Novel OMNI-115, 124, 127, 144-149, 159, 218, 237, 248, 251-253 and 259 CRISPR nucleases

JP2024532784A5Pending Publication Date: 2025-08-20EMENDOBIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024508548
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-13
Filing Date
2022-08-12
Publication Date
2025-08-20

AI Technical Summary

Technical Problem

Current CRISPR nucleases face limitations in sequence specificity, expression, and delivery, which restrict their applications in genome engineering due to diverse characteristics such as PAM site restrictions and pre-immunity, necessitating the development of new CRISPR nucleases with improved properties for targeted genome editing.

Method used

The development of OMNI CRISPR nucleases with specific amino acid sequences (SEQ ID NOs: 1-17) and complementary RNA molecules for targeted genome editing, including nickase and catalytically inactive variants, which form complexes with guide RNA to achieve precise DNA targeting and editing.

Benefits of technology

OMNI CRISPR nucleases demonstrate enhanced specificity and reduced off-target activity compared to SpCas9, enabling efficient and precise genome editing in eukaryotic and prokaryotic cells, including human cells, with potential applications in treating genetic disorders and diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention provides a non-naturally occurring composition comprising a CRISPR nuclease comprising a sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Application No. 63 / 232,723 (filed August 13, 2021), the contents of which are incorporated herein by reference.

[0002] Throughout this application, various publications are referenced, including those referenced in parentheses. The disclosures of all publications mentioned in this application are incorporated by reference in their entireties into this application to fulfill the teachings of the present invention and / or to which the present invention pertains.

[0003] Sequence Listing Reference This application was created on Aug. 12, 2022 on an IBM PC machine format using an operating system compatible with MS-Windows®, and incorporates by reference the nucleotide sequence in an XML file, 575 KB in size, filed as part of this application on Aug. 12, 2022, with file name "210812_91769-A-PCT_Sequence_Listing_AWG.xml."

[0004] Technical Field The present invention relates, inter alia, to compositions and methods for genome editing. [Background technology]

[0005] Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems in bacterial and archaeal adaptive immunity exhibit extreme diversity in protein composition and genomic locus structure. CRISPR systems have become important tools in research and genome engineering. Nevertheless, many details of CRISPR systems are unknown, and the application of CRISPR nucleases may be limited by sequence specificity, expression or delivery. Different CRISPR nucleases have diverse characteristics such as size, PAM site, on-target activity, specificity, cleavage patterns (e.g., blunt ends, sticky ends) and prominent patterns of indel formation after cleavage. Combinations of different properties may be useful for different applications. For example, some CRISPR nucleases are capable of targeting specific genomic loci, while another group of CRISPR nucleases cannot due to PAM site restrictions. In addition, some currently used CRISPR nucleases exhibit pre-immunity, which may limit their applicability in vivo. See Charlesworth et al., Nature Medicine (2019) and Wagner et al., Nature Medicine (2019). Thus, the discovery, application and improvement of novel CRISPR nucleases is important. Summary of the Invention

[0006] This specification discloses compositions and methods that can be used for genome engineering, epigenome engineering, genome targeting, cellular genome editing and / or in vitro diagnosis.

[0007] The disclosed compositions may be used to modify genomic DNA sequences. As used herein, genomic DNA refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in a cell or group of cells of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a prokaryotic cell. In some embodiments, the method creates a double-strand break (DSB) at a predetermined target site in the genomic DNA sequence, resulting in a mutation, insertion and / or deletion of the DNA sequence at the target site in the genome.

[0008] Thus, in some embodiments, the composition comprises a clustered regularly interspaced short palindromic repeats (CRISPR) nuclease. In some embodiments, the CRISPR nuclease is a CRISPR-associated protein.

[0009] OMNI CRISPR Nuclease The present invention provides CRISPR nucleases, referred to as "OMNI" nucleases, as shown in Table 1.

[0010] The invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, comprising introducing into the cell (i) a composition comprising a CRISPR nuclease having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 18 to 51, and (ii) a DNA targeting RNA molecule, or a DNA polynucleotide encoding a DNA targeting RNA molecule comprising a nucleotide sequence complementary to a sequence of a target DNA.

[0011] The present invention relates to a) one or more RNA molecules comprising a guide sequence portion capable of hybridizing to a target sequence linked to direct repeats, or one or more nucleotide sequences encoding said one or more RNA molecules; and b) a CRISPR nuclease comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease; Also provided are non-natural compositions comprising a CRISPR-associated system comprising: wherein the one or more RNA molecules hybridize to the target sequence, the target sequence being adjacent to the 3' end of a complementary sequence of a protospacer adjacent motif (PAM), and the one or more RNA molecules form a complex with the CRISPR nuclease.

[0012] The present invention relates to a) a CRISPR nuclease comprising a sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease; and b) i) a nucleotide sequence of a nuclease-binding RNA capable of interacting / binding to said CRISPR nuclease; and ii) a nucleotide sequence of the DNA-targeting RNA that comprises a sequence complementary to a sequence in the target DNA sequence; or one or more DNA polynucleotides encoding said one or more RNA molecules, Also provided is a non-natural composition comprising: The CRISPR nuclease can complex with the one or more RNA molecules to form a complex that can hybridize to the target DNA sequence. [Brief description of the drawings]

[0013] [Figure 1A] Figures 1A-1D show the predicted secondary structures of single guide RNA (sgRNA) (crRNA-tracrRNA) molecules from sgRNA_127, sgRNA_237, and sgRNA_259. Figure 1A shows the crRNA-tracrRNA duplex of OMNI-127 with the crRNA and tracrRNA portions of the sgRNA. [Figure 1B] Figure 1B shows an example of V1 of sgRNA for OMNI-237. [Figure 1C] Figure 1C shows an example of V2 of sgRNA for OMNI-114. [Figure 1D] Figure 1D shows an example of V1 of sgRNA for OMNI-259 (Table 2). [Figure 1E] Figure 1E shows an example of V1 of sgRNA for OMNI-127 (Table 2). [Diagram 2] Figures 2-18 show the results of in vitro TXTL PAM depletion of OMNI nucleases. The PAM logo is a schematic representation of the percentage of deleted sites (upper panel). The depletion percentage (lower panel, left) of specific PAM sequences (lower panel, right) from the PAM plasmid library was calculated after NGS of the TXTL reaction. The calculation for each OMNI is based on a 4N window along an 8 base pair sequence of the PAM library. The PAM required for the tested OMNI and the level of nuclease activity at this reaction condition are inferred from the depletion percentage. The in vitro PAM depletion results for OMNI-115 are shown in Figures 2-18. [Diagram 3] FIG. 3 shows the results for OMNI-124. [Figure 4] FIG. 4 shows the results for OMNI-127. [Diagram 5] FIG. 5 shows the results for OMNI-144. [Figure 6] FIG. 6 shows the results for OMNI-145. [Figure 7] FIG. 7 shows the results for OMNI-146. [Figure 8] FIG. 8 shows the results for OMNI-147. [Figure 9] FIG. 9 shows the results for OMNI-148. [Figure 10] FIG. 10 shows the results for OMNI-149. [Figure 11] FIG. 11 shows the results for OMNI-159. [Figure 12]FIG. 12 shows the results for OMNI-218. [Figure 13] FIG. 13 shows the results for OMNI-237. [Figure 14] FIG. 14 shows the results for OMNI-248. [Figure 15] FIG. 15 shows the results for OMNI-251. [Figure 16] FIG. 16 shows the results for OMNI-252. [Figure 17] FIG. 17 shows the results for OMNI-253. [Figure 18] FIG. 18 shows the results for OMNI-259. [Figure 19A] Figures 19A-19C show the activity of OMNI-127 as part of an RNP complex in U2OS cells and spacer optimization. OMNI-127 nuclease was overexpressed and purified. The purified protein was complexed with synthetic sgRNA to form RNPs. In Figure 19A, in an in vitro assay, decreasing amounts of RNPs (4, 2, 1, and 0.5 pmol) with ELANE-targeting g135 guides (listed in Table 6) were incubated with 40 ng of ELANE DNA target template. Activity was confirmed by the ability of the RNPs to cleave the linear template. [Figure 19B] In Figures 19B-19C, in vivo assays, ELANE-targeted g135 and g136 guide RNPs with various spacer lengths (20-24 nucleotides) were electroporated into U2OS cells, and editing levels were measured by next-generation sequencing (NGS) based on indel formation. [Figure 19C] FIG. 19C shows activity assay results of OMNI-127 as part of an RNP complex in U2OS cells: RNPs with ELANE g134, g135 and g136 (spacer length 22 bp, Table 6) were electroporated into the U2OS cell line and editing levels (indels) were measured by NGS. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] Detailed Description In some aspects of the invention, the disclosed compositions comprise a nucleic acid molecule comprising a clustered regularly interspaced short palindromic repeats (CRISPR) nuclease and / or a sequence encoding same.

[0015] Table 1 shows the novel CRISPR nucleases and the position of one or more substitutions in each nuclease that convert the nuclease into a nickase or a catalytically inactive nuclease. For example, the catalytic site of the CRISPR nuclease of the present invention may be modified so that the nuclease has nickase activity and can cleave single-stranded DNA. Alternatively, the catalytic site of the CRISPR nuclease of the present invention may be modified so that the nuclease does not have nuclease activity, i.e., is a catalytically inactive nuclease. Throughout the specification, CRISPR nucleases are referred to, but these nucleases may be modified to have nickase activity (i.e., nucleases that cleave single strands instead of cleaving double stranded DNA) or to have no nuclease activity (i.e., nucleases that are catalytically inactive).

[0016] Table 2 shows the crRNA, tracrRNA and single guide RNA (sgRNA) sequences, as well as portions of the crRNA, tracrRNA and sgRNA sequences compatible with each CRISPR nuclease. Thus, a crRNA molecule capable of binding and targeting an OMNI nuclease shown in Table 2 as part of a crRNA:tracrRNA complex may comprise a crRNA sequence shown in Table 2. Similarly, a tracrRNA molecule capable of binding and targeting an OMNI nuclease shown in Table 2 as part of a crRNA:tracrRNA complex may comprise a tracrRNA sequence shown in Table 2. Also, a single guide RNA molecule capable of binding and targeting an OMNI nuclease shown in Table 2 may comprise a sequence shown in Table 2.

[0017] For example, the crRNA molecule of OMNI-115 nuclease (SEQ ID NO: 1) may comprise the sequence shown in SEQ ID NO: 52 to 55; the tracrRNA molecule of OMNI-115 nuclease may comprise the sequence shown in any one of SEQ ID NO: 56 to 63; and the sgRNA molecule of OMNI-115 nuclease may comprise the sequence shown in any one of SEQ ID NO: 52 to 64. Other crRNA, tracrRNA or sgRNA molecules of each OMNI nuclease can be derived in the same manner from the sequences shown in Table 2.

[0018] Any one of these nucleases can be targeted to a desired DNA target sequence via a guide RNA molecule. The nuclease-guide complex also carries the molecule bound to the complex to the target site. Thus, this disclosure also contemplates the use of fusion proteins comprising a CRISPR nuclease and a DNA modifying domain (e.g., a deaminase, nuclease, nickase, recombinase, methyltransferase, methylase, acetylase, acetyltransferase, transcriptional activator or transcriptional repressor domain), as well as fusion proteins that correct mutations in a genome (e.g., the genome of a human subject) associated with disease or generate mutations in a genome (e.g., the human genome) to reduce or prevent expression of a gene.

[0019] In some embodiments, the CRISPR nuclease of the present application may be fused to a protein having an enzymatic activity. In some embodiments, the enzymatic activity modifies the target DNA. In some embodiments, the enzymatic activity is a nuclease activity, a methyltransferase activity, a demethylase activity, a DNA repair activity, a DNA damage activity, a deamination activity, a dismutase activity, an alkylation activity, a depurination activity, an oxidation activity, a pyrimidine dimer formation activity, an integrase activity, a transposase activity, a recombinase activity, a polymerase activity, a ligase activity, a helicase activity, a photolyase activity, or a glycosylase activity. In some embodiments, the enzymatic activity is a nuclease activity. In some embodiments, the nuclease activity creates a double-stranded break in the target DNA. In some embodiments, the enzymatic activity modifies a target polypeptide associated with the target DNA. Optionally, the enzymatic activity is a methyltransferase activity, a demethylase activity, an acetyltransferase activity, a deacetylase activity, a kinase activity, a phosphatase activity, a ubiquitin ligase activity, a deubiquitinating activity, an adenylating activity, a deadenylating activity, a sumoylating activity, a desumoylating activity, a ribosylation activity, a deribosylation activity, a myristoylating activity, or a demyristoylating activity. Optionally, the target polypeptide is a histone and the enzymatic activity is a methyltransferase activity, a demethylase activity, an acetyltransferase activity, a deacetylase activity, a kinase activity, a phosphatase activity, a ubiquitin ligase activity, or a deubiquitinating activity.

[0020] Thus, any one of the CRISPR nucleases, nickases or catalytically inactive nucleases may be fused (e.g., directly or via a linker) to another DNA modulating or modifying enzyme, including but not limited to a deaminase, a reverse transcriptase (e.g., see Anzaolone et al. (2019) for use in prime editing), an enzyme that alters the methylation state of DNA (e.g., a methyltransferase) or a base editor such as a modifier of histones (e.g., a histone acetyltransferase). Indeed, the OMNI-50 nuclease, nickase, or inactive nuclease of the present application may be fused to a DNA modifying enzyme or its effector domain. Examples of DNA regulators include, but are not limited to, deaminases, nucleases, nickases, recombinases, methyltransferases, methylases, acetylases, acetyltransferases, reverse transcriptases, helicases, integrases, ligases, transposases, demethylases, phosphatases, transcriptional activators, or transcriptional repressors. In some embodiments, the CRISPR nucleases of the present application are fused to a protein having enzymatic activity. In some embodiments, the enzymatic activity modifies the target DNA molecule. The CRISPR nucleases of the present application or their fusion proteins may be used to modify or generate one or more mutations in a gene associated with a disease, or to increase, modify, decrease, or prevent the expression of a gene.

[0021] The non-natural composition comprises a CRISPR nuclease comprising a sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-17, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease.

[0022] In some embodiments, the composition further comprises one or more RNA molecules, or a DNA polynucleotide encoding any one of the one or more RNA molecules, wherein the one or more RNA molecules and the CRISPR nuclease are not co-occurring in nature, and the one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or to target the complex to a target site.

[0023] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs:52-64.

[0024] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:52-55.

[0025] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 56-63.

[0026] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:52-64.

[0027] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 65-81.

[0028] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:2, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:65-68 and 80.

[0029] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 69-77 and 81.

[0030] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:2, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:65-81.

[0031] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 3, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 82-97.

[0032] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:3, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:82-85 and 96.

[0033] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 86-93 and 97.

[0034] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:3, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:82-97.

[0035] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NOs: 4-9, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 98-114.

[0036] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NOs: 4-9, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 98-101 and 114.

[0037] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 102-111.

[0038] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NOs: 4-9, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 98-114.

[0039] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 115-127.

[0040] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 115-118.

[0041] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 119-126.

[0042] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 115-127.

[0043] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 11, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 128-141.

[0044] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:11, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:128-131.

[0045] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 132-140.

[0046] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:11, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:128-141.

[0047] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 12, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 142-155.

[0048] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 12, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 142-145.

[0049] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 146-152 and 155.

[0050] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 12, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 142-155.

[0051] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 13, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 156-167 and GCUUUAAGC.

[0052] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 13, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 156-159.

[0053] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 160-166 and GCUUUAAGC.

[0054] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 13, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 156-167 and GCUUUAAGC.

[0055] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14 or 15, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 168-176.

[0056] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14 or 15, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 168 and 169.

[0057] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 170-175.

[0058] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14 or 15, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 168-176.

[0059] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 16, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 177-185.

[0060] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 16, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 177 and 178.

[0061] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 179-184.

[0062] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 16, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 177-185.

[0063] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 17, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 186-202.

[0064] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 17, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 186-189 and 201.

[0065] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 190-198 and 202.

[0066] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 17, and the at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 186-202.

[0067] In some embodiments, the CRISPR nuclease is a nickase with an inactivated RuvC domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 5 of Table 1.

[0068] In some embodiments, the CRISPR nuclease is a nickase with an inactivated HNH domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 6 of Table 1.

[0069] In some embodiments, the CRISPR nuclease is a catalytically inactive nuclease having an inactivated RuvC domain and an inactivated HNH domain created by substitution of the CRISPR nuclease at the positions shown in column 7 of Table 1.

[0070] For example, the RuvC domain can be inactivated by substituting the aspartic acid residue (D) at position 9 of the amino acid sequence of OMNI-127 (SEQ ID NO:3) with another amino acid, e.g., alanine (A), to generate a nickase of the OMNI-127 nuclease. Substitutions with other amino acids are permitted at each of the amino acid positions shown in columns 5-7 unless otherwise indicated in Table 1. Other nickases or catalytically inactive nucleases can be similarly generated from Table 1.

[0071] In some embodiments, the CRISPR nuclease utilizes a protospacer adjacent motif (PAM) sequence as shown for the CRISPR nucleases in columns 2-4 of Table 3.

[0072] The invention also provides a method for modifying the nucleotide sequence of a DNA target site in a cell-free system or in the genome of a cell, comprising introducing into a cell any one of the compositions described above. In some embodiments, the composition comprises a CRISPR nuclease and a crRNA:tracrRNA complex or an sgRNA molecule.

[0073] In some embodiments, the CRISPR nuclease cleaves the DNA strand adjacent to the CRISPR nuclease protospacer adjacent motif (PAM) sequence shown in columns 2-4 of Table 3, and cleaves the DNA strand adjacent to the sequence complementary to the PAM sequence. For example, an OMNI-115 nuclease with an appropriate targeting sgRNA or crRNA:tracrRNA complex can cleave DNA at the strand adjacent to the sequence NNRYTT or NNRTTT, and at the DNA strand adjacent to the sequence complementary to the sequence NNRYTT or NNRTTT. In some embodiments, the DNA strand is inside the nucleus of the cell.

[0074] In some embodiments, the CRISPR nuclease is a nickase with an inactivated RuvC domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 5 of Table 1, and cleaves the DNA strand adjacent to the sequence complementary to the PAM sequence.

[0075] In some embodiments, the CRISPR nuclease is a nickase with an inactivated NHN domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 6 of Table 1, and cleaves the DNA strand adjacent to the PAM sequence.

[0076] In some embodiments, the CRISPR nuclease is a catalytically inactive nuclease having an inactivated RuvC domain and an inactivated HNH domain created by substitution of the CRISPR nuclease at the positions shown in column 7 of Table 1, and cleaves the DNA strand adjacent to the PAM sequence.

[0077] In some embodiments, the cell is a eukaryotic cell or a prokaryotic cell.

[0078] In some embodiments, the cell is a mammalian cell.

[0079] In some embodiments, the cells are human cells.

[0080] In some embodiments, the CRISPR nuclease comprises an amino acid sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, or 82% sequence identity to a CRISPR nuclease of a sequence set forth in any of SEQ ID NOs: 1-17. In certain embodiments, the sequence encoding the CRISPR nuclease has at least 95% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 18-51.

[0081] In some aspects of the invention, the disclosed compositions include DNA constructs or vector systems that include a nucleotide sequence encoding a CRISPR nuclease or a CRISPR nuclease variant. In some embodiments, the nucleotide sequence encoding the CRISPR nuclease or a CRISPR nuclease variant is operably linked to a promoter operable in a cell of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a mammalian cell. In some embodiments, the nucleic acid sequence encoding the modified CRISPR nuclease is codon-optimized for use in cells of a particular organism. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for E. coli. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for eukaryotic cells. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for mammalian cells.

[0082] In some embodiments, the composition comprises a recombinant nucleic acid comprising a heterologous promoter operably linked to a polynucleotide encoding a CRISPR enzyme having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90% identity to any of SEQ ID NOs: 1-17. Each possibility is a separate embodiment.

[0083] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:1, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:18 and 35.

[0084] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:2, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:19 and 36.

[0085] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:3, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:20 and 37.

[0086] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:4, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:21 and 38.

[0087] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:5, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:22 and 39.

[0088] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:6, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:23 and 40.

[0089] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:7, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:24 and 41.

[0090] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:8, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:25 and 42.

[0091] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:9, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:26 and 43.

[0092] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 10, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 27 and 44.

[0093] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO:11, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:28 and 45.

[0094] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 12, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29 and 46.

[0095] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 13, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 30 and 47.

[0096] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 14, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31 and 48.

[0097] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 15, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 32 and 49.

[0098] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 16, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 33 and 50.

[0099] In an embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% identity to the amino acid sequence set forth in SEQ ID NO: 17, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34 and 51.

[0100] According to some embodiments, modified or non-natural compositions are provided that include a CRISPR nuclease comprising a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-17, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease. Each possibility is a separate embodiment. In some embodiments, the CRISPR nuclease is modified or does not occur in nature. The CRISPR nuclease may be recombinant. Such CRISPR nucleases are created by collecting genetic material from multiple sources and using laboratory methods (molecular cloning) to create sequences not otherwise found in organisms.

[0101] In certain embodiments, the CRISPR nucleases of the invention have increased specificity for a target site compared to SpCas9 nucleases when complexed with one or more RNA molecules.

[0102] In certain embodiments, complexes of the CRISPR nuclease and one or more RNA molecules of the invention maintain at least on-target editing activity at a target site and reduce off-target activity compared to SpCas9 nuclease.

[0103] In certain embodiments, the CRISPR nuclease further comprises an RNA binding site capable of interacting with a DNA-targeting RNA molecule (gRNA molecule), and an active site that exhibits site-specific enzymatic activity.

[0104] In one embodiment, the composition further comprises a DNA-targeting RNA molecule, or a DNA polynucleotide encoding a DNA-targeting RNA molecule, wherein said DNA-targeting RNA comprises a guide sequence portion, i.e., a nucleotide sequence complementary to a sequence within a target region, and wherein said DNA-targeting RNA molecule and said CRISPR nuclease are not found together in nature.

[0105] In certain embodiments, the DNA-targeting RNA molecule further comprises a nucleotide sequence capable of forming a complex with a CRISPR nuclease.

[0106] The present invention relates to a) one or more RNA molecules comprising a guide sequence portion capable of hybridizing to a target sequence linked to direct repeats, or one or more nucleotide sequences encoding said one or more RNA molecules; and b) a CRISPR nuclease comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease; Also provided are non-natural compositions comprising a CRISPR-associated system comprising: wherein the one or more RNA molecules hybridize to the target sequence, the target sequence being 3' to a protospacer adjacent motif (PAM), and the one or more RNA molecules form a complex with the CRISPR nuclease.

[0107] In some embodiments, the composition further comprises an RNA molecule (e.g., a tracrRNA molecule) comprising a nucleotide sequence capable of forming a complex with a CRISPR nuclease, or a DNA polynucleotide comprising a sequence encoding an RNA molecule capable of forming a complex with a CRISPR nuclease.

[0108] In certain embodiments, the composition further comprises a donor template for homology directed repair (HDR).

[0109] In some embodiments, the composition is capable of editing a target region of the genome of a cell.

[0110] According to some embodiments, (a) an RNA binding site; and Active sites that exhibit site-specific enzyme activity A CRISPR nuclease or a polynucleotide encoding the CRISPR nuclease, wherein the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80% identity to any of SEQ ID NOs: 1 to 17; and (b) i) a DNA-targeting RNA sequence that comprises a nucleotide sequence that is complementary to a target DNA sequence; and ii) a protein-binding RNA sequence capable of interacting with the RNA-binding site of the CRISPR nuclease; one or more RNA molecules or a DNA polynucleotide encoding said one or more RNA molecules, A non-natural composition is provided, comprising: Here, the DNA targeting RNA sequence and the CRISPR nuclease are not found together in nature, and each possibility is a separate embodiment.

[0111] In some embodiments, a single RNA molecule is provided that comprises a DNA targeting RNA sequence and a protein binding RNA sequence, and said RNA molecule can form a complex with CRISPR nuclease and function as a DNA targeting module.In some embodiments, the length of the RNA molecule is up to 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, 50 bases.Each possibility is a separate embodiment.In some embodiments, the first RNA molecule that comprises a DNA targeting RNA sequence and the second RNA molecule that comprises a protein binding RNA sequence interact by base pairing or fuse with each other to form a complex with CRISPR nuclease and form one or more RNA molecules that function as a DNA targeting module.

[0112] The present invention relates to a) a CRISPR nuclease comprising a sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease; and b) i) a nucleotide sequence of a nuclease-binding RNA capable of interacting / binding to said CRISPR nuclease; and ii) a nucleotide sequence of the DNA-targeting RNA that comprises a sequence complementary to a sequence in the target DNA sequence; or one or more DNA polynucleotides encoding said one or more RNA molecules, Also provided is a non-natural composition comprising: Here, the CRISPR nuclease can complex with the one or more RNA molecules to form a complex that is capable of hybridizing to the target DNA sequence.

[0113] In certain embodiments, the CRISPR nuclease and one or more RNA molecules form a CRISPR complex that is capable of binding to and cleaving a target DNA sequence.

[0114] In certain embodiments, the CRISPR nuclease and at least one of the one or more RNA molecules are not found together in nature.

[0115] In one embodiment: a) CRISPR nucleases contain an RNA-binding site and an active site that exhibits site-specific enzymatic activity; b) the nucleotide sequence of the DNA-targeting RNA comprises a nucleotide sequence that is complementary to the target DNA sequence; and c) The nucleotide sequence of the nuclease-binding RNA comprises a sequence that interacts with the RNA-binding site of the CRISPR nuclease.

[0116] In one aspect, the nucleotide sequence of the nuclease-binding RNA and the nucleotide sequence of the DNA-targeting RNA are on a single guide RNA molecule (sgRNA), which can form a complex with a CRISPR nuclease and function as a DNA-targeting module.

[0117] In one aspect, the nucleotide sequence of the nuclease-binding RNA is on a first RNA molecule and the nucleotide sequence of the DNA-targeting RNA is on a second RNA molecule, and the first and second RNA sequences interact by base pairing or fuse to each other to form an RNA complex or form a complex with a CRISPR nuclease to form an sgRNA that functions as a DNA-targeting module.

[0118] In certain embodiments, the sgRNA is up to 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, 50 bases in length.

[0119] In certain embodiments, the composition further comprises a donor template for homology directed repair (HDR).

[0120] In some embodiments, the CRISPR nuclease is not naturally occurring.

[0121] In some embodiments, the CRISPR nuclease is modified to include unnatural or synthetic amino acids.

[0122] In some embodiments, the CRISPR nuclease is modified to include one or more of a nuclear localization sequence (NLS), a cell penetrating peptide sequence, and / or an affinity tag.

[0123] In certain embodiments, the CRISPR nuclease comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of a CRISPR complex comprising a detectable amount of the CRISPR nuclease in the nucleus of a eukaryotic cell.

[0124] The invention also provides a method for modifying the nucleotide sequence of a target site in a cell-free system or within the genome of a cell, comprising introducing a composition of the invention into a cell.

[0125] In some embodiments, the cell is a eukaryotic cell.

[0126] In another embodiment, the cell is a prokaryotic cell.

[0127] In some embodiments, the one or more RNA molecules further comprise an RNA sequence comprising a nucleotide molecule capable of forming a complex with an RNA nuclease (tracrRNA), or a DNA polynucleotide encoding an RNA molecule comprising a nucleotide sequence capable of forming a complex with a CRISPR nuclease.

[0128] In some embodiments, the CRISPR nuclease comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the amino terminus, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the carboxyl terminus, or a combination of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the amino terminus and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the carboxyl terminus. In some embodiments, 1-4 NLSs are fused to the CRISPR nuclease. In some embodiments, the NLS is internal to the open reading frame (ORF) of the CRISPR nuclease.

[0129] The method of fusing NLS at or near the amino terminus, at or near the carboxyl terminus, or within ORF of expressed protein is widely known in the art.As an example, to fuse NLS to the amino terminus of CRISPR nuclease, the nucleic acid sequence of NLS is placed immediately after the start codon of CRISPR nuclease in the nucleic acid encoding NLS-fused CRISPR nuclease.Also, to fuse NLS to the carboxyl terminus of CRISPR nuclease, the nucleic acid sequence of NLS is placed after the codon that codes the last amino acid of CRISPR nuclease and before the stop codon.

[0130] The invention contemplates combinations of NLSs, cell penetrating peptide sequences and / or affinity tags at positions along the ORF of the CRISPR nuclease.

[0131] The amino acid and nucleic acid sequences of the CRISPR nucleases of the present invention may include NLSs and / or TAGs inserted to interrupt consecutive amino acid or nucleic acid sequences of the CRISPR nuclease.

[0132] In certain embodiments, one or more of the NLSs are tandemly repeated.

[0133] In certain aspects, one or more NLSs are considered to be proximal to the N-terminus or C-terminus if the nearest amino acid of the NLS is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more amino acids along the polypeptide chain from the N-terminus or C-terminus.

[0134] As discussed, the CRISPR nuclease may be modified to include one or more of a nuclear localization sequence (NLS), a cell penetrating peptide sequence, and / or an affinity tag.

[0135] In certain embodiments, a CRISPR nuclease has increased specificity for a target site when complexed with one or more RNA molecules, compared to its wild-type form.

[0136] In certain embodiments, a complex of a CRISPR nuclease and one or more RNA molecules maintains at least on-target editing activity at the target site and reduces off-target activity compared to a wild-type form of the CRISPR nuclease.

[0137] In one embodiment, the composition further comprises a recombinant nucleic acid molecule comprising a heterologous promoter operably linked to a nucleotide molecule comprising a sequence encoding a CRISPR nuclease.

[0138] In certain embodiments, the CRISPR nuclease or the nucleic acid molecule comprising a sequence encoding the CRISPR nuclease is not naturally occurring or is modified.

[0139] The invention also provides non-natural or modified compositions comprising vector systems comprising nucleic acid molecules comprising sequences encoding the CRISPR nucleases of the invention.

[0140] The invention also provides the use of a composition of the invention for the treatment of a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0141] The invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, comprising introducing into the cell (i) a composition comprising a CRISPR nuclease having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 17, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 18 to 51, and (ii) a DNA targeting RNA molecule, or a DNA polynucleotide encoding a DNA targeting RNA molecule comprising a nucleotide sequence complementary to a sequence of a target DNA.

[0142] In some embodiments, the method is performed ex vivo. In some embodiments, the method is performed in vivo. In some embodiments, some steps of the method are performed ex vivo and some steps are performed in vivo. In some embodiments, the mammalian cells are human cells.

[0143] In one embodiment, the method further comprises (iii) introducing into the cell an RNA molecule comprising a tracrRNA sequence, or a DNA polynucleotide encoding an RNA molecule comprising the tracrRNA sequence.

[0144] In some embodiments, the DNA-targeting RNA molecule comprises a crRNA repeat sequence.

[0145] In one embodiment, an RNA molecule comprising a tracrRNA sequence can bind to a DNA-targeting RNA molecule.

[0146] In one embodiment, the DNA-targeting RNA molecule and the RNA molecule comprising the tracrRNA sequence interact to form an RNA complex, and the RNA complex can form an active complex with a CRISPR nuclease.

[0147] In one embodiment, the DNA-targeting RNA molecule and the RNA molecule comprising the nuclease-binding RNA sequence are fused in the form of a single guide RNA molecule suitable for forming an active complex with a CRISPR nuclease.

[0148] In some aspects, the guide sequence portion comprises a sequence complementary to a protospacer sequence.

[0149] In certain embodiments, the CRISPR nuclease complexes with a DNA-targeting RNA molecule and makes a double-stranded break 3' or 5' to the protospacer adjacent motif (PAM).

[0150] In any aspect of the methods of the present application, the methods are for treating a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0151] In one aspect, the method involves first selecting a subject suffering from a disease associated with a genomic mutation and obtaining cells from the subject.

[0152] The invention also provides modified cells obtained by the methods of the present application. In some embodiments, these modified cells are capable of giving rise to progeny cells. In some embodiments, these modified cells are capable of giving rise to progeny cells after transplantation.

[0153] The invention also provides compositions comprising these modified cells and a pharma- ceutically acceptable carrier, as well as in vitro or ex vivo methods for preparing the same, comprising combining the cells with a pharma- ceutically acceptable carrier.

[0154] DNA-targeting RNA molecules A "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that can hybridize to a specific target DNA sequence, e.g., the guide sequence portion is partially or completely complementary to the targeted DNA sequence along its length. In some embodiments, the length of the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or less. 39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20 nucleotides. The entire length of the guide sequence portion is completely complementary to the targeted DNA sequence along its length. The guide sequence portion may be a portion of an RNA molecule that can form a complex with a CRISPR nuclease having a guide sequence portion that functions as the DNA targeting portion of the CRISPR complex. When a DNA molecule having a guide sequence portion is present simultaneously with a CRISPR molecule, the RNA molecule can target the CRISPR nuclease to a specific target DNA sequence. Each possibility is a separate embodiment. The RNA molecule can be specifically designed to target a desired sequence. Thus, a molecule that includes a "guide sequence portion" is a type of targeting molecule. Throughout this application, the terms "guide molecule", "RNA guide molecule", "guide RNA molecule" and "gRNA molecule" are synonymous with a molecule that includes a guide sequence portion, and the term "spacer" is synonymous with "guide sequence portion".

[0155] In embodiments of the invention, the CRISPR nuclease has greatest cleavage activity when used with an RNA molecule that includes a guide sequence portion having 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0156] Single guide RNA (sgRNA) molecules can be used to direct CRISPR nuclease to desired target sites. Single guide RNA includes guide sequence portion and scaffold portion. The scaffold portion interacts with CRISPR nuclease and, together with the guide sequence portion, activates and directs CRISPR nuclease to desired target sites. The scaffold portion can be further designed, for example, to be small in size.

[0157] In some aspects of the invention, the disclosed methods include methods of modifying a nucleotide sequence in a cell-free system or at a target site in the genome of a cell, comprising introducing into a cell a composition as described herein.

[0158] In some embodiments, the cell is a eukaryotic cell, preferably a mammalian cell or a plant cell.

[0159] In some aspects of the invention, the disclosed methods include the use of the compositions of the present application for the treatment of a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0160] In some aspects of the invention, the disclosed methods include methods of treating a subject having a mutational disorder comprising targeting a composition of the present application to an allele associated with the mutational disorder.

[0161] In some aspects, the mutational disorder is associated with a disease or disorder selected from any of neoplasia, age-related macular degeneration, schizophrenia, neurological disorders, neurodegenerative diseases, movement disorders, fragile X syndrome, secretase-related disorders, prion-related disorders, ALS, addiction, autism, Alzheimer's disease, neutropenia, inflammation-related disorders, Parkinson's disease, blood and coagulation diseases and disorders, beta thalassemia, sickle cell anemia, cellular dysregulation, tumor-related diseases and disorders, inflammation and immune-related diseases and disorders, metabolic, liver, hypercholesterolemia, kidney and protein diseases and disorders, muscular and skeletal diseases and disorders, skin diseases and disorders, neurological diseases and disorders, pulmonary diseases and disorders, corneal diseases and disorders, retinal diseases and disorders, and ophthalmic diseases and disorders.

[0162] Disease and Treatment An embodiment of the present invention targets nucleases to specific loci associated with a disease or disorder as a form of gene editing, treatment or therapeutic method. For example, the novel nucleases disclosed herein may be specifically targeted to pathogenic mutant alleles of a gene using specially designed guide RNA molecules to induce gene editing or knockout. It is preferable to design guide RNA molecules by first considering the PAM requirements of the nuclease, which also depends on the system in which gene editing is performed, as shown in the specification. For example, guide RNA molecules designed to target OMNI-115 nuclease to a target site are designed to include a spacer region complementary to the DNA strand of the DNA double-stranded region adjacent to the OMNI-115 PAM sequence (e.g., "NNRYTT" or "NNRTTT"). The guide RNA molecule is preferably further designed to contain a spacer region (i.e., the region of the guide RNA molecule that is complementary to the target allele) of sufficient and preferably optimal length to increase the specific activity of the nuclease and reduce off-target effects.

[0163] As a non-limiting example, guide RNA molecules may be designed to target nucleases to specific regions of mutant alleles, for example, near the start codon, such that upon DNA damage by nucleases, non-homologous end joining (NHEJ) pathways are induced, resulting in silencing of the mutant allele by introducing frameshift mutations. This approach to design guide RNA molecules is particularly useful for altering the action of dominant-negative mutations, thereby treating subjects. As another non-limiting example, guide RNA molecules may be designed to target specific pathogenic mutations of mutated alleles, such that upon DNA damage by nucleases, homology-directed repair (HDR) pathways are induced, resulting in template-mediated correction of the mutant allele. This approach to design guide RNA molecules is particularly useful for altering the haploinsufficient action of mutant alleles, thereby treating subjects.

[0164] Non-limiting examples of genes that may be targeted for modification to treat disease or disorders are given below. Disease-associated genes and mutations that induce mutation disorders are described in the literature. Such mutations can be used to design DNA targeting RNA molecules that target the alleles of disease-associated genes, and CRISPR compositions that induce DNA damage to induce DNA repair pathways to modify the alleles, thereby treating the mutation disorder.

[0165] Mutations in the ELANE gene are associated with neutropenia. Accordingly, aspects of the invention that target ELANE may be used, without limitation, in methods of treating subjects suffering from neutropenia.

[0166] CXCR4 is a coreceptor in human immunodeficiency virus type 1 (HIV-1) infection. Accordingly, aspects of the invention that target CXCR4 may be used, without limitation, in methods of treating subjects with HIV-1 or conferring resistance to HIV-1 infection in a subject.

[0167] Disruption of programmed cell death protein 1 (PD-1) promotes CAR-T cell killing of tumor cells, making PD-1 a potential target for cancer therapy. Thus, embodiments of the present invention that target PD-1 may be used without restriction in methods of treating subjects with cancer. In one embodiment, the treatment is CAR-T cell therapy with T cells modified according to the present invention to be PD-1 deficient.

[0168] In addition, BCL11A is a gene involved in the suppression of hemoglobin production. By inhibiting BCL11A, globin production may be increased to treat diseases such as thalassemia and sickle cell anemia. See, for example, WO 2017 / 077394, U.S. Patent Application Publication No. 2011 / 0182867; Humbert et al. Sci. Transl. Med. (2019) and Canver et al. Nature (2015). Thus, aspects of the invention that target enhancers of BCL11A may be used without restriction in methods of treating subjects suffering from β-thalassemia or sickle cell anemia.

[0169] The present invention may be used to target disease-associated genes in the study, modification or treatment of diseases or disorders listed below in Table A or Table B. Indeed, disease-associated genes having a genetic locus may be studied, modified or treated by using the nucleases disclosed herein to target the appropriate disease-associated gene, such as those listed in US Patent Application Publication No. 2018 / 0282762 and EP Patent No. 3079726 (B1).

[0170] [Table A]

[0171] [Table B-1]

[0172] [Table B-2]

[0173] [Table B-3]

[0174] Unless otherwise defined, all technical and / or scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this invention, representative methods and / or materials are described below. In case of conflict, the specification, including definitions, will control. Additionally, the materials, methods, and examples are merely illustrative and are not intended to be necessarily limiting.

[0175] Unless otherwise stated in the discussion, adjectives such as "substantially" and "about" that modify the state or relationship of features of an embodiment of the invention are understood to mean that the state or relationship is defined within an acceptable range for operation of the embodiment for its intended use. Unless otherwise indicated, the term "or" in the specification and claims is considered an inclusive "or" rather than an exclusive "or," indicating at least one, and any combination, of the items it conjugates.

[0176] The term "a" or "an" as used herein should be understood to refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically noted otherwise. Thus, the terms "a" or "an" and "at least one" have the same meaning in this application.

[0177] To better understand the teachings and in no way limit the scope of the teachings, unless otherwise specified, all numbers indicating quantities, percentages or ratios, and other numerical values ​​used in the specification and claims should be understood to be modified in all instances by the term "about." Thus, unless indicated to the contrary, the numerical values ​​set forth in the specification and claims are approximations that may vary depending on the desired properties sought to be obtained. At the very least, each numerical value should be interpreted in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0178] When numerical ranges are stated in this specification, it is understood that the invention contemplates every integer between the upper and lower limits, inclusive, unless otherwise stated.

[0179] In this specification and claims, the verbs "contain," "include," and "have," and each of their conjugations, are used to indicate that the object of the verb is not necessarily an exhaustive list of components, elements, or parts of the subject of the verb. Other terms in this specification are intended to have the meanings that are well known in the art.

[0180] The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are synonymous. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Polynucleotides may have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci determined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA sequences, isolated RNA sequences, nucleic acid probes and primers. A polynucleotide may contain one or more modified nucleotides, such as methylated nucleotides or their analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The nucleotide sequence may be interrupted by non-nucleotide elements. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

[0181] The term "nucleotide analog" or "modified nucleotide" refers to a nucleotide that contains one or more of a variety of chemical modifications (e.g., substitutions) in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)), in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, 6-membered sugar analogs or open-ring sugar analogs), or in the phosphate moiety. Each of the RNA sequences described herein may contain one or more nucleotide analogs.

[0182] As used herein, the following nucleotide identifiers are used to represent nucleotide bases:

[0183] [Table C]

[0184] In this specification, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence or a molecule that contains a nucleotide sequence that can hybridize to a specific target sequence, for example, a targeting sequence is at least partially complementary to the sequence that is targeted along its length. A targeting sequence or a targeting molecule can be a part of a targeting RNA molecule with which a CRISPR nuclease having a targeting sequence that functions as the targeting part of a CRISPR complex can form a complex. When a molecule having a targeting sequence is present simultaneously with a CRISPR molecule, the RNA molecule can target CRISPR nuclease to a specific target sequence. Each possibility is a separate embodiment. A targeting RNA molecule can be specifically designed to target a desired sequence.

[0185] In this specification, the term "target" refers to the preferential hybridization of targeting sequence or targeting molecule with the nucleic acid having the target nucleotide sequence.It is understood that the term "target" encompasses variable hybridization, such that there is preferential targeting of the nucleic acid having the target nucleotide sequence, but in addition to on-target hybridization, unintended off-target hybridization may also occur.When an RNA molecule targets a sequence, it is understood that the complex of the RNA molecule and the CRISPR nuclease molecule targets the sequence due to nuclease activity.

[0186] When targeting a DNA sequence present in multiple cells, it is understood that targeting encompasses the hybridization of the guide sequence portion of the RNA molecule with a sequence in one or more cells, and also encompasses the hybridization of the RNA molecule with the target sequence in less than all cells in the multiple cells.Therefore, when targeting a sequence in multiple cells, it is understood that the complex of the RNA molecule and CRISPR nuclease hybridizes with the target sequence in one or more cells, and it is also understood that it may hybridize with the target sequence in less than all cells.Therefore, it is understood that the complex of the RNA molecule and CRISPR nuclease hybridizes with the target sequence in one or more cells to introduce double-strand breaks, and may hybridize with the target sequence in less than all cells to introduce double-strand breaks.In this specification, the term "modified cell" refers to a cell that is double-stranded by the complex of the RNA molecule and CRISPR nuclease as a result of hybridization with the target sequence, i.e., on-target hybridization.

[0187] As used herein, the term "wild type" refers to a typical form of an organism, strain, gene, or trait that occurs in nature, as distinguished from a variant or a variant, as understood by those of skill in the art. Thus, as used herein, when an amino acid or nucleotide sequence refers to a wild type sequence, a variant refers to a variant of that sequence, including, for example, a substitution, deletion, or insertion. In some embodiments of the invention, the modified CRISPR nuclease is a variant of a CRISPR nuclease that includes at least one amino acid modification (e.g., a substitution, deletion, and / or insertion) compared to any of the CRISPR nucleases shown in Table 1.

[0188] The terms "non-natural," "non-naturally occurring," or "artificial" are used interchangeably and refer to human modification. When used with respect to a nucleic acid molecule or polypeptide, the term may mean that the nucleic acid molecule or polypeptide is at least substantially free from at least one component with which it is naturally associated in nature and which is found in nature.

[0189] As used herein, the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine and its D or I optical isomers, as well as amino acid analogs and peptidomimetics.

[0190] As used herein, "genomic DNA" refers to a sequence of linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA present in a cell or cells of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a prokaryotic cell. In some embodiments, the method creates a double-strand break (DSB) at a predetermined target site in the genomic DNA sequence, resulting in a mutation, insertion and / or deletion of the DNA sequence at the target site in the genome.

[0191] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells.

[0192] As used herein, the term "nuclease" refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases may be isolated or derived from natural sources. The natural source may be any organism. Alternatively, nucleases may be modified or synthetic proteins that have phosphodiester bond cleavage activity.

[0193] As used herein, the term "PAM" refers to a nucleotide sequence in a target DNA that is located adjacent to the target DNA sequence and that is recognized by a CRISPR nuclease. The PAM sequence may vary depending on the nuclease.

[0194] As used herein, the term "mutation disorder" or "mutation disease" refers to a disorder or disease associated with a dysfunction of a gene caused by a mutation. A dysfunctional gene that manifests as a mutation disorder contains a mutation in at least one of its alleles and is called a "disease-associated gene". The mutation may be in any part of the disease-associated gene, for example, a regulatory part, a coding part, or a non-coding part. The mutation may be a substitution, an insertion, or a deletion mutation. The mutation of the disease-associated gene may manifest as a disorder or disease according to any mutation mechanism, such as a recessive, dominant negative, a gain-of-function, a loss-of-function, or a mutation that leads to haploinsufficiency of the gene product.

[0195] One of skill in the art will appreciate that embodiments of the present invention disclose RNA molecules that can form complexes with nucleases, such as CRISPR nucleases, that bind to a target genomic DNA sequence of interest adjacent to a protospacer adjacent motif (PAM). The nuclease then generates a double-stranded break within the protospacer via cleavage of the target DNA.

[0196] In some embodiments of the present invention, the CRISPR nuclease and the targeting molecule form a CRISPR complex that binds to and cleaves the target DNA sequence. The CRISPR nuclease may form a CRISPR complex comprising the CRISPR nuclease and an RNA molecule without a further separate tracrRNA molecule. Alternatively, the CRISPR nuclease may form a CRISPR complex between the CRISPR nuclease, the RNA molecule and the tracrRNA molecule.

[0197] The term "protein binding sequence" or "nuclease binding sequence" refers to a sequence that can bind to CRISPR nuclease to form a CRISPR complex. Those skilled in the art will understand that a tracrRNA that can bind to CRISPR nuclease to form a CRISPR complex includes a protein or nuclease binding sequence.

[0198] The "RNA binding portion" of a CRISPR nuclease refers to the portion of the CRISPR nuclease that may bind to an RNA molecule to form a CRISPR complex, e.g., the nuclease binding sequence of a tracrRNA molecule. The "active portion" of a CRISPR nuclease refers to the portion of the CRISPR nuclease that makes a double-stranded break in a DNA molecule, e.g., when complexed with a DNA-targeting RNA molecule.

[0199] The RNA molecule may comprise a sequence sufficiently complementary to the tracrRNA molecule to hybridize to the tracrRNA by base pairing and promote the formation of a CRISPR complex (e.g., U.S. Patent No. 8,906,616). In some embodiments of the invention, the RNA molecule may further comprise a tracr mate sequence.

[0200] In some embodiments of the invention, the targeting molecule may further comprise the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of a guide portion of an RNA molecule (gRNA or crRNA) and a transactivating crRNA (tracrRNA) forming a single guide RNA (sgRNA) (see Jinek et al., Science (2012)). Some embodiments of the invention may utilize a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion to form a CRISPR complex. In such embodiments, the tracrRNA molecule may hybridize to the RNA molecule by base pairing, which may be advantageous in certain applications of the invention described herein.

[0201] In embodiments of the invention, the RNA molecule may contain "nexus" regions and / or "hairpin" regions that may further specify the structure of the RNA molecule (see Briner et al., Molecular Cell (2014)).

[0202] As used herein, the term "direct repeat" refers to two or more repeats of a particular amino acid sequence of a nucleotide sequence.

[0203] As used herein, an RNA sequence or molecule that can "interact with" or "bind to" a CRISPR nuclease refers to the ability of the RNA sequence or molecule to form a CRISPR complex with a CRISPR nuclease.

[0204] As used herein, the term "operably linked" refers to a relationship (i.e., fusion, hybridization) between two sequences or molecules that allows them to function in their intended manner. In embodiments of the invention, when an RNA molecule is operably linked to a promoter, the RNA molecule and the promoter can function in their intended manner.

[0205] As used herein, the term "heterologous promoter" refers to a promoter that is not naturally found co-located with the molecule being expressed or in the pathway being promoted.

[0206] As used herein, a sequence or molecule has X% "sequence identity" with respect to another sequence or molecule if X% of the bases or amino acids between the sequences of the molecules are the same and in the same relative positions. For example, a first nucleotide sequence that has at least 95% sequence identity with a second nucleotide sequence has at least 95% of the bases in the same relative positions as the other sequence.

[0207] nuclear localization sequence The terms "nuclear localization sequence" and "NLS" are used interchangeably to refer to an amino acid sequence / peptide that directs the transport of an associated protein from the cytoplasm across the nuclear membrane barrier. The term "NLS" is intended to encompass not only a specific peptide nuclear localization sequence, but also derivatives thereof that can direct the translocation of cytoplasmic polypeptides across the nuclear membrane barrier. An NLS can direct nuclear translocation of a polypeptide when attached to the N-terminus, C-terminus, or both the N-terminus and C-terminus of the polypeptide. Additionally, polypeptides with an NLS linked at the N-terminus or C-terminus to the side chain of an amino acid randomly located in the amino acid sequence of the polypeptide are translocated. Typically, an NLS is composed of one or more short sequences of positively charged lysines or arginines exposed on the protein surface, although other types of NLS are known. Non-limiting examples of NLSs include NLS sequences derived from SV40 virus large T antigen, nucleoplasmin, c-myc, hRNPA1 M9 NLS, the IBB domain from importin alpha, sarcoma T protein, human p53, mouse c-abl IV, influenza virus NS1, hepatitis virus delta antigen, mouse Mx1 protein, human poly(ADP-ribose) polymerase and steroid hormone receptor (human) glucocorticoid.

[0208] delivery The CRISPR nuclease or CRISPR composition of the present application may be delivered as a protein, a DNA molecule, an RNA molecule, a ribonucleoprotein (RNP), a nucleic acid vector, or a combination thereof. In some embodiments, the RNA molecule comprises a chemical modification. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl-3'-phosphorothioate (MS) or 2'-O-methyl-3'-thioPACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility is a separate aspect of this invention.

[0209] The CRISPR nuclease of the present application and / or the polynucleotide encoding same, and optionally additional proteins (e.g., ZFPs, TALENs, transcription factors, restriction enzymes) and / or nucleotide molecules such as guide RNAs, may be delivered to a target cell by suitable means. A target cell may be any cell, such as a eukaryotic or prokaryotic cell, in any environment, whether isolated or not, in culture, in vitro, ex vivo, in vivo or in planta.

[0210] In some embodiments, the composition delivered comprises a nuclease mRNA and a guide RNA. In some embodiments, the composition delivered comprises a nuclease mRNA, a guide RNA, and a donor template. In some embodiments, the composition delivered comprises a CRISPR nuclease and a guide RNA. In some embodiments, the composition delivered comprises a CRISPR nuclease, a guide RNA, and a donor template for gene editing, e.g., by homology-directed repair. In some embodiments, the composition delivered comprises a nuclease mRNA, a DNA targeting RNA, and a tracrRNA. In some embodiments, the composition delivered comprises a nuclease mRNA, a DNA targeting RNA, a tracrRNA, and a donor template. In some embodiments, the composition delivered comprises a CRISPR nuclease, a DNA targeting RNA, and a tracrRNA. In some embodiments, the composition delivered comprises a CRISPR nuclease, a DNA targeting RNA, and a tracrRNA. In some embodiments, the composition delivered comprises a CRISPR nuclease, a DNA targeting RNA, a tracrRNA, and a donor template for gene editing, e.g., by homology-directed repair.

[0211] The RNA composition can be delivered using a suitable viral vector system. Conventional viral and non-viral based gene transfer methods can be used to introduce the nucleic acid and / or CRISPR nuclease into cells (e.g., mammalian cells, plant cells, etc.) and target tissues. Such methods can also be used to administer the in vitro encoded nucleic acid and / or CRISPR nuclease protein to cells. In some embodiments, the nucleic acid and / or CRISPR nuclease is administered for in vivo or ex vivo gene therapy. Non-viral vector delivery systems include naked nucleic acid and nucleic acid complexed with a delivery vehicle such as liposomes or poloxamers. For reviews of gene therapy procedures, see Anderson, Science (1992); Nabel and Felgner, TIBTECH (1993); Mitani and Caskey, TIBTECH (1993); Dillon, TIBTECH (1993); Miller, Nature (1992); Van Brunt, Biotechnology (1988); Vigne et al., Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer and Perricaudet, British Medical Bulletin (1995); Haddada et al., Current Topics in Microbiology and Immunology (1995), and Yu et al., Gene Therapy 1:13-26 (1994).

[0212] Non-viral methods of delivery of nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, artificial virions, and drug-enhanced nucleic acid uptake, or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, Tobacco Mosaic Virus, Potato Virus X, Cauliflower Mosaic Virus, Cassava Vein Mosaic Virus). See, e.g., Chung et al. Trends Plant Sci. (2006). Sonoporation, e.g., using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also contemplated as an in vivo or in vitro delivery method, see Zuris et al., Nat. Biotechnol. (2015), Coelho et al., N. Engl. J. Med. (2013); Judge et al., Mol. Ther. (2006) and Basha et al., Mol. Ther. (2011).

[0213] Non-viral vectors, such as transposon-based systems (e.g., recombinant Sleeping Beauty transposon system or recombinant PiggyBac transposon system), may also be used to deliver to target cells and transfer the polynucleotide sequences of, or polynucleotide sequences encoding, the molecules of the composition in the target cells.

[0214] Other representative nucleic acid delivery systems include those provided by Amaxa® Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc. (see, e.g., U.S. Pat. No. 6,008,336). Lipofectin is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam®, Lipofectin®, and Lipofectamine® RNAiMAX). Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those disclosed in WO 91 / 17424 and WO 91 / 16024. Delivery to cells (ex vivo administration) or target tissues (in vivo administration) is possible.

[0215] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is widely known to those of skill in the art (see, e.g., Crystal, Science (1995); Blaese et al., Cancer Gene Ther. (1995); Behr et al., Bioconjugate Chem. (1994); Remy et al., Bioconjugate Chem. (1994); Gao and Huang, Gene Therapy (1995); Ahmad and Allen, Cancer Res., (1992); U.S. Pat. Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028 and 4,946,787).

[0216] Another delivery method involves using packaging of the nucleic acid to be delivered in an EnGeneIC delivery vehicle (EDV). The EDV is delivered specifically to the target tissue using a bispecific antibody, where one arm of the antibody has specificity for the target tissue and the other arm has specificity for the EDV. The antibody carries the EDV to the surface of the target cell, where it is then carried into the cell by endocytosis. Once inside the cell, the contents are released (see MacDiamid et al., Nature Biotechnology (2009)).

[0217] The use of RNA or DNA virus-based systems for delivering nucleic acids utilizes highly evolved methods to target viruses to specific cells in the body and transport the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo). RNA or DNA virus-based systems for delivering nucleic acids include, but are not limited to, recombinant retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, vaccinia viruses and herpes simplex virus vectors for gene transfer. However, RNA viruses are preferred for delivery of the RNA compositions of the present application. Also, high transduction efficiency has been observed in various cells and target tissues. The nucleic acids of the present invention may be delivered by non-integrating lentiviruses. Optionally, lentivirus-based RNA delivery is utilized. In some cases, the lentivirus includes a nuclease mRNA, a guide RNA. In some cases, the lentivirus includes a nuclease mRNA, a guide RNA and a donor template. In some cases, the lentivirus comprises a nuclease protein, a guide RNA. In some cases, the lentivirus comprises a nuclease protein, a guide RNA, and / or a donor template for gene editing, for example, by homology-directed repair. In some cases, the lentivirus comprises a nuclease mRNA, a DNA targeting RNA, and a tracrRNA. In some cases, the lentivirus comprises a nuclease mRNA, a DNA targeting RNA, a tracrRNA, and a donor template. In some cases, the lentivirus comprises a nuclease protein, a DNA targeting RNA, and a tracrRNA. In some cases, the lentivirus comprises a nuclease protein, a DNA targeting RNA, and a tracrRNA. In some cases, the lentivirus comprises a nuclease protein, a DNA targeting RNA, a tracrRNA, and a donor template for gene editing, for example, by homology-directed repair.

[0218] As previously described, the compositions of the present application can be delivered to target cells using non-integrating lentiviral particle methods (e.g., the LentiFlash® system). Such methods may be used to deliver mRNA or other RNA to target cells, such that delivery of the RNA to the target cell results in assembly of the compositions of the present application inside the target cell. See also WO 2013 / 014537, WO 2014 / 016690, WO 2016 / 185125, WO 2017 / 194902, WO 2017 / 194903.

[0219] Retroviral tropism can be altered by incorporating foreign envelope proteins, expanding the potential target cell targeting. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and usually produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats that can package up to 6-10 kb of foreign sequences. A minimal number of cis-acting LTRs are sufficient for vector replication and packaging, which are then used to integrate therapeutic genes into target cells and provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher Panganiban, J. Virol. (1992); Johann et al., J. Virol. (1992); Sommerfelt et al., Virol. (1990); Wilson et al., J. Virol. (1989); Miller et al., J. Virol. (1991); WO 94 / 26877).

[0220] At least six viral vector approaches are currently available for gene transfer in clinical trials, using methods involving complementation of a defective vector by a gene inserted into a helper cell line to generate the transducing agent.

[0221] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al., Blood (1995);Kohn et al., Nat. Med. (1995);Malech et al., PNAS (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy (Blaese et al., Science (1995)). Transduction efficiencies of over 50% have been observed with MFG-S packaged vectors (Ellem et al., Immunol Immunother. (1997);Dranoff et al., Hum. Gene Ther. (1997)).

[0222] Packaging cells are used to form viral particles capable of infecting host cells. Such cells include 293 cells, which package adenovirus AAV, and psi.2 or PA317 cells, which package retrovirus. Viral vectors for use in gene therapy are usually obtained by producer cell lines that package nucleic acid vectors into viral particles. The vectors usually contain the minimal viral sequences required for packaging and subsequent integration into the host (if applicable), other viral sequences being replaced by expression cassettes that code for the proteins to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors for use in gene therapy usually only possess the terminal inverted repeat (ITR) sequences of the AAV genome, which are required for packaging and integration into the host genome. The viral DNA is packaged in a cell line that contains a helper plasmid that codes for other AAV genes, namely rep and cap, but lacks the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates the replication of the AAV vector and the expression of the AAV genes from the helper plasmid. The helper plasmid is not packaged in large quantities because it lacks ITR sequences. Contamination with adenovirus can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. Furthermore, AAV can be produced on a clinical scale using the baculovirus system (see U.S. Patent No. 7,479,554).

[0223] In many gene therapies, it is desirable for the gene therapy vector to be delivered with high specificity to a particular tissue. Thus, viral vectors can be modified to have specificity for cells of interest by expressing a ligand on the outer surface of the virus as a fusion protein with the viral coat protein. The ligand is selected to have affinity for a receptor known to be present on the cells of interest. For example, Han et al., Proc. Natl. Acad. Sci. USA (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, where the target cell expresses a receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be modified to display antibody fragments (e.g., FAB or Fv) with specific binding affinity for virtually any cellular receptor. Although this discussion applies primarily to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be modified to contain uptake sequences that facilitate uptake by specific target cells.

[0224] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous or intracranial injection) or local application as described below. Alternatively, vectors can be delivered ex vivo to cells, such as transplanted cells (e.g., lymphocytes, bone marrow aspirates, biopsy tissue) from an individual patient or hematopoietic stem cells from a universal donor, which are then re-implanted into the patient, typically after selection of cells that have incorporated the vector. In some embodiments, in vivo and ex vivo delivery of mRNA, as well as delivery of RNPs, may be utilized.

[0225] Ex vivo cell transfection for diagnostics, research, or gene therapy (e.g., by re-injection of the transfected cells into the host organism) is well known to those of skill in the art. In a preferred embodiment, cells are isolated from a subject organism, transfected with an RNA composition, and re-injected into the subject organism (e.g., a patient). A variety of cells suitable for ex vivo transfection are well known to those of skill in the art (see, e.g., Freshney, "Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications" (6th edition, 2010) and references cited therein for a discussion of how to isolate and culture cells from a patient).

[0226] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T) and perC6 cells, any plant cell (differentiated or undifferentiated), as well as insect cells such as Spodoptera fugiperda (Sf), or fungal cells such as Saccharomyces, Pichia and chizosaccharomyces. In some embodiments, the cell line is a CHO-K1, MDCK or HEK293 cell line. Additionally, primary cells may be isolated and treated with a nuclease (e.g., ZFN or TALEN) or nuclease system (e.g., CRISPR) and then used ex vivo for reintroduction into the subject. Suitable primary cells include peripheral blood mononuclear cells (PBMCs) and blood cell subsets, such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells, such as, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neural stem cells and mesenchymal stem cells.

[0227] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage of using stem cells is that they can be differentiated in vitro into other cell types or introduced into a mammal (such as a cell donor) where they engraft in the bone marrow. Methods are known for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such as GM-CSF, IFNγ, and TNFα (see, for non-limiting examples, Inaba et al., J. Exp. Med. (1992)).

[0228] Stem cells are isolated for transduction and differentiation by known methods. For example, stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies that bind to unwanted cells such as CD4+ and CD8+ (T cells), CD45+ (pan B cells), GR-1 (granulocytes), and Iad (differentiated antigen presenting cells) (see, for non-limiting examples, Inaba et al., J. Exp. Med. (1992)). In some embodiments, modified stem cells can also be used.

[0229] In particular, the CRISPR nucleases of the present application may be suitable for genome editing of post-mitotic cells or cells that are not actively dividing (e.g., arrested cells). Examples of post-mitotic cells that may be edited using the CRISPR nucleases of the present invention include, but are not limited to, muscle cells, cardiomyocytes, liver cells, bone cells, and neurons.

[0230] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic RNA compositions can also be administered directly to an organism for transduction of cells in vivo. Alternatively, naked RNA or mRNA can be administered. Administration is by routes including, but not limited to, injection, infusion, topical application, and electroporation, which are commonly used to introduce molecules with eventual contact with blood or tissue cells. Suitable methods of administering such nucleic acids are available and known to those of skill in the art, and although multiple routes of administration of a particular composition can be used, certain routes often result in more rapid and effective responses than others.

[0231] Suitable vectors for introducing transgenes into immune cells (e.g., T cells) include non-integrating lentiviral vectors, see, e.g., U.S. Patent Application Publication No. 2009 / 0117617.

[0232] Pharmaceutically acceptable carriers are determined in part by the composition being administered, as well as by the method used to administer the composition. Thus, there is a wide variety of suitable formulations of pharmaceutical compositions available, see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989.

[0233] DNA repair by homologous recombination The term "homologous recombination repair" or "HDR" refers to a mechanism that repairs DNA damage in cells, for example, during repair of double-stranded and single-stranded breaks in DNA. HDR requires nucleotide sequence homology and uses a "nucleic acid template" (nucleic acid template or donor template, used interchangeably herein) to repair a sequence (e.g., a DNA target sequence) where a double-stranded or single-stranded break has occurred. This results, for example, in the transfer of genetic information from the nucleic acid template to the DNA target sequence. If the nucleic acid template sequence differs from the DNA target sequence and some or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR can lead to alterations of the DNA target sequence (e.g., insertions, deletions, mutations). In some embodiments, all or a portion of the nucleic acid template polynucleotide, or a copy of the nucleic acid template, is incorporated at the site of the DNA target sequence.

[0234] The terms "nucleic acid template" and "donor" refer to a nucleotide sequence to be inserted or copied into a genome. A nucleic acid template comprises a sequence of, e.g., one or more nucleotides that may be added to a target nucleic acid, template a change in a target nucleic acid, or be used to modify a target sequence. The length of the nucleic acid template sequence may be any length, e.g., 2-10,000 nucleotides (or any integer therebetween or greater), preferably about 100-1,000 nucleotides (or any integer therebetween), more preferably about 200-500 nucleotides. A nucleic acid template may be a single-stranded nucleic acid, a double-stranded nucleic acid. In some embodiments, a nucleic acid template comprises a sequence of, e.g., one or more nucleotides, corresponding to a wild-type sequence of a target nucleic acid, e.g., at a target location. In some embodiments, a nucleic acid template comprises a sequence of, e.g., one or more ribonucleotides, corresponding to a wild-type sequence of a target nucleic acid, e.g., at a target location. In some embodiments, a nucleic acid template comprises modified ribonucleotides.

[0235] Insertion of exogenous sequences (also referred to as "donor sequences", "donor templates" or "donors") can also be performed, for example, to correct a mutant gene or increase expression of a wild-type gene. It is readily apparent that a donor sequence is not usually identical to the genomic sequence in which it is placed. A donor sequence can include a non-homologous sequence flanked by two homologous regions to allow efficient HDR at a target location. Additionally, a donor sequence can include a vector molecule that includes a sequence that is not homologous to a target region in cellular chromatin. A donor molecule can include discontinuous regions that are homologous to cellular chromatin. For example, to target insertion of a sequence that is not normally present in a target region, the sequence can be present in a donor nucleic acid molecule and can be flanked by regions that are homologous to a sequence of the target region.

[0236] The donor polynucleotide may be single-stranded and / or double-stranded DNA or RNA, and may be introduced into cells in linear or circular form. See, for example, US Patent Application Publication Nos. 2010 / 0047805; 2011 / 0281361; 2011 / 0207221 and 2019 / 0330620. When introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues are added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang and Wilson, Proc. Natl. Acad. Sci. USA (1987); Nehls et al., Science (1996). Other methods of protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified internucleotide linkages (e.g., phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues).

[0237] Thus, the embodiment of the present invention using a donor template for repair may use DNA or RNA, which is a single-stranded and / or double-stranded donor template that can be introduced into cells in a linear or circular form. In an embodiment of the present invention, the gene editing composition comprises (1) an RNA molecule comprising a guide sequence that makes a double-stranded break in the gene before repair, and (2) a donor RNA template for repair, where the RNA molecule comprising the guide sequence is a first RNA molecule and the donor RNA template is a second RNA molecule. In some embodiments, the guide RNA molecule and the template RNA molecule are linked as part of one molecule.

[0238] The donor sequence may be an oligonucleotide and may be used for gene correction or targeted modification of an endogenous sequence. The oligonucleotide may be introduced into the cell by a vector, electroporated into the cell, or by other methods known in the art. The oligonucleotide may be used to "correct" a mutant sequence in an endogenous gene (e.g., the sickle mutation of beta globin) or may be used to insert a sequence at an endogenous locus for a desired purpose.

[0239] Polynucleotides can be introduced into cells as part of a vector molecule that contains additional sequences such as, for example, an origin of replication, a promoter, and genes encoding antibiotic resistance. Additionally, donor polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome, poloxamer, or delivered by recombinant virus (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0240] The donor is generally inserted such that its expression is driven by the endogenous promoter of the integration site, i.e., the promoter that drives expression of the endogenous gene into which the donor is inserted. However, it will be apparent that the donor may also include a promoter and / or enhancer, e.g., a constitutive promoter or an inducible or tissue-specific promoter.

[0241] The donor molecule may be inserted into an endogenous gene such that all or a portion of the endogenous gene is expressed, or none of the endogenous gene is expressed. For example, a transgene of the present application may be inserted into an endogenous locus such that a portion of the endogenous sequence (the N-terminus and / or C-terminus of the transgene) is expressed, or none of the endogenous sequence is expressed, e.g., as a fusion with the transgene. In other embodiments, the transgene (with or without additional coding sequences, e.g., an endogenous gene) is integrated into any endogenous locus, such as a safe harbor locus (e.g., the CCR5 gene, the CXCR4 gene, the PPP1R12c (also known as AAVS1) gene, the albumin gene, or the Rosa gene). See, e.g., U.S. Patent Nos. 7,951,925 and 8,110,379; U.S. Patent Application Publication Nos. 2008 / 0159996; 20100 / 0218264; 2010 / 0291048; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983 and 2013 / 0177960, and U.S. Provisional Application No. 61 / 823,689).

[0242] When an endogenous sequence (endogenous or part of a transgene) is expressed along with a transgene, the endogenous sequence may be a full-length sequence (wild-type or mutant) or a partial sequence. Preferably, the endogenous sequence is functional. Non-limiting examples of functions of these full-length or partial sequences include increasing the half-life of a polypeptide expressed by the transgene (e.g., a therapeutic gene) and / or acting as a carrier.

[0243] In addition, although not essential for expression, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as a promoter, an enhancer, an insulator, an internal ribosome entry site, a sequence encoding a 2A peptide, and / or a polyadenylation signal.

[0244] In one embodiment, the donor molecule comprises a sequence selected from the group consisting of a gene encoding a protein (e.g., a coding sequence encoding a protein that is missing in a cell or individual, or an alternative version of a gene encoding a protein), a regulatory sequence, and / or a sequence encoding a structural nucleic acid such as a microRNA or siRNA.

[0245] It is intended that the embodiments described above are applicable to each other, for example, it is understood that an RNA molecule or composition of the invention may be utilized in a method of the invention.

[0246] In this specification, all headings are for organizational purposes only and are not intended to limit the disclosure in any way. The content of each section is equally applicable to all sections.

[0247] Additional objects, advantages, and novel features of the present invention will become apparent to those skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various aspects and aspects of the present invention as described hereinabove and as claimed in the appended claims is found to be experimentally supported in the following examples.

[0248] It will be understood that features of the invention that are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in the context of a single embodiment, may also be provided separately, in any suitable subcombination, or in any other embodiment of the invention, as appropriate. Certain features described in the context of various embodiments should not be construed as essential features of those embodiments, unless the embodiment is inoperable without those elements.

[0249] Generally, the nomenclature used herein and the laboratory procedures utilized in this invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully described in the literature. See, e.g., Sambrook et al., "Molecular Cloning: A laboratory Manual" (1989); Ausubel, RM (Ed.), "Current Protocols in Molecular Biology" Volumes I-III (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (Eds.), "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York. (1998); the methods set forth in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cellis, JE (Ed.), "Cell Biology: A Laboratory Handbook", Volumes I-III (1994); Freshney, "Culture of Animal Cells - A Manual of Basic Technique" Third Edition, Wiley-Liss, NY (1994); Coligan JE (Ed.), "Current Protocols in Immunology" Volumes I-III (1994); Stites et al. (Eds.), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994);Mishell and Shiigi (Eds.), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996);Clokie and Kropinski (Eds.), "Bacteriophage Methods and Protocols", Volume 1: Isolation, Characterization, and Interactions (2009), all of which are incorporated by reference. Other general references are provided throughout this specification.

[0250] In order to facilitate a more complete understanding of the present invention, the following examples are provided to illustrate representative modes of making and practicing the present invention. However, the scope of the invention is not limited to the specific embodiments disclosed in these examples, which are intended for illustrative purposes only. EXAMPLES

[0251] Experimental details In order to facilitate a more complete understanding of the present invention, the following examples are presented, which illustrate exemplary modes of making and practicing the invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only.

[0252] CRISPR repeat (crRNA), trans-activating RNA (tracrRNA), nuclease polypeptide (OMNI) and protospacer adjacent motif (PAM) sequences were predicted from various metagenomic databases of sequences from environmental samples.

[0253] Construction of OMNI nuclease polypeptides To construct novel nuclease polypeptides (OMNIs), several OMNI open reading frames were codon-optimized for expression in human cell lines. The ORFs were cloned into the bacterial expression plasmid pET9a and the mammalian expression plasmid pmOMNI (Table 4).

[0254] sgRNA prediction and construction For each OMNI, single guide RNAs (sgRNAs) were predicted by detecting CRISPR repeats and transactivating crRNAs in the respective bacterial genomes. In silico, the native and immature crRNA and tracrRNA sequences were connected with the tetraloop "gaaa" and the secondary structure elements of the duplex were predicted using an RNA secondary structure prediction tool.

[0255] The predicted secondary structures of the entire duplex RNA element (crRNA-tracrRNA chimera) were used to identify possible tracrRNA sequences for the design of sgRNA. Possible sgRNA scaffolds were constructed by shortening the duplex at different positions in the upper stem (sgRNA designs for all OMNIs are shown in Table 2). Furthermore, small modifications were made to the nucleotide sequences of possible sgRNAs in some cases to overcome transcriptional and structural constraints and evaluate the plasticity of sgRNA scaffolds in human cells (Figure 1, Table 2). Finally, for each OMNI, up to three versions of the designable scaffolds were synthesized, connected downstream with a universal and unique spacer sequence of 22 nucleotides (T2, SEQ ID NO: 268), and cloned into a bacterial expression plasmid (pShuttleGuide, Table 4) under an inducible T7 promoter combined with a U6 promoter for mammalian expression. T2 - GGAAGAGCAGAGCCTTGGTCTC (SEQ ID NO: 268)

[0256] In vitro depletion assay with TXTL Depletion of PAM sequences in vitro was tracked as described in Maxwell et al., Methods. 2018. Briefly, linear DNA expressing OMNI nuclease and sgRNA under a T7 promoter were added to a cell-free transcription-translation in vitro system (TXTL mix, Arbor Bioscience) along with a linear construct expressing T7 polymerase. RNA expression and protein translation in the TXTL mix results in the formation of an RNP complex. Because linear DNA was used, Chi6 DNA sequences were added to the TXTL reaction mix to inhibit the exonuclease activity of RecBCD and protect the linear DNA from degradation. The sgRNA spacer was designed to target a library of plasmids containing a targeted protospacer (pbPOST2 library, Table 4) flanked by an 8N randomized set of PAM sequences. PCR was used to add the necessary adaptors and indexes to both the truncated library and a control library expressing a non-targeting gRNA, and depletion of PAM sequences from the library was measured by high-throughput sequencing. After deep sequencing, in vitro activity was confirmed by the percentage of depleted sequences with the same PAM sequence compared to their appearance in the control, indicating functional DNA cleavage by OMNI nuclease (Figures 2-18, Table 3).

[0257] Activity against endogenous genomic targets in human cells The ability of OMNIs to promote editing of specific locations of the genome in human cells was also assayed. For this purpose, for each OMNI, the corresponding OMNI-P2A-mCherry expression vector (Table 4) was transfected into HeLa cells together with sgRNAs designed to target specific locations of the human genome (pShuttle guide - Table 4, spacer sequence - Table 5). After 72 hours, cells were harvested. Half of the resulting cells were used for quantification of transfection efficiency by FACS using mCherry fluorescence as a marker. The other half of the resulting cells were lysed and their genomic DNA was used to PCR amplify the corresponding putative genomic targets. The amplicons were next-generation sequenced (NGS) and the resulting sequences were used to calculate the editing rate at each target site. Short insertions or deletions (indels) around the cut site are a typical outcome of repair of DNA ends after DNA cleavage by nucleases. Therefore, the calculation of the editing rate was estimated from the percentage of indel containing sequences within each amplicon.

[0258] Genomic activity of each OMNI was assessed using a panel of at least six sgRNAs, each designed to target a different genomic location. The results of these experiments are summarized in Table 5. As can be seen from this table (column 6, "Indel Rate"), several OMNIs had significant high levels of editing at most or a portion of the target sites tested.

[0259] Another consequence of OMNI-127 as part of the RNP complex Purification of OMNI-127 protein OMNI-127 constructs in pET28a were expressed in BL-21 cells (NEB). Cells were grown in AIM+0.4% glycerol and expressed for 23 hours at 37°C. Cells were chemically lysed and the clear lysate was purified with Ni-NTA resin. Ni-NTA eluted fractions were purified with CEX (SO3 Fractogel) resin followed by SEC purification with Superdex® 200 Increase 10 / 300 GL, AKTA Pure (GE Healthcare Life Sciences). Fractions with OMNI-127 protein were pooled, concentrated to 25mg / ml, flash frozen in liquid nitrogen and stored at -80°C.

[0260] Cleavage activity of OMNI-127RNP in vitro OMNI-127 sgRNA was synthesized with three 2'-O-methyl 3'-phosphorothioates (Agilent) at the 3' and 5' ends.

[0261] The activity of OMNI-127 RNP was analyzed in vitro using the ELANEg135 guide (Table 6, Figure 2A). Briefly, 10 pmol of OMNI-127 nuclease was mixed with 20 pmol of the synthesized guide. After 10 min of incubation at room temperature, the RNP complex was serially diluted to 4, 2, 1, and 0.5 pmol and reacted with 40 ng of linear DNA template prepared by amplifying the ELANEg135 target from extracted genomic DNA. OMNI-127 completely cleaved the ELANE template, indicating high cleavage activity (Figure 19A).

[0262] Guide optimization of OMNI-127 by RNP editing activity in U2OS cells Spacer length was optimized in mammalian cells. RNPs were assembled by mixing 120uM synthetic guides of various spacer lengths (20-24 nucleotides, Table 6) and 100uM Cas9 electroporation enhancer (IDT) with 100uM nuclease. After 10 minutes of incubation at room temperature, the RNP complexes were mixed with 200,000 pre-washed U2OS cells and electroporated using a Lonza SE Cell Line 4D-NucleofectorTM X Kit with DN100 according to the manufacturer's protocol. 72 hours after electroporation, cells were lysed and genomic DNA was extracted. The corresponding genomic targets were amplified by PCR. Amplicons were subjected to next-generation sequencing (NGS) and the resulting sequences were used to calculate the editing rate. As can be seen from Figure 19B and Table 7, OMN1-127 had high editing levels at all spacer lengths.

[0263] OMNI-127 editing activity as part of an RNP complex in human cells Activity of OMNI-127 protein as part of the RNP complex was observed in U2OS cells (Table 7, Figure 19C) and comparable activity was observed in HSC-MLP2 cells (Table 8). For HSC experiments, RNPs were assembled by mixing 120 uM synthetic guides (Table 6) and 100 uM Cas9 electroporation enhancer (IDT) with 100 uM nuclease. After 10 min incubation at room temperature, the RNP complex was mixed with 250,000 pre-washed HSC-MLP2 cells and electroporated using the Lonza P3 Cell Line 4D-NucleofectorTM X Kit with CA137 according to the manufacturer's protocol. After 72 hours, cells were lysed and genomic DNA targets were amplified by PCR. Amplicons were NGSed and the resulting sequences were used to calculate the editing rate. OMNI-127 was tested with ELANE-g135 and g136 guides. OMNI-127 showed edits in two ELANE guides (g135, g136).

[0264] [Table 1-1]

[0265]

Table 1-2

[0266]

Table 2-1

[0267]

Table 2-2

[0268]

Table 2-3

[0269]

Table 2-4

[0270]

Table 2-5

[0271]

Table 2-6

[0272]

Table 3

[0273]

Table 4

[0274]

Table 5-1

[0275]

Table 5-2

[0276]

Table 6

[0277]

Table 7

[0278]

Table 8

[0279] References 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20. 2. Anderson (1992) “Human gene therapy”, Science 256:808-13. 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200. 4. Behr (1994) “Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89. 5. Blaese et al. (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97. 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80. 7. Briner et al. (2014) “Guide RNA functional modules direct Cas9 activity and orthognality”, Molecular Cell 56:333-39. 8. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39. 9. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41. 10. Canver et al., (2015) "BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis", Nature Vol. 527, Pgs. 192-214. 11. Chang and Wilson (1987) “Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959-4963. 12. Charlesworth et al. (2019) “Identification of preexisting adaptive immunity to Cas9 proteins in humans”, Nature Medicine, 25(2), 249. 13. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1-4. 14. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med. 369, 819-829. 15. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10. 16. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173. 17. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1):111-23. 18. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57. 19. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20. 20. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22. 21. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Boehm, pp. 297-306. 22. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc. Natl. Acad. Sci. USA 92(21):9747-51. 23. Humbert et al., (2019) "Therapeutically relevant engraftment of a CRISPR-Cas9-edited HSC-enriched population with HbF reactivation in nonhuman primates", Sci. Trans. Med., Vol. 11, Pgs. 1-13. 24. Inaba et al. (1992) “Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte / macrophage colony-stimulating factor”, J Exp Med. 176(6):1693-702. 25. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”, Science 337(6096):816-21. 26. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40. 27. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505. 28. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23. 29. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44. 30. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51. 31. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38. 32. Maxwell et al. (2018) “A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer adjacent motifs”, Methods 14348-57 33. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24. 34. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60. 35. Mitani and Caskey (1993) “Delivering therapeutic genes - matching approach and application”, Trends in Biotechnology 11(5):162-66. 36. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15. 37. Nehls et al. (1996) “Two genetically separable steps in the differentiation of thymic epithelium” Science 272:886-889. 38. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54. 39. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598-018-19441-8. 40. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20. 41. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54. 42. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36. 43. Wagner et al. (2019) “High prevalence of Streptococcus pyogenes Cas9-reactive T cells within the adult human population” Nature Medicine, 25(2), 242 44. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78. 45. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26. 46. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71. 47. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80.

Claims

1. A non-naturally occurring composition comprising a CRISPR nuclease comprising a sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 1, or 2-17, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease.

2. 10. The composition of claim 1, further comprising one or more RNA molecules or a DNA polynucleotide encoding any one of said one or more RNA molecules, wherein said one or more RNA molecules and said CRISPR nuclease do not occur together in nature, and said one or more RNA molecules are configured to form a complex with said CRISPR nuclease and / or said one or more RNA molecules are configured to target said complex to a target site.

3. 3. The composition of claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:3, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs:82-97.

4. 4. The composition of claim 3, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:3, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:82-85 and 96.

5. 5. The composition of claim 4, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 86-93 and 97.

6. 3. The composition of claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:3, and wherein at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:82-97.

7. (A) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 52-64; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1; and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 52-55; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 56-63. (B) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 52-64; (C) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 65-81; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:2, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs:65-68 and 80; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 69-77 and 81. (D) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 65-81; (E) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NOs: 4-9, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 98-114; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NOs: 4-9, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 98-101 and 114; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 102-111. (F) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NOs: 4-9, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 98-114; (G) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 115-127; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 115-118; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 119-126. (H) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 10, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 115-127; (I) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 11, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 128-141; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 11, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 128-131; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 132-140. (J) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 11, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 128-141; (K) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 12, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 142-155; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 12, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 142-145; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 146-152 and 155. (L) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 12, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 142-155; (M) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 13, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 156-167 and GCUUUAAGC; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 13, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 156-159; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 160-166 and GCUUUAAGC. (N) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 13, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 156-167 and GCUUUAAGC; (O) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14 or 15, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 168-176; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14 or 15, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 168 and 169; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 170-175. (P) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 14 or 15, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 168-176; (Q) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 16, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 177-185; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 16, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 177 and 178; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 179-184. (R) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 16, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 177-185; (S) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 17, and at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 186-202; Optionally, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 17, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 186-189 and 201; Optionally, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 190-198 and 202. (T) the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 17, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of SEQ ID NOs: 186-202.

8. 8. The composition of any one of claims 1 to 7, wherein the CRISPR nuclease is a nickase having an inactivated RuvC domain made by amino acid substitutions in the CRISPR nuclease at the positions shown in column 5 of Table 1.

9. 8. The composition of any one of claims 1 to 7, wherein the CRISPR nuclease is a nickase having an inactivated HNH domain made by amino acid substitutions in the CRISPR nuclease at the positions shown in column 6 of Table 1.

10. 8. The composition of any one of claims 1 to 7, wherein the CRISPR nuclease is a catalytically inactive nuclease having an inactivated RuvC domain and an inactivated HNH domain made by substitutions of the CRISPR nuclease at the positions shown in column 7 of Table 1.

11. 8. The composition of any one of claims 1-7, wherein the CRISPR nuclease utilizes a protospacer adjacent motif (PAM) sequence as shown for CRISPR nucleases in columns 2-4 of Table 3.

12. A method for modifying the nucleotide sequence of a DNA target site in a cell-free system or in the genome of a cell, comprising introducing the composition of any one of claims 2 to 7 into the cell-free system or cell.

13. A method for modifying the nucleotide sequence of a DNA target site in a cell-free system or within the genome of a cell, comprising introducing into the cell-free system or a cell a composition of any one of claims 2 to 7, wherein the CRISPR nuclease cleaves the DNA strand adjacent to a CRISPR nuclease protospacer adjacent motif (PAM) sequence shown in columns 2 to 4 of Table 3 and / or cleaves the DNA strand adjacent to a sequence complementary to the PAM sequence. the CRISPR nuclease is a nickase having an inactivated RuvC domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 5 of Table 1, and cleaves the DNA strand adjacent to the sequence complementary to the PAM sequence; or wherein the CRISPR nuclease is a nickase having an inactivated HNH domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 6 of Table 1, and cleaves the DNA strand adjacent to the PAM sequence.

14. A method for modifying the nucleotide sequence of a DNA target site in a cell-free system or within the genome of a cell, comprising introducing a composition of any one of claims 2 to 7 into the cell-free system or the cell, wherein the cell is a eukaryotic or prokaryotic cell.

15. A method for modifying the nucleotide sequence of a DNA target site in a cell-free system or within the genome of a cell, comprising introducing a composition of any one of claims 2 to 7 into the cell-free system or cell, wherein the cell is a mammalian cell, and optionally the cell is a human cell.