Compositions and methods for producing circular polyribonucleotides

Abstract

The present disclosure relates generally to compositions and methods for producing, purifying, and using circular RNA.

Description

[Background technology]

[0001] A need exists for methods of making, purifying, and using circular polyribonucleotides. Summary of the Invention [Means for solving the problem]

[0002] The present disclosure provides compositions and methods for producing, purifying, and using circular RNA.

[0003] In one aspect, the invention features a linear polyribonucleotide having the formula 5'-(A)-(B)-(C)-(D)-(E)-(F)-(G)-3'. The linear polyribonucleotide includes, from 5' to 3', (A) a 3' half of a Group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a Group I catalytic intron fragment. The polyribonucleotide has 2 to 50, such as 5 to 50, such as 6 to 50, such as 7 to 50, such as 8 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, such as at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and comprises: (A) the 3' half of a group I catalytic intron fragment; (B) a 3' splice site; or (C) a first annealing region present within a 3' exon fragment. The polyribonucleotide also has 2 to 50, such as 5 to 50, such as 6 to 50, such as 7 to 50, such as 8 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, such as at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and comprises: (E) a 5' exon fragment; (F) a 5' splice site; or (G) a second annealing region present within the 5' half of the group I catalytic intron fragment. The first annealing region has 80% to 100% (e.g., 85% to 100%, e.g., 90% to 100%, e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity with the second annealing region, or has 0 to 10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatch bases.

[0004] In another aspect, the invention features a linear polyribonucleotide having the formula 5'-(A)-(B)-(C)-(D)-(E)-(F)-(G)-3', the linear polyribonucleotide comprising, from 5' to 3', (A) a 3' half of a group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a group I catalytic intron fragment, wherein the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena. The polyribonucleotide has 5 to 50, e.g., 6 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and comprises: (A) the 3' half of a Group I catalytic intron fragment; (B) a 3' splice site; or (C) a first annealing region present within a 3' exon fragment. The polyribonucleotide has 5-50, e.g., 6-50 (e.g., 10-30, 10-20, or 10-15, e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and also includes: (E) a 5' exon fragment; (F) a 5' splice site; or (G) a second annealing region present within the 5' half of the group I catalytic intron fragment.The first annealing region has 80% to 100% (e.g., 85% to 100%, e.g., 90% to 100%, e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity with the second annealing region, or has 0 to 10, e.g., (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatch base pairs.

[0005] In another aspect, the invention features a linear polyribonucleotide having the formula 5'-(A)-(B)-(C)-(D)-(E)-(F)-(G)-3', the linear polyribonucleotide comprising, from 5' to 3', (A) a 3' half of a group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a group I catalytic intron fragment, wherein the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a Tetrahymena pre-rRNA. The polyribonucleotide has 6 to 50, e.g., 7 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, e.g., at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and comprises: (A) a 3' half of a group I catalytic intron fragment; (B) a 3' splice site; or (C) a first annealing region present within a 3' exon fragment. The polyribonucleotide has 6 to 50, e.g., 7 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, e.g., at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and also includes: (E) a 5' exon fragment; (F) a 5' splice site; or (G) a second annealing region that is within the 5' half of the group I catalytic intron fragment. The first annealing region has 80% to 100% (e.g., 85% to 100%, e.g., 90% to 100%, e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity with the second annealing region, or has 0 to 10, e.g., (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatch base pairs.

[0006] In some embodiments, (A) or (C) comprises a first annealing region and (E) or (G) comprises a second annealing region.

[0007] In some embodiments, the 3' exon fragment of (C) comprises a first annealing region and the 5' exon fragment of (E) comprises a second annealing region.

[0008] In some embodiments, the 3' exon fragment of (C) comprises a first annealing region and the 5' half of the group I catalytic intron fragment of (G) comprises a second annealing region.

[0009] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) comprises a first annealing region and the 5' exon fragment in (E) comprises a second annealing region.

[0010] In some embodiments, the first annealing region and the second annealing region contain zero or one mismatched base pair.

[0011] In some embodiments, the first annealing region and the second annealing region are 100% complementary.

[0012] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena, a pre-rRNA of Tetrahymena, or a td gene of T4 phage.

[0013] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena, the 3' exon fragment in (C) comprises a first annealing region, and the 5' exon fragment in (E) comprises a second annealing region. The first annealing region may comprise, for example, 5 to 50, e.g., 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides, and the second annealing region may comprise, for example, 5 to 50, e.g., 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides.

[0014] In some embodiments, the 3' half of the group I catalytic intron fragment of (A) and the 5' half of the group I catalytic intron fragment of (G) are derived from Tetrahymena pre-rRNA, and the 3' half of the group I catalytic intron fragment of (A) comprises a first annealing region and the 5' exon fragment of (E) comprises a second annealing region. In some embodiments, the 3' exon fragment of (C) comprises a first annealing region and the 5' half of the group I catalytic intron fragment of (G) comprises a second annealing region. The first annealing region may comprise, for example, 6 to 50, e.g., 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region may comprise, for example, 6 to 50, e.g., 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0015] In some embodiments, the 3' half of the group I catalytic intron fragment of (A) and the 5' group I catalytic intron fragment of (G) are derived from the td gene of T4 phage. The 3' exon fragment of (C) may comprise a first annealing region and the 5' half of the group I catalytic intron fragment of (G) may comprise a second annealing region. The first annealing region may comprise, for example, 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides and the second annealing region may comprise, for example, 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0016] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is the 5' end of the linear polynucleotide.

[0017] In some embodiments, the 5' half of the group I catalytic intron fragment of (G) is the 3' end of a linear polyribonucleotide.

[0018] In some embodiments, the linear polyribonucleotide does not comprise an additional annealing region.

[0019] In some embodiments, the linear polyribonucleotide does not include an annealing region 3' of (A) that comprises partial or complete nucleic acid complementarity with a 5' annealing region of (G).

[0020] In some embodiments the polyribonucleotide cargo of (D) comprises expressed sequences, non-coding sequences, or expressed sequences and non-coding sequences.

[0021] In some embodiments the polyribonucleotide cargo of (D) comprises an expressible sequence that encodes a polypeptide.

[0022] In some embodiments the polyribonucleotide cargo of (D) comprises an IRES operably linked to an expression sequence encoding a polypeptide.

[0023] In some embodiments, the IRES is located upstream of the expressed sequence. In some embodiments, the IRES is located downstream of the expressed sequence.

[0024] In some embodiments the polyribonucleotide cargo of (D) comprises an expressible sequence that encodes a polypeptide that has a biological effect on a subject.

[0025] In some embodiments, the linear polyribonucleotide further comprises a first spacer region between the 3' exon fragment of (C) and the polyribonucleotide cargo of (D). The first spacer region may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, the linear polyribonucleotide further comprises a second spacer region between the polyribonucleotide cargo of (D) and the 5' exon fragment of (E). The second spacer region may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, each spacer region is at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. Each spacer region may have a length of, for example, 5 to 500 (for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may include a polyA sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may include a polyAC sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may include a polyAG sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may include a polyAT sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a random sequence.

[0026] In some embodiments, the linear polyribonucleotide is 50 to 20,000, e.g., 100 to 20,000, e.g., 200 to 20,000, e.g., 300 to 20,000 (e.g., 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, In embodiments, the linear polyribonucleotide may be at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length.

[0027] In another aspect, the invention features a DNA vector including an RNA polymerase promoter operably linked to a DNA sequence encoding a linear polyribonucleotide of any of the embodiments described herein.

[0028] In another aspect, the invention features a circular polyribonucleotide (e.g., a covalently closed circular polyribonucleotide) generated from a linear polyribonucleotide or DNA vector of any of the embodiments described herein.

