presence of musk ligands, whereas in the presence of eugenol, isoeugenol and ultravanil, which are not ligands for this receptor, resistance was comparable to the solvent control. Similarly, as shown in Figure 3, for cells carrying vectors with OR10G9, selectively enhanced resistance was observed for the cognate ligands ultravanil and vanitrope, whereas no increased resistance was observed for musk ketone, eugenol and isoeugenol, which do not bind to this receptor at the given concentrations.

[0179] These results show that activation of the cyclic AMP pathway acting on the CRE element by functional expression of an olfactory receptor and addition of its cognate ligand is capable of selectively inducing resistance to a selectable marker (puromycin in this case).

[0180] Example 3. Selection of cell clones with functional expression of a difficult to express OR As described in Example 1, a pGL4.29-CRE-Puro-OR vector containing the receptor OR5A2 (NCBI Genbank ID: 219981) was generated. The wild-type sequence of human OR5A2 encodes a difficult-to-express receptor and cannot be expressed in cells expressing chaperones RTP1S and RTP2. It requires unknown accessory factors for functional expression. OR5A2 was inferred to be a musk receptor in WO2019110630A1, and genetic variants in this receptor were shown to correlate with sensitivity to the musk ligand galaxolide in Trimmer et al. (2019) PNAS 116(19):9475-9480. These data collectively indicate that OR5A2 is a candidate musk receptor. This construct was transfected into 2,500,0000 HEK293T cells stably transfected with RTP1S and RTP2 variants as described in Example 1. 24 hours after transfection, the cells were resuspended in 240 ml of DMEM containing 9% FBS and distributed into 12-well plates (1 ml / well). Instead of selecting with hygromycin as in Example 1, a direct selection was performed according to the procedure of the present invention as follows: after 24 hours of incubation to allow cell adhesion, the ligand musk ambrette was added to a final concentration of 30 μM to stimulate OR5A2 and thus initiate cAMP production. After 7 hours, puromycin was added to a final level of 3 μg / ml. The cells were then exposed to this concentration of ligand and puromycin continuously by repeatedly changing the incubation medium, and single clones that survived this treatment were isolated and tested for ligand-dependent resistance and functional expression of OR5A2. Of the 2.5 million cells used for the experiment, only one clone ("Clone 3") was isolated that was able to survive puromycin treatment in the presence of the ligand musk ambrette, but not in its absence.This clone was first characterized by the evaluation of its selective OR-ligand-induced resistance as described in Example 2. As shown in Figure 4, this clone acquired ligand-induced puromycin resistance, indicating that it can functionally express receptor OR5A2 and produce cAMP upon addition of ligand. This clone was further analyzed for functional expression: it was grown in 96-well plates at a density of 10000 cells / well and transiently transfected with plasmid pGL4.29 (Promega) carrying CRE-inducible luciferase using lipofectamine 2000 as described in Example 1. 24 hours after transfection, cells were stimulated with various ligands, and 4.5 hours later, luciferase signals induced based on OR-dependent cAMP production were measured. Figure 5a shows the results for HEK293T cells stably transfected with variants of RTP1S and RTP2 (SEQ ID NO: 17 and 18) and carrying the receptor OR5A2, but not undergoing selection for functional expression according to the invention. No ligand-induced luciferase signal was detected, indicating that this receptor is not functional even in cells expressing RTP1S and RTP2. In Figure 5b, the results are shown for "clone 3" carrying OR5A2 derived from the selection procedure as described above. This clone showed a strong ligand-induced luciferase signal. This confirms that the ligand-based selection procedure selected rare mutations (out of 250,0000 cells) that allow functional expression of this difficult-to-express receptor.

[0181] Example 4. Retroviral-mediated forward gain-of-function mutagenesis followed by selection of cell clones with functional expression of a difficult-to-express OR As described in Example 1, pGL4.29-CRE-Puro-Hygro-OR vector containing receptor OR5A2 (NCBI Genbank gene ID: 219981) was generated. HEK293T cells stably transfected with RTP1S and RTP2 variants as described in Example 1 were transfected with this new construct, and stable clones were selected in the presence of hygromycin as described in Example 1. Selected clones were tested for puromycin resistance, and a single clone sensitive to 0.5 μg / ml puromycin was selected and expanded. This provided a homogenous pool of cells with the same insertion site of pGL4.29-CRE-Puro-Hygro-OR vector and high sensitivity to puromycin.

