Method for concentrating circular polyribonucleotides

JP2024523054A5Pending Publication Date: 2025-06-02FLAGSHIP PIONEERING INNOVATIONS VI LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023571506
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-05-18
Filing Date
2022-05-18
Publication Date
2025-06-02

AI Technical Summary

Technical Problem

The presence of linear polyribonucleotides in pharmaceutical preparations of cyclic polyribonucleotides leads to undesirable effects due to their degradation, necessitating methods to enrich and purify cyclic polyribonucleotides.

Method used

A method involving the use of 5' and 3' exonucleases to digest linear polyribonucleotides, creating an enriched population of cyclic polyribonucleotides by selectively removing linear counterparts.

Benefits of technology

The method achieves a high yield of cyclic polyribonucleotides, typically between 40% to 95% of the total, while minimizing the presence of linear forms, thereby enhancing the stability and efficacy of pharmaceutical formulations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000052_0000
    Figure 00000052_0000
  • Figure 00000052_0001
    Figure 00000052_0001
  • Figure 00000053_0000
    Figure 00000053_0000
Patent Text Reader

Abstract

Using the methods of the present disclosure, a population of circular polyribonucleotides can be enriched in a mixture of linear and circular polyribonucleotides.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Sequence Listing This application is filed with a Sequence Listing in electronic format, which is provided in a file entitled 51509-034WO2_Sequence_Listing_5_18_22__ST25, created May 18, 2022, which is 6,438 bytes in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety. [Background technology]

[0002] Circular polyribonucleotides exhibit increased resistance to degradation by nucleases, resulting in a longer half-life compared to linear polyribonucleotides. Circular polyribonucleotides are known to occur endogenously or can be circularized exogenously. Exogenous circularization reactions result in a mixture of successfully circularized polyribonucleotides plus some residual linear polyribonucleotides. The presence of linear polyribonucleotides in pharmaceutical circular polyribonucleotide preparations can lead to unexpected and undesirable effects. Thus, there remains a need for methods to concentrate, separate, and / or purify cyclic polyribonucleotides compared to linear polyribonucleotides. Summary of the Invention [Means for solving the problem]

[0003] The present disclosure provides a method for producing an enriched population of circular polyribonucleotides. In particular, the present disclosure provides a method for producing an enriched population of circular polyribonucleotides from a mixture of linear and circular polyribonucleotides by digesting linear polyribonucleotides with 5' exonucleases and 3' exonucleases.

[0004] In one aspect, the disclosure provides a method of making an enriched population of circular polyribonucleotides, comprising providing a polyribonucleotide population comprising circular polyribonucleotides and linear polyribonucleotides; dissolving at least a portion of the linear polyribonucleotides in an amount of 0.01 U to 0.2 U (e.g., 0.01 U to 0.16 U, 0.01 U to 0.12 U, 0.01 U to 0.0.8 U, 0.01 U to 0.04 U, 0.01 U to 0.02 U, 0.01 U to 0.012 U, 0.02 U to 0.2 U, 0.04 U to 0.2 U, 0.0.08 U to 0.2 U, 0.12 U to 0.2 U, and 0.16 U to 0.2 U) per μg of polyribonucleotide. and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease in an amount of 0.4U to 4U (e.g., 0.4U to 3.6U, 0.4U to 3.2U, 0.4U to 2.8U, 0.4U to 2.4U, 0.4U to 2U, 0.4U to 1.6U, 0.4U to 1.2U, 0.4U to 0.8U, 0.8U to 4U, 1.2U to 4U, 1.6U to 4U, 2U to 4U, 24U to 4U, 2.8U to 4U, 3.2U to 4U, 3.6U to 4U, and 0.4U to 0.6U) per μg of polyribonucleotide; thereby producing an enriched population of circular polyribonucleotides. In some embodiments, the 5' termini of at least a portion of the linear polyribonucleotides comprise a monophosphate moiety. In some embodiments, the step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide is performed prior to digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide. In some embodiments, the step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide is performed after digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide.In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide and the digestion step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide are performed simultaneously.

[0005] In some embodiments, the 5' exonuclease is a 5'-phosphate dependent exonuclease. In some embodiments, the 5' exonuclease is Xrn-1. In some embodiments, the 3' exonuclease is RNase R. In some embodiments, the 3' exonuclease is Exonuclease T.

[0006] In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide is carried out for 30 minutes to 90 minutes (e.g., 35 minutes to 90 minutes, 45 minutes to 90 minutes, 1 hour to 90 minutes, 75 minutes to 90 minutes, 30 minutes to 75 minutes, 30 minutes to 1 hour, 30 minutes to 45 minutes, or 30 minutes to 35 minutes). In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide is carried out for 30 minutes to 90 minutes (e.g., 35 minutes to 90 minutes, 45 minutes to 90 minutes, 1 hour to 90 minutes, 75 minutes to 90 minutes, 30 minutes to 75 minutes, 30 minutes to 1 hour, 30 minutes to 45 minutes, or 30 minutes to 35 minutes).

[0007] In some embodiments, the digesting step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide is performed at a temperature of about 37° C. In some embodiments, the digesting step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide is performed at a temperature of about 37° C.

[0008] In some embodiments, the step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per 1 μg of polyribonucleotide and the step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 1 U to 10 U per 2.5 μg of polyribonucleotide are carried out using a method comprising the steps of: 2+ In some embodiments, the digestion is performed in a digestion buffer containing Mg 2+ has a concentration of 0.05 mM to 1 mM (e.g., 0.05 mM to 0.8 mM, 0.05 mM to 0.6 mM, 0.05 mM to 0.4 mM, 0.05 mM to 0.2 mM, 0.05 mM to 0.1 mM, 0.05 mM to 0.1 mM, 0.1 mM to 1 mM, 0.2 mM to 1 mM, 0.4 mM to 1 mM, 0.6 mM to 1 mM, and 0.8 mM to 1 mM).

[0009] In some embodiments, the step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide and the step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide are carried out in a digestion buffer containing dithiothreitol. In some embodiments, the dithiothreitol has a concentration of 0.1 mM to 5 mM (e.g., 0.1 mM to 4 mM, 0.1 mM to 3 mM, 0.1 mM to 2 mM, 0.1 mM to 1 mM, 0.1 mM to 0.5 mM, 0.5 mM to 5 mM, 1 mM to 5 mM, 2 mM to 5 mM, 3 mM to 5 mM, or 4 mM to 5 mM). In some embodiments, the 5' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 5' exonuclease is in an amount of 0.012U to 0.1U (e.g., 0.012U to 0.08U, 0.012U to 0.06U, 0.012U to 0.04U, 0.012U to 0.1U, 0.02U to 0.1U, 0.04U to 0.1U, 0.06U to 0.1U, 0.08U to 0.15U) per 1 μg of polyribonucleotide. In some embodiments, the 5' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 5' exonuclease is in an amount of 0.025U per 1 μg of polyribonucleotide.

[0010] In some embodiments, the 3' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 3' exonuclease is in an amount of 0.4U to 2U (e.g., 1U to 1.8U, 0.4U to 1.6U, 0.4U to 1.4U, 0.4U to 1.2U, 0.4U to 1U, 0.4U to 0.8U, 0.4U to 0.6U, 0.6U to 2U, 0.8U to 2.5U, 1U to 2U, 1.2U to 2U, 1.4U to 2U, 1.6U to about 2U, 1.8U to 2U) per 1 μg of polyribonucleotide. In some embodiments, the 3' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 3' exonuclease is in an amount of 0.5U per 1 μg of polyribonucleotide.

[0011] In some embodiments, after the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide and the digestion step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide, the percentage (w / w) of circular polyribonucleotides is 40% to 95% (e.g., 40% to 90%, 40% to 80%, 40% to 70%, 40% to 60%, 40% to 50%, 50% to 95%, 60% to 95%, 70% to 95%, 80% to 95%, or 90% to 95%) of the total polynucleotide. In some embodiments, after the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide and the digestion step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide, the percentage (w / w) of circular polyribonucleotides is 60% to 90% (e.g., 60% to 85%, 60% to 80%, 60% to 75%, 60% to 70%, 60% to 65%, 65% to 90%, 70% to 90%, 75% to 90%, 80% to 90%, or 85% to 90%) of the total polynucleotide. In some embodiments, after the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide and the digestion step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide, the percentage (w / w) of cyclic polyribonucleotides is 70% to 90% (e.g., 70% to 90%, 70% to 85%, 70% to 80%, 70% to 75%, 75% to 90%, 80% to 90%, or 85% to 90%) of the total nucleotides.In some embodiments, after the digestion step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease in an amount of 0.01 U to 0.2 U per μg of polyribonucleotide and the digestion step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease in an amount of 0.4 U to 4 U per μg of polyribonucleotide, the total percent yield (w / w) of circular polyribonucleotide is between 70% and 100% (e.g., 70% to 95%, 70% to 90%, 70% to 85%, 70% to 80%, 70% to 75%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, and 95% to 100%).

[0012] In another aspect, the disclosure provides a method of making an enriched population of circular polyribonucleotides, the method comprising: providing a polyribonucleotide population comprising circular polyribonucleotides and linear polyribonucleotides; digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease; and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease. The digestion step of digesting with 3' exonuclease and the digestion step of digesting at least a portion of the linear polyribonucleotide with 3' exonuclease may be performed using a 3' exonuclease containing 0.05 mM to 1 mM (e.g., 0.05 mM to 0.8 mM, 0.05 mM to 0.6 mM, 0.05 mM to 0.4 mM, 0.05 mM to 0.2 mM, 0.05 mM to 0.1 mM, 0.05 mM to 0.1 mM, 0.1 mM to 1 mM, 0.2 mM to 1 mM, 0.4 mM to 1 mM, 0.6 mM to 1 mM, and 0.8 mM to 1 mM) Mg 2+ and / or in a digestion buffer containing 0.1 mM to 5 mM (e.g., 0.1 mM to 4 mM, 0.1 mM to 3 mM, 0.1 mM to 2 mM, 0.1 mM to 1 mM, 0.1 mM to 0.5 mM, 0.5 mM to 5 mM, 1 mM to 5 mM, 2 mM to 5 mM, 3 mM to 5 mM, or 4 mM to 5 mM) dithiothreitol; thereby producing an enriched population of cyclic polyribonucleotides.

[0013] In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease is performed before the step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease. In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease is performed after the step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease. In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and the digestion step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease are performed simultaneously.

[0014] In some embodiments, the 5' exonuclease is in an amount of 0.01 U to 0.2 U (e.g., 0.01 U to 0.16 U, 0.01 U to 0.12 U, 0.01 U to 0.0.8 U, 0.01 U to 0.04 U, 0.01 U to 0.02 U, 0.01 U to 0.012 U, 0.02 U to 0.2 U, 0.04 U to 0.2 U, 0.0.08 U to 0.2 U, 0.12 U to 0.2 U, and 0.16 U to 0.2 U) per μg of polyribonucleotide. In some embodiments, the 3' exonuclease is in an amount of 0.4U to 4U (e.g., 0.4U to 3.6U, 0.4U to 3.2U, 0.4U to 2.8U, 0.4U to 2.4U, 0.4U to 2U, 0.4U to 1.6U, 0.4U to 1.2U, 0.4U to 0.8U, 0.8U to 4U, 1.2U to 4U, 1.6U to 4U, 2U to 4U, 24U to 4U, 2.8U to 4U, 3.2U to 4U, 3.6U to 4U, and 0.4U to 0.6U) per μg of polyribonucleotide.

[0015] In an embodiment, the 5' end of at least a portion of the linear polyribonucleotide comprises a monophosphate moiety.

[0016] In some embodiments, the 5' exonuclease is a 5'-phosphate dependent exonuclease. In some embodiments, the 5' exonuclease is Xrn-1. In some embodiments, the 3' exonuclease is RNase R. In some embodiments, the 3' exonuclease is Exonuclease T.

[0017] In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease is carried out over a period of 30 to 90 minutes (e.g., 35 to 90 minutes, 45 to 90 minutes, 1 hour to 90 minutes, 75 to 90 minutes, 30 to 75 minutes, 30 minutes to 1 hour, 30 to 45 minutes, or 30 to 35 minutes). In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease is carried out over a period of 45 to 60 minutes (e.g., 45 to 55 minutes, 45 to 50 minutes, 50 to 60 minutes, and 55 to 60 minutes). In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease is carried out over a period of 30 to 90 minutes (e.g., 35 to 90 minutes, 45 to 90 minutes, 1 hour to 90 minutes, 75 to 90 minutes, 30 to 75 minutes, 30 minutes to 1 hour, 30 to 45 minutes, or 30 to 35 minutes). In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease is carried out over a period of 45 to 60 minutes (e.g., 45 to 55 minutes, 45 to 50 minutes, 50 to 60 minutes, and 55 to 60 minutes).

[0018] In some embodiments, the digesting step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease is performed at a temperature of about 37° C. In some embodiments, the digesting step of digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease is performed at a temperature of about 37° C.

[0019] In some embodiments, the 5' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 5' exonuclease is in an amount of 0.012U to 0.1U (e.g., 0.012U to 0.08U, 0.012U to 0.06U, 0.012U to 0.04U, 0.012U to 0.02U, 0.02U to 0.1U, 0.04U to 0.1U, 0.06U to 0.1U, 0.08U to 0.1U) per 1 μg of polyribonucleotide. In some embodiments, the 5' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 5' exonuclease is in an amount of 0.025U per 1 μg of polyribonucleotide.

[0020] In some embodiments, the 3' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 3' exonuclease is in an amount of 0.4U to 2U (e.g., 0.4U to 1.8U, 0.4U to 1.6U, 0.4U to 1.4U, 0.4U to 1.2U, 0.4U to 1U, 0.4U to 0.8U, 0.4U to 0.6U, 0.6U to 2U, 0.8U to 2U, 1 to 2U, 1.2U to 2U, 1.4U to 2U, 1.6U to 2U, 1.8U to 2U) per 1 μg of polyribonucleotide. In some embodiments, the 3' exonuclease in the digestion step of digesting at least a portion of the linear polyribonucleotide with the 3' exonuclease is in an amount of 0.5U per 1 μg of polyribonucleotide.

[0021] In some embodiments, after the digestion steps of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease, the percentage (w / w) of circular polyribonucleotides is between 40% and 95% (e.g., between 40% and 90%, between 40% and 80%, between 40% and 70%, between 40% and 60%, between 40% and 50%, between 50% and 95%, between 60% and 95%, between 70% and 95%, between 80% and 95%, or between 90% and 95%) of the total polynucleotide.

[0022] In some embodiments, after the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and the digestion step of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease, the percentage (w / w) of circular polyribonucleotides is between 60% and 90% (e.g., between 60% and 85%, between 60% and 80%, between 60% and 75%, between 60% and 70%, between 60% and 65%, between 65% and 90%, between 70% and 90%, between 75% and 90%, between 80% and 90%, or between 85% and 90%) of the total polynucleotide. In some embodiments, after the digestion steps of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease, the percent (w / w) of cyclic polyribonucleotides is between 70% and 90% (e.g., 70% and 90%, 70% and 85%, 70% and 80%, 70% and 75%, 75% and 90%, 80% and 90%, or 85% and 90%) of total nucleotides. In some embodiments, after the digestion steps of digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease, the total percent yield (w / w) of cyclic polyribonucleotides is between 70% and 100%.

[0023] definition In order to facilitate understanding of the present invention, a number of terms are defined below. Terms defined herein have the meanings as commonly understood by one of ordinary skill in the art to which the present invention pertains. Terms such as "a," "an," and "the" are not intended to refer to a singular entity only, but encompass general categories of which specific examples may be used for illustration. The terminology used herein is used to describe specific embodiments of the present invention, but such usage is not intended to limit the present invention, except as outlined in the claims.

[0024] As used herein, any value provided as a range of values ​​includes both an upper and lower limit, as well as any value that falls within the upper and lower limits.

[0025] As used herein, the term "3' exonuclease" refers to an enzyme that has exonuclease activity such that the enzyme removes nucleotides from a nucleotide chain using hydrolysis that begins at the 3' end of the nucleotide chain and proceeds sequentially toward the 5' end of the nucleotide chain. 3' exonucleases include, but are not limited to, Exonuclease T, RNase PH, polynucleotide phosphorylase, RNase D, RNase R, and Exoribonuclease II.

[0026] As used herein, the term "5' exonuclease" refers to an enzyme that has exonuclease activity such that the enzyme removes nucleotides from a nucleotide chain using hydrolysis that begins at the 5' end of the nucleotide chain and proceeds sequentially toward the 3' end of the nucleotide chain. 5' exonucleases include, but are not limited to, Xrn-1, and Terminator™ exonuclease.

[0027] As used herein, the term "5'-phosphate dependent exonuclease" refers to an exonuclease that digests polynucleotides having a 5' monophosphate proceeding from 5' to 3' (e.g., Terminator™ exonuclease and Xrn-1).

[0028] As used herein, the terms "circRNA," "circular polyribonucleotide," "circular RNA," and "circular polyribonucleotide molecule" are used interchangeably and refer to polyribonucleotide molecules having a structure with no free ends (i.e., no free 3' or 5' ends), e.g., polyribonucleotide molecules that form a circular or endless structure via covalent or non-covalent bonds.

[0029] As used herein, the term "circularization efficiency" is a measure of the resulting circular polyribonucleotide relative to its non-circular starting material.

[0030] As used herein, the terms "circRNA preparation," "circular polyribonucleotide preparation," and "circular RNA preparation" are used interchangeably and refer to a composition comprising a circRNA molecule and a diluent, carrier, first adjuvant, or combinations thereof.

[0031] As used herein, the term "digested mixture" refers to a mixture of linear and cyclic polyribonucleotides produced by contacting a mixture of linear and cyclic polyribonucleotides with a digestive enzyme (e.g., a 5' exonuclease or a 3' exonuclease).

[0032] As used herein, the terms "digestion buffer" and "digestion buffer" refer to a buffer in which a nuclease (e.g., an exonuclease) is active and digests at least a portion of a polynucleotide. A digestion buffer may contain a buffering agent, such as Mg 2+ , and / or dithiothreitol (DTT).

[0033] As used herein, the term "enriched population" refers to a population of polyribonucleotides that has a higher percentage of circular polyribonucleotides compared to another population of circular and linear polyribonucleotides.

[0034] As used herein, the terms "fragment" and "portion" refer to any portion of a polynucleotide molecule that is at least one nucleotide shorter than the polynucleotide molecule. For example, the nucleotide molecule may be a linear polyribonucleotide molecule, and the fragment may be a monoribonucleotide or any number of contiguous polyribonucleotides that are part of the linear polyribonucleotide molecule.

[0035] As used herein, the term "impurity" refers to an undesired substance present in a composition, e.g., a pharmaceutical composition described herein. In some embodiments, the impurity is a process-related impurity. In some embodiments, the impurity is a product-related substance other than the desired product in the final composition, e.g., an active drug component, e.g., a circular or linear polyribonucleotide described herein. As used herein, the term "process-related impurity" refers to a substance used, present, or produced in the manufacture of a composition, preparation, or product that is undesirable in the final composition, preparation, or product, other than the linear polyribonucleotide described herein. In some embodiments, the process-related impurity is an enzyme used in the synthesis or cyclization of polyribonucleotides. As used herein, the term "product-related substance" refers to a substance or by-product produced during the synthesis of a composition, preparation, or product, or any intermediate thereof. In some embodiments, the product-related substance is a deoxyribonucleotide fragment. In some embodiments, the product-related substance is a deoxyribonucleotide monomer. In some embodiments, the product-related material is a derivative or fragment of one or more of the polyribonucleotides described herein, e.g., fragments of 10, 9, 8, 7, 6, 5, or 4 ribonucleic acids, monoribonucleic acids, diribonucleic acids, or triribonucleic acids.

[0036] As used herein, the term "linear counterpart" refers to a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) and has two free ends (i.e., the non-cyclic form of a circular polyribonucleotide (and fragments thereof)). In some embodiments, a linear counterpart (e.g., a form prior to circularization) is a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) and the same or similar nucleic acid modifications as a circular polyribonucleotide and has two free ends (i.e., the non-cyclic form of a circular polyribonucleotide (and fragments thereof)). In some embodiments, the linear counterpart is a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as the circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) and a different nucleic acid modification, or has the same or similar nucleotide sequence as the circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) but no nucleic acid modification and has two free ends (i.e., a non-cyclic form of the circular polyribonucleotide (and fragments thereof)). In some embodiments, a fragment of a polyribonucleotide molecule that is a linear counterpart is any portion of the linear counterpart polyribonucleotide molecule that is shorter than the linear counterpart polyribonucleotide molecule. In some embodiments, the linear counterpart further comprises a 5' cap. In some embodiments, the linear counterpart further comprises a polyadenosine tail. In some embodiments, the linear counterpart further comprises a 3' UTR. In some embodiments, the linear counterpart further comprises a 5' UTR.

[0037] As used herein, the terms "linear RNA", "linear polyribonucleotide" and "linear polyribonucleotide molecule" are used interchangeably and refer to a polyribonucleotide molecule having a 5' and a 3' end. One or both of the 5' and 3' ends may be free ends or may be attached to another moiety. Linear RNA includes RNA that has not been circularized (e.g., not previously circularized) and can be used as starting material for circularization, for example, by splint ligation or chemical, enzymatic, ribozyme or splicing catalyst circularization methods.

[0038] As used herein, the term "mixture" refers to a material consisting of two or more different substances mixed together. In some cases, the mixtures described herein can be homogenous mixtures of two or more different substances, e.g., the mixtures can have the same proportions of its components (e.g., two or more substances) throughout any given sample of the mixture. In some cases, the mixtures provided herein can be heterogenous mixtures of two or more different substances, e.g., the proportions of the components (e.g., two or more substances) of the mixture can vary throughout the mixture. In some cases, the mixture comprises cyclic polyribonucleotides and linear polyribonucleotides. In some embodiments, the mixture can comprise cyclic polyribonucleotides, linear polyribonucleotides, and linear polydeoxyribonucleotides. In some cases, the mixture is a solution, e.g., the mixture exists in a liquid phase. In some cases, a liquid solution can be considered to comprise a liquid solvent and a solute. Mixing a solute into a liquid solvent can be referred to as a "dissolving" process. In some cases, the liquid solution is a solution containing a liquid in a liquid (e.g., a liquid solute dissolved in a liquid solvent), a solution containing a solid in a liquid (e.g., a solid solute dissolved in a liquid solvent), or a solution containing a gas in a liquid (e.g., a solid solute dissolved in a liquid solvent). In some cases, there are multiple solvents and / or multiple solutes. In some cases, the mixture is a colloid, liquid suspension, or emulsion. In some cases, the mixture is a solid mixture, e.g., the mixture exists in a solid phase.

[0039] As used herein, the term "modified ribonucleotide" means a nucleotide having at least one modification to the sugar, nucleobase, or internucleoside linkage.

[0040] As used herein, the term "polynucleotide" refers to a molecule that includes one or more nucleic acid subunits or nucleotides, and can be used interchangeably with "nucleic acid" or "oligonucleotide." A polynucleotide can include one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. A nucleotide can include a nucleoside and at least one, two, three, four, five, six, seven, eight, nine, ten, or more phosphate (PO3) groups. A nucleotide can include a nucleobase, a five-carbon sugar (either ribose or deoxyribose), and one or more phosphate groups. A ribonucleotide is a nucleotide in which the sugar is ribose. Polyribonucleotide or ribonucleic acid, or RNA, can refer to a polymer that includes multiple ribonucleotides polymerized through phosphodiester bonds. A deoxyribonucleotide is a nucleotide in which the sugar is deoxyribose.

[0041] Polydeoxyribonucleotide or deoxyribonucleic acid, or DNA, refers to a polymer comprising multiple deoxyribonucleotides polymerized via phosphodiester bonds. Nucleotides can be nucleoside monophosphates or nucleoside polyphosphates. Nucleotides refer to deoxyribonucleoside polyphosphates, such as deoxyribonucleoside triphosphates (dNTPs), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP), and deoxythymidine triphosphate (dTTP) dNTPs, including detectable tags (e.g., fluorophores), such as luminescent tags or markers. Nucleotides can include any subunit that can be incorporated into a growing nucleic acid chain. Such subunits may be A, C, G, T, or U, or any other subunits that are specific to one or more complementary A, C, G, T, or U, or that are complementary to purines (i.e., A or G, or variants thereof) or pyrimidines (i.e., C, T, or U, or variants thereof). In some instances, the polynucleotide is a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or a derivative or variant thereof. In some instances, the polynucleotide is a small interfering RNA (siRNA), a microRNA (miRNA), a plasmid DNA (pDNA), a small hairpin RNA (shRNA), a small nuclear RNA (snRNA), a messenger RNA (mRNA), a pre-mRNA (pre-mRNA), an antisense RNA (asRNA), to name a few, and includes both nucleotide sequences and any structural embodiment thereof, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some instances, the polynucleotide molecule is circular. The polynucleotide may have a variety of lengths. The nucleic acid molecule can have a length of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 50 kb, or more. Polynucleotides can be isolated from cells or tissues.As embodied herein, polynucleotide sequences can include isolated and purified DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogs.

[0042] A polynucleotide, such as a polyribonucleotide or polydeoxyribonucleotide, may include one or more nucleotide variants, including non-standard nucleotides, non-natural nucleotides, nucleotide analogs, and / or modified nucleotides, including, but not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5 ... These include methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxocine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. In some cases, nucleotides can include modifications of their phosphate moieties, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include longer phosphate chains (e.g., phosphate chains having 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications of the thiol moiety (e.g., α-thiotriphosphate and β-thiotriphosphate).Nucleic acid molecules can also be modified at the base moiety, sugar moiety, or phosphate backbone (e.g., at one or more atoms typically available to form hydrogen bonds with complementary nucleotides, and / or at one or more atoms typically not available to form hydrogen bonds with complementary nucleotides). Nucleic acid molecules can also include amine-modifying groups such as aminoallyl-dUTP (aa-dUTP) and aminohexylacrylamide-dCTP (aha-dCTP) to allow covalent attachment of amine-reactive moieties such as N-hydroxysuccinimide ester (NHS). Alternatives to standard DNA or RNA base pairs in the oligonucleotides of the present disclosure can provide high bit density per cubic mm, higher safety (resistance to accidental or deliberate synthesis of natural toxins), easier identification in photoprogrammed polymerases, or subsecondary structures. Such alternative base pairs compatible with native and mutant polymerases for de novo and / or amplicon synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. 2012 Jul;8(7):612-4, incorporated herein by reference for all purposes.

[0043] As used herein, the phrase "quasi-helical structure" refers to a higher order structure of a circular polyribonucleotide in which at least a portion of the circular polyribonucleotide is folded into a helical structure.

[0044] As used herein, the terms "total ribonucleotide molecules" and "total polyribonucleotides" refer to the total amount of any ribonucleotide molecules, including linear polyribonucleotide molecules, circular polyribonucleotide molecules, monomeric ribonucleotides, other polyribonucleotide molecules, fragments thereof, and modified versions thereof, as measured by the total mass of the ribonucleotide molecules.

[0045] As used herein, the term "units" refers to the amount of enzyme required to perform a defined catalytic activity under a specified method of assay, which are summarized for each enzyme in Table 1.

[0046] [Table 1] [Brief description of the drawings]

[0047] [Figure 1] 1 shows that the linear polyribonucleotide encoding gLuc is degraded after digestion with RNase R. [Diagram 2] 1 shows that the linear polyribonucleotide encoding gLuc is degraded following digestion with Terminator™ exonuclease. [Diagram 3] 1 shows that the linear polyribonucleotide encoding gLuc is degraded after digestion with Xrn-1. [Figure 4] We show that the combination of Terminator™ exonuclease and RNase R selectively degrades the linear polyribonucleotide encoding gLuc. [Diagram 5] 1 shows enrichment of circular polyribonucleotides in a post-ligation polyribonucleotide mixture using a combination of Terminator™ exonuclease and RNase R. [Figure 6] We show that simultaneous digestion with optimal concentrations of 5' and 3' exonucleases selectively degrades linear polyribonucleotides in the post-ligation polyribonucleotide mixture, generating an enriched circular polyribonucleotide preparation. [Figure 7] FIG. 1 shows the enrichment of circular polyribonucleotides using two different combinations of 5′ and 3′ exonucleases. [Figure 8]1 shows the results of digestion of a post-ligation polyribonucleotide mixture with a combination of Terminator™ exonuclease and RNase R in various buffers and corresponding buffer controls. [Figure 9] 1 shows the results of digestion of a post-ligation polyribonucleotide mixture with a combination of Xrn-1 and RNase R in various buffers and corresponding buffer controls. [Figure 10] 1 shows the results of digestion of a post-ligation polyribonucleotide mixture with a combination of Xrn-1 and RNase R in various buffers and corresponding buffer controls. [Figure 11] 1 shows in vitro expression of Gaussia luciferase from concentrated circular polyribonucleotides. [Figure 12] 1 shows the results of selective enrichment of circular polyribonucleotides of several different molecular weights. [Figure 13] The results of simultaneous digestion using several different combinations of 5' and 3' exonucleases are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0048] The present disclosure provides a method for producing an enriched population of circular polyribonucleotides. For example, using the compositions and methods described herein, an enriched population of circular polyribonucleotides may be produced by providing a polyribonucleotide population comprising circular polyribonucleotides and linear polyribonucleotides; digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease in an amount of 0.01U to 0.2U per 1 μg of polyribonucleotide; and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease in an amount of 0.4U to 4U per 1 μg of polyribonucleotide. The present disclosure also provides a method of making an enriched population of circular polyribonucleotides by providing a population of polyribonucleotides comprising circular polyribonucleotides and linear polyribonucleotides; digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease; and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease, the digesting step comprising administering to the subject a 5' exonuclease having 0.05 mM to 1 mM Mg 2+ wherein the digestion buffer comprises a step of:

[0049] A population of polyribonucleotides comprising circular and linear polyribonucleotides may be reacted with a 5' exonuclease and a 3' exonuclease at a concentration, time, and temperature sufficient to allow at least a portion of the linear polyribonucleotides to be digested.

[0050] Method for concentrating circular polyribonucleotides In one aspect, the present disclosure provides a method for producing an enriched population of circular polyribonucleotides. The method for enriching a polyribonucleotide population with respect to circular polyribonucleotides may include providing a polyribonucleotide population comprising circular polyribonucleotides and linear polyribonucleotides; digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease; and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease, thereby producing an enriched population of circular polyribonucleotides. The 5' exonuclease may be in an amount of 0.01 U to 0.25 U per μg of polyribonucleotide, and the 3' exonuclease may be in an amount of 0.4 U to 4 U per μg of polyribonucleotide.

[0051] In another aspect, the disclosure provides a method of making an enriched population of circular polyribonucleotides comprising: providing a population of polyribonucleotides comprising circular polyribonucleotides and linear polyribonucleotides; digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease; and digesting at least a portion of the linear polyribonucleotides with a 3' exonuclease, wherein the digestion buffer is free of Mg. 2+ and / or dithiothreitol (DTT); thereby producing an enriched population of circular polyribonucleotides.

[0052] Exonuclease digestion In one embodiment, a population of polyribonucleotides comprising circular and linear polyribonucleotides is reacted with a 5' exonuclease and a 3' exonuclease to produce an enriched population of circular polyribonucleotides.

[0053] In some embodiments, at least a portion of the linear polyribonucleotides are digested with a 5' exonuclease. In some embodiments, at least a portion of the linear polyribonucleotides are digested with a 3' exonuclease. In some embodiments, at least a portion of the linear polyribonucleotides are digested with a 5' exonuclease and then with a 3' exonuclease. In some embodiments, at least a portion of the linear polyribonucleotides are digested with a 3' exonuclease and then with a 5' exonuclease. In some embodiments, at least a portion of the linear polyribonucleotides are digested with a 5' exonuclease and then with a 3' exonuclease. In some embodiments, at least a portion of the linear polyribonucleotides are digested with a 5' exonuclease and then with a 3' exonuclease simultaneously.

[0054] In some embodiments, the 5' exonuclease is a 5'-phosphate dependent exonuclease (e.g., Xrn-1 or Terminator™ exonuclease). In some embodiments, the 5' exonuclease is Xrn-1. In some embodiments, the 5' exonuclease is Terminator™ exonuclease. In some embodiments, the 3' exonuclease is RNase R. In some embodiments, the 3' exonuclease is Exonuclease T. In some embodiments, the 3' exonuclease is RNase PH. In some embodiments, the 3' exonuclease is polynucleotide phosphorylase. In some embodiments, the 3' exonuclease is RNase D. In some embodiments, the 3' exonuclease is exoribonuclease II.

[0055] In some embodiments, the 5' exonuclease is in an amount of 0.01U to 0.2U (e.g., 0.01U to 0.16U, 0.01U to 0.12U, 0.01U to 0.0.8U, 0.01U to 0.04U, 0.01U to 0.02U, 0.01U to 0.012U, 0.02U to 0.2U, 0.04U to 0.2U, 0.0.08U to 0.2U, 0.12U to 0.2U, and 0.16U to 0.2U) per 1 μg of polyribonucleotide. In some embodiments, the 5' exonuclease is present in an amount of 0.012U to 0.1U (e.g., 0.012U to 0.08U, 0.012U to 0.06U, 0.012U to 0.04U, 0.012U to 0.02U, 0.02U to 0.1U, 0.04U to 0.1U, 0.06U to 0.1U, 0.08U to 0.1U) per μg of polyribonucleotide. In some embodiments, the 5' exonuclease is present in an amount of 0.025U per μg of polyribonucleotide.

[0056] In some embodiments, the 3' exonuclease is in an amount of 0.4U to 4U (e.g., 0.4U to 3.6U, 0.4U to 3.2U, 0.4U to 2.8U, 0.4U to 2.4U, 0.4U to 2U, 0.4U to 1.6U, 0.4U to 1.2U, 0.4U to 0.8U, 0.8U to 4U, 1.2U to 4U, 1.6U to 4U, 2U to 4U, 24U to 4U, 2.8U to 4U, 3.2U to 4U, 3.6U to 4U, and 0.4U to 0.6U) per μg of polyribonucleotide. In some embodiments, the 3' exonuclease is present in an amount of 0.4U to 2U (e.g., 0.4U to 1.8U, 0.4U to 1.6U, 0.4U to 1.4U, 0.4U to 1.2U, 0.4U to 1U, 0.4U to 0.8U, 0.4U to 0.6U, 0.6U to 2U, 0.8U to 2U, 1U to 2U, 1.2U to 2U, 1.4U to 2U, 1.6U to 2U, 1.8U to 2U) per μg of polyribonucleotide. In some embodiments, the 3' exonuclease is present in an amount of 0.5U per μg of polyribonucleotide.

[0057] In some embodiments, the ratio of the concentration of 5' exonuclease to the concentration of 3' exonuclease is 0.2 U 5' exonuclease to 4 U 3' exonuclease per μg of polyribonucleotide.

[0058] In some embodiments, the reaction of the 5' exonuclease with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out for at least 30 minutes (e.g., at least 35 minutes, at least 1 hour, at least 1.5 hours, at least 2 hours, at least 5 hours, at least 12 hours, or at least 24 hours). In some embodiments, the reaction of the 5' exonuclease with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out for 30 minutes to 90 minutes (e.g., 35 minutes to 90 minutes, 45 minutes to 90 minutes, 1 hour to 90 minutes, 30 minutes to 75 minutes, 30 minutes to 1 hour, 30 minutes to 45 minutes, or 30 minutes to 35 minutes). In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 5' exonuclease is carried out for 45 minutes to 60 minutes (e.g., 45 minutes to 55 minutes, 45 minutes to 50 minutes, 50 minutes to 60 minutes, and 55 minutes to 60 minutes).

[0059] In some embodiments, the reaction of the 3' exonuclease with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out for at least 30 minutes (e.g., at least 35 minutes, at least 1 hour, at least 1.5 hours, at least 2 hours, at least 5 hours, at least 12 hours, or at least 24 hours). In some embodiments, the reaction of the 5' exonuclease with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out for 30 minutes to 90 minutes (e.g., 35 minutes to 90 minutes, 45 minutes to 90 minutes, 1 hour to 90 minutes, 30 minutes to 75 minutes, 30 minutes to 1 hour, 30 minutes to 45 minutes, or 30 minutes to 35 minutes). In some embodiments, the digestion step of digesting at least a portion of the linear polyribonucleotide with a 3' exonuclease is carried out for 45 minutes to 60 minutes (e.g., 45 minutes to 55 minutes, 45 minutes to 50 minutes, 50 minutes to 60 minutes, and 55 minutes to 60 minutes).

[0060] In some embodiments, the 5' exonuclease reaction with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out at a temperature of 30°C to 42°C (e.g., about 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, and 41°C). In some embodiments, the 5' exonuclease reaction with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out at a temperature of about 37°C. In some embodiments, the 3' exonuclease reaction with the cyclic polyribonucleotide population comprising linear polyribonucleotides and cyclic polyribonucleotides is carried out at a temperature of 30°C to 42°C (e.g., about 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, and 41°C). In some embodiments, the reaction of the 3' exonuclease with the population of circular polyribonucleotides comprising linear polyribonucleotides and circular polyribonucleotides is carried out at a temperature of about 37°C.

[0061] Digestion buffer In one embodiment, a population of polyribonucleotides comprising circular and linear polyribonucleotides is reacted with a 5' exonuclease and a 3' exonuclease in a digestion buffer to produce an enriched population of circular polyribonucleotides.

[0062] In some embodiments, the digestion buffer contains 0.05 mM to 1 mM (e.g., 0.05 mM to 0.8 mM, 0.05 mM to 0.6 mM, 0.05 mM to 0.4 mM, 0.05 mM to 0.2 mM, 0.05 mM to 0.1 mM, 0.05 mM to 0.1 mM, 0.1 mM to 1 mM, 0.2 mM to 1 mM, 0.4 mM to 1 mM, 0.6 mM to 1 mM, and 0.8 mM to 1 mM) Mg. 2+ In some embodiments, the digestion buffer comprises 0.05 mM to 0.5 mM (e.g., 0.05 mM to 0.1 mM, 0.05 mM to 0.2 mM, 0.05 mM to 0.3 mM, 0.05 mM to 0.4 mM, 0.1 mM to 0.5 mM, 0.2 mM to 0.5 mM, 0.3 mM to 0.5 mM, and 0.4 mM to 0.5 mM) Mg. 2+ In some embodiments, the digestion buffer contains about 0.1 mM Mg 2+ In some embodiments, the digestion buffer contains about 0.5 mM Mg 2+ Contains Mg 2+ may be added to the digestion buffer as magnesium sulfate, magnesium chloride, magnesium lactate, magnesium citrate, magnesium carbonate, or any magnesium salt.

[0063] In some embodiments, the digestion buffer contains dithiothreitol (DTT), in which DTT has a concentration of 0.1 mM to 5 mM (e.g., 0.1 mM to 4 mM, 0.1 mM to 3 mM, 0.1 mM to 2 mM, 0.1 mM to 1 mM, 0.1 mM to 0.5 mM, 0.5 mM to 5 mM, 1 mM to 5 mM, 2 mM to 5 mM, 3 mM to 5 mM, or 4 mM to 5 mM) in the digestion buffer. In some embodiments, DTT has a concentration of 0.5 mM to 2 mM in the digestion buffer (e.g., 0.5 mM to 0.7 mM, 0.5 mM to 1 mM, 0.5 mM to 1.2 mM, 0.5 mM to 1.5 mM, 0.5 mM to 1.7 mM, 1.7 mM to 2 mM, 1.5 mM to 2 mM, 1.2 mM to 2 mM, 1 mM to 2 mM, or 0.8 mM to 2 mM). In some embodiments, DTT has a concentration of 1 mM in the digestion buffer.

[0064] In some embodiments, the digestion buffer comprises NaCl. In some embodiments, the digestion buffer comprises 10 mM to 1M NaCl; for example, the digestion buffer may comprise 10 mM to 900 mM, 10 mM to 700 mM, 10 mM to 500 mM, 10 mM to 200 mM, 10 mM to 100 mM, 10 mM to 50 mM, 50 mM to 1M, 100 mM to 1M, 200 mM to 1M, 500 mM to 1M, or 700 mM to 1M NaCl. In some embodiments, the digestion buffer comprises 10 mM to 200 mM NaCl. In some embodiments, the digestion buffer comprises 100 mM NaCl.

[0065] In some embodiments, the digestion buffer comprises a buffering agent. In some embodiments, the buffering agent comprises Tris-HCl, Tris base, HEPES, phosphate buffered saline (PBS), or a combination thereof. For example, the buffering agent may be Tris-HCl. In some embodiments, the digestion buffer comprises 10 mM and 1 M of a buffering agent; for example, the digestion buffer may comprise 10 mM to 900 mM, 10 mM to 700 mM, 10 mM to 500 mM, 10 mM to 200 mM, 10 mM to 100 mM, 10 mM to 50 mM, 50 mM to 1 M, 100 mM to 1 M, 200 mM to 1 M, 500 mM to 1 M, or 700 mM to 1 M of a buffering agent. In some embodiments, the digestion buffer comprises 10 mM and 500 mM of a buffering agent; for example, the digestion buffer may comprise 10 mM to 40 mM, 10 mM to 400 mM, 10 mM to 350 mM, 10 mM to 300 mM, 10 mM to 250 mM, 10 mM to 200 mM, 10 mM to 150 mM, 10 mM to 100 mM, 10 mM to 50 mM, 50 mM to 500 mM, 100 mM to 500 mM, 150 mM to 500 mM, 200 mM to 500 mM, 250 mM to 500 mM, 300 mM to 500 mM, 350 mM to 500 mM, 400 mM to 500 mM, and 450 mM to 500 mM. In some embodiments, the digestion buffer comprises 50 mM buffering agent.

[0066] In some embodiments, the digestion buffer has a pH of 6 to 8. For example, the pH of the digestion buffer may be 6 to 7.8, 6 to 7.5, 6 to 7.2, 6 to 7, 6 to 6.8, 6 to 6.5, 6 to 6.3, 6.3 to 8, 6.5 to 8, 6.8 to 8, 7 to 8, 7.3 to 8, 7.5 to 8, and 7.8 to 8.

[0067] Enriched population of circular polyribonucleotides In some embodiments, after digestion with the 5' exonuclease and the 3' exonuclease, the percentage (w / w) of circular polyribonucleotides is between 40% and 95% (e.g., between 40% and 90%, between 40% and 80%, between 40% and 70%, between 40% and 60%, between 40% and 50%, between 50% and 95%, between 60% and 95%, between 70% and 95%, between 80% and 95%, or between 90% and 95%) of the total polynucleotide. In some embodiments, after digestion with a 5' exonuclease and a 3' exonuclease, the percentage (w / w) of cyclic polyribonucleotides is 60%-90% (e.g., 60%-85%, 60%-80%, 60%-75%, 60%-70%, 60%-65%, 65%-90%, 70%-90%, 75%-90%, 80%-90%, or 85%-90%) of the total polynucleotide. In some embodiments, after digestion with a 5' exonuclease and a 3' exonuclease, the percentage (w / w) of cyclic polyribonucleotides is 70%-90% (e.g., 70%-90%, 70%-85%, 70%-80%, 70%-75%, 75%-90%, 80%-90%, or 85%-90%) of the total polynucleotide. In some embodiments, after digestion with the 5' exonuclease and the 3' exonuclease, the total percent yield (w / w) of cyclic polyribonucleotide is between 60% and 100%; for example, the total percent yield (w / w) of cyclic polyribonucleotide is between 60% and 95%, 60% and 90%, 60% and 85%, 60% and 80%, 60% and 75%, 60% and 70%, 60% and 65%, 65% and 100%, 70% and 100%, 75% and 100%, 80% and 100%, 85% and 100%, 90% and 100%, and 95% and 100%. In some embodiments, the total percent yield (w / w) of cyclic polyribonucleotide is between 70% and 100%; for example, the percent yield (w / w) of cyclic polyribonucleotide is between 70% and 95%, 70% and 90%, 70% and 85%, 70% and 80%, 70% and 75%, 75% and 100%, 80% and 100%, 85% and 100%, 90% and 100%, and 95% and 100%.In some embodiments, the total percent yield (w / w) of cyclic polyribonucleotide is between 80% and 100%; for example, the total percent yield (w / w) of cyclic polyribonucleotide is between 80% and 95%, between 80% and 90%, between 80% and 85%, between 85% and 100%, between 90% and 100%, and between 95% and 100%.

[0068] Circular Polyribonucleotides The present disclosure provides a population of circular polyribonucleotides that may be enriched from a mixture of circular and linear polyribonucleotides.

[0069] In some embodiments, the cyclic polyribonucleotide comprises one or more of the elements as described herein. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence (e.g., lacks a polyA sequence at the 3' end of the ORF), lacks a free 3' end, lacks an RNA polymerase recognition motif, or any combination thereof. In some embodiments, the cyclic polyribonucleotide comprises any feature, or any combination of features, as disclosed in WO 2019 / 118919 (hereby incorporated by reference in its entirety).

[0070] In some embodiments, a polyribonucleotide (e.g., a cyclic polyribonucleotide) is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments, the polyribonucleotide (eg, a cyclic polyribonucleotide) is less than 1.2 kb, between 1.2 and 1.4 kb, between 1.4 and 1.6 kb, between 3.5 and 4.5 kb, between 4.5 and 5.4 kb, or greater than 5.4 kb.

[0071] In some embodiments, polyribonucleotides (e.g., cyclic polyribonucleotides) may be of sufficient size to accommodate the binding site of a ribosome. In some embodiments, the maximum size of a cyclic polyribonucleotide may be within the technical constraints of generating and / or using a cyclic polyribonucleotide. Without wishing to be bound by a particular theory, multiple segments of RNA may be generated from DNA and their 5' and 3' free ends may be annealed to generate a "string" of RNA, which may eventually be circularized to leave only one 5' free end and one 3' free end. In some embodiments, the maximum size of a cyclic polyribonucleotide may be limited by the ability to package and deliver RNA to a target. In some embodiments, the size of the circular polyribonucleotide is sufficient to encode a useful polypeptide, and thus lengths of at least 20,000 nucleotides, at least 15,000 nucleotides, at least 10,000 nucleotides, at least 7,500 nucleotides, or at least 5,000 nucleotides, at least 4,000 nucleotides, at least 3,000 nucleotides, at least 2,000 nucleotides, at least 1,000 nucleotides, at least 500 nucleotides, at least 400 nucleotides, at least 300 nucleotides, at least 200 nucleotides, at least 100 nucleotides, or at least 70 nucleotides may be useful.

[0072] In some embodiments, the cyclic polyribonucleotide lacks susceptibility to degradation by exonucleases. In some embodiments, the fact that the cyclic polyribonucleotide lacks susceptibility to degradation can mean that the cyclic polyribonucleotide is not degraded by exonucleases or is degraded to a limited extent in the presence of exonucleases, for example to an extent equivalent or similar to that in the absence of exonucleases. In some embodiments, the cyclic polyribonucleotide is not degraded by exonucleases. In some embodiments, the cyclic polyribonucleotide has reduced degradation when exposed to exonucleases. In some embodiments, the cyclic polyribonucleotide lacks binding to cap-binding proteins. In some embodiments, the cyclic polyribonucleotide lacks a 5' cap.

[0073] Expression sequence In some embodiments, the cyclic polyribonucleotide comprises an expressed sequence encoding a peptide or polypeptide. In some embodiments, the cyclic polyribonucleotide comprises at least one expressed sequence encoding a peptide or polypeptide. Such peptides may include, but are not limited to, small peptides, peptidomimetics (e.g., peptoids), amino acids, and amino acid analogs. The peptides may be linear or branched. Such peptides may have a molecular weight of less than about 5,000 grams per mole, less than about 2,000 grams per mole, less than about 1,000 grams per mole, less than about 500 grams per mole, as well as salts, esters, and other pharma- ceutically acceptable forms of such compounds. Such peptides may include, but are not limited to, neurotransmitters, hormones, drugs, toxins, viral or microbial particles, synthetic molecules, and agonists or antagonists thereof.

[0074] The encoded polypeptide may have a length of about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, polypeptides having a length of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less may be useful.

[0075] Polypeptides may be produced in substantial quantities. Thus, the polypeptides may be any proteinaceous molecule that can be produced. The polypeptides may be polypeptides that can be secreted from cells or that can be localized in the cytoplasm, nucleus, or membrane components of cells. Some polypeptides include, but are not limited to, at least a portion of a viral envelope protein, metabolic regulatory enzymes (e.g., those that regulate lipid or steroid production), antigens, cytokines, toxins, enzymes whose absence is associated with disease, and polypeptides that are not active in animals (e.g., in the intestine of animals) until cleaved, and hormones.

[0076] In some embodiments, the cyclic polyribonucleotide comprises an expression sequence that encodes a protein, e.g., a therapeutic protein. In some embodiments, the therapeutic protein that can be expressed from the cyclic polyribonucleotide disclosed herein has antioxidant activity, binding, cargo receptor activity, catalytic activity, molecular carrier activity, molecular function regulator activity, molecular transporter activity, nutrient storage activity, protein tag, structural molecule activity, toxin activity, transcription regulator activity, translation regulator activity, or transporter activity. Some examples of therapeutic proteins can include, but are not limited to, enzyme replacement proteins, replenishing proteins, protein vaccinations, antigens (e.g., tumor antigens, viral antigens, bacterial antigens), hormones, cytokines, antibodies, immunotherapy (e.g., cancer), cell reprogramming / transdifferentiation factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (e.g., affecting immune response / sensitivity to signals), regulated death effector proteins (e.g., inducers of apoptosis or necrosis), non-lytic inhibitors of tumors (e.g., inhibitors of oncoproteins), epigenetic modifiers, epigenetic enzymes, transcription factors, DNA or protein modifying enzymes, DNA intercalators, efflux pump inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, competitive inhibitors of enzymes, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains, ligands or receptors, and CRISPR systems or components thereof.

[0077] In some embodiments, exemplary proteins that may be expressed from the cyclic polyribonucleotides disclosed herein include human proteins, such as receptor binding proteins, hormones, growth factors, growth factor receptor regulators, and regenerative proteins (e.g., proteins implicated in proliferation and differentiation, e.g., therapeutic proteins for wound healing). In some embodiments, exemplary proteins that may be expressed from the cyclic polyribonucleotides disclosed herein include EGF (epidermal growth factor). In some embodiments, exemplary proteins that may be expressed from the cyclic polyribonucleotides disclosed herein include enzymes, such as oxidoreductase enzymes, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, and desaturases. In some embodiments, exemplary proteins that may be expressed from the cyclic polyribonucleotides disclosed herein include intracellular or cytoplasmic proteins. In some embodiments, the cyclic polyribonucleotide expresses NanoLuc® luciferase (nLuc). In some embodiments, exemplary proteins that may be expressed from the cyclic polyribonucleotides disclosed herein include secretory proteins, such as secretory enzymes. In some cases, the cyclic polyribonucleotides express secretory proteins that may have therapeutic agents with short half-lives in the blood or may be proteins with intracellular localization signals or proteins with secretory signal peptides. In some embodiments, the cyclic polyribonucleotides express Gaussia luciferase (gLuc). In some cases, the cyclic polyribonucleotides express non-human proteins, such as fluorescent proteins, energy transfer acceptors, or protein tags, such as Flag, Myc, or His. In some embodiments, exemplary proteins that may be expressed from the cyclic polyribonucleotides include GFP.In some embodiments, the circular polyribonucleotide expresses a tagged protein, e.g., a fusion protein or an engineered protein comprising a protein tag, e.g., chitin binding protein (CBP), maltose binding protein (MBP), Fc tag, glutathione-S-transferase (GST), AviTag, calmodulin tag, polyglutamate tag; E-tag, FLAG tag), HA tag, His tag, Myc tag, NE tag, S tag, SBP tag, Softag 1, Softag 3, Spot tag, Strep tag; TC tag, Ty tag, V5 tag; VSV tag; or Xpress tag.

[0078] In some embodiments, the cyclic polyribonucleotide encodes the expression of an antibody, such as an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the cyclic polyribonucleotide can be of any isotype, such as IgA, IgD, IgE, IgG, IgM, etc. In some embodiments, the cyclic polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, or further portions thereof. In some embodiments, the cyclic polyribonucleotide expresses one or more portions of an antibody. For example, the cyclic polyribonucleotide can include two or more expression sequences, each of which expresses a portion of an antibody, and which together can constitute an antibody. In some cases, the cyclic polyribonucleotide includes one expression sequence that encodes a heavy chain of the antibody and another expression sequence that encodes a light chain of the antibody. In some cases, when the cyclic polyribonucleotide is expressed in a cell or in a cell-free environment, the light and heavy chains can be subjected to appropriate modification, folding, or other post-translational modifications to form a functional antibody.

[0079] Adjustment element The circular polyribonucleotide or polyribonucleotide comprises a regulatory element, e.g., a sequence that regulates the expression of an expression sequence within the circular polyribonucleotide. The regulatory element may comprise a sequence located adjacent to the expression sequence that encodes the expression product. The regulatory element may be operably linked to the adjacent sequence. The regulatory element may increase the amount of the expressed product compared to the amount of the product expressed in the absence of the regulatory element. A regulatory element may be used to increase the expression of one or more polypeptides encoded by the circular polyribonucleotide. Similarly, a regulatory element may be used to decrease the expression of one or more polypeptides encoded by the circular polyribonucleotide. In some embodiments, a regulatory element may be used to increase the expression of a polypeptide and another regulatory element may be used to decrease the expression of another polypeptide for the same circular polyribonucleotide. Furthermore, a regulatory element may increase the amount of the expressed product (e.g., polypeptide) for multiple expression sequences linked side by side. Thus, a regulatory element may promote the expression of one or more expression sequences (e.g., polypeptides). Multiple regulatory elements may also be used, e.g., to differentially regulate the expression of different expression sequences. In some embodiments, the regulatory element provided herein may include a selective translation sequence. As used herein, the term "selective translation sequence" refers to a nucleic acid sequence that selectively initiates or activates the translation of an expression sequence in a circular polyribonucleotide, such as a specific riboswitch aptazyme. The regulatory element may also include a selective degradation sequence. As used herein, the term "selective degradation sequence" refers to a nucleic acid sequence that initiates the degradation of a circular polyribonucleotide or an expression product of a circular polyribonucleotide. In some embodiments, the regulatory element is a translation modulator. A translation modulator may regulate the translation of an expression sequence in a circular polyribonucleotide. A translation modulator may be a translation enhancer or suppressor. In some embodiments, a translation initiation sequence may function as a regulatory element.Further examples of regulatory elements are described in paragraphs

[0154] to

[0161] of International Publication No. 2019 / 118919, the entirety of which is incorporated herein by reference.

[0080] It is known that the nucleotides adjacent to the codon that initiates translation, including but not limited to the initiation codon or alternative initiation codon, affect the translation efficiency, length, and / or structure of the circular polyribonucleotide (see, for example, Matsuda and Mauro PLoS ONE, 2010 5:11, the contents of which are incorporated herein by reference in their entirety). Masking any of the nucleotides adjacent to the codon that initiates translation may be used to alter the position of the translation initiation, translation efficiency, length, and / or structure of the circular polyribonucleotide.

[0081] In one embodiment, a masking agent may be used near the start codon or an alternative start codon to mask or hide the codon and reduce the probability of translation initiation at the masked or alternative start codon. In another embodiment, a masking agent may be used to mask the start codon of the circular polyribonucleotide to increase the likelihood that translation will initiate at the alternative start codon.

[0082] Translation initiation sequence In some embodiments, the circular polyribonucleotide encodes a polypeptide and includes a translation initiation sequence, e.g., a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the translation initiation sequence includes a Kozak sequence. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the circular polyribonucleotide includes a translation initiation sequence, e.g., a Kozak sequence, adjacent to an expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, a translation initiation sequence, e.g., a Kozak sequence, is present on one or both sides of each expression sequence, resulting in separation of the expression products. In some embodiments, the circular polyribonucleotide includes at least one translation initiation sequence adjacent to an expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the circular polyribonucleotide. In some embodiments, the translation initiation sequence is within a substantially single-stranded region of the circular polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs

[0163] to

[0165] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0083] A circular polyribonucleotide may include two or more start codons, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60 or more than 60 start codons. Translation may begin at the first start codon or may begin downstream of the first start codon.

[0084] In some embodiments, the circular polyribonucleotide may start at the first initiation codon, for example, a codon that is not AUG. Translation of the circular polyribonucleotide may start at an alternative translation initiation sequence, such as those described in International Patent Publication WO 2019 / 118919 (incorporated herein by reference in its entirety)

[0164] .

[0085] In some embodiments, translation is initiated by processing of eukaryotic initiation factor 4A (eIF4A) with RocAglate (translation is suppressed by blocking 43S scanning, causing premature upstream translation initiation and reduced protein expression from transcripts with RocA-eIF4A target sequences, see, e.g., www.nature.com / articles / nature17978).

[0086] Stagger Element The circular polyribonucleotide of the present disclosure may include a cleavage domain (e.g., a stagger element or cleavage sequence). The term "stagger element" refers to a portion, such as a nucleotide sequence, that induces pausing of the ribosome during translation. In some embodiments, the stagger element is a non-conserved sequence of amino acids with strong alpha-helical propensity, followed by the consensus sequence -D(V / I)ExNPGP (SEQ ID NO:2), where x=any amino acid. In some embodiments, the stagger element may include a chemical moiety, such as glycerol, a non-nucleic acid linking moiety, a chemical modification, a modified nucleic acid, or any combination thereof.

[0087] In some embodiments, the circular polyribonucleotide comprises at least one stagger element adjacent to the expressed sequence. In some embodiments, the stagger element is present on one or both sides of each expressed sequence, resulting in separation of the expression products. In some embodiments, the stagger element is part of one or more expressed sequences. In some embodiments, the circular polyribonucleotide comprises one or more expressed sequences, each of the one or more expressed sequences being separated from the subsequent expressed sequence. In some embodiments, the stagger element prevents the generation of a single polypeptide from (a) two translations of a single expressed sequence, or (b) one or more translations of two or more expressed sequences. In some embodiments, the stagger element is a sequence separated from one or more expressed sequences. In some embodiments, the stagger element comprises a portion of an expressed sequence of one or more expressed sequences.

[0088] Examples of stagger elements are described in paragraphs

[0172] to

[0175] of International Publication No. WO 2019 / 118919, the entirety of which is incorporated herein by reference.

[0089] To avoid the production of continuous expression products while maintaining rolling circle translation, a stagger element may be included to induce ribosome stalling during translation. In some embodiments, the stagger element is at the 3' end of at least one of the expression sequences or sequences. The stagger element may be designed to stall the ribosome during rolling circle translation of the circular polyribonucleotide. The stagger element may include, but is not limited to, a 2A-like or CHYSEL (cis-acting hydrolase element) sequence. In some embodiments, the stagger element encodes a sequence with a C-terminal consensus sequence of X1X2X3EX5NPGP (SEQ ID NO: 22), where X1 is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid. In some embodiments, the sequence contains a non-conserved sequence of amino acids with strong alpha-helical character followed by the consensus sequence -D(V / I)ExNPGP (SEQ ID NO:2), where x=any amino acid. Some non-limiting examples of stagger elements include GDVESNPGP (SEQ ID NO:3), GDIEENPGP (SEQ ID NO:4), VEPNPGP (SEQ ID NO:5), IETNPGP (SEQ ID NO:6), GDIESNPGP (SEQ ID NO:7), GDVELNPGP (SEQ ID NO:8), GDIETNPGP (SEQ ID NO:9), GDVENPGP (SEQ ID NO:10), GDVEENPGP (SEQ ID NO:11), GDVEQNPGP (SEQ ID NO:12), IESNPGP (SEQ ID NO:13), GDIELNPGP (SEQ ID NO:14), HDIETPGP (SEQ ID NO:15), HDVETNPGP (SEQ ID NO:16), HDVEMNPGP (SEQ ID NO:17), GDMESNPGP (SEQ ID NO:18), GDVETNPGP (SEQ ID NO:19), GDIEQNPGP (SEQ ID NO:20), and DSEFNPGP (SEQ ID NO:21).

[0090] In some embodiments, the stagger elements described herein cleave the expression product, such as between the G and P of the consensus sequences described herein. As one non-limiting example, the cyclic polyribonucleotide comprises at least one stagger element for cleaving the expression product. In some embodiments, the cyclic polyribonucleotide comprises a stagger element adjacent to at least one expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element after each expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element present on one or both sides of each expressed sequence to cause translation of individual peptides and / or polypeptides from each expressed sequence.

[0091] In some embodiments, the stagger element comprises one or more modified or non-natural nucleotides that induce ribosome stalling during translation. Non-natural nucleotides may include peptide nucleic acids (PNAs), morpholinos and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Examples such as these are distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule. Modifications may include any modification to the sugar, nucleobase, internucleoside bond (e.g., linking phosphate / phosphodiester bond / phosphodiester backbone), and any combination thereof, that may induce ribosome stalling during translation. Some of the exemplary modifications provided herein are described elsewhere herein.

[0092] In some embodiments, the stagger element is present in other forms in the circular polyribonucleotide. For example, in some exemplary circular polyribonucleotides, the stagger element comprises a termination sequence of the first expressed sequence in the circular polyribonucleotide and a nucleotide spacer sequence that separates the termination sequence from the first translation initiation sequence of the expression contiguous to the first expressed sequence. In some examples, the first stagger element of the first expressed sequence is present upstream (5' to) the first translation initiation sequence of the expression contiguous to the first expressed sequence in the circular polyribonucleotide. In some cases, the first expressed sequence and the expression sequence contiguous to the first expressed sequence are two separate expressed sequences in the circular polyribonucleotide. The distance between the first stagger element and the first translation initiation sequence may allow for the contiguous translation of the first expressed sequence and the contiguous expressed sequence. In some embodiments, the first stagger element comprises a termination sequence and separates the expression product of the first expressed sequence from the expression product of the contiguous expressed sequence, thereby creating a separate expression product. In some cases, a circular polyribonucleotide that includes a first stagger element upstream of a first translation initiation sequence of a contiguous sequence in the circular polyribonucleotide is continuously translated, while a corresponding circular polyribonucleotide that includes a stagger element of a second expressed sequence that is upstream of a second translation initiation sequence of a contiguous expressed sequence in the second expressed sequence is not continuously translated. In some cases, there is only one expressed sequence in the circular polyribonucleotide, and the first expressed sequence and the contiguous expressed sequence are the same expressed sequence. In some exemplary circular polyribonucleotides, the stagger element includes a first termination sequence of the first expressed sequence in the circular polyribonucleotide and a nucleotide spacer sequence that separates the termination sequence from the downstream translation initiation sequence. In some such examples, the first stagger element is upstream (5' to) the first translation initiation sequence of the first expressed sequence in the circular polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation sequence allows for continuous translation of the first expressed sequence and any contiguous expressed sequences.In some embodiments, the first stagger element separates the first expression product of the first expression sequence from the next expression product of the first expression sequence, thereby creating separate expression products. In some cases, a circular polyribonucleotide that includes a first stagger element upstream of a first translation initiation sequence of a first expression sequence in a circular polyribonucleotide is continuously translated, while a corresponding circular polyribonucleotide that includes a stagger element upstream of a second translation initiation sequence of a second expression sequence in a corresponding circular polyribonucleotide is not continuously translated. In some cases, the distance between the second stagger element and the second translation initiation sequence is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold greater in the corresponding circular polyribonucleotide than the distance between the first stagger element and the first translation initiation sequence in the circular polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation sequence is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or more. In some embodiments, the distance between the second stagger element and the second translation initiation sequence is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or more, greater than the distance between the first stagger element and the first translation initiation sequence. In some embodiments, the circular polyribonucleotide comprises two or more expressed sequences.

[0093] IRES In some embodiments, the circular polyribonucleotides described herein include an internal ribosome entry site (IRES) element. In some embodiments, the circular polyribonucleotides described herein include two or more (e.g., 2, 3, 4, and 5) internal ribosome entry site (IRES) elements. In some embodiments, the circular polyribonucleotides include one or more IRES sequences on one or both sides of each expressed sequence, leading to the separation of the resulting peptide(s) and / or polypeptide(s). In some embodiments, an IRES flanks at least one (e.g., 2, 3, 4, 5, or more) expressed sequence on both sides. A suitable IRES element for inclusion in a circular polyribonucleotide can be an RNA sequence capable of associating with a eukaryotic ribosome. In some embodiments, the IRES is an encephalomyocarditis virus (EMCV) IRES. In some embodiments, the IRES is a coxsackievirus (CVB3) IRES. Further examples of IRES are described in paragraphs

[0166] to

[0168] of WO 2019 / 118919 (hereby incorporated by reference in its entirety). In some embodiments, the circular polyribonucleotide lacks an internal ribosome entry site. In some embodiments, the circular polyribonucleotide lacks an internal ribosome entry site and is competent for protein expression from its one or more expression sequences.

[0094] translation In some embodiments, once the translation of the circular polyribonucleotide is initiated, the ribosome bound to the circular polyribonucleotide does not leave the circular polyribonucleotide before completing at least one translation of the circular polyribonucleotide.In some embodiments, the circular polyribonucleotide described herein is capable of rolling circle translation. In some embodiments, during rolling circle translation, once translation of a circular polyribonucleotide is initiated, a ribosome bound to the circular polyribonucleotide does not detach from the circular polyribonucleotide before completing translation of the circular polyribonucleotide at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 5000, at least 10000, at least 105, or at least 106.

[0095] In some embodiments, the rolling circle translation of the cyclic polyribonucleotide results in the production of polypeptide products ("contiguous" expression products) that are translated from two or more translations of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide includes a staggered element, and the rolling circle translation of the cyclic polyribonucleotide results in the production of polypeptide products ("distinct" expression products) that are generated from one translation or less than one translation of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide is configured such that at least 10%, 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the total polypeptides (mol / mol) generated during the rolling circle translation of the cyclic polyribonucleotide are distinct polypeptides. In some embodiments, the cyclic polyribonucleotide is designed such that at least 99% of the total polypeptides are distinct polypeptides. In some embodiments, the amount ratio of the distinct products across the entire polypeptide is tested in an in vitro translation system. In some embodiments, the in vitro translation system used to test the amount ratio comprises rabbit reticulocyte lysate. In some embodiments, the amount ratio is tested in an in vivo translation system, such as eukaryotic or prokaryotic cells, cultured cells, or cells within an organism.

[0096] Untranslated Regions In some embodiments, the circular polyribonucleotide comprises an untranslated region (UTR). The UTR of a genomic region that comprises a gene may be transcribed but not translated. In some embodiments, the UTR may be included upstream of the translation initiation sequence of the expression sequence described herein. In some embodiments, the UTR may be included downstream of the expression sequence described herein. In some cases, one UTR for a first expression sequence is the same as or contiguous with or overlaps with another UTR for a second expression sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, such as ZKSCAN1.

[0097] In some embodiments, the cyclic polyribonucleotide comprises a UTR that contains one or more stretches of adenosines and uridines. These AU-rich signatures may increase the turnover rate of the expression product.

[0098] The introduction, removal, or modification of AU-rich elements (AREs) in the UTRs can be useful for modulating the stability or immunogenicity (e.g., the level of one or more markers of immune or inflammatory response) of a cyclic polyribonucleotide. When modifying a particular cyclic polyribonucleotide, one or more copies of an ARE may be introduced into the cyclic polyribonucleotide, and the copies of the ARE may modulate the translation and / or production of the expression product. Similarly, AREs can be identified and removed or modified into a cyclic polyribonucleotide to modulate the intracellular stability, which in turn affects the translation and production of the resulting protein.

[0099] It should be understood that any UTR from any gene may be incorporated into each flanking region of the circular polyribonucleotide. Exemplary untranslated regions are described in paragraphs

[0197] to

[0201] of International Publication No. WO 2019 / 118919 (hereby incorporated by reference in its entirety).

[0100] In some embodiments, the cyclic polyribonucleotide lacks a 5'-UTR and is competent for protein expression from its one or more expression sequences. In some embodiments, the cyclic polyribonucleotide lacks a 3'-UTR and is competent for protein expression from its one or more expression sequences. In some embodiments, the cyclic polyribonucleotide lacks a 5'-UTR. In some embodiments, the cyclic polyribonucleotide lacks a 3'-UTR. In some embodiments, the cyclic polyribonucleotide lacks a termination element and is competent for protein expression from its one or more expression sequences. In some embodiments, the cyclic polyribonucleotide lacks an internal ribosome entry site and is competent for protein expression from its one or more expression sequences. In some embodiments, the cyclic polyribonucleotide lacks a cap and is competent for protein expression from its one or more expression sequences. In some embodiments, the cyclic polyribonucleotide lacks a 5'UTR, a 3'UTR, and an IRES and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding an exogenous gene, a sequence encoding a therapeutic, a regulatory element (e.g., a translation modulator, e.g., a translation enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids (e.g., siRNAs, lncRNAs, shRNAs) targeting an endogenous gene, and a sequence encoding a therapeutic mRNA or protein.

[0101] terminating element A circular polyribonucleotide may include one or more expression sequences, each of which may or may not have a termination element. Further examples of termination elements are described in paragraphs

[0169] to

[0170] of WO 2019 / 118919 (hereby incorporated by reference in its entirety).

[0102] In some embodiments, the circular polyribonucleotide comprises a polyA sequence. In some embodiments, the length of the polyA sequence is greater than 10 nucleotides. In one embodiment, the polyA sequence is greater than 15 nucleotides in length (e.g., at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides or more). In some embodiments, the polyA sequence is designed according to the description of the polyA sequence in

[0202] to

[0204] of WO 2019 / 118919 (incorporated herein by reference in its entirety). In some embodiments, the circular polyribonucleotide lacks a polyA sequence (e.g., lacks a polyA sequence at the 3' end of the ORF). In some embodiments, the circular polyribonucleotide lacks a termination element. In some embodiments, the circular polyribonucleotide lacks a polyA sequence (e.g., lacks a polyA sequence at the 3' end of the ORF) and is competent for protein expression from its one or more expression sequences.

[0103] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and the expression sequences lack a termination element, and therefore the circular polyribonucleotide is translated continuously. Removal of the termination element may result in rolling circle translation or continuous expression of expression products, e.g., peptides or polypeptides, since there is no ribosome stalling or shedding. In such embodiments, the rolling circle translation expresses consecutive expression products through each expression sequence. In some other embodiments, the termination element of the expression sequence may be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide comprise a termination element. However, rolling circle translation in the circular polyribonucleotide or expression of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences is performed. In such examples, translation may terminate when the ribosome encounters a termination element, e.g., a stop codon, causing the ribosome to fall off the expression product. In some embodiments, translation terminates while the ribosome, eg, at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.

[0104] In some embodiments, the circular polyribonucleotide comprises a termination element at the end of one or more expressed sequences. In some embodiments, one or more expressed sequences comprise two or more termination elements in succession. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome is completely released from association with the circular polyribonucleotide. In some such embodiments, production of the subsequent (e.g., second, third, fourth, fifth, etc.) expressed sequences in the circular polyribonucleotide may require the ribosome to reassociate with the circular polyribonucleotide before translation begins. Generally, termination elements include in-frame nucleotide triplets, such as UAA, UGA, UAG, that signal the termination of translation. In some embodiments, one or more termination elements in the circular polyribonucleotide are frame-shifted termination elements that may terminate translation, including, but not limited to, off-frame or -1 and +1 shifted reading frames (e.g., cryptic stops). Frameshifted termination elements include the nucleotide triplets TAA, TAG, and TGA, which appear in the second and third reading frames of an expressed sequence. Frameshifted termination elements can be important in preventing misreading of mRNA, which is often harmful to the cell.

[0105] RNA binding site In some embodiments, the cyclic polyribonucleotide comprises one or more target RNA binding sites. In some embodiments, the cyclic polyribonucleotide comprises a target RNA binding site that modulates the expression of endogenous and / or exogenous genes. In some embodiments, the target RNA binding site regulates the expression of a host gene. The target RNA binding site may comprise a sequence that hybridizes to an endogenous gene (e.g., a sequence for miRNA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, gRNA as described herein), a sequence that hybridizes to an exogenous nucleic acid such as viral DNA or RNA, a sequence that hybridizes to RNA, a sequence that interferes with gene transcription, a sequence that interferes with RNA translation, a sequence that stabilizes RNA or destabilizes RNA, such as by targeting degradation, or a sequence that regulates DNA binding or RNA binding factors. In some embodiments, the cyclic polyribonucleotide comprises a target aptamer sequence that binds to RNA. The target aptamer sequence can bind to an endogenous gene (e.g., a sequence for miRNA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, gRNA as described herein), bind to an exogenous nucleic acid such as a viral DNA or RNA, bind to an RNA, bind to a sequence that interferes with gene transcription, bind to a sequence that interferes with RNA translation, bind to a sequence that stabilizes or destabilizes RNA, such as by targeting degradation, or bind to a sequence that regulates a DNA-binding or RNA-binding factor. The secondary structure of the target aptamer sequence can bind to an RNA. A circular RNA can form a complex with an RNA by the binding of the target aptamer sequence to the RNA.

[0106] In some embodiments, the target RNA binding site can be one of tRNA, lncRNA, lincRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA binding sites. Target RNA binding sites are well known to those skilled in the art.

[0107] Certain target RNA binding sites can inhibit gene expression through the biological process of RNA interference (RNAi). In some embodiments, the circular polyribonucleotide comprises an RNA or RNA-like structure having a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to the coding sequence of the target gene to be expressed in the cell, typically having 15-50 base pairs (e.g., about 18-25 base pairs). RNAi molecules include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), small hairpin RNA (shRNA), meroduplex, and dicer substrate. Further examples of target binding sites are described in paragraphs

[0129] to

[0146] of WO2020 / 023655, which is hereby incorporated by reference in its entirety.

[0108] DNA binding site In some embodiments, the circular polyribonucleotide comprises a target DNA binding site, such as a guide RNA (gRNA) sequence. In some embodiments, the circular polyribonucleotide comprises a guide RNA or a complement of the gRNA sequence. gRNA small synthetic RNAs comprise a target binding sequence required for binding to an imperfect effector moiety and a user-defined targeting sequence of about 20 nucleotides to a genomic target. The guide RNA sequence is 17-24 nucleotides in length (e.g., 19, 20, or 21 nucleotides) and is complementary to the nucleic acid sequence to be targeted. Custom gRNA generators and algorithms can be used in designing effective guide RNAs. Gene editing can be achieved using chimeric "single guide RNAs" ("sgRNAs"), which are engineered (synthetic) single RNA molecules that mimic the naturally occurring crRNA-tracrRNA complex and have both a tracrRNA (for binding to a nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing). Chemically modified gRNAs can be effective in genome editing.

[0109] A gRNA can recognize a specific DNA sequence (e.g., a sequence adjacent to or within a gene's promoter, enhancer, silencer, or repressor).

[0110] In some embodiments, gRNA is part of the CRISPR system for gene editing.For gene editing, circular polyribonucleotide can be designed to include one or more guide RNA sequences corresponding to desired target DNA sequence.The gRNA sequence can include at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides for interacting with Cas9 or other exonucleases to cleave DNA, for example, Cpf1 interacts with at least about 16 nucleotides of gRNA sequence for detectable DNA cleavage.

[0111] In some embodiments, the cyclic polyribonucleotide comprises a target aptamer sequence that can bind to DNA. The secondary structure of the target aptamer sequence can bind to DNA. In some embodiments, the cyclic polyribonucleotide forms a complex with DNA by binding to DNA via the target aptamer sequence.

[0112] Further examples of circular polyribonucleotide sequences that bind to DNA are described in paragraphs

[0151] to

[0153] of International Publication No. WO 2020 / 023655, which is hereby incorporated by reference in its entirety.

[0113] Protein binding In some embodiments, cyclic polyribonucleotide comprises one or more protein binding sites that allow proteins, such as ribosomes, to bind to internal sites within the RNA sequence.By designing protein binding sites, such as ribosome binding sites, into cyclic polyribonucleotide, cyclic polyribonucleotide can evade or reduce detection by the host's immune system by masking cyclic polyribonucleotide from components of the host's immune system, regulate degradation, or regulate translation.

[0114] In some embodiments, the cyclic polyribonucleotide comprises at least one immunity protein binding site, for example, to evade an immune response, for example, a CTL (cytotoxic T lymphocyte) response. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and assists in masking the cyclic polyribonucleotide as exogenous. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and assists in masking the cyclic polyribonucleotide as exogenous or foreign.

[0115] The traditional mechanism of ribosome association to linear RNA involves ribosome binding to the capped 5' end of the RNA. The ribosome moves from the 5' end to the start codon whereupon the first peptide bond is formed. According to the present invention, internal initiation of translation of a circular polyribonucleotide (i.e., cap-independent) does not require a free or capped end. Rather, the ribosome binds to an uncapped internal site, whereby the ribosome initiates polypeptide elongation at the start codon. In some embodiments, the circular polyribonucleotide comprises one or more RNA sequences that include a ribosome binding site, e.g., a start codon.

[0116] Natural 5'UTRs have characteristics that play a role in translation initiation. They contain signatures such as the Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates the translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO:23), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another "G". 5'UTRs are also known to form secondary structures involved in elongation factor binding.

[0117] In some embodiments, the cyclic polyribonucleotide encodes a protein binding sequence that binds to a protein. In some embodiments, the protein binding sequence targets or localizes the cyclic polyribonucleotide to a specific target. In some embodiments, the protein binding sequence specifically binds to an arginine-rich region of a protein.

[0118] In some embodiments, the protein binding sites include, but are not limited to, ACIN1, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, EIF4G2, EL AVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMR1, FUS, FXR1, FXR2, GNL3, GTF2F1, HNRNPA1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPL, HNRNPM, HNRNPU, HNRNPUL1, IGF2BP1, IGF2BP2, IGF2BP3, ILF3, KHDRBS1, LARP7, LIN28A, LIN28B , m6A, MBNL2, METTL3, MOV10, MSI1, MSI2, NONO, NONO-, NOP58, NPM1, NUDT21, PCBP2, POLR2A, PRPF8, PTBP1, RBFO X2, RBM10, RBM22, RBM27, RBM47, RNPS1, SAFB2, SBDS, SF3A3, SF3B4, SIRT7, SLBP, SLTM, SMNDC1, SND1, SRRM4, SRS Binding sites for proteins such as F1, SRSF3, SRSF7, SRSF9, TAF15, TARDBP, TIA1, TNRC6A, TOP3B, TRA2A, TRA2B, U2AF1, U2AF2, UNK, UPF1, WDR33, XRN2, YBX1, YTHDC1, YTHDF1, YTHDF2, YWHAG, ZC3H7B, PDK1, AKT1, and any other protein that binds RNA.

[0119] qualification The circular polyribonucleotides described herein may contain one or more substitutions, insertions and / or additions, deletions, and covalent modifications compared to a reference sequence, particularly a parent polyribonucleotide, and are encompassed within the scope of the invention.

[0120] In some embodiments, the circular polyribonucleotide comprises one or more post-transcriptional modifications (e.g., capping, truncation, polyadenylation, splicing, polyA sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than 100 different nucleoside modifications identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA comprises at least one nucleoside selected from the group described in

[0311] of International Patent Publication WO 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0121] Cyclic polyribonucleotides may include any useful modification, for example, to the sugar, nucleobase, or internucleoside linkage (e.g., linking phosphate / phosphodiester linkage / phosphodiester backbone). One or more atoms of the pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino, an optionally substituted thiol, an optionally substituted alkyl (e.g., methyl or ethyl), or a halo (e.g., chloro or fluoro). In certain embodiments, a modification (e.g., one or more modifications) is present in each of the sugar and the internucleoside linkage. The modification may be of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or hybrids thereof). Further modifications are described herein.

[0122] In some embodiments, the cyclic polyribonucleotide comprises at least one N(6) methyl adenosine (m6A) modification to increase translation efficiency. In some embodiments, the N(6) methyl adenosine (m6A) modification can reduce the immunogenicity of the cyclic polyribonucleotide (e.g., reduce the level of one or more markers of an immune or inflammatory response).

[0123] In some embodiments, the modification may include chemical or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modifications are described by Lewis and Pan, "RNA modifications and structures cooperate to guide RNA-protein interactions" in Nat Reviews Mol Cell Biol, 2017, 18:202-210.

[0124] In some embodiments, chemical modifications to the ribonucleotides of a cyclic polyribonucleotide or oligonucleotide may enhance immune evasion. Circular polyribonucleotides may also be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, SLet al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-terminal modifications (phosphorylation (mono-, di- and tri-), conjugation, reverse linkage, etc.), 3'-terminal modifications (conjugation, DNA nucleotides, reverse linkage, etc.), base modifications (e.g., replacement with a stabilizing base, a destabilizing base, or a base that base pairs with an expanded repertoire of partners), removal of a base (abasic nucleotide), or conjugated base. Modified ribonucleotide bases may also include 5-methylcytidine and pseudouridine. In some embodiments, base modifications can regulate the expression, immune response, stability, and intracellular localization of cyclic polyribonucleotides, to name a few functional effects. In some embodiments, modifications include biorthogonal nucleotides, such as unnatural bases. See, for example, Kimoto et al, Chem Commun (Camb), 2017, 53:12309, DOI:10.1039 / c7cc06661a (herein incorporated by reference).

[0125] In some embodiments, the sugar modification (e.g., at the 2' or 4' position) or sugar substitution of one or more ribonucleotides of a cyclic polyribonucleotide or oligonucleotide, as well as the backbone modification, may include modification or substitution of a phosphodiester bond. Specific examples of cyclic polyribonucleotides include cyclic polyribonucleotides that include modified backbones or non-natural internucleoside linkages, such as internucleoside modifications, including, but not limited to, modification or substitution of a phosphodiester bond. Cyclic polyribonucleotides with modified backbones include, in particular, those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in the internucleoside backbone can also be considered oligonucleosides. In certain embodiments, a cyclic polyribonucleotide will include ribonucleotides that have a phosphorus atom in the internucleoside backbone.

[0126] Modified cyclic polyribonucleotide or oligonucleotide backbones may include, for example, phosphorothioates, chiral phosphorothioates, dithiophosphates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, such as 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, such as 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linkage analogs, and those with reversed polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts, and free acid forms. In some embodiments, cyclic polyribonucleotides can be negatively or positively charged.

[0127] Modified nucleotides that may be incorporated into cyclic polyribonucleotides or oligonucleotides may be modified with respect to the internucleoside linkage (e.g., phosphate backbone). In the present specification, in the context of polynucleotide backbones, the terms "phosphate" and "phosphodiester" are used interchangeably. The backbone phosphate group may be modified by replacing one or more of the oxygen atoms with different substituents. In addition, modified nucleosides and nucleotides may include extensive replacement of unmodified phosphate moieties with alternative internucleoside linkages as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Dithiophosphates have both non-linked oxygens replaced by sulfur. Phosphate linkers can also be modified by replacement of the linking oxygen with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates).

[0128] The a-thio substituted phosphate moieties are provided to provide stability to RNA and DNA polymers via non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have enhanced nuclease resistance and subsequent extended half-life in cellular environments. Phosphorothioates linked to circular polyribonucleotides are expected to reduce innate immune responses via weaker binding / activation of cellular innate immune molecules.

[0129] In specific embodiments, the modified nucleoside comprises an α-thionucleoside (e.g., 5'-O-(l-thiophosphate)-adenosine, 5'-O-(l-thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(l-thiophosphate)-guanosine, 5'-O-(l-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine).

[0130] Other internucleoside linkages that may be used in accordance with the present invention are described herein, including internucleoside linkages that do not contain a phosphorous atom.

[0131] In some embodiments, a cyclic polyribonucleotide or oligonucleotide may include one or more cytotoxic nucleosides. For example, a cytotoxic nucleoside may be incorporated into a cyclic polyribonucleotide, such as a bifunctional modification. Cytotoxic nucleosides may include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4'-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-β-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2'-deoxy-2'-methylidenecytidine (DMDC), and 6-mercaptopurine. Further examples include fludarabine phosphate, N4-behenoyl-1-β-D-arabinofuranosylcytosine, N4-octadecyl-1-β-D-arabinofuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-β-D-arabino-pentofuranosyl)cytosine, and P-4055 (cytarabine 5'-elaidate).

[0132] A cyclic polyribonucleotide or oligonucleotide may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or more or all of A, G, U, C, I, pU) may or may not be uniformly modified in a cyclic polyribonucleotide or in a given predetermined sequence region thereof. In some embodiments, a cyclic polyribonucleotide or oligonucleotide includes pseudouridine. In some embodiments, a cyclic polyribonucleotide or oligonucleotide includes inosine, which may contribute to the immune system characterizing cyclic polyribonucleotides as endogenous RNA and viral RNA. Incorporation of inosine may also mediate improved RNA stability / reduced degradation. See, for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self”. Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety.

[0133] In some embodiments, all nucleotides in a cyclic polyribonucleotide or oligonucleotide (or a given sequence region thereof) are modified. In some embodiments, modifications may include m6A, which may enhance expression; inosine, which may attenuate immune response; pseudouridine, which may enhance RNA stability or translational read-through (staggered elements), m5C, which may enhance stability; and 2,2,7-trimethylguanosine, which aids in intracellular translocation (e.g., nuclear localization).

[0134] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may be present at various positions in a cyclic polyribonucleotide or oligonucleotide. One skilled in the art will appreciate that nucleotide analogs or other modifications may be placed at any position in a cyclic polyribonucleotide or oligonucleotide without substantially diminishing the function of the cyclic polyribonucleotide. Modifications may also be non-coding region modifications. A cyclic polyribonucleotide or oligonucleotide may be present in an amount ranging from about 1% to about 100%, or any percentage therebetween (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 1%-10% or 1%-10%). The nucleic acid sequence may contain 0% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%) modified nucleotides.

[0135] Production method In some embodiments, the circular polyribonucleotide comprises a deoxyribonucleic acid sequence that is non-naturally occurring and can be produced using recombinant techniques (eg, obtained in vitro using a DNA plasmid), chemical synthesis, or a combination thereof.

[0136] It is within the scope of this disclosure that the DNA molecules used to generate the RNA circle may comprise the DNA sequence of a naturally occurring original nucleic acid sequence, a modified form thereof, or a DNA sequence encoding a synthetic polypeptide not normally found in nature (e.g., a chimeric molecule or a fusion protein). DNA and RNA molecules may be modified using a variety of techniques, including but not limited to classical mutagenesis techniques and recombinant techniques, such as site-specific mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and / or mutagenesis of selected regions of a nucleic acid sequence, synthesis of mixtures of oligonucleotides and ligation of mixtures to "build" a mixture of nucleic acid molecules, and combinations thereof.

[0137] In some embodiments, the linear primary construct or linear mRNA can be circularized or concatemerized to generate a circular polyribonucleotide as described herein. The mechanism of circularization or concatemerization can be by methods such as the splint ligation method. The newly formed 5'- / 3'-bond can be an intramolecular bond or an intermolecular bond.

[0138] Methods for making the circular polyribonucleotides described herein are described, for example, in Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012).

[0139] Circularization In some embodiments, the linear polyribonucleotide for circularization may be circularized or concatemerized. In some embodiments, the linear polyribonucleotide for circularization may be circularized in vitro before formulation and / or delivery. In some embodiments, the circular polyribonucleotide may be in a mixture with the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide has the same nucleic acid sequence as the circular polyribonucleotide.

[0140] Extracellular cyclization In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized using chemical methods to form a circular polyribonucleotide. In some chemical methods, the 5'-end and 3'-end of a nucleic acid (e.g., the linear polyribonucleotide for circularization) contain chemically reactive groups that can form a new covalent bond between the 5'-end and 3'-end of the molecule when brought close to each other. The 5'-end can contain an NHS-ester reactive group, and the 3'-end can contain a 3'-amino terminal nucleotide, such that in an organic solvent, the 3'-amino terminal nucleotide at the 3'-end of the linear RNA molecule undergoes nucleophilic attack on the 5'-NHS-ester moiety to form a new 5'- / 3'-amide bond.

[0141] In some embodiments, a DNA or RNA ligase is used to enzymatically ligate a 5'-phosphorylated nucleic acid molecule (e.g., a linear polyribonucleotide for circularization) to a 3'-hydroxyl group of a nucleic acid (e.g., a linear nucleic acid) to form a new phosphorodiester bond. In an example reaction, a linear polyribonucleotide for circularization is incubated at 37°C for 1 hour with 1-10 units of T4 RNA ligase according to the manufacturer's protocol (New England Biolabs, Ipswich, MA). The ligation reaction can occur in the presence of a linear nucleic acid capable of base pairing with both the 5'- and 3'-regions aligned to aid in the enzymatic ligation reaction. In some embodiments, the ligation is a splint ligation. For example, a splint ligase such as SplintR® ligase, RNA ligase II, T4 RNA ligase, or T4 DNA ligase can be used for splint ligation. In splint ligation, a single-stranded polynucleotide (splint), such as a single-stranded RNA, can be designed to hybridize with both ends of a linear polyribonucleotide such that the two ends can be juxtaposed upon hybridization with the single-stranded splint. Thus, a splint ligase can catalyze the ligation of the two juxtaposed ends of a linear circular polyribonucleotide to generate a circular polyribonucleotide.

[0142] In some embodiments, DNA or RNA ligase is used to synthesize the circular polynucleotide. In some embodiments, either the 5' or 3' end of the linear polyribonucleotide for circularization may encode a ligase ribozyme sequence such that during in vitro transcription, the resulting linear polyribonucleotide for circularization contains an active ribozyme sequence capable of ligating the 5' end of the linear polyribonucleotide for circularization to the 3' end of the linear polyribonucleotide for circularization. The ligase ribozyme may be derived from group I intron, hepatitis delta virus, hairpin ribozyme, or may be selected by SELEX (systematic evolution of ligands by exponential enrichment). The ribozyme ligase reaction may be carried out at a temperature of 0 to 37° C. for 1 to 24 hours.

[0143] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized by using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety may react with a region or feature near the 5' end and / or near the 3' end of the linear polyribonucleotide for circularization to circularize or concatemerize the linear polyribonucleotide for circularization. In another aspect, the at least one non-nucleic acid moiety may be located at or linked to or near the 5' end and / or 3' end of the linear polyribonucleotide for circularization. The possible non-nucleic acid moieties may be homogeneous or heterogeneous. As a non-limiting example, the non-nucleic acid moiety may be a bond such as a hydrophobic bond, an ionic bond, a biodegradable bond and / or a cleavable bond. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or peptide moiety such as an aptamer or a non-nucleic acid linker as described herein.

[0144] In some embodiments, linear polyribonucleotides for circularization are synthesized using IVT and RNA polymerase, where the nucleotide mixture used for IVT contains an excess of guanosine monophosphate compared to guanosine triphosphate, and therefore may preferentially produce RNA with a 5' monophosphate; purified IVT products may be circularized using splint DNA.

[0145] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized by a non-nucleic acid moiety that induces an attractive force between atoms, molecular surfaces at, near, or connected to the 5' and 3' ends of the linear polyribonucleotide for circularization. As a non-limiting example, one or more linear polyribonucleotides for circularization may be circularized or concatemerized by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonance bonds, agnostic bonds, dipole bonds, conjugation, hyperconjugation, and antibonds.

[0146] In some embodiments, the linear polyribonucleotide for circularization may contain ribozyme RNA sequences near the 5' end and near the 3' end. The ribozyme RNA sequence may be covalently linked to the peptide when the sequence is exposed to the rest of the ribozyme. In one embodiment, the peptides covalently linked to the ribozyme RNA sequence near the 5' end and near the 3' end may be linked to each other to circularize or concatemerize the linear polyribonucleotide for circularization. In another embodiment, the peptides covalently linked to the ribozyme RNA near the 5' end and near the 3' end may be circularized or concatemerized after subjecting the linear primary construct or linear mRNA to ligation using various methods known in the art, including but not limited to protein ligation. A non-limiting list of examples of ribozymes or methods for incorporating and / or covalently linking peptides for use in the linear primary constructs or linear RNA of the present invention is described in U.S. Patent Application Publication No. 20030082768, the entire contents of which are incorporated herein by reference.

[0147] In some embodiments, linear polyribonucleotides for circularization may include 5' triphosphates of nucleic acids that are converted to 5' monophosphates, for example, by contacting the 5' triphosphates with RNA 5' pyrophosphohydrolase (RppH) or ATP diphosphohydrolase (apyrase). In some embodiments, the 5' termini of at least a portion of the linear polyribonucleotides include a monophosphate moiety. In some embodiments, a polyribonucleotide population including circular and linear polyribonucleotides is contacted with RppH prior to digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and / or a 3' exonuclease. Alternatively, the conversion of the 5' triphosphate of a linear polyribonucleotide for circularization to a 5' monophosphate can be carried out by a two-step reaction comprising: (a) contacting the 5' nucleotide of the linear polyribonucleotide for circularization with a phosphatase (e.g., Antarctic phosphatase, shrimp alkaline phosphatase, or calf intestinal phosphatase) to remove all three phosphates; and (b) contacting the 5' nucleotide after step (a) with a kinase (e.g., polynucleotide kinase) that adds one phosphate.

[0148] In some embodiments, the cyclization efficiency of the cyclization methods provided herein is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In some embodiments, the cyclization efficiency of the cyclization methods provided herein is at least about 40%. In some embodiments, the cyclization method provided has a cyclization efficiency of about 10% to about 100%; for example, the cyclization efficiency can be about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 99%. In some embodiments, the cyclization efficiency is about 20% to about 80%. In some embodiments, the cyclization efficiency is about 30% to about 60%. In some embodiments, the cyclization efficiency is about 40%.

[0149] In some embodiments, the circular polyribonucleotide comprises an internal splicing element where the spliced ​​ends are joined together when duplicated. Some examples may include splice site sequences and short inverted repeats (30-40 nt), such as AluSq2, AluJr, and AluSz, inverted sequences in adjacent introns, Alu elements in adjacent introns, and motifs found in cis-sequence elements proximal to backsplice events (suptable 4 enriched motifs), such as small introns (<100 nt) with sequences 200 bp before (upstream) or after (downstream) the backsplice site with the adjacent exon. In some embodiments, the circular polyribonucleotide comprises at least one repeated nucleotide sequence described elsewhere herein as an internal splicing element. In such embodiments, the repeated nucleotide sequence may comprise a repeated sequence from the Alu family of introns. In some embodiments, splicing repeat ribosome binding proteins may regulate circular polyribonucleotide biosynthesis (eg, Muscleblind and Quaking (QKI) splicing factors).

[0150] In some embodiments, a circular polyribonucleotide may include a canonical splice site adjacent to the head-to-tail junction of the circular polyribonucleotide.

[0151] In some embodiments, a circular polyribonucleotide may contain a bulge-helix-bulge motif that includes a 4-base pair stem flanked by two 3-nucleotide bulges. Cleavage occurs at a site in the bulge region to generate a characteristic fragment with a terminal 5'-hydroxyl group and a 2',3'-cyclic phosphate. Circularization proceeds by nucleophilic attack of the 5'-OH group on the 2',3'-cyclic phosphate of the same molecule to form a 3',5'-phosphodiester bridge.

[0152] In some embodiments, the circular polyribonucleotide may comprise a multimeric repeat RNA sequence that contains an HPR element. The HPR comprises a 2',3'-cyclic phosphate and a 5'-OH terminus. The HPR element self-processes the 5' and 3' ends of the linear circular polyribonucleotide, thereby ligating these ends together.

[0153] In some embodiments, the circular polyribonucleotide may comprise a sequence that mediates self-ligation. In one embodiment, the circular polyribonucleotide may self-ligate by comprising an HDV sequence (e.g., HDV replication domain conserved sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (Beeharry et al 2004) (SEQ ID NO: 24) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO: 25)). In one embodiment, the circular polyribonucleotide may self-ligate by comprising a loop E sequence (e.g., in PSTVd). In another embodiment, the circular polyribonucleotide can include a self-circularizing intron, such as a 5' and 3' slice junction, or a self-circularizing catalytic intron, such as a Group I, Group II, or Group III intron. Non-limiting examples of Group I intron self-splicing sequences include the self-splicing permuted intron-exon sequence from the T4 bacteriophage gene td and the Tetrahymena intervening sequence (IVS) rRNA.

[0154] Other Cyclization Methods In some embodiments, the linear polyribonucleotide for circularization may contain complementary sequences that include repetitive or non-repetitive nucleic acid sequences within individual introns or across adjacent introns. The repetitive nucleic acid sequences are sequences present within a segment of the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide comprises a repetitive nucleic acid sequence. In some embodiments, the repetitive nucleotide sequence comprises a polyCA or polyUG sequence. In some embodiments, the circular polyribonucleotide comprises at least one repetitive nucleic acid sequence that hybridizes to a complementary repetitive nucleic acid sequence in another segment of the circular polyribonucleotide, where the hybridized segment forms an internal duplex. In some embodiments, the circular polyribonucleotide comprises between 1 and 10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, and 10) repetitive nucleic acid sequences that hybridize to a complementary repetitive nucleic acid sequence in another segment of the circular polyribonucleotide, where the hybridized segment forms an internal duplex. In some embodiments, the circular polyribonucleotide comprises two repeat nucleic acid sequences that hybridize to complementary repeat nucleic acid sequences in another segment of the circular polyribonucleotide, and the hybridized segments form internal duplexes.In some embodiments, the repeat nucleic acid sequences and complementary repeat nucleic acid sequences from two separate circular polyribonucleotides hybridize to generate a single circularized polyribonucleotide, and the hybridized segments form internal duplexes.In some embodiments, the complementary sequences are found at the 5' and 3' ends of the linear polyribonucleotide for circularization. In some embodiments, the complementary sequence comprises about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more paired nucleotides.

[0155] In some embodiments, chemical methods of circularization can be used to generate circular polyribonucleotides, including, but not limited to, click chemistry (e.g., alkyne and azide-based methods or clickable bases), olefin metathesis, phosphoramidate ligation, hemiaminal-imine crosslinking, base modification, and any combination thereof.

[0156] In some embodiments, enzymatic methods of circularization can be used to generate circular polyribonucleotides. In some embodiments, a ligation enzyme, such as a DNA or RNA ligase, can be used to generate a circular polyribonuclease or a template for the complement, a complementary strand of the circular polyribonuclease, or a circular polyribonuclease.

[0157] Circularization of circular polyribonucleotides can be carried out by methods known in the art, such as those described in "RNA circularization strategies in vivo and in vitro" by Petkovic and Muller, Nucleic Acids Res, 2015, 43(4):2454-2465 and "In vitro circularization of RNA" by Muller and Appel, RNA Biol, 2017, 14(8):1018-1027.

[0158] The circular polyribonucleotide may encode sequences and / or motifs useful for replication. Exemplary replication elements are described in paragraphs

[0280] to

[0286] of International Patent Publication No. WO 2019 / 118919, the entirety of which is incorporated herein by reference.

[0159] In some embodiments, a linear circular polyribonucleotide may contain complementary sequences, including either repetitive or non-repetitive nucleic acid sequences, within individual introns or across adjacent introns. A repetitive nucleic acid sequence is a sequence present within one segment of a circular polyribonucleotide. In some embodiments, a circular polyribonucleotide comprises a repetitive nucleic acid sequence. In some embodiments, the repetitive nucleotide sequence comprises a polyCA or polyUG sequence. In some embodiments, a circular polyribonucleotide comprises at least one repetitive nucleic acid sequence that hybridizes to a complementary repetitive nucleic acid sequence in another segment of the circular polyribonucleotide, where the hybridized segment forms an internal duplex. In some embodiments, the repetitive nucleic acid sequence and the complementary repetitive nucleic acid sequence from two separate circular polyribonucleotides hybridize to generate a single circularized polyribonucleotide, where the hybridized segment forms an internal duplex. In some embodiments, the complementary sequences are found at the 5' and 3' ends of a linear circular polyribonucleotide. In some embodiments, the complementary sequence comprises about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more paired nucleotides.

[0160] In some embodiments, circular polyribonucleotides may be generated using chemical cyclization methods, including but not limited to click chemistry (e.g., alkyne and azide-based methods, or click-compatible bases), olefin metathesis, phosphoramidate ligation, hemiaminal-imine crosslinking, base modification, and any combination thereof.

[0161] duplicate element The circular polyribonucleotide may encode sequences and / or motifs useful for replication. Replication of the circular polyribonucleotide may occur by the generation of a complementary circular polyribonucleotide. In some embodiments, the circular polyribonucleotide contains a motif for initiating transcription, where transcription is driven by either endogenous cellular machinery (DNA-dependent RNA polymerase) or RNA-dependent RNA polymerase encoded by the circular polyribonucleotide. When the product of the rolling circle transcription event is cleaved by a ribozyme, either a complementary circular polyribonucleotide or an expanded circular polyribonucleotide may be generated in unit length. The ribozyme may be encoded in trans by the circular polyribonucleotide, its complement, or by the RNA sequence. In some embodiments, the encoded ribozyme may contain sequences or motifs that control circular RNA proliferation by modulating (inhibiting or promoting) the activity of the ribozyme. In some embodiments, the unit length sequence may be ligated into a circular form by a cellular RNA ligase. In some embodiments, the circular polyribonucleotide contains a replication element that aids in self-amplification. Examples of such replication elements include, but are not limited to, the HDV replication domain described elsewhere herein, the potato spindle tuber viroid RNA promoter (see, e.g., Kolonko 2005 Virology), and replication-competent circular RNA sense and / or antisense ribozymes such as antigenomic 5'-CGGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAUCCGAAGGAGGACGCACGUCCACUCGGAUGGCUAAGGGAGAGCCA-3' (SEQ ID NO: 26) or genomic 5'-UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCCA-3' (SEQ ID NO: 27).

[0162] In some embodiments, the circular polyribonucleotide comprises at least one stagger element as described herein, which aids in replication. The stagger element in the circular polyribonucleotide can cleave the long transcript replicated from the circular polyribonucleotide to a specific length, which can then be circularized to form the complement to the circular polyribonucleotide.

[0163] In another embodiment, the circular polyribonucleotide contains at least one ribozyme sequence for cleaving a long transcript replicated from the circular polyribonucleotide to a specific length, where a separate encoded ribozyme cleaves the transcript at the ribozyme sequence. Circularization forms a complement to the circular polyribonucleotide.

[0164] In some embodiments, the circular polyribonucleotide is substantially resistant to degradation, for example, by exonucleases.

[0165] In some embodiments, the cyclic polyribonucleotide replicates within the cell. In some embodiments, the cyclic polyribonucleotide replicates within the cell at a rate of about 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, 95%-99%, or any percentage in between. In some embodiments, the cyclic polyribonucleotide replicates within the cell and is passed on to daughter cells. In some embodiments, the cell passes on at least one cyclic polyribonucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, cells undergoing meiosis inherit cyclic polyribonucleotides to daughter cells with at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% efficiency. In some embodiments, cells undergoing mitosis inherit cyclic polyribonucleotides to daughter cells with at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% efficiency.

[0166] In some embodiments, the cyclic polyribonucleotide replicates in a host cell. In one embodiment, the cyclic polyribonucleotide is capable of replicating in a mammalian cell, such as a human cell.

[0167] In some embodiments, the cyclic polyribonucleotide replicates in the host cell, but the cyclic polyribonucleotide is not integrated into the host genome, for example, in the host chromosome. In some embodiments, the cyclic polyribonucleotide exhibits negligible recombination frequency, for example, in the host chromosome. In some embodiments, the cyclic polyribonucleotide exhibits a recombination frequency, for example, in the host chromosome, of less than about 1.0 cM / Mb, 0.9 cM / Mb, 0.8 cM / Mb, 0.7 cM / Mb, 0.6 cM / Mb, 0.5 cM / Mb, 0.4 cM / Mb, 0.3 cM / Mb, 0.2 cM / Mb, 0.1 cM / Mb, or less.

[0168] Detection of linear and circular RNA The presence of linear RNA in circular RNA pharmaceutical preparations can have unexpected and sometimes undesirable effects.Therefore, circular RNA can be enriched, separated, and / or purified compared to linear RNA; methods that can monitor, evaluate, and / or control linear RNA (e.g., methods for producing circular RNA preparations); and methods of using such pharmaceutical compositions and preparations.In some embodiments, circular RNA preparations have linear RNA below a threshold level, for example, circular RNA preparations are enriched or purified to reduce linear RNA compared to linear RNA.In some embodiments, circular polyribonucleotide population is enriched such that a mixture of circular polyribonucleotides and linear polyribonucleotides contains a threshold level of circular polyribonucleotides.

[0169] In general, detection and quantification of elements in pharmaceutical preparations involves the use of a reference standard that is either the component of interest (e.g., circular RNA, linear RNA, fragments, impurities, etc.) or a similar material (e.g., using a linear RNA structure of the same sequence as the circular RNA structure as a standard for circular RNA), or involves the use of an internal standard or signal from a test sample. In some embodiments, a standard is used to establish a response (response factor) from a detector for a known or relative amount of a material. In some embodiments, the response factor is determined from one or more concentration standards (e.g., using linear regression analysis). In some embodiments, the response factor is then used to determine the amount of the material of interest from the signal due to that component. In some embodiments, the response factor is assumed to be or have a value of 1.

[0170] In some embodiments, detection and quantification of linear RNA compared to circular RNA in the pharmaceutical composition is determined using a comparison with a linear version of circular polyribonucleotide. In some embodiments, a calibration curve is prepared using a linear version of circular polyribonucleotide and assuming a response factor of 1 to determine the mass of total ribonucleotides in the pharmaceutical composition. In some embodiments, the w / w percentage of circular polyribonucleotides in the pharmaceutical preparation is determined by comparing a calibration curve prepared by band intensities of multiple known amounts of linear versions of circular polyribonucleotides with the band intensities of circular polyribonucleotides in the pharmaceutical preparation. In some embodiments, bands are generated during gel-based electrophoresis, and band intensities are measured by a gel imager (e.g., E-gel imager). In some embodiments, the circular polyribonucleotide preparation comprises less than a threshold amount of linear polyribonucleotide molecules when evaluated as described herein (e.g., where the threshold amount is a reference standard, e.g., a pharmaceutical release standard for the circular polyribonucleotide preparation).

[0171] In some embodiments, the detection and quantification of nicked RNA relative to total RNA in the pharmaceutical composition is determined by gel extraction of the preparation containing circular RNA followed by sequencing. In some embodiments, the detection and quantification of nicked RNA relative to linear RNA in the pharmaceutical composition is determined by gel extraction of the preparation containing circular RNA followed by sequencing. In some embodiments, the circular polyribonucleotide preparation comprises nicked RNA, linear RNA, or a combination of linear RNA and nicked RNA that is less than a threshold amount (e.g., where the threshold amount is a reference standard, e.g., a pharmaceutical release standard for the circular polyribonucleotide preparation) when evaluated as described herein. For example, the reference standard for the amount of linear polyribonucleotide molecules present in the preparation is 30%, 20%, 15%, 10%, 1%, 0.5%, or 0.1% or less of linear polyribonucleotide molecules based on the total ribonucleotide molecules in the preparation, or any percentage therebetween. In some embodiments, a reference standard for the amount of nicked polyribonucleotide molecules present in a preparation is no more than 30%, 20%, 15%, 10%, 1%, 0.5%, or 0.1%, or any percentage therebetween, of nicked polyribonucleotide molecules based on the total ribonucleotide molecules in the preparation. In some embodiments, a reference standard for the amount of linear and nicked polyribonucleotide molecules present in a preparation is no more than 40%, 30%, 20%, 15%, 10%, 1%, 0.5%, or 0.1%, or any percentage therebetween, of a combination of linear and nicked polyribonucleotide molecules based on the total ribonucleotide molecules in the preparation.

[0172] In some embodiments, the standards are run under the same conditions as the samples. For example, the standards are run in the same type of gel, the same buffer, and the same exposure as the samples. In further embodiments, the standards are run in parallel with the samples. In some embodiments, the quantification of elements is repeated (e.g., in duplicate or triplicate) in multiple samples from a subject preparation, and the average result is determined. In some embodiments, the quantification of linear RNA is measured using parallel capillary electrophoresis (e.g., using a Fragment Analyzer or analytical HPLC with UV detection).

[0173] Alternatively, qPCR reverse transcription (RT-qPCR) was used to measure the amount of linear and circular RNA present: one spanning the ligation site and one specific to the ORF. The primers spanning the ligation site report on the level of circular RNA, while the primers specific to the ORF report on both circular and linear RNA. In some embodiments, the reverse transcription reaction is performed with reverse transcriptase (e.g., Super-Script II:RNase H; Invitrogen) and random hexamers according to the manufacturer's instructions. In some embodiments, the amplified PCR products are analyzed using polyacrylamide gel electrophoresis and visualized by ethidium bromide staining. In some embodiments, the PCR products may be quantified using densitometry to estimate the enrichment fold of circular polyribonucleotides, and the concentration of the total RNA sample may be measured by ultraviolet absorbance.

[0174] Other embodiments Various modifications and variations of the described compositions, methods, and uses of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the present invention.

[0175] All publications, patents, and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety. EXAMPLES

[0176] The following examples, which are intended to illustrate but not limit the disclosure, are presented to provide one of ordinary skill in the art with an explanation of how the compositions and methods described herein can be used, made, and evaluated. The examples are intended to be purely illustrative of the disclosure and are not intended to limit the scope of what the inventors regard as their invention.

[0177] Example 1: Optimization of exonuclease concentration for degradation of linear polyribonucleotides This example demonstrates that 5' and 3' exonucleases can be used to degrade linear polyribonucleotides.

[0178] In this experiment, 2.5 μg of linear polyribonucleotides encoding Gaussia luciferase (gLuc) were digested with 0 U, 0.5 U, 0.625 U, 1 U, 1.25 U, 2.5 U, or 5 U of the 3' exonuclease RNase R for 90 minutes at 37°C. Each digestion was performed in Terminator™ A buffer (Lucigen), quenched with EDTA, and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The results of this experiment show that linear polyribonucleotides were degraded by the 3' exonuclease RNase R (Figure 1). In Examples 5 and 7, 0.5 U of RNase R per μg of RNA was selected and used (Figures 6, 8-10).

[0179] In this experiment, 2.5 μg of linear polyribonucleotide encoding gLuc was digested with 0 U, 0.025 U, 0.03 U, 0.05 U, 0.0625 U, 0.125 U, or 0.25 U of the 5' exonuclease Terminator™ exonuclease for 60 minutes at 37° C. Each digestion was performed in Terminator™ A buffer (Lucigen), quenched with EDTA, and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The results of this experiment show that linear polyribonucleotides were degraded by Terminator™ 5' exonuclease (FIG. 2). In Examples 5 and 7, 0.025 U of Terminator™ exonuclease per μg of RNA was selected and used (FIGS. 6, 8-10).

[0180] In this experiment, 2.5 μg of linear polyribonucleotides encoding gLuc were digested with 0 U, 0.025 U, 0.03 U, 0.05 U, 0.0625 U, 0.125 U, or 0.25 U of 5' exonuclease Xrn-1 for 60 minutes at 37°C. Each digestion was performed in Terminator™ A buffer (Lucigen), quenched with EDTA, and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The results of this experiment show that linear polyribonucleotides were degraded by 5' exonuclease Xrn-1 (Figure 3). In Examples 5 and 7, 0.05 U of Xrn-1 per μg of RNA was selected and used (Figures 6, 8-10).

[0181] This Example 1 demonstrates that 5' and 3' exonucleases degrade linear polyribonucleotides.

[0182] Example 2: In vitro production of circular polyribonucleotides encoding Gaussia luciferase This example describes the in vitro production of circular polyribonucleotides.

[0183] A circular polyribonucleotide was designed with an IRES and an ORF encoding Gaussia luciferase (GLuc), and two spacer elements flanking the IRES-ORF. The circular polyribonucleotide was generated using in vitro synthesis (IVT) using one of two methods:

[0184] In the first method, unmodified linear polyribonucleotides were synthesized by IVT using T7 RNA polymerase from a DNA segment containing the above elements. The transcribed polyribonucleotides were purified with an RNA purification system (New England Biolabs, Inc.), treated with RNA 5' phosphohydrolase (RppH) (New England Biolabs, M0356) according to the manufacturer's instructions, and purified again with the RNA purification system. The RppH-treated linear polyribonucleotides were circularized using splint DNA.

[0185] In the second method, unmodified linear polynucleotides were synthesized by IVT using T7 RNA polymerase from a DNA segment containing the above elements. The nucleotide mixture used for IVT contained an excess of guanosine monophosphate compared to guanosine triphosphate to preferentially produce RNA with a 5' monophosphate. The transcribed polyribonucleotides were purified with an RNA purification system (New England Biolabs, Inc.) according to the manufacturer's instructions. The purified IVT products were circularized using splint DNA.

[0186] Circular polyribonucleotides were generated by splint ligation as follows: transcribed linear polyribonucleotides and a DNA splint (5'-GTTTTTCGGCTATTCCCAATAGCCGTTTTG-3'; SEQ ID NO: 1) were mixed, annealed, and treated with RNA ligase to generate a post-ligation polyribonucleotide mixture. A by-product of this circularization reaction is unreacted linear polyribonucleotides.

[0187] Example 3: Selective Degradation of Linear Polyribonucleotides Using a Combination of 5' and 3' Exonucleases This example demonstrates that a combination of 5' and 3' exonucleases can be used to selectively degrade linear polyribonucleotides.

[0188] A combination of 5' and 3' exonuclease was used to degrade unreacted linear polyribonucleotides after the circularization reaction. In this example, 2.5 μg of the post-ligation polyribonucleotide mixture containing both circular and linear polyribonucleotides prepared as described in Example 2 was simultaneously digested with 0.5 U Terminator™ 5' exonuclease and 1 U, 2 U, 4 U, 6 U, 8 U or 10 U of 3' exonuclease RNase R at 37° C. for 90 minutes. Each digestion was performed in Terminator™ A buffer (Lucigen), quenched with EDTA, and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of total polyribonucleotides that were circular after exonuclease digestion (%Circular), and the percentage of circular polyribonucleotides remaining after exonuclease digestion compared to the amount of circular polyribonucleotides present after ligation (%eRNA remaining) were analyzed by Image Lab. The results of this example show that the combination of 5' and 3' exonucleases selectively degraded linear polyribonucleotides in the polyribonucleotide mixture after ligation (Figure 4).

[0189] Example 4: Concentration of circular polyribonucleotides using a combination of 5' and 3' exonucleases This example demonstrates that a combination of 5' and 3' exonucleases can be used to enrich circular polyribonucleotides in a scaled-up reaction.

[0190] In this example, 1 mg of the post-ligation polyribonucleotide mixture prepared as described in Example 2 was simultaneously digested with 4000 U RNase R and 200 U Terminator™ exonuclease for 60 minutes at 37° C. Digestion was performed in Terminator™ A buffer, quenched with EDTA, and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of total polyribonucleotides after exonuclease digestion that were circular polyribonucleotides (%Circular), and the percentage of circular polyribonucleotides remaining after exonuclease digestion compared to the amount of circular polyribonucleotides present after ligation (%eRNA remaining) were analyzed by Image Lab. The results of this example show that circular polyribonucleotides were enriched in the polyribonucleotide mixture after ligation using a combination of 5' and 3' exonucleases (Figure 5).

[0191] Example 5: Concentration of circular polyribonucleotides using low concentrations of 5' and 3' exonucleases This example demonstrates that a combination of low concentrations of 5' and 3' exonucleases can be used to enrich circular polyribonucleotides.

[0192] In this example, 2.5 μg of the post-ligation polyribonucleotide mixture, produced as described in Example 2, was digested simultaneously with either (i) 1.25 U RNase R and 0.0625 U Terminator™ exonuclease; or (ii) 1.25 U RNase R and 0.0625 U Xrn-1 in Terminator™ A buffer for 60 minutes at 37° C. Each digestion was quenched with EDTA and analyzed by gel electrophoresis. TBE-Urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of total polyribonucleotides after exonuclease digestion that were circular (%Circular) and the percentage of circular polyribonucleotides remaining after exonuclease digestion compared to the amount of circular polyribonucleotides present after ligation (%eRNA remaining) were analyzed by Image Lab. The results of this example show that simultaneous digestion with optimal concentrations of 5' and 3' exonucleases selectively degrades linear polyribonucleotides in the post-ligation polyribonucleotide mixture, creating an enriched circular polyribonucleotide preparation (Figure 6).

[0193] Example 6: Concentration of circular polyribonucleotides using a combination of 5' and 3' exonucleases This example compares the enrichment of circular polyribonucleotides using two different combinations of 5' and 3' exonucleases.

[0194] In this example, 2.5 μg of the post-ligation polyribonucleotide mixture, produced as described in Example 2, was digested with 0.5 U RNase R (Lucigen or MC Labs) and 0.025 U Terminator™ (Lucigen) exonuclease per μg of RNA; or (ii) 0.5 U RNase R (Lucigen or MC Labs) and 0.2 U Xrn-1 (New England Biolabs) per μg of RNA simultaneously in Terminator™ A buffer at 37° C. for 60 minutes. Each digestion was quenched with EDTA and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of total polyribonucleotides that were circular after exonuclease digestion (%Circular) and the percentage of circular polyribonucleotides remaining after exonuclease digestion compared to the amount of circular polyribonucleotides present after ligation (%eRNA remaining) were analyzed by Image Lab.

[0195] FIG. 7 shows the results of this example (Lane 1: NEB ssRNA ladder; Lane 2: 2.5 μg untreated post-ligation mixture; Lane 3: 2.5 μg post-ligation mixture treated with RNase R + Terminator™ exonuclease; Lane 4: 2.5 μg post-ligation mixture treated with RNase R (Lucigen) + Xrn-1 exonuclease; Lane 5: 2.5 μg post-ligation mixture treated with Xrn-1; Lane 6: 2.5 μg post-ligation mixture treated with Terminator™ alone; Lane 7: 2.5 μg post-ligation mixture treated with RNase R (Lucigen) alone; Lane 8: 2.5 μg post-ligation mixture treated with Terminator™ exonuclease and RNase R (MC Labs); Lane 9: 2.5 μg post-ligation mixture treated with Xrn-1 and RNase R (MC Lanes: 10: 2.5 μg post-ligation mixture treated with RNase R (MC Labs); 11: 2.5 μg post-ligation mixture treated with RNase R (MC Labs). The post-ligation polyribonucleotide mixture consisted of 64% circular polyribonucleotides (lane 2). After digestion with RNase R and Terminator™ exonuclease, the circular polyribonucleotides in the post-ligation polyribonucleotide mixture were enriched to 80% (lanes 3 and 8) circular polyribonucleotides. After digestion with RNase R+Xrn-1, the circular polyribonucleotides in the post-ligation polyribonucleotide mixture were enriched to 76% with Lucigen RNase R (lane 4) and 81% with MC Labs RNase R (lane 9). When only Xrn-1 or Terminator™ exonuclease was used alone, the post-ligation mixture of circular polyribonucleotides was concentrated to 69% (lane 5) or 74% (lane 7), respectively. When only Lucigen RNase R or MC Labs RNase R was used alone, the post-ligation mixture of circular polyribonucleotides was concentrated to 61% (lane 6) or 74% (lane 10), respectively.

[0196] Example 7. Identification of exonuclease reaction time for enrichment of circular polyribonucleotides This example compares the reaction times for digestion of linear polyribonucleotides with 5' and 3' exonucleases used to enrich for circular polyribonucleotides.

[0197] In this experiment, 3.75 μg of the post-ligation polyribonucleotide mixture prepared as described in Example 2 was simultaneously digested with either (i) 15 U RNase R and 1.5 U Terminator™ exonuclease in Terminator™ A buffer: reactions were carried out for 15, 30, 45, 60, 75, 90, 105, or 120 minutes at 37° C. Each digestion was quenched with EDTA and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of circular polyribonucleotides was analyzed by Image Lab. The results of this example show that when the reaction time was 90 minutes or less, at least 50% of the circular polyribonucleotides remaining after ligation and before exonuclease digestion still remained after digestion with both 5' and 3' exonucleases. The results of this example also show that when the reaction time is 15 minutes or longer, the resulting total polyribonucleotides contain at least 80% cyclic polyribonucleotides. The results for each reaction time tested are summarized in Table 2.

[0198] [Table 2]

[0199] Example 8: Identification of buffer conditions for the concentration of circular polyribonucleotides This example describes the identification of buffer conditions for the enrichment of circular polyribonucleotides using a combination of 5' and 3' exonucleases.

[0200] Experiment 1 In this experiment, 2.5 μg of the post-ligation polyribonucleotide mixture, produced as described in Example 2, was digested simultaneously with either (i) 1.25 U of RNase R and 0.0625 U of Terminator™ exonuclease; or (ii) 1.25 U of RNase R and 0.0625 U of Xrn-1 for 60 minutes at 37° C. in one of the following buffers: Buffer T: Terminator(TM) A buffer (Lucigen; proprietary) Buffer 1: 100 mM NaCl, 50 mM Tris-HCl (pH 8) Buffer 2: 100 mM NaCl, 50 mM Tris-HCl (pH 8), 0.5 mM MgCl2 Buffer 3: 100 mM NaCl, 50 mM Tris-HCl (pH 8), 1 mM DTT Buffer 4: 100 mM NaCl, 50 mM Tris-HCl (pH 8), 0.5 mM MgCl2, 1 mM DTT

[0201] As a control, 2.5 μg of the post-ligation polyribonucleotide mixture prepared as described in Example 2 was mixed in Buffer 1, Buffer 2, Buffer 3, or Buffer 4 without exonuclease digestion (Buffer Control). Each digestion was quenched with EDTA and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of total polyribonucleotides after exonuclease digestion that were circular (%Circular) and the percentage of circular polyribonucleotides remaining after exonuclease digestion compared to the amount of circular polyribonucleotides present after ligation (%eRNA remaining) were analyzed by Image Lab.

[0202] FIG. 8 shows the results of digestion with a combination of Terminator™ exonuclease and RNase R in various buffers and corresponding buffer controls (Lane 1: NEB ssRNA ladder; Lane 2: Terminator™ A Buffer (Terminator™ + RNase R); Lane 3: Buffer 1 control (no exonuclease digestion); Lane 4: Buffer 1 (Terminator™ + RNase R); Lane 5: Buffer 2 control (no exonuclease digestion); Lane 6: Buffer 2 (Terminator™ + RNase R); Lane 7: Buffer 3 control (no exonuclease digestion); Lane 8: Buffer 3 (Terminator™ + RNase R); Lane 9: Buffer 4 control (no exonuclease digestion); Lane 10: Buffer 4 (Terminator™ + RNase R)). The circular polyribonucleotides in the post-ligation polyribonucleotide mixture were enriched to 83% after digestion with a combination of Terminator™ exonuclease and RNase R in buffer 2 (lane 6).

[0203] FIG. 9 shows the results of combined digestion with Xrn-1 and RNase R in various buffers and corresponding buffer controls (Lane 1: NEB ssRNA ladder; Lane 2: Terminator™ A Buffer (Xrn-1+RNase R); Lane 3: Buffer 1 control (no exonuclease digestion); Lane 4: Buffer 1 (Xrn-1+RNase R); Lane 5: Buffer 2 control (no exonuclease digestion); Lane 6: Buffer 2 (Xrn-1+RNase R); Lane 7: Buffer 3 control (no exonuclease digestion); Lane 8: Buffer 3 (Xrn-1+RNase R); Lane 9: Buffer 4 control (no exonuclease digestion); Lane 10: Buffer 4 (Xrn-1+RNase R)). These results show that the circular polyribonucleotides in the post-ligation polyribonucleotide mixture were enriched to 85% after combined digestion with Xrn-1 and RNase R in buffer 2 (Lane 6).

[0204] Experiment 2 In this experiment, 2.5 μg of the post-ligation polyribonucleotide mixture prepared as described in Example 2 was digested simultaneously with 0.0625 U of Xrn-1 and 1.25 U of RNase R for 60 minutes at 37° C. in one of the following buffers: Terminator(TM) A Buffer (Lucigen; proprietary) Xrn-1 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT; pH 7.9) RNase R buffer (Lucigen) (100 mM KCl, 20 mM Tris-HCl (pH 8), 0.1 mM MgCl2) Buffer 2: 100 mM NaCl, 50 mM Tris-HCl (pH 8), 0.5 mM MgCl2

[0205] As a control, 2.5 μg of the post-ligation polyribonucleotide mixture made as described in Example 2 was mixed in each buffer without exonuclease digestion (buffer control). Each digestion was quenched with EDTA and analyzed by gel electrophoresis. TBE-urea gels were stained with SYBR Safe and imaged with an iBright imager (Invitrogen). The percentage of total polyribonucleotides after exonuclease digestion that were circular (%Circular) and the percentage of circular polyribonucleotides remaining after exonuclease digestion compared to the amount of circular polyribonucleotides present after ligation (%eRNA remaining) were analyzed by Image Lab. Figure 10 shows the results of combined digestion with Xrn-1 and RNase R in various buffers and corresponding buffer controls (lane 1: NEB ssRNA ladder; lane 2: Terminator™ A buffer control (no exonuclease); lane 3: Terminator™ A buffer (Xrn-1 + RNase R); lane 4: Xrn-1 buffer control (no exonuclease digestion); lane 5: Xrn-1 buffer (Xrn-1 + RNase R); lane 6: RNase R buffer control (no exonuclease digestion); lane 7: RNase R buffer (Xrn-1 + RNase R); lane 8: Buffer 2 control (no exonuclease digestion) lane 7: no RNase digestion); lane 8: buffer 2 (Xrn-1 + RNase R). These results show that the circular polyribonucleotides in the post-ligation polyribonucleotide mixture were enriched to 87% after digestion with a combination of Xrn-1 and RNase R in RNase R buffer 2 (lane 7). The circular polyribonucleotides in the post-ligation polyribonucleotide mixture were enriched to 85% after digestion with a combination of Xrn-1 and RNase R in buffer 2 (lane 9).

[0206] Example 9: In vitro expression of Gaussia luciferase from enriched circular RNA This example demonstrates that circular polyribonucleotides enriched using a double exonuclease express GLuc at levels comparable to those purified using reverse-phase chromatography without the use of a double exonuclease.

[0207] To generate the dual exonuclease, reversed-phase purified sample, the post-ligation polyribonucleotide mixture prepared as described in Example 2 was simultaneously digested with 0.025 U Terminator™ exonuclease per μg RNA and 0.5 U RNase R per μg RNA for 60 minutes at 37° C. The digestion was quenched with EDTA and purified by reversed-phase chromatography. After chromatography and buffer exchange, expression of the purified circular polyribonucleotide was tested by in vitro expression.

[0208] The ligated polyribonucleotide mixture was purified by reversed-phase chromatography to generate a reversed-phase purified sample. After chromatography and buffer exchange, the expression of the purified circular polyribonucleotide was tested by in vitro expression.

[0209] HeLa cells (10,000 cells) were transfected with 0.1 pmol of purified circular polyribonucleotide using a transfection reagent (Lipofectamine MessengerMax (ThermoFisher, LMRNA015)). Supernatants were analyzed at 6, 24, 48, and 72 hours by measuring Gaussia luciferase activity using a Gaussia Luciferase activity assay (Pierce Gaussia Luciferase Flash Assay Kit (16159)).

[0210] This example demonstrates successful protein expression from enriched circular RNA (Figure 11).

[0211] Example 10: Selective enrichment of circular polyribonucleotides of various molecular weights This example demonstrates the ability to selectively enrich circular polyribonucleotides using a combination of 5' and 3' exonucleases across a wide range of molecular weight sizes.

[0212] In this example, 150.0 μg of various polyribonucleotides were digested simultaneously with 0.625 U RNase R and 0.0625 U Terminator™ exonuclease per μg of RNA for 60 min at 37° C. in Buffer 2. The molecular weights for each of the encoded polyribonucleotide ORFs evaluated were varied. Each of RNA1-RNA6 is an identical circular polyribonucleotide with expressed sequences of different sizes ranging from less than 1.2 kb to more than 5.4 kb, with molecular weights increasing from left to right. In each case, digestion was quenched with EDTA and analyzed by anion exchange high performance liquid chromatography (AEX-HPLC). The percentage of total polyribonucleotides that were circular polyribonucleotides (% circular RNA) after exonuclease digestion was compared to the percentage of circular polyribonucleotides in the mixture before digestion. Figure 12 shows the results of this example for selective enrichment of circular polyribonucleotides in the size ranges less than 1.2 kb, 1.2-1.4 kb, 1.4-1.6 kb, 3.5-4.5 kb, 4.5-5.4 kb, and greater than 5.4 kb. The circular populations of total polyribonucleotides prior to digestion were determined to be 71.4, 59.0, 64.1, 21.9, 21.2, and 17.6 percent, respectively. After digestion with RNase R and Terminator™, the circular populations of these same polyribonucleotides were found to be enriched to 86.0, 79.4, 80.2, 32.0, 48.9, and 25.7 percent, respectively.

[0213] Example 11: Enrichment of circular polyribonucleotides using different combinations of 5' and 3' exonucleases This example demonstrates the ability to selectively enrich a circular polyribonucleotide population using a combination of four 5' and 3' exonucleases.

[0214] In this example, 150.0 μg of polyribonucleotides were simultaneously digested with (i) 0.625 U RNase R(a) and 0.0625 U Terminator™; (ii) 0.625 U RNase R(a) and 0.0625 U Xrn-1; (iii) 0.625 U RNase R(b) and 0.0625 U Terminator™; or (iv) 0.625 U RNase R(b) and 0.0625 U Xrn-1 exonuclease per μg of RNA for 60 min at 37° C. Each digestion was quenched with EDTA and analyzed by anion exchange high performance liquid chromatography (AEX-HPLC). The percentage of total polyribonucleotides that were cyclic polyribonucleotides (% cyclic RNA) after exonuclease digestion was compared to the percentage of cyclic polyribonucleotides before digestion. The results of this example demonstrate that selective enrichment of circular polyribonucleotide species can be achieved with various combinations of 5' and 3' exonucleases. Figure 13 shows the results of co-digestion using (i) RNase R(a) and Terminator™; (ii) RNase R(a) and Xrn-1; (iii) RNase R(b) and Terminator™; and (iv) RNase R(b) and Xrn-1. The percentage of circular polyribonucleotides in the post-IVT polyribonucleotide mixture was only 18.2% before the co-digestion process. After co-digestion, the percentage of circular polyribonucleotides was found to be enriched to (i) 36.0±0.91; (ii) 39.0±0.03; (iii) 30.2±0.70; and (iv) 36.5±2.23 percent, respectively.

Claims

1. A method for producing a concentrated population of circular polynucleotides, comprising: (a) providing a polynucleotide population comprising circular polynucleotides and linear polynucleotides; (b) digesting at least a portion of the linear polynucleotides with a 5'-exonuclease in an amount of 0.01 U to 0.2 U per μg of polynucleotides; and (c) digesting at least a portion of the linear polynucleotides with a 3'-exonuclease in an amount of 0.4 U to 4 U per μg of polynucleotides ; thereby producing a concentrated population of circular polynucleotides.

2. The method according to claim 1, wherein at least a portion of the 5'-terminus of the linear polynucleotide contains a monophosphate moiety.

3. The method according to claim 1 or claim 2, wherein the 5'-exonuclease is a 5'-phosphate-dependent exonuclease.

4. The method according to claim 3, wherein the 5'-exonuclease is Xrn-1.

5. The method according to claim 1 or claim 2, wherein the 3'-exonuclease is RNase R or Exonuclease T.

6. (a) The digestion step (b) is carried out for 30 minutes to 90 minutes, or (b) The digestion step (b) is carried out at a temperature of about 37 °C, or (c) The digestion step (c) is carried out for 30 minutes to 90 minutes, or (d) The digestion step (c) is carried out at a temperature of about 37 °C, The method according to claim 1 or claim 2.

7. The digestion steps (b) and (c) are carried out in a digestion buffer containing Mg 2+ or dithiothreitol, according to the method of claim 1 or claim 2.

8. The method according to claim 1 or claim 2, wherein the 5'-exonuclease in step (b) is in an amount of 0.012 U to 0.1 U per μg of polynucleotides.

9. The method according to claim 1 or claim 2, wherein the 3'-exonuclease in step (c) is in an amount of 0.4 U to 2 U per μg of polynucleotides.

10. After the digestion steps (b) and (c), (a) the percentage (w / w) of the circular polynucleotides is 40% to 95% of the total polynucleotides, or (b) the total percentage yield (w / w) of the circular polynucleotides is 70% to 100%, The method according to claim 1 or claim 2.

11. A method for producing a concentrated population of circular polynucleotides, comprising: Providing a polynucleotide population comprising a circular polynucleotide and a linear polynucleotide; Digesting at least a portion of the linear polynucleotide with a 5'-exonuclease, and Digesting at least a portion of the linear polynucleotide with a 3'-exonuclease comprising The digestion steps (b) and (c) are carried out in a digestion buffer containing 0.05 mM to 1 mM Mg 2+ and / or 0.1 mM to 5 mM dithiothreitol; a method for producing an enriched population of circular polynucleotides thereby. **Claim 12** The method according to claim 11, wherein the 5'-exonuclease is in an amount of 0.01 U to 0.2 U per μg of polynucleotide. **Claim 13** The method according to claim 11, wherein the 3'-exonuclease is in an amount of 0.4 U to 4 U per μg of polynucleotide. **Claim 14** The method according to any one of claims 11 to 13, wherein the 5'-exonuclease is a 5'-phosphate-dependent exonuclease. **Claim 15** The method according to claim 14, wherein the 5'-exonuclease is Xrn-1. **Claim 16** The method according to any one of claims 11 to 13, wherein the 3'-exonuclease is RNase R or Exonuclease T. **Claim 17** (a) The digestion step (b) is carried out for 30 minutes to 90 minutes, or (b) The digestion step (b) is carried out at a temperature of about 37°C, or (c) The digestion step (c) is carried out for 30 minutes to 90 minutes, or (d) The digestion step (c) is carried out at a temperature of about 37°C, The method according to any one of claims 11 to 13. **Claim 18** The method according to any one of claims 11 to 13, wherein the 5'-exonuclease in step (b) is in an amount of 0.012 U to 0.1 U per μg of polynucleotide. **Claim 19** The method according to any one of claims 11 to 13, wherein the 3'-exonuclease in step (c) is in an amount of 0.4 U to 2 U per μg of polynucleotide. **Claim 20** After the digestion steps (b) and (c), (a) The percentage (w / w) of the circular polynucleotide is 40% to 95% of the total polynucleotide, or (b) The total percentage yield (w / w) of the circular polynucleotide is 70% to 100%, The method according to any one of claims 11 to 13.