[0029] In another aspect, the invention features a circular polyribonucleotide (eg, a covalently closed circular polyribonucleotide) that has a splice bond connecting a 5' exon fragment and a 3' exon fragment. The 3' exon fragment comprises a first annealing region comprising 2 to 50, for example, 5 to 50, for example, 6 to 50, for example, 7 to 50, for example, 8 to 50 (for example, 10 to 30, 10 to 20, or 10 to 15, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides; The 5' exon fragment comprises a second annealing region comprising 2 to 50, for example, 5 to 50, for example, 6 to 50, for example, 7 to 50, for example, 8 to 50 (for example, 10 to 30, 10 to 20, or 10 to 15, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides. In an embodiment, the first annealing region and the second annealing region comprise 80% to 100% (e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity. In an embodiment, the first annealing region and the second annealing region comprise 0 to 10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatched base pairs (bp). In an embodiment, the circular polynucleotide further comprises a polyribonucleotide cargo. In an embodiment, the polyribonucleotide cargo comprises an expressed (or coding) sequence, a non-coding sequence, or a combination of expressed (or coding) sequence and non-coding sequence. In an embodiment, the polyribonucleotide cargo comprises an expressed (coding) sequence encoding a polypeptide. In an embodiment, the polyribonucleotide comprises an IRES operably linked to an expressed sequence encoding a polypeptide.In some embodiments, the circular polyribonucleotide further comprises a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment. The spacer region may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. The spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. In some embodiments, the spacer region comprises a polyA sequence. In some embodiments, the spacer region comprises a polyAC sequence. In some embodiments, the spacer region comprises a polyAG sequence. In some embodiments, the spacer region comprises a polyAT sequence. In some embodiments, the spacer region comprises a random sequence.

[0030] In some embodiments, the cyclic polyribonucleotide is 50 to 20,000, e.g., 100 to 20,000, e.g., 200 to 20,000, e.g., 300 to 20,000 (e.g., 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, In embodiments, the cyclic polyribonucleotide is at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length.

[0031] In some embodiments, the circular polyribonucleotide is generated from a linear polyribonucleotide or vector described herein.

[0032] In another aspect, the invention features a method of expressing a polypeptide in a cell by providing the cell with a linear polyribonucleotide, a DNA vector, or a circular polyribonucleotide described herein, The method further includes enabling the cellular machinery to express the polypeptide from the polyribonucleotide.

[0033] In another aspect, the invention features a method of producing a circular polyribonucleotide described herein by providing a linear polyribonucleotide described herein under conditions suitable for self-splicing of the linear polyribonucleotide to produce a circular polyribonucleotide.

[0034] definition To facilitate understanding of the present disclosure, several terms are defined below. Terms defined herein have the meanings as commonly understood by those skilled in the art in the areas relevant to the present disclosure. Terms such as "a", "an" and "the" are not intended to refer to a singular entity only, but also include general classes, specific examples of which may be used for illustration. The term "or" is used to mean "and / or" unless expressly specified to refer to alternatives only or the alternatives are not mutually exclusive, but the present disclosure supports a definition that refers to alternatives only and "and / or". Although the terms in this specification are used to describe specific embodiments, their use should not be construed as limiting, except as outlined in the claims.

[0035] As used herein, any value provided in a range of values ​​includes both the upper and lower limits, as well as any value subsumed within the upper and lower limits.

[0036] As used herein, the term "about" refers to a value within ±10% of the recited value.

[0037] As used herein, the term "carrier" refers to a compound, composition, reagent, or molecule that facilitates the transport or delivery of a composition (e.g., cyclic polyribonucleotide) to a cell, via a partially or fully encapsulated agent, or a combination thereof, by covalent modification of the cyclic polyribonucleotide. Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), nanoparticles (e.g., nanoparticles encapsulated or covalently attached to cyclic polyribonucleotides), liposomes, fusosomes, exosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently attached to polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfection reagents).

[0038] As used herein, the terms "cyclic polyribonucleotide" and "cyclic RNA" are used interchangeably and refer to a polyribonucleotide molecule having a structure that does not have free ends (i.e., free 3' and / or 5' ends), e.g., a polyribonucleotide molecule that forms a circular or endless structure through covalent or non-covalent bonds. A circular polyribonucleotide may be, for example, a covalently closed polyribonucleotide.

[0039] As used herein, the term "circularization efficiency" is a measure of the resulting circular polyribonucleotide relative to its non-circular starting material.

[0040] As used herein, the terms "disease," "disorder," and "condition" each refer to a state of less than optimal health, e.g., a condition that is or would be normally diagnosed or treated by a medical professional.

[0041] "Heterologous" means occurring under a situation other than the naturally occurring (natural) situation. A "heterologous" polynucleotide sequence indicates that the polynucleotide sequence is used in a manner other than that found in the sequence's native genome. For example, a "heterologous promoter" is used to drive the transcription of a sequence that is not naturally transcribed by that promoter; therefore, a "heterologous promoter" sequence is often included in an expression construct using recombinant nucleic acid technology. The term "heterologous" is also used to refer to a given sequence that is placed in a non-naturally occurring relationship with another sequence; for example, a heterologous coding or non-coding nucleotide sequence is commonly inserted into a genome by genome transformation techniques, resulting in a genetically modified or recombinant genome.

[0042] As used herein, "increasing fitness" or "promoting fitness" of a subject refers to any favorable alteration in the physiology or any activity carried out by the subject organism as a result of administration of a peptide or polypeptide described herein, including, but not limited to, any one or more of the following desired effects: (1) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more increase in resistance to biotic or abiotic stress; (2) about a 10% increase in yield or biomass; (3) an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in flowering time; (4) an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in resistance to pests or pathogens; (5) an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in resistance to herbicides. (5) an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in the population of a target organism (e.g., an agriculturally important insect); (6) an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in the reproductive rate of a target organism (e.g., an insect, e.g., a honeybee or a silkworm); (7) an increase of about 10% in the motility of a target organism (e.g., an insect, e.g., a honeybee or a silkworm). , 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more increase; (8) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more increase in the body weight of a target organism (e.g., an insect, e.g., a honeybee or a silkworm); (9) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more increase in metabolic rate or activity of a target organism (e.g., an insect, e.g., a honeybee or a silkworm);(10) an increase in pollination (e.g., number of plants pollinated in a given time period) by a target organism (e.g., an insect, such as a honeybee or silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (11) an increase in the production of by-products (e.g., honey from honeybees or silk from silkworms) by a target organism (e.g., an insect, such as a honeybee or silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (12) an increase in the nutrient content (e.g., of a target organism (e.g., an insect) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; or (12) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more increase in the resistance of the target organism to a pesticide (e.g., a neonicotinoid (e.g., imidacloprid) or an organophosphate insecticide (e.g., a phosphorothioate, e.g., fenitrothion)), or (13) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more increase in the resistance of the target organism to a pesticide (e.g., a neonicotinoid (e.g., imidacloprid) or an organophosphate insecticide (e.g., a phosphorothioate, e.g., fenitrothion)), or (14) an enhancement of health or a reduction in disease in a target organism, such as a human or non-human animal. The increase in host fitness can be determined as compared to a target organism to which the modulator is not administered. Conversely, a "reduced fitness" of a subject refers to any undesirable alteration in the physiology or in any activity carried out by the subject organism as a result of administration of a peptide or polypeptide described herein, including, but not limited to, any one or more of the following intended effects: (1) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in biotic or abiotic stress tolerance; (2) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in yield or biomass; (3) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more alteration in flowering time;(4) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in pest or pathogen resistance; (4) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in herbicide resistance; (5) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in populations of target organisms (e.g., agriculturally important insects); (6) a reduction in the reproductive rate of a target organism (e.g., an insect, e.g., a honeybee or silkworm) of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (7) a reduction in the motility of a target organism (e.g., an insect, e.g., a honeybee or silkworm) of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (8) a reduction in the body weight of a target organism (e.g., an insect, e.g., a honeybee or silkworm) of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more. %, 70%, 80%, 90%, 95%, 99%, 100% or more reduction; (9) about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in metabolic rate or activity of a target organism (e.g., an insect, e.g., a honeybee or silkworm); (10) about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in pollination (e.g., number of plants pollinated in a given period) by a target organism (e.g., an insect, e.g., a honeybee or silkworm). 0% or more reduction;(11) about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the production of by-products (e.g., honey from honeybees or silk from silkworms) of a target organism (e.g., an insect, such as a honeybee or a silkworm);(12) about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the nutrient content (e.g., protein, fatty acids, or amino acids) of a target organism (e.g., an insect);or (13) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the resistance of the target organism to a pesticide (e.g., a neonicotinoid (e.g., imidacloprid) or an organophosphate insecticide (e.g., a phosphorothioate, e.g., fenitrothion)); (14) a reduction in the health or reduction in disease of the target organism, such as a human or non-human animal. The reduction in host fitness can be determined in comparison to a target organism to which the regulator has not been administered. It will be apparent to one of skill in the art that certain changes in the physiology, phenotype, or activity of a subject, such as altered flowering time in a plant, can be considered to increase the fitness of the subject or decrease the fitness of the subject, depending on the context (e.g., to adapt to changes in climate or other environmental conditions). For example, a delay in flowering (e.g., about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% reduction in plants in a population that flower on a given calendar date) may be a beneficial adaptation to later or cooler spring seasons and therefore may be considered to increase the fitness of the plant; conversely, a similar delay in flowering in the context of earlier or warmer spring seasons may be considered to decrease the fitness of the plant;