[0182] Retroviral particles were generated by transfection of HEK293T cells with vectors (i) pCCLsin.PPT.SFFV or pCCLsin.PPT.eGFP.sPRE.3'LTRsenseSFFV, (ii) pK-Rev, (iii) pMD2-VSV-G and (iv) pMDLg-pRRE. These vectors allow cells to produce infectious but non-replicative viral particles containing the strong SFFV promoter in the viral genome / vector as described by Montini et al. (2009) J Clin Invest 119:964-75 and Ranzani et al. (2014) Mol Ther 22(12):2056-2068. Cell supernatants containing viral particles were harvested 24-36 hours after transfection.

[0183] The pGL4.29-CRE-Puro-Hygro-OR vector-containing highly puromycin-sensitive stable clones were cultured in 10 cm petri dishes at 3 × 10 5Cells were seeded with 10 ...

[0184] Example 5. Positive gain-of-function mutagenesis using CRISPRa followed by selection of cell clones with functional expression of a hard-to-express OR The highly puromycin-sensitive stable clones of Example 4 containing the pGL4.29-CRE-Puro-Hygro-OR vector and containing the receptor OR5A2 are transduced with lentivirus to express the dCas9-VPH gene encoding the "catalytically dead" Cas9 fused to the VP64, p65 and HSF1 transactivation domains (plasmid pRDVCRB-RSV-dCas9-VPH-2A-Blast available from Cellecta Inc. CA, USA). Stable clones are selected in the presence of blasticidin. Stable clones are then cultured in 10 cm Petri dishes with 3×10 5Cells are seeded with cells / plate. The cells are incubated for 24 hours to allow attachment and then infected with viral particles obtained from Cellecta Inc. (catalog number KADHGW-105K-V9; https: / / cellecta.com / collections / crispra-and-crispri-lentiviral-sgrna-libraries). These viral particles encode a whole genome library of guide RNAs (sgRNAs). The cells are incubated for 3 days to allow infection and integration of the viral vector into the chromosome. The dCas9-VPH protein then leads to activation of the genes adjacent to the binding site of the sgRNA. Direct selection by the procedure of the present invention is then performed as follows: the ligand musk ambrette is added to a final concentration of 30 μM to stimulate OR5A2 and thus initiate cAMP production. After 7 hours, puromycin is added to a final level of 4 μg / ml. The cells are then continuously exposed to this concentration of ligand and puromycin by repeatedly changing the incubation medium. Single clones surviving this treatment are isolated and tested for ligand-dependent resistance and functional expression of OR5A2 as described in Example 3.

[0185] Example 6. Characterization of mutations in clone 3 To identify the integration site of the transfected plasmid, chromosomal DNA from "clone 3" as described in Example 3 was extracted according to standard protocols. DNA was individually digested with the following restriction enzymes: BamHI, BglII, HindIII, NcoI, NdeI, NheI, SpeI. Each of the individual digests was subjected to a ligation reaction to generate circular DNA fragments, which were then subjected to nested PCR with the following primer pairs: First PCR: 5'-ATTAAGGTACGGGAGGTATTGG-3' (SEQ ID NO:34) and 5'-AAGAGTGGGCTATATCGAACTG-3' (SEQ ID NO:35); Nested PCR: 5'-AACATTTCTCTGGCCTAACTGG-3' (SEQ ID NO:28) and 5'-ATTCCCGATGATGAGCACTTTC-3' (sequence number 29). The sequence of the resulting PCR product was determined by Sanger sequencing. The results showed that in clone 3, the OR5A2 gene derived from the inserted plasmid acquired a mutation at its C-terminus through a recombination event. The alignment in FIG. 6 shows the wild-type amino acid sequence of OR5A2 starting from the last transmembrane domain to the C-terminus (SEQ ID NO:69) and the mutated sequence of OR5A2 amplified from "clone 3" (SEQ ID NO:62). The complete sequence of OR5A2 from "clone 3" is represented by SEQ ID NO:20, and the C-terminal end is represented by SEQ ID NO:62.

[0186] To verify that the identified mutations indeed conferred on OR5A2 the ability to be functionally expressed in HEK293T cells, OR5A2 variants were PCR amplified from genomic DNA of clone 3 using primers 5'-TACAGGAATTCATGGCTGTAGGAAGGAACAAC-3' (SEQ ID NO: 30) and 5'-ACTGCGGCCGCTTACCATGAGCGACAACACCG-3' (SEQ ID NO: 31) and cloned into the expression vector pcDNA3.1(+) downstream of the signal peptide (SEQ ID NO: 14).

