Salmonella engineered for non-virulent colonization of tumors

JP2024533400A5Pending Publication Date: 2025-08-05REGENTS OF THE UNIVERSITY OF MINNESOTA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024515462
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-09-10
Filing Date
2022-09-09
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

Existing bacterial anticancer treatments, particularly those using Salmonella enterica Typhimurium, face challenges with tumor colonization and significant toxicity from systemic administration, limiting their efficacy in clinical settings.

Method used

Genetically engineered Salmonella strains with reduced toxicity are developed by modifying bacterial surface molecules to minimize interaction with mammalian toll-like receptors and expressing outer membrane proteases to inhibit complement activation, combined with systemic administration of immunomodulatory proteins to target the tumor microenvironment.

Benefits of technology

The engineered strains achieve non-toxic systemic delivery and robust tumor colonization, enabling effective anti-cancer immune responses with reduced systemic toxicity, as demonstrated in preclinical models of spontaneous tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein is the ability to deliver bacteria intravenously without septic side effects, and to deliver immunomodulatory proteins with systemic toxicity directly to the tumor microenvironment without any systemic toxicity.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to Salmonella bacteria engineered for non-virulent colonization of tumors. [Background technology]

[0002] Many of the bacterial anticancer therapies being developed rely on the ability of bacteria to specifically colonize tumors. Early attempts to translate preclinical findings with Salmonella enterica Typhimurium (S. Typhimurium) into a clinical setting failed primarily due to the lack of tumor colonization and significant toxicity of systemically administered Gram-negative bacteria. Summary of the Invention [Means for solving the problem]

[0003] Provided herein is a reduction in toxicity due to the interaction of bacterial surface molecules with receptors on mammalian cells. This is achieved by editing the bacterial genome to remove flagellin, fimbria, O antigen, and lipopolysaccharide proteins that bind to toll-like receptors on mammalian cells. In addition, the expression of outer membrane proteases that inhibit complement activation is increased. Furthermore, toxicity is reduced / eliminated by systemic administration of immune modulator proteins. This is achieved by bacterial strains that contain plasmids with gene cassettes for expressing and secreting proteins into the tumor microenvironment, resulting in anti-cancer immune responses with reduced systemic toxicity. Thus, provided herein is the ability to deliver bacteria intravenously without septic side effects, and to deliver immune modulator proteins with systemic toxicity directly to the tumor microenvironment without any systemic toxicity.

[0004] One embodiment provides an attenuated Salmonella cell comprising: a) a mutation or deletion in one or more Salmonella genes encoding cell surface proteins that induce IL-6 secretion, resulting in reduced or no expression of the one or more proteins; and, optionally, b) an increased expression of one or more outer membrane proteases that inhibit complement activation, and / or a decreased expression of cell surface lipopolysaccharide protein (LPS) compared to a control cell. In one embodiment, the cell is a S. Typhimurium cell. In one embodiment, the one or more Salmonella genes encode flagellin, fimbria, O antigen, and / or lipopolysaccharide protein (LPS). In another embodiment, the one or more Salmonella genes are fliC, fljB, fimH, and / or rfaL. In one embodiment, the one or more outer membrane proteases are PgtE.

[0005] One embodiment further comprises a deletion of the enterobacterial common antigen locus (eca). Another embodiment further comprises a deletion of the rpoS gene and / or an addition of the viaB locus. Another embodiment further comprises a deletion of one or more of the fljA, rflP, flgKL, and / or motAB genes. In some embodiments, the endogenous flhDP promoter of Salmonella is replaced with a tumor-specific expression promoter. In one embodiment, the tumor-specific expression promoter is FF+20 * A promoter.

[0006] In one embodiment, the cells comprise one or more exogenous immune regulator genes that express exogenous immune regulator proteins. In some embodiments, the immune regulator genes encode / express IL-12, IL-18, IL-15, CXCL9-10, αCTLA-4 single chain variable fragment (scFv), αPD-L1 scFv, αCTLA-4 single domain antibody (sdAb), αPD-L1 sdAb and / or αCD47 sdAb proteins. In one embodiment, the immune regulator proteins are secreted from the cells. In some embodiments, the one or more exogenous immune regulator genes are under the control of a tumor-specific expression promoter. In one embodiment, the tumor-specific expression promoter is FF+20 * It is.

[0007] One aspect provides a composition comprising a cell population described herein or a combination thereof and a pharma- ceutically acceptable carrier. One aspect provides a method of treating cancer, comprising administering to a subject in need thereof an effective amount of a cell population described herein, a combination thereof, or a composition described herein to treat the cancer.

[0008] One embodiment provides a method of inhibiting tumor growth / proliferation or reducing tumor volume / size, comprising administering to a subject in need thereof an effective amount of a cell population described herein, a combination thereof, or a composition described herein, so as to inhibit tumor growth or reduce tumor volume.

[0009] Another aspect provides a method of treating metastasis, reducing the formation / number of metastases, or inhibiting the spread of metastases, comprising administering to a subject in need thereof an effective amount of a cell population described herein, a combination thereof, or a composition described herein to treat metastasis, reduce the formation / number of metastases, or inhibit the spread of metastases.

[0010] In one embodiment, the tumor, cancer, or metastasis is a lung, liver, kidney, breast, prostate, pancreatic, colon, head and neck, ovarian, and / or gastrointestinal tumor, cancer, or metastasis. In another embodiment, the cells or compositions are administered systemically. In one embodiment, the cells are administered more than once. Another embodiment further comprises administering a vascular disrupting agent (VDA) and / or cannabidiol (CBD). In one embodiment, the VDA and / or CBD are administered before and / or during the treatment (after at least one administration of the cells). In some embodiments, the VDA and / or CBD are administered more than once. In one embodiment, the VDA is VDA combretastatin A4 phosphate and / or VDA CKD-516. In one embodiment, an anti-interleukin-6 (IL-6) is administered.

[0011] One aspect is a method of reducing virulence of Salmonella bacteria, the Salmonella bacteria comprising: a) a deletion of one or more Salmonella genes encoding cell surface proteins that induce IL-6 secretion, resulting in reduced or no expression of the one or more proteins; and, optionally, b) an increased expression of one or more outer membrane proteases that inhibit complement activation, and / or a decreased expression of cell surface lipopolysaccharide protein (LPS) compared to control cells. In one embodiment, the Salmonella bacteria is a S. Typhimurium cell. In one aspect, the one or more Salmonella genes encode flagellin, fimbriae, O antigen, and / or lipopolysaccharide protein (LPS). In another aspect, the one or more Salmonella genes are fliC, fljB, fimH, and / or rfaL. In one aspect, the one or more outer membrane proteases are PgtE. One embodiment further comprises a deletion of the enterobacterial common antigen locus (eca). Another embodiment further comprises a deletion of the rpoS gene and / or the addition of the viaB locus. A further embodiment comprises a deletion of one or more of the fljA, rflP, flgKL, and / or motAB genes. In one embodiment, the flhDP promoter is replaced with a tumor-specific expression promoter. In another embodiment, the tumor-specific expression promoter is FF+20 * A promoter. [Brief description of the drawings]

[0012] [Figure 1]Anti-IL-6 antibody reduces systemic S. Typhimurium + VDA toxicity. BALB-neuT female mice bearing 400 mm3 tumors were treated intravenously with either 5x105 or 1x106 cfu of BCT1 strain (pNG). Bacterial cfu counts indicate total cfu delivered on day 0, with 50% of bacteria administered in two injections 3 hours apart. All mice received two intravenous injections of CA4P VDA, 0.4 mg per injection, 3 hours apart, administered on days -2 and -1. Where indicated, 1 mg of anti-IL-6 mAb was administered intraperitoneally immediately after the first S. Typhimurium injection. Mice were monitored for weight loss and survival after 7 days of treatment. Surviving mice / total mice treated in each group are represented as fractions below each column. The y-axis values ​​represent the average percent weight loss of surviving mice in each group. Error bars indicate standard deviation from the mean. [Diagram 2] Construction of strain BCT2. S. Typhimurium strain BCT2 was constructed by introducing the ΔfliC, ΔfljB, ΔfimH, pgtEp (NC_016863.1:g.2506794G>A), and ΔrfaL mutations into strain χ11091 (containing a lipid A mutation (23)) to modify surface molecules to avoid systemic induction of CRS. Genes are listed in the last column, the molecules they encode in the middle column, and the corresponding immune responses in the first column. [Diagram 3] Figure 2. S. Typhimurium BCT2 virulence. Body weight changes after bacterial challenge of non-tumor-burdened BALB / c mice with 1x107 cfu (closed symbols) or 1x106 cfu (open symbols) of strains VNP20009 or BCT2(pPflEPLux) were followed for 7 days after bacterial injection. Error bars (shown unidirectional for clarity) represent the standard deviation of measurements from four mice. [Figure 4]S. Typhimurium BCT2 virulence and tumor colonization. Body weight changes were followed in tumor-burdened BALB-neuT mice treated with strain BCT2(pFF+20*Lux) and VDA. CKD-516 VDA was administered as a single 0.1 mg intraperitoneal injection on days -4, -3, -2 and -1, followed by two 1.5x106 cfu BCT2(pFF+20*Lux) doses administered intravenously 3 hours apart on day 0, followed by 0.05 mg intraperitoneal injection of CKD-516 1 hour later. Error bars represent standard deviation of measurements from three mice. Inset: Bioluminescence from tumors in three BALB-neuT mice treated with BCT2(pFF+20*Lux) and VDA. Four figures for each mouse are shown. [Figure 5A] Efficacy of engineered bacterial strains in Balb-neuT tumor-burdened mice. The data demonstrate the anti-cancer therapeutic utility of BCT2, BCT5 and BCT14 strains. All mice were injected with 100 microliters of the indicated strain. Treatments (A)-(D) have been described previously (11). All treated mice received 4 mg / kg VDA (vascular disrupting agent) + 50 mg / kg CBD IP (cannabidiol) on day -2. For treatment (E), on day 0, mice were intravenously injected with 2 x 106 cfu of BCT2(pFF+20*-Quad)-2 hr-2 x 106 cfu of BCT2(pFF+20*-Quad), followed by 5 x 106 cfu of BCT5(pFF+20*-Quad)-2 hr-5 x 106 cfu of BCT5(pFF+20*-Quad) on day 14. For treatment (F), mice were administered 2.5x106 cfu of BCT14-PL-Lux(pfliC-P)-2h-2.5x106 cfu of BCT14-PL-Lux(pfliC-P) on day 0. Mice in cohorts (E) and (F) were administered 2mg / kg VDA+50mg / kg CBD IP 2h after the second intravenous injection of bacteria on day 0. Statistics for tumor volume difference (panel A) and mean survival time difference (panel B) are provided only for comparisons with p-values ​​<0.05. [Figure 5B]Efficacy of engineered bacterial strains in Balb-neuT tumor-burdened mice. The data demonstrate the anti-cancer therapeutic utility of BCT2, BCT5 and BCT14 strains. All mice were injected with 100 microliters of the indicated strain. Treatments (A)-(D) have been described previously (11). All treated mice received 4 mg / kg VDA (vascular disrupting agent) + 50 mg / kg CBD IP (cannabidiol) on day -2. For treatment (E), on day 0, mice were intravenously injected with 2 x 106 cfu of BCT2(pFF+20*-Quad)-2 hr-2 x 106 cfu of BCT2(pFF+20*-Quad), followed by 5 x 106 cfu of BCT5(pFF+20*-Quad)-2 hr-5 x 106 cfu of BCT5(pFF+20*-Quad) on day 14. For treatment (F), mice were administered 2.5x106 cfu of BCT14-PL-Lux(pfliC-P)-2h-2.5x106 cfu of BCT14-PL-Lux(pfliC-P) on day 0. Mice in cohorts (E) and (F) were administered 2mg / kg VDA+50mg / kg CBD IP 2h after the second intravenous injection of bacteria on day 0. Statistics for tumor volume difference (panel A) and mean survival time difference (panel B) are provided only for comparisons with p-values ​​<0.05. [Figure 6A]Plasmids expressing and secreting immune regulator proteins. Both the pFF+20*IL15Hly plasmid (A) and the scFv secretion plasmid designated pFF+20*αCTLA4Hly (B) contain sequences from plasmid pYA292, including the E. coli rrnB locus transcription terminator sequence, the p15A origin of replication, and the cDNA encoding S. Typhimurium aspartate semialdehyde dehydrogenase. They also contain the FF+20* facilitated operon consisting of the immune regulator protein cDNA fused to the C-terminal 60 amino acid hemolysin secretion signal sequence (HlyA) and cDNAs encoding the E. coli (HlyB) and (HlyD) hemolysin transport proteins. The IL15 immunomodulator cDNA consists of sequences encoding the sushi domain of the mouse IL-15 receptor alpha subunit (IL15Ra), followed by a gly / ser flexible linker (L1), followed by sequences encoding mouse IL-15 (IL15), followed by sequences encoding a second gly / ser flexible linker (L2). The scFv immunomodulator cDNA consists of sequences encoding the variable light (Vl) and variable heavy (Vh) antibody sequences separated by a flexible gly / ser linker (L), followed by 6x histidine and hemagglutinin tags (T). The strategy for constructing pFF+20*αPDL1 (not shown) was identical to pFF+20*αCTLA4. [Figure 6B]Plasmids expressing and secreting immune regulator proteins. Both the pFF+20*IL15Hly plasmid (A) and the scFv secretion plasmid designated pFF+20*αCTLA4Hly (B) contain sequences from plasmid pYA292, including the E. coli rrnB locus transcription terminator sequence, the p15A origin of replication, and the cDNA encoding S. Typhimurium aspartate semialdehyde dehydrogenase. They also contain the FF+20* facilitated operon consisting of the immune regulator protein cDNA fused to the C-terminal 60 amino acid hemolysin secretion signal sequence (HlyA) and cDNAs encoding the E. coli (HlyB) and (HlyD) hemolysin transport proteins. The IL15 immunomodulator cDNA consists of sequences encoding the sushi domain of the mouse IL-15 receptor alpha subunit (IL15Ra), followed by a gly / ser flexible linker (L1), followed by sequences encoding mouse IL-15 (IL15), followed by sequences encoding a second gly / ser flexible linker (L2). The scFv immunomodulator cDNA consists of sequences encoding the variable light (Vl) and variable heavy (Vh) antibody sequences separated by a flexible gly / ser linker (L), followed by 6x histidine and hemagglutinin tags (T). The strategy for constructing pFF+20*αPDL1 (not shown) was identical to pFF+20*αCTLA4. [Figure 7A]Western analysis of immune modulator protein secretion. Soluble proteins harvested from the medium (M) and sonicated bacteria (B) from a culture of strain χ4550 harboring an immune modulator secretion plasmid were subjected to gel electrophoresis and transferred to a PVDF membrane. All three membranes were probed with anti-DnaK antibody as a control for non-secreted proteins. In panel A, DnaK was identified using a secondary antibody fused to a red fluorescent dye, whereas in panels B and C, DnaK was detected as a green fluorescent band. In panel A, proteins from the gel were probed with anti-mouse IL-15 antibody, and in panels B and C, proteins from the gel were probed with antibody to identify six consecutive histidine residues located at the C-terminus of anti-CTLA-4 or anti-PD-L1 scFv. The molecular weight (lane MW) of the protein ladder (Li-Cor cat.928-40000) included in the gel in panel A is indicated. [Figure 7B] Western analysis of immune modulator protein secretion. Soluble proteins harvested from the medium (M) and sonicated bacteria (B) from a culture of strain χ4550 harboring an immune modulator secretion plasmid were subjected to gel electrophoresis and transferred to a PVDF membrane. All three membranes were probed with anti-DnaK antibody as a control for non-secreted proteins. In panel A, DnaK was identified using a secondary antibody fused to a red fluorescent dye, whereas in panels B and C, DnaK was detected as a green fluorescent band. In panel A, proteins from the gel were probed with anti-mouse IL-15 antibody, and in panels B and C, proteins from the gel were probed with antibody to identify six consecutive histidine residues located at the C-terminus of anti-CTLA-4 or anti-PD-L1 scFv. The molecular weights (lane MW) of the protein ladder (Li-Cor cat.928-40000) included in the gel in panel A are indicated. [Figure 7C]Western analysis of immune modulator protein secretion. Soluble proteins harvested from the medium (M) and sonicated bacteria (B) from a culture of strain χ4550 harboring an immune modulator secretion plasmid were subjected to gel electrophoresis and transferred to a PVDF membrane. All three membranes were probed with anti-DnaK antibody as a control for non-secreted proteins. In panel A, DnaK was identified using a secondary antibody fused to a red fluorescent dye, whereas in panels B and C, DnaK was detected as a green fluorescent band. In panel A, proteins from the gel were probed with anti-mouse IL-15 antibody, and in panels B and C, proteins from the gel were probed with antibody to identify six consecutive histidine residues located at the C-terminus of anti-CTLA-4 or anti-PD-L1 scFv. The molecular weights (lane MW) of the protein ladder (Li-Cor cat.928-40000) included in the gel in panel A are indicated. [Figure 8] Efficacy of treatment. BALB-neuT female mice with the largest tumors measuring less than 50 mm3 were either untreated or administered VDA, CBD and bacteria as described in Materials and Methods. Tumor size was measured for each mouse over time during the experiment, and total tumor mass was compared to tumor mass at the start of the experiment to calculate fold change. For clarity, only positive error bars representing one standard deviation are shown. Comparison of mean tumor burden at day 28 using a two-sample two-tailed unequal variance Student's t-test yielded the indicated P values. A vs. B and B vs. C were not considered significantly different as their P values ​​were greater than 0.05 (nd). [Figure 9] Kaplan-Meier survival analysis. Survival of mice from the efficacy study described in Figure 8 was followed for 9 weeks after treatment. Mice were euthanized when one of the tumors exceeded 2 cm3. Differences in mean survival time are reported with log-rank P values ​​calculated using SAS JMP® software, version 15.1.0. A vs. B and A vs. C were not considered significantly different because their P values ​​were greater than 0.05 (nd). [Figure 10]Treatment toxicity. Mouse weight change from day 0 is plotted to show the amount of toxicity per body weight that mice suffered as a result of treatment. Maximum tolerated dose doxorubicin data (MTD doxorubicin) were imported from a previously published study in tumor-burdened BALB-neuT mice

[27] . These mice were injected with 5 mg / kg doxorubicin, which is comparable to the maximum tolerated dose in humans on a body surface area basis. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] Salmonella has an inherent propensity to colonize solid tumors. Although intravenous delivery of significant amounts of Salmonella results in significantly higher tumor colonization rates, the toxicity of Gram-negative bacteria does not allow for large numbers of bacteria to be injected. Provided herein are attenuated Salmonella that are further attenuated to reduce toxic side effects, but genetically modified to maintain efficacy in colonizing tumors. Additionally, provided herein are multiple genetically engineered Salmonella constructs that express and secrete various immune modulator proteins that have significant anti-tumor effects. When administered in therapeutic doses, these immune modulator proteins can be toxic, and the present delivery method reduces or even eliminates such toxicity.

[0014] No reduction in toxicity has been reported to a level that would allow administration of the bacterial numbers required for robust therapeutic colonization of spontaneous tumors. The combination of flagellin, fimbria, O antigen, LPS and outer membrane protease mutations introduced into the bacterial strain allows for non-toxic administration of sufficient numbers of bacteria to achieve widespread and robust colonization of spontaneous tumors. Furthermore, the systemic toxicity that limits the anticancer efficacy of administered immune modulator proteins is addressed by simultaneously and sequentially secreting multiple immune modulator proteins directly into the tumor microenvironment without the systemic toxicity that limits the efficacy of current cancer immunotherapies.

[0015] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some embodiments of methods and materials are described herein. As used herein, each of the following terms has the meaning associated with it in this section.

[0016] For clarity and conciseness of description, features may be described herein as part of the same or separate embodiments, however, it will be understood that the scope of the invention may include embodiments having combinations of all or any of the described features.

[0017] References herein to "one embodiment," "an embodiment," and the like indicate that the described embodiment may include a particular aspect, feature, structure, moiety, or characteristic, but not all embodiments necessarily include that aspect, feature, structure, moiety, or characteristic. Moreover, such phrases may, but do not necessarily, refer to the same embodiment as referenced elsewhere in this specification. Moreover, when a particular aspect, feature, structure, moiety, or characteristic is described in connection with an embodiment, it is within the knowledge of one of ordinary skill in the art to use or combine such aspect, feature, structure, moiety, or characteristic with other embodiments, whether or not explicitly described.

[0018] As used herein, the indefinite articles "a," "an," and "the" are understood to include plural referents unless the context clearly indicates otherwise. The term "and / or" as used herein should be understood to mean "either or both" of the elements so conjoined, e.g., elements that are conjunctive in some cases and disjunctive in other cases.

[0019] As used herein, "or" should be understood to have the same meaning as "and / or" defined above. For example, when separating a list of items, "and / or" or "or" shall be interpreted as being inclusive, e.g., including at least one of a number of items, but also including two or more, and optionally including additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," refer to the inclusion of exactly one element of a number or list of elements. In general, as used herein, the term "or" shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other, but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

[0020] As used herein, the terms "including," "includes," "having," "has," "with," or variations thereof, are intended to be inclusive in the same manner as the term "comprising."

[0021] As used herein, the term "about" means plus or minus 10% of the indicated value. For example, about 100 means 90 to 110. Numerical ranges recited herein by endpoints include all numbers and fractions within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term "about."

[0022] The terms "individual", "subject" and "patient" are used interchangeably herein and refer to any subject, e.g., a mammal, for which diagnosis, treatment or therapy is desired. Mammals include, but are not limited to, humans, livestock, sport animals and pets. A "subject" is a vertebrate such as a mammal, e.g., a human. Mammals include, but are not limited to, humans, livestock, sport animals and companion animals. Included in the term "animal" are dogs, cats, fish, gerbils, guinea pigs, hamsters, horses, rabbits, pigs, mice, monkeys (e.g., apes, gorillas, chimpanzees, orangutans), rats, sheep, goats, cows and birds.

[0023] The terms "treatment", "treat" and the like are used herein to generally mean obtaining a desired pharmacological and / or physiological effect, for example, arresting or inhibiting or attempting to arrest or inhibit the onset or progression of a disorder, and / or causing or attempting to cause a reduction, suppression, regression, or remission of a disorder and / or its symptoms. The effect may be prophylactic in that it completely or partially prevents a disease or its symptoms, and / or may be therapeutic in that it partially or completely cures a disease and / or its adverse effects caused by the disease. As will be understood by those skilled in the art, various clinical and scientific methodologies and assays can be used to assess the onset or progression of a disorder, as well as various clinical and scientific methodologies and assays can be used to assess the reduction, regression, or remission of a disorder or its symptoms. In addition, the treatment can be applied to a subject or cell culture (in vivo or in vitro).

[0024] The terms "inhibit", "inhibiting" and "inhibition" refer to slowing, stopping or reversing the growth or progression of a disease, infection, condition, cell population, protein or expression thereof. Inhibition can be, for example, greater than about 20%, 40%, 60%, 80%, 90%, 95% or 99% compared to the growth or progression that occurs in the absence of treatment or contacting.

[0025] "Expression" refers to the production of RNA from DNA and / or the production of a protein directed by genetic material (e.g., RNA (mRNA)). Inducible expression, as opposed to constitutive expression (which is always expressed), is expression that occurs only under certain conditions, e.g., in the presence of a particular molecule (e.g., arabinose) or environmental condition.

[0026] The term "exogenous" as used herein with respect to nucleic acids (or proteins) and hosts refers to nucleic acids that do not occur in (and cannot be obtained from) a particular type of cell as found in nature, or proteins encoded by such nucleic acids. Thus, non-naturally occurring nucleic acids are considered exogenous to the host once they are in the host. It is important to note that non-naturally occurring nucleic acids can include nucleic acid subsequences or fragments of a nucleic acid sequence found in nature when the nucleic acid does not occur in nature as a whole. For example, a nucleic acid molecule containing a genomic DNA sequence within an expression vector is a non-naturally occurring nucleic acid and is therefore exogenous to the host cell once introduced into the host, since the nucleic acid molecule does not occur in nature as a whole (genomic DNA + vector DNA). Thus, any vector, autonomously replicating plasmid, or virus (e.g., retrovirus, adenovirus, or herpes virus) that does not occur in nature as a whole is considered to be a non-naturally occurring nucleic acid. It follows that genomic DNA fragments and cDNAs produced by PCR or restriction endonuclease treatment are considered to be non-naturally occurring nucleic acids because they exist as separate molecules not found in nature. Thus, exogenous sequences can be integrated into the genome of a host. Any nucleic acid (e.g., cDNA or genomic DNA) that contains a promoter sequence and a polypeptide coding sequence in an arrangement not found in nature is also said to be a non-naturally occurring nucleic acid. A naturally occurring nucleic acid can be exogenous to a particular host microorganism. For example, an entire chromosome isolated from a cell of yeast x is an exogenous nucleic acid to a cell of yeast y when the chromosome is introduced into the cell of yeast y.

[0027] In contrast, the term "endogenous" as used herein with respect to a nucleic acid (e.g., gene) (or protein) and host refers to a nucleic acid (or protein) that occurs in (and can be obtained from) a particular host as found in nature. Moreover, a cell that "endogenously expresses" a nucleic acid (or protein) expresses that nucleic acid (or protein) as the same type of host would express it as found in nature. Moreover, a host that "endogenously produces" or "endogenously produces" a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as the same type of host would produce it as found in nature.

[0028] The term "contacting" refers to the act of touching, contacting, or bringing into close proximity or proximate proximity, including at the cellular or molecular level, e.g., in a solution, in a reaction mixture, in vitro or in vivo, to cause a physiological reaction, a chemical reaction, or a physical change.

[0029] An "effective amount" is an amount sufficient to produce a beneficial or desired result, such as a preclinical or clinical result. An effective amount can be administered in one or more administrations. The term "effective amount" as applied to the compounds, biologics, and pharmaceutical compositions described herein means the amount necessary to produce the desired therapeutic result. For example, an effective amount is a level effective to treat, cure, or alleviate the symptoms of the disorder and / or disease for which the therapeutic compound, biologic, or composition is administered. The amount effective for the particular therapeutic goal sought will vary depending on a variety of factors, including the disorder being treated and its severity and / or stage of development / progression; the bioavailability and activity of the particular compound, biologic, or pharmaceutical composition used; the route or method of administration and the site of introduction in the subject; the clearance rate and other pharmacokinetic properties of the particular compound or biologic; the duration of treatment; the inoculation regimen; the drugs used in combination or simultaneously with the particular compound, biologic, or composition; the age, weight, sex, diet, physiology, and overall health of the subject being treated; and similar factors well known to those skilled in the relevant scientific fields. Some variation in dosage may occur depending on the condition of the subject being treated, and the physician or other individual administering treatment will, in any event, determine the appropriate dose for the individual patient.

[0030] As used herein, "disorder" refers to a disorder, disease or condition, or other deviation from health or normal biological activity, and these terms can be used interchangeably. The term refers to any condition that impairs normal function. The condition can be caused by sporadic or inherited genetic abnormalities. The condition can also be caused by non-genetic abnormalities. The condition can also be caused by injury to the subject by environmental factors, including, but not limited to, cutting, crushing, burning, puncturing, stretching, shearing, injecting, or otherwise modifying the subject's cells, tissues, organs, systems, etc.

[0031] As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these terms also include their progeny, which are any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations.

[0032] The "coding region" of a gene consists of nucleotide residues on the coding strand of the gene and those on the non-coding strand of the gene that are homologous or complementary, respectively, to the coding region of the mRNA molecule produced by transcription of the gene.

[0033] "Complementary" as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids, e.g., between two DNA molecules. If a nucleotide position in both molecules is occupied by a nucleotide that can normally base-pair with each other, the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are complementary to each other if a significant number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides that normally base-pair with each other (e.g., A:T and G:C nucleotide pairs). Thus, it is known that an adenine residue in a first nucleic acid region can form specific hydrogen bonds ("base-pair") with the residue in a second nucleic acid region that is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue in a first nucleic acid strand can base-pair with the residue in a second nucleic acid strand that is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or different nucleic acid if, when the two regions are arranged in an antiparallel manner, at least one nucleotide residue of the first region can base pair with the residue of the second region.Preferably, the first region comprises a first portion, and the second region comprises a second portion, and when the first portion and the second portion are arranged in an antiparallel manner, at least about 50%, preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion can base pair with the nucleotide residues in the second portion.More preferably, all the nucleotide residues of the first portion can base pair with the nucleotide residues in the second portion.

[0034] "Encode" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, either by a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence, and the biological properties resulting therefrom. Thus, a gene codes for a protein when transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing) and the non-coding strand (used as a template for transcription of the gene or cDNA) can be said to code for a protein or other product of the gene or cDNA.

[0035] As used herein, an "essentially pure" preparation of a particular protein or peptide is one in which at least about 95% by weight, and preferably at least about 99% by weight, of the protein or peptide in the preparation is the particular protein or peptide.

[0036] A "fragment" or "segment" is a portion of an amino acid sequence comprising at least one amino acid, or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms "fragment" and "segment" are used interchangeably herein.

[0037] As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property by which it is characterized. A functional enzyme is, for example, an enzyme that exhibits the characteristic catalytic activity by which the enzyme is characterized.

[0038] "Homology" as used herein refers to the similarity of subunit sequences between two polymer molecules, e.g., between two nucleic acid molecules, e.g., between two DNA molecules or two RNA molecules, or between two polypeptide molecules. If a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of the two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of positions that match or are homologous, e.g., if half of the positions in two compound sequences (e.g., 5 positions in a polymer 10 subunits long) are homologous, then the two sequences are 50% homologous, and if 90% of the positions, e.g., 9 out of 10, are matched or homologous, then the two sequences share 90% homology. As an example, the DNA sequences 3'ATTGCC5' and 3'TATGGC5' share 50% homology.

[0039] As used herein, "homology" is used synonymously with "identity." The determination of percent identity between two nucleotide or amino acid sequences can be achieved using mathematical algorithms.For example, a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268), which is modified in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877).This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990, J. Mol. Biol. 215:403-410), and can be accessed, for example, at the National Center for Biotechnology Information (NCBI) website using the BLAST tool at the NCBI World Wide Web site with Universal Resource Locator. BLAST nucleotide searches can be performed with the NBLAST program (named "blastn" on the NCBI website) using the following parameters: gap penalty=5; gap extension penalty=2; mismatch penalty=3; match reward=1; expectation value=10.0; and word size=11 to obtain nucleotide sequences homologous to the nucleic acids described herein. BLAST protein searches can be performed with the XBLAST program (named "blastn" on the NCBI website) or the NCBI "blastp" program using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to the protein molecules described herein. To obtain gapped alignments for comparison, Gapped BLAST, as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402), can be utilized. Alternatively, PSI-Blast or PHI-Blast can be used to perform iterative searches to detect distant relationships between molecules (ibid.) and relationships between molecules that share common patterns.When utilizing BLAST, Gapped BLAST, PSI-Blast, and PHI-Blast programs, the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used.

[0040] The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating the percent identity, typically exact matches are counted.

[0041] As used herein, the term "hybridization" is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between nucleic acids) are affected by factors such as the degree of complementarity between the nucleic acids, the stringency of the conditions involved, the length of the hybrid formed, and the G:C ratio within the nucleic acid.

[0042] As used herein, "instructional material" includes publications, records, diagrams, or any other medium of expression that can be used to communicate the usefulness of the peptides of the present invention in the kits to provide relief from the various diseases or disorders listed herein. Optionally, or alternatively, the instructional material may describe one or more methods of alleviating a disease or disorder in a mammalian cell or tissue. The instructional material of the kits of the present invention may be, for example, attached to a container that holds the identified compound of the present invention or may be shipped together with a container that holds the identified compound. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound are used cooperatively by the recipient.

[0043] The term "nucleic acid" generally refers to large polynucleotides. "Nucleic acid" refers to any nucleic acid, whether it is composed of deoxyribonucleosides or ribonucleosides, and whether it is composed of phosphodiester bonds or modified bonds, such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone bonds, and combinations of such bonds. The term nucleic acid also specifically includes the nucleic acid composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0044] As used herein, the term "nucleic acid" includes RNA as well as single- and double-stranded DNA and cDNA. Furthermore, the terms "nucleic acid", "DNA", "RNA" and similar terms also include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. For example, the so-called "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered to be within the scope of the present invention. By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester bonds or modified bonds, such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethyl ester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone bonds, and combinations of such bonds. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine, and uracil). The following conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5' end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of nucleotide addition from 5' to 3' to the nascent RNA transcript is referred to as the transcription direction. The DNA strand with the same sequence as the mRNA is referred to as the "coding strand;" the sequence on the DNA strand that is 5' to the reference point on the DNA is referred to as the "upstream sequence;" the sequence on the DNA strand that is 3' to the reference point on the DNA is referred to as the "downstream sequence."

[0045] As used herein, the term "nucleic acid construct" encompasses DNA and RNA sequences that encode the particular gene or gene fragment of interest, whether obtained by genomic or synthetic methods.

[0046] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNAs can contain introns.

[0047] The term "oligonucleotide" typically refers to a short polynucleotide, generally less than about 50 nucleotides. When a nucleotide sequence is represented as a DNA sequence (i.e., A, T, G, C), it is understood to also include RNA sequences in which "U" replaces "T" (i.e., A, U, G, C).

[0048] "Substantially homologous nucleic acid sequence" refers to a nucleic acid sequence that corresponds to a reference nucleic acid sequence, and the corresponding sequence encodes a peptide having substantially the same structure and function as the peptide encoded by the reference nucleic acid sequence, for example, a peptide in which only amino acid changes that do not significantly affect peptide function occur. Preferably, the substantially identical nucleic acid sequence encodes the peptide encoded by the reference nucleic acid sequence. The percentage of identity between a substantially similar nucleic acid sequence and the reference nucleic acid sequence is at least about 50%, 65%, 75%, 85%, 95%, 99% or more. The substantial identity of nucleic acid sequences can be determined by comparing the sequence identity of two sequences, for example, by physical / chemical methods (i.e., hybridization) or by sequence alignment via computer algorithms. Suitable nucleic acid hybridization conditions for determining whether a nucleotide sequence is substantially similar to a reference nucleotide sequence are as follows: 7% sodium dodecyl sulfate SDS, 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 2x standard saline citrate (SSC), 0.1% SDS at 50°C; preferably, in 7% (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 1x SSC, 0.1% SDS at 50°C; preferably, in 7% SDS, 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 0.5x SSC, 0.1% SDS at 50°C; more preferably, in 7% SDS, 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 0.1x SSC, 0.1% SDS at 65°C.Suitable computer algorithms for determining substantial similarity between two nucleic acid sequences include the GCS program package (Devereux et al., 1984 Nucl. Acids Res. 12:387), and the BLASTN or FASTA programs (Altschul et al., 1990 Proc. Natl. Acad. Sci. USA. 1990 87:14:5509-13; Altschul et al., J. Mol. Biol. 1990 215:3:403-10; Altschul et al., 1997 Nucleic Acids Res. 25:3389-3402). The default settings provided with these programs are suitable for determining substantial similarity of nucleic acid sequences for the purposes of the present invention.

[0049] Describing two polynucleotides as "operably linked" means that a single-stranded or double-stranded nucleic acid moiety contains two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides can exert a physiological effect on the other by which it is characterized. As an example, a promoter operably linked to the coding region of a gene can promote transcription of the coding region.

[0050] As used herein, the term "pharmaceutical acceptable carrier" refers to a chemical composition that can be combined with a suitable compound or derivative and can be used to administer the suitable compound to a subject after combination. "Pharmaceutical acceptable" means physiologically tolerated for either human or veterinary applications. As used herein, "pharmaceutical composition" includes formulations for human and veterinary use.

[0051] As used herein, the term "purified" and similar terms refer to the enrichment of a molecule or compound relative to other components that normally accompany the molecule or compound in its natural environment. The term "purified" does not necessarily indicate that complete purity of a particular molecule has been achieved during the process. As used herein, a "highly purified" compound refers to a compound that is greater than 90% pure. Specifically, purified sperm cell DNA refers to DNA that does not produce significant detectable levels of non-sperm cell DNA upon PCR amplification of purified sperm cell DNA and subsequent analysis of the amplified DNA. A "significant detectable level" is the amount of contaminant visible in the presented data and that must be addressed / accounted for during the analysis of forensic evidence.

[0052] "Recombinant polynucleotide" refers to a polynucleotide having sequences that are not linked together in nature. The amplified or assembled recombinant polynucleotide can be included in a suitable vector, and the vector can be used to transform a suitable host cell.

[0053] A recombinant polynucleotide may serve a non-coding function as well, such as promoter, origin of replication, ribosome binding site, etc. A host cell containing a recombinant polynucleotide is referred to as a "recombinant host cell." A gene that is expressed in a recombinant host cell containing a recombinant polynucleotide produces a "recombinant polypeptide."

[0054] A "recombinant polypeptide" is one produced upon expression of a recombinant polynucleotide. A "recombinant cell" is a cell that contains a transgene. Such cells may be eukaryotic or prokaryotic. Transgenic cells also include, but are not limited to, embryonic stem cells that contain the transgene, cells obtained from a chimeric mammal derived from a transgenic embryonic stem cell whose cells contain the transgene, cells obtained from a transgenic mammal or fetal or placental tissue thereof, and prokaryotic cells that contain the transgene.

[0055] The term "modulate" refers to either stimulating or inhibiting a function or activity of interest. The term "standard" as used herein refers to something that is used for comparison. For example, it may be a known standard drug or compound that is administered and used to compare results when administering a test compound, or a standard parameter or function that is measured to obtain a control value when measuring the effect of a drug or compound on a parameter or function. A standard may also refer to an "internal standard", for example, a drug or compound that is added to a sample in a known amount and is useful for determining purification or recovery rates, etc., when a marker of interest is measured after the sample has been processed or subjected to a purification or extraction procedure. An internal standard is often a purified marker of interest that is labeled, such as with a radioisotope, so that it can be distinguished from an endogenous marker.

[0056] The method involving conventional molecular biology techniques is described herein. Such techniques are generally known in the art and are described in detail in methodological treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol.1-3, ed.Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; and Current Protocols in Molecular Biology, ed.Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (regularly updated). Methods for chemical synthesis of nucleic acid are discussed, for example, in Beaucage and Carruthers, Tetra.Letts.22:1859-1862, 1981, and Matteucci et al., J.Am.Chem.Soc.103:3185, 1981.

[0057] As used herein, the terms "including," "includes," "having," "has," "with," or variations thereof, are intended to be inclusive in the same manner as the term "comprising."

[0058] The terms "comprises," "comprising," and the like may have their meaning under U.S. Patent Law and may mean "includes," "including," and the like. As used herein, "including" or "includes," and the like, means including without limitation.

[0059] bacteria Bacteria useful in the present invention include, but are not limited to, Salmonella.

[0060] Examples of Salmonella strains that can be used in the present invention include Salmonella typhi (ATCC No. 7251) and S. typhimurium (ATCC No. 13311). Attenuated Salmonella strains include S. typhi-aroC-aroD (Hone et al., Vacc. 9:810 (1991), S. typhimurium-aroA mutant (Mastroeni et al., Micro. Pathol. 13:477 (1992)) and Salmonella typhimurium 7207. Additional attenuated Salmonella strains that can be used in the present invention include those that have one or more other attenuating mutations, such as (i) auxotrophic mutations, such as aro (Hoiseth et al., Nature, 291:238-239 (1981)), gua (McFarland et al., Microbiol. Path., 3:129-141 (1987)), nad (Park et al., J.B. act, 170:3725-3730 (1988), thy (Nnalue et al., Infect. Immun., 55:955-962 (1987)), and asd (Curtiss, supra) mutations; (ii) mutations that inactivate global regulatory functions, e.g., cya (Curtiss et al., Infect. Immun., 55:3035-3043 (1987)), crp (Curtiss et al. (1987), supra). , phoP / phoQ (Groisman et al., Proc. Natl. Acad. Sci., USA, 86:7077-7081 (1989); and Miller et al., Proc. Natl. Acad. Sci., USA, 86:5054-5058 (1989)), phop.sup.c (Miller et al., J. Bact., 172:2485-2490 (1990)), or ompR (Dorman et al., In fect. Immun., 57:2136-2140 (1989)) mutations; (iii) mutations that alter stress response, such as recA (Buchmeier et al., MoI. Micro., 7:933-936 (1993)), htrA (Johnson et al., MoI. Micro., 5:401-407 (1991)), htpR (Neidhardt et al., Biochem. Biophys. Res. Com., 100:894-900 (1981)), hsp (Neidhardt et al., Ann. Rev. Genet, 18:295-329 (1984)) and groEL (Buchmeier et al., Sci., 248:730-732 (1990)) mutations; mutations in specific virulence factors, such as IsyA (Libby et al., Proc. Natl. Acad. Sci., USA, 91:489-493 (1994)), pag or prg (Miller et al. (1990), supra; and Miller et al. (1989), supra), iscA or virG (d'Hauteville et al., MoI. Microbiol., 1999, 2001, 2010, 2011, 2012, 2013, 2014, 2015, 2016, 2017, 2019, 2020, 2021, 2022, 2023, 2024, 2025, 2026, 2027, 2028, 2030, 2031, 2032, 2033, 2034, 2036, 2037, 2038, 2040, 2041, 2042, 2043, 2044, 2050, 2051, 2060, 2061, 2062, 2063, 2064, 2065, 2066, 2067, 2068, 2070, 2071, 2072, 2073, 2074, 20 ., 6:833-841 (1992)), plcA (Mengaud et al., Mol. Microbiol., 5:367-72 (1991); Camilli et al., J. Exp. Med, 173:751-754 (1991)), and act (Brundage et al., Proc. Natl. Acad. Sci., USA, 90:11890-11894 (1993)) mutations; (v) mutations that affect DNA topology, e.g., topA (Galan et al., Infect. Immun., 58:1879-1885 (1990)); (vi) mutations that disrupt or alter the cell cycle, e.g., min (de Boer et al., Cell, 56:641-649 (1989); (vii) introduction of genes encoding suicide systems, e.g., sacB (Recorbet et al., App. Environ. Micro., 59:1361-1366 (1993); Quandt et al., Gene, 127:15-21 (1993)), nuc (Ahrenholtz et al., App. Environ. Micro., 60:3746-3751 (1994)), hok, gef, kil, or phlA (Molin et al., Ann. Rev. Microbiol., 47:139-166 (1993)); (viii) mutations that alter the biosynthesis of lipopolysaccharide and / or lipid A, e.g., rFb (Raetz in Esherishia coli and Salmonella typhimurium, Neidhardt et al., Ed., ASM Press, Washington DC pp1035-1063 (1996)), galE (Hone et al., J. Infect. Dis., 156:164-167 (1987)) and htrB (Raetz, supra), msbB (Reatz, supra; and U.S. Pat. No. 7,514,089); and (ix) the introduction of a bacteriophage lytic system, such as the lysogen encoded by P22 (Rennell et al., Virol, 143:280-289 (1985)), ramdamurein transglycosylase (Bienkowska-Szewczyk et al., Mol. Gen. Genet., 184:111-114 (1981)) or S-gene (Reader et al., Virol, 43:623-628 (1971)).

[0061] The attenuating mutations can be either constitutively expressed or under the control of an inducible promoter, such as a temperature-sensitive heat shock family promoter (Neidhardt et al., supra), or the anaerobically induced nirB promoter (Harbome et al. Mol. Micro., 6:2805-2813 (1992)), or a repressible promoter, such as uapA (Gorfinkiel et al., J. Biol. Chem., 268:23376-23381 (1993)) or gcv (Stauffer et al., J. Bact., 176:6159-6164 (1994)).

[0062] In one embodiment, the bacterial strain is VNP20009, a derivative of Salmonella typhimurium. Its two deletions of genes msbB and purI have resulted in its complete attenuation (by preventing toxic shock in the animal host) and its dependence on an external source of purines for survival. This dependence renders the organism unable to replicate in normal tissues such as liver and spleen, but still capable of growing in tumors where purines are available. In another embodiment, the bacterial strain is SL3261 or χ11091.

[0063] Vectors / plasmids In the compositions and / or methods of the present invention, DNA, RNA and / or protein can be produced by recombinant methods. Nucleic acid is inserted into a replicable vector for expression. Many such vectors are available. Vector components generally include, but are not limited to, one or more of the following: origin of replication, one or more marker genes, enhancer elements, promoter, and transcription termination sequence and coding sequence. In some embodiments, for example in Salmonella, gene and / or promoter (sequence of interest) can be integrated into host cell chromosome or can be present on a plasmid / vector, for example.

[0064] Expression vectors usually contain a selection gene, also called a selection marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with a vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, methotrexate, or tetracycline, (b) complement an auxotrophic deficiency, or (c) supply vital nutrients that are not available from complex media.

[0065] An expression vector may contain a promoter that is recognized by a host organism and operably linked to a nucleic acid sequence, e.g., a nucleic acid sequence encoding an open reading frame. Promoters are untranslated sequences located upstream (5') of the start codon of a structural gene (generally within about 100-1000 bp) that control the transcription of the particular nucleic acid sequence to which they are operably linked. In bacterial cells, the region that controls the overall regulation may be called the operator. Promoters are typically divided into two classes: inducible and constitutive. Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient or a change in temperature. A large number of promoters recognized by a variety of potential host cells are well known.

[0066] Suitable promoters for use in prokaryotic hosts include β-lactamase and lactose promoter systems, alkaline phosphatase, tryptophan (trp) promoter systems, hybrid promoters such as the tac promoter, and starvation promoters (Matin, A. (1994) Recombinant DNA Technology II, Annals of New York Academy of Sciences, 722:277-291). However, other known bacterial promoters are also suitable. Such nucleotide sequences are published, thereby enabling one of skill in the art to operably ligate them to DNA coding sequences. Promoters for use in bacterial systems may also contain a Shine-Dalgarno (SD) sequence operably linked to the coding sequence.

[0067] Construction of suitable vectors containing one or more of the above components employs standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the desired configuration to generate the required plasmid.

[0068] In some embodiments of the invention, the expression vector is a plasmid or bacteriophage vector suitable for use in Salmonella, and the DNA, RNA and / or protein is provided to the subject through expression by engineered Salmonella (attenuated in one aspect) administered to the patient. As used herein, the term "plasmid" refers to any nucleic acid encoding an expressible gene, including linear or circular nucleic acid and double-stranded or single-stranded nucleic acid. The nucleic acid may be DNA or RNA, may contain modified nucleotides or ribonucleotides, and may be chemically modified by methylation or inclusion of protecting groups or cap or tail structures.

[0069] Cancer Treatment Bacteria such as Salmonella have a natural tropism for cancers, such as solid tumors. Types of cancer that can be treated using the methods of the present invention include solid tumors, such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelioma, lymphangiosarcoma, lymphangioendothelioma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, and the like. tumor, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocarcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical carcinoma, uterine carcinoma, testicular carcinoma, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0070] In some embodiments, the subject is treated with radiation, surgery, and / or chemotherapy before, after, or during administration of the bacterial cells described herein. Administration The invention also includes methods of administration of the attenuated Salmonella strains described herein, and methods of preparing and administering pharmaceutical compositions comprising formulating a pharma- ceutically acceptable carrier with one or more of the attenuated Salmonella strains described herein.

[0071] The pharmaceutical composition of the present invention is formulated to suit its intended route of administration. The solution or suspension used for parenteral, intradermal, or subcutaneous application can contain the following components: a sterile diluent, such as water for injection, saline, non-volatile oil, polyethylene glycol, glycerin, propylene glycol or other synthetic solvent; an antioxidant, such as ascorbic acid or sodium bisulfite; a chelating agent, such as ethylenediaminetetraacetic acid; a buffer, such as acetate, citrate or phosphate, and an agent for adjusting tonicity, such as sodium chloride or dextrose. The pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in glass or plastic ampoules, disposable syringes or multiple dose vials.

[0072] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF; Parsippany, NJ) or phosphate buffered saline (PBS). It needs to be stable under the conditions of manufacture and storage and needs to be preserved against the contaminating action of other (undesirable) microorganisms. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include an isotonic agent, for example, sugar, polyalcohol, for example, mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable composition can be brought about by including an agent that delays absorption, for example, aluminum monostearate and gelatin in the composition.

[0073] Injection can be prepared by incorporating the active compound in the required amount in suitable solvent with one or combination of the above-mentioned components.Generally, dispersion is prepared by incorporating active compound into vehicle that contains basic dispersion medium and various other components mentioned above.For the powder for preparing injection, the preferred preparation method is vacuum drying and freeze-drying, which obtains the powder of active ingredient plus any other desired components obtained before.

[0074] Oral compositions generally contain an inert diluent or an edible carrier. For example, they can be encapsulated in gelatin capsules. For oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules.

[0075] Pharmaceutically compatible binders and / or auxiliary materials can be included as part of the composition.Tablets, pills, capsules, lozenges etc. can contain any of the following ingredients or compounds of similar nature: binders such as microcrystalline cellulose, tragacanth or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid, Primogel or corn starch; lubricants such as magnesium stearate or Sterotes; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavorings such as peppermint, methyl salicylate or orange flavoring.

[0076] For administration by inhalation, the bacteria are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant (eg, a gas such as carbon dioxide) or a nebulizer.

[0077] Systemic administration may be by transmucosal or transdermal means. For transmucosal or transdermal administration, a penetrant suitable for the barrier to be permeated is used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved through the use of nasal sprays or suppositories. For transdermal administration, the bacteria is formulated into ointments, salves, gels, or creams as generally known in the art.

[0078] For ease of administration and uniformity of dosage, it is particularly advantageous to formulate the composition in unit dosage form.Unit dosage form as used herein refers to a physically separate unit suitable as a unit dose for the subject to be treated, and each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect in association with necessary pharmaceutical carrier.The specification of the unit dosage form of the present invention is determined and directly depends on the inherent characteristics of active compound and the specific therapeutic effect to be achieved, as well as the inherent limitation of the technology of compounding such active compound for individual treatment.

[0079] When administered to a patient, the attenuated Salmonella can be used alone or in combination with any physiological carrier. Generally, the dosage is about 1.0 cfu / kg to about 1×10 12 cfu / kg, optionally from about 1.0 cfu / kg to about 1×10 10 cfu / kg; optionally, from about 1.0 cfu / kg to about 1×10 8 cfu / kg; optionally, approximately 1 x 10 2 cfu / kg ~ approx. 1 x 10 8 cfu / kg; optionally, approximately 1 x 10 4 cfu / kg ~ approx. 1 x 10 8 cfu / kg; optionally, approximately 1 x 10 5 cfu / kg ~ approx. 1 x 10 12 cfu / kg; optionally, approximately 1 x 10 5 cfu / kg ~ approx. 1 x 10 10 cfu / kg; optionally, approximately 1 x 10 5 cfu / kg ~ approx. 1 x 10 8 in the cfu / kg range. EXAMPLES

[0080] The following examples are provided to demonstrate and further illustrate certain embodiments and aspects of the present invention and should not be construed as limiting its scope. Example I Engineered Salmonella Enterica Typhimurium for non-virulent systemic colonization of spontaneous tumors Introduction In preclinical studies, strains of Salmonella enterica serovar Typhimurium (S. Typhimurium) genetically engineered to express multiple anticancer mechanisms and reduce virulence have shown efficacy (1). Preclinical studies have relied primarily on mouse models in which tumors develop from implants of preformed cancer tissue or injection of cancer cell lines. These tumors develop rapidly in rodents, requiring euthanasia within a few weeks of tumor initiation. These tumors are robust and often reach 1 × 10 per gram of tumor tissue. 9 reaching more than colony forming units (cfu) of bacteria (2).

[0081] Unfortunately, early clinical trials of intravenous S. Typhimurium cancer therapy have been disappointing, in part due to poor bacterial colonization of spontaneous (naturally occurring) human tumors (3–5). In contrast to preclinical transplant tumor models, spontaneous tumors develop over months to years, with more mature vasculature and limited necrotic spaces (6, 7), which may explain the relatively poor colonization by bacteria seen in clinical trials. Many attenuated strains of Salmonella have been used in preclinical bacterial cancer therapy studies, but none have been optimized for colonization of spontaneous tumors with systemic delivery. Most published studies of Salmonella cancer therapy have been in animal models with tumors that developed from bolus administration of transplanted cancer tissue or cancer cells. Recent examples include VNP20009 (8, 9), A1-R (10, 11), SL3261 (12, 13), and v4550 (14, 15). Also, many of these studies have necessarily been performed in immunocompromised animals. For example, experiments using Salmonella Typhimurium strain A1-R in a patient-derived orthotopic xenograft mouse model (16) do not recapitulate spontaneous tumor establishment and cannot accurately assess immune responses in patients with intact immune systems.

[0082] Previous studies have shown that robust bacterial colonization of spontaneous tumors in genetically engineered mouse models (GEMMs) can be improved by preconditioning tumors with vasculature disrupting agents (VDAs) to establish increased necrotic spaces (17). However, attempts to achieve consistent and widespread colonization of VDA-conditioned spontaneous tumors by increasing bacterial doses were limited by toxicity. To overcome this limitation, engineered strains of S. Typhimurium with less immunogenicity are provided herein. Herein, we report the development of strains of S. Typhimurium with reduced systemic toxicity and capable of robust colonization of VDA-conditioned spontaneous tumors.

[0083] material and method The characteristics of the plasmids are listed in Table 1. Plasmid pNG was constructed by EcoRI / HindIII digestion of plasmid pYA292 (18) and recircularization by ligation of the blunt ends to eliminate expression of the LacZ-α peptide. Plasmid pLux was constructed by ligating a PCR-generated fragment from pYA292 containing the LacUV5 promoter sequence with primers LacFwd and LacRev to the luxCDABE operon amplified by PCR from plasmid pAKlux2 (19) with primers LuxFwd and LuxRev. The LacUV5 promoter in plasmid pLux was ligated to the tumor-specific promoters PflEP (20) and FF+20 * (21) by replacing the plasmids pPflEPLux and pFF+20 * Built Lux. PflEP and FF+20 *gBlocks with sequences were digested with DraIII and BlpI. The resulting fragment was ligated into pLux that had been digested with DraIII and BlpI and treated with alkaline phosphatase. Restriction enzyme digestion, ligation and alkaline phosphatase treatment followed the manufacturer's guidelines (New England Biolabs, Ipswich, MA). Primers and gBlocks were obtained from Integrated DNA Technologies (Coralville, IA). See Table 2 for DNA sequences of all synthetic molecules used in plasmid construction.

[0084] [Table 1]

[0085] [Table 2]

[0086] Bacterial strains Bacterial strains, including associated genotypes and sources, are listed in Table 1. S. Typhimurium strain VNP20009 was obtained from the American Type Culture Collection (ATCC#202165). Strain SL3261 was obtained from the Salmonella Genetic Stock Centre (SGSC#439). Strain BCT1 was constructed by deleting the aspartate-semialdehyde dehydrogenase (asd) gene from the chromosome of SL3261 using the phage k Red recombinase method (22) and two PCR primers DSfwd and DSrev (Table 2). When measuring tumor colonization, bacteria were transformed with a plasmid containing the lux operon for bioluminescence (23). S. Typhimurium strain BCT2 was constructed by deleting the fliC , fljB , fimH , and rfaL genes from χ11091 ( 24 ) and introducing a single nucleotide change into the pgtE promoter in the χ11091 chromosome. The oligonucleotide primers used to introduce these mutations into χ11091 by the DIRex method ( 25 ) are listed in Table 2 .

[0087] Bacterial growth conditions For experiments involving BCT1, strains were transformed with plasmid pNG and bacterial injections were prepared from fresh mid-logarithmic phase Lysogeny Medium Miller (LB) cultures. Cultures were harvested by centrifugation at 3,500 × g for 5 min at 4 °C. Cell pellets were resuspended in chilled phosphate-buffered saline (PBS), pelleted, and resuspended again at the required concentration. For experiments involving strains BCT2 or VNP20009, bacterial injections were prepared by growing cultures as indicated for strain BCT1(pNG), but the final cell resuspension was in chilled 20% glycerol / PBS (vol / vol) and cell samples were stored at -80 °C. Frozen glycerol stocks were thawed and diluted in PBS to the desired concentration before use. After animal injection, colony forming units (cfu) per mL of injected bacteria were verified by dilution plating on LB agar at 37 °C.

[0088] Animal testing BALB-neuT colonies were maintained and managed as previously described (26). The number of mice used for each data point is provided in the figure captions. Tumors were measured by external calipers and tumor volumes were calculated by subtracting 0.5 (length × width). 2 ) were calculated. All drugs were administered parenterally to mice by injection of 100 microliters in PBS at the concentrations and dosing schedules indicated in individual experiments. Bacteria were injected into the tail vein (IV). Vascular disrupting agents (VDAs) were injected either IV or intraperitoneally (IP) as indicated. VDA combretastatin A4 phosphate (CA4P; SF204, Selleck) was administered IV and VDA CKD-516 (A07.020.548, Aurora Fine Chemicals) was administered IP. Anti-interleukin-6 (IL-6) monoclonal antibody (MP5-20F3, BioXCell) was injected IP. To measure tumor radiance in mice treated with luminescent bacteria, mice were anesthetized by inhalation of 3% isoflurane in oxygen and imaged using an IVIS Spectrum in vivo imaging system with Living Image software (PerkinElmer). Acquire the total luminescence (photons / sec / cm) for 60 seconds and measure the radiance (photons / sec / cm) of the tumor of interest. 2 / sr).

[0089] Abbreviation S. Typhimurium: Salmonella enterica serovar Typhimurium; GEMM: genetically engineered mouse model; VDA: vascular disruption agent; LB: lysogeny medium Miller; PBS: phosphate-buffered saline; cfu: colony forming units; IV: intravenous; IP: intraperitoneal; CA4P: combretastatin A-4 phosphate; IL-6: interleukin-6; CRS: cytokine release syndrome; PAMP: pathogen-associated molecular pattern.

[0090] result Elimination of intrinsic toxicity of S. Typhimurium When estimating maximum tolerated doses in human clinical trials, the toxicology literature defines an upper limit of acute weight loss of 10% in short-term (7-day) dosing studies of drugs in rodents (27). We suspected that the toxicity observed when S. Typhimurium strain BCT1(pNG) was administered IV with VDA was due to cytokine release syndrome (CRS), and applied a treatment that has been reported to reduce CRS-induced toxicity, involving administration of an antibody that antagonizes interleukin-6 (IL-6) receptor activation (28). Mice treated with anti-IL-6 antibody had a 1 × 10 6 IV administration of 5 × 10 cfu of S. Typhimurium strain BCT1(pNG)+VDA was tolerated with benign toxicity (<10% weight loss), whereas two of three mice without anti-IL-6 antibody experienced unacceptable 18% weight loss and death (Figure 1, columns 4 and 5). 5 Administration of cfu bacteria was less toxic, but similar differences in percentage (%) weight loss were observed when compared to mice treated with or without anti-IL-6 antibody (Figure 1, columns 2 and 3).

[0091] When reduced virulence due to blockade of IL-6 signaling was observed, genes encoding S. Typhimurium surface molecules known to induce IL-6 secretion from immune cells were mutated to allow administration of increased bacterial doses with non-toxic virulence and thus avoid CRS. Starting with S. Typhimurium χ11091 (24), a strain attenuated for virulence by folate auxotrophy and engineered for reduced lipopolysaccharide activation of toll-like receptor 4, genes encoding additional surface molecules involved in the induction of IL-6 secretion were deleted. The flagellin genes fliC and fljB were deleted (29), as was fimH, which encodes the maltose receptor-binding adhesin subunit of fimbria (30). In addition, the O antigen was eliminated by deletion of rfaL (31,32). Finally, the transcriptional promoter sequence of pgtE was modified to increase expression of the PgtE outer membrane protease, which inhibits complement activation (33). The resulting strain was designated BCT2 (Fig. 2 ).

[0092] Virulence of the BCT2 strain Non-tumor-burdened mice were used to test the virulence of the BCT2 strain in comparison to the VNP20009 strain, a strain used in many preclinical studies and in several clinical trials of S. Typhimurium cancer treatment (1, 3-5). Non-tumor-burdened mice were immunized with 1 × 10 6 Treatment with cfu of these strains resulted in less than 5% weight loss in BCT2(pPflEPLux) and less than 10% weight loss in VNP20009 (Fig. 3). The pPflEPLux plasmid was used in this experiment as a source of the asd gene to complement the chromosomal asd mutation, resulting in non-antibiotic balanced lethal plasmid maintenance (34). 7 Treatment with cfu of BCT2(pPflEPLux) resulted in a weight loss of about 12% after 3 days, which recovered to about 10% weight loss after 7 days. 7 The same administration of cfu of strain VNP20009 resulted in a 15% weight loss after 3 days and nearly 25% weight loss after 7 days (Figure 3). These results indicate that strain BCT2 is significantly less virulent than strain VNP20009.

[0093] Conditioning tumor vasculature for bacterial colonization When tumor-burdened mice were pretreated with VDA to increase the hypoxic necrotic space within the tumor for colonization by facultative anaerobes such as S. Typhimurium, 3 × 10 6 cfu of strain BCT2(pFF+20 * Administration of pFF+20 did not result in the establishment of at least one tumor in any treated mouse (data not shown). * The Lux plasmid contains the asd gene to complement the chromosomal asd mutation and the expression lux operon to track the bacteria by bioluminescence throughout the body. Thus, in addition to VDA pretreatment, we added a post-bacterial administration of VDA to "trap" the bacteria within the tumor. 3 × 10 6 cfu of strain BCT2(pFF+20 *Lux) toxicity and colonization at 3×10 6 A pulse injection of cfu of bacteria was tested along with IP administration of VDA 1 hour later. This protocol resulted in only benign toxicity and tumor colonization in all mice (Figure 4).

[0094] Consideration Although bacteria have been used for many medical applications, it has been difficult to deliver bacteria to target tissues and avoid toxicity resulting from antibacterial immune responses. One application of bacterial therapy has been the development of Salmonella-based strains as vaccine strains for the treatment of salmonellosis in humans and other animals (35). In these cases, toxicity becomes a significant problem when bacteria are administered systemically. Attempts to reduce toxicity have focused on attenuating the immunogenicity of lipopolysaccharide endotoxins or flagella (35-37). By mutating genes encoding lipid A synthesis as in strain χ11091 (Figure 2), the virulence of S. Typhimurium was greatly reduced.

[0095] In addition to developing vaccine strains, another application of bacteria has been in the treatment of solid tumors (38). Specific to cancer therapy, the "holy grail" of microbial-based cancer therapy is systemic delivery with robust colonization of solid tumors in a non-toxic manner (39). The bacteria used in these experiments include S. Typhimurium, Escherichia coli, and Clostridium perfringens, which are capable of growing in the hypoxic necrotic spaces of tumors. Preclinical studies of the anticancer potential of bacteria have primarily focused on the use of S. Typhimurium in transplanted tumor models in mice (38). In these experiments, tumor colonization is robust, thus requiring fewer bacteria for treatment, resulting in little or no toxicity. Very promising results of efficacy have been reported in these preclinical studies in several different types of solid tumors.

[0096] In an early clinical trial of S. Typhimurium for cancer therapy, VNP20009, a strain with attenuated virulence due to amino acid auxotrophy and reduced lipopolysaccharide toxicity, was administered intravenously (4). The investigators reported poor efficacy and suggested that increased bacterial doses would be required to increase tumor colonization, but bacterial toxicity should be overcome. The dose-limiting toxicity observed in that trial could be due to overstimulation of the systemic immune response against the organism, since most of its highly immunogenic pathogen-associated molecular pattern (PAMP) molecules, such as flagella and fimbriae, remained intact (40). Despite the successful application of the VNP20009 strain in preclinical trials using transplanted tumors, tumor colonization and toxicity have been limiting in clinical trials, indicating the difficulty of translating preclinical results to human trials.

[0097] In contrast to the transplanted tumor models used in preclinical studies, human tumors develop differently in terms of time, vasculature, and necrotic space, which may be the cause of the obstacles in translating preclinical mouse studies to human trials. The use of spontaneous tumor models, such as immune-competent BALB-neuT mice, in preclinical studies is more appropriate because they more closely resemble tumors that develop in humans. This is exactly why we used spontaneous models in our studies. However, when using the establishment of spontaneous tumors for comparison with transplanted tumors in mice, we observed that the establishment was several orders of magnitude less unless VDA was used to increase the necrotic space of the tumor (17). Therefore, to achieve robust establishment of spontaneous tumors, the number of bacteria used in the treatment and the amount of necrotic space in the tumor need to be optimized, and the resulting toxicity needs to be addressed.

[0098] When using S. Typhimurium to systemically target spontaneous tumors, the induction of toxic overstimulated systemic antibacterial immune responses should be avoided. PAMP molecules on the bacterial surface effectively stimulate antitumor immune responses in the tumor microenvironment, but also induce systemic immune responses that result in unacceptable toxicity. Modification of bacteria by disruption of genes encoding immune-stimulating PAMPs allows the use of bacteria as biological factories to secrete therapeutic molecules into the tumor microenvironment with minimal toxicity.

[0099] Addressing the toxicity caused by IV-administered S. Typhimurium has led to the construction of a genetically engineered organism, BCT2, with disruption of several genes involved in the expression of PAMPs (29-31) and mutations to reduce complement activation (33). When combined with vascular disrupting agents, this strain promotes robust, non-toxic colonization of spontaneous tumors in preclinical studies.

[0100] literature

[0101] [Table 3-1]

[0102] [Table 3-2]

[0103] [Table 3-3]

[0104] [Table 3-4]

[0105] Example II A less virulent Salmonella strain engineered to secrete immune modulators reduces tumor growth and improves survival in a spontaneous mouse model of breast cancer. Introduction Until recently, the mainstay of cancer treatment was surgery, radiation, and chemotherapy. A fourth therapeutic strategy, immunotherapy, is rapidly emerging and being widely adopted. However, stimulating the immune system to attack cancer and prevent its recurrence is hampered by dangerous overactivation of the systemic immune response, which can lead to unacceptable destruction of healthy tissues and cause significant systemic toxicity [1]. By targeting immune system-modulating molecules to the tumor microenvironment, it may be possible to avoid systemic toxicity and enhance the potential of anticancer immunotherapy [2]. Herein, a virulence-attenuated strain of Salmonella enterica serovar Typhimurium (S. Typhimurium)

[18] is provided for non-virulent colonization of tumors and delivery of immune modulators.

[0106] To demonstrate the therapeutic potential of this approach, a combinatorial delivery of a cytokine and two immune checkpoint inhibitors is provided herein. The interleukin-15 superagonist, IL-15Ra-IL-15 (RLI) [3], was selected for its toxicity-limiting ability and provides potent anticancer efficacy [4], as does the combination of anti-CTLA4 and anti-PD-L1 immune checkpoint inhibitors [5]. Furthermore, this treatment was tested in a model of spontaneous breast cancer rather than a transplanted cancer model to more rigorously test the potential for successful clinical translation. The development of spontaneous tumors allows for more mature vasculogenesis, resulting in less necrotic space. Thus, a vasculature-disrupting agent (VDA) was included to increase the necrotic space and allow the administered bacteria to colonize [6]. To expand and maintain the VDA-induced necrotic space and reduce any acute bacteria-induced systemic inflammatory response, cannabidiol (CBD) was included for its antiangiogenic and anti-inflammatory effects [7, 8].

[0107] Disclosed herein is the reported anti-cancer efficacy of non-pathogenic S. Typhimurium engineered for targeted secretion of immune modulators directly into the tumor microenvironment. These bacteria do not induce the toxic responses inherent to cancer immunotherapy resulting from systemic administration of immune stimulatory molecules.

[0108] material and method Plasmids The plasmids used in this study were designed to express and secrete various immune modulators that can be tested for anticancer therapy (Table 1). *

[10] was constructed by replacing the Trc promoter and LacZα sequence in plasmid pYA292 [9] with the FF+20 * The promoter was used for tumor-specific gene expression. The operon was * It consisted of a promoter, an immune regulator cDNA sequence in frame with the C-terminal 60 amino acid E. coli HlyA secretion signal

[11] , followed by cDNA sequences encoding the E. coli hemolysin secretory proteins HlyB and HlyD (Figure 6). * IL15Hly, pFF+20 * αCTLA4Hly and pFF+20 * αPDL1Hly, including their complete DNA sequences, have been deposited with Addgene. *The IL-15 sequence in IL15Hly is modeled from RLI [3]. The mouse IL-15Ra sushi domain, isolated by PCR from plasmid pORF9-mIL15RAa (InvivoGen cat.porf-mil15raa), was linked via a 20 amino acid RLI flexible linker to cDNA encoding the mouse IL-15 gene, isolated by PCR from plasmid pORF9-mIL15 (InvivoGen cat.porf-mil15). A second 18 amino acid glycine / serine-rich flexible linker GQSSRSSGGGGSSGGGGS

[12] was used to link the C-terminal amino acids of IL-15 to the C-terminal 60 amino acids of the HlyA signal sequence. Anti-CTLA-4 and anti-PD-L1 scFv cDNA sequences containing C-terminal 6x histidine and hemagglutinin tags were isolated from an immunized chicken antibody library as previously described

[13] . They were directly linked at their C-terminal amino acids to the C-terminal 60 amino acid HlyA signal sequence. The E. coli hemolysin operon sequence in each immunoregulatory factor plasmid was isolated by PCR from plasmid pNirB-PAop-hlyA

[14] using forward and reverse primers TTAGCCTATGGAAGTCAGGGTAATC and TTAACGCTCATGTAAACTTTCTGTTAC, respectively. For Western analysis of immunoregulatory factor expression and secretion, FF+20 * The promoter and sequences immediately upstream of the consensus AGGAGG Shine-Dalgarno sequence were replaced by the sequence AGATCTCCGGAAGACCTTCCATTCTGAAATGAGCTGTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAAT containing the LacUV5 promoter

[15] in pLacUV5IL15Hly and the sequence AGATCTCCGGAAGACCTTCCATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAAT containing the Trc promoter

[16] in pTrcaCTLA4Hly and pTrcaPDL1Hly.

[0109] All plasmids contained the asd gene, which complemented the Dasd mutation in strains χ4550 and BCT2.

[0110] [Table 4]

[0111] Bacterial strains Bacterial strains with associated genotypes and sources are listed in Table 1. Three strains were established to test the expression and secretion of the three immune regulator proteins by transforming strain χ4550 with pLacUV5IL15Hly, pTrcαCTLA4Hly or pTrcαPDL1Hly. Strain BCT2 was transformed with plasmid pFF+20 * Lux, pFF+20 * IL15Hly, pFF+20 * αCTLA4Hly, or pFF+20 * Four strains were established for efficacy and toxicity experiments by transformation with αPDL1Hly. * Experiments were performed using either the Lux-transformed line (BCT2pLux) or a combination of all four lines including BCT2pLux (BCT2pQuad) and tumor establishment was monitored.

[0112] Analysis of protein expression A single colony of strain χ4550 transformed with the immunomodulatory plasmid was used to inoculate 50 mL of lysogeny medium Miller (LB). The culture was grown with aeration at 37° C. for approximately 17 hours until the optical density at 600 nm was approximately 6.0. 20 mL of the culture was harvested at 4000×g for 20 minutes at 4° C. and the culture medium was saved. The bacterial pellet was resuspended in phosphate buffered saline (PBS), recentrifuged, and resuspended in 2 mL of PBS+1×Halt protease inhibitor (Thermo Fisher cat.78430). The culture medium was concentrated to approximately 400 μl by vacuum filtration through a 0.2 μm filter and centrifugation through a 10 kDa cutoff Millipore® Amicon centrifugal filter (Millipore, UFC901024), then diluted to a final volume of 2 mL with PBS. Resuspended bacterial cells (0.5 mL of the original 2 mL) were sonicated 6 times for 15 s on ice at 40% power using a Sonic Dismembrator (Dynatech Laboratories, Model 300) and centrifuged at 21,000 × g for 12 min. 10 μl of 6× Loading Buffer (Boston Bioproducts cat. BP-111R) was added to 50 μl aliquots of sonicated supernatants (representing soluble cellular proteins) and concentrated culture medium, and the samples were incubated in a boiling water bath for 10 min. Each boiled sample (25 μl) was analyzed on a Tris-Tricine 10% to 20% gradient polyacrylamide gel. Proteins were electrophoretically transferred to a PVDF membrane and subjected to Western analysis. The primary antibodies used in these experiments were mouse anti-DnaK (Enzo Life Sciences cat. ADI-SPA-880), rat anti-mouse-IL15 (R&D Systems cat. MAB447) or mouse anti-His tag (BioLegend cat. 65201). The secondary antibodies were goat anti-mouse (LI-COR IRDye 680RD cat. 926-68070) or goat anti-rat (LI-COR IRDye 800CW cat. 926-32219).

[0113] Animal testing For animal studies, the bacterial cultures used for injections were cultured in pFF+20 * Lux, pFF+20 * IL15Hly, pFF+20 * aCTLA4Hly or pFF+20 * aPDL1Hly were prepared from fresh mid-log phase LB cultures of strain BCT2 containing either 100% glycerol or 100% glycerol. Cultures were harvested by centrifugation at 3,500 x g for 5 min at 4 °C. Cell pellets were resuspended in chilled phosphate buffered saline (PBS), pelleted, and then resuspended in chilled 20% glycerol / PBS (vol / vol). Cell samples were stored at -80 °C. Frozen glycerol stocks were thawed and diluted in PBS to the desired concentration before use. Before storage at -80 °C and after animal injection, colony forming units (cfu) per mL of injected bacteria were verified by dilution plating on LB agar at 37 °C.

[0114] BALB-neuT colonies were maintained and managed as previously described

[20] . To assess toxicity, mice were weighed and observed for reduced mobility and fuzziness. Tumors were measured with external calipers and tumor volume was calculated as 0.5 (length × width 2). Mice were cultured until tumors reached 2 cm. 3 Mice were euthanized whenever the immunization rate exceeded 100 μl. All drugs were administered parenterally to mice by injection of 100 μl in PBS at the concentrations and dosing schedules indicated in the individual experiments. On day -2, mice received a single intraperitoneal injection of 4 mg / kg VDA (CKD-516, Aurora Fine Chemicals cat. A07.020.548) and 50 mg / kg CBD (99% pure crystalline CBD, Endoca USA). On day 0, mice were administered 1.5 × 10 6 cfu of bacteria were injected into the lateral tail vein (IV), and 3 h later, 1.5 × 10 6cfu of bacteria were injected IV once more. One hour after this procedure, 2mg / kg VDA + 50mg / kg CBD were injected IP. Mice were treated with BCT2pLux alone as a control, or with BCT2pQuad. When BCT2pQuad was used, each of the four bacterial strains was mixed in equal amounts and 1.5×10 6 cfu injection concentration.

[0115] To measure tumor radiance in mice treated with luminescent bacteria, mice were anesthetized by inhalation of 3% isoflurane in oxygen and imaged using an IVIS Spectrum in vivo imaging system with Living Image software (PerkinElmer). Total light flux (luminescence) was acquired for 60 seconds and the radiance (photons / sec / cm) of the tumor of interest was measured. 2 / sr).

[0116] Abbreviation S. Typhimurium: Salmonella enterica serovar Typhimurium; VDA: vascular disrupting agent; LB: lysogeny medium Miller; PBS: phosphate buffered saline; cfu: colony forming units; IV: intravenous; IP: intraperitoneal; IL-15: interleukin-15; CBD: cannabidiol; MTD: maximum tolerated dose.

[0117] result Secretion of immune regulators. Secretion of immunomodulators by the type I hemolysin secretion apparatus was tested. Western analysis of immunomodulator proteins expressed in S. Typhimurium strain χ4550 transformed with plasmids pLacUV5IL15Hly or pTrcαCTLA4Hly or pTrcαPD-L1Hly confirmed secretion of all three immunomodulators (Figure 7). The presence of intracellular DnaK protein in bacterial sonicates (B) but not in medium (M) indicated that the immunomodulator protein bands observed in medium (M) were due to secretion and not bacterial lysis. Furthermore, it was confirmed that these secreted immunomodulators were biologically active (data not shown).

[0118] We previously investigated the LacUV5 promoter, which constitutively drives the transcription of the lux operon, in tumor-specific FF+20 * It was observed that replacing the LacUV5 and Trc promoters in these plasmids with the FF+20 promoter resulted in tumor-specific expression of the lux operon. Therefore, after confirming the secretion of immune regulator proteins in vitro, we replaced the LacUV5 and Trc promoters in these plasmids with the FF+20 promoter. * The aim of this study was to restrict expression of immune regulators to the tumor microenvironment in order to avoid toxicity from inflammatory stimulation of systemic immune cells that can lead to cytokine release syndrome, which often limits the feasible efficacy of cancer immunotherapy

[21] .

[0119] Effectiveness. pFF+20 *Four individual strains were established by transforming strain BCT2 with Lux or with one of the plasmids encoding the production of one of the three immune modulator proteins. Tumor-burdened mice were treated with VDA 2 days before bacteria administration to generate necrotic spaces for bacterial colonization. VDA was also administered 1 h after bacteria, which resulted in increased tumor colonization, as shown in previous experiments (data not shown). On day -2, 4 mg / kg VDA was injected IP at a dose equivalent to the maximum tolerated dose (MTD) determined in human clinical trials, in terms of body surface area

[22] . On day 0, mice were administered bacteria by two tail vein injections, 3 h apart. This "pulse" administration of bacteria has been demonstrated to increase bacterial colonization of tumors compared to the injection of a single bolus dose

[23] , and this strategy was confirmed by experiments (data not shown). VDA injected on day 0 was reduced to 50% MTD (2 mg / kg) due to toxicity observed when MTD VDA was administered after bacteria (see below). CBD was included in all VDA injections to transiently inhibit acute angiogenesis following VDA-induced necrosis

[24] and suppress any early systemic inflammatory response to bacteria. The administered CBD dose of 50 mg / kg was equivalent to the MTD determined in human clinical trials, calculated on a body surface area basis

[25] . Bioluminescence imaging on days 4 or 5 revealed that at least one tumor was colonized by bacteria in 10 of 15 BCT2pLux-injected mice and 9 of 14 BCT2pQuad-injected mice (data not shown).

[0120] Tumor growth in mice treated with VDA+CBD without bacteria, although tending to grow slower, was not significantly different from tumor growth observed in untreated mice (Figure 8, day 28, A vs. B, P=0.1). When strain BCT2pLux was added to the treatment, tumor growth by day 28 was significantly reduced by 40% compared to tumor growth in untreated mice (Figure 8, day 28, A vs. C, P=0.02). This suggests that BCT2 without immune modulator expression may add a small efficacy to this treatment, although no significant difference was observed between VDA+CBD with and without BCT2pLux (Figure 8, day 28, B vs. C, P=0.2). A significant reduction of tumor growth of 64% was observed in mice treated with BCT2pQuad compared to untreated animals (Figure 8, A vs. D, P=0.0004). The additional delay of tumor growth of 41% and 51% in mice injected with BCT2pQuad compared to that observed in mice injected with VDA+CBD with or without BCT2pLux, respectively (Figure 8, day 28, C vs. D, P=0.004 or B vs. D, P=0.0006) suggests that tumor-specific expression of immune modulators induces antitumor immune responses in addition to any antitumor efficacy provided by the bacteria alone.

[0121] Mice were followed for 9 weeks after bacterial treatment (Figure 9). Treatment with VDA+CBD alone tended to reduce survival by 12% compared to untreated mice, although the significance was less than 95% (Figure 9, A vs. B, P = 0.09). This suggests a possible inhibition of anti-cancer immunity due to the anti-inflammatory properties of CBD [8]. The addition of BCT2pLux did not significantly affect survival compared to untreated (Figure 9, A vs. C, P = 0.6), but increased survival by 15% compared to VDA+CBD alone (Figure 9, B vs. C, P = 0.01). When BCT2pQuad was included in the treatment strategy, mice survived 25% longer than untreated mice (Figure 9, A vs. D, P = 0.0002), 33% longer than mice treated with VDA+CBD alone (Figure 9, B vs. D, P = 0.00002), and 21% longer than when BCT2pLux was the only strain included in the treatment strategy (Figure 9, C vs. D, P = 0.0001). This data further supports the conclusion that bacterially delivered immune modulators induce effective anticancer immune responses in the tumor microenvironment.

[0122] toxicity. Adverse effects of treatment with VDA+CBD+BCT2pQuad were minimal. Toxicity was empirically determined by weight loss, reaching a maximum of -6.9% ± 2.0% 2 days after BCT2pQuad administration (Figure 10). Body weights on day 3 showed that mice resumed normal weight gain compared to untreated animals. This result is within the range of 10% weight loss for 7 days, which is considered the upper limit for the translation of drugs tested in rodents to human clinical trials

[26] . In addition, this empirically determined innocuous toxicity was much lower than that observed with maximal tolerated dose chemotherapy (Figure 10, MTD doxorubicin). Mice injected with MTD doxorubicin continued to lose more than 25% body weight by day 14 and did not resume weight gain until day 21 (previously published data)

[27] . Toxicity was also determined subjectively by observing activity and coat smoothness on the following scale of 0-3: 0) no difference in activity from untreated animals, smooth, shiny, non-fluffy coat, 1) slightly less movement and slightly fuzzy coat, 2) noticeably slower movement and fuzzy coat, and 3) no movement without forcing, sluggish and extremely fuzzy coat. On this motility / coat scale, all of the BCT2pQuad-injected mice were observed to be either 0 / 0, 1 / 0 or 0 / 1 on days 1-4, and all were scored 0 / 0 on day 7. Thus, while some toxicity was evident with this treatment strategy, it was innocuous in nature and well within the limits suitable for human clinical application.

[0123] Consideration Provided herein is a method to target the delivery of multiple immune modulator proteins to the tumor microenvironment without the toxicity that has limited the potential efficacy of cancer immunotherapy. Previously reported studies using intravenous administration of bacteria have shown significant toxicity likely due to the overactivation of many inflammatory cascades elicited by Gram-negative bacteria (28, 29), which has subsequently limited the adoption of this therapeutic strategy. To address the issue of toxicity, we have successfully developed a strain of S. Typhimurium that allows for non-toxic intravenous administration of these bacteria (18), and also engineered the bacteria for stealth and tumor-specific expression of immune modulators. Importantly, these bacteria have demonstrated non-toxic anti-cancer efficacy in a mouse model of spontaneous breast cancer that is more clinically relevant than models using transplanted tumors (30).

[0124] Tumor colonization was enhanced by establishing necrotic spaces with VDA before and after administering the bacteria. Small molecule VDAs bind to tubulin and interfere with the cytoskeleton in immature vascular endothelial cells, causing the disruption of blood flow in tumors. This results in areas of hypoxia and ischemia, leading to the death of surrounding tumor cells and the formation of necrotic spaces (31). We believe that these formed necrotic spaces provide a culture environment for these bacteria to grow and subsequently release immune modulators. Having demonstrated enhanced S. Typhimurium colonization of spontaneous tumors using the VDA combretastatin [6], we optimized dosing in this study using a more stable VDA, CKD-516 (32). We found that a single pretreatment with MTD VDA 2 days before administration of bacteria resulted in bacterial colonization of tumors to the same extent as dosing with VDA once a day for up to 4 days before administration of bacteria. This suggests that a single MTD VDA can destroy a large portion of the available immature intratumoral vasculature (33). Furthermore, administering VDA on day -1 reduced the amount of colonization (unpublished results), suggesting that VDA may impede passage of bacteria from the blood vessels to the tumor if administered too close to bacterial treatment. The half-life of circulating CKD-516 is approximately 5 h (34), and therefore allowing 2 days for VDA clearance may promote bacterial colonization by allowing time for the growth of neovasculature. It may be beneficial to wait 2 h after bacterial treatment before administering VDA, rather than the 1-h interval used in the treatment strategy reported in this study, to increase tumor colonization by once again disrupting the vasculature and potentially trapping bacteria within the tumor.

[0125] The antiangiogenic and anti-inflammatory properties of CBD were exploited to temporarily inhibit angiogenesis, maintain the necrotic space, and reduce acute toxicity due to bacterially stimulated systemic inflammation. Because VDA treatment is known to disrupt the vasculature, thereby stimulating angiogenic responses in tumors (35), CBD, which has a 24-h half-life in the circulation (36) and antiangiogenic properties (7), may prolong the time of VDA-induced necrosis, thereby expanding the necrotic space for bacterial colonization of tumors.

[0126] The tumor microenvironment is a complex array of interacting cells and molecules that result in the suppression of anti-cancer immunity

[38] . Although some monotherapies using single immune modulators have demonstrated anti-cancer efficacy, combining immune modulators in a single treatment is much more effective. For example, administration of a combination of anti-PD-1 and anti-CTLA4 monoclonal antibodies resulted in patients surviving more than twice as long as if either treatment was administered alone

[39] . Augmenting the treatment with additional immune modulators to affect more cellular functions may further overcome the immunosuppressive nature of the tumor microenvironment and induce increasingly activated anti-tumor immune responses

[40] . However, as is the case with all systemically delivered immune modulators, toxicity from immune-related adverse events limits the achievable efficacy of current anti-cancer immunotherapies, especially when immune modulators are combined

[41] . Overcoming the adverse effects that limit the efficacy of systemically delivered anti-cancer immunotherapies may allow the delivery of additional combinations of immune modulators other than the IL-15 cytokines and anti-PD-L1 and anti-CTLA4 immune checkpoint inhibitors combined in this study. Our system of immunogenic stealth S. Typhimurium (BCT2) and tumor-specific expression of immune modulators avoids systemic toxicity while maintaining significant efficacy in a mouse model of spontaneous breast cancer, raising the possibility of successful clinical translation to treat cancer in humans.

[0127] literature

[0128] [Table 5-1]

[0129] [Table 5-2]

[0130] [Table 5-3]

[0131] [Table 5-4]

[0132] Example III Plasmid construction hemolysin secretion system The Trc promoter and LacZα sequence in plasmid pYA292 were cloned as FF+20 * Construct a plasmid by replacing the promoter sequence (1) with FF+20 * The promoter sequence was used for tumor-specific gene expression (2). The operon was * They consisted of a promoter, an immune regulator cDNA sequence that was in frame with the 60 amino acid E. coli HlyA secretion signal at the C-terminus (3), followed by cDNA sequences encoding the E. coli hemolysin secreted proteins HlyB and HlyD. The immune regulator cDNA sequences used in these constructs included IL-15, αCTLA-4 scFv, and αPD-L1 scFv. The construction of plasmids containing these immune regulator genes was previously described (4).

[0133] Using a similar approach (4), we cloned cDNAs for the following immune regulators: * pFF+20 * -CXCL9-10.

[0134] pFF+20 * -pFF+20 to construct CXCL9-10* The -IL15 and CXCL9-10 gBlocks were cut with BsrGI and Esp3I. The digested plasmids were treated with alkaline phosphatase and ligated to the digested gBlocks. The ligations were used to transform strain χ6212, plasmid DNA was isolated, and the plasmids were sequenced and analyzed to identify FF+20 * The -CXCL9-10 construct was confirmed: the correct plasmid was transformed into strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT2.

[0135] CXCL9-10 gBlock sequence (1126bp): * pFF+20 * -αPD-L1N (N=nanobody) pFF+20 * -To construct αPD-L1N, pFF+20 * The -IL15 and PDL1N gBlocks were cut with BamHI and PacI. The digested plasmids were treated with alkaline phosphatase and ligated to the digested gBlocks. The ligations were used to transform strain χ6212, plasmid DNA was isolated, and the plasmids were sequenced to identify FF+20 * -The αPD-L1N construct was confirmed. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT2.

[0136] PDL1N gBlock sequence (557bp): TCAAATGGATCCAGATCGATGTTTAAAGATCCCCCTCACTCCTGCCATCATTCTGATATTGAAATAAGAGAGGAGGAACATAAATGGCTCAAGTTCAATTAGTAGAAACAGGGGGAGGCTTAGTTCAGCCTGGAGGAT CTCTTCGCTTATCTTGCACTGCTTCAGGCTTCACATTCTCGATGCACGCGATGACCTGGTACCGTCAAGCGCCGGGGAAGCAGCGTGAATTGGTGGCAGTTATTACGAGTCATGGGGACCGGGCGAACTACACTGATAG CGTCCGTGGGCGTTTCACGATTAGCCGCGACAATACCAAAAACATGGTATACTTACAGATGAATAGCTTAAAACCGGAAGATACGGCTGTGTATTACTGTAACGTTCCACGGTACGATTCATGGGGGCAGGGTACTCAA GTCACTGTCAGCAGTGGCGGCTTACCGGAAACAGGGGGTCACCACCACCATCATCACGGTGCGTACCCCTATGATGTGCCTGACTATGCGAGCTTAGCCTATGGAAGTCAGGGTAATCTTAATCCATTAATTAACCTCTC Flagellar Secretion System To utilize the flagellar secretion system (5), a plasmid was constructed containing the FliC promoter sequence and the FliC secretion signal fused to an immunomodulatory DNA sequence. Activity of the plasmid FliC promoter is controlled by the chromosomal flagellar locus, which is expressed in the tumor-specific FF+20 to restrict expression and secretion of immunomodulatory factors to the tumor microenvironment. * It is driven by the promoter (2). See description of strain BCT14.

[0137] The immunomodulatory cDNA sequences used in these constructs include: * pFliC-IL-15 To generate pFliC-IL15, FLIC-IL15 gBlock-2 and plasmid pLacUV5-mIL15Ra-mIL15(4) were digested with DraIII and SphI. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-IL15 construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0138] FLIC-IL15 gBlock-2 sequence (380bp): CCAGTCCACAGTGTGCGGAATAATGATGCATAAAGCGGCTATTTCGCCGCCTAAGAAAAAAGATCGGGGGAAGTGAAAAATTTTCTAAAGTTCGAAATTCAGGTGCCGATACAAGGGTTACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATAAGGAAAAGATCATGGCACAAG TCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAATCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGTCCGCTGGGCCTGGCGGGAACCACGTGTCCACCTCCCGTATCTATTGAGCATGCTTCCAG Construction of pFliC plasmids carrying the following immune regulator genes followed a similar protocol as in the construction of pFliC-IL15.

[0139] * pFliC-αPD-L1 scFv To generate pFliC-αPD-L1 scFv, the pLacUV5-OmpA-αPD-L1 plasmid and αPD-L1 gBlock were digested with BstEII and AvrII. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-αPD-L1 construct. The correct plasmid was used to transform strain χ3730A; plasmid was isolated from the transformant and used to transform strain BCT13.

[0140] FLIC-αPDL1 gBlock(1053bp): * pFliC-αCTLA-4 scFv To generate pFliC-αCTLA-4 scFv, the pFliC-αPD-L1 scFv plasmid and αCTLA4 gBlock were digested with NsiI and SpeI. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-αCTLA4 construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0141] FLIC-aCTLA4 gBlock(1070bp): * pFliC-CXCL9-10 To generate pFliC-CXCL9-10, the pFliC-IL15 plasmid and the CXCL9-10 pFlic gBlock were digested with HindIII and DraIII. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-CXCL9-10 construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0142] CXCL9-10 pFlic gBlock(991bp): CCAGTCCACAGTGTGCGGAATAATGATGCATAAAGCGGCTATTTCGCCGCCTAAGAAAAAGATCGGGGGAAGTGAAAAATTTTCTAAAGTTCGAAATTCAGGTGCCGATACAAGGGTTACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATAAGGAAAAGATCATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAATCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGTCCGTTAGGACTTGCAGGCAAATCCGCCGTTTTATTTTTACTGGGGATTATCTTTCTGGAGCAATGCGGCGTACGCGGGACCCTGGTCATCCGCAACGCACGCTGCTCGTGCATCTCTACTTCCCGGGGAACAATTCATTATAAGTCCTTGAAGGACTTGAAGCAGTTTGCGCCGTCACCTAACTGCAATAAGACTGAGATTATTGCAACCCTTAAAAATGGGGACCAAACCTGCTTGGACCCTGACAGCGCAAATGTCAAGAAACTGATGAAAGAATGGGAAAAGAAAATTTCCCAGAAAAAGAAACAAAAACGGGGTAAGAAGCATCAGAAAAATATGAAAAATCGTAAACCAAAGACCCCACAGAGCCGTCGGCGTAGTCGTAAAACGACAGTGCCAGGCGTTGGTGTACCGGGAGTCGGGGGCATCCCATTAGCCCGGACGGTTCGGTGCAACTGCATTCACATCGACGATGGCCCTGTACGTATGCGGGCCATTGGAAAATTGGAAATCATCCCAGCCAGTCTTTCCTGCCCACGGGTTGAAATCATTGCGACTATGAAGAAGAATGATGAGCAACGTTGCCTTAACCCGGAATCCAAAACTATCAAAAACCTGATGAAGGCTTTCAGTCAAAAACGTTCTAAGCGGGCACCTTAAGCTTGACACG * pFliC-αCTLA-4N (N=nanobody) To generate pFliC-αCTLA-4N, the pFliC-IL15 plasmid and αCTLA4N pFliC gBlock were digested with HindIII and DraIII. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-αCTLA-4N construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0143] αCTLA4N pfliC gBlock(727bp): CCAGTCCACAGTGTGCGGAATAATGATGCATAAAGCGGCTATTTCGCCGCCTAAGAAAAAGATCGGGGGAAGTGAAAAATTTTCTAAAGTTCGAAATTCAGGTGCCGATACAAGGGTTACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATAAGGAAAAGATCATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAATCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGTCCGCTTGGTTTGGCTGGTCAGGTTCAACTTGTTGAAAGCGGAGGCGGATTAGCTCAACCCGGCGGCTCTTTACGTCTTTCCTGCGCTGCCTCTGGGTCCACTATTAGCTCCGTTGCCGTGGGTTGGTACCGTCAAACCCCAGGCAACCAACGTGAATGGGTTGCAACATCCAGCACCAGTAGCACAACCGCCACCTATGCAGACTCGGTAAAGGGGCGCTTCACGATTAGTCGTGACAACGCAAAAAACACCATCTACCTTCAAATGAACTCTCTGAAGCCAGAGGACACAGCCGTGTACTATTGCAAGACGGGACTTACAAATTGGGGGCGCGGAACGCAAGTTACCGTAAGCTCGGGTGGTGGCTACCCGTATGACGTGCCTGACTACGCCTAAGCTTGACACG * pFliC-αPD-L1N(N=ナノボディ) To generate pFliC-αPD-L1N, the pFliC-IL15 plasmid and αPDL1N pFlic gBlock were digested with HindIII and DraIII. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-αPDL1N construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0144] αPDL1N pFLic gBlock(730bp): CCAGTCCACAGTGTGCGGAATAATGATGCATAAAGCGGCTATTTCGCCGCCTAAGAAAAAGATCGGGGGAAGTGAAAAATTTTCTAAAGTTCGAAATTCAGGTGCCGATACAAGGGTTACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATAAGGAAAAGATCATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAATCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGTCCATTAGGTTTAGCCGGCCAAGTCCAGCTTGTCGAAACCGGAGGTGGACTGGTGCAGCCTGGAGGGTCACTGCGCCTTTCCTGTACCGCATCTGGTTTCACTTTCAGTATGCACGCTATGACTTGGTATCGTCAGGCTCCTGGTAAGCAACGTGAACTTGTCGCGGTCATTACGAGCCATGGAGATCGCGCGAACTATACGGACTCAGTACGTGGTCGCTTTACAATCTCCCGCGACAACACTAAGAATATGGTCTATTTGCAAATGAATAGCCTGAAGCCTGAAGATACAGCGGTCTATTATTGTAACGTACCTCGTTACGACAGTTGGGGCCAGGGGACTCAAGTAACGGTTTCATCTGGTGGAGGCTATCCCTATGATGTGCCAGATTACGCGTAAGCTTGACACG * pFliC-αCD47N(N=ナノボディ) To generate pFliC-αCD47N, the pFliC-IL15 plasmid and αCD47 pFliC gBlock were digested with HindIII and DraIII. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-αCD47N construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0145] αCD47 pFliC gBlock(751bp): CCAGTCCACAGTGTGCGGAATAATGATGCATAAAGCGGCTATTTCGCCGCCTAAGAAAAAAGATCGGGGGAAGTGAAAAATTTTCTAAAGTTCGAAATTCAGGTGCCGATACAAGGGTTACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATAAGGAAAAGATCATGGCGC AGGTAATCAATACAAACTCCTTAAGTCTTTTAACTCAAAATAATCTTAACAAGAGTCAATCTGCGCTTGGCACTGCTATCGAGCGGTTGTCTAGCGGGTTACGCATCAATTCTGCCAAGGATGATGCGGCGGGTCCACTTGGCTTAGCGGGCCAAGTGCAGTTGGTGGAATCTGGGCGGCGGTTTGGTC GAGCCGGGTGGATCGTTACGGTTATCTTGTGCTGCATCGGGAATCATCTTCAAGATCAACGACATGGGGTGGTACCGGCAGGCACCAGGTAAACGTCGTGAATGGGTAGCAGCGTCGACTGGTGGGGATGAAGCCATTTATCGCGATTCCGTTAAGGACCGTTTTACTATTAGTCGCGACGCCAAGAA TTCCGTTTTTTTACAGATGAATAGTTTGAAACCGGAGGATACCGCCGTCTATTACTGTACTGCTGTAATCTCAACAGACCGGGATGGTACAGAGTGGCGTCGCTATTGGGGCCAGGGGACGCAGGTTACAGTGAGTTCTGGTGGTGGCTATCCGTACGATGTCCCGGATTACGCGTAAGCTTGACACG Construction of plasmids containing immune-modulating gene combinations 1. pFliC-IL15-αPDL1N (N=nanobody) bicistronic operon To generate the bicistronic plasmid pFliC-IL15-αPDL1N, the IL15-αPDL1N gBlock and pFliC-IL15 plasmids (see above) were digested with DraIII and HindIII. The digested plasmid was treated with alkaline phosphatase and ligated to the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-IL15-αPDL1N construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0146] IL15-αPDL1N gBlock(1555bp): 2. pFliC-P contains a pentacistronic operon with IL12, IL18, IL15, αPDL1N, and αCTLA4N (N=nanobody) Two steps were used to generate the pFliC-P plasmid with a pentacistronic operon. The first step involved cloning the IL12 gene. In the second step, the remaining four gene sequences were added to the pFliC-IL12 plasmid.

[0147] Step 1: pFliC-IL12D gBlock and pFliC-IL15 plasmids (see above) were digested with DraIII and HindIII. The digested plasmids were treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-IL12D construct.

[0148] pFliC-IL12D gBlock(1960bp): Step 2: The "penta gBlock 2 MH" gBlock and plasmid pFliC-IL12D were digested with MluI and HindIII. The digested plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212, plasmid DNA was isolated, and the plasmid was sequenced to confirm the FliC-P construct. The correct plasmid was used to transform strain χ3730A; the plasmid was isolated from the transformant and used to transform strain BCT13.

[0149] "penta gBlock 2 MH" gBlock(2663bp): 3. pFliC-P-Lux contains a pentacistronic operon with IL12, IL18, IL15, αPDL1N, and αCTLA4N, and a lux operon (N=nanobody) To track tumor colonization by bioluminescence, the lux operon was inserted into the pFliC-P plasmid.

[0150] pGRG36-LacUV5-Lux was used as the source of the LacUV5-Lux operon. The LacUV5-Lux operon was amplified from pLux(6) using the following primers:

[0151] Lux PacI Fwd 60.2: 5'ACT GTT AAT TAA GAA GAC CTT CCA TTC TG 3' Lux XhoI Rev 60.4: 5'-AGG ATT CTC GAG TTA TCA ACT ATC AAA CGC TTC GGT TAA G-3' The PCR product was digested with PacI and XhoI and ligated into pGRG36 (7) cut with the same enzymes. The recombinant pGRG36-LacUV5-Lux plasmid was confirmed by restriction digestion of the plasmid and bioluminescence of bacteria containing this plasmid. The pGRG36-LacUV5-Lux plasmid was cut with PacI and XhoI and the ends were made blunt. pFliC-P was cut with HindIII, the ends were made blunt, and treated with alkaline phosphatase. These two cut plasmids were ligated and used to transform strain χ6212. The resulting colonies were screened for bioluminescence; plasmids were isolated from positive clones and the constructs were confirmed by PCR and sequencing. This plasmid was used to transform strain χ3730A and the plasmid was isolated from the transformants. This plasmid was used to transform strain BCT14 and Lux ​​expression was again confirmed by colony bioluminescence.

[0152] literature

[0153] [Table 6]

[0154] Example IV Strain construction BCT2(χ11091+fliC-fljB-fimH-rfaL-pgtE * ) Salmonella enterica Typhimurium strain χ11091 was used as a starting point to generate strain BCT2 with the following modifications to reduce virulence: deletion of the fliC gene; deletion of the fljB gene; deletion of the fimH gene; deletion of the rfaL gene; and a single nucleotide change in the pgtE promoter to increase expression. All these modifications were performed using the DIRex protocol (1). Details of these experiments have been described previously (2).

[0155] BCT2E (BCT2+eca-) The enterobacterial common antigen (3) locus (eca) was deleted in BCT2 to reduce virulence using the DIRex protocol (1) and the following primers: eca FP1: AAGTGTAATGTTCTAACAGGTCTCTTCTAGGAGCTGGCGTTCTCCCTTCTGATGAGTGTAGGCTGGAGCTGCTTC eca RP1: CCATAAGCACAATCCGCTGCTCAAGTCATCAGAAGGGAGAACGCCAGCTCCTAGAGTGTAGGCTGGAGCTGCTTC

[0156] [Table 7]

[0157] Table 1. Toxicity of strains BCT2 and BCT2E. Based on data from two cohorts of nine mice each, strain BCT2E injected into the tail vein of non-tumor-burdened Balb / C mice results in less than half the toxicity observed with strain BCT2. All mice received 100 microliter injections as previously described (2, 11), with the following modifications: Day 2: (4 mg / kg VDA + 50 mg / kg CBD) IP. Day 0: 4 × 10 6 cfu of BCT2(pLux) or BCT2E(pLux)-3 h-4 × 10 6 cfu of BCT2(pLux) or BCT2E(pLux)-2 hours-(1mg / kg VDA + 50mg / kg CBD). Coating / motility was observed on a scale of 0-3=normal-poor. One mouse from the BCT2 cohort experienced extreme weight loss and became moribund, and one mouse from the BCT2E cohort was found dead on day 1 and were considered outliers and were not included in the analysis.

[0158] BCT5 (BCT2+rpoS-+viaB) The rpoS gene encodes the RNA polymerase sigma factor (4). This gene was deleted using the DIRex protocol (1) and the following primers:

[0159] rpoS FP1: TTGCTAGTTCCGTCAAGGGATCACGGGTAGGAGCCACCTTGTACCCTTGTCAAAAGTGTAGGCTGGAGCTGCTTC rpoS RP1: AAGGCCAGTCGACAGACTGGCCTTTTTTTGACAAGGGTACAAGGTGGCTCCTACCGTGTAGGCTGGAGCTGCTTC The ViaB capsule-encoding locus from Salmonella Typhi Ty2 ( 5 , 6 ) was PCR amplified and inserted into the BCT2 chromosome at the attTn7 site using λ red recombination ( 7 ).

[0160] viaB PCR forward primer: 5'-CGGGGTACCAGTATGACGTTCTGACGGTT-3' viaB PCR reverse primer: 5'-CGGGGTACCATTTTCAGCTCTGAAGTACA-3' BCT14(BBCT2+fljA-rflP-flgKL-motAB-;flhDp→FF+20 * ;eca-) We exploited the flagellar type III secretion system (8) to secrete bacterially expressed immune modulators into the tumor microenvironment, and to further reduce virulence, we engineered several deletions in the BCT2 strain. All modifications were made using the DIRex protocol (1) and the primers indicated.

[0161] Deletion of the fljA gene fljA FP1: ATTCGGGGCTTTTTCATTTAGCATAGATGAATATATATTTCGCCTACGGTAATAAGTGTAGGCTGGAGCTGCTTC fljA RP1: AGTTTTACTTTTCTCACGGAATTTTTTATTACCGTAGGCGAAATATATATTCATCGTGTAGGCTGGAGCTGCTTC Deletion of the rflP gene rflP FP1: ACTGGATGGCGAATAGCGCCCTAACCATGGGACTGGCGTA CCTTTCTGTTTGCCGGTGTAGGCTGGAGCTGCTTC rflP RP1: AGACGGTTAATCACCGGTTAAACACCGGCAAACAGAAAGG TACGCCAGTCCCATGGTGTAGGCTGGAGCTGCTTC Deletion of the flgKL gene flgKL FP1: GCCGATAACAACGAGTATTGAAGGATTAAAAGGAACCATCCACCTCTTTTTGAAAGTGTAGGCTGGAGCTGCTTC flgKL RP1: AAAACATATCCAGTTTCGTGATATGTTTCAAAAAGAGGTGGATGGTTCCTTTTAAGTGTAGGCTGGAGCTGCTTC Deletion of the motAB genes motAB FP1: CTGCGCATCCTGTCATAGTCAACAGCGGAAGGATGATGTCTAGCGTGAGCATGGAGTGTAGGCTGGAGCTGCTTC motAB RP1: AAATGTCTGATAAAAATCGCTAATATCCATGCTCACGCTA GACATCATCCTTCCGGTGTAGGCTGGAGCTGCTTC The flhDp promoter sequence for flagellar gene expression was inserted into tumor-specific FF+20 * (9) to restrict expression of these genes to the tumor microenvironment.

[0162] Promoter replacement: flhDp → FF+20 * flhDp→FF+20 * FP1-2: GGATGCTTCATTTAAATGGGTGAACAAGGAAAGCTAAAAGGGATCAGGTAAATTTGATGTACATCAAATGGATCCAGATCGATGTTTAAAGATCCCCCTCACTCCTGCCATCATTCTGATATTGAAAT AAGAGAGGAGGAACATAAGTGTAGGCTGGAGCTGCTTC flhDp→FF+20 * RP1: AAATGTGTTTTAGCAACTCGGATGTATGCATTGTTCCCATTTATGTTCCTCCTCTCTTATTTCAATATCAGAATGATGGCAGGAGTGAGGGGATCTTTAAACATCGATCTGGATCCATTTGATGTACATCAAATTTACCTGATCCGTGTAGGCTGGAGCTGCTTC Deletion of the eca locus(3) to reduce virulence in the BCT2E strain eca FP1: AAGTGTAATGTTCTAACAGGTCTCTTCTAGGAGCTGGCGTTCTCCCTTCTGATGAGTGTAGGCTGGAGCTGCTTC eca RP1: CCATAAGCACAATCCGCTGCTCAAGTCATCAGAAGGGAGAACGCCAGCTCCTAGAGTGTAGGCTGGAGCTGCTTC BCT14-PL-Lux The PL-Lux operon was inserted into the chromosomal attTn7 site using λred recombination (7). In this construct, the lux operon is driven by the λPL promoter (10). The lux operon was amplified from pLux (2) with the following primers, which contain the PL promoter sequence and relevant restriction enzyme sites:

[0163] PL-Lux PacI Fwd: 5'-ACT GTT AAT TAA TTA TCT CTG GCG GTG TTG ACA TAA ATA CCA CTG GCG GTG ATA CTG AGC ACA TCA GCA GGA CGC ACT GAC CCA CAA TAG GAG GAA CAT AAA TGA CTA AA-3' Lux XhoI Rev 60.4: 5'-AGG ATT CTC GAG TTA TCA ACT ATC AAA CGC TTC GGT TAA G-3' The PCR product was digested with PacI and XhoI and ligated into pGRG36 (7) cut with the same enzymes. The recombinant pGRG36-PL-Lux plasmid was confirmed by restriction digestion of the plasmid and bioluminescence of bacteria containing the plasmid. The PL-Lux operon from pGRG36-PL-Lux was then inserted into the attTn7 site of the BCT13 chromosome using λred recombination (7), followed by deletion of the eca locus (3) as described for BCT2E.

[0164] literature

[0165] [Table 8-1]

[0166] [Table 8-2]

[0167] Example V KK: BCT15 (BCT14+viaB locus) The ViaB capsule-encoding locus from Salmonella Typhi Ty2 (χ8073) ( 1 , 2 ) was PCR amplified and inserted into the attTn7 site of the BCT14 chromosome using λred recombination ( 3 ).

[0168] viaB PCR forward primer: 5'-CGGGGTACCAGTATGACGTTCTGACGGTT-3' viaB PCR reverse primer: 5'-CGGGGTACCATTTTCAGCTCTGAAGTACA-3' BCT16 (BCT14+glmS-) The glmS gene (4) was deleted in strains χ6212, χ3730A, and BCT14, resulting in another balanced lethal selection in addition to the asd deletion. The DIRex protocol (5) was used with the following primers for the deletion in BCT14:

[0169] glmS FP1

[0170] [ka]

[0171] glmS RP1

[0172] [ka]

[0173] Plasmids: pGlmS pGlmS contains the glmS gene that complements the glmS chromosomal deletion in BCT16. To construct pGlmS, the pNG.1 plasmid was digested with BspH1 and BspE1 and ligated into pGlmS gBlock1 cut with BspH1 and EcoR1-HF, and pGlmS gBlock2 cut with EcoR1-HF and BspE1. The ligation was used to transform strain χ6212 glmS-, plasmid DNA was isolated, and the plasmid was sequenced to confirm the pGlmS construct. The correct plasmid was used to transform strain χ3730A glmS-, and plasmid was isolated from the transformant.

[0174] pGlmS gBlock1(1058bp)

[0175] [ka]

[0176] pGlmS gBlock2(2404bp)

[0177] [ka]

[0178] pGlmS-CXCL9-10 To generate pGlmS-CXCL9-10, the pGlmS plasmid was digested with NheI, blunt-ended, and treated with alkaline phosphatase. pFliC-CXCL9-10 was digested with HindIII and DraIII, blunt-ended, and ligated into the digested pGlmS plasmid. The ligation was used to transform strain χ6212glmS-, plasmid DNA was isolated, and the plasmid construct was confirmed by sequencing. The correct plasmid was used to transform strain χ3730AglmS; the plasmid was isolated from the transformant and used to transform strain BCT16.

[0179] pGlmS-aCD47N (N=nanobody) To generate pGlmS-aCD47, the pGlmS plasmid was digested with NheI, blunt-ended, and treated with alkaline phosphatase. pFliC-aCD47 was digested with HindIII and DraIII, blunt-ended, and ligated into the digested pGlmS plasmid. The ligation was used to transform strain χ6212glmS-, plasmid DNA was isolated, and the plasmid construct was confirmed by sequencing. The correct plasmid was used to transform strain χ3730AglmS-; the plasmid was isolated from the transformant and used to transform strain BCT16.

[0180] pGlmS-INF (Interferon α + λ bicistronic operon) To generate pGlmS-INF, the pGlmS plasmid and the pGmsS-INF gBlock were digested with NheI and BsaI. The digested pGlmS plasmid was treated with alkaline phosphatase and ligated into the digested gBlock. The ligation was used to transform strain χ6212glmS-, plasmid DNA was isolated, and the plasmid construct was confirmed by sequencing. The correct plasmid was used to transform strain χ3730AglmS-; the plasmid was isolated from the transformant and used to transform strain BCT16.

[0181] pGlmS-INF gBlock(1710bp)

[0182] [ka]

[0183] literature

[0184] [Table 9]

[0185] Some embodiments 1. An attenuated Salmonella cell, comprising: a) a mutation or deletion in one or more Salmonella genes encoding cell surface proteins that induce IL-6 secretion, resulting in reduced or no expression of said one or more cell surface proteins, and optionally b) increased expression of one or more outer membrane proteases that inhibit complement activation and / or decreased expression of cell surface lipopolysaccharide protein (LPS) compared to control cells; , comprising a cell.

[0186] 2. The cell of embodiment 1, which is a S. Typhimurium cell. 3. The cell of embodiment 1 or 2, wherein the one or more Salmonella genes encode flagellin, fimbria, O-antigen, and / or lipopolysaccharide protein (LPS).

[0187] 4. The cell of any one of embodiments 1 to 3, wherein the one or more Salmonella genes are fliC, fljB, fimH, and / or rfaL. 5. The cell of any one of embodiments 1 to 4, wherein the one or more outer membrane proteases is PgtE.

[0188] 6. The cell of any one of embodiments 1 to 5, further comprising a deletion of the enterobacterial common antigen locus (eca). 7. The cell of any one of embodiments 1 to 6, further comprising a deletion of the rpoS gene, a deletion of glmS, and / or the addition of the viaB locus.

[0189] 8. The cell of any one of embodiments 1 to 7, further comprising a deletion of one or more of the fljA, rflP, flgKL, and / or motAB genes. 9. A cell according to any one of the preceding embodiments, wherein the flhDP promoter is replaced with a tumor-specific expression promoter.

[0190] 10. Tumor-specific expression promoter is FF+20 * 10. The cell of embodiment 9, which is a promoter. 11. The cell of any one of embodiments 1 to 10, wherein the cell comprises one or more exogenous immunomodulator genes that express an exogenous immunomodulator protein.

[0191] 12. The cell of embodiment 11, wherein the immune regulator gene expresses IL-12, IL-18, IL-15, CXCL9-10, aCTLA-4 single chain variable fragment (scFv), aPD-L1 scFv, aCTLA-4 single domain antibody (sdAb), aPD-L1 sdAb and / or aCD47 sdAb.

[0192] 13. The cell of any one of embodiments 11-12, wherein the immunomodulatory factor protein is secreted from the cell. 14. The cell according to any one of embodiments 11 to 13, wherein one or more exogenous immune modulator genes are under the control of a tumor-specific expression promoter.

[0193] 15. Tumor-specific expression promoter is FF+20 * 15. The cell of embodiment 14, wherein said cell is 16. A composition comprising a cell population according to any one of embodiments 1-15 or a combination thereof, and a pharma- ceutically acceptable carrier.

[0194] 17. A method for treating cancer, comprising administering to a subject in need thereof an effective amount of a cell population described in any one of embodiments 1-15, a combination thereof, or a composition described in embodiment 16, so as to treat the cancer.

[0195] 18. A method for inhibiting tumor growth / proliferation or reducing tumor volume / size, comprising administering to a subject in need thereof an effective amount of a cell population described in any one of embodiments 1-15, a combination thereof, or a composition described in embodiment 16 so as to inhibit tumor growth or reduce tumor volume.

[0196] 19. A method for treating metastasis, reducing the formation / number of metastases or inhibiting the spread of metastases, comprising administering to a subject in need thereof an effective amount of a cell population according to any one of embodiments 1-15, a combination thereof, or a composition according to embodiment 16, so as to treat metastasis, reduce the formation / number of metastases or inhibit the spread of metastases.

[0197] 20. The method of any one of embodiments 17-19, wherein the tumor, cancer, or metastasis is a lung, liver, kidney, breast, prostate, pancreas, colon, head and neck, ovarian, and / or gastrointestinal tumor, tumor-associated cell, cancer, or metastasis.

[0198] 21. The method of any one of embodiments 17 to 20, wherein the cells or composition are administered systemically, for example intravenously. 22. The method of any one of embodiments 17-21, wherein the cells are administered more than once.

[0199] 23. The method of any one of embodiments 17-22, further comprising administering a vascular disrupting agent (VDA) and / or cannabidiol (CBD). 24. The method of embodiment 24, wherein the VDA and / or CBD are administered before and / or during treatment (after at least one administration of cells).

[0200] 25. The method of embodiment 23 or 24, wherein the VDA and / or CBD are administered two or more times. 26. The method of any one of embodiments 23 to 25, wherein the VDA is VDA combretastatin A4 phosphate and / or VDA CKD-516.

[0201] 27. The method of any one of embodiments 17-26, wherein an anti-interleukin-6 (IL-6) is administered. 28. A method for reducing the toxicity of Salmonella, comprising: a) a deletion of one or more Salmonella genes encoding cell surface proteins that induce IL-6 secretion, resulting in reduced or no expression of said one or more cell surface proteins, and optionally b) increased expression of one or more outer membrane proteases that inhibit complement activation and / or decreased expression of cell surface lipopolysaccharide protein (LPS) compared to control cells; A method comprising:

[0202] 29. The method of embodiment 28, wherein the Salmonella is a S. Typhimurium cell. 30. The method of embodiment 28 or 29, wherein the one or more Salmonella genes encode flagellin, fimbria, O-antigen, and / or lipopolysaccharide protein (LPS).

[0203] 31. The method of any one of embodiments 28 to 30, wherein the one or more Salmonella genes are fliC, fljB, fimH, and / or rfaL. 32. The method of any one of embodiments 28 to 31, wherein the one or more outer membrane proteases are PgtE.

[0204] 33. The method of any one of embodiments 28 to 32, further comprising a deletion of the enterobacterial common antigen locus (eca). 34. The method of any one of embodiments 28 to 33, further comprising a deletion of the rpoS gene and / or an addition of the viaB locus.

[0205] 35. The method of any one of embodiments 28 to 34, further comprising a deletion of one or more of the fljA, rflP, flgKL, and / or motAB genes. 36. The method according to any one of embodiments 28 to 35, wherein the flhDP promoter is replaced with a tumor-specific expression promoter.

[0206] 37. Tumor-specific expression promoter is FF+20 * 37. The method of claim 36 which is a promoter. All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event that the definitions of terms incorporated by reference conflict with terms defined in this specification, the specification shall control.

Claims

1. 1. An attenuated Salmonella cell, comprising: a) a mutation or deletion in one or more Salmonella genes encoding cell surface proteins that induce IL-6 secretion, which mutation or deletion results in reduced or no expression of said one or more cell surface proteins; and optionally b) increased expression of one or more outer membrane proteases that inhibit complement activation and / or decreased expression of cell surface lipopolysaccharide protein (LPS) compared to control cells; including, cells.

2. 2. The cell of claim 1, wherein the cell is a S. Typhimurium cell.

3. The cell of claim 1 , wherein the one or more Salmonella genes encode flagellin, fimbria, O antigen, and / or lipopolysaccharide protein (LPS).

4. 2. The cell of claim 1, wherein the one or more Salmonella genes are fliC, fljB, fimH, and / or rfaL.

5. The cell of claim 1 , wherein the one or more outer membrane proteases is PgtE.

6. The cell of claim 1 , further comprising a deletion of the enterobacterial common antigen locus (eca).

7. 2. The cell of claim 1, further comprising a deletion of the rpoS gene, a deletion of glmS, and / or an addition of the viaB locus.

8. The cell of claim 1 further comprising a deletion of one or more of the fljA, rflP, flgKL, and / or motAB genes.

9. The cell of claim 1, wherein the flhDP promoter is replaced with a tumor-specific expression promoter.

10. The tumor-specific expression promoter is FF+20 * The cell of claim 9, which is a promoter.

11. The cell of claim 1 , wherein the cell comprises one or more exogenous immunomodulator genes that express an exogenous immunomodulator protein.

12. 12. The cell of claim 11, wherein the immune modulator gene expresses IL-12, IL-18, IL-15, CXCL9-10, αCTLA-4 single chain variable fragment (scFv), αPD-L1 scFv, αCTLA-4 single domain antibody (sdAb), αPD-L1 sdAb, and / or αCD47 sdAb.

13. The cell of claim 11 , wherein the immunomodulator protein is secreted from the cell.

14. The cell of claim 11 , wherein the one or more exogenous immunomodulator genes are under the control of a tumor-specific expression promoter.

15. The tumor-specific expression promoter is FF+20 * The cell of claim 14,

16. 10. A composition comprising the cell population of claim 1 or a combination thereof and a pharmaceutically acceptable carrier.

17. 10. A pharmaceutical composition for treating cancer, comprising an effective amount of the cell population of claim 1 and administered to a subject in need thereof to treat the cancer.

18. 10. A pharmaceutical composition for inhibiting tumor growth / proliferation or reducing tumor volume / size, said pharmaceutical composition comprising an effective amount of the cell population of claim 1 and administered to a subject in need thereof to suppress tumor growth or reduce the volume of said tumor.

19. A pharmaceutical composition for treating metastasis, reducing the formation / number of metastases, or inhibiting the spread of metastases in a tumor or cancer, said pharmaceutical composition comprising an effective amount of the cell population described in claim 1 and being administered to a subject in need thereof to treat metastasis, reducing the formation / number of metastases, or inhibiting the spread of metastases.

20. 18. The pharmaceutical composition of claim 17, wherein the cancer is a cancer of the lung, liver, kidney, breast, prostate, pancreas, colon, head and neck, ovary, and / or digestive system.

21. 18. The pharmaceutical composition of claim 17, wherein the cell population is administered systemically, for example, intravenously.

22. 18. The pharmaceutical composition of claim 17, wherein the cell population is administered two or more times.

23. 18. The pharmaceutical composition of claim 17, further comprising a vascular disrupting agent (VDA) and / or cannabidiol (CBD).

24. 24. The pharmaceutical composition method of claim 23, wherein the VDA and / or CBD is administered before and / or during treatment (after at least one administration of the cell population).

25. 24. The pharmaceutical composition of claim 23, wherein the VDA and / or CBD is administered two or more times.

26. 24. The pharmaceutical composition of claim 23, wherein the VDA is VDA combretastatin A4 phosphate and / or VDA CKD-516.

27. 18. The pharmaceutical composition of claim 17, further comprising an anti-interleukin-6 (IL-6) agent.

28. 1. A method for reducing the virulence of Salmonella bacteria, comprising: a) deletion of one or more Salmonella genes encoding cell surface proteins that induce IL-6 secretion, resulting in reduced or no expression of said one or more cell surface proteins; and optionally b) increased expression of one or more outer membrane proteases that inhibit complement activation and / or decreased expression of cell surface lipopolysaccharide protein (LPS) compared to control cells; A method comprising:

29. 29. The method of claim 28, wherein the Salmonella is a S. Typhimurium cell.

30. 29. The method of claim 28, wherein the one or more Salmonella genes encode flagellin, fimbria, O antigen, and / or lipopolysaccharide protein (LPS).

31. 29. The method of claim 28, wherein the one or more Salmonella genes are fliC, fljB, fimH, and / or rfaL.

32. 29. The method of claim 28, wherein the one or more outer membrane proteases is PgtE.

33. 29. The method of claim 28, further comprising a deletion of the enterobacterial common antigen locus (eca).

34. 29. The method of claim 28, further comprising a deletion of the rpoS gene and / or the addition of the viaB locus.

35. 29. The method of claim 28, further comprising a deletion of one or more of the fljA, rflP, flgKL, and / or motAB genes.

36. 29. The method of claim 28, wherein the flhDP promoter is replaced with a tumor-specific expression promoter.

37. The tumor-specific expression promoter is FF+20 * 37. The method of claim 36, wherein the promoter is a promoter.