[0043] As used herein, the terms "linear RNA" or "linear polyribonucleotide" or "linear polyribonucleotide molecule" are used interchangeably and refer to a polyribonucleotide molecule having a 5' and a 3' end. Either or both of the 5' and 3' ends may be free ends or may be attached to another moiety. Linear RNA includes RNA that has not been circularized (e.g., not previously circularized) and can be used as starting material for circularization.

[0044] As used herein, the term "modified ribonucleotide" means a nucleotide having at least one modification to the sugar, nucleobase, or internucleoside linkage.

[0045] As used herein, the term "naked delivery" refers to a formulation for delivery to cells without the aid of a carrier or covalent modification of moieties that aid in delivery to cells. Naked delivery formulations do not include transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. For example, a naked delivery formulation of cyclic polyribonucleotide is a formulation that includes cyclic polyribonucleotide without covalent modification and does not include a carrier.

[0046] The term "pharmaceutical composition" is also intended to disclose that the cyclic or linear polyribonucleotide contained within the pharmaceutical composition can be used for the treatment of the human or animal body by therapy.

[0047] As used herein, the term "polynucleotide" refers to a molecule that includes one or more nucleic acid subunits or nucleotides, and can be used interchangeably with "nucleic acid" or "oligonucleotide." A polynucleotide can include one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. A nucleotide can include a nucleoside and at least one, two, three, four, five, six, seven, eight, nine, ten, or more phosphate (PO3) groups. A nucleotide can include a nucleobase, a five-carbon sugar (either ribose or deoxyribose), and one or more phosphate groups. A ribonucleotide is a nucleotide in which the sugar is ribose. Polyribonucleotide or ribonucleic acid, or RNA, can refer to a polymer that includes multiple ribonucleotides polymerized through phosphodiester bonds. A deoxyribonucleotide is a nucleotide in which the sugar is deoxyribose. As used herein, a polyribonucleotide sequence that represents thymine (T) is understood to represent uracil (U).

[0048] As used herein, the term "polyribonucleotide cargo" herein includes any sequence comprising at least one polyribonucleotide. In embodiments, the polyribonucleotide cargo comprises one or more expressed sequences, each expressed sequence encoding a polypeptide. In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences, such as polyribonucleotides with regulatory or catalytic functions. In embodiments, the polyribonucleotide cargo comprises a combination of expressed and non-coding sequences. In embodiments, the polyribonucleotide cargo comprises one or more polyribonucleotide sequences as described herein, for example, one or more regulatory elements, internal ribosome entry site (IRES) elements, or spacer sequences.

[0049] As used interchangeably herein, the terms "polyA" or "polyA sequence" refer to an untranslated flanking region of a nucleic acid molecule that is at least 5 nucleotides in length and consists of adenosine residues. In some embodiments, the polyA sequence is at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 nucleotides in length. In some embodiments, the polyA sequence is located 3' to (e.g., downstream of) an open reading frame (e.g., an open reading frame encoding a polypeptide), and the polyA sequence is present 3' to a termination sequence (e.g., a stop codon) such that the polyA is not translated. In some embodiments, the polyA sequence is located 3' to the termination sequence and the 3' untranslated region.

[0050] As used herein, nucleic acid elements are "operably linked" when they are placed in a vector such that they can be transcribed to form linear RNA, which can then be circularized into circular RNA using the methods provided herein.

[0051] Polydeoxyribonucleotide or deoxyribonucleic acid, or DNA, refers to a polymer comprising multiple deoxyribonucleotides polymerized via phosphodiester bonds. Nucleotides can be nucleoside monophosphates or nucleoside polyphosphates. Nucleotides refer to deoxyribonucleoside polyphosphates, such as deoxyribonucleoside triphosphates (dNTPs), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP), and deoxythymidine triphosphate (dTTP) dNTPs, including detectable tags (e.g., fluorophores), such as luminescent tags or markers. Nucleotides can include any subunit that can be incorporated into a growing nucleic acid chain. Such subunits may be A, C, G, T, or U, or any other subunits that are specific to one or more complementary A, C, G, T, or U, or that are complementary to purines (i.e., A or G, or variants thereof) or pyrimidines (i.e., C, T, or U, or variants thereof). In some instances, the polynucleotide is a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or a derivative or variant thereof. In some instances, the polynucleotide is a small interfering RNA (siRNA), a microRNA (miRNA), a plasmid DNA (pDNA), a small hairpin RNA (shRNA), a small nuclear RNA (snRNA), a messenger RNA (mRNA), a pre-mRNA (pre-mRNA), an antisense RNA (asRNA), to name a few, and includes both nucleotide sequences and any structural embodiment thereof, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some instances, the polynucleotide molecule is circular. The polynucleotide may have a variety of lengths. The nucleic acid molecule can have a length of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 50 kb, or more. Polynucleotides can be isolated from cells or tissues.Polynucleotide sequence embodiments can include isolated and purified DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogs.

[0052] Polynucleotide embodiments, such as polyribonucleotides or polydeoxyribonucleotides, include polynucleotides that contain one or more nucleotide variants, including non-standard nucleotides, non-natural nucleotides, nucleotide analogs, or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguan ... -methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxocine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. In some cases, the nucleotides include modifications of their phosphate moieties, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include longer phosphate chains (e.g., phosphate chains having 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications of the thiol moiety (e.g., α-thiotriphosphate and β-thiotriphosphate).In embodiments, the nucleic acid molecules are also modified at the base moiety, sugar moiety, or phosphate backbone (e.g., at one or more atoms typically available to form hydrogen bonds with complementary nucleotides, or at one or more atoms typically not available to form hydrogen bonds with complementary nucleotides). In embodiments, the nucleic acid molecules include amine-modified groups such as aminoallyl-dUTP (aa-dUTP) and aminohexylacrylamide-dCTP (aha-dCTP) to allow covalent attachment of amine-reactive moieties such as N-hydroxysuccinimide ester (NHS). Alternatives to standard DNA or RNA base pairs in the oligonucleotides of the present disclosure may provide high bit density per cubic mm, higher safety (resistance to accidental or deliberate synthesis of natural toxins), easier identification in photoprogrammed polymerases, or subsecondary structures. Such alternative base pairs compatible with native and mutant polymerases for de novo or amplicon synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. 2012 Jul;8(7):612-4, incorporated herein by reference for all purposes.

[0053] As used herein, "polypeptide" refers to a polymer of amino acid residues (natural or non-natural) linked together, most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs thereof. Polypeptides can be single molecules or multi-molecular complexes such as dimers, trimers, or tetramers. Polypeptides can also include single chain or multi-chain polypeptides such as antibodies or insulin, which can be associated or linked. Disulfide bonds are most commonly found in multi-chain polypeptides. The term polypeptide can also be applied to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.