[0187] The resulting plasmid carrying OR5A2 with the same introduced C-terminal mutations as shown in Figure 6 was then used for transient transfection of HEK293T cells stably transfected with a functional variant of human RTP1S (V227I, SEQ ID NO: 17) and a functional variant of RTP2 (L220R, SEQ ID NO: 18). As shown in Figure 7, functional expression and response to musk ligands could be verified by co-transfection of CRE-inducible luciferase and stimulation with various musk ligands. This demonstrates that the stable mutations at the C-terminus are sufficient to confer the ability of OR5A2 to be functionally expressed.

[0188] Example 7. Selection of cells expressing a specific cognate receptor from a pool of cells expressing the receptor by selection with a target ligand For many ligands, the cognate OR receptor is not known ("orphan receptor"), or it is not known which of the pool of receptors has the best affinity for the ligand of interest, e.g., a particular fragrance note of interest. Thus, ligand-induced selection pressure can be used to enrich for cells expressing a particular OR from a pool of cells expressing an OR in the presence of the ligand of interest. HEK293T cells stably expressing RTP1S and RTP2 were seeded at 330,000 cells / well in seven wells of a 6-well plate.

[0189] The next day, cells from each well were transfected with 2 μg of PvuI-linearized pGL4.29-CRE-Puro-Hygro-OR constructs carrying one of the receptors OR5A1 (NCBI Genbank Gene ID: 219982), OR5A2 (NCBI Genbank Gene ID: 219981), OR5AN1 NCBI Genbank Gene ID: 390195, SEQ ID NO: 70), OR6Y1 (NCBI Genbank Gene ID: 391112), OR10G4 (NCBI Genbank Gene ID: 390264, SEQ ID NO: 72), OR10G7 (NCBI Genbank Gene ID: 390265, SEQ ID NO: 71), or OR10G9 (NCBI Genbank Gene ID: 219870). 24 hours after transfection, cells from all seven transfections were harvested and pooled. 350 cells of this pool of cells with different OR gene insertions were then seeded into each well of seven 96-well plates.

[0190] After 3 days, cells were stimulated with ligands for either OR5AN1 (10 μM musk ketone), OR10G7 (1 μM eugenol), or OR10G4 (100 μM vanitrope). One plate was treated with DMSO only. Six hours after addition of the OR ligand, puromycin was added to each plate at a final concentration of 1 μg / ml. Every day during the following week, the medium in all plates was replaced with fresh medium containing the corresponding ligand and puromycin. Plates were then probed for wells that contained only a single colony of puromycin-resistant cells. Cells from these colonies were transferred to larger plates and grown until they increased to approximately 8 million cells. Genomic DNA of 2 million cells of each clone was isolated using the Puregene kit according to the manufacturer's protocol. Using PCR primers 5'-ACAAGGACGACGACGATAAG-3' (SEQ ID NO: 32) and 5'-GATGGCTGGCAACTAGAAGG-3' (SEQ ID NO: 33), the OR gene stably integrated in a particular cell clone after transfection with the pGL4.29-CRE-Puro-Hygro-OR plasmid was amplified and sequenced. A sequence alignment of the resulting sequences is shown below.

[0191] All nine clones selected by musk ketone (clones M1-M9, SEQ ID NOs: 36-44) contained OR5AN1, which is known to respond to musks such as musk ketone, eight of the eight clones selected by eugenol (clones E1-E8, SEQ ID NOs: 45-53) contained OR10G7, a specific receptor for eugenol, and eight of the eight colonies selected by vanitrope (clones V1-V8, SEQ ID NOs: 54-61) contained OR10G4, a receptor that responds to this ligand.

[0192] Thus, by applying the selection procedure of the present invention, selective receptor deorphanization for a particular ligand is feasible, since this ligand makes it possible to select, from a pool of cells transfected with various ORs, specific cells expressing a receptor that is efficiently activated by the ligand of interest.

[0193] Example 8. Construction of vectors to select for OR-ligand-induced blasticidin resistance and evaluation of ligand-induced blasticidin resistance in stable cell lines containing the vectors To generate a vector that allows positive selection of cell clones with functional expression of a specific OR gene, a blasticidin resistance gene was placed upstream of SEQ ID NO: 4. The pGL4.29-CRE-Puro-OR vector, generated as described in Example 1, was digested with BglII and FseI to remove the contained basal promoter and the complete puromycin resistance gene. The removed basal promoter sequence was amplified with primers AACATTTCTCTGGCCTAACTGG (SEQ ID NO: 28), GACAAAGGCATGGTGGCTTTACCAACAG (SEQ ID NO: 63), and the sequence coding for blasticidin S deaminase (bsd, SEQ ID NO: 64) was amplified by PCR using primers GTAAAGCCACCATGCCTTTGTCTCAAGAAGAATCC (SEQ ID NO: 66), CCGACTCTAGATTAGCCCTCCCACACATAAC (SEQ ID NO: 67). The two overlapping PCR products were joined by fusion PCR using primers AACATTTCTCTGGCCTAACTGG (SEQ ID NO: 28) and ATCAGGCCGGCCGCCCCGACTCTAGATTAGCCCTCC (SEQ ID NO: 68). The resulting DNA fragment was digested with BglII / FseI and ligated into the digested vector to create pGL4.29-CRE-Blast-OR.

[0194] This vector was used to generate stable cell lines as described in Example 1. Stable clones containing a stable insertion of the pGL4.29-CRE-BLAST-OR construct with the receptor OR5AN1 (NCBI Genbank gene ID: 390195) were then seeded in white 96-well microtiter plates with clear bottoms, coated with polyethyleneimide, at a density of 3000 cells / well in 100 μl of Dulbecco's Modified Eagle Medium (DMEM). After allowing the cells to adhere for 24 h, 50 μl of medium containing various odor molecules (musk ketone or ethyl vanillin at 40 μM) was added to each well, resulting in an odor molecule concentration of 13.3 μM. Six hours after odor molecule addition, 50 μl of medium containing blasticidin was added to reach a final concentration of 0.5 to 256 μg / ml in 10 two-fold dilution steps (day 1 of selection). This step further diluted the odor molecules to 10 μM. On the fourth day of selection (72 hours after blasticidin addition), the medium from each well was completely removed, 100 μl of PrestoBlue® cell viability reagent (ThermoFisher Scientific, Catalog No: 14200-083) diluted in phosphate-buffered saline containing 1 mg / ml glucose was added to each well, and the cells were incubated at 37°C until a color change in the well containing blasticidin was visible. To evaluate the relative cell metabolic activity, which is the net result of cell proliferation and cell killing in the presence of various concentrations of blasticidin, fluorescence was determined at an excitation of 560 nm and an emission of 590 nm. The results were expressed as % viability compared to a control without cells (0%) and a control with cells treated with olfactory ligands only (100%). Since cells were actively proliferating in this experiment, a partial loss of viability does not indicate cytotoxicity but may indicate (partial) cell retention, whereas 0% viability indicates complete cytotoxicity.

[0195] Figure 8 shows results for cells transduced with the vector pGL4.29-CRE-BLAST-OR, which contains the OR5AN1 gene known to respond to musk compounds such as musk ketone. In the presence of musk ligand, enhanced blasticidin resistance and only a slight decrease in viable cells was observed, whereas in the presence of ethyl vanillin, which is not a ligand for this receptor, cells were equally sensitive to blasticidin as in the presence of a solvent control. Compared to puromycin, selection with blasticidin provides an even enhanced dynamic range, for example, since the difference in viability at 32 μM is almost 10-fold (75% viable cells in the presence of musk ligand, whereas only 7% viability was observed in the absence of ligand) and the concentration of blasticidin that reduces viability by 50% (EC50) is >50-fold higher in the presence of musk ligand.

Claims

1. A method for selecting cells that express a functional olfactory receptor and / or accessory molecules required for functional expression in said cells, comprising the following steps: A) providing a cell, wherein said cell comprises a nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP-responsive element (CRE), a CRE half-site, or a NFAT-responsive element (NFAT-RE), and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor ; B) culturing said cell in the presence of a ligand of said olfactory receptor; C1) selecting cells that functionally express an olfactory receptor by culturing them in the presence of an antibiotic and a ligand comprising said method.

2. A method for selecting cells that express a functional olfactory receptor and / or accessory molecules required for functional expression in said cells, comprising the following steps: A) applying a mutagenesis step to a cell, wherein said cell comprises a nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, wherein said encoded polypeptide confers resistance to an antibiotic, wherein said promoter and / or enhancer is inducible by an olfactory receptor, preferably wherein said promoter and / or enhancer sequence comprises one or more copies of a cAMP-responsive element (CRE), a CRE half-site, or a NFAT-responsive element (NFAT-RE), and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor ; B) culturing the mutated cells in the presence of a ligand of said olfactory receptor; C1) selecting mutated cells that functionally express an olfactory receptor by culturing them in the presence of an antibiotic and a ligand The method as described above, including **Claim 3** The mutagenesis step is carried out using insertional mutagenesis, where the nucleic acid sequence is inserted into the genome of the cell using recombination mediated by a plasmid, linear DNA sequence, transposon, retrovirus, lentivirus or CRISPR-Cas. The method according to claim 2. **Claim 4** The method according to claim 3, wherein the inserted nucleic acid sequence contains enhancer and / or promoter sequences suitable for activating the expression of endogenous genes. **Claim 5** The method according to claim 3, wherein the insertion site of the inserted nucleic acid sequence in the selected cells is mapped and / or identified. **Claim 6** The method according to claim 2, wherein the mutagenesis step is carried out using CRISPR-Cas-mediated mutagenesis using CRISPR interference or CRISPR activation. **Claim 7** A method for identifying an olfactory receptor that binds to a given ligand, comprising the following steps: A) Providing a heterogeneous population of cells, where the cells contain a nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide, where the encoded polypeptide confers resistance to an antibiotic, where the promoter and / or enhancer is inducible by an olfactory receptor, preferably where the promoter and / or enhancer sequence contains one or more copies of a cAMP-responsive element (CRE), CRE half-sequence, or NFAT-responsive element (NFAT-RE), and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor, where the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct contained in at least one of the cells is distinguishable from the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct in at least one of the other cells of the population. including B) Culturing the population of cells in the presence of the given ligand. C1) Selecting, for the cells that functionally express an olfactory receptor that binds to the given ligand, by culturing them in the presence of an antibiotic and the ligand. D) Determining the nucleotide sequence encoding the receptor in the selected cells. The method as described above, including

8. The method according to claim 1, wherein step C1) further includes a subculture step, where cells with improved functional expression of olfactory receptors are concentrated in the culture.

9. The method according to any one of claims 1 to 8, wherein the nucleic acid sequence encoding the polypeptide conferring resistance to the antibiotic is the puromycin-N-acetyltransferase gene or the blasticidin-S deaminase gene.

10. A nucleic acid construct comprising a promoter and / or enhancer sequence operably linked to a nucleic acid sequence encoding a polypeptide conferring resistance to an antibiotic, wherein the promoter and / or enhancer is inducible by an olfactory receptor, preferably where the promoter and / or enhancer sequence comprises one or more copies of a cAMP-responsive element (CRE), a CRE half-sequence, or an NFAT-responsive element (NFAT-RE).

11. The nucleic acid construct according to claim 10, wherein the nucleic acid sequence encoding the polypeptide conferring resistance to the antibiotic is the puromycin-N-acetyltransferase gene or the blasticidin-S deaminase gene.

12. A cell comprising the nucleic acid construct according to claim 10 or 11 and a second nucleic acid construct comprising a nucleic acid molecule encoding an olfactory receptor, preferably where the nucleic acid constructs are fused to form a single nucleic acid construct.

13. The cell according to claim 12, which is a eukaryotic cell, preferably a human cell.

14. A population of cells comprising several cells as defined in claim 12, wherein the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct contained in at least one of the cells is distinguishable from the olfactory receptor encoded by the nucleic acid molecule contained in the second nucleic acid construct in at least one of the other cells in the population, defining a pool of cells expressing distinguishable olfactory receptors.

15. The population of cells according to claim 14, wherein at least one olfactory receptor is functionally expressed in the population of cells. **Claim 16** An olfactory receptor comprising an amino acid sequence having at least 60% identity or similarity with SEQ ID NO: 62, preferably wherein SEQ ID NO: 62 is located at the C-terminus of the olfactory receptor, said olfactory receptor. **Claim 17** Preferably, an olfactory receptor according to claim 16, wherein its amino acid sequence comprises, consists essentially of, or consists of an amino acid sequence having at least 60% identity or similarity with SEQ ID NO: 20.

Images