Retinal organoid model system

Abstract

The present disclosure relates to genetically engineered retinal organoids that can be used to test therapeutic treatments.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is an international patent application claiming the benefit of U.S. Provisional Application No. 63 / 238,415, filed August 30, 2021, the entire contents of which are incorporated herein by reference. Statement regarding government support This invention was made with government support under awards EY021218 and EY031230 from the National Institutes of Health. The Government has certain rights in the invention. Electronic Sequence Listing Reference A computer readable form of the Sequence Listing is attached to this application by electronic submission and is incorporated by reference in its entirety. The Sequence Listing is contained in a file named "21-0000-WO.xml", created on August 16, 2022, and is 14 kilobytes in size. FIELD OF THEINVENTION The present disclosure relates to genetically engineered retinal organoids and uses thereof. [Background technology]

[0002] 2. Description of Related Art With numerous human disorders directly attributable to genetic mutations, the retina is at the forefront of gene therapy testing for many reasons, and even companies not ultimately interested in ocular disease often "start" their trials in the eye due to its distinct advantages. For example, the retina is easily accessible using standard surgical procedures, and experimental risks are relatively low. Many standardized non-invasive imaging and functional tests are available to monitor therapeutic effects in retinal models, and many different genes and genetic mutations (e.g., missense, nonsense, frameshift, cryptic splice variants, coding / non-coding) lead to functional impairment and blindness, with significant genotype-phenotype heterogeneity. Nonetheless, there remains a need for robust, clinically relevant in vitro models that can be used to test gene therapies in the laboratory. Summary of the Invention

[0003] The ability to generate authentic prenatal neural retinal cell types and tissues from human embryonic stem cells and induced pluripotent stem cells (hESCs and hiPSCs, respectively, collectively known as human pluripotent stem cells (hPSCs)) has spurred their use for in vitro disease modeling. Most of these studies have employed hPSC differentiation methods in which retinal progeny are grown in suspension culture as isolated 3D optic vesicle-like structures (OVs), also known as retinal organoids. Advantages of such 3D culture techniques include the yield of a high percentage of retinal cell types with little or no non-retinal contamination, and their tendency to self-organize into mature tissue structures. However, further refinement of model systems is required to more easily and rapidly test novel therapeutics for genetic disorders, and there is still an urgent need to develop model systems that mimic genetic disorders to facilitate the identification of novel clinically relevant therapies for genetic disorders.

[0004] Quick Overview As described herein, in a first aspect, the present disclosure provides a retinal organoid model system comprising a population of human pluripotent stem cell (hPSC) derived photoreceptor (PR) cells.PR cells are adapted to form interphotoreceptor matrix (IPM) with visible outer segments on its surface upon restoration of the function of genes encoding the structural components of IPM. In one embodiment of the first aspect, the hPSCs are human embryonic stem cells (hESCs) or human induced pluripotent stem cells (hiPSCs). In one embodiment of the first aspect, the function of the gene is reversible by administration of a therapeutic treatment to the retinal organoid. In one embodiment, the therapeutic treatment comprises a protein, a virus, an RNA molecule, a DNA molecule, or a small molecule. In one embodiment, the therapeutic treatment further comprises a gene editor, a base editor, an RNA editor, a small molecule targeting DNA / RNA, or a cell therapy. In another embodiment of the first aspect, the hPSCs are hiPSCs. In one embodiment, the hiPSCs are derived from a patient with a spontaneous mutation in a gene encoding a structural component of the IPM. In one embodiment, the spontaneous mutation is one or more of a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a non-coding mutation. In one embodiment, the hiPSCs are recombinant hiPSCs comprising an engineered mutation in at least one allele of a gene encoding a structural component of the IPM. In one embodiment, the engineered mutation is one or more of a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a non-coding mutation. In another embodiment of the first aspect, the hPSCs are hESCs. In one embodiment, the hESCs are H9, H1, H7, BG01, BG02, HES-3, HES-2, HSF-6, HUES9, HUES7, or I6. In one embodiment, the hESCs are recombinant hESCs that include an engineered mutation in at least one allele of a gene encoding a structural component of the IPM. In one embodiment, the engineered mutation is one or more of a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a non-coding mutation. In another embodiment of the first aspect, the gene encoding a structural component of the IPM is IMPG1 or IMPG2. In one embodiment, the gene encoding a structural component of the IPM is IMPG2.

[0005] In a second aspect, the present disclosure provides a retinal organoid model system comprising a population of human pluripotent stem cell (hPSC)-derived photoreceptor (PR) cells. The PR cells comprise a recombinant gene encoding a structural part of interphotoreceptor matrix (IPM). The recombinant gene comprises at least one of a first non-functional allele with a first engineered genetic mutation and / or a second non-functional allele with a second engineered genetic mutation. The restoration of the function of at least one of the first and second alleles produces an IPM that comprises an outer segment visible on the surface of the PR cells. In one embodiment of the second aspect, the hPSCs are human embryonic stem cells (hESCs) or human induced pluripotent stem cells (hiPSCs). In one embodiment of the second aspect, the function of the gene is restored by administration of a therapeutic treatment to the retinal organoid. In one embodiment, the therapeutic treatment comprises a protein, a virus, an RNA molecule, a DNA molecule, or a small molecule. In one embodiment, the therapeutic treatment comprises a gene editor, a base editor, an RNA editor, a small molecule targeting DNA / RNA, or a cell therapy. In one embodiment of the second aspect, the hPSCs are hiPSCs. In one embodiment of the second aspect, the first engineered genetic mutation is one or more of a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a noncoding mutation. In one embodiment of the second aspect, the second engineered genetic mutation is one or more of a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a noncoding mutation. In one embodiment of the second aspect, the first engineered genetic mutation and the second engineered genetic mutation are the same mutation. In another embodiment of the second aspect, the hPSCs are hESCs. In one embodiment, the hESCs are H9, H1, H7, BG01, BG02, HES-3, HES-2, HSF-6, HUES9, HUES7, or I6. In another embodiment of the second aspect, the gene encoding a structural component of the IPM is IMPG1 or IMPG2. In one embodiment, the gene encoding a structural component of the IPM is IMPG2.

[0006] In a third aspect, the present disclosure provides a method for testing the effectiveness of therapeutic treatment using the retinal organoid model system of any one of the above aspects or these embodiments.The method includes administering a candidate therapeutic treatment to the retinal organoid model system to restore the function of the gene encoding the structural component of IPM; visualizing the photoreceptor outer segment in the IPM of the retinal organoid model system; and detecting the change in IPM.A change in the generation and / or maintenance of the photoreceptor outer segment visible under a microscope in the IPM of the retinal organoid model system indicates that the therapeutic treatment is effective in restoring the function of the gene encoding the structural component of IPM, and no change in the generation and / or maintenance of the photoreceptor outer segment visible under a microscope in the IPM of the retinal organoid model system indicates that the therapeutic treatment is not effective. In one embodiment of the third aspect, the method further comprises visualizing the IPM prior to administration of the therapeutic candidate. In one embodiment of the third aspect, visualizing the IPM of the retinal organoid model system comprises qualitatively observing or quantifying the presence of visible photoreceptor outer segments on the surface of the PR cells.

[0007] In a fourth aspect, the present disclosure provides a method for testing whether a therapeutic treatment is effective against a genetic mutation, comprising generating a retinal organoid model system comprising a population of human pluripotent stem cell (hPSC)-derived photoreceptor (PR) cells adapted to express an interphotoreceptor matrix (IPM) having a visible outer segment on its surface upon restoration of function of a gene encoding a structural component of the IPM. The gene encoding a structural component of the IPM comprises a predetermined or pre-existing genetic mutation. The method further comprises administering a candidate therapeutic treatment to the retinal organoid model system, and evaluating the retinal organoid model system for the presence or absence of a visible outer segment in the IPM. The presence of a visible outer segment of the IPM indicates that the candidate therapeutic treatment effectively treats the predetermined genetic mutation to restore the function of the gene encoding a structural component of the IPM. In one embodiment of the fourth aspect, the evaluation further comprises determining the presence or absence of alteration of the IPM using qualitative observation or quantification of visible outer segments on the surface of the PR cells, and an increase in the presence or amount of visible outer segments indicates the presence of alteration of the IPM of the retinal organoid model system. In one embodiment of the fourth aspect, the therapeutic treatment comprises a protein, a virus, an RNA molecule, a DNA molecule, a gene therapy, or a small molecule. In one embodiment, the therapeutic treatment comprises a gene editor, a base editor, an RNA editor, a small molecule targeting DNA / RNA, or a cell therapy. In one embodiment, the virus comprises an adeno-associated virus vector (AAV) or a lentivirus. In one embodiment, the therapeutic treatment comprises a genome or base editing technology, a nanoparticle, or a cell delivery mechanism. In one embodiment of the fourth aspect, the predetermined genetic mutation comprises a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a noncoding mutation, or a knockout mutation. In one embodiment of the fourth aspect, the candidate therapeutic treatment is a candidate for the treatment of a genetic disease. In one embodiment, the genetic disease is cystic fibrosis, sickle cell anemia, hemochromatosis, Huntington's disease, Duchenne muscular dystrophy, Tay-Sachs disease, Angelman syndrome, ankylosing spondylitis, Marfan syndrome, or thalassemia.

[0008] In a fifth aspect, the disclosure provides a method of producing a retinal organoid model system, comprising: engineering one or more genetic mutations in genes encoding structural portions of the interphotoreceptor matrix (IPM) in a population of human pluripotent stem cells (hPSCs); and inducing differentiation of the hPSCs into a retinal lineage, said differentiation resulting in three-dimensional (3D) retinal organoids comprising photoreceptor (PR) cells adapted to express outer segments visible within the IPM on their surface upon restoration of function of the genes encoding structural components of the IPM. In a sixth aspect, the present disclosure provides a method for producing a retinal organoid model system, comprising: obtaining a tissue sample from a subject having a mutation in a gene encoding the structural part of interphotoreceptor matrix (IPM); establishing a population of human induced pluripotent stem cells (hiPSCs) from said tissue sample; and inducing said hiPSCs to differentiate into a retinal lineage, said differentiation producing a three-dimensional (3D) retinal organoid comprising photoreceptor (PR) cells. The PR cells are adapted to express interphotoreceptor matrix (IPM) structural proteins, and the restoration of IPM structure allows the generation and maintenance of visible photoreceptor outer segments on the surface of the retinal organoid.

[0009] The accompanying drawings are included to provide a further understanding of the methods and compositions of the present disclosure, and are incorporated in and constitute a part of this specification. The drawings illustrate one or more non-limiting embodiments of the present disclosure and, together with the description, serve to explain the principles and operation of the present disclosure. [Brief description of the drawings]

[0010] [Figure 1] Figures 1A-1D show light microscopic classification of hPSC-ROs during differentiation: (Figure 1A) stage 1 hPSC-ROs; (Figure 1B) stage 2 hPSC-ROs; (Figures 1C and 1D) stage 3 hPSC-ROs. Figure 1D is a magnified image of the boxed area in Figure 1C, showing photoreceptor outer segments (brackets). Scale bars are 100 µm (Figures 1A and 1C) and 25 µm (Figures 1B and 1D). [Diagram 2] 2A-2E show that differentiation of hPSC-RO containing IMPG2 mutations results in the absence of photoreceptor outer segments: (Fig. 2A) iPSC IMPG2Y254C / A805(fs)Ter, (Fig. 2B) iPSC IMPG2Y254C / +, (Fig. 2C) iPSC IMPG2- / -, (Fig. 2D) H9 IMPG2Y254C / Y254C, and (Fig. 2E) H9 IMPG2- / -. Scale bar = 25 μm. [Diagram 3]Figures 3A-3D show that stage 3 genetically corrected IMPG2 hPSC-ROs exhibit photoreceptor outer segments: (Figure 3A, 3B) iPSC IMPG2+ / + ROs exhibit complete restoration of photoreceptor outer segments along the surface. A magnified image of the RO shown in (Figure 3A) is shown in (Figure 3B). (Figure 3C, 3D) shows a wild-type H9 RO. Scale bars = 100 µm (Figure 3A, 3C); 25 µm (Figure 3B, 3D). [Figure 4] Figures 4A-4E show optical microscopy images of RO derived from mixed cultures of wild-type (WT) and mutant (MT) IMPG2 hPSCs. Figure 4A shows 100% WT control hPSC-RO, Figure 4B shows 50:50 WT:MT hPSC-RO; Figure 4C shows 20:80 WT:MT hPSC-RO, Figure 4D shows 5:95 WT:MT hPSC-RO, and Figure 4E shows 100% MT IMPG2 hPSC-RO. Scale bars = 20 µm. [Diagram 5] Figure 5 shows fluorescent confocal images of WT(CRX-TdTomato):MT IMPG2 mixed hPSC-RO. The WT portion of IMPG2 hPSC-RO (left of dashed line) shows strong expression of IMPG2, which roughly corresponds to CRX-TdTomato expression. The MT portion (right of dashed line) shows little to no expression of either IMPG2 or CRX-TdTomato. [Figure 6] Figure 6 shows an example of a base editing approach to correct a mutation in IMPG2. The sequences shown in the figure correspond, from top to bottom, to SEQ ID NOs: 3 to 5, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Detailed Description definition Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this disclosure belongs. In this application, unless otherwise specified, the techniques utilized may be found in any of several prior art sources, such as: Molecular Cloning: A Laboratory Manual (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press); Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991, Academic Press, San Diego, CA), "Guide to Protein Purification" in Methods in Enzymology (edited by MP Deutscher, (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis et al. 1990. Academic Press, San Diego, CA); Culture of Animal Cells: A Manual of Basic Technique, 2nd Edition (RI Freshney. 1987. Liss, Inc. New York, NY); Gene Transfer and Expression Protocols, pp. 109-128, edited by EJ Murray, The Humana Press Inc., Clifton, NJ); and the Ambion 1998 Catalog (Ambion, Austin, TX).

[0012] As used herein, ranges and amounts can be expressed as "about" a particular value or range. About includes the exact amount. For example, "about 5%" means "about 5%" and "5%." The term "about" can also refer to ±10% of a given value or range of values. Thus, about 5% also means, for example, 4.5% to 5.5%. As used herein, the terms "or" and "and / or" are used to describe multiple elements in combination with each other or exclusively. For example, "x, y, and / or z" can refer to "x" alone, "y" alone, "z" alone, "x, y, and z," "(x and y) or z," "x or (y and z)," or "x or y or z." In this disclosure, "comprises, comprising," "containing," "having," and the like, shall have the meaning given to them in United States Patent Law and may mean "includes, including," and the like. As used herein, the terms "determining," "assessing," "assaying," "measuring," "detecting," and "identifying" refer to both quantitative and qualitative determinations, and thus, these terms may be used interchangeably, although their quantitative or qualitative nature, where applicable, will be understood in context by one of ordinary skill in the art. As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0013] As used herein, "retinal organoids" are in vitro generated cell clusters that mimic the cellular ultrastructure and function of retinal tissue. As used herein, "retinal organoid model system" refers to retinal organoids that can be used to identify or evaluate therapeutic treatments for genetic mutations. As used herein, "pluripotency" refers to the ability of a cell to differentiate into cells of all three germ layers. As used herein, the term human "pluripotent stem cells" (hPSCs) refers to cells that have the capacity for continued self-renewal and the ability to differentiate under appropriate conditions into cells of all three germ layers. Examples of hPSCs include human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs). As used herein, "iPS cells" refer to cells that are substantially genetically identical to the respective differentiated somatic cells of origin, as described herein, and that exhibit characteristics equivalent to more potent cells, such as embryonic stem (ES) cells. These cells can be obtained by reprogramming non-pluripotent (e.g., multipotent or somatic) cells.

[0014] "Photoreceptor cells" or "PR cells", as used herein, are a specialized type of neuroepithelial cell capable of visual light transduction and consist of inner and outer segments. There are two types of PR cells: rods and cones. Rods are adapted for low light vision to see in grayscale, and cones are adapted for daytime vision to see in color. As used herein, the term "constitute" means to develop, express, or present. For example, PR cells are adapted to constitute the interphotoreceptor matrix (IPM), which is adapted to develop, express, and / or present the IPM. The term "interphotoreceptor matrix" or "IPM", as used herein, is a highly organized structure that is located between the photoreceptors and the retinal pigment epithelium (RPE). The IPM is an essential component of the healthy normal retina and is important for transporting metabolites, retinal adhesion, and photoreceptor alignment. As used herein, the "outer segment" is the portion of the PR cell that is closest to the brain and furthest from the visual field. The outer segment is the portion of the PR cell that absorbs light.

[0015] As used herein, the term "wild type" refers to a normal, healthy, and / or unaltered state. For example, when an unmutated gene is expressed, a wild-type phenotype results. Additionally, a wild-type gene refers to a gene that, when expressed, results in a normal functional phenotype. As used herein, the term "phenotype" refers to the set of observable characteristics that result from a genotype. For example, a wild-type phenotype refers to a phenotype that is the result of the normal expression of a wild-type gene or set of genes. As used herein, an "allele" is any one of two or more versions of a gene that can exist alternatively at a certain site (locus) on a chromosome. Alleles may exist in pairs, or there may be multiple alleles that affect the expression of a particular trait (phenotype) that can be attributed to the gene responsible for that trait.

[0016] As used herein, "visible outer segment" or "visible IPM phenotype" refers to an IPM that has hair-like photoreceptor structures in the outer segments of PR cells that are visually observable, for example with the use of a microscope. The term "restoration of function", when used in reference to a partially functional or non-functional gene, refers to the restoration of a wild-type phenotype when the gene is expressed. For example, restoration of function of a gene may occur when a mutation in the gene is functionally repaired by a therapeutic agent to restore the wild-type phenotype (without necessarily readjusting the gene itself to a wild-type, non-mutated form). It is contemplated herein that restoration of function may be partial, i.e., may not require a complete return to full wild-type function (or phenotype). In this context, restoration of function may be viewed as an improvement in function that is deemed clinically relevant. For example, partial restoration of function of a gene may result in partial restoration of vision and / or a reduction in the rate of vision loss in an individual treated with a therapeutic agent, as contemplated herein.

[0017] The term "mutation" is defined as a change in the sequence or structure of a gene that results in a variant form of the gene or a part thereof that can be transmitted to the next generation. Mutations can occur, for example, by single base unit changes in DNA, or by deletion, insertion, or rearrangement of larger segments of the gene. A "natural" genetic mutation is a mutation in a gene, or part thereof, that occurs spontaneously within a population. For example, a natural mutation may be inherited and may be associated with a genetic disease, such as retinitis pigmentosa. As used herein, "recombinant" as used herein refers to a gene, cell, or tissue that has been intentionally genetically altered or engineered. The term "genetically engineered," when used in reference to a gene, refers to a gene or a portion thereof that does not occur in nature, due to genetic engineering of one or both alleles of the gene. For example, a gene having a non-functional allele may be the result of one or more engineered genetic mutations introduced into that allele. The engineered mutations may be predetermined or random and may result in changes in the expression level or expressed phenotype of the gene. Cells and / or tissues that contain one or more engineered genes are also considered to be recombinant or engineered.

[0018] As used herein, a "predetermined gene mutation" refers to a gene mutation whose gene sequence is known. For example, a predetermined gene mutation can be added to a gene to disrupt the function of that gene. In a particular example, a predetermined gene mutation can be introduced into a gene that codes for a structural element of the IPM of a retinal organoid. This mutation disrupts the expression of the gene, thereby impairing the IPM structure and leading to the disappearance of the visible IPM phenotype. Examples of predetermined gene mutations include one or more of missense mutations, nonsense mutations, frameshift mutations, cryptic slice variant mutations, coding mutations, or non-coding mutations, and / or knockout mutations.

[0019] As used herein, an "effective or sufficient amount" or a "therapeutically effective amount" is an amount of an agent, such as a therapeutic agent, sufficient to induce a particular cellular effect according to the present disclosure. For example, an effective or sufficient amount of a therapeutic agent effective to treat a genetic mutation is an amount of the therapeutic agent that, when administered to a subject, results in partial or complete restoration of the function of the gene. As used herein, "therapeutic treatment" refers to treatment with a therapeutic agent to provide a positive clinical effect or therapeutic benefit, such as restoration of gene function or a wild-type phenotype.

[0020] A "candidate therapeutic treatment" is an experimental treatment where the efficacy of the treatment has not been established. As used herein, a "therapeutic agent" may refer to a substance, such as a chemical compound, compound, and / or pharmaceutical composition, that, when administered to a subject in need thereof in a therapeutically effective amount, provides a therapeutic benefit to the subject having the particular disease or disorder being treated. Other examples of therapeutic agents may include genetically modified cells for use in cell therapy. As used herein, "therapeutic benefit" refers to the eradication or amelioration of the underlying disease being treated and / or the eradication or amelioration of one or more symptoms associated with the underlying disease, such that a subject being treated with a therapeutic agent reports an improved feeling or condition, even though the subject may still be suffering from the underlying disease. Further examples of therapeutic benefit include partial or complete restoration of gene function and / or partial or complete restoration of phenotype. Still further examples of therapeutic benefit include partial or complete cessation of loss of function associated with a particular disease. In a specific example, a person experiencing therapeutic benefit may experience an improvement or restoration of vision associated with retinitis pigmentosa, or a reduction in the rate of vision loss.

[0021] By "subject" or "patient" is meant a mammal, including, but not limited to, a human, such as a human patient, a non-human primate, or a non-human mammal, such as a cow, horse, dog, sheep, or cat. As used herein, "treatment" refers to alleviating, reducing, reducing, ameliorating, eliminating, or ameliorating a disorder and / or one or more symptoms associated therewith. Although not precluded, it will be recognized that treating a disorder or condition does not require the complete elimination of the disorder, condition, or symptoms associated therewith.

[0022] overview The present disclosure provides a retinal organoid model system for identifying and / or evaluating the efficacy of therapeutic treatments against genetic mutations. The retinal organoid model system contains a genetic mutation that disrupts the IPM, which can result in the loss of visible hair-like, outer segment structures of photoreceptors. This loss of the outer segment of PR cells is a readily visible phenotype that indicates the presence of a genetic mutation. Partial or complete restoration of the visible outer segment of the IPM by administration of a candidate therapeutic treatment indicates that the candidate therapeutic treatment is effective in treating the genetic mutation. Thus, the retinal organoid model system of the present disclosure provides a means to rapidly evaluate the efficacy of a candidate therapeutic treatment against a genetic disease. Furthermore, although these model systems are based on retinal organoids, the genetic mutations that can be tested are not limited to those that have adverse effects on the eye. As described elsewhere herein, any genetic mutation can be introduced into these systems to cause the loss of visible outer segments of the IPM. Thus, candidate therapeutic treatments that are being considered for the treatment of other genetic diseases other than the eye caused by specific mutations can be tested in the systems provided herein. As a result, the present disclosure introduces a powerful new tool for the rapid qualitative evaluation of new clinically relevant treatments for genetic disorders.

[0023] Retinal Organoids In one embodiment, the retinal organoid of the present disclosure is a cell cluster that mimics the cellular ultrastructure and function of retinal tissue. The cell cluster forms an isolated 3D optic vesicle-like structure (OV) with a three-dimensional (3D) retinal cup containing retinal ganglion cells, horizontal cells, amacrine cells, bipolar cells, Müller cells, and photoreceptor (PR) cells (i.e., rods and cones) and a fully laminated 3D retinal tissue containing retinal pigment epithelium (RPE). In healthy or wild-type retinal organoids, PR cells with wild-type IPM produce visible outer segments on the IPM surface. This visible outer segment, which looks like a hair-like structure, can be easily visualized using any kind of suitable microscopy and can serve as a visible phenotype that indicates healthy wild-type retinal organoids. Methods for visualizing outer segments and the IPM can include, but are not limited to, light microscopy, electron microscopy, and scanning probe microscopy. Various examples of light microscopy include bright field, confocal, and fluorescence microscopy.

[0024] The retinal organoids of the present disclosure can be generated using human pluripotent stem cells (hPSCs). For example, hPSCs can be induced to develop into the various cell types present in the retinal organoid model system by differentiation protocols such as those outlined in Meyer et al. (2009, PNAS, 106(39): 16698-16703), which is incorporated herein by reference. In various embodiments, the hPSCs can be human embryonic stem cells (hESCs). In some embodiments, the hPSCs can be human induced pluripotent stem cells (hiPSCs) (Zhong et al., 2014, Nature Communications, 5: 4047). In further embodiments, the contemplated retinal organoid model system can be generated using a combination of hESCs and hiPSCs. Non-limiting examples of hESCs that can be used include WA09, WA01, WA07, BG01, BG02, HES-3, HES-2, HSF-6, HUES9, HUES7, and I6 embryonic stem cells (Thomson et al., 1998, Science, 282, no. 5391: 1145-1147). A registry of contemplated human embryonic stem cell lines can be found at the NIH Human Embryonic Stem Cell Registry. The retinal organoids of the present disclosure can be generated by the methods found in Capowski et al. (2019, Development, 146, no. 1), the entirety of which is incorporated by reference herein.

[0025] The retinal organoids of the model system can be generated in vitro, can be wild-type retinal organoids, or can contain natural or engineered genetic mutations in genes encoding one or more structural components of the IPM. In wild-type retinal organoids of the model system, the outer segments of the IPM are visible under a microscope and appear as thin hair-like structures on the surface of the IPM. In contrast, retinal organoids containing one or more genetic mutations in genes encoding structural components of the IPM show a reduced number of visible outer segments of the IPM and / or a complete loss of visible outer segments. Structural components of the IPM include, among others, RPE, PHAMM, IMPG2, IMPG1, PEDF, CD44, Müller cells, and hyaluronan (Ishikawa, et al., 2015 Experimental Eye Research, Ocular extracellular matrix: Role in development, homeostasis and disease, 13: 3-18).

[0026] Disease Models Retinal disorders can be associated with characteristic changes in IPM components. These IPM changes can result in changes in the visible phenotype. One example of a retinal disorder is retinitis pigmentosa (RP). RP is a heterogeneous group of rare inherited retinal degenerative diseases characterized primarily by progressive loss of photoreceptors over years to decades. RP can be caused by mutations in over 80 genes involved in photoreceptor function and maintenance. In one example of RP, the IMPG2 gene is mutated, leading to loss of the PR outer segments and eventual death of rods and cones, followed by blindness. In this type of RP, impaired IMPG2 gene expression leads to easily visible outer segment loss and can be easily diagnosed based on the absence of visible ciliated outer segments on the IPM surface. In various embodiments of the present disclosure, retinal organoid model system can comprise one or more genetic mutations; genetic mutations in one or both alleles of genes; and / or one or more genetic mutations in genes encoding structural components of IPM. Such genetic mutations lead to the reduction or loss of visible outer segments on the surface of IPM. Thus, the presence of one or more mutations in one or both alleles of one or more genes encoding structural components of IPM can be visualized based on outer segments of IPM phenotype.

[0027] In various embodiments, genes encoding structural components of IPM may include IMPG1, IMPG2, perlecan, HCAM, HAPLN1, HAPLN4, and / or versican. In a preferred embodiment, the engineered structural gene is IMPG2. In various embodiments of the present disclosure, mutations in genes encoding structural components of IPM may be naturally occurring or genetically engineered and may include one or more of missense mutations, nonsense mutations, frameshift mutations, cryptic slice variant mutations, coding mutations, and / or non-coding mutations.

[0028] Various examples of spontaneous mutations in genes encoding structural components of the IPM include missense mutations such as Y254C, or frameshift mutations such as A805(fs)Ter, or nonsense mutations. Published mutations can be found in papers such as Bandah-Rozenfeld et al. (2010, American Journal of Human Genetics 87 (2): 199-208) and Brandl et al. (2017, Genes 8 (7): 170). Other natural variants can be found at www.uniprot.org / uniprot / Q9BZV3. Various examples of engineered genetic mutations that can be introduced into genes encoding structural components of the IPM include nonsense mutations such as Y254C, or frameshift mutations such as A805(fs)Ter.

[0029] In various embodiments of the present disclosure, the retinal organoids of the present disclosure are generated to contain a predetermined genetic mutation, such as a genetic mutation found in a genetic disease. In various embodiments, the retinal organoid model system can comprise engineered genetic mutations in at least one or both alleles of genes encoding structural components of IPM.In one non-limiting example, the retinal organoid model system comprises one or more engineered mutations in one or both IMPG2 alleles. In various examples of this embodiment, the engineered genetic mutation is IMPG2 Y254C / A805(fs)Ter , IMPG2 Y254C / + , IMPG2 - / - , and / or IMPG2 Y254C / Y254C It is.

[0030] There are many genetic diseases caused by well-characterized and reproducible genetic mutations.The retinal organoids of the present disclosure can generate those carrying genetic mutations of known genetic diseases, and in this way, such retinal organoids can be used to test therapeutic drugs intended to treat these diseases.The examples of genetic diseases with genetic mutations that are intended to be tested in the retinal organoid model system of the present disclosure include, but are not limited to, cystic fibrosis, Marfan syndrome, sickle cell anemia, hemochromatosis, Huntington's disease, Duchenne muscular dystrophy, Tay-Sachs disease, Angelman syndrome, ankylosing spondylitis, and thalassemia. In one non-limiting example, the retinal organoid model system of the present disclosure can be engineered to contain deletions in one or both alleles of the genes encoding the structural components of the IPM, such that the deletions mimic the most common deletions known to cause cystic fibrosis.The retinal organoid model system can then be used to evaluate methods for restoring the function of genes and candidate therapeutic treatments for cystic fibrosis.

[0031] Functional restoration and therapeutic treatment The retinal organoid model system of the present disclosure is designed to generate a visible phenotype in response to the restoration of function of one or more genetic mutations of genes encoding structural components of the IPM. The restoration of function of genetic mutations results in the restoration of visible ciliary outer segments on the surface of the IPM. Thus, the restoration of function of one or more genetic mutations of genes encoding structural components of the IPM can be visualized by the presence of visible outer segments on the surface of the IPM. Thus, the retinal organoid model system of the present disclosure provides a phenotype that is easily visualized and directly corresponds to the functional genotype of genes encoding structural components of the IPM. The restoration of function can occur by any mechanism suitable for the restoration of gene function. Restoration of visible outer segments in the IPM may include a partial or complete increase in the number, size, or density of outer segments. Restoration does not require a complete return to wild-type appearance (or phenotype) and may include any clinically relevant visible improvement. Restoration of the IPM outer segment phenotype may vary depending on the mutation of the genes encoding the structural components of the IPM and the mechanism for restoration of gene function.

[0032] In one example, gene function can be restored by administering therapeutic treatment to retinal organoid model system.In various embodiments of this example, therapeutic treatment can include, but is not limited to, treatment with protein, virus, RNA molecule, DNA molecule, small molecule, gene editor, base editor, RNA editor, small molecule that targets DNA / RNA, or cell therapy, and any combination thereof. In some non-limiting examples, candidate therapeutic treatments include gene augmentation, genome editing, base editing, RNA trans-splicing molecules, antisense oligonucleotides, nonsense read-through drugs, and the like.

[0033] In various non-limiting examples, viruses that can be used include adenoviruses, adeno-associated viruses (AAV), alphaviruses, flaviviruses, herpes simplex viruses (HSV), measles viruses, rhabdoviruses, retroviruses, lentiviruses, Newcastle disease virus (NDV), poxviruses, and picornaviruses. In various non-limiting examples, a contemplated RNA molecule can be an aptamer, such as pegaptanib. In some embodiments, contemplated DNA molecules can be DNA aptamers, DNAzymes, and oligonucleotides for antigene and antisense applications. In some embodiments, contemplated small molecules are nonsense readthrough drugs. In various non-limiting examples, gene, base, or RNA editors can include CRISPR, cytosine base editors (CBEs), adenine base editors (ABEs), TALEN base editors, zinc finger nucleases, antisense oligonucleotides, RNA trans-splicing molecules, and the like. In various non-limiting examples, contemplated cell therapies include stem cell transplantation.

[0034] In various embodiments, the present disclosure provides a method for testing the effectiveness of therapeutic treatment using retinal organoid model system.These methods include administering a candidate therapeutic treatment for the restoration of the function of genes encoding structural components of IPM to retinal organoid model system; visualizing photoreceptor outer segments in the IPM of retinal organoid model system; and evaluating the presence or absence of change in IPM.The presence of change in the production (i.e., increased production) and / or maintenance (i.e., prevention of loss) of photoreceptor outer segments visible under a microscope in the IPM of retinal organoid model system indicates that the therapeutic treatment is effective in restoring the function of genes encoding structural components of IPM.The absence of change in the production (i.e., increased production) and / or maintenance (i.e., prevention of loss) of visible outer segments of photoreceptors visible under a microscope indicates that the therapeutic treatment is not effective.

[0035] Therapeutic treatments may be administered to the retinal organoid model system using any suitable method, including but not limited to nanoparticle drug delivery, membrane fusion, lipofection, ribonucleoprotein delivery, electroporation, local injection of therapeutic treatments into the organoids, or addition of therapeutic treatments to the medium surrounding the organoids. The methods of the disclosure may further include visualizing the IPM prior to administration of the therapeutic candidate to assess photoreceptor outer segments within the IPM prior to administration of the therapeutic candidate. In various embodiments, visualization of the IPM involves qualitatively observing or quantifying the presence, length, diameter and / or density of visible photoreceptor outer segments on the PR cell surface, hi one embodiment, visualization of the IPM involves identifying only the presence or absence of visible photoreceptor outer segments on the PR cell surface.

[0036] According to the methods of the present disclosure, assessing the status of the IPM can further include determining the presence or absence of alteration of the IPM using qualitative observation or quantification of visible outer segments on the surface of PR cells, with an increase in the presence or amount of visible outer segments indicating the presence of alteration of the IPM of the retinal organoid model system. The status of the IPM can also be assessed by looking at post-translational modifications (i.e., proper glycosylation) of proteoglycan proteins such as IMPG1 and 2. According to a further aspect of the present disclosure, the retinal organoid model system can be used to model various genetic mutations and disorders, and then to test the effectiveness of candidate therapeutic treatments. The effectiveness of candidate therapeutic treatments can be easily evaluated using the clearly visible PR cell outer segment phenotype. In various embodiments of this aspect, the retinal organoid system can be engineered to contain a predetermined genetic mutation that mimics one or more genetic mutations found in genetic diseases, as described elsewhere herein. The retinal organoid model system can then be used to test candidate therapeutic treatments. Effective treatment of genetic mutations can be identified by the restoration of the function of genes that code for structural components of IPM. EXAMPLES

[0037] Working Example The following examples are illustrative of certain embodiments of the present disclosure and various uses thereof. These embodiments are presented for illustrative purposes only and should not be construed as limiting the scope of the present disclosure in any way.

[0038] Example 1: Establishment of hPSC retinal organoids overview In this example, retinal organoids were established using human pluripotent stem cells. Materials and Methods The following hPSC cell lines were used: H9 IMPG2 + / + , H9 IMPG2 - / - , H9 IMPG2 Y254C / Y254C , iPSC-IMPG2 Y254C / A805(fs)Ter , iPSC-IMPG2 Y254C / + , iPSC-IMPG2 - / - , and iPSC IMPG2 + / + . hPSCs were maintained on Matrigel (WICell). To maintain the pluripotency of hPSCs, mTeSR Plus (STEMCELL TECHNOLOGIES) was used. For subculture and generation of embryoid bodies (EBs), ReLeSR (STEMCELL TECHNOLOGIES) was used. EBs were then stepwise transitioned from mTeSR plus to neural induction medium (NIM; DMEM:F12 1:1, 1% N2 supplement, 1x MEM non-essential amino acids (MEM NEAA), 1x GlutaMAX (Thermo Fisher) and 2 mg / mL heparin (Sigma)) over 4 days.

[0039] On day 6, 1.5 nM BMP4 (R&D Systems) was added to fresh NIM, and on day 7, EBs were seeded on Matrigel® at a density of 200 EBs per well in a 6-well plate. On days 9, 12, and 15, half of the medium was replaced with fresh NIM to serially dilute BMP4, and on day 16, the medium was changed to retinal differentiation medium (RDM; DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1x antimycotic antibiotic (Thermo Fisher), and 1x GlutaMAX). On days 25-30, 3D optic vesicle-like structures (OVs) were seen and excised with an MSP ophthalmic surgical knife (Surgical Specialties Corporation). Organoids were maintained in polyHEMA-coated flasks (polyHEMA from Sigma) with 3D-RDM (DMEM:F12 3:1, 2% B27 supplement, 1x MEM NEAA, 1x antimycotic antibiotic, and 1x GlutaMAX supplemented with 5% FBS, 100 μM taurine, 1:1000 chemically defined lipid supplement (11905031, Thermo Fisher)) fed twice weekly. Live cultures were imaged with a Nikon Ts2-FL equipped with a DS-Fi3 camera or a Nikon Ts100 equipped with a QImaging CE CCD camera. All plasticware and reagents were from Thermo Fisher unless otherwise noted. All hPSC-ROs were differentiated by 200 days, which was consistent with IMPG2 + / + This was the time point at which hPSC-RO exhibited elongated photoreceptor outer segments (PR-OS; Capowski et al., 2019 ).

[0040] result Light microscopic classification of hPSC-ROs during differentiation is shown in Figures 1A-1D. Stage 1 hPSC-ROs (Figure 1A) consist primarily of retinal progenitor cells and ganglion cells. Stage 2 hPSC-ROs (Figure 1B) show intermediate development in which photoreceptor progenitors are more mature. Stage 3 hPSC-ROs (Figures 1C and 1D) are characterized by the surface appearance of easily identifiable (by low magnification light microscopy) photoreceptor outer segments. Figure 1D is a magnified image of the boxed area in Figure 1C, showing photoreceptor outer segments (brackets). conclusion Photoreceptor outer segments from stage 3 hPSC-ROs are easily observed under a low-magnification light microscope, therefore, functional perturbations of genes required for the generation of photoreceptor outer segments should be easily identified.

[0041] Example 2: IMPG2 Mutations and Photoreceptor (PR) Outer Segment Maintenance overview In this example, single nucleotide polymorphism (SNP) modification was used to create mutations in IMPG2 to observe the effect on photoreceptor (PR) outer segment (OS) maintenance. Materials and Methods To perform single nucleotide polymorphism (SNP) modification, we used a protocol using single-stranded oligonucleotide (ssODN) methodology described by Yang et al. (2013, Nucleic Acids Research, 41(19)). This approach was modified to fit within the existing CRISPR workflow published by Chen et al. (2015 Cell Stem Cell 17(2):233-44). Briefly, the CRISPOR design tool (www.crispor.tefor.net) was used to identify single guide RNAs (sgRNAs) for the desired site. The sgRNA sequence was then cloned into the pLentiCRISPR-V1 plasmid provided by the Feng Zhang laboratory. A donor single-stranded oligo donor (ssODN) was used to generate the Y254C mutation.

[0042] H9 IMPG2 - / - RO and H9 IMPG2Y254C / Y254C To produce RO, H9 IMPG2 + / + The cells used were iPSC IMPG2 Y254C / + RO and iPSC IMPG2 - / - To generate ROs, iPSC IMPG2 Y254C / A805(fs)Ter Each cell line was grown according to the protocol in Example 1. iPSC IMPG2 + / + To generate iPSCs, IMPG2 Y254C / + Cells were cultured and electroporated as described in Chen et al. After electroporation, cells were treated with puromycin to select for cells containing the pLentiCRISPRV1 plasmid. After puromycin selection, cells were cultured in MEF-conditioned hPSC medium until colonies were visible for selection. Clonal populations were hand-selected and isolated. Genomic DNA isolation was then performed to confirm successful ssODN integration and off-target analysis.

[0043] result As shown in Figures 2A-2E, differentiation of hPSC-RO containing IMPG2 mutations results in the absence of photoreceptor outer segments. All hPSC lines differentiated by day 200, at which point photoreceptor outer segments are always present in age-matched wild-type control hPSC lines (see Figure 1). However, as easily determined by low-magnification light microscopy, each line carrying the IMPG2 mutation, i.e., (see Figure 2A) iPSC IMPG2 Y254C / A805(fs)Ter , (Figure 2B) iPSC IMPG2 Y254C / + , (Figure 2C) iPSC IMPG2 - / - , (Fig. 2D) H9 IMPG2 Y254C / Y254C , and ( Fig. 2E ) H9 IMPG2 - / - completely lacks outer segments. conclusion Mutations in IMPG2 can result in a loss-of-function phenotype (lack of photoreceptor outer segment maintenance) observable in retinal organoids. This represents an accelerated phenotype of what is seen in human patients, as disease does not develop until the age of 20 years. However, surprisingly, even after genetic correction of a single allele, heterozygous IMPG2 hPSC-RO still lack photoreceptor outer segments (Figure 2B), which is in contrast to humans containing heterozygous IMPG2 mutations (MT) who do not have a clinical diagnosis of RP. The presence of the disease phenotype in heterozygous IMPG2 hPSC-RO serves as a powerful reference point / benchmark for the expression levels that should be achieved by therapeutic intervention to restore the wild-type (WT) phenotype. For example, restoration of the WT phenotype after treatment of the homozygous IMPG2 (MT / MT) model suggests that more than 50% of normal protein expression was achieved, which would be more than enough to restore the functional phenotype of human RP patients, since actual patients with heterozygous IPMG2 mutations have a normal phenotype. Indeed, restoring the heterozygous state to other types of mutations associated with other diseases may also have clinically meaningful consequences for patients with such diseases.

[0044] Example 3: Restoration of PR outer segments in hPSC-RO containing IMPG2 mutations overview In this example, single nucleotide polymorphism (SNP) modification was used to determine whether correction of an induced mutation in IMPG2 could reverse a loss-of-function phenotype in retinal organoids by restoring visible photoreceptor outer segments. Materials and Methods Gene correction mutations were performed according to the protocol outlined in Example 2 above, using various ssODNs that reversed the mutations introduced into IMPG2 in Example 2, reverting IMPG2 to wild type.

[0045] result 3. Genetic Correction of Stage IMPG2 iPSCs + / +ROs exhibited photoreceptor outer segments (Figures 3A-3D). Gene-corrected IMPG2 mutant lines (i.e., conversion of mutant IMPG2 lines to the wild-type IMPG2 state) differentiated by 200 days. At this time point, these gene-corrected isogenic iPSCs IMPG2 + / + RO showed complete restoration of photoreceptor outer segments on their surface (Figures 3A and 3B). A magnified image of the RO shown in panel 3A is shown in Figure 3B. By comparison, the appearance of the restored outer segments in Figures 3A and 3B is nearly indistinguishable from the outer segments of unmodified wild-type H9 RO (Figures 3C and 3D).

[0046] conclusion Genetic manipulation to restore IMPG2 function results in the restoration of visible outer segments in retinal organoids. These results suggest that the restoration of IMPG2 function by gene therapy or by administration of other therapeutic agents to ROs carrying a genetically mutated IMPG2 gene can be used as a readily observable readout to determine the efficacy of such therapies. It is envisioned that any type of therapy that can restore IMPG2 function can be tested with this model system, and that various types of genetic mutations, regardless of gene source or associated disease, can be incorporated into this model system for testing. Thus, it is believed that this model system can serve as a platform for identifying disease-associated genetic mutations and testing candidate therapies and / or therapeutic agents for any genetic disease that can be introduced into IMPG2 to result in the loss of IMPG2 function and the loss of visible outer segments.

[0047] Example 4: Evaluation of novel therapies for IMPG2-RP overview Here, we investigated the level of correction required to restore the surface outer segments of RO using mixed cultures of wild-type and IMPG2 mutant hPSC lines, providing insight into the sensitivity of this model system for testing therapies. Materials and Methods The IMPG2 mutant hPSC line is described in Example 2 above. The hPSC photoreceptor reporter line (WA09 CRX+ / TdTomato ) was generated according to Phillips et al. (2018, Stem Cells, 36(3): 313-324) and used as the IMPG2 wild-type cell line. To generate mixed wild-type (WT) and IMPG2 mutant (MT) hPSC-ROs (i.e., hPSC-ROs generated from a mixed culture of wild-type and IMPG2 mutant hPSCs), the wild-type and IMPG2 mutant hPSC lines were subcultured as described above in Example 1. Once the hPSCs were dissociated into single cells, the cells were counted using a hemocytometer. The single-celled hPSCs were then mixed in 15 mL conical tubes at three different wild-type:IMPG2 mutant ratios: 1) 5:95 (to model a minimal level of gene enhancement); 2) 20:80 (to model a maximal level of gene enhancement possible in vivo with our viral delivery vector); and 3) 50:50 (to model a target (expected) level of gene enhancement). The mixed cultures and specific culture ratios used were designed to determine the level of correction required to restore outer segments to the RO surface (e.g., the degree of functional recovery required).

[0048] result Light microscopy images of RO derived from mixed cultures of wild-type (WT) and mutant (MT) IMPG2 hPSCs are shown in Figures 4A-4E. Figure 4A shows a 100% WT control hPSC-RO with thick photoreceptor outer segments in brackets. Figure 4B shows a 50:50 WT:MT hPSC-RO culture, showing a smaller but still modest amount of photoreceptor outer segments compared to 100% WT RO. A further reduction in the presence of photoreceptor outer segments was seen in hPSC-RO cultures with a ratio of 20:80 (Figure 4C) and 5:95 (Figure 4D) WT:MT. Figure 4E shows a 100% MT IMPG2 hPSC-RO control, showing a complete lack of photoreceptor outer segments on the RO surface. Fluorescent confocal images of WT(CRX-TdTomato):MT mixed ROs are shown in Figure 5. The border between the WT (left of the white dashed line) and MT (right of the white dashed line) regions of the mixed ROs is shown. Note the presence or absence of IMPG2 expression in the variable thick superficial layer of the IPM in the WT or MT regions, respectively. conclusion These results indicate that sufficient wild-type IMPG2 is present to result in restoration of the IPM and photoreceptor outer segments.

[0049] Example 5: H9 IMPG2 with AAV5-IMPG2 - / - Treatment overview In this example, a gene augmentation approach was attempted to determine whether IMPG2 function could be restored in IMPG2 knockout H9 hPSC-RO. Materials and Methods On day 150 of differentiation, IMPG2 knockout hPSC-RO (as described above) were cultured in 2 e12 vp / mL AAV5-IMPG2. Treated hPSC-RO were monitored for the appearance of photoreceptor outer segments. After 50 days, hPSC-RO were cryosectioned and screened for IMPG2 expression by ICC. Cone photoreceptors were visualized using immunostaining against the cone-specific protein cone arrestin-3 (AAR3). ICC analysis of RO treated with AAV5-IMPG2 was performed.

[0050] result Untreated wild-type H9 hPSC-RO showed high levels of endogenous IMPG2 expression and had photoreceptor outer segments marked by discontinuous (sectioned) ARR3 immunostaining. Knockout of IMPG2 in hPSC-RO resulted in a complete lack of IMPG2 expression and photoreceptor outer segments in untreated hPSC-RO. Treatment of IMPG2 knockout hPSC-RO with AAV5-IMPG2 showed some restoration of IMPG2 expression (data not shown). conclusion These results indicate that restoration of IMPG2 function by gene augmentation therapy can be monitored by the reappearance of photoreceptor outer segments in IMPG2 knockout hPSC-RO. Therefore, we conclude that additional approaches to restore IMPG2 function can be tested using hPSC-RO lines containing IMPG2 deleterious mutations. Specific treatment candidates can be tailored to the specific type of mutation introduced into IMPG2.

[0051] Example 6: Base editing approaches to correct IMPG2 function overview In this example, we explore a base editing approach to restore IMPG2 function. Figure 6 shows a potential base editing approach to correct the IMPG2 mutation. As an example, the cytidine that causes the deleterious Y254C mutation in IMPG2 is shown in black. Using cytidine deaminase fused to Cas9, this mutation can be targeted by the cytidine deaminase enzyme, converting the guanine-cytosine pair to an adenine-thymine pair.

[0052] significance CRISPR / Cas9 genome editing has shown some ability to correct deleterious mutations through homology-directed repair (HDR). However, most double-stranded DNA breaks generated by CRISPR / Cas9 result in non-homologous end joining (NHEJ) and do not result in mutation repair. CRISPR / Cas9 base editing also targets the repair of specific mutations but does not cause double-stranded DNA breaks. Instead, the mutations are corrected by deaminase enzymes, which successfully convert the mutated base pairs.

[0053] All embodiments of any aspect of this disclosure can be used in combination unless the context clearly indicates otherwise. Accordingly, all patents and publications mentioned in this specification are incorporated by reference herein to the same extent as if each individual patent and publication was specifically and individually indicated to be incorporated by reference. Citation or identification of any reference in any section of this application should not be construed as an admission that such reference is available as prior art to the present disclosure.

[0054] array IMPG1 cDNA (SEQ ID NO: 1) NC_000006.12:c76072662-75921114 Gene ID: 3617

[0055] IMPG2 cDNA (SEQ ID NO:2) NC_000003.12:c101320575-101222546 Gene ID:50939

[0056] Example annealing sequence for Cas9 fusion cytidine deaminase gene editing approach (SEQ ID NO:3) - ccctgcactgcttccccaaa Example 5'-3' IMPG2 gene segment targeted by Cas9 fusion cytidine deaminase gene editing approach (SEQ ID NO: 4) - ggacatcaagaagggacgtgacgaaggggttttcc Example 3'-5' IMPG2 gene segment targeted by Cas9 fusion cytidine deaminase gene editing approach (SEQ ID NO:5) - cctgtagttcttccctgcactgcttccccaaaagg

Claims

1. 1. A retinal organoid model system, comprising: a population of human pluripotent stem cell (hPSC)-derived photoreceptor (PR) cells; A retinal organoid model system in which the PR cells are adapted to form the interphotoreceptor matrix (IPM) with visible outer segments on its surface upon restoration of function of genes encoding structural components of the IPM.

2. The retinal organoid model system of claim 1, wherein the hPSC is a human embryonic stem cell (hESC) or a human induced pluripotent stem cell (hiPSC).

3. The retinal organoid model system of claim 1, wherein the function of the gene can be restored by therapeutic treatment of the retinal organoid.

4. The retinal organoid model system of claim 3, wherein the therapeutic treatment comprises the administration of a protein, a virus, an RNA molecule, a DNA molecule, or a small molecule.

5. The retinal organoid model system of claim 4, wherein the therapeutic treatment further comprises the administration of a gene editor, a base editor, an RNA editor, or a small molecule that targets DNA / RNA, or cell therapy.

6. The retinal organoid model system of claim 2, wherein the hPSCs are hiPSCs.

7. The retinal organoid model system of claim 6, wherein the hiPSCs are derived from a patient with a spontaneous mutation in a gene encoding a structural component of the IPM.

8. The retinal organoid model system of claim 7, wherein the spontaneous mutation is one or more of a missense mutation, a nonsense mutation, a frameshift mutation, a cryptic slice variant mutation, a coding mutation, or a non-coding mutation.

9. The retinal organoid model system of claim 6, wherein the hiPSCs are recombinant hiPSCs comprising a genetically engineered mutation in at least one allele of the gene encoding a structural component of the IPM.

10. The retinal organoid model system of claim 2, wherein the hPSCs are hESCs.

11. 11. The retinal organoid model system of claim 10, wherein the hESC is H9, H1, H7, BG01, BG02, HES-3, HES-2, HSF-6, HUES9, HUES7, or 16.

12. The retinal organoid model system of claim 11, wherein the hESCs are recombinant hESCs comprising a genetically engineered mutation in at least one allele of the gene encoding a structural component of the IPM.

13. The retinal organoid model system of claim 1, wherein the gene encoding a structural component of the IPM is IMPG1 or IMPG2.

14. 14. The retinal organoid model system of claim 13, wherein the gene encoding a structural component of the IPM is IMPG2.

15. A method for testing the efficacy of a therapeutic treatment using the retinal organoid model system of any one of claims 1 to 14, comprising: a. administering to said retinal organoid model system a candidate therapeutic treatment to restore function of said gene encoding a structural component of the IPM; b. Visualizing photoreceptor outer segments within the IPM of the retinal organoid model system; and c. Detecting a change in the IPM Including, an alteration in the generation and / or maintenance of microscopically visible photoreceptor outer segments within the IPM of the retinal organoid model system indicates that the therapeutic treatment was effective in restoring function of genes encoding structural components of the IPM; The absence of a change in the generation and / or maintenance of microscopically visible photoreceptor outer segments within the IPM of the retinal organoid model system indicates that the therapeutic treatment was ineffective. method.

16. 16. The method of claim 15, further comprising visualizing the IPM prior to administration of a therapeutic candidate.

17. 16. The method of claim 15, wherein visualizing the IPM of the retinal organoid model system comprises qualitatively observing or quantifying the presence of visible photoreceptor outer segments on the surface of the PR cells.

Images