[0054] As used herein, the term "plant-modifying polypeptide" refers to a polypeptide that can modify a genetic property (e.g., increase gene expression, decrease gene expression, or otherwise modify the nucleotide sequence of DNA or RNA), an epigenetic property, or a biochemical or physiological property of a plant in a manner that results in a change in the physiology or phenotype of the plant, e.g., an increase or decrease in plant fitness.

[0055] As used herein, the term "regulatory element" is a portion of a nucleic acid sequence or the like that alters the expression of an expression sequence within a circular or linear polyribonucleotide.

[0056] As used herein, "spacer" refers to any adjacent nucleotide sequence (eg, of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions.

[0057] As used herein, the term "sequence identity" is determined by alignment of two peptide sequences or two nucleotide sequences using a global or local alignment algorithm. Sequences are called "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity when optimally aligned (aligned by a program such as GAP or BESTFIT using default parameters). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Generally, the default parameters of GAP are used: gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignment and sequence identity percentage scores are determined using computer programs such as, for example, GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or EmbossWin version 2.10.0 (using the program "Needle"). Alternatively or additionally, percent identity is determined by searching in a database, for example, using algorithms such as FASTA, BLAST, etc. Sequence identity refers to sequence identity over the entire length of the sequence.

[0058] As used herein, "structured" with respect to RNA refers to an RNA sequence that is predicted by RNAFold software or similar prediction tools to form structures (e.g., hairpin loops) with itself or with other sequences in the same RNA molecule.

[0059] As used herein, the term "subject" refers to an organism, such as an animal, a plant, or a microorganism. In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a bison, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxonomic group such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In embodiments, the subject is an invertebrate that is an invertebrate agricultural pest or a parasite on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgo), fern, horsetail, club moss, or bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is an agriculturally or horticulturally important plant, such as row crops, fruit-bearing plants and trees, vegetables, trees, and ornamentals, e.g., ornamental flowers, shrubs, trees, ground covers, and turf.

[0060] As used herein, the term "treat" or "treating" refers to the prophylactic or therapeutic treatment of a disease or disorder (e.g., an infection, cancer, toxicity, or allergic reaction) of interest. The effect of treatment may include reversing, alleviating, reducing the severity of, curing, inhibiting progression of, reducing the likelihood of recurrence of, the disease or one or more symptoms or manifestations of the disease or disorder, stabilizing (i.e., not worsening) the condition of the disease or disorder, or preventing the spread of the disease or disorder compared to the condition or symptoms of the disease or disorder in the absence of therapeutic treatment. Embodiments include treating plants to control diseases or deleterious symptoms caused by or associated with invertebrate pests or microbial (e.g., bacterial, fungal, oomycete, or viral) pathogens. Embodiments include treating plants to increase the plant's natural defense or immune ability to withstand pest or pathogen pressure.

[0061] As used herein, the term "termination element" is a portion, such as a nucleic acid sequence, that terminates translation of an expressed sequence in a circular or linear polyribonucleotide.

[0062] As used herein, the term "translation efficiency" refers to the rate or amount of protein or peptide production from a ribonucleotide transcript. In an embodiment, translation efficiency can be expressed as the amount of protein or peptide produced per a given amount of transcript encoding the protein or peptide, for example, in a given translation system, for example, a cell-free translation system such as rabbit reticulocyte lysate, for example, in a given period of time.

[0063] As used herein, the term "translation initiation sequence" is a nucleic acid sequence that initiates the translation of an expression sequence in a circular or linear polyribonucleotide.

[0064] As used herein, the term "therapeutic polypeptide" refers to a polypeptide that provides some therapeutic benefit when administered to or expressed in a subject. In embodiments, a therapeutic polypeptide is used to treat or prevent a disease, disorder, or condition in a subject by administration of the therapeutic polypeptide to the subject or by expression of the therapeutic polypeptide in the subject. In other embodiments, a therapeutic polypeptide is expressed in a cell, and the cell provides a therapeutic benefit when administered to a subject.

[0065] As used herein, "vector" refers to a piece of DNA that is synthesized (e.g., using PCR) or taken from a virus, plasmid, or cell of a higher organism into which a foreign DNA piece can or has been inserted for cloning or expression purposes. In some embodiments, the vector can be stably maintained in the organism. The vector can include, for example, an origin of replication, a selectable marker or reporter gene, such as antibiotic resistance or GFP, or a multiple cloning site (MCS). The term includes linear DNA pieces (e.g., PCR products, linearized plasmid fragments), plasmid vectors, viral vectors, cosmids, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), and the like. In one embodiment, the vectors provided herein include a multiple cloning site (MCS). In another embodiment, the vectors provided herein do not include a MCS. [Brief description of the drawings]

[0066] [Figure 1] FIG. 1A is a schematic diagram showing an exemplary Anabaena replacement intron-exon with a 5 nucleotide annealing region (FIG. 1A) and an exemplary Anabaena replacement intron-exon with an extended annealing region (FIG. 1B). [Diagram 2]2A-2B are schematic diagrams showing the structures of an exemplary Anabaena replacement intron-exon with a 5 nucleotide annealing region (FIG. 2A) and an exemplary Anabaena replacement intron-exon with an extended annealing region (FIG. 2B). [Diagram 3] 3A-3B are graphs showing circularization efficiencies of Anabaena replacement intron-exon with a 5 nucleotide annealing region (Anabaena1), Anabaena replacement intron-exon with an extended annealing region (Anabaena2), and Anabaena3 with either a 1.2 Kb RNA (Figure 3A) or a 4.5 Kb RNA (Figure 3B). [Figure 4] FIG. 1 is a graph showing the relative expression of Gluc from circular RNA generated by Anabaena replaced intron-exon with a 5 nucleotide annealing region (Anabaena1), Anabaena replaced intron-exon with an extended annealing region (Anabaena2), or Anabaena3 at three different time points. [Diagram 5] FIG. 2 is a graph showing relative expression of SARS-CoV-2 spike protein from circular RNA generated by Anabaena substituted intron-exon with a 5 nucleotide annealing region (Anabaena1), Anabaena substituted intron-exon with an extended annealing region (Anabaena2), or Anabaena3 at three different time points. [Figure 6] FIG. 1 is a schematic diagram showing an exemplary design of an Anabaena replacement intron-exon with several extended annealing regions between E2 and E1. [Figure 7] FIG. 1 is a graph showing circularization efficiency for Anabaena replacement intron-exon with extended annealing region (Anabaena2) and Anabaena replacement intron-exon further with 5, 10, or 15 nucleotide extensions of the annealing region. [Figure 8] FIG. 2 is a graph showing expression at three different time points for Anabaena replacement intron-exon with extended annealing region (Anabaena2) and Anabaena replacement intron-exon further with 5, 10, or 15 nucleotide extensions of the annealing region. [Figure 9] FIG. 9 is a schematic diagram showing an exemplary Tetrahymena replacement intron-exon with a 6 nucleotide annealing region (FIG. 9A) and an exemplary Tetrahymena replacement intron-exon with an extended annealing region (FIG. 9B). [Figure 10] 9A-9B are schematic diagrams showing the structures of an exemplary Tetrahymena replacement intron-exon with a 6 nucleotide annealing region (FIG. 9A) and an exemplary Tetrahymena replacement intron-exon with an extended annealing region (FIG. 9B). [Figure 11] FIG. 1 is a graph showing circularization efficiency of Tetrahymena replacement intron-exon with a 6 nucleotide annealing region (Tetrahymenal) and Tetrahymena replacement intron-exon with an extended annealing region (Tetrahymena2). [Figure 12] 12A-B are schematic diagrams showing an exemplary T4 phage replaced intron-exon with a 2-nucleotide annealing region (FIG. 12A) and an exemplary T4 phage replaced intron-exon with an extended annealing region (FIG. 12B). [Figure 13] 1 is a graph showing the circularization efficiency of T4 phage replaced intron-exon with a 2 nucleotide annealing region (T4 phage 1) and T4 phage replaced intron-exon with an extended annealing region (T4 phage 2). [Figure 14]14A-B are schematic diagrams showing an exemplary replacement intron-exon with an annealing region (FIG. 14A) and an exemplary replacement intron-exon with an extended annealing region (FIG. 14B). [Figure 15] 15A-B are schematic diagrams showing the structures of an exemplary Synechococcus replacement intron-exon with a 7 nucleotide annealing region (FIG. 15A) and an exemplary Synechococcus replacement intron-exon with a modified and extended annealing region (FIG. 15B). [Figure 16] 16A-B are schematic diagrams showing the structures of an exemplary Anabaena azollae replacement intron-exon with a 5 nucleotide annealing region (FIG. 16A) and an exemplary Anabaena azollae replacement intron-exon with a modified and extended annealing region (FIG. 16B). [Figure 17] 17A-B are schematic diagrams showing the structures of an exemplary Anabaena cylindrica with a 5 nucleotide annealing region (FIG. 17A) and an exemplary Anabaena cylindrica replacement intron-exon with a modified and extended annealing region (FIG. 17B). [Figure 18] 18A-B are schematic diagrams showing the structures of an exemplary Scytonema replacement intron-exon with a 5-nucleotide annealing region (FIG. 18A) and an exemplary Scytonema replacement intron-exon with a modified and extended annealing region (FIG. 18B). [Figure 19] 1 is a table showing exemplary modifications to various replacement intron-exons with annealing regions. Bold identifies the original annealing region; italics and underlining identify exemplary modifications to extended annealing. [Figure 20]Graph showing fold increase in circularization of various modified replacement intron-exons with 4.5 Kb RNA compared to unmodified (original) replacement intron-exons with 4.5 Kb RNA. Enhanced circularization efficiency is observed for Group I introns with replacement intron-exons with extended E2-E1 annealing regions. [Figure 21] (FIG. 21A) Schematic showing the secondary structure of the Anabaena self-splicing intron. The replacement region in P6b is highlighted. (FIG. 21B) Schematic showing the structure of an exemplary design of the Anabaena replacement intron-exon with an extended P6b stem (Anabaena4) or with an alteration to the stem of the P6b bulge (Anabaena5). [Figure 22] 1 is a graph showing circularization efficiency for Anabaena replacement intron-exon with extended annealing region (Anabaena2), Anabaena replacement intron-exon with 5 nucleotide annealing region (Anabaena1), Anabaena4, and Anabaena5. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0067] The present invention features compositions and methods for producing circular polyribonucleotides (circular RNA). The circular polyribonucleotides described herein are particularly useful for delivering polynucleotide cargo (e.g., encoding genes or proteins) to target cells.

[0068] A circular polyribonucleotide can be generated from a linear polyribonucleotide, where the ends are self-spliced ​​together, thereby forming a circular polyribonucleotide. The linear RNA molecule described herein comprises, from 5' to 3', (A) the 3' half of a group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a group I catalytic intron fragment. The polyribonucleotide has 2-50, e.g., 8-50 ribonucleotides, and comprises a first annealing region present within (A) the 3' half of a group I catalytic intron fragment; (B) the 3' splice site; or (C) the 3' exon fragment. The polyribonucleotide has 2-50, e.g., 8-50, ribonucleotides, and also includes a second annealing region that is within (E) the 5' exon fragment; (F) the 5' splice site; or (G) the 5' half of the group I catalytic intron fragment. The first annealing region has 80%-100% complementarity with the second annealing region, or has 0-10 mismatched base pairs. These characteristics allow the first annealing region to hybridize with the second annealing region, thereby bringing into close proximity the splice sites near the 5' and 3' ends of the linear polyribonucleotide. Once the splice sites are in close proximity, the polyribonucleotide can self-splice the 3' and 5' splice sites, thereby forming a circular polyribonucleotide.

[0069] By including a first annealing region, for example, within the (A) 3' half of the group I catalytic intron fragment; (B) 3' splice site; or (C) 3' exon fragment, and a second annealing region, for example, within the (E) 5' exon fragment; (F) 5' splice site; or (G) 5' half of the group I catalytic intron fragment, the linear molecule exhibits increased circularization efficiency and splicing fidelity when compared to other polyribonucleotide constructs lacking these features. Furthermore, by using an autocatalytic, self-splicing intron, the linear molecule does not need to be treated with an exogenous enzyme, such as a ligase, to generate a circular polyribonucleotide. This is particularly advantageous for generating a circular product in a single-pot reaction. The resulting molecules, methods, and uses thereof are described in more detail below.

[0070] Polynucleotides The present disclosure features circular polyribonucleotide compositions and methods for making circular polyribonucleotides. In some embodiments, circular polyribonucleotides are generated from linear polyribonucleotides (e.g., by ends of linear polyribonucleotides that are compatible with self-splicing). In some embodiments, linear polyribonucleotides are transcribed from deoxyribonucleotide templates (e.g., vectors, linearized vectors, or cDNA). Thus, the present disclosure features deoxyribonucleotides, linear polyribonucleotides, and circular polyribonucleotides and compositions thereof that are useful in generating circular polyribonucleotides.

[0071] Template deoxyribonucleotide The present invention features a template deoxyribonucleotide for making a circular RNA. The deoxyribonucleotide comprises the following operably linked in a 5' to 3' direction: (A) the 3' half of a group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a group I catalytic intron fragment. In an embodiment, the deoxyribonucleotide comprises additional elements, for example, outside or between any of elements (A), (B), (C), (D), (E), (F), or (G). In an embodiment, any of elements (A), (B), (C), (D), (E), (F), or (G) are separated from each other by a spacer sequence, as described herein.

[0072] In embodiments, the deoxyribonucleotides are, for example, a circular DNA vector, a linearized DNA vector, or linear DNA (eg, generated from a DNA vector, e.g., cDNA).

[0073] In some embodiments, the deoxyribonucleotide further comprises an RNA polymerase promoter operably linked to the linear RNA coding sequence described herein. In embodiments, the RNA polymerase promoter is heterologous to the linear RNA coding sequence. In some embodiments, the RNA polymerase promoter is a T7 promoter, a T6 promoter, a T4 promoter, a T3 promoter, an SP6 viral promoter, or an SP3 promoter.

[0074] In some embodiments, the deoxyribonucleotides comprise a multiple cloning site (MCS).

[0075] In some embodiments, deoxyribonucleotides are used to generate circular RNAs having a size range of about 100 to about 20,000 nucleotides, in some embodiments, the circular RNAs are at least 100, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, or 5,000 nucleotides in size. In some embodiments, the circular RNA is less than or equal to 20,000, 15,000, 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, or 4,000 nucleotides in size.

[0076] Linear Polyribonucleotides The invention also features a linear polyribonucleotide that includes the following operably linked in a 5' to 3' direction: (A) a 3' half of a group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a group I catalytic intron fragment. In embodiments, the linear polyribonucleotide includes additional elements, e.g., outside or between any of elements (A), (B), (C), (D), (E), (F), or (G), e.g., any of elements (A), (B), (C), (D), (E), (F), or (G) can be separated by a spacer sequence, as described herein.

[0077] In certain embodiments, provided herein are methods of producing linear RNA by performing transcription in a cell-free system (e.g., in vitro transcription) using a deoxyribonucleotide provided herein (e.g., a vector, a linearized vector, or a cDNA) as a template (e.g., a vector, a linearized vector, or a cDNA provided herein in which an RNA polymerase promoter is positioned upstream of a region encoding the linear RNA).

[0078] In embodiments, the deoxyribonucleotide template is transcribed to produce a linear RNA containing the components described herein. Upon expression, the linear polyribonucleotide produces a splicing-compatible polyribonucleotide that can self-splice to produce a circular polyribonucleotide.

[0079] In some embodiments, the linear polyribonucleotide is 50 to 20,000, 100 to 20,000, 200 to 20,000, 300 to 20,000 (e.g., 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, In embodiments, the linear polyribonucleotide is at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length.

[0080] Circular Polyribonucleotides In some embodiments, the invention features a circular polyribonucleotide (e.g., a covalently closed circular polyribonucleotide). In embodiments, the circular polyribonucleotide includes a splice bond connecting a 5' exon fragment and a 3' exon fragment. In embodiments, the 3' exon fragment includes a first annealing region having 2-50, e.g., 8-50 (e.g., 10-30, 10-20, or 10-15, e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides. and the 5' exon fragment comprises a second annealing region having 2 to 50, e.g., 8 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides. In an embodiment, the first annealing region and the second annealing region comprise 80% to 100% (e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity. In an embodiment, the first annealing region and the second annealing region comprise 0 to 10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatched base pairs.

[0081] In embodiments, the circular polynucleotide further comprises a polyribonucleotide cargo. In embodiments, the polyribonucleotide cargo comprises an expressed (or coding) sequence, a non-coding sequence, or a combination of expressed (coding) and non-coding sequences. In embodiments, the polyribonucleotide cargo comprises an expressed (coding) sequence encoding a polypeptide. In embodiments, the polyribonucleotide comprises an IRES operably linked to an expressed sequence encoding a polypeptide. In some embodiments, the IRES is located upstream of the expressed sequence. In some embodiments, the IRES is located downstream of the expressed sequence. In some embodiments, the circular polyribonucleotide further comprises a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment. The spacer region may, for example, be at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. The spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides. In some embodiments, the spacer region comprises a polyA sequence. In some embodiments, the spacer region comprises a polyAC sequence. In some embodiments, the spacer region comprises a polyAG sequence. In some embodiments, the spacer region comprises a polyAT sequence. In some embodiments, the spacer region comprises a random sequence. In some embodiments, the first annealing region and the second annealing region are linked, thereby forming a circular polyribonucleotide.

[0082] In some embodiments, the circular RNA is generated by a deoxyribonucleotide template or a linear RNA as described herein. In some embodiments, the circular RNA is generated by any of the methods described herein.

[0083] In some embodiments, a cyclic polyribonucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.

[0084] In some embodiments, the size of the circular polyribonucleotide is sufficient to accommodate a binding site for ribosome. In some embodiments, the size of the circular polyribonucleotide is sufficient to encode a useful polypeptide, for example, at least 20,000 nucleotides, at least 15,000 nucleotides, at least 10,000 nucleotides, at least 7,500 nucleotides, at least 5,000 nucleotides, at least 4,000 nucleotides, at least 3,000 nucleotides, at least 2,000 nucleotides, at least 1,000 nucleotides, at least 500 nucleotides, at least 1400 nucleotides, at least 300 nucleotides, at least 200 nucleotides, or at least 100 nucleotides can be produced.

[0085] In some embodiments, the circular polyribonucleotide comprises one or more elements described elsewhere herein. In some embodiments, the elements are separated from each other by a spacer sequence. In some embodiments, the elements are separated from each other by 1 ribonucleotide, 2 nucleotides, about 5 nucleotides, about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 80 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, about 900 nucleotides, about 1000 nucleotides, up to about 1 kb, at least about 1000 nucleotides, or any amount of nucleotides therebetween. In some embodiments, one or more elements are adjacent to each other, e.g., lacking a spacer element.

[0086] In some embodiments, the cyclic polyribonucleotide comprises one or more repeat elements as described elsewhere herein. In some embodiments, the cyclic polyribonucleotide comprises one or more modifications as described elsewhere herein. In one embodiment, the cyclic RNA comprises at least one nucleoside modification. In one embodiment, up to 100% of the nucleosides of the cyclic RNA are modified. In one embodiment, the at least one nucleoside modification is a uridine modification or an adenosine modification.

[0087] As a result of its circularization, circular polyribonucleotides may contain certain characteristics that distinguish it from linear RNA. For example, circular polyribonucleotides are less susceptible to exonuclease degradation compared to linear RNA. As such, circular polyribonucleotides are more stable than linear RNA, especially when incubated in the presence of exonucleases. The increased stability of circular polyribonucleotides compared to linear RNA makes them more useful as cell transformation reagents for producing polypeptides, and they can be stored more easily and for longer periods of time than linear RNA. The stability of exonuclease-treated circular polyribonucleotides can be tested using standard methods in the art to determine whether RNA degradation has occurred (e.g., by gel electrophoresis). Furthermore, unlike linear RNA, circular polyribonucleotides are less susceptible to dephosphorylation when circular polyribonucleotides are incubated with phosphatases, such as calf intestinal phosphatase.

[0088] Annealing Region The polynucleotide compositions described herein can include more than one annealing region, e.g., more than one annealing region described herein. An annealing region, or pair of annealing regions, is one that contains portions with a high degree of complementarity that promotes hybridization under suitable conditions.

[0089] The annealing region comprises at least the complementary region described herein. The high degree of complementarity of the complementary regions promotes the association of the annealing region pair. When a first annealing region (e.g., a 5' annealing region) is located at or near the 5' end of the linear RNA, and a second annealing region (e.g., a 3' annealing region) is located at or near the 3' end of the linear RNA, the association of the annealing regions brings the 5' and 3' and corresponding intron fragments into close proximity. In some embodiments, this supports the circularization of the linear RNA by splicing of the 3' and 5' splice sites. In some embodiments, the annealing regions described herein reinforce naturally occurring annealing regions, for example, promoting self-splicing.

[0090] The annealing region can be modified by introducing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) mutations into the polyribonucleotide sequence. For example, the annealing region can be extended by introducing one or more point mutations into the first annealing region and / or the second annealing region to increase the length of complementarity between the first and second annealing regions. The annealing region can also be altered by inserting one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) nucleotides into the polyribonucleotide. In an embodiment, the annealing region is extended by inserting one or more nucleotides into the first annealing region and / or the second annealing region, increasing the length of complementarity between the first and second annealing regions. In an embodiment, the annealing region is extended by introducing one or more point mutations into the first annealing and / or the second region, and inserting one or more nucleotides into the first annealing and / or the second annealing region, increasing the length of complementarity. The alteration of the annealing region can alter the secondary structure of the polyribonucleotide by favoring bulges or mismatched regions with the original sequence, preferentially forming stem or stem-loop structures with the altered sequence.

[0091] The polyribonucleotide has 2 to 50, 5 to 50, 6 to 50, 7 to 50, or 8 to 50 (e.g., 10 to 30, 10 to 20, or 10 to 15, e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and comprises: (A) the 3' half of a Group I catalytic intron fragment; (B) a 3' splice site; or (C) a first annealing region present within a 3' exon fragment. The polyribonucleotide has 2-50, 5-50, 6-50, 7-50, or 8-50 (e.g., 10-30, 10-20, or 10-15, e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and also includes: (E) a 5' exon fragment; (F) a 5' splice site; or (G) a second annealing region present within the 5' half of the group I catalytic intron fragment. The first annealing region has 80% to 100% (e.g., 85% to 100%, e.g., 90% to 100%, e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity with the second annealing region, or has 0 to 10, e.g., (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatch base pairs.

[0092] In some embodiments, the first annealing region and the second annealing region are 100% complementary.

[0093] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the 5'-TCCGT-3' sequence (SEQ ID NO:1), and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the 5'-ACGGA-3' sequence (SEQ ID NO:2).

[0094] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TCCGTAGCGTCT-3' (SEQ ID NO:5), and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AGACGCTACGGA-3' (SEQ ID NO:6).

[0095] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TCCGTAGCGTCTAAACG-3' (SEQ ID NO: 22) and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CGTTTAGACGCTACGGA-3' (SEQ ID NO: 23).

[0096] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TCCGTAGCGTCTAAACGGTCGT-3' (SEQ ID NO: 24) and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-ACGACCGTTTAGACGCTACGGA-3' (SEQ ID NO: 25).

[0097] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TCCGTAGCGTCTAAACGGTCGTGTGGG-3' (SEQ ID NO:26) and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CCCACACGACCGTTTAGACGCTACGGA-3' (SEQ ID NO:27).

[0098] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AAGGTA-3' (SEQ ID NO: 13), and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TACCTT-3' (SEQ ID NO: 14).

[0099] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AAGGTAAATATT-3' (SEQ ID NO: 16) and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AATATTTACCTT-3' (SEQ ID NO: 17).

[0100] In some embodiments, the first annealing region has the sequence 5'-CT-3' and the second annealing region has the sequence 5'-AG-3'.

[0101] In some embodiments, the first annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CTCAATT-3' (SEQ ID NO:20) and the second annealing region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AATTGAG-3' (SEQ ID NO:21).

[0102] In some embodiments, (A) or (C) comprises a first annealing region and (E) or (G) comprises a second annealing region.

[0103] In some embodiments, the 3' exon fragment of (C) comprises a first annealing region and the 5' exon fragment of (E) comprises a second annealing region.

[0104] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) comprises a first annealing region and the 5' exon fragment in (E) comprises a second annealing region.

[0105] In some embodiments, the 3' exon fragment of (C) comprises a first annealing region and the 5' half of the Group I catalytic intron fragment comprises a second annealing region.

[0106] In some embodiments, the first annealing region and the second annealing region contain zero or one mismatched base pair.

[0107] In embodiments, the annealing region further comprises a non-complementary region, as described below: The addition of a non-complementary region to a complementary region allows the ends of the RNA to remain flexible, amorphous, or less structured than the complementary region.

[0108] In some embodiments, each annealing region comprises 2 to 100, 5 to 100, or 6 to 100 ribonucleotides (e.g., 6 to 80, 6 to 50, 6 to 30, 6 to 20, 10 to 100, 10 to 80, 10 to 50, or 10 to 30 ribonucleotides). In some embodiments, the 5' annealing region comprises 2 to 100, 5 to 100, or 6 to 100 ribonucleotides (e.g., 6 to 80, 6 to 50, 6 to 30, 6 to 20, 10 to 100, 10 to 80, 10 to 50, or 10 to 30 ribonucleotides). In some embodiments, the 3' annealing region comprises 6 to 100 ribonucleotides (e.g., 6 to 80, 6 to 50, 6 to 30, 6 to 20, 10 to 100, 10 to 80, 10 to 50, or 10 to 30 ribonucleotides).

[0109] In some embodiments, the polyribonucleotide does not include an annealing region 3' of (A) that comprises partial or complete nucleic acid complementarity with a 5' annealing region of (G).

[0110] In some embodiments, the polyribonucleotide does not include any further annealing regions, for example, in addition to the first annealing region and the second annealing region.

[0111] Complementary Region A complementary region is one that supports association with a corresponding complementary region under suitable conditions, e.g., a pair of complementary regions may share a high degree of sequence complementarity (e.g., a first complementary region is at least partially the reverse complement of a second complementary region). When two complementary regions associate (e.g., hybridize), they may form a highly structured secondary structure, such as a stem or stem loop.

[0112] In some embodiments, the polyribonucleotide comprises a 5' complementary region and a 3' complementary region. In some embodiments, the 5' complementary region has 2 to 50, e.g., 5 to 50 ribonucleotides (e.g., 5 to 40, 5 to 30, 5 to 20, 5 to 10, 10 to 50, 10 to 40, 10 to 30, 10 to 20, or 20 to 50, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 ribonucleotides). In some embodiments, the 3' complementary region has from 2 to 50, e.g., from 5 to 50 ribonucleotides (e.g., from 5 to 40, 5 to 30, 5 to 20, 5 to 10, 10 to 50, 10 to 40, 10 to 30, 10 to 20, or 20 to 50, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 ribonucleotides).

[0113] In some embodiments, the 5' complementary region and the 3' complementary region have 50% to 100% sequence complementarity (e.g., 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, or 100%, e.g., 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence complementarity).

[0114] In some embodiments, the 5' complementary region and the 3' complementary region have a free energy of binding of less than -5 kcal / mol (eg, less than -10 kcal / mol, less than -20 kcal / mol, or less than -30 kcal / mol).

[0115] In some embodiments, the 5' complementary region and the 3' complementary region have a Tm of binding of at least 10°C, at least 15°C, at least 20°C, at least 30°C, at least 40°C, at least 50°C, at least 60°C, at least 70°C, at least 80°C, or at least 90°C.

[0116] In some embodiments, the 5' complementary region and the 3' complementary region contain at least one but not more than 10 mismatches, e.g., 10, 9, 8, 7, 6, 5, 4, 3, or 2 mismatches, or one mismatch (i.e., when the 5' complementary region and the 3' complementary region hybridize to each other). The mismatches can be, for example, nucleotides in the 5' complementary region and nucleotides in the 3' complementary region that are inverse to each other (i.e., when the 5' complementary region and the 3' complementary region hybridize) but do not form Watson-Crick base pairs. The mismatches can be, for example, unpaired nucleotides that form a kink or bulge in either the 5' complementary region or the 3' complementary region. In some embodiments, the 5' complementary region and the 3' complementary region do not contain any mismatches.

[0117] Non-complementary regions A non-complementary region is a region that does not support association with a corresponding non-complementary region under suitable conditions. For example, a pair of non-complementary regions may share a low degree of sequence complementarity (e.g., the first non-complementary region is not the reverse complement of the second non-complementary region). When two non-complementary regions are in close proximity, they do not form a highly structured secondary structure such as a stem or stem loop.

[0118] In some embodiments, the polyribonucleotide comprises a 5' non-complementary region and a 3' non-complementary region. In some embodiments, the 5' non-complementary region has 5 to 50 ribonucleotides (e.g., 5 to 40, 5 to 30, 5 to 20, 5 to 10, 10 to 50, 10 to 40, 10 to 30, 10 to 20, or 20 to 50 ribonucleotides). In some embodiments, the 3' non-complementary region has 5 to 50 ribonucleotides (e.g., 5 to 40, 5 to 30, 5 to 20, 5 to 10, 10 to 50, 10 to 40, 10 to 30, 10 to 20, or 20 to 50 ribonucleotides).

[0119] In some embodiments, the 5' non-complementary region is located 5' to the 5' complementary region (e.g., between the 5' catalytic intron fragment and the 5' complementary region). In some embodiments, the 3' non-complementary region is located 3' to the 3' complementary region (e.g., between the 3' complementary region and the 3' catalytic intron fragment).

[0120] In some embodiments, the 5' non-complementary region and the 3' non-complementary region have 0% to 50% sequence complementarity (e.g., 0% to 40%, 0% to 30%, 0% to 20%, 0% to 10%, or 0% sequence complementarity).

[0121] In some embodiments, the 5' non-complementary region and the 3' non-complementary region have a free energy of binding greater than -5 kcal / mole.

[0122] In some embodiments, the 5' complementary region and the 3' complementary region have a Tm of binding of less than 10°C.

[0123] In some embodiments, the 5' non-complementary region and the 3' non-complementary region comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.

[0124] Catalytic intron The polyribonucletides described herein include a catalytic intron fragment, such as (A) the 3' half of a group I catalytic intron fragment and (G) the 5' half of a group I catalytic intron fragment. The first and second annealing regions can be located within the catalytic intron fragment. Group I catalytic introns are self-splicing ribozymes that catalyze their own cleavage from mRNA, tRNA, and rRNA precursors via a two-metal ion phosphoryl introduction mechanism. Importantly, the RNA itself self-catalyzes intron removal without the need for exogenous enzymes such as ligases.

[0125] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena or a pre-rRNA of Tetrahymena.

[0126] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena, the 3' exon fragment in (C) comprises a first annealing region, and the 5' exon fragment in (E) comprises a second annealing region. The first annealing region may comprise, for example, 5 to 50, e.g., 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides, and the second annealing region may comprise, for example, 5 to 50, e.g., 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides.

[0127] In some embodiments, the 3' half of the group I catalytic intron fragment of (A) and the 5' half of the group I catalytic intron fragment of (G) are derived from Tetrahymena pre-rRNA, and the 3' half of the group I catalytic intron fragment of (A) comprises a first annealing region and the 5' exon fragment of (E) comprises a second annealing region. In some embodiments, the 3' exon of (B) comprises a first annealing region and the 5' half of the group I catalytic intron fragment of (G) comprises a second annealing region. The first annealing region may comprise, for example, 6 to 50, e.g., 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region may comprise, for example, 6 to 50, e.g., 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0128] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena, a pre-rRNA of Tetrahymena, or a td gene of T4 phage.

[0129] In some embodiments, the 3' half of the group I catalytic intron fragment of (A) and the 5' group I catalytic intron fragment of (G) are derived from the td gene of T4 phage. The 3' exon fragment of (C) may comprise a first annealing region and the 5' half of the group I catalytic intron fragment of (G) may comprise a second annealing region. The first annealing region may comprise, for example, 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides and the second annealing region may comprise, for example, 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0130] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is the 5' end of the linear polynucleotide.

[0131] In some embodiments, the 5' half of the group I catalytic intron fragment of (G) is the 3' end of a linear polyribonucleotide.

[0132] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AACAACAGATAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAATG-3' (SEQ ID NO: 28).

[0133] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT-3' (SEQ ID NO:29).

[0134] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:28 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:29.

[0135] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0136] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0137] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:30 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:31.

[0138] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0139] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACT-3' (SEQ ID NO: 33).

[0140] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:32 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:33.

[0141] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0142] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-ACGGTAGACGCAGCGGACTTAGAAAACTGGGCCTCGATCGCGAAAGGGATCGAGTGGCAGCTCTCAAACTCAGGGAAACCTAAAACTTTAAACATTMAAGTCATGGCAATCCTGAGCCAAGCTAAAGC-3' (SEQ ID NO: 81).

[0143] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:80 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:81.

[0144] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0145] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0146] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:82 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:83.

[0147] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0148] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0149] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:84 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:85.

[0150] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0151] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0152] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:86 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:87.

[0153] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0154] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0155] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:88 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:89.

[0156] In some embodiments, the 3' half of the Group I catalytic intron fragment of (A) is [ka] The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with

[0157] In some embodiments, the 5' half of the Group I catalytic intron fragment of (G) is The sequence has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT-3' (SEQ ID NO: 91).

[0158] In some embodiments, the 3' half of the group I catalytic intron fragment in (A) has the sequence of SEQ ID NO:90 and the 5' half of the group I catalytic intron fragment in (G) has the sequence of SEQ ID NO:91.

[0159] Splice Site The polyribonucleotides described herein include splice sites, such as (B) a 3' splice site; and (F) a 5' splice site. The splice sites may be derived from the pre-tRNA-Leu gene of the cyanobacterium Anabaena, the pre-rRNA of Tetrahymena, or the td gene of T4 phage.

[0160] In some embodiments, the 3' splice site (e.g., between the 3' half of the Group I catalytic intron fragment and the 3' exon fragment) [ka] where the arrow represents the cleavage site. In some embodiments, the 5' splice site (e.g., between the 5' exon fragment and the 5' half of the group I catalytic intron fragment) has [ka] where the arrow indicates the cleavage site.

[0161] In some embodiments, the 3' splice site (e.g., between the 3' half of the Group I catalytic intron fragment and the 3' exon fragment) [ka] where the arrow represents the cleavage site. In some embodiments, the 5' splice site (e.g., between the 5' exon fragment and the 5' half of the group I catalytic intron fragment) has [ka] where the arrow indicates the cleavage site.

[0162] In some embodiments, the 3' splice site (e.g., between the 3' half of the Group I catalytic intron fragment and the 3' exon fragment) [ka] where the arrow represents the cleavage site. In some embodiments, the 5' splice site (e.g., between the 5' exon fragment and the 5' half of the group I catalytic intron fragment) has [ka] where the arrow indicates the cleavage site.

[0163] Exon fragment The polyribonucleotides described herein include exon fragments, such as: (C) a 3' exon fragment; and (E) a 5' exon fragment.

[0164] In some embodiments, the 3' exon fragment of (C) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3' (SEQ ID NO: 40).

[0165] In some embodiments, the 3' exon fragment of (C) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3' (SEQ ID NO: 41).

[0166] In some embodiments, the 5' exon fragment of (E) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-AGACGCTACGGACTT-3' (SEQ ID NO:42).

[0167] In some embodiments, the 5' exon fragment of (E) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CGTTTAGACGCTACGGACTT-3' (SEQ ID NO:43).

[0168] In some embodiments, the 5' exon fragment of (E) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-ACGACCGTTTAGACGCTACGGACTT-3' (SEQ ID NO:44).

[0169] In some embodiments, the 5' exon fragment of (E) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CCCACACGACCGTTTAGACGCTACGGACTT-3' (SEQ ID NO: 45).

[0170] In some embodiments, the 3' exon fragment of (C) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TAAGGTAGC-3' (SEQ ID NO:46).

[0171] In some embodiments, the 3' exon fragment of (C) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-TAAGGTAAATATTGC-3' (SEQ ID NO:47).

[0172] In some embodiments, the 5' exon fragment of (E) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-ATGACTCTCT-3' (SEQ ID NO:48).

[0173] In some embodiments, the 3' exon fragment of (C) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CTACCGTTTAATATT-3' (SEQ ID NO:49).

[0174] In some embodiments, the 3' exon fragment of (C) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-CTCAATTTTAATATT-3' (SEQ ID NO:50).

[0175] In some embodiments, the 5' exon fragment of (E) has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence 5'-ATGTTTTCTTGGGT-3' (SEQ ID NO:51).

[0176] Polyribonucleotide Cargo The polyribonucleotide cargo described herein includes any sequence comprising at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo of (D) comprises an expressed sequence, a non-coding sequence, or an expressed sequence and a non-coding sequence. In some embodiments, the polyribonucleotide cargo of (D) comprises an expressed sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo of (D) comprises an IRES operably linked to an expressed sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo of (D) comprises an expressed sequence encoding a polypeptide having a biological effect on a subject.

[0177] The polyribonucleotide cargo may comprise, for example, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments the polyribonucleotide cargo comprises from 1 to 20,000 nucleotides, from 1 to 10,000 nucleotides, from 1 to 5,000 nucleotides, from 100 to 20,000 nucleotides, from 100 to 10,000 nucleotides, from 100 to 5,000 nucleotides, from 500 to 20,000 nucleotides, from 500 to 10,000 nucleotides, from 500 to 5,000 nucleotides, from 1,000 to 20,000 nucleotides, from 1,000 to 10,000 nucleotides, or from 1,000 to 5,000 nucleotides.

[0178] In embodiments, the polyribonucleotide cargo comprises one or more expressed (or coding) sequences, where each expressed (or coding) sequence encodes a polypeptide. In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences. In embodiments, the polyribonucleotide cargo consists entirely of non-coding sequences. In embodiments, the polyribonucleotide cargo comprises a combination of expressed (or coding) sequences and non-coding sequences.

[0179] In some embodiments, the polyribonucleotides produced as described herein are used as effectors in therapy or agriculture.For example, the cyclic polyribonucleotides produced by the methods described herein (e.g., the cell-free methods described herein) can be administered to a subject (e.g., in pharmaceutical, veterinary, or agricultural compositions).In another example, the cyclic polyribonucleotides produced by the methods described herein (e.g., the cell-free methods described herein) can be delivered to a cell.

[0180] In some embodiments, the polyribonucleotide comprises any feature, or any combination of features, as disclosed in WO 2019 / 118919, the entirety of which is incorporated herein by reference.

[0181] Polypeptide Expression Sequences In some embodiments, a polