T cells having cell surface expression of adenosine deaminase and uses thereof

JP2024532382A5Pending Publication Date: 2025-09-02THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024513217
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-30
Filing Date
2022-08-29
Publication Date
2025-09-02

AI Technical Summary

Technical Problem

Current adoptive T-cell therapies, such as CAR-T cell therapy, face challenges in treating solid tumors due to T cell exhaustion and immunosuppressive mechanisms in the tumor microenvironment, particularly high adenosine levels that suppress T cell function.

Method used

Engineered T cells with increased cell surface expression of adenosine deaminase (ADA) to convert adenosine into inosine, reducing immunosuppression and enhancing T cell effector function.

Benefits of technology

Enhances T cell persistence and effector function, improving tumor killing capacity and overcoming immunosuppression in the tumor microenvironment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure generally relates to compositions and methods for robustly improving the fitness and function of CAR T cells. More specifically, the present disclosure relates to novel chimeric polypeptides capable of anchoring adenosine deaminase activity to the surface of T cells, nucleic acids encoding the chimeric polypeptides, and engineered T cells comprising the chimeric polypeptides or nucleic acids encoding the chimeric polypeptides. Methods of generating engineered T cells, methods of administering engineered T cells, and methods of treating individuals with associated health conditions are also provided herein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 238,756, filed August 30, 2021, the disclosure of which is incorporated by reference in its entirety, including any drawings.

[0002] Incorporating sequence tables This application contains a Sequence Listing, which is incorporated herein by reference in its entirety. The attached Sequence Listing text file entitled "078430-535001WO_SequenceListing_ST26.xml" was created on Aug. 25, 2022 and is 23 KB. [Background technology]

[0003] Adoptive transfer of genetically modified immune cells, such as T cells, has emerged as a powerful therapy for various malignancies. For example, current modalities of adoptive T cell therapy include cells modified to express receptors specific for cancer antigens, such as chimeric antigen receptors (CARs) and high affinity T cell receptors (TCRs). Upon exposure to cancer antigens, modified T cells exhibit cytolytic activity and / or signal to initiate an immune response against cancer.

[0004] In adoptive T cell therapy, engineered T cells are generally activated by exposure to cognate antigen in vitro or ex vivo and administered to an individual where they proliferate and have anticancer activity. Recent clinical trials using CAR engineered T cells (CAR-T cells) specific for the CD19 molecule on B cell malignancies have demonstrated significant disease regression in some patients with advanced cancer. However, extending this therapy to other types of cancer, especially solid tumors, presents several challenges. For example, overstimulation by prolonged antigen recognition and exposure to inflammatory signals can cause T cells to lose effector function, a phenomenon called "T cell exhaustion." Furthermore, the tumor microenvironment induces many resistance and immunosuppressive mechanisms that may reduce the effectiveness of adoptive cell therapy. For example, the concentration of adenosine is one of the immunosuppressive mechanisms that CAR T cells must face in the tumor microenvironment.

[0005] Thus, new compositions and strategies for generating improved therapeutic cells for adoptive cell therapy are needed. Aspects and embodiments of the present disclosure address these needs and provide other related advantages. Summary of the Invention

[0006] Provided herein are novel methods and compositions, inter alia, for preventing and / or treating various health conditions. In particular, described herein are immune cells, e.g., T cells, engineered to express elevated levels of cell surface expression of adenosine deaminase (ADA). In some embodiments, the engineered immune cells, e.g., engineered T cells, exhibit increased resistance to the immunosuppressant adenosine and / or enhanced effector function, e.g., enhanced efficacy and persistence, of the T cells in patients. Also provided are methods for generating a population of engineered immune cells with enhanced effector function, and pharmaceutical compositions containing such a population of engineered immune cells with enhanced effector function, as well as methods and kits for preventing and / or treating a health condition in a subject in need thereof.

[0007] In one aspect, provided herein is a chimeric polypeptide comprising: (a) a first amino acid sequence comprising a first polypeptide module having adenosine deaminase activity; and (b) a second amino acid sequence comprising a second polypeptide module capable of anchoring the adenosine deaminase activity to the surface of a T cell.

[0008] Non-limiting exemplary embodiments of the disclosed chimeric polypeptides may include one or more of the following features: In some embodiments, the first polypeptide module is operably linked to the second polypeptide module. In some embodiments, the first polypeptide module has human adenosine deaminase activity. In some embodiments, the human adenosine deaminase activity is the activity of ADA1, ADA2, or a functional variant of any of these. In some embodiments, the first polypeptide module comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:7 or SEQ ID NO:8. In some embodiments, the second polypeptide module comprises a polypeptide transmembrane domain. In some embodiments, the polypeptide transmembrane domain is derived from CD8, CD4, CD28, CD80, ICOS, CTLA4, PD1, PD-L1, BTLA, HVEM, CD27, 4-1BB, 4-1BBL, OX40, OX40L, DR3, GITR, CD30, SLAM, CD2, 2B4, TIM1, TIM2, TIM3, TIGIT, CD226, CD160, LAG3, LAIR1, B7-1, B7-H1, and B7-H transmembrane domains. In some embodiments, the polypeptide transmembrane domain is a CD8 transmembrane domain or a functional variant thereof. In some embodiments, the CD8 transmembrane domain comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:9.

[0009] In one aspect, provided herein is a method for generating an engineered T cell with enhanced effector function, the method comprising introducing into a T cell a chimeric polypeptide described herein or a nucleic acid encoding the chimeric polypeptide.

[0010] Non-limiting exemplary embodiments of the disclosed methods for generating engineered T cells may include one or more of the following features: In some embodiments, the introduced chimeric polypeptide results in a reduced intracellular level of adenosine in the engineered T cells compared to a reference T cell that does not include the chimeric polypeptide. In some embodiments, the introduced chimeric polypeptide results in enhanced effector function of the engineered T cells compared to a control T cell, e.g., a T cell that has not been engineered to include such a chimeric polypeptide. In some embodiments, the method further includes introducing at least one recombinant antigen-specific receptor into the T cells. In some embodiments, the at least one recombinant antigen-specific receptor includes an engineered T cell receptor (TCR) and / or an engineered chimeric antigen receptor (CAR).

[0011] In another aspect, some embodiments of the present disclosure relate to an engineered T cell comprising a chimeric polypeptide comprising (a) a first polypeptide module having adenosine deaminase activity and (b) a second polypeptide module capable of anchoring the adenosine deaminase activity to the surface of the T cell. In a related aspect, some embodiments of the present disclosure relate to an engineered T cell produced by the methods described herein.

[0012] Non-limiting exemplary embodiments of the engineered T cells described herein may include one or more of the following features: In some embodiments, the T cells are CD8+ T cytotoxic lymphocyte cells or CD4+ T helper lymphocyte cells. In some embodiments, the CD8+ T cytotoxic lymphocyte cells are selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, and bulk CD8+ T cells. In some embodiments, the CD4+ T helper lymphocyte cells are selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells. In some embodiments, the T cells are exhausted or non-exhausted T cells. In some embodiments, the T cells are obtained by leukapheresis of a sample obtained from a subject.

[0013] In a related aspect, some embodiments of the present disclosure relate to a cell culture comprising at least one engineered T cell of the present disclosure and a culture medium.

[0014] In one aspect, provided herein is a pharmaceutical composition comprising the engineered T cells disclosed herein and a pharma- ceutical acceptable excipient.

[0015] In another aspect, provided herein is a method for preventing and / or treating a health condition in a subject in need thereof, the method comprising administering to the subject a composition comprising: (a) at least one engineered T cell described herein; and / or (b) a pharmaceutical composition described herein.

[0016] Non-limiting exemplary embodiments of the therapeutic methods described herein may include one or more of the following features: In some embodiments, the health condition is a proliferative disease (e.g., cancer), an autoimmune disease, or a chronic infectious disease. In some embodiments, the subject is a mammalian subject. In some embodiments, the mammalian subject is a human subject. In some embodiments, the engineered T cells are autologous to the subject. In some embodiments, the engineered T cells are obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs). In some embodiments, the administered composition inhibits adenosine-mediated immunosuppression in the subject. In some embodiments, the administered composition confers enhanced effector function of the engineered T cells compared to control T cells under similar conditions, e.g., T cells that have not been administered such a composition. In some embodiments, the enhanced effector function of the engineered T cells is selected from the group consisting of growth rate (proliferation), mortality rate, type of mortality, target cell inhibition (cytotoxicity), differentiation cluster change, macrophage activation, B cell activation, cytokine production, in vivo persistence, and enhanced spare respiratory capacity. In some embodiments, the enhanced effector function comprises increased production of one or more cytokines (e.g., interferon gamma (INFγ), tumor necrosis factor alpha (TNFα), and interleukin-2 (IL-2)). In some embodiments, the composition is administered to the subject individually (monotherapy) or in combination with a second therapy, where the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, or surgery.

[0017] In another aspect, some embodiments of the present disclosure relate to a kit for preventing and / or treating a condition in a subject in need thereof, the kit comprising one or more of: (a) a chimeric polypeptide described herein; (b) a nucleic acid encoding a chimeric polypeptide described herein; (c) at least one engineered T cell described herein; and (d) a pharmaceutical composition described herein.

[0018] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the exemplary embodiments and features described herein, further aspects, embodiments, objects and features of the present disclosure will become more fully apparent from the drawings and detailed description, and the claims. [Brief description of the drawings]

[0019] [Figure 1A] Figures 1A-1E summarize the results of experiments performed to illustrate that CD39 expression marks a highly dysfunctional population of exhausted CART T cells that exhibit suppressive capacity. Figure 1A shows the kinetics of surface CD39 expression on CD19.28z and exhausted HA CAR T cells. Representative donors are n=3. [Figure 1B] Figures 1A-1E summarize the results of experiments performed to illustrate that CD39 expression marks a highly dysfunctional population of exhausted CART T cells that exhibit suppressive capacity. Figure 1B shows IL-2 and IFNγ secretion by CD19.28z and HA CAR T cells stimulated with Nalm6-GD2 tumor cell line 6 and 14 days after T cell activation. Data are mean ± SEM from triplicate wells. n=3 representative donors. [Figure 1C] Figure 1A-1E summarize the results of experiments performed to illustrate that CD39 expression marks a highly dysfunctional population of exhausted CART T cells that exhibit suppressive capacity. Figure 1C shows cytokines secreted by CD39+ and CD39-CD8 HA CAR T cells 24 hours after stimulation with Nalm6-GD2+ cells (pg / ml) as detected by Luminex. Data are the mean of n=3 donors. [Figure 1D]Figure 1A-1E summarize the results of experiments performed to illustrate that CD39 expression marks a highly dysfunctional population of exhausted CART T cells that exhibit suppressive capacity. Figure 1D shows CyTOF analysis of HA CAR T cells 10 days after activation. Heatmaps represent the median expression of the indicated markers in CD39- and CD39+ of CD4 or CD8. Heatmaps were generated using the median Arcsinh ratio of a given marker to total CD8 values ​​in each column. A representative donor is shown (n=3 donors). [Figure 1E] Figures 1A-1E summarize the results of experiments performed to illustrate that CD39 expression marks a highly dysfunctional population of exhausted CART T cells that exhibit suppressive capacity. Figure 1E shows the GSEA of the indicated signatures from a ranked list of genes differentially expressed in CD8+CD39+ and CD8+CD39-. Figure 1E shows the GSEA of the indicated signatures from a ranked list of genes differentially expressed in CD8+CD39+ and CD8+CD39-. [Figure 1F] Figure 1 shows that CD19BB CAR T cells were activated with the Nalm6 tumor line alone or in the presence of total HA or CD8 purified HA CAR T cells. IL-2 secretion by CD19BB CAR T cells was assessed 24 hours after stimulation. Data are the mean ± SEM from triplicate wells. A representative experiment of n=2 is shown. [Figure 2A] Figures 2A-C summarize the results of experiments performed to illustrate that HA.28z (HA) CAR T cells show higher expression of exhaustion markers and reduced cytokine secretion compared to CD19.28z CAR T cells. Figure 2A shows the expression of exhaustion markers 14 days after T cell activation in non-transduced mock (grey), CD19.28z (blue), or HA (red) CAR T cells, and (B) shows the release of IL-2 (left) and IFNγ (right) after 24 h of co-culture with CD19+GD2+Nalm6-GD2 leukemia cells. Data are the mean ± standard error from triplicate wells of 3-4 donors. [Figure 2B] Figures 2A-C summarize the results of experiments performed to demonstrate that HA.28z (HA) CAR T cells show higher expression of exhaustion markers and reduced cytokine secretion compared to CD19.28z CAR T cells. Figure 2B shows contour plots showing the kinetics of exhaustion marker expression upon activation in CD19.28z and HA CAR T cells. [Figure 2C] Figures 2A-C summarize the results of experiments performed to demonstrate that HA.28z (HA) CAR T cells show higher expression of exhaustion markers and reduced cytokine secretion compared to CD19.28z CAR T cells. Figure 2C shows the MFI and frequency of exhaustion markers expressed by CD19.28z and HA CAR T cells at the indicated time points after activation. C. MFI and frequency of exhaustion markers expressed by CD19.28z and HA CAR T cells at the indicated time points after activation. [Figure 3A] Figures 3A-C summarize the results of experiments performed to characterize CD39+CD4 HA CAR T cells. Figure 3A shows the percentage (%) of CD39+ cells in the CD4+ and CD8+ compartments of HA CAR T cells. n=11 donors from independent experiments. Contour plots of one representative donor are shown. [Figure 3B] Figures 3A-C summarize the results of experiments performed to characterize CD39+CD4 HA CAR T cells. Figure 3B shows cytokines secreted by CD39+ and CD39-CD4 HA CAR T cells 24 hours after stimulation with Nalm6-GD2+ cells, as detected by Luminex. Data are the average of three donors. [Figure 3C]Figures 3A-C summarize the results of experiments performed to characterize CD39+CD4 HA CAR T cells. Figure 3C shows CyTOF analysis of CD4 HA CAR T cells 10 days after activation. Heatmaps represent the median expression of the indicated markers in CD4 or CD8 CD39- and CD39+. Heatmaps were generated using the median Arcsinh ratio of a given marker to total CD4 or total CD8 values ​​for each column. A representative donor is shown (n=3). [Figure 4A] Figures 4A and 4B summarize the results of experiments performed to illustrate transcriptional differences between CD39+ and CD39- CD8 and CD4 HA CAR T cells. Figure 4A shows a volcano plot representing RNA expression levels in CD39+ T cells compared to CD39- T cells. Significantly different genes were identified by DESeq2 (Wald test) and are shown in red (adjusted P value < 0.1). [Figure 4B] Figures 4A and 4B summarize the results of experiments performed to illustrate the transcriptional differences between CD39+ and CD39- CD8 and CD4 HA CAR T cells. Figure 4B shows a Venn diagram depicting the overlap between 95 genes significantly upregulated in CD4+CD39+ T cells compared to CD4+CD39- T cells and 57 genes significantly upregulated in CD8+CD39+ T cells compared to CD8+CD39- T cells. [Figure 5A] Figure 5A-C summarize the results of experiments performed to demonstrate that conversion of CD39- to CD39+ CAR T cells is dependent on CAR tonic signaling and does not require TGFβ. Figure 5A shows the percentage (%) of CD39+ in CAR+ and CAR-HA T cells 10 days after activation. N=12 donors from independent experiments. [Figure 5B]Figure 5A-C summarize the results of experiments performed to illustrate that conversion of CD39- to CD39+ CAR T cells depends on tonic signaling of the CAR and does not require TGFβ. Figure 5B shows that on day 16 after activation, bulk HA or purified CD39-HA CAR T cell populations were cultured in the presence of 1 μM dasatinib or 0.001 mg / ml neutralizing anti-TGFβ. After 7 days of treatment, CD39 expression was assessed. Data are the mean ± standard error of 3-4 donors from independent experiments. P values ​​were determined by unpaired two-tailed t-test. [Figure 5C] Figure 5A-C summarize the results of experiments performed to illustrate that conversion of CD39- to CD39+ CAR T cells depends on tonic signaling of the CAR and does not require TGFβ. Figure 5C shows that on day 16 after activation, bulk HA or purified CD39-HA CAR T cell populations were cultured in the presence of 1 μM dasatinib or 0.001 mg / ml neutralizing anti-TGFβ. After 7 days of treatment, CD39 expression was assessed. Dot plots of a representative donor are shown. Data are the mean ± standard error of 3-4 donors from independent experiments. P values ​​were determined by unpaired two-tailed t-test. [Figure 6A] Figures 6A-E summarize the results of experiments performed to demonstrate that exhausted CAR T cells can convert ATP into immunosuppressive adenosine through CD39 and CD73 expression, and that exhausted HA CAR T cells show high expression of enzymatically active CD39 and CD73 leading to adenosine production. Figure 6A is a schematic of the purinergic pathway. [Figure 6B]Figures 6A-E summarize the results of experiments performed to demonstrate that exhausted CAR T cells can convert ATP into immunosuppressive adenosine through CD39 and CD73 expression, or that exhausted HA CAR T cells show high expression of enzymatically active CD39 and CD73 leading to adenosine production. Figure 6B shows a representative contour plot showing CD39 and CD73 expression by HA CAR T cells 14 days after activation (left). The percentage (%) of double positive CD39+CD73+ T cells in CD4+ and CD8+ HA CAR T cells in four donors from independent experiments is shown (right). [Figure 6C] Figures 6A-E summarize the results of experiments performed to demonstrate that exhausted CAR T cells are able to convert ATP into immunosuppressive adenosine through CD39 and CD73 expression, and that exhausted HA CAR T cells show high expression of enzymatically active CD39 and CD73 leading to adenosine production. Figure 6C shows the percentage of eATP hydrolysis by CAR T cells preincubated with or without an anti-CD73 blocking antibody (left: representative data from n=4 donors) and the percentage of eADO produced by ectonucleotidases expressed on the surface of CAR T cells (right: representative data from n=3 donors). [Figure 6D] Figures 6A-E summarize the results of experiments performed to demonstrate that exhausted CAR T cells are able to convert ATP into immunosuppressive adenosine through CD39 and CD73 expression, or that exhausted HA CAR T cells show high expression of enzymatically active CD39 and CD73 leading to adenosine production. Figure 6D shows IL-2 secretion by HA and CD19 CAR T cells stimulated with Nalm6GD2 cell line in the presence or absence of NECA or 40 μM a2aR inhibitor at day 16 after activation. Data are mean ± SEM from triplicate wells. Representative data from n=2 donors. [Figure 6E]Figures 6A-E summarize the results of experiments performed to demonstrate that exhausted CAR T cells can convert ATP to immunosuppressive adenosine through CD39 and CD73 expression, or that exhausted HA CAR T cells show high expression of enzymatically active CD39 and CD73 leading to adenosine production. Figure 6E shows that CD19bb or CD19bb A2aR knockout CAR T cells were activated with the Nalm6 tumor line alone or in the presence of total HA, or HA with CD39 knockout. IL-2 secretion by CD19bb CAR T cells was assessed 24 hours after stimulation. [Figure 7A] Figures 7A-7D summarize the results of experiments performed to illustrate that cytokine suppression of both exhausted and non-exhausted CAR T cells can be mediated by NECA in a dose-responsive manner. Figure 7A shows IL-2 and IFNγ secretion by HA CAR T cells stimulated with Nalm6-GD2 cell line on day 10 or day 16 in the presence of different concentrations of NECA, with or without 40 μM of A2aR inhibitor CPI444. Data are mean ± SEM from triplicate wells. Representative donor of three independent experiments. [Figure 7B] Figures 7A-7D summarize the results of experiments performed to illustrate that cytokine suppression of both exhausted and non-exhausted CAR T cells can be mediated by NECA in a dose-responsive manner. Figure 7B shows IL-2 and IFNγ secretion by CD19 CAR T cells stimulated with Nalm6-GD2 cell line on days 10 or 16 in the presence of different concentrations of NECA, with or without 40 μM of the A2aR inhibitor CPI444. Data are mean ± SEM from triplicate wells. Representative donor of three independent experiments. [Figure 7C]Figures 7A-7D summarize the results of experiments performed to illustrate that cytokine suppression of both exhausted and non-exhausted CAR T cells can be mediated by NECA in a dose-responsive manner. Figure 7C shows NFkB-GFP activation levels 4 hours after stimulation of HA CAR T cells in the presence or absence of NECA and an A2aR competitive inhibitor. Data are the mean ± SEM from triplicate wells. [Figure 7D] Figures 7A-7D summarize the results of experiments performed to demonstrate that cytokine suppression of both exhausted and non-exhausted CAR T cells can be mediated by NECA in a dose-responsive manner. Figure 7D shows adenosine secretion by cells after 2 hours of incubation with mock or CAR T cells. Representative of two experiments. [Figure 8A] Figures 8A-D summarize the results of experiments performed to illustrate that ATP metabolism influences exhausted CAR T cell phenotype and function. Figure 8A shows the expanded phenotyping of genetically modified HA CAR T cells. Approximately 5,000 or the maximum number of CD8+HA CAR T cells from each donor (n=4) were organized by their combined expression of 26 markers using UMPAS. Donors were matched by deleted genes and linked to a total of 93,280 randomly sampled events. [Figure 8B] Figures 8A-8D summarize the results of experiments performed to demonstrate that ATP metabolism influences exhausted CAR T cell phenotype and function. Figure 8B shows the phenotypic clusters defined using the FlowSOM algorithm. [Figure 8C] Figures 8A-8D summarize the results of experiments performed to illustrate that ATP metabolism influences exhausted CAR T cell phenotype and function. Figure 8C shows IL-2 and IFNγ secretion by genetically modified and idiotype-stimulated HA CAR T cells in the presence of 100 μM ATP 24 hours after stimulation. [Figure 8D]Figures 8A-D summarize the results of experiments performed to illustrate that ATP metabolism influences exhausted CAR T cell phenotype and function. Figure 8D shows co-culture with Nalm6-GD2 (1:8 E:T), mg63.3 (1:5 E:T), or 143b (1:1 E:T) tumor lines, respectively, in IncuCyte to evaluate CAR-T cell cytotoxicity. Tumor GFP fluorescence intensity was normalized to the first time point (duplicate or triplicate wells). n=2-3 representative donors are shown. [Figure 9A] Figures 9A-D summarize the results of experiments performed to illustrate that manipulation of the purinergic pathway affects exhausted CAR T cell phenotype and function. Figure 9A shows a heatmap depicting Arhin median expression of 26 markers used in FlowSOM analysis manually gated on CD8 CAR T cells. Samples from four donors were linked using the OMIQ platform. [Figure 9B] Figures 9A-D summarize the results of experiments performed to illustrate that manipulation of the purinergic pathway affects exhausted CAR T cell phenotype and function. Figure 9B shows CD4 HA CAR T cells (5,000 events per sample or max) from four donors organized by their combined expression of 26 markers using UMPAS and colored by cluster ID defined by FlowSOM. Donors were matched by deleted or overexpressed genes and linked to a total of 93,280 randomly sampled events. [Figure 9C] Figures 9A-D summarize the results of experiments performed to illustrate that manipulation of the purinergic pathway affects exhausted CAR T cell phenotype and function. Figure 9C shows IL-2 and IFNγ secretion by HA CAR T cells stimulated with Nalm6-GD2 in the presence of 200 μM ATP to recapitulate the solid tumor microenvironment. [Figure 9D]Figures 9A-9D summarize the results of experiments performed to demonstrate that manipulation of the purinergic pathway affects exhausted CAR T cell phenotype and function. Figure 9D shows a histogram depicting the expression levels of the GD2 antigen on various tumor lines. [Figure 10A] Figures 10A-H summarize the results of experiments performed to demonstrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10A is a schematic diagram of the role of ADA1 in the purinergic pathway (top) and ADA1 construct structure (bottom). [Figure 10B] Figure 10A-H summarize the results of experiments performed to illustrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10B shows the expanded phenotyping of genetically modified HA CAR T cells 14 days after activation. 5,000 or the maximum number of CD8+ HA CAR T cells from each donor (n=4) were organized by their combined expression of 26 markers using UMPAS. Donors were matched by deleted or overexpressed genes and linked to a total of 93,280 randomly sampled events. Violin plots show the frequency of population clusters defined using FlowSOM per condition. [Figure 10C] Figures 10A-H summarize the results of experiments performed to illustrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10C shows plots of the first versus second principal component for each of the expression profiles assessed at day 14 post-activation in cells from CRISPR knockout experiments (KO) or ADA-overexpressing (O / E) HA CAR T cells. [Figure 10D]Figure 10A-H summarize the results of experiments performed to demonstrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10D shows a volcano plot representing RNA expression levels in control HA T cells compared to ADA O / E HA CAR T cells. Significantly different genes were identified by DESeq2 (Wald test) (adjusted P value < 0.01). [Figure 10E] Figures 10A-H summarize the results of experiments performed to demonstrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10E is a heat map showing DEGs identified from AAVS1 and ADA-overexpressing HA CAR T cells. [Figure 10F] Figures 10A-H summarize the results of experiments performed to illustrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10F shows O2 consumption rate (OCR) and extracellular acidification rate (ECAR) for HA and ADA O / E CAR T cells measured by Seahorse 11 days after activation. Bar graphs show quantitative data of spare respiratory capacity (SRC) and basal OCR / ECAR ratio. Representative plots are shown (n=2). [Figure 10G] Figures 10A-H summarize the results of experiments performed to demonstrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10G shows the frequency of Foxp3+CD25+CD127-CD8 HA and HA ADA O / E CAR T cells 10 days after activation. [Figure 10H]Figures 10A-H summarize the results of experiments performed to illustrate that overexpression of adenosine deaminase ADA1 improves exhausted and non-exhausted CAR T cell function. Figure 10H shows cytotoxic function at 1:8 E:T ratio, IL-2 secretion after 24 hours of stimulation, and proliferation index 72 hours after stimulation in Nalm6-GD2 or CHLA25.5 tumor lines. Data are mean ± SEM from duplicate or triplicate wells. Representative graphs are shown (n=2-3 donors). [Figure 11A] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11A shows CD39 and CD73 surface expression by various tumor cell lines. [Figure 11B] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11B shows ADA-Tag surface expression and CAR expression. [Figure 11C] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11C shows the expression of CD69 after 24 hours of HA CAR T cells co-cultured with Nalm6-GD2+ leukemia cells in the presence or absence of 200 μM eATP. Data are the mean ± SEM from triplicate wells. [Figure 11D] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11D shows the phenotype and frequency of the indicated populations in CD4+HA and HA ADA O / E CAR T cells analyzed using FlowSOM at day 14 post activation. [Figure 11E] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11E shows GSEA analysis of HA ADA O / E and HA CAR T cells 14 days after activation. [Figure 11F] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11F shows the killing Incucyte assay at 1:8 E:T ratio, IL-2 secretion 24 hours after stimulation, and proliferation index 72 hours after stimulation on the Nalm6 tumor line 14 days after activation. [Figure 11G] Figures 11A-11G summarize the results of experiments performed to describe the expression of CD39 and CD73 on different tumor lines and the effect of ADA overexpression on CAR T cell phenotype, transcriptome, and function. Figure 11G shows the killing Incucyte assay at 1:8 E:T ratio, IL-2 secretion 24 hours after stimulation, and proliferation index 72 hours after stimulation on the Nalm6 tumor line 14 days after activation. [Figure 12A] Two exemplary plasmid designs for expressing ADA1 and ADA2 are shown. SS: signaling domain (leader sequence); CD8-TM: CD8 transmembrane sequence; tEGFR: surface selection marker (truncated EGFR-like protein). [Figure 12B] Schematic summary of the results of experiments performed to demonstrate that overexpression of each of the two human ADA isozymes resulted in increased tumor killing by HA CAR T cells. [Figure 12C] Schematic summary of the results of experiments performed to demonstrate that non-exhausted CAR T cells expressing membrane-bound ADA1 or ADA2 secreted higher levels of IL-2 and IFNγ. [Figure 12D]1 is a schematic summary of the results of an experiment performed to demonstrate that CAR T cells expressing ADA1-TM or ADA2-TM produced more IL-2 and IFNγ compared to the control group, and this increase was abrogated in the presence of the adenosine deaminase inhibitor EHNA. HA CAR T cells were stimulated with the Nalm6-GD2 tumor line in the presence or absence of 10 uM EHNA inhibitor on day 15 after activation. IL-2 and IFNγ secretion were evaluated using ELISA. One donor is shown. [Figure 12E] 1 is a schematic summary of the results of experiments performed to test the antitumor efficacy of transmembrane-bound adenosine deaminase by using the 143b solid tumor model. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The present disclosure generally relates to methods and compositions for, among other things, preventing and / or treating various health conditions. In particular, described herein are chimeric polypeptides with adenosine deaminase activity for improving the effector function of CAR T cells. Also provided are methods for generating engineered immune cells with enhanced effector function, engineered immune cells according to the methods described herein, pharmaceutical compositions comprising the same, and methods and kits for preventing and / or treating health conditions in subjects in need thereof.

[0021] The following description and examples will explain the embodiments of the present disclosure in detail. Although the present disclosure has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications can be practiced within the scope of the appended claims.

[0022] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0023] Although various features of the present disclosure may be described in the context of a single embodiment, the features may be provided separately or in any suitable combination. Conversely, although the present disclosure may be described herein in the context of separate embodiments for clarity, the present disclosure may also be implemented in a single embodiment. It should be understood that the present disclosure is not limited to the specific embodiments described herein and may therefore vary. Those skilled in the art will recognize that variations and modifications of the present disclosure exist and are encompassed within the scope of the present disclosure.

[0024] Every maximum numerical limitation given throughout this specification is intended to include every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification is intended to include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification is intended to include every narrower numerical range that falls within the broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0025] All patent applications, websites, other publications, accession numbers, etc. cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item was specifically and individually indicated to be incorporated by reference. Where different versions of sequences are associated with accession numbers at different times, the version associated with the accession number at the effective filing date of this application is meant. The effective filing date means the earlier of the actual filing date or, where reference is made to an accession number, the filing date of the priority application. Similarly, where different versions of publications, websites, etc. are published at different times, the version published most recently to the effective filing date of this application is meant unless otherwise indicated. Any feature, step, element, embodiment, or aspect of this disclosure may be used in combination with any other, unless otherwise indicated.

[0026] definition All terms are intended to be understood as understood by one of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0027] The following definitions supplement those in the art and are directed to this application and are not attributable to any related or unrelated cases, such as any commonly owned patents or applications. Although any methods and materials similar or equivalent to those described herein can be used in carrying out the testing of the present disclosure, preferred materials and methods are described herein. Therefore, the terminology used herein is intended only to describe specific embodiments and is not intended to be limiting.

[0028] In this application, the use of the singular includes the plural unless otherwise indicated. It should be noted that as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all the options "A," "B," "A or B," and "A and B."

[0029] Furthermore, use of the term "including" as well as other forms such as "include," "includes," and "included" is not limiting.

[0030] References herein to "some embodiments," "an embodiment," "one embodiment," or "other embodiments" mean that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least some embodiments of the present disclosure, but not necessarily in all embodiments.

[0031] As used in the specification and claims, the terms "comprising" (and any form of including, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the disclosure, and vice versa. Furthermore, the compositions of the disclosure can be used to achieve the methods of the disclosure.

[0032] The term "administration" and grammatical variations thereof, as used herein, refers to the delivery of a bioactive composition or formulation by a route of administration, including, but not limited to, oral, intravenous, intraarterial, intramuscular, intraperitoneal, subcutaneous, intramuscular, and topical administration, or a combination thereof. This term includes, but is not limited to, administration by a medical professional and self-administration.

[0033] The term "cancer" refers to the presence of cells that have some characteristics of cancer-causing cells, such as unlimited proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Cancer cells may be aggregated into a mass, such as a tumor, or may exist alone in a subject. A tumor may be a solid tumor, a soft tissue tumor, or a metastatic lesion. As used herein, the term "cancer" also encompasses other types of non-tumor cancers. Non-limiting examples include blood or hematological cancers, such as leukemia. Cancers may include pre-malignant cancers as well as malignant cancers.

[0034] The terms "cell", "cell culture", and "cell line" refer not only to a particular subject cell, cell culture, or cell line, but also to the progeny or potential progeny of such a cell, cell culture, or cell line, regardless of the number of transfers or passages in culture. It should be understood that not all progeny are strictly identical to the parent cell. This is because certain modifications may occur in successive generations, either due to mutations (e.g., intentional or unintentional mutations) or environmental influences (e.g., methylation or other epigenetic modifications), so that the progeny may not actually be identical to the parent cell, but still be within the scope of the terms used herein, so long as the progeny retain the same function as the original cell, cell culture, or cell line.

[0035] The term "operably linked" as used herein refers to a physical or functional linkage between two or more elements, e.g., polypeptide or polynucleotide sequences, that allows them to operate in their intended manner. For example, an operably linked linkage between a polynucleotide of interest and a control sequence (e.g., a promoter) is a functional linkage that allows expression of the polynucleotide of interest. It is understood that operably linked elements may be contiguous or non-contiguous. In the context of a polypeptide, "operably linked" refers to a physical linkage (e.g., direct or indirect linkage) between amino acid sequences (e.g., different domains) to provide a described activity of the polypeptide. In the present disclosure, various domains of a recombinant polypeptide of the present disclosure may be operably linked to retain proper folding, processing, targeting, expression, binding, and other functional properties of the recombinant polypeptide in a cell. The operably linked domains of a recombinant polypeptide of the present disclosure may be contiguous or non-contiguous (e.g., may be linked to each other via a linker).

[0036] The term "percent identity" as used herein in the context of two or more nucleic acids or proteins refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) when measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters described below, or by manual alignment and visual inspection. See, for example, the NCBI website at ncbi.nlm.nih.gov / BLAST. Such sequences are said to be "substantially identical". This definition may also refer to or apply to the complement of a sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. Sequence identity can be calculated over a region that is typically at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence. Sequence identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al, Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol 215:403, 1990). Sequence identity can be measured using sequence analysis software such as the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705) with its default parameters.

[0037] As used herein, the terms "recombinant" or "engineered" nucleic acid molecule, polypeptide, or cell refer to a nucleic acid molecule, polypeptide, or cell that has been modified through human intervention.

[0038] As used herein, unless otherwise specified, a "therapeutically effective amount" or "therapeutically effective number" of an agent is an amount or number sufficient to provide a therapeutic benefit in the treatment or management of a disease, such as cancer, or to delay or minimize one or more symptoms associated with a disease. A therapeutically effective amount or number of a compound means an amount or number of a therapeutic agent, alone or in combination with other therapeutic agents, that provides a therapeutic benefit in the treatment or management of a disease. The term "therapeutically effective amount" can include an amount or number that improves the overall treatment of a disease, reduces or avoids the symptoms or causes of a disease, or enhances the therapeutic effectiveness of another therapeutic agent. An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which may also be referred to as a "therapeutically effective amount." A "reduction" of a symptom means that the severity or frequency of the symptom is reduced, or that the symptom is eliminated. The precise amount of a composition that comprises a "therapeutically effective amount" will depend on the purpose of the treatment and can be ascertained by one of ordinary skill in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (Vols. 1-3, 2010); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (2016); Pickar, Dosage Calculations (2012); and Remington: The Science and Practice of Pharmacy, 22 nd Edition, 2012, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0039] As used herein, a "subject" or "individual" includes animals, such as humans (e.g., human subjects) and non-human animals. In some embodiments, a "subject" or "individual" is a patient under the care of a physician. Thus, a subject may be a human patient or subject who has, is at risk of, or is suspected of having a disease of interest (e.g., cancer) and / or one or more symptoms of the disease. A subject may also be a subject who has been diagnosed at or after diagnosis as being at risk for a condition of interest. The term "non-human animal" includes all vertebrates, such as mammals, such as rodents, e.g., mice, non-human primates, and other mammals, such as sheep, dogs, cows, chickens, and non-mammals, such as amphibians, reptiles, etc.

[0040] As used herein, the term "functional variant thereof" refers to a molecule that has a qualitative biological activity in common with the wild-type molecule from which the variant is derived. For example, when referring to a polypeptide having an enzymatic activity (e.g., an enzyme such as adenosine deaminase; ADA), the term "functional variant" refers to an enzyme having a polypeptide sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to the polypeptide sequence encoding the enzyme. A "functional variant" enzyme may retain amino acid residues recognized as conserved for the enzyme, and may have non-conserved amino acid residues found to be substituted or of different amino acids, or inserted or deleted amino acids, but do not affect or only slightly affect its enzymatic activity compared to the enzymes described herein. A "functional variant" enzyme has an enzymatic activity that is the same or essentially the same as the biological activity of the enzymes described herein (e.g., ADA). One of skill in the art will understand that a "functional mutant" enzyme may be found in nature, i.e., may occur naturally, or may be an engineered mutant thereof. Thus, the term "ADA polypeptide variant" includes naturally occurring allelic variants or alternative splice variants of an ADA polypeptide. For example, an ADA polypeptide variant includes the substitution of one or more amino acids in the amino acid sequence of a parent ADA polypeptide with a similar or homologous amino acid or a different amino acid. There are many measures by which amino acids can be ranked as similar or homologous. (Gunnar von Heijne, Sequence Analysis in Molecular Biology, p. 123-39 (Academic Press, New York, NY 1987).

[0041] Whenever the terms "at least," "more," or "greater than or equal to" precede the first number in a series of two or more numbers, the terms "at least," "more than," or "greater than or equal to" apply to every number in the series. For example, 1, 2, or 3 or more is equivalent to 1 or more, 2 or more, or 3 or more.

[0042] Whenever the terms "no more than," "less than," or "less than or equal to" precede the first number in a series of two or more numbers, the terms "no more than," "less than," or "less than or equal to" apply to each number in the series. For example, 3, 2, or 1 or less is equal to 3 or less, 2 or less, or 1 or less.

[0043] Headings, e.g., (a), (b), (i), etc., are provided solely to facilitate reading of the specification and claims. The use of headings in this specification or claims does not require that the steps or elements be performed in alphabetical or numerical order or in the order in which they are presented.

[0044] As will be understood by those skilled in the art, for any purpose, such as providing a written description, all ranges disclosed herein also encompass all possible subranges and combinations thereof. Any recited range can be readily recognized as fully describing and allowing the same range to be broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third, and upper third, etc. As will also be understood by those skilled in the art, all terms such as "up to / up to," "at least," "more than," "less than," etc., refer to ranges that are inclusive of the recited numbers and that can be subsequently broken down into subranges as described above. Finally, as will be understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1-5 items refers to a group having 1, 2, 3, 4, or 5 items, and so on.

[0045] Certain ranges are presented herein with numerical values ​​preceded by the term "about". In this specification, the term "about" is used to provide literal support for the exact number it precedes, as well as a number that is close to or approximately the number it precedes. In determining whether a number is close to or approximately a specifically recited number, the close or approximate unrecited number may be a number that, in the context in which it is presented, provides a substantial equivalent to the specifically recited number. If the degree of approximation is not clear from the context, "about" means within plus or minus 10% of the provided value in all cases, including the provided value, or rounded to the nearest significant figure. In some embodiments, the term "about" refers to the specified value ±10%, ±5%, or ±1%.

[0046] It is understood that aspects and embodiments of the disclosure described herein include the aspects and embodiments "comprising," "consisting," and "consisting essentially of." As used herein, "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional unrecited elements or method steps. As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claimed composition or method. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term "comprising," particularly in the description of a component of a composition or in the description of a step of a method, is understood to encompass compositions and methods that consist essentially of and consist of the recited components or steps.

[0047] The use of ordinal terms such as "first," "second," "third," etc. in the claims to modify claim elements does not, by itself, imply any priority, precedence, or ordering of one claim element relative to another, or the temporal order in which acts of a method are performed, but is merely used as a label to distinguish one claim element having a certain name from another element having the same name (other than the use of ordinal terms). Similarly, the use of these terms herein does not, by itself, imply any required priority, precedence, or ordering.

[0048] It is understood that certain features of the present disclosure that are described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, various features of the present disclosure that are described in the context of a single embodiment for brevity may also be provided separately or in any suitable subcombination. All combinations of the embodiments related to the present disclosure are specifically embraced by the present disclosure and are disclosed herein as if each and every combination were individually and expressly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein as if each and every such subcombination were individually and expressly disclosed herein.

[0049] Adenosine deaminase and CAR T cell therapy Adenosine deaminase Adenosine deaminase (also known as adenosine aminohydrolase or ADA) is an enzyme (EC 3.5.4.4) that is considered to be one of the key enzymes of purine metabolism. This enzyme is found in bacteria, plants, invertebrates, vertebrates, and mammals, and its amino acid sequence is highly conserved. The high conservation of the amino acid sequence suggests the important nature of ADA in the purine salvage pathway.

[0050] Primarily, ADA in humans is involved in the development and maintenance of the immune system. However, ADA association has also been observed in epithelial cell differentiation, neurotransmission, and pregnancy maintenance. In addition to adenosine degradation, ADA is also thought to stimulate the release of excitatory amino acids and is required for the coupling of A1 adenosine receptors with heterotrimeric G proteins. Adenosine deaminase deficiency causes pulmonary fibrosis, suggesting that chronic exposure to high levels of adenosine may exacerbate rather than suppress inflammatory responses. It has also been recognized that adenosine deaminase protein and activity are upregulated in mouse hearts overexpressing HIF1α, which partially explains the reduced levels of adenosine in HIF-1α-expressing hearts during ischemic stress.

[0051] There are two adenosine deaminases in humans: ADA1 and ADA2. ADA1 (41 kDa) is encoded by the ADA gene (OMIM 608958 or Entrez Gene ID 100) on chromosome 20q13.12 and is produced by all cells. The primary role of ADA1, acting as a monomer, is to eliminate intracellular toxic derivatives of adenosine and deoxyadenosine and protect cells from apoptosis. Absence of ADA1 due to genetic mutations causes severe combined immunodeficiency (SCID). Although the intracellular role of ADA1 is well established, the enzyme also has extracellular roles, for example, ADA1 (or extracellular ADA) forms a ternary complex with CD26 and A2a receptors that bridges two different cells as a costimulatory molecule that influences T cell proliferation. ADA1 converts adenosine, an endogenous purine metabolite, to the immunologically inactive inosine, which acts via leukocyte purinergic receptors to suppress proinflammatory and Th1 polarizing responses. ADA1 also plays a role in enhancing T helper 2 (Th2) immunity via adenosine receptors. ADA1 deficiency impairs thymocyte development and immunoglobulin production by B lymphocytes, resulting in severe combined immunodeficiency.

[0052] ADA2 (57 kDa) is encoded by the CECR1 (ADA2) gene (OMIM 607575 or Entrez Gene ID 51816) on chromosome 22q11.1 and is produced by activated monocytes, macrophages, and dendritic cells (DCs). ADA2 regulates immunity through binding to cognate receptors on immune cells, independent of its enzymatic activity. ADA2 also induces differentiation of monocytes into macrophages in T cell cocultures. ADA2, also known as Cat Eye Syndrome Chromosomal Region Candidate 1 or CECR1, is an adenosine deaminase that catalyzes the deamination of adenosine and 2-prime-deoxyadenosine to inosine and deoxyinosine, respectively. In contrast to ADA1, ADA2 is a secreted homodimer and is highly expressed in plasma. ADA2 is highly expressed in dendritic cells, CD14+ monocytes, and lymphoid tissues, especially the thymus. ADA2 has a higher Km for adenosine (23, 24) and, as a result, less enzymatic activity than ADA1. Residual ADA2 activity ADA2 can be measured in patients with ADA1 deficiency (23, 25), but its important role in immunity has not been fully recognized until now.

[0053] CAR T cell therapy CAR T cell therapy has been shown to be highly effective in many types of hematological cancers. However, in the context of solid tumors, there are still many challenges to be addressed before CAR T can become a standard treatment, including overcoming the hostile tumor microenvironment, which has proven to be one of the most challenging. In this context, several reports have highlighted the role of adenosine as a key immunosuppressant factor that accumulates in the tumor microenvironment. In pathological conditions, extracellular adenosine (eADO) concentrations can be up to 100-fold higher than in physiological conditions. This increase can be the result of passive release of adenosine from dying cells, active transport via equilibrative nucleoside transporters (ENT), or production of adenosine by ATP / ADP catabolism mediated by CD39 and CD73. Extracellular adenosine can then inhibit T cells through interactions with different G protein-coupled receptors: ADORA1, ADORA2A, ADORA2B, and ADORA3, with ADORA2a (A2aR) having the highest affinity. Thus, targeting the adenosinergic pathway is an attractive new therapeutic strategy in the context of CAR T cell immunotherapy.

[0054] As described in more detail below, the experimental data presented herein demonstrate, inter alia, that exhausted CAR T cell populations exhibiting antigen-independent clustering have high surface expression of the extracellular enzymes CD39 and CD73, both of which are involved in adenosine production, and that exhausted CD39+ CAR T cells upregulate markers associated with the Treg phenotype at the gene and protein level, demonstrating adenosine-mediated suppressive function. These data further support the distinct expression kinetics of CD39 compared to standard exhaustion / activation markers such as TIM3, LAG3, or PD1, which are upregulated early upon activation. Unlike these standard exhaustion / activation markers, CD39 appears to specifically correlate with the progressive loss of function in exhausted CAR T cells.

[0055] CD39+CD8 exhausted CAR T cells display unique transcriptional, phenotypic, and functional profiles compared to their CD39- counterparts. CD39+CD8 CAR T cells display high proliferative potential, defined as Ki67+, and secrete high levels of cytokines such as IFNγ, granzyme B, IL-27, and TGFβ, which are involved in Treg differentiation and function. They also secrete low levels of IL-2, MPC-1, TNFα, and TNFβ cytokines. These data suggest a high level of similarity between CD39+ exhausted T cells and regulatory T cells. Gene enrichment analysis confirmed the upregulation of genes associated with the Treg phenotype. Furthermore, CD39+CD8 CAR T cells displayed consistent suppressive capabilities via adenosine production, which is consistent with reports characterizing CD39 as a Treg marker and the in vitro suppressive function of CD39+CD8 T cells obtained from human tumors. However, in contrast to studies showing that CD73 expression is reduced upon activation and differentiation, it is demonstrated herein that exhausted CD8 CAR T cells show increased expression of both CD39 and CD73, which leads to active hydrolysis of eATP and generation of adenosine.

[0056] It has been shown that TGFβ is related to CD39 expression. However, as demonstrated herein, neutralizing TGFβ antibody does not cause any change in CD39 expression in HA CAR T cells. Instead, the experimental data presented herein demonstrates a strong correlation between CAR expression and CD39 upregulation, suggesting the role of endogenous factors. Indeed, blocking tonic signaling in CD39-selected HA CAR T cells with dasatinib (a tyrosine kinase inhibitor) inhibits CD39 expression. This supports the need for improved suppressive capacity of cells to counteract overstimulation and self-damage when cells are in a long-term antigen-stimulated state.

[0057] As demonstrated herein, the deletion of the adenosine receptor A2aR in exhausted CAR T cells, in contrast to the deletion of CD39 or CD73, does not result in significant phenotypic changes, but improves tumor-specific killing. Of CAR T cells with knockouts of CD39, CD73, and high-affinity adenosine A2a receptor, only CD39 or CD73 knockout affects the exhausted phenotype, resulting in a significant increase in the frequency of Tscm and effector-like populations of CAR T cells. Despite these changes in phenotype, the deletion of all three genes results in increased IL-2 secretion in short-term assays. Only A2aR KO shows significantly higher tumor growth control in killing tests.

[0058] A2a receptor plays an important role in inosine-induced antitumor T cell responses. Furthermore, A2b receptor is expressed by T cells and can mediate T cell suppression. Therefore, A2aR knockout may not be the most efficient way to improve CAR T cell therapy. Instead, overexpression of adenosine deaminase (ADA) enzyme on the surface of CAR T cells can reduce adenosine accumulation in the tumor microenvironment. Thus, in some embodiments, provided herein are compositions and methods for improving the effector function of CAR T cells by overexpressing ADA, which can modulate the balance between adenosine and non-inhibitory inosine, which is a less potent agonist of A2aR than adenosine. Adenosine can increase cAMP-biased signaling, while inosine activates ERK1 / 2-biased signaling. Inosine signaling through A2aR has been shown to induce Th1-type responses, which are beneficial in the context of T cell immunotherapy. Inosine can be utilized by T cells as an alternative to glucose as an energy source, supporting the effector function of CAR T cells. As demonstrated herein, ADA overexpression in CAR T cells induces changes at the transcriptional and protein levels, promoting more T SCM(stem cell memory T cell)-like phenotype and less exhausted phenotype. Overexpression of ADA in both exhausted and non-exhausted CAR T cells results in a phenotypic change, increasing the frequency of stem cell-like memory T cell effectors and simultaneously decreasing the exhausted subpopulation. Both antigen-driven proliferation and effector function of CAR T cells are significantly improved after overexpression of ADA. Memory cells have been reported to exhibit improved beta-oxidation and mitochondrial spare respiratory capacity (SRC). As demonstrated herein, ADA-overexpressing CAR T cells are enriched in the expression of genes involved in fatty acid metabolism and show a significant shift towards oxidative phosphorylation and enhanced SRC compared to control CAR T cells under similar conditions, such as CAR T cells that have not been engineered to overexpress such ADA. This translates into improved antigen-specific proliferation and cytotoxicity function. This phenomenon is observed in both exhausted and non-exhausted CAR T cells.

[0059] The experimental data presented herein demonstrate that overexpression of adenosine deaminase (ADA) may be an innovative approach to improve the effector function of CAR T cells by modulating the balance between adenosine and non-inhibitory inosine. In some embodiments, the ADA activity is the activity of ADA1, ADA2, or a functional mutant of either of these.

[0060] Compositions of the Disclosure As described in more detail below, one aspect of the disclosure relates to chimeric polypeptides that include one or more polypeptide modules, e.g., having a first polypeptide module having adenosine deaminase activity and a second polypeptide module capable of anchoring the adenosine deaminase activity to the surface of a T cell. Some embodiments of the disclosure provide engineered T cells that include the chimeric polypeptide or a nucleic acid encoding the chimeric polypeptide.

[0061] Chimeric Polypeptides As outlined above, some embodiments of the present disclosure relate to chimeric polypeptides engineered to improve CAR T cell phenotype and effector function. As described in more detail in the Examples section below, CD39 expression correlates with progressive loss of function during CAR T cell exhaustion. Briefly, CD39+CD8+ exhausted CAR T cells exhibit Treg-associated phenotype and suppressive function. Not only are CD39+CD8 CAR T cells exhausted, they may represent a novel cell subpopulation with an enriched inhibitory molecular signature, phenotype, and function. As explained in more detail below, conversion of CD39-CAR T cell populations to CD39+ is dependent on tonic signaling. Long-term T cell stimulation is sufficient to convert CD39- cells to CD39+ cells. Exhausted CAR T cells exhibit high expression of enzymatically active CD39 and CD73, which leads to the production of inhibitory adenosine. High levels of expression of CD39 and CD73 on the surface of exhausted CAR T cells correlate with an improved ability to degrade ATP and convert ADP / AMP to adenosine. As demonstrated herein, adenosine can suppress cytokine production by CAR T cells after antigen stimulation. Exhausted CAR T cells express active CD39 and CD73 on their surface, which leads to an improved ability to generate adenosine. Adenosine then exerts an inhibitory effect on the function and proliferation of CAR T cells in an A2a receptor-mediated manner. Blocking the A2a receptor on CAR T cells or knocking out CD39 on CAR T cells can restore cytokine (e.g., IL-2) production by CAR T cells in the presence of adenosine-producing cells. Thus, the purinergic pathway can regulate the phenotype and function of exhausted CAR T cells. Autocrine adenosine production as a result of co-expression of CD39 and CD73 by CAR T cells may result in an inhibitory effect on neighboring cells as well as endogenous suppression of CAR T cell activity. Adenosine and the pathways regulating its production play an important role in modulating CAR T cell responses and phenotype.

[0062] As described in more detail below, overexpression of adenosine deaminase can improve CAR T cell phenotype and effector function. In the context of the tumor microenvironment, adenosine production is regulated by CD39 and CD73 present on CAR T cells, as well as expressed on the surface of cancer-associated fibroblasts, stroma, or directly on tumor cells. Knocking out CD39 or CD73 may improve cytokine secretion in vitro, but may not be a successful approach in vivo. Similarly, although the A2a receptor shows the highest affinity for adenosine, it is not the only adenosine receptor expressed by T cells. Thus, an alternative approach to reduce the inhibitory effect of adenosine on CAR T cells is to overexpress adenosine deaminase (ADA), the enzyme involved in metabolizing adenosine to inosine. In some embodiments of the present disclosure, ADA can be fused to a polypeptide transmembrane domain, e.g., the transmembrane domain of CD8, to ensure that the overexpressed ADA can be anchored on the surface of T cells. As described in more detail below, overexpression of transmembrane-bound ADA significantly and robustly improves the fitness and function of both exhausted and non-exhausted CAR T cells by shifting the phenotype of CAR T cells to memory-like cells (see, e.g., Examples 8 and 9). In particular, exhausted CAR T cells engineered to overexpress transmembrane-bound ADA had improved spare respiratory capacity (SRC), a hallmark of memory T cells. For example, genes associated with memory phenotype and persistence, such as TCF7, IL7R, were found to be upregulated in ADA-overexpressing HA CAR T cells (see, e.g., FIG. 10E). There was upregulation of many genes involved in cell proliferation, cMYC regulatory pathways, and fatty acid metabolism (see, e.g., FIG. 11E). In contrast, genes associated with effector functions, such as granzyme B, IL-3, IL-5, TNFSF4 (OX40), or TNFSF11 (RANKL), were downregulated.In addition, overexpression of transmembrane-bound ADA significantly reduces Foxp3 frequency in exhausted HA and non-exhausted CD19 CD8 and CD4 CAR T cells (see, e.g., Figures 10G and 11F). Reduction in the percentage of Tregs in ADA+CAR T cells led to improved effector function against tumor lines exhibiting different surface antigen density and proliferation (see, e.g., Figures 10H and 11G).

[0063] Furthermore, the experimental data described herein provide evidence that overexpression of transmembrane-bound ADA1 or transmembrane-bound ADA2 significantly improves the effector function of exhausted and non-exhausted CAR T cells in vitro and in vivo. In particular, CAR T cells engineered to overexpress either membrane-bound ADA1 or membrane-bound ADA2 resulted in increased tumor killing compared to control CAR T cells expressing HA (see, e.g., FIG. 12B). Both CAR T cells overexpressing either HA-ADA1-TM or HA-ADA2-TM produced more IL-2 and IFNγ compared to the control group, and this increase was abrogated in the presence of EHNA (see, e.g., FIG. 12D). These results indicate that the increase in cytokine secretion by CAR T cells was mediated by the enzymatic activity of transmembrane-bound ADA.

[0064] In one aspect, provided herein is a chimeric polypeptide comprising a first polypeptide module having adenosine deaminase activity and a second polypeptide module capable of anchoring (e.g., attaching, tethering, or immobilizing) the adenosine deaminase activity to the surface of a T cell.

[0065] Non-limiting exemplary embodiments of chimeric polypeptides according to the present disclosure include one or more of the following features: In some embodiments, the first polypeptide module is operably linked to the second polypeptide module. In some embodiments, the first polypeptide module has human adenosine deaminase activity. In some embodiments, the adenosine deaminase activity is the activity of ADA1, ADA2, or a functional variant of any of these. In some embodiments, the first polypeptide module has human ADA1 activity or a functional variant thereof. In some embodiments, the first polypeptide module has human ADA2 activity or a functional variant thereof. In some embodiments, the first polypeptide module comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:7, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 100% sequence identity. In some embodiments, the first polypeptide module comprises an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% sequence identity to the sequence of SEQ ID NO: 7. In some embodiments, the first polypeptide module comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 7. In some embodiments, the first polypeptide module comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 7, wherein 1, 2, 3, 4 or 5 amino acid residues in SEQ ID NO: 7 are replaced by a different amino acid residue.

[0066] In some embodiments, the first polypeptide module comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 8, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 100% sequence identity. In some embodiments, the first polypeptide module comprises an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% sequence identity to the sequence of SEQ ID NO: 8. In some embodiments, the first polypeptide module comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 8. In some embodiments, the first polypeptide module comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 8, wherein 1, 2, 3, 4 or 5 amino acid residues in SEQ ID NO: 8 are replaced by a different amino acid residue.

[0067] As described above, in some embodiments of the present disclosure, the second polypeptide module of the chimeric polypeptide comprises a polypeptide transmembrane domain. Non-limiting examples of transmembrane domains suitable for the compositions and methods of the present disclosure include those derived from CD8α, CD4, CD28, CD80, ICOS, CTLA4, PD1, PD-L1, BTLA, HVEM, CD27, 4-1BB, 4-1BBL, OX40, OX40L, DR3, GITR, CD30, SLAM, CD2, 2B4, TIM1, TIM2, TIM3, TIGIT, CD226, CD160, LAG3, LAIR1, B7-1, B7-H1, and B7-H transmembrane domains. In some embodiments, the polypeptide transmembrane domain is a CD8 transmembrane domain or a functional variant thereof. In some embodiments, the CD8 transmembrane domain comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:9, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 100% sequence identity. In some embodiments, the CD8 transmembrane domain comprises an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% sequence identity to the sequence of SEQ ID NO:7. In some embodiments, the CD8 transmembrane domain comprises an amino acid sequence having 100% sequence identity to SEQ ID NO:9. In some embodiments, the CD8 transmembrane domain comprises an amino acid sequence having 100% sequence identity to SEQ ID NO:9, wherein 1, 2, 3, 4 or 5 amino acid residues in SEQ ID NO:9 are replaced by different amino acid residues. In some embodiments, the first polypeptide module is operably linked to a second polypeptide module.

[0068] Designating an amino acid sequence of a chimeric polypeptide comprising a polypeptide module having adenosine deaminase activity as a "first" polypeptide module and designating an amino acid sequence of a chimeric polypeptide comprising a polypeptide module comprising a polypeptide transmembrane domain as a "second" polypeptide module is not intended to imply any particular structural arrangement of the "first" and "second" amino acid sequences within the chimeric polypeptide. As a non-limiting example, in some embodiments of the present disclosure, a chimeric polypeptide may comprise an N-terminal polypeptide module having adenosine deaminase activity and a C-terminal polypeptide module comprising a polypeptide transmembrane domain. In other embodiments, a chimeric polypeptide may comprise an N-terminal polypeptide module comprising a polypeptide transmembrane domain and a C-terminal polypeptide module having adenosine deaminase activity. Additionally or alternatively, a chimeric polypeptide may comprise two or more polypeptide modules having adenosine deaminase activity and / or two or more polypeptide modules comprising a polypeptide transmembrane domain. Thus, in some embodiments, the first amino acid sequence of the chimeric polypeptide comprises at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 polypeptide modules, each having adenosine deaminase activity. In some embodiments, the at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 polypeptide modules of the second amino acid sequence each comprise a polypeptide transmembrane domain.

[0069] In some embodiments, the first amino acid sequence of the chimeric polypeptide is operably linked to the second amino acid sequence via a linker.The linker that can be used in the multivalent polypeptide described herein is not particularly limited.In some embodiments, the linker is a synthetic compound linker, such as, for example, a chemical crosslinker. Non-limiting examples of suitable cross-linkers that are commercially available include N-hydroxysuccinimide (NHS), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS3), dithiobis(succinimidyl propionate) (DSP), dithiobis(sulfosuccinimidyl propionate) (DTSSP), ethylene glycol bis(succinimidyl succinate) (EGS), ethylene glycol bis(sulfosuccinimidyl succinate) (sulfo-EGS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST), bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone (BSOCOES), and bis[2-(sulfosuccinimidyloxy)ethyl]sulfone (sulfo-BSOCOES). Other examples of alternative structures and linkages suitable for multivalent polypeptides and multivalent antibodies of the present disclosure include those described in Spiess et al., Mol. Immunol. 67:95-106, 2015.

[0070] In some embodiments, the first amino acid sequence of the chimeric polypeptide disclosed herein is operably linked to the second amino acid sequence via a linker polypeptide sequence (peptide bond). In theory, there is no particular limit to the length and / or amino acid composition of the linker polypeptide sequence. In some embodiments, the linker of the polypeptide comprises a single-chain peptide comprising about 1-100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues). In some embodiments, the linker polypeptide sequence comprises about 5-50, about 10-60, about 20-70, about 30-80, about 40-90, about 50-100, about 60-80, about 70-100, about 30-60, about 20-80, about 30-90 amino acid residues. In some embodiments, the linker polypeptide sequence comprises about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, or about 50 to 70 amino acid residues. In some embodiments, the linker polypeptide sequence comprises about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the linker polypeptide sequence comprises about 1 to 10, about 5 to 15, about 10 to 20, or about 15 to 25 amino acid residues.

[0071] nucleic acid In one aspect, provided herein are isolated nucleic acids encoding the chimeric polypeptides described herein, expression cassettes encoding the chimeric polypeptides described herein, and expression vectors containing the isolated nucleic acids encoding the chimeric polypeptides described herein. In some embodiments, the isolated nucleic acids can be operably linked to regulatory sequences that facilitate expression of the chimeric polypeptides in a host cell.

[0072] The terms "nucleic acid" and "polynucleotide" may be used interchangeably herein and refer to both RNA and DNA molecules, including nucleic acids including cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. Nucleic acids may be double-stranded or single-stranded (e.g., sense or antisense strands). Nucleic acids may contain non-conventional or modified nucleotides. The terms "polynucleotide sequence" and "nucleic acid sequence", used interchangeably herein, refer to the sequence of a polynucleotide molecule. The nomenclature of nucleotide bases set forth in 37 CFR § 1.822 is used herein.

[0073] The nucleic acids of the present disclosure can be of any length, including nucleic acids that are generally about 0.5 Kb to about 20 Kb, for example, about 0.5 Kb to about 20 Kb, about 1 Kb to about 15 Kb, about 2 Kb to about 10 Kb, or about 5 Kb to about 25 Kb, for example, about 10 Kb to 15 Kb, about 15 Kb to about 20 Kb, about 5 Kb to about 20 Kb, about 5 Kb to about 10 Kb, or about 10 Kb to about 25 Kb.

[0074] In some embodiments disclosed herein, a nucleic acid of the disclosure comprises a nucleotide sequence that encodes a chimeric polypeptide comprising (i) a first polypeptide module having adenosine deaminase activity and (ii) a second polypeptide module capable of anchoring (e.g., attaching, tethering, or immobilizing) the adenosine deaminase activity to the surface of a T cell.

[0075] In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a chimeric polypeptide comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of a chimeric polypeptide or a functional fragment thereof disclosed herein.

[0076] Nucleic acid sequences having a high degree of sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) to the sequences of the modified genome or RNA replicon of the alphavirus species of interest can be identified and / or isolated by genomic sequence analysis, hybridization, and / or PCR using degenerate or gene-specific primers derived from sequences identified in the alphavirus species genome by using the sequences identified herein (e.g., SEQ ID NOs: 7-9) or any other sequences known in the art.

[0077] In some embodiments, the nucleic acid disclosed herein can be incorporated into an expression cassette or expression vector. Thus, some embodiments disclosed herein relate to a vector or expression cassette comprising the nucleic acid disclosed herein. An expression cassette will generally be understood to include a construct of genetic material that contains a coding sequence and sufficient control information to direct proper transcription and / or translation of the coding sequence in a recipient cell in vivo and / or ex vivo. Generally, the expression cassette can be inserted into a vector for targeting to a desired host cell and / or into an individual. Thus, in some embodiments, an expression cassette of the present disclosure includes a coding sequence of a chimeric polypeptide disclosed herein, which is operably linked to any one or combination of expression control elements such as a promoter, and optionally other nucleic acid sequences that affect the transcription or translation of the coding sequence.

[0078] In some embodiments, the nucleic acid of the present disclosure can be incorporated into an expression vector. The term "vector" generally refers to a recombinant polynucleotide construct designed for transfer between host cells, and will be understood by those skilled in the art to be used for transformation, e.g., for the introduction of heterologous DNA into a host cell. Thus, in some embodiments, the vector can be a plasmid, phage, or cosmid into which another DNA segment can be inserted to effect replication of the inserted segment. In some embodiments, the expression vector can be an integrating vector. Thus, also provided herein are vectors, plasmids, or viruses that contain one or more nucleic acids encoding any of the chimeric polypeptides disclosed herein. The above nucleic acids can be included within a vector that can direct their expression, for example, in a cell transduced with the vector. Vectors suitable for use in eukaryotic and prokaryotic cells are known in the art and are commercially available or readily prepared by those skilled in the art. Additional vectors can also be found, for example, in Ausubel, FM, et al., Current Protocols in Molecular Biology, (Current Protocols, 1994) and Sambrook et al., "Molecular Cloning: A Laboratory Manual," 2nd ED. (1989).

[0079] It should be understood that not all vectors and expression control sequences work equally well to express the DNA sequences described herein. Also, not all hosts work equally well in the same expression system. However, one of skill in the art can make a selection among these vectors, expression control sequences, and hosts without undue experimentation. For example, in selecting a vector, the host must be considered since the vector must replicate in the host. The copy number of the vector, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. For example, vectors that can be used include vectors that amplify the copy number of DNA encoding the multivalent polypeptides and multivalent antibodies of the present disclosure. Such amplifiable vectors are known in the art. These include, for example, vectors that can be amplified by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461) or glutamine synthetase ("GS") amplification (see, e.g., U.S. Pat. No. 5,122,464 and European Patent No. 338,841).

[0080] Thus, in some embodiments, the chimeric polypeptides of the present disclosure can be expressed from vectors, generally expression vectors. Vectors can be useful for autonomous replication in a host cell, or can be integrated into the genome of the host cell upon introduction into the host cell, and thereby replicated together with the host genome (e.g., non-episomal mammalian vectors). Expression vectors can direct the expression of coding sequences to which they are operably linked. Generally, expression vectors useful in recombinant DNA technology are often in the form of plasmids (vectors). However, other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), are also included.

[0081] Exemplary recombinant expression vectors are selected based on the host cell to be used for expression, and can contain one or more control sequences operably linked to the nucleic acid sequence to be expressed.

[0082] Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY) and other standard molecular biology laboratory manuals.

[0083] The nucleic acid sequence encoding the chimeric polypeptide of the present disclosure can be optimized for expression in a host cell of interest. For example, the GC content of the sequence can be adjusted to an average level for a given cell host, calculated by referring to known genes expressed in the host cell. Methods for codon optimization are known in the art. The codon usage in the coding sequence of the chimeric polypeptide disclosed herein can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons in the coding sequence are optimized for expression in the host cell. In these examples, the expression of the codon-optimized polypeptide can be enhanced by at least about 20%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% compared to a reference polypeptide, for example, the original polypeptide that is not codon-optimized.

[0084] In selecting an expression control sequence, various factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the actual DNA sequence encoding the chimeric polypeptide of interest, especially with respect to potential secondary structure. A host should be selected taking into consideration compatibility with the selected vector, toxicity of the product encoded by the DNA sequence of the present disclosure, secretion characteristics, ability to correctly fold the polypeptide, fermentation or cultivation requirements, and ease of purification of the product encoded by the DNA sequence.

[0085] Viral vectors that can be used in the present disclosure include, for example, retrovirus, adenovirus and adeno-associated virus, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, e.g., Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY).

[0086] The nucleic acid is not limited to the sequence that codes for the chimeric polypeptide. It can also include some or all of the non-coding sequences located upstream or downstream of the coding sequence. Those skilled in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. For example, the nucleic acid molecule can be generated by treating genomic DNA with a restriction endonuclease or by performing a polymerase chain reaction (PCR). If the nucleic acid molecule is a ribonucleic acid (RNA), the molecule can be produced, for example, by in vitro transcription.

[0087] Exemplary nucleic acids of the present disclosure can include fragments not naturally found in the natural state. Thus, the present disclosure encompasses recombinant nucleic acid molecules, e.g., recombinant nucleic acid molecules in which a nucleic acid sequence (e.g., a sequence encoding a chimeric polypeptide of the present disclosure) is integrated into a vector (e.g., a plasmid or viral vector) or into the genome of a host cell (e.g., a T cell).

[0088] manipulated T cells A nucleic acid encoding a chimeric polypeptide of the present disclosure can be introduced into a host cell, such as, for example, a human T lymphocyte, to produce an engineered T cell containing the nucleic acid. Introduction of a nucleic acid molecule of the present disclosure into a cell can be accomplished by methods known to those skilled in the art, such as, for example, viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0089] In some embodiments, a host cell (e.g., a T cell) may be genetically engineered (e.g., transduced or transformed or transfected) with, for example, a vector construct of the present application, which may be, for example, a viral vector, or a vector for homologous recombination that includes a nucleic acid sequence homologous to a portion of the genome of the host cell, or an expression vector for expression of a polypeptide of interest. The host cell (e.g., a T cell) may be either an untransformed cell or a cell that has already been transfected with at least one nucleic acid molecule.

[0090] In some embodiments, the host cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell.

[0091] In some embodiments, the host cell is an immune system cell, such as a lymphocyte (e.g., a T cell or an NK cell), or a dendritic cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (T H ), cytotoxic T cells (T CTL ), or other T cells.

[0092] In some embodiments, the immune system cells are T lymphocytes. In some embodiments, the cells can be obtained by leukapheresis performed on a sample obtained from a subject. In some embodiments, the subject is a human patient or subject having, at risk of having, or suspected of having a disease of interest (e.g., cancer) and / or one or more symptoms of the disease.

[0093] Thus, in one aspect, provided herein are engineered T cells produced by any of the methods provided herein. In some embodiments, the T cells are CD8+ T cytotoxic lymphocyte cells or CD4+ T helper lymphocyte cells. In some embodiments, the CD8+ T cytotoxic lymphocyte cells are selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, and bulk CD8+ T cells. In some embodiments, the CD4+ T helper lymphocyte cells are selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells. In some embodiments, the T cells are exhausted T cells. In some embodiments, the T cells are non-exhausted T cells. In some embodiments, the T cells are obtained by leukapheresis of a sample obtained from a subject.

[0094] In another aspect, provided herein is a cell culture comprising at least one engineered T cell disclosed herein and a culture medium. Generally, the culture medium can be any culture medium suitable for culturing the cells described herein. Techniques for transforming a wide variety of the above host cells and species are known in the art and described in the technical and scientific literature. Thus, a cell culture comprising at least one engineered cell and a culture medium disclosed herein is also within the scope of this application. Suitable methods and systems for generating and maintaining cell cultures are known in the art.

[0095] Pharmaceutical Compositions The engineered T cells, chimeric polypeptides, and nucleic acids encoding the chimeric polypeptides of the present disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions can generally include one or more engineered T cells, chimeric polypeptides, and nucleic acids encoding the chimeric polypeptides of the present disclosure, and a pharma- ceutically acceptable excipient, such as a carrier. Thus, in one aspect, some embodiments of the present disclosure relate to a pharmaceutical composition comprising a pharma- ceutically acceptable excipient and (a) the engineered T cells of the present disclosure; (b) the chimeric polypeptide of the present disclosure; and / or (c) a nucleic acid encoding the chimeric polypeptide of the present disclosure.

[0096] In some embodiments, the pharmaceutical compositions of the present disclosure are formulated to treat, ameliorate, or reduce or delay the onset of a health condition, e.g., a proliferative disease such as cancer.

[0097] Non-limiting exemplary embodiments of the pharmaceutical compositions described herein may include one or more of the following features: In some embodiments, the composition comprises a nucleic acid encoding one or more chimeric polypeptides of the present disclosure and a pharma- ceutically acceptable excipient. In some embodiments, the nucleic acid is encapsulated in a viral capsid or lipid nanoparticle. In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector. In some embodiments, the expression vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0098] In some embodiments, the nucleic acid can be introduced into a host immune cell, e.g., a T lymphocyte, to produce a recombinant immune cell comprising the nucleic acid. In some embodiments, the nucleic acid can be administered to a subject in need thereof.

[0099] Introduction of the nucleic acids of the present disclosure into cells can be accomplished by methods known to those of skill in the art, such as, for example, viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0100] Thus, in some embodiments, the nucleic acid molecule may be delivered by a viral or non-viral delivery vehicle known in the art. For example, the nucleic acid molecule may be stably integrated into the host genome, or may be episomally replicated, or may exist in the host cell as a minicircle expression vector for transient expression. Thus, in some embodiments, the nucleic acid molecule is maintained and replicated in the host cell as an episomal unit. In some embodiments, the nucleic acid molecule is stably integrated into the genome of the host cell. Stable integration can be achieved using classical random genome recombination techniques, or using more precise techniques such as guide RNA-directed CRISPR / Cas9 genome editing, or DNA-guided endonuclease genome editing using NgAgo (Natronobacterium gregoryi Argonaute), or TALEN genome editing (transcription activator-like effector nuclease). In some embodiments, the nucleic acid molecule exists in the host cell as a minicircle expression vector for transient expression.

[0101] The nucleic acid molecule can be encapsulated in a viral capsid, or liposome, or lipid nanoparticle (LNP), or can be delivered by viral or non-viral delivery means and methods known in the art, such as electroporation. For example, the introduction of nucleic acid into cells can be achieved by viral transduction. In a non-limiting example, adeno-associated virus (AAV) can be engineered to deliver nucleic acid to target cells via viral transduction. Several AAV serotypes have been described, and all known serotypes can infect cells of multiple diverse tissue types. AAV can transduce a wide range of species and tissues in vivo without exhibiting toxicity, and produces relatively mild innate and adaptive immune responses.

[0102] Lentivirus-derived vector systems are also useful for nucleic acid delivery and gene therapy by viral transduction. Lentivirus vectors offer several attractive properties as gene delivery vehicles, including: (i) sustained gene delivery through stable vector integration into the host genome, (ii) ability to infect both dividing and non-dividing cells, (iii) broad tissue tropism, including important gene and cell therapy target cell types, (iv) no expression of viral proteins after vector transduction, (v) ability to deliver complex genetic elements such as polycistronic or intron-containing sequences, (vi) potentially safer integration site profile, and (vii) relatively easy system for vector engineering and production.

[0103] In some embodiments, the composition comprises at least one engineered T cell of the present disclosure and a pharma- ceutically acceptable excipient. In some embodiments, the at least one engineered T cell, when introduced into a subject, exhibits enhanced effector function compared to the effector function of a control T cell, e.g., a non-engineered T cell, under similar conditions. Examples of enhanced effector function in engineered T cells include, but are not limited to, growth rate (proliferation), mortality rate, type of mortality, target cell inhibition (cytotoxicity), target cell killing, target cell survival, differentiation cluster change, macrophage activation, B cell activation, cytokine production, in vivo persistence, and improved spare respiratory capacity.

[0104] In certain embodiments, pharmaceutical compositions according to some embodiments disclosed herein include cultures of engineered T cells that can be washed, treated, combined, replenished, or otherwise modified prior to administration to an individual in need thereof. Furthermore, administration can be at various doses, time intervals, or multiple administrations.

[0105] In certain embodiments, pharmaceutical compositions according to some embodiments disclosed herein comprise engineered T cells comprising a chimeric polypeptide of the present disclosure.

[0106] The pharmaceutical compositions provided herein may be in any form that allows the composition to be administered to a subject. In some specific embodiments, the pharmaceutical composition is suitable for administration to humans. As used herein, the term "pharmaceutical acceptable" means approved by a federal or state regulatory agency or listed in the United States Pharmacopeia or other generally recognized pharmacopoeias for use in animals, more specifically in humans. A carrier may be a diluent, adjuvant, excipient, or vehicle administered with a pharmaceutical composition. Saline and aqueous dextrose and glycerol solutions can also be used as liquid carriers, including injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. In some embodiments, the pharmaceutical composition is formulated sterilely for administration to an individual. In some embodiments, the individual is a human. One of ordinary skill in the art will appreciate that the formulation must be compatible with the mode of administration.

[0107] In some embodiments, the pharmaceutical composition of the present disclosure is formulated to suit the intended route of administration to an individual.For example, the pharmaceutical composition can be formulated to suit parenteral administration, intraperitoneal administration, colorectal administration, intraperitoneal administration, and intratumoral administration.In some embodiments, the pharmaceutical composition can be formulated for intravenous administration, oral administration, intraperitoneal administration, intratracheal administration, subcutaneous administration, intramuscular administration, topical administration, or intratumoral administration.

[0108] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants, for example, sodium dodecyl sulfate. The action of microorganisms can be prevented by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, generally, isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, and / or sodium chloride, are included in the composition. Prolonged absorption of the injectable composition can be achieved by including in the composition an agent that delays absorption, such as aluminum monostearate and gelatin.

[0109] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.

[0110] In some embodiments, the engineered immune cells of the present disclosure can be formulated for administration to a subject using techniques known to those of skill in the art. For example, a formulation comprising a population of engineered immune cells can include a pharma- ceutically acceptable excipient. The excipients included in the formulation serve different purposes, for example, depending on the engineered immune cells used and the mode of administration. Examples of commonly used excipients include, but are not limited to, saline, buffered saline, dextrose, water for injection, glycerol, ethanol, and combinations thereof, stabilizers, solubilizers and surfactants, buffers and preservatives, tonicity agents, bulking agents, and lubricants. The formulation comprising engineered immune cells can be prepared and cultured in the absence of non-human components, for example, in the absence of animal serum. The formulation can include one population of engineered immune cells, or two or more populations of engineered immune cells, for example, two, three, four, five, six or more populations.

[0111] The formulation comprising the population of engineered immune cells can be administered to a subject using modes and techniques known to those skilled in the art. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, but are not limited to, intratumoral, intradermal, subcutaneous (SC, sq, sub-Q, Hypo), intramuscular (im), intraperitoneal (ip), intraarterial, intramedullary, intracardiac, intraarticular (joint), intrasynovial (joint fluid area), intracranial, intraspinal, and intrathecal (spinal fluid). Such administration can be performed using devices useful for parenteral injection or infusion of formulations.

[0112] kit Also provided herein is a kit for carrying out the methods described herein. The kit may include one or more of the engineered immune cells (e.g., engineered T cells), chimeric polypeptides, nucleic acids encoding the chimeric polypeptides, and / or pharmaceutical compositions described and provided herein. For example, provided herein is a kit that, in some embodiments, includes one or more engineered T cells of the present disclosure. In some embodiments, provided herein is a kit that includes one or more pharmaceutical compositions of the present disclosure. In some embodiments, the kit of the present disclosure further includes written instructions for making and using the engineered T cells, chimeric polypeptides, nucleic acids encoding the chimeric polypeptides, and / or pharmaceutical compositions of the present disclosure.

[0113] In some embodiments, the kits of the present disclosure further comprise one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer any one of the provided T cells, nucleic acids, and pharmaceutical compositions to a subject in need thereof. In some embodiments, the kits may have one or more additional therapeutic agents that can be administered simultaneously or sequentially with other kit components for a desired purpose, e.g., to modulate the activity of cells, inhibit target cancer cells, or treat a health condition in a subject in need thereof.

[0114] For example, any of the above kits can further comprise one or more additional reagents, which can be selected from a dilution buffer, a reconstitution solution, a wash buffer, a control reagent, a control expression vector, a negative control T cell population, a positive control T cell population, and reagents for ex vivo production of T cell populations.

[0115] In some embodiments, the components of the kit can be in separate containers. In some other embodiments, the components of the kit can be combined in a single container. For example, in some embodiments of the present disclosure, the kit includes one or more of the provided immune cells, nucleic acids, and / or pharmaceutical compositions described herein in one container (e.g., in a sterile glass or plastic vial) and an additional therapeutic agent in another container (e.g., in a sterile glass or plastic vial).

[0116] In some embodiments, the kit may further include instructions for using the components of the kit to carry out the methods disclosed herein. For example, the kit may include a package insert containing information about the pharmaceutical compositions and dosage forms in the kit. Generally, such information helps patients and physicians to effectively and safely use the enclosed pharmaceutical compositions and dosage forms. For example, the following information about the combinations of the present disclosure may be provided in the package insert: pharmacokinetics, pharmacodynamics, clinical trials, efficacy parameters, indications and methods of use, contraindications, warnings, cautions, adverse reactions, overdosage, appropriate use and dosage, method of delivery, appropriate storage conditions, reference materials, manufacturer / distributor information, and proprietary information.

[0117] In some embodiments, the kit may include further instructions for using the components of the kit to carry out the methods disclosed herein. The instructions for carrying out the methods are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate such as paper or plastic. The instructions can be present in the kit as a package insert, in the label of the container of the kit or its components (e.g., associated with the package or subpackage), etc. The instructions can be present as an electronic storage data file present on a suitable computer-readable storage medium, such as a CD-ROM, diskette, flash drive, etc. In some cases, the actual instructions are not present in the kit, but a means for obtaining the instructions from a remote source (e.g., via the Internet) can be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[0118] Methods of the Disclosure As described in more detail below, one aspect of the disclosure relates to methods of generating the engineered T cells described herein, methods of administering the engineered T cells, and methods of treating individuals with associated health conditions, such as proliferative diseases (e.g., cancer), autoimmune diseases, and microbial infections (e.g., viral infections).

[0119] Methods for generating engineered T cells A nucleic acid encoding a chimeric polypeptide of the present disclosure can be introduced into a host cell, such as, for example, a human T lymphocyte, to produce an engineered T cell containing the nucleic acid. Introduction of a nucleic acid molecule of the present disclosure into a cell can be accomplished by methods known to those skilled in the art, such as, for example, viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0120] The nucleic acid can be delivered, for example, by a viral or non-viral delivery vehicle known in the art. In some embodiments, the nucleic acid can be maintained and replicated in the host cell (e.g., T cell) as an episomal unit. In some embodiments, the nucleic acid can be stably integrated into the genome of the host cell (e.g., T cell). Stable integration can be achieved using classical random genome recombination techniques, or more precise techniques such as guide RNA-directed CRISPR / Cas9 genome editing, or DNA-guided endonuclease genome editing using NgAgo (Natronobacterium gregoryi Argonaute), or TALEN genome editing (transcription activator-like effector nuclease). In some embodiments, the nucleic acid can be present in the host cell (e.g., T cell) as a minicircle expression vector for transient expression.

[0121] Thus, in certain embodiments, provided herein is a method for generating an engineered T cell with enhanced effector function, comprising introducing any one of the chimeric polypeptides of the present disclosure or a nucleic acid encoding the chimeric polypeptide into a T cell. In some embodiments, the introduced chimeric polypeptide results in a reduced intracellular level of adenosine in the engineered T cell compared to a reference T cell that does not contain the chimeric polypeptide. In some embodiments, the introduced chimeric polypeptide results in an enhanced effector function of the engineered T cell compared to a control T cell under similar conditions, e.g., a T cell that has not been engineered to contain such a chimeric polypeptide. In some embodiments, the method further comprises introducing at least one recombinant antigen-specific receptor into the T cell. In some embodiments, the at least one recombinant antigen-specific receptor comprises an engineered T cell receptor (TCR) and / or an engineered chimeric antigen receptor (CAR).

[0122] Treatment method Administration of any one of the therapeutic compositions described herein, e.g., engineered T cells, nucleic acid molecules encoding chimeric polypeptides of the present disclosure, and pharmaceutical compositions, can be used to treat an individual in the treatment of associated health conditions, such as proliferative diseases (e.g., cancer), autoimmune diseases, and microbial infections (e.g., viral infections). In some embodiments, one or more of the engineered T cells, nucleic acid molecules, and pharmaceutical compositions described herein can be incorporated into a therapeutic agent for use in a method of treating a subject having, suspected of having, or potentially at risk for developing one or more health conditions, such as proliferative diseases (e.g., cancer), autoimmune diseases, and chronic infections. In some embodiments, the subject is a mammalian subject. In some embodiments, the subject has or is suspected of having a proliferative disease, an autoimmune disease, or an infection. In some embodiments, the proliferative disease is cancer. In some embodiments, the subject is a patient under the care of a physician.

[0123] Thus, in certain aspects, provided herein is a method for preventing and / or treating a health condition in a subject in need thereof, comprising administering to the subject a composition comprising: (a) at least one engineered T cell of the present disclosure; and / or (b) a pharmaceutical composition of the present disclosure. In some embodiments, the health condition is a proliferative disease (e.g., cancer), an autoimmune disease, or a chronic infectious disease. In some embodiments, the subject is a mammalian subject. In some embodiments, the mammalian subject is a human subject. In some embodiments, the engineered T cells are autologous to the subject. In some embodiments, the engineered T cells are obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs). In some embodiments, the administered composition inhibits adenosine-mediated immunosuppression in the subject. In some embodiments, adenosine-mediated immunosuppression in a subject is inhibited by at least 10%, e.g., at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 20-fold, about 50-fold, about 100-fold, or about 200-fold, as compared to a reference subject. In some embodiments, the reference subject is a subject that has not been administered the same composition. In some embodiments, the reference subject is a subject that has been administered a polypeptide having adenosine deaminase activity that does not have adenosine deaminase activity and / or is not operably linked to a polypeptide module that can anchor (e.g., attach, tether, or immobilize) the adenosine deaminase activity to the surface of a T cell.

[0124] In some embodiments, the administered composition confers enhanced effector function of the engineered T cells compared to the effector function of a control T cell under similar conditions, e.g., a T cell that has not been administered such a composition. Examples of enhanced effector function in engineered immune cells include, but are not limited to, growth rate (proliferation), mortality rate, type of mortality, target cell inhibition (cytotoxicity), differentiation cluster changes, macrophage activation, B cell activation, cytokine production, in vivo persistence, and improved spare respiratory capacity. In some embodiments, the effector function of immune cells comprising a composition of the present disclosure is enhanced at a level at least 10% higher, e.g., at least about 10% higher than about 10%, at least about 20% higher, at least about 30% higher, at least about 40% higher, at least about 50% higher, at least about 60% higher, at least about 70% higher, at least about 80% higher, at least about 90% higher, at least about 2-fold higher, at least about 3-fold higher, at least about 4-fold higher, at least about 5-fold higher, at least about 6-fold higher, at least about 7-fold higher, at least about 8-fold higher, at least about 9-fold higher, at least about 20-fold higher, at least about 50-fold higher, at least about 100-fold higher, or at least about 200-fold higher, compared to a reference immune cell under similar conditions, e.g., a reference T cell that has not been administered the same composition. Thus, in some embodiments, the reference immune cell does not comprise a composition of the present disclosure. For example, in some embodiments, the reference T cell is a T cell that has not been administered the same composition. In some embodiments, the reference T cell is a T cell that does not have adenosine deaminase activity and / or has been administered a polypeptide having adenosine deaminase activity that is not operably linked to a polypeptide module that can anchor (e.g., attach, tether, or immobilize) the adenosine deaminase activity to the surface of the T cell.

[0125] In some embodiments, the enhanced effector function comprises increased production of one or more cytokines (e.g., interferon gamma (INFγ), tumor necrosis factor alpha (TNFα), and interleukin-2 (IL-2)). In some embodiments, the administered composition results in increased production of one or more cytokines by at least 10%, e.g., at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 20-fold, about 50-fold, about 100-fold, or about 200-fold, as compared to a reference immune cell, e.g., a reference T cell, under similar conditions. In some embodiments, the reference T cell is a T cell that has not been administered the same composition. In some embodiments, the reference T cell is a T cell that does not have adenosine deaminase activity and / or has been administered a polypeptide having adenosine deaminase activity that is not operably linked to a polypeptide module that can anchor (e.g., attach, tether, or immobilize) the adenosine deaminase activity to the surface of the T cell.

[0126] In some embodiments, the composition is administered to a subject individually (monotherapy) or in combination with a second therapy, wherein the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, or surgery.

[0127] Non-limiting exemplary embodiments of the therapeutic methods described herein may include one or more of the following features: In some embodiments, the health condition is a proliferative disease or an infectious disease. Exemplary proliferative diseases may include, but are not limited to, angiogenic diseases, metastatic diseases, tumorigenic diseases, neoplastic diseases, and cancer. In some embodiments, the proliferative disease is cancer. In some embodiments, the cancer is pediatric cancer. In some embodiments, the cancer is pancreatic cancer, colon cancer, ovarian cancer, prostate cancer, lung cancer, mesothelioma, breast cancer, urothelial cancer, liver cancer, head and neck cancer, sarcoma, cervical cancer, gastric cancer, melanoma, uveal melanoma, cholangiocarcinoma, multiple myeloma, leukemia, lymphoma, and glioblastoma.

[0128] In some embodiments, the cancer is a multidrug resistant cancer or a recurrent cancer. It is contemplated that the compositions and methods disclosed herein are suitable for both non-metastatic and metastatic cancers. Thus, in some embodiments, the cancer is a non-metastatic cancer. In some other embodiments, the cancer is a metastatic cancer. In some embodiments, the composition administered to the subject inhibits metastasis of the cancer in the subject. In some embodiments, the composition administered inhibits tumor growth in the subject.

[0129] Exemplary proliferative diseases may include, but are not limited to, angiogenic diseases, metastatic diseases, tumorigenic diseases, neoplastic diseases, and cancer. In some embodiments, the proliferative disease is cancer. The term "cancer" generally refers to diseases characterized by the rapid and uncontrolled growth of abnormal cells. The abnormal cells may form solid tumors or constitute hematological malignancies. Cancer cells may spread locally or via the bloodstream and lymphatic system to other parts of the body. There are no particular limitations regarding the cancers that can be treated by the compositions and methods of the present disclosure. Non-limiting examples of suitable cancers include ovarian cancer, renal cancer, breast cancer, prostate cancer, liver cancer, brain cancer, lymphoma, leukemia, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, lung cancer, and the like.

[0130] Other cancers that may be suitably treated with the compositions and methods of the present disclosure include acute myeloblastic leukemia (AML), acute lymphoblastic leukemia (ALL), chronic myelogenous leukemia (CML), adrenal cortical carcinoma, anal cancer, aplastic anemia, bile duct cancer, bladder cancer, bone cancer, bone metastases, brain cancer, central nervous system (CNS) cancer, peripheral nervous system (PNS) cancer, breast cancer, cervical cancer, colon and rectal cancer, endometrial cancer, esophageal cancer, Ewing family of tumors (e.g., Ewing sarcoma), eye cancer, transitional cell carcinoma, vaginal cancer, myeloproliferative disorders, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumors, prostate cancer, retinoblastoma, These include, but are not limited to, gallbladder cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic disease, non-Hodgkin's lymphoma, Hodgkin's lymphoma, childhood non-Hodgkin's lymphoma, Kaposi's sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, liver cancer, lung cancer, pulmonary carcinoid tumor, malignant mesothelioma, multiple myeloma, myelodysplastic syndrome, rhabdomyosarcoma, salivary gland cancer, sarcoma, melanoma skin cancer, non-melanoma skin cancer, gastric cancer, testicular cancer, thymic cancer, thyroid cancer, uterine cancer (e.g., uterine sarcoma), transitional cell carcinoma, vaginal cancer, vulvar cancer, mesothelioma, squamous cell or epidermoid carcinoma, bronchial adenoma, choriocarcinoma, head and neck cancer, teratocarcinoma, or Waldenstrom's macroglobulinemia.

[0131] Particularly suitable cancers include, but are not limited to, breast cancer, ovarian cancer, lung cancer, pancreatic cancer, mesothelioma, leukemia, lymphoma, brain cancer, prostate cancer, multiple myeloma, melanoma, bladder cancer, osteosarcoma, soft tissue sarcoma, retinoblastoma, renal tumor, neuroblastoma, and carcinoma.

[0132] In some embodiments, the cancer is a multidrug resistant cancer or a recurrent cancer. It is contemplated that the compositions and methods disclosed herein are suitable for both non-metastatic and metastatic cancers. Thus, in some embodiments, the cancer is a non-metastatic cancer. In some other embodiments, the cancer is a metastatic cancer. In some embodiments, the composition administered to the subject inhibits metastasis of the cancer in the subject. For example, in some embodiments, the composition administered to the subject can reduce metastatic nodules in the subject. In some embodiments, the administered composition inhibits tumor growth in the subject.

[0133] In some embodiments, the proliferative disease is an autoimmune disease, hi some embodiments, the autoimmune disease is selected from the group consisting of rheumatoid arthritis, insulin-dependent diabetes mellitus, hemolytic anemia, rheumatic fever, thyroiditis, Crohn's disease, myasthenia gravis, glomerulonephritis, autoimmune hepatitis, multiple sclerosis, alopecia areata, psoriasis, vitiligo, dystrophic epidermolysis bullosa, systemic lupus erythematosus, moderate to severe plaque psoriasis, psoriatic arthritis, Crohn's disease, ulcerative colitis, and graft-versus-host disease.

[0134] In some embodiments, the administered composition inhibits proliferation of the target cancer cells and / or inhibits tumor growth of the cancer in the subject. For example, the target cells may be inhibited if their proliferation is reduced, if their pathological or pathogenic behavior is reduced, if the target cells are destroyed or killed, etc. Inhibition includes at least about a 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% reduction in the measured pathological or pathogenic behavior. In some embodiments, the method includes administering to the individual an effective number of engineered immune cells as disclosed herein, wherein the engineered immune cells inhibit proliferation of the target cells and / or inhibit tumor growth of the target cancer in the subject compared to proliferation of the target cells and / or tumor growth of the target cancer in a subject not administered the engineered immune cells.

[0135] Administration of the compositions described herein, such as engineered immune cells, nucleic acids, and pharmaceutical compositions, can be used in stimulating immune responses. In some embodiments, one or more of the engineered immune cells, nucleic acids, and / or pharmaceutical compositions described herein are administered to an individual after induction of cancer remission by chemotherapy or after autologous or allogeneic hematopoietic stem cell transplantation. In some embodiments, the compositions described herein are administered to a subject in need of increased production of interferon gamma (IFNγ), tumor necrosis factor alpha (TNFα), and / or interleukin-2 (IL-2) in a subject receiving one of the therapeutic compositions disclosed herein, compared to the production of these molecules in a subject not receiving the therapeutic compositions disclosed herein.

[0136] In some embodiments, the administered composition confers enhanced effector function of immune cells, e.g., T cells. Examples of enhanced effector functions in engineered immune cells include, but are not limited to, growth rate (proliferation), death rate, type of death, target cell inhibition (cytotoxicity), target cell killing, target cell survival, differentiation cluster changes, macrophage activation, B cell activation, cytokine production, in vivo persistence, and improved spare respiratory capacity. In some embodiments, the effector function of immune cells comprising a composition of the present disclosure is enhanced at a level at least 10% higher, e.g., at least about 10% higher than about 10%, at least about 20% higher, at least about 30% higher, at least about 40% higher, at least about 50% higher, at least about 60% higher, at least about 70% higher, at least about 80% higher, at least about 90% higher, at least about 2-fold higher, at least about 3-fold higher, at least about 4-fold higher, at least about 5-fold higher, at least about 6-fold higher, at least about 7-fold higher, at least about 8-fold higher, at least about 9-fold higher, at least about 20-fold higher, at least about 50-fold higher, at least about 100-fold higher, or at least about 200-fold higher, compared to a reference immune cell under similar conditions, e.g., a reference T cell not administered such a composition. In some embodiments, the reference immune cell does not comprise a composition of the present disclosure. In some embodiments, the administered composition results in increased cell surface expression of ADA in the immune cell. In some embodiments, the administered composition results in increased cell surface expression of ADA by at least 10%, e.g., at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 20-fold, about 50-fold, about 100-fold, or about 200-fold, as compared to a reference immune cell, e.g., a reference T cell, under similar conditions. In some embodiments, the reference T cell is a T cell that has not been administered the same composition.In some embodiments, the reference T cell is a T cell that does not have adenosine deaminase activity and / or has been administered a polypeptide having adenosine deaminase activity that is not operably linked to a polypeptide module capable of anchoring the adenosine deaminase activity to the surface of the T cell.

[0137] The effective amount of the compositions described herein, e.g., engineered T cells, nucleic acids, and / or pharmaceutical compositions, can be determined based on the intended goal, e.g., regression of cancer. For example, if an existing cancer is being treated, the amount of the compositions disclosed herein may be greater than if the administration of the composition is for the prevention of cancer. One of skill in the art will be able to determine the dosage and frequency of administration of the compositions in light of the present disclosure. The dosage will also vary depending on the individual to whom it is administered, the individual's condition, and the protection desired, both as a function of the number of administrations and the dose. The exact amount of the composition will also depend on the physician's judgment and will be unique to each subject. The frequency of administration may range from 1-2 days, to 2-6 hours, to 6-10 hours, to 1-2 weeks, or more, depending on the physician's judgment.

[0138] The determination of the dosage of the composition can be made by one skilled in the art and depends in part on the extent and severity of the cancer, and on whether the engineered immune cells, e.g., T cells, are administered to treat an existing cancer or to prevent cancer. For example, for prophylactic purposes, longer administration intervals and lower amounts of the composition can be employed. For example, the dosage of the composition per administration can be 50% of the dosage administered in the treatment of active disease, and administration can be at weekly intervals. In light of the present disclosure, one skilled in the art will be able to determine the effective amount and frequency of administration of the composition. This determination will depend in part on the particular clinical situation present (e.g., type of cancer, severity of cancer).

[0139] In some embodiments, it may be desirable to provide a treatment subject, e.g., a patient, with a continuous supply of the compositions disclosed herein. In some embodiments, continuous perfusion of the area of ​​interest (such as a tumor) may be preferred. The duration of perfusion is selected by the clinician for the particular subject and situation, but the time may range from about 1-2 hours, to about 2-6 hours, to about 6-10 hours, to about 10-24 hours, to about 1-2 days, to about 1-2 weeks, or longer. Generally, the dose of the composition by continuous perfusion is equivalent to the dose given by single or multiple injections, adjusted for the period over which the dose is administered.

[0140] In some embodiments, administration is by intravenous infusion. The effective amount of the engineered T cells, nucleic acids, and / or pharmaceutical compositions disclosed herein can be determined based on the intended goal, e.g., tumor regression. For example, if an existing cancer is being treated, the number of cells administered may be greater than if the administration of the engineered immune cells, e.g., T cells, disclosed herein, is for the prevention of cancer. One of skill in the art would be able to determine the number of cells administered and the frequency of administration in light of the present disclosure. Also, the dosage will vary depending on the individual to whom it is administered, the individual's condition, and the protection desired, both as a function of the number of administrations and the dose. The exact amount of therapeutic composition is also dependent on the physician's judgment and is unique to each individual. The frequency of administration may range from 1-2 days, to 2-6 hours, to 6-10 hours, to 1-2 weeks, or more, depending on the physician's judgment. Generally, the dose of therapeutic composition by continuous perfusion is equivalent to the dose given by single or multiple injections, adjusted for the period of time over which the dose is administered.

[0141] Administration of engineered immune cells to a subject. In some embodiments, the methods of the present disclosure involve administering an effective amount or number of engineered immune cells, e.g., T cells, provided herein to a subject in need thereof. This administration step can be accomplished using any transplant delivery method in the art. For example, the engineered immune cells, e.g., engineered T cells, can be directly injected into the subject's bloodstream or otherwise administered to the subject.

[0142] In some embodiments, the methods disclosed herein include administering engineered immune cells, e.g., engineered T cells, to an individual by a method or route that results in at least partial localization of the introduced cells at a desired site such that a desired effect occurs, a term that is used interchangeably with the terms "introducing," "implanting," and "transplanting." The engineered immune cells, e.g., engineered T cells, or their differentiated progeny, can be administered by any suitable route that delivers the administered cells or components of the cells to a desired location in an individual where at least a portion of the cells remain viable. The survival period of the cells after administration to a subject can be as short as a few hours, e.g., 24 hours, to days, years, or even the lifetime of the individual, e.g., long-term engraftment.

[0143] When provided prophylactically, the engineered immune cells, e.g., engineered T cells, described herein can be administered to a subject prior to any symptoms of the disease or health condition being treated. Thus, in some embodiments, prophylactic administration of the engineered T cell population prevents the onset of symptoms of the disease or health condition.

[0144] When provided therapeutically in some embodiments, the engineered immune cells are provided at (or after) the onset of a symptom or sign of a disease or health condition, e.g., at the onset of the disease or health condition.

[0145] For use in the various embodiments described herein, an effective amount of the engineered immune cells, e.g., T cells, disclosed herein is at least 10 2 Cells, at least 5 x 10 2 Cells, at least 103 Cells, at least 5 x 10 3 Cells, at least 10 4 Cells, at least 5 x 10 4 Cells, at least 10 5 Cells, at least 2 x 10 5 Cells, at least 3 x 10 5 Cells, at least 4 x 10 5 Cells, at least 5 x 10 5 Cells, at least 6 x 10 5 Cells, at least 7 x 10 5 Cells, at least 8 x 10 5 Cells, at least 9 x 10 5 Cells, at least 1 x 10 6 Cells, at least 2 x 10 6 Cells, at least 3 x 10 6 Cells, at least 4 x 10 6 Cells, at least 5 x 10 6 Cells, at least 6 x 10 6 Cells, at least 7 x 10 6 Cells, at least 8 x 10 6 Cells, at least 9 x 10 6 The cell may be a single cell or a multiple thereof.

[0146] In some embodiments, the engineered immune cells, e.g., T cells, are not autologous to the subject in need of treatment. In some embodiments, the adoptive cell therapy is allogeneic adoptive cell therapy. For example, in some embodiments, the engineered immune cells, e.g., T cells, are allogeneic to the subject in need of treatment. In allogeneic adoptive cell therapy, the engineered immune cells, e.g., T cells, are not derived from the individual receiving the adoptive cell therapy. Allogeneic cell therapy generally refers to a therapy in which the individual providing the immune cells (donor) is a different individual (of the same species) from the individual receiving the cell therapy. For example, the population of engineered immune cells administered to the individual is derived from one or more unrelated donors, or from one or more non-identical siblings. Thus, the engineered immune cells may be derived from one or more donors, or may be obtained from an autologous source. In some embodiments, the engineered immune cells are expanded in culture before being administered to the subject in need thereof.

[0147] In some embodiments, delivery of a cell composition (e.g., a composition comprising a plurality of engineered immune cells, e.g., T cells, by any of the cells described herein) to a subject by a method or route results in at least partial localization of the cell composition at a desired site. The composition comprising engineered immune cells, e.g., T cells, can be administered by any suitable route that results in an effective treatment in the subject, e.g., administration can include administering at least a portion of the delivered composition, e.g., at least 1×10 4 The cells are delivered to the desired site for a period of time, resulting in delivery to the desired site in the subject. Exemplary modes of suitable administration include injection, infusion, and infusion. "Injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, percutaneous intratracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. For cell delivery, delivery by injection or infusion is often considered the standard mode of administration.

[0148] In some embodiments, the engineered immune cells, e.g., T cells, are administered systemically, e.g., via infusion or injection. For example, a population of engineered immune cells, e.g., T cells, described herein are administered in a manner other than directly to a target site, tissue, or organ, such that they enter the subject's circulatory system and are thereby subject to metabolic and other similar biological processes.

[0149] The efficacy of a treatment, including any of the compositions provided herein, for the prevention or treatment of a disease or health condition in a subject can be determined by a skilled clinician. However, one of skill in the art will understand that a prevention or treatment is considered effective if any one or all of the signs or symptoms or markers of the disease are improved or ameliorated, compared to untreated subjects under similar conditions. Efficacy can also be measured by the subject not being worse (e.g., the progression of the disease is stopped or at least slowed), as assessed by a reduction in the need for hospitalization or medical intervention. Methods for measuring these indications are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in a subject or animal (some non-limiting examples include humans or mammals), and includes (1) inhibiting the disease, e.g., stopping or slowing the progression of a symptom; or (2) alleviating the disease, e.g., causing regression of a symptom; and (3) preventing or reducing the likelihood of the onset of a symptom, compared to untreated subjects under similar conditions.

[0150] The degree of effectiveness is measured based on the parameter selected for the disease being treated and the symptoms experienced. Generally, a parameter known or recognized to correlate with the degree or severity of the disease is selected, for example, a parameter recognized or used in the medical community. For example, in the treatment of solid cancer, suitable parameters may include the reduction in the number and / or size of metastases, months of progression-free survival, overall survival, stage or grade of disease, disease progression rate, reduction of diagnostic biomarkers (such as, but not limited to, reduction of circulating tumor DNA or RNA, reduction of circulating acellular tumor DNA or RNA, etc.), and combinations thereof, compared to untreated subjects under similar conditions. It will be understood that the effective dose and the degree of effectiveness are generally determined in relation to a single subject and / or a group or population of subjects. The treatment methods of the disclosure reduce symptoms and / or disease severity and / or disease biomarkers by at least about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100% as compared to untreated subjects under similar conditions.

[0151] As mentioned above, a therapeutically effective amount of a pharmaceutical composition may be an amount of the pharmaceutical composition sufficient to promote a particular beneficial effect when administered to a subject, such as a person having, suspected of having, or at risk for a disease or health condition. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the onset of symptoms of a disease or health condition, alter the course of symptoms of a disease or health condition (such as, but not limited to, slow the progression of symptoms of a disease), or reverse symptoms of a disease or health condition, compared to an untreated subject under similar conditions. It is understood that for any given case, the appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.

[0152] Additional Therapies As mentioned above, any one of the compositions disclosed herein, e.g., engineered immune cells (e.g., engineered T cells) and pharmaceutical compositions, can be administered to a subject in need thereof as a single therapy (e.g., monotherapy). Additionally or alternatively, in some embodiments of the present disclosure, one or more of the engineered immune cells and pharmaceutical compositions described herein can be administered to a subject in combination with one or more additional (e.g., adjunctive) therapies, e.g., at least one, two, three, four, or five additional therapies. Suitable therapies administered in combination with the compositions of the present disclosure include, but are not limited to, chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, targeted therapy, and surgery. Other suitable therapies include therapeutic agents, such as chemotherapeutic agents, anti-cancer agents, and anti-cancer therapeutic agents.

[0153] Administration "in combination with" one or more additional therapies includes simultaneous (concurrent) administration and sequential administration in any order. In some embodiments, the one or more additional therapies are selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, and surgery. The term chemotherapy as used herein encompasses anti-cancer drugs. Various types of anti-cancer drugs can be suitably used in the methods disclosed herein. Non-limiting examples of anti-cancer drugs include alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxins, antibodies (e.g., monoclonal or polyclonal antibodies), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone therapy, soluble receptors, and other antineoplastic agents.

[0154] Topoisomerase inhibitors are another type of anticancer drug that can be used herein. Topoisomerases are essential enzymes that maintain DNA topology. Inhibition of type I or type II topoisomerases disrupts proper DNA supercoiling, thereby impairing both DNA transcription and replication. Some type I topoisomerase inhibitors include camptothecins such as irinotecan and topotecan. Examples of type II inhibitors include amsacrine, etoposide, etoposide phosphate, and teniposide. These are semi-synthetic derivatives of epipodophyllotoxin, an alkaloid naturally occurring in the roots of American Mayapple (Podophyllum peltatum).

[0155] Antineoplastic drugs include the immunosuppressants dactinomycin, doxorubicin, epirubicin, bleomycin, mechlorethamine, cyclophosphamide, chlorambucil, and ifosfamide.Antineoplastic compounds generally act by chemically modifying the DNA of cells.

[0156] Alkylating agents are capable of alkylating many nucleophilic functional groups under conditions present within cells. Cisplatin and carboplatin, as well as oxaliplatin, are alkylating agents. They impair cellular function by forming covalent bonds with amino, carboxyl, sulfhydryl, and phosphate groups in biologically important molecules.

[0157] Vinca alkaloids bind to specific sites on tubulin and inhibit the assembly of tubulin into microtubules (M phase of the cell cycle). Vinca alkaloids include vincristine, vinblastine, vinorelbine, and vindesine.

[0158] Antimetabolites mimic purines (azathioprine, mercaptopurine) or pyrimidines and prevent these substances from being incorporated into DNA during the "S" phase of the cell cycle, halting normal development and division. Antimetabolites also affect RNA synthesis.

[0159] Plant alkaloids and terpenoids are derived from plants and block cell division by interfering with microtubule function. Microtubules are essential for cell division, so without them cell division cannot occur. Prime examples are the vinca alkaloids and taxanes.

[0160] Podophyllotoxin is not only a plant-derived compound that has been reported to aid digestion, but is also used to produce two other cytostatic drugs, etoposide and teniposide, which prevent cells from entering the G1 phase (the start of DNA replication) and DNA replication (S phase).

[0161] The taxanes as a group include paclitaxel and docetaxel. Paclitaxel, originally known as taxol, is a natural product that was first derived from the bark of the Pacific yew tree. Docetaxel is a semisynthetic analogue of paclitaxel. Taxanes increase microtubule stability and prevent chromosome segregation during anaphase.

[0162] In some embodiments, the anticancer agent is Remicade, docetaxel, celecoxib, melphalan, dexamethasone (Decadron®), steroids, gemcitabine, cisplatin, temozolomide, etoposide, cyclophosphamide, temodar, carboplatin, procarbazine, Gliadel, tamoxifen, topotecan, methotrexate, gefitinib (Iressa®), taxol, taxotere, fluorouracil, leucovorin, irinotecan, Xeloda, CPT-11, interferon alpha, pegylated interferon alpha (e.g., PEG-10 ... In some embodiments, the therapeutic agent may be selected from the group consisting of INTRON-A, capecitabine, cisplatin, thiotepa, fludarabine, carboplatin, liposomal daunorubicin, cytarabine, doxetaxol, pacilitaxel, vinblastine, IL-2, GM-CSF, dacarbazine, vinorelbine, zoledronic acid, palmitronate, biaxin, busulfan, prednisone, bortezomib (Velcade®), bisphosphonates, arsenic trioxide, vincristine, doxorubicin (Doxil®), paclitaxel, ganciclovir, adriamycin, estroustine sodium phosphate (Emcyt®), sulindac, etoposide, and any combination thereof.

[0163] In other embodiments, the anti-cancer agent can be selected from bortezomib, cyclophosphamide, dexamethasone, doxorubicin, interferon-alpha, lenalidomide, melphalan, pegylated interferon-alpha, prednisone, thalidomide, or vincristine.

[0164] In some embodiments, the prophylactic and / or therapeutic methods described herein further comprise immunotherapy. In some embodiments, the immunotherapy comprises administration of one or more checkpoint inhibitors. Thus, some embodiments of the therapeutic methods described herein further comprise administration of a compound that inhibits one or more immune checkpoint molecules. Non-limiting examples of immune checkpoint molecules include CTLA4, PD-1, PD-L1, A2AR, B7-H3, B7-H4, TIM3, and any combination thereof. In some embodiments, the compound that inhibits one or more immune checkpoint molecules comprises an antagonist antibody. Examples of antagonist antibodies suitable for the compositions and methods disclosed herein include, but are not limited to, ipilimumab, nivolumab, pembrolizumab, durvalumab, atezolizumab, tremelimumab, and avelumab.

[0165] In some aspects, one or more of the anti-cancer therapies is radiation therapy. In some embodiments, radiation therapy may include the administration of radiation to kill cancer cells. Radiation interacts with molecules within the cell, such as DNA, to induce cell death. Radiation may also damage cell and nuclear membranes, as well as other organelles. Different types of radiation may have different mechanisms of DNA damage and different relative biological effects. For example, heavy particles (i.e., protons, neutrons) directly damage DNA and have greater relative biological effects. Electromagnetic radiation indirectly causes ionization, primarily through short-lived hydroxyl free radicals that are generated by ionizing water within the cell. Clinical applications of radiation consist of external beam radiation (from an external source) and brachytherapy (using a radiation source implanted or inserted into the patient). External beam radiation consists of X-rays and / or gamma rays, with brachytherapy using radionuclides that decay and emit alpha or beta particles along with gamma rays. Radiation contemplated herein also includes, for example, the directed delivery of radioisotopes to cancer cells. Other forms of DNA damaging agents, such as microwave and UV radiation, are also contemplated herein.

[0166] Radiation can be administered in a single dose or in succession of smaller doses in a dose fractionation schedule. Amounts of radiation contemplated herein range from about 1 to about 100 Gy, including, for example, about 5 to about 80, about 10 to about 50 Gy, or about 10 Gy. The total dose can be applied in a fractionation regimen. For example, the regimen can include fractionated individual doses of 2 Gy. Dose ranges for radioisotopes vary widely and depend on the half-life of the isotope and the strength and type of radiation emitted. When radiation involves the use of a radioisotope, the isotope can be conjugated to a targeting agent, such as a therapeutic antibody, that carries the radionucleotide to the target tissue (e.g., tumor tissue).

[0167] Surgery as described herein includes resection, in which all or part of the cancerous tissue is physically removed, operated on, and / or destroyed. Tumor resection refers to the physical removal of at least a portion of the tumor. In addition to tumor resection, surgical treatments include laser surgery, cryosurgery, electrosurgery, and microsurgery (Mohs surgery). Removal of pre-cancerous or normal tissue is also contemplated herein.

[0168] Thus, in some embodiments, the compositions according to the present disclosure are administered to a subject individually as a single therapy (monotherapy) or as a first therapy in combination with at least one additional therapy (e.g., a second therapy). In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, targeted therapy, and surgery. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, or surgery. In some embodiments, the first therapy and the second therapy are administered simultaneously. In some embodiments, the first therapy is administered simultaneously with the second therapy. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in alternation. In some embodiments, the first and second therapies are administered together in a single formulation.

[0169] Each of the aspects and embodiments described herein can be used together unless expressly or specifically excluded from the context of the embodiment or aspect.

[0170] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0171] No admission is made that any reference cited herein constitutes prior art. The discussion of references states what their authors assert, and applicants reserve the right to challenge the accuracy and pertinence of the cited documents. Although several sources of information, including scientific journal articles, patent documents, and textbooks, are mentioned herein, it will be clearly understood that this reference is not an admission that any of these documents form part of the common general knowledge in the art.

[0172] The discussion of general methods presented herein is intended for illustrative purposes only: other alternative methods and substitutions will be apparent to those of skill in the art upon review of this disclosure, and are intended to be within the spirit and scope of this application. EXAMPLES

[0173] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. Such techniques are described in Sambrook, J., & Russell, DW (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russell, DW (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as "Sambrook"); Ausubel, FM (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including appendices through 2014); Bollag, DM et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, M ​​Get al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: the Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, K.B., Ferre, F. & Gibbs, R. (1994).PCR: the Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, EA (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SLet al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including appendices through 2014); and Makrides, SC (2003). See Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences BV, the disclosures of which are incorporated herein by reference.

[0174] Further embodiments are disclosed in further detail in the following examples, which are provided for illustrative purposes and are not intended to limit the scope of the disclosure or claims in any way.

[0175] Example 1. General Materials and Methods Viral Vector Constructs: MSGV retroviral vectors encoding the following CARs have been previously described: CD19-28z, CD19-BBz, GD2-BBz and Her2-BBz (Neelapu et al. 2017). The HA-28z CAR was generated by introducing a point mutation into the 14G2a scFv of the GD2-28z CAR plasmid to create the E101K mutation as previously described in (Rachel et al).

[0176] Isolation of T cells: Healthy donor buffy coats were purchased from Stanford Blood Center under an IRB-waived protocol. Primary human T cells were isolated using the RosetteSep Human T Cell Enrichment Kit (Stem Cell Technologies) according to the manufacturer's protocol. Isolated T cells were cryopreserved in CryoStor CS10 cryopreservation medium (Stem Cell Technologies). CD39- T cells were purified using anti-PE MicroBeads (Miltenyi Biotec) and LD autoMACS (Miltenyi Biotec) columns according to the manufacturer's protocol. Depletion efficiency was assessed by flow cytometry.

[0177] Human CAR T cell production: Non-tissue culture treated 12-well plates were coated with 1 ml of Retronectin (Takara) at 25 μg / ml in PBS overnight at 4°C. Plates were washed with PBS and blocked with 2% BSA for 15 min. Thawed retroviral supernatant was added at approximately 1 ml per well and centrifuged at 3,200 rpm at 32°C for 2 h before adding cells. Primary human T cells were thawed and activated with Human T-Expander CD3 / CD28 Dynabeads (Gibco) at a bead:cell ratio of 3:1 in complete medium (RPMI1640 supplemented with 10% fetal bovine serum, 10 mM N-2-hydroxyethylpiperazine-N9-2-ethanesulfonic acid, 2 mM GlutaMAX, 100 U / mL penicillin (Gibco), and 100 U / mL (Peprotech)). T cells were transduced with retroviral vectors on days 2 and 3 post-activation. Beads were removed on day 4 post-activation.

[0178] Cell lines: CD19+Nalm6-GL B-ALL cell line was provided by D. Barrett (Barrett 2011). Nalm6-GD2 was generated by co-transducing Nalm6-GL with cDNAs for GD2 and GD3 synthases. All cell lines were cultured in complete medium (CM) (RPMI supplemented with 10% FBS, 10 mM HEPES, 2 mM GlutaMAX, 100 U ml-1 penicillin, and 100 μg ml-1 streptomycin (Gibco)). STR DNA profiling of all cell lines was performed annually by Genetica Cell Line testing. None of the cell lines used in this study were included in the commonly misidentified cell line registry. Before use in in vivo experiments, cell lines were tested with the MycoAlert detection kit (Lonza). All cell lines tested were negative.

[0179] Flow cytometry: Anti-CD19 CAR idiotype antibody was provided by B. Jena and L. Cooper. 1A7 anti-14G2a idiotype antibody was obtained from NCI Frederick and University of Texas MD Anderson Cancer Center. Her2 CAR was detected using human Her2-Fc recombinant protein (R&D). Idiotype antibodies and Fc fusion proteins were conjugated in-house using the Dylight650 antibody labeling kit (Thermo Fisher). T cell surface phenotype was assessed using the following antibodies: From BioLegend: CD4-APC-Cy7 (clone OKT4), CD8-PerCp-Cy5.5 (clone SK1), TIM-3-BV510 (clone F38-2E2), CD39-FITC, PE or APC-Cy7 (clone A1), CD3-PacBlue (clone HIT3a); From eBioscience: PD-1-PE-Cy7 (clone eBio J105), LAG-3-PE (clone 3DS223H), CD45RO-PE-Cy7 (clone UCHL1), CD45-PerCp-Cy5.5 (clone HI30), CCR7-PE (clone 3D12); From BD: LAG-3-BV421 (clone T47-530), CD45RA-FITC or BV711 (clone HI100), CD62L-BV605 (clone DREG-56), CD73-PE-Cy7 or BV510 (clone AD2), CD4-BUV395 (clone SK3), CD8-BUV805 (clone SK1).

[0180] Proliferation assay: T cells were labeled with 2.5 μM CTV for 10 min at 37°C, followed by addition of 5 ml of ice-cold PBS 2% FBS to quench the reaction. Cells were then washed with complete RPMI 1640 and diluted at 5 × 10 4 Cells were activated and cultured in 96-well plates coated with 1 or 5 μg / ml of CD19 or 1A7 idiotypes overnight at 4 °C. Proliferation assays were performed in the absence of exogenous IL-2. After 72-96 h, CTV dilution, as an index of cell proliferation, was assessed by flow cytometry.

[0181] Suppression assay: To evaluate inhibition of IL-2 secretion, 5 × 10 4 CD19 CAR T cells, 5 × 10 4 5 × 10 Nalm6 tumor cells 4 The cells were cultured with HA CAR or mock T cells in 300 μL of CM in 96-well flat-bottom plates for 24 hours. Triplicate wells were plated for each condition. Culture supernatants were harvested and analyzed for IL-2 by ELISA (BioLegend).

[0182] Co-culture assay: CAR-T cells were cultured with 1 μM CPI444 (CORVUS BIOPHARMA) for 2–24 h and then co-cultured with tumor cells or plate-bound idiotypes at 1 or 5 μg / ml (unless otherwise stated). To stimulate a2aR, cells were treated with 0.01–0.1 mM NECA (Torcis). For cytotoxicity assays, approximately 5 × 10 4 Tumor cells were co-cultured with CAR T cells at the indicated ratios in 200 μL of CM in 96-well flat-bottom plates. Four images per well at 10x magnification were collected at each time point. Tumor cell growth was quantified by measuring total integrated GFP intensity per well every 2–3 h using an IncuCyte ZOOM Live-Cell analysis system (Essen Bioscience). GFP signals were normalized to the signal at time 0. Cell culture supernatants were harvested after 24 h and concentrations of interleukin-2 (IL-2) and interferon-g were measured by enzyme-linked immunosorbent assay (Biolegend). Triplicate wells were plated for each condition. All co-culture experiments were performed between days 10 and 16 after activation unless otherwise stated in the text.

[0183] CRISPR knockout: CRISPR-Cas9 gene knockout was performed by transient Cas9 / gRNA(RNP) complex electroporation using the 4D-Nucleofector X Kit S (Lonza) in P3 primary cells. On day 4 of culture, HA-28z CAR T cells were counted, pelleted, and 1.5 × 10 per 18 μL reaction was added. 6 ~2×10 6Cells were resuspended in P3 buffer at 1000 x g for 10 min. 3.3 μg of Alt-R.Sp (Streptococcus pyogenes) Cas9 nuclease Cas9 protein (IDT) and 120 pmol of chemically modified synthetic sgRNA (Synthego) (gRNA:Cas9 molar ratio of 6:1) were precomplexed per reaction for 10 min at room temperature to generate ribonucleoprotein complexes (RNPs). 18 μL of cell suspension was mixed with RNPs and electroporated in 16-well cuvette strips using the EO-115 protocol. Cells were harvested in 200 μL of T cell medium for 30 min at 37°C and then grown as above. Knockdown efficiency was measured using TIDE and / or flow cytometry. Control HA-28z CAR T cells were electroporated with gRNA targeting the safe harbor locus AAVS1. The following gRNA target sequence was used:

[0184] AAVS1:GGGGCCACTAGGGACAGGAT (SEQ ID NO:1);

[0185] ADORA2a-guide1: GUCUGUGGCCAUGCCCAUCA (SEQ ID NO:2);

[0186] ADORA2a-guide2: UACACCGAGGAGCCCAUGAU (SEQ ID NO:3);

[0187] CD73-guide1: GCGGGCGCCCGCGCGGCUCG (SEQ ID NO: 4);

[0188] CD73-guide2: CUAUGUGUCCCCGAGCCGCG (SEQ ID NO:5);

[0189] CD39:UGGCACCCUGGAAGUCAAAG (sequence number 6).

[0190] Bulk RNA-Seq: Healthy donor T cells were prepared for bulk RNA isolation as described above. On day 14, CD39+ and CD39-CD4+ or CD8+ subsets were isolated using a BD FACSAria cell sorter (Stem Cell FACS Core, Stanford University School of Medicine) and total mRNA was isolated using a Qiagen RNeasy Plus mini isolation kit. Bulk RNA-seq was performed on a BGISEQ-500 platform, single-end 50 bp read length, 30 × 10 per sample. 6 The analysis was performed by BGI America (Cambridge, MA) using the reads. Significantly different genes were identified by DESeq2 using Wald test. Gene annotation enrichment analysis was performed using Kegg pathways and GO terms (biological process, cellular component, and molecular function). Functional annotation clustering was performed to show terms with p<0.05 (Benjamini corrected). Redundant terms were manually removed for visualization.

[0191] ATP measurement: CAR T cells were washed with phenol red-free RPMI (Agilent). Then, 5 × 10 4 The cells were resuspended in 150 μL of phenol-free RPMI medium in the presence of 20 μM ATP (PerkinElmer). After 10 min of incubation at 37° C., the supernatants were collected and the concentration of ATP / sample was measured using the ATPlite Luminescence Assay System (PerkinElmer) according to the manufacturer's protocol.

[0192] ADO measurement: To measure the capacity of exoenzymes on the surface, CAR T cells were treated with CPX006 for 24 hours and 2 hours before the assay. The cells were then washed with phenol-free RPMI (Agilent). 5 × 10 4The cells were resuspended in 150 μL of phenol-free RPMI medium and spiked with 20 μM ATP (PerkinElmer). After incubation at 37°C for 30 min, the supernatant was collected. For autocrine adenosine production, 3 × 10 5 CAR T cells were resuspended in 120 μL of phenol-free RPMI (Agilent) and incubated for 2 h at 37° C. Adenosine concentrations were assessed using an adenosine assay kit (Abcam) according to the manufacturer's protocol.

[0193] Luminex: On day 14 after activation, sorted CD39+ and CD39-CD4+ or CD8+ CAR T cells were co-cultured with Nalm6-GD2 cells at a 1:1 ratio. Duplicate wells were plated for each condition. After 24 hours, supernatants were collected and analysis was performed using the Luminex assay at the Human Immune Monitoring Center of Stanford University. The Human 62-plex kit was purchased from eBioscience / Affymetrix and used according to the manufacturer's recommendations with the modifications noted. Briefly, beads were added to a 96-well plate and washed with a BioTek ELx405 Select Deep Well Washer. Samples were added to the plate containing the mixed antibody-conjugated beads and incubated at room temperature for 1 hour, followed by overnight incubation at 4°C with shaking. The low temperature and room temperature incubation steps were performed on an orbital shaker at 500-600 rpm. After overnight incubation, the plate was washed with a BioTek ELx405 Select Deep Well Washer. Biotinylated detection antibody was then added for 75 minutes at room temperature with shaking. Plates were washed as described above and streptavidin-PE was added. After 30 minutes incubation at room temperature, washing was performed as described above and read buffer was added to the wells. Plates were read using a Luminex FLEXMAP 3D instrument with a lower limit of 50 beads per cytokine per sample. Custom assay control beads by Radix Biosolutions were added to all wells. Dilution factors were taken into account. Concentrations (pg / ml) were calculated for each cytokine. Heatmaps were generated using GraphPad Prism 8.4.

[0194] Seahorse Mito Stress Assay: OCR and ECAR were determined for HA and ADA O / E HA CAR T cells using a Seahorse XFe96 Bioanalyser (Agilent). Cells were washed with assay medium (XF base medium (Agilent) containing glucose (25 mM), sodium pyruvate (1 mM), and L-glutamine (2 mM) (Gibco), pH 7.4 at 37 °C) and then plated at 2 × 10 per well on Seahorse cell culture plates coated with Cell-Tak (Corning). 5 After attachment and equilibration, cellular OCR and ECAR were measured in a Seahorse Mito stress assay (Agilent) by adding oligomycin (1.5 μM), carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP; 1.0 μM), and antimycin A and rotenone (0.5 μM each).

[0195] Statistical Analysis: Unless otherwise stated, statistical analysis for significant differences between groups was performed using unpaired two-tailed t-tests without correction for multiple comparisons and without assuming constant standard deviations using GraphPad Prism 8.4.

[0196] Example 2. CD39 expression correlates with progressive loss of function during CAR T cell exhaustion This example describes the results of experiments performed to demonstrate that CD39 expression correlated with progressive loss of function during CAR T cell exhaustion.

[0197] Human T cells expressing high affinity (HA) CARs (HA-CARs) targeting the disialoganglioside GD2, which signal tonic in the absence of antigen, showed reduced effector cytokine secretion and high surface expression of inhibitory receptors (Figure 2A). Using this model, we observed that CD39 expression on HA-CAR T cells strongly correlated with the acquisition of other hallmarks of exhaustion. However, the kinetics of CD39 differed from that of other exhaustion markers. Canonical markers of T cell exhaustion, such as TIM3, PD1, or LAG3, showed expression and frequency peaks 5–7 days after activation and then slowly downregulated as activation bead-induced signaling waned (Figure 2B). Conversely, CD39 expression and frequency peaked once the exhausted phenotype was fully established (Figure 1A). However, expression of exhaustion markers was still higher at later time points compared to non-tonic signaling CAR T cells (Figure 1A; Figure 2B). This delayed increase in the frequency of CD39 expression also correlated with a significant / progressive decrease in the secretion of the effector cytokines IL-2 (p=0.0001) and IFNγ (p<0.0001) (Figure 1B). Of note, CD39 expression appeared to be more specific for CD8 CAR T cells (61.3%±4.3) compared to CD4 CAR T cells (32.5%±4.4) (Figure 3A).

[0198] To assess whether CD39 expression is indicative of reduced CAR T function, CD39+HA CAR T cells were co-cultured with Nalm6 leukemia cells engineered to overexpress GD2 on their surface, followed by measuring cytokine secretion levels. As expected, secretion of inflammatory cytokines such as IL-2, TNFα, and TNFβ, or IL-31 (belonging to the IL-6 family) by CD39+CAR T cells was shown to be lower compared to their CD39- counterparts (Figure 1C). In contrast, IFNγ and MPC-1, which are involved in immune cell migration, showed increased secretion (Figure 1C). Of note, TGFβ and IL-27, both cytokines involved in the differentiation and suppressive function of regulatory T cells, were secreted at higher levels by CD39+CD8 CAR T cells. A similar trend was observed in CD4+CAR T cells (Figure 3B).

[0199] Taken together, these results demonstrate that CD39+ was a characteristic dysfunctional / exhausted T cell population.

[0200] Example 3. CD39+CD8+ exhausted CAR T cells exhibit a Treg-associated phenotype and suppressive function This example describes the results of experiments performed to demonstrate that CD39+CD8+ exhausted CAR T cells exhibited a Treg-associated phenotype and suppressive function.

[0201] To better characterize the CD39+ CAR-T cell population, high-dimensional single-cell mass cytometry was used (Figure 1D). High expression of canonical exhaustion markers such as TIM3, PD1, and LAG3 was observed. The exhaustion-associated transcription factor T-bet was also observed in CD39+CD8 CAR T cells. Of note, CD39+ CAR-T cells showed low or no expression of memory and homing molecules such as CD62L, CCR7, or CD127, indicating a more differentiated phenotype. However, markers related to immune suppression such as Foxp3, TIGIT, CD49, LAP, CD73, or CTLA4 were upregulated (marked by boxes), in accordance with the cytokine secretion pattern shown in Figure 1C. Similar results were obtained in CD4+HA CAR T cells (Figure 3C).

[0202] Genome-wide transcriptome analysis confirmed that both CD4+CD39+ and CD8+CD39+ CAR-T cells expressed lower levels of memory / homing-related genes such as (TCF7, TCF4, Sell, or IL-7R) compared to their CD39- counterparts. We also confirmed that CD39+ CAR-T cells expressed higher levels of many Treg-related genes (Figures 4A-4B). Gene set enrichment analysis (GSEA) showed significant similarities in gene expression patterns between CD39+CD8 CAR T cells and regulatory T cells (Figure 1E). We observed that CD39+ T cells expressed higher levels of retinoic X receptor alpha (RXRA), a nuclear orphan receptor involved in the induction of FOXP3 in regulatory T cells, and retinoic X receptor alpha (RXRA), which has been reported to be involved in the differentiation of FOXP3+-induced regulatory T cells.

[0203] To investigate whether exhausted CAR T cells show similarities to Tregs not only phenotypically but also functionally, their ability to suppress the function of surrounding cells was evaluated. CD19 CAR T cells with 4-1BBz costimulatory domains that showed improved clinical efficacy and persistence were selected to test their ability to suppress the function of surrounding cells. IL-2 secreted by CD19.BBz CAR T cells co-cultured with Nalm6 leukemia cells was measured for 24 hours in the presence or absence of bulk or sorted CD8+HA CAR T cells. CD19.BBz CAR T cells activated in the presence of either bulk or CD8+HA T cells secreted significantly less IL-2, indicating that HA CAR-T cells can suppress antigen-dependent IL-2 production of neighboring healthy CAR-T cells (Figure 1F).

[0204] Collectively, these data demonstrated that CD39+CD8 CAR T cells are not only exhausted, but that they may represent a novel cell subpopulation with an enriched inhibitory molecular signature, phenotype, and function.

[0205] Example 4. Conversion of CD39-CAR T cell populations to CD39+ is dependent on tonic signaling This example describes the results of experiments performed to demonstrate that conversion of CD39-CAR T cell populations to CD39+ was dependent on tonic signaling.

[0206] CD39 has previously been described as a marker of regulatory T cell subsets that can prevent effective antitumor immune responses in tumor-bearing hosts. In the antigen-independent CAR-driven exhaustion model presented herein, the frequency of CD39+ T cells was increased in cells bearing HA CARs (Figure 5A). This increase in the CD39+ population could be due to expansion of a small pre-existing CD39+ population in the culture or due to CAR-mediated factors induced by tonic signaling. To distinguish between these two possibilities, CD39-HA CAR T cells were sorted and maintained in the presence or absence of dasatinib, a tyrosine kinase inhibitor that was recently shown to block tonic signaling without affecting CAR T cell proliferation (Figures 5B-5C). The addition of dasatinib to CD39-depleted HA CAR-T cultures profoundly affected their ability to generate CD39+HA CAR T cells. This result indicates that CAR-mediated signaling and exhaustion were required for the upregulation of CD39 and the generation of the CD39+ T cell subset.

[0207] TGFβ has been shown to play a prominent role in the upregulation of CD39 in the context of regulatory T cells. We investigated whether TGFβ produced by exhausted cells is sufficient to drive the conversion of CD39- cells to CD39+ cells. We observed that the addition of neutralizing anti-TGFβ antibodies to bulk and CD39-depleted cultures had no effect on the frequency of CD39+ cells, nor on the expression level of CD39 on CAR T cells (Figures 5B-5C).

[0208] These data suggested that long-term T cell stimulation was sufficient to convert CD39- cells to CD39+ cells.

[0209] Example 5. Exhausted HA CAR T cells show high expression of enzymatically active CD39 and CD73, which leads to the production of inhibitory adenosine This example describes the results of experiments performed to demonstrate that exhausted HA CAR T cells exhibited high expression of enzymatically active CD39 and CD73, which led to the production of inhibitory adenosine.

[0210] One of the Treg immunosuppressive mechanisms is the co-expression of CD39 and CD73, which leads to increased levels of extracellular adenosine, which in turn suppresses effector T cells through activation of the high affinity A2a adenosine receptor (Figure 6A). The majority of mouse CD4+ Tregs express high levels of CD39 and CD73, whereas only a small percentage of human Treg cells are CD73+. Surprisingly, in the tonic signaling CAR model described herein, not only was the frequency of the CD39+ / CD73+ population much lower in the CD4+ subset than in the CD8+, but the expression level of CD73 in this subset was also much lower in the CD4+ subset than in the CD8+ (Figure 6B). We then investigated whether these enzymes were functional by assessing the ability of these cells to hydrolyze extracellular ATP and generate adenosine. Consistent with the higher expression of CD39, HA CAR T cells showed a four-fold improved ability to hydrolyze eATP compared to CD19 CAR or mock T cells (40% vs. 10% ± 1.245 standard error). Using the CRISPR / Cas9 system to knock out CD39 or CD73 confirmed that CD39, but not CD73, is critical for the conversion of eATP to ADP / AMP (Figure 6C). We next investigated whether exhausted CAR T cells could further process ADP / AMP to adenosine. We observed that HA CAR T cells were able to produce twice as much adenosine compared to mock or non-exhausted CD19 CAR T cells (4 μM vs. 2 μM ± 0.2965 standard error) (Figure 6C). Importantly, adenosine production was abrogated by knockout of either CD39 or CD73.

[0211] Taken together, these data indicate that high levels of expression of CD39 and CD73 on the surface of exhausted HA CAR-T cells correlate with an enhanced ability to degrade ATP and convert ADP / AMP to adenosine.

[0212] Example 6. Adenosine can suppress cytokine production by CAR T cells after antigen stimulation This example describes the results of experiments performed to demonstrate that adenosine can suppress cytokine production by CART T cells following antigen stimulation.

[0213] To test whether CAR T cells are sensitive to adenosine-mediated inhibition, HA and CD19 CAR T cells were activated with plate-bound idiotypes in the presence or absence of the adenosine receptor agonist 5'-(N-ethylcarboxamido) adenosine (NECA) and analyzed for their ability to secrete effector cytokines by ELISA (Figure 6D; Figures 7A-7B). NECA treatment led to a decrease in IL-2 and IFNγ production. Adenosine-dependent a2aR stimulation led to an elevation of intracellular 3',5'-cyclic adenosine monophosphate (cAMP), which inhibited the NF-kB pathway and cell proliferation (Figure 6A). To assess whether adenosine inhibition of CAR T cells acts through the same mechanism, an NF-kB activation reporter was constructed by placing a green fluorescent protein (GFP) gene downstream of the NF-kB response element. HA CAR-T cells were co-transduced with this NF-kB-GFP reporter. When activated with plate-bound idiotype, NECA reduced activation of the NF-kB-GFP reporter (Figure 7C). This inhibitory effect on activation was prevented by the addition of a selective A2aR competitive antagonist (iA2aR), confirming the involvement of the A2a receptor (A2aR) in the suppressive effect of NECA on HA CAR-T cells.

[0214] These data explained that exhausted CAR T cells expressed active CD39 and CD73 on their surface, which resulted in an improved ability to generate adenosine, and that adenosine exerted an inhibitory effect on CAR T cell function and proliferation in an A2a receptor-mediated manner. To test this hypothesis that adenosine production is responsible for the inhibitory function of exhausted CAR T cells on neighboring cells, we investigated whether HA CAR-T cells could produce adenosine in an autocrine manner (Figure 7D). Next, CD19 CAR T cells preincubated with A2aR inhibitors were activated in the presence or absence of (CD8) HA CAR T cells. Consistent with this hypothesis, blocking the A2a receptor (A2aR) on CD19 CAR T cells or knocking out CD39 on HA CAR T cells restored IL-2 production by CD19 CAR T cells in the presence of adenosine-producing HA cells (Figure 6E).

[0215] Example 7. Purinergic pathways regulate the phenotype and function of exhausted CAR T cells This example describes the results of experiments performed to demonstrate that the purinergic pathway regulated exhausted CAR T cell phenotype and function.

[0216] Autocrine adenosine production as a result of co-expression of CD39 and CD73 by HA CAR T cells may result in an inhibitory effect on neighboring cells as well as an endogenous suppression of CAR T cell activity, and in that context, modulation of the purinergic pathway may improve CAR T cell function.

[0217] Using single-cell mass cytometry, the effect of knockout of A2aR, CD39, or CD73 on the exhausted phenotype of HA CAR-T cells was analyzed using samples generated from four donors. Controls were HA CAR T cells from a CRISPR knockout (KO) experiment using AAVS1 guides, targeting adeno-associated virus integration site 1 with minimal risk of off-target Cas9 binding elsewhere in the genome. U-MAP analysis of data distribution showed that A2aR knockout (KO) and control AAVS1 KO HA CAR T cell populations were spatially close to each other, while CD39 KO and CD73 KO cells were shifted to opposite sides of the map, suggesting that knockout of extracellular enzymes affected the exhausted T cell phenotype to a greater extent than A2aR KO (Figure 8A). Furthermore, FlowSOM analysis was performed to manually gate CD4 and CD8 CAR T cells to determine the maximum number of clusters among five identified T cell populations: stem cell memory T cells (T SCM ), effector T cells (T EF ), exhausted T cells (T Exh ), and exhausted T cell precursors (T PEX ), and effector memory-like T cells (T EM (Figure 8B). This strategy was SCM The results revealed a significant phenotypic shift following knockout of CD39 or CD73, characterized by an increase in the frequency of HA and effector-like CAR T cells. In contrast, A2aR KO did not cause a change in HA CAR T cell phenotype. The phenotypic characteristics of the clusters were ordered according to their lineage and median expression of each marker and displayed in a heatmap (Figure 9A). A similar trend in CAR T cell phenotypic change was observed for CD4+ CAR T cells (Figure 9B).

[0218] To assess whether these phenotypic changes translated into functional differences, IL-2 and IFNγ production of each KO HA CAR-T cell was compared upon stimulation with idiotype. Notably, both cytokine levels were increased in A2aR KO, CD39 KO, and CD73 KO compared to AAVS1 KO controls, with CD73KO and CD39KO showing a greater increase in cytokine secretion (Figure 8C). This trend was also observed when KO HA CAR-T cells were stimulated with Nalm6-GD2 cells instead of idiotype (Figure 9C). To further characterize the impact of KO components of the purinergic pathway on exhausted CAR-T cell function, cytolytic potential was measured against different tumor cell lines expressing different levels of GD2 on their surface (Figure 9D). Notably, only A2aR KO improved the cytotoxic function of HA CAR T cells (Figure 8D). These results showed that CD39 and CD73 KO increased cytokine secretion against tumor lines expressing high GD2 density, but only A2aR KO increased the activation threshold of HA CAR T cells against low antigen density.

[0219] Collectively, these results illustrated that adenosine and the pathways regulating its production play an important role in regulating CAR T cell responses and phenotype.

[0220] Example 8. Overexpression of transmembrane-bound ADA improves CAR T cell phenotype and effector function This example describes the results of experiments performed to demonstrate that overexpression of adenosine deaminase improved CAR T cell phenotype and effector function.

[0221] In the context of the tumor microenvironment, adenosine production is regulated by CD39 and CD73 present on CAR T cells, as well as expressed on the surface of cancer-associated fibroblasts, the stroma, or directly on tumor cells (Figure 11A). Knocking out CD39 or CD73 may improve cytokine secretion in vitro, but may not be a successful approach in vivo. Similarly, although the A2a receptor shows the highest affinity for adenosine, it is not the only adenosine receptor expressed by T cells. Therefore, an alternative approach to reduce the inhibitory effect of adenosine on CAR T cells is to overexpress adenosine deaminase (ADA), the enzyme involved in metabolizing adenosine to inosine. To ensure that overexpressed ADA1 could be anchored on the surface of T cells, ADA1 was fused to the transmembrane domain of CD8 (SEQ ID NO: 9). To aid in detection, a hemagglutinin tag (HA tag) was added to its C-terminus (Figure 10A). It was observed that ADA1 overexpression did not affect CAR surface expression (Figure 11B). To test the ability of ADA1 overexpression to protect CAR T cells from adenosine-mediated inhibition, HA CAR T cells were spiked with adenosine producing in the presence of eATP and analyzed for CD69 expression (Figure 11C). HA CAR T cells spiked with eATP expressed CD69 at a lower MFI and frequency. This activation inhibition was observed to be rescued by overexpression of ADA1.

[0222] To further analyze the effect of ADA1 overexpression on the surface of HA CAR T cells, high-dimensional CyTOF analysis was performed. ADA1-overexpressing HA CAR T cells showed a completely different expression profile compared to control samples (Figure 10B). FlowSOM analysis compared to other knockout conditions revealed a significant decrease in the frequency of exhausted progenitor cells, resulting in a decrease in the exhausted population. Meanwhile, the stem cell memory-like population was significantly increased only in the ADA-overexpressing (O / E) condition. A similar trend was observed in CD4 HA CAR T cells (Figure 11D).

[0223] Furthermore, transcriptome profiling showed that overexpression of ADA on HA CAR-T cells drove the greatest difference in gene expression compared to controls or CD39, CD73, or A2aR knockout (KO) (Figure 10C). There were over 2,500 differentially expressed genes between ADA1 O / E and control samples as depicted in the volcano plot (Figure 10D). Among the most differentially expressed genes, genes associated with memory phenotype and persistence were identified, such as TCF7, IL7R, which were upregulated in ADA1-overexpressing HA CAR T cells (Figure 10E). Genes associated with effector function, such as granzyme B, IL-3, IL-5, TNFSF4 (OX40), or TNFSF11 (RANKL), were downregulated. Furthermore, leading-edge analysis was performed on the GSEA dataset to identify the subset of genes that contributed most significantly to the enrichment score. There was upregulation of many genes involved in cell proliferation, cMYC-regulated pathways, and fatty acid metabolism (Figure 11E). This result suggested changes at the metabolic level. The metabolic status of HA- and ADA1-overexpressing CAR T cells was examined by performing a Mito stress test using a Seahorse analyzer (Figure 10F). ADA1 HA CAR T cells showed both higher OCR and ECAR at baseline. However, the OCR / ECAR ratio indicated a higher reliance on oxidative phosphorylation than glycolysis. Further injection of mitochondrial inhibitors showed that ADA1-overexpressing exhausted CAR T cells had improved spare respiratory capacity (SRC), a characteristic of memory T cells.

[0224] To investigate whether overexpression of transmembrane-bound ADA1 could affect the regulatory phenotype of HA CAR T cells, we measured the expression of Foxp3. Overexpression of transmembrane-bound ADA1 significantly reduced Foxp3 frequency in exhausted HA and non-exhausted CD19 CD8 and CD4 CAR T cells (Figure 10G; Figure 11F). A reduction in the percentage of Tregs in ADA1+ CAR T cells led to improved effector function against tumor lines exhibiting different surface antigen density and proliferation (Figure 10H; Figure 11G).

[0225] Taken together, ADA1 overexpression significantly and robustly improved the fitness and function of both exhausted and non-exhausted CAR T cells by shifting their phenotype towards memory-like cells.

[0226] Example 9. Overexpression of adenosine deaminase improves CAR T cell phenotype and effector function This example describes the results of further experiments performed to determine whether human ADA isoforms ADA1 and ADA2 improve CAR T cell effector function.

[0227] As previously reported and described above, there are two isoforms of human adenosine deaminase: ADA1 and ADA2. Both types catalyze the deamination of adenosine and reduce immunosuppressive signals. Although ADA1 polypeptide does not contain any signal sequence required for protein secretion by cells, ADA1 polypeptide can be attached to cell surface via membrane-bound CD26 protein. In contrast, ADA2 is equipped with a signal peptide that can drive its secretion outside the cell (see, for example, Zavialov AV et al., Biochem.J.391,51-57,2005; and Zavialov AV et al., Biol.Chem.285,12367-12377,2010).

[0228] To determine whether ADA1 and ADA2 similarly improve CAR T cell effector function, recombinant CAR T cells were engineered to express ADA polypeptides fused to a transmembrane domain. In these experiments, the transmembrane domain was derived from CD8. 14 days after activation, recombinant CAR T cells expressing (i) HA, (ii) HA-ADA1-TM, or (iii) HA-ADA2-TM were stimulated with leukemia Nalm6-GD2 and 143b osteosarcoma tumor cells (see, e.g., FIG. 12A).

[0229] In these experiments, CAR T cells expressing (i) HA, (ii) HA-ADA1-TM, or (iii) HA-ADA2-TM were co-cultured with Nalm6-GD2 or 143b tumor lines at a T:E ratio of 8:1 on day 15 after activation. Cytotoxicity function was assessed by IncuCyte assay. Representative donors are shown (n=2). It was observed that CAR T cells engineered to overexpress either membrane-bound ADA1 or membrane-bound ADA2 conferred increased tumor killing compared to control CAR T cells expressing HA (see, e.g., FIG. 12B).

[0230] Furthermore, it was observed that non-exhausted bispecific CD19-CD22 CAR T cells expressing membrane-bound ADA1 or ADA2 secreted higher levels of IL-2 and IFNγ (see, e.g., FIG. 12C). In these experiments, bispecific CD19-CD22.BBz CAR T cells were stimulated with the Nalm6 tumor line 15 days after activation. IL-2 and IFNγ secretion was assessed using ELISA. A representative donor is shown (n=2).

[0231] In some further experiments, CAR T cells overexpressing either ADA1-TM or ADA2-TM were activated with Nalm6-GD2 in the presence or absence of 10 uM adenosine deaminase inhibitor EHNA. It was observed that both CAR T cells overexpressing either HA-ADA1-TM or HA-ADA2-TM produced more IL-2 and IFNγ compared to the control group, and this increase was abrogated in the presence of EHNA (see, for example, FIG. 12D). This result indicates that the increase in cytokine secretion by CAR T cells was mediated by the enzymatic activity of transmembrane-bound ADA.

[0232] Further experiments were performed to test the antitumor efficacy of transmembrane-bound adenosine deaminase by using the 143b solid tumor model. In these experiments, NSG mice were injected with 1×10 6 Each mouse was inoculated with 10 × 10 143b osteosarcoma tumors by intramuscular injection. Four days after inoculation, 10 × 10 6 In these experiments, NSG mice were injected with 1 × 10 control Her2.BBz CAR T cells or Her2.BBz CAR T cells overexpressing ADA2-TM. 6 1×10 143b tumor cells were injected intramuscularly. Four days after injection, mice were immunized with 1×10 143b tumor cells expressing (i) Her2.BBz CAR (i.e., control Her2) or (ii) Her2.BBz CAR and ADA2-TM. 7 CAR T cells were injected intravenously. Tumor growth was monitored by caliper measurement. N=5 mice / group. It was observed that the group of mice injected with CAR T cells expressing ADA2-TM exhibited significantly lower tumor burden (see, e.g., Figure 12E).

[0233] Taken together, the above experimental data provide evidence that overexpression of transmembrane-bound ADA1 or transmembrane-bound ADA2 significantly improves the effector function of exhausted and non-exhausted CAR T cells in vitro and in vivo.

[0234] While the present disclosure has been particularly shown and described with reference to certain embodiments, some of which are preferred embodiments, it should be understood by those skilled in the art that various changes in form and detail can be made therein without departing from the spirit and scope of the present disclosure disclosed herein.

Claims

1. a first amino acid sequence comprising a first polypeptide module having adenosine deaminase activity; a second amino acid sequence comprising a second polypeptide module capable of anchoring the adenosine deaminase activity to the surface of a T cell; A chimeric polypeptide comprising:

2. The chimeric polypeptide of claim 1 , wherein the first polypeptide module is operably linked to the second polypeptide module.

3. The chimeric polypeptide of claim 1 , wherein the first polypeptide module has human adenosine deaminase activity.

4. The chimeric polypeptide of claim 3 , wherein the human adenosine deaminase activity is the activity of ADA1, ADA2, or a functional variant of either of these.

5. The chimeric polypeptide of claim 4, wherein the first polypeptide module comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:7 or SEQ ID NO:

8.

6. The chimeric polypeptide of claim 1 , wherein the second polypeptide module comprises a polypeptide transmembrane domain.

7. 7. The chimeric polypeptide of claim 6, wherein the polypeptide transmembrane domain is derived from a CD8α, CD4, CD28, CD80, ICOS, CTLA4, PD1, PD-L1, BTLA, HVEM, CD27, 4-1BB, 4-1BBL, OX40, OX40L, DR3, GITR, CD30, SLAM, CD2, 2B4, TIM1, TIM2, TIM3, TIGIT, CD226, CD160, LAG3, LAIR1, B7-1, B7-H1, and B7-H transmembrane domain.

8. The chimeric polypeptide of claim 7 , wherein the polypeptide transmembrane domain is a CD8 transmembrane domain or a functional variant thereof.

9. The chimeric polypeptide of claim 8, wherein the CD8 transmembrane domain comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:

9.

10. A method for generating engineered T cells with enhanced effector function, comprising introducing the chimeric polypeptide of claim 1 or a nucleic acid encoding the chimeric polypeptide into a T cell.

11. 11. The method of claim 10, wherein the introduced chimeric polypeptide results in a decrease in intracellular levels of adenosine in the engineered T cells compared to a reference T cell that does not contain the chimeric polypeptide.

12. 11. The method of claim 10, wherein the introduced chimeric polypeptide results in enhanced effector function of the engineered T cell.

13. 11. The method of claim 10, further comprising introducing at least one recombinant antigen-specific receptor into said T cells.

14. 14. The method of claim 13, wherein the at least one recombinant antigen-specific receptor comprises an engineered T cell receptor (TCR) and / or an engineered chimeric antigen receptor (CAR).

15. 11. An engineered T cell produced by the method of claim 10.

16. engineered T cells comprising a chimeric polypeptide a first amino acid sequence comprising a first polypeptide module having adenosine deaminase activity; a second amino acid sequence comprising a second polypeptide module capable of anchoring the adenosine deaminase activity to the surface of a T cell; 1. An engineered T cell comprising:

17. 16. The engineered T cell of claim 15, wherein the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell.

18. 18. The engineered T cells of claim 17, wherein the CD8+ T cytotoxic lymphocyte cells are selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, and bulk CD8+ T cells.

19. 18. The engineered T cells of claim 17, wherein the CD4+ T helper lymphocyte cells are selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells.

20. 16. The engineered T cell of any one of claims 15, wherein the T cell is an exhausted T cell or a non-exhausted T cell.

21. 16. The engineered T cells of claim 15, wherein the T cells are obtained by leukapheresis of a sample obtained from a subject.

22. 16. A cell culture comprising at least one engineered T cell of claim 15 and a culture medium.

23. 16. A pharmaceutical composition comprising the engineered T cells of claim 15 and a pharmaceutically acceptable excipient.

24. 1. Use of a composition for the manufacture of a medicament for preventing and / or treating a health condition in a subject in need thereof, wherein the composition comprises (a) at least one engineered T cell according to claim 15 or 16; and / or (b) a pharmaceutical composition comprising at least one engineered T cell of (a). Including, E. wherein the composition is for administration to said subject. use.

25. 25. The use of claim 24, wherein the health condition is a proliferative disease, an autoimmune disease, or a chronic infectious disease.

26. 26. The use according to claim 25, wherein the proliferative disease is cancer.

27. 25. The use of claim 24, wherein the subject is a mammalian subject.

28. 28. The use according to claim 27, wherein the mammalian subject is a human subject.

29. 25. The use of claim 24, wherein the engineered T cells are autologous to the subject.

30. 25. The use of claim 24, wherein the engineered T cells are obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).

31. The use described in claim 24, wherein the composition for administration to a subject inhibits adenosine-mediated immunosuppression in the subject.

32. The use of claim 24, wherein the composition for administration to a subject confers enhanced effector function to the engineered T cells.

33. 33. The use of claim 32, wherein the enhanced effector function of the engineered T cells is selected from the group consisting of growth rate (proliferation), mortality rate, type of mortality, target cell inhibition (cytotoxicity), differentiation cluster change, macrophage activation, B cell activation, cytokine production, in vivo persistence, and improved spare respiratory capacity.

34. 33. The use of claim 32, wherein the enhanced effector function comprises increased production of one or more cytokines.

35. 35. The use of claim 34, wherein the one or more cytokines include, for example, interferon gamma (INFγ), tumor necrosis factor alpha (TNFα), and / or interleukin-2 (IL-2).

36. 25. The use of claim 24, wherein the composition is for administration to the subject individually (monotherapy) or in combination with a second therapy, wherein the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, or surgery.

37. A composition for use in preventing and / or treating a health condition in a subject in need thereof. a) at least one engineered T cell according to claim 15 or 16; and / or b) A pharmaceutical composition comprising at least one engineered T cell according to (a). A composition comprising:

38. 1. A kit for preventing and / or treating a condition in a subject in need thereof, comprising: (a) the chimeric polypeptide of claim 1; (b) a nucleic acid encoding the chimeric polypeptide of (a); (c) at least one engineered T cell comprising the chimeric polypeptide of (a) and / or the nucleic acid of (b); and / or (d) a pharmaceutical composition comprising at least one engineered T cell of (c). Includes a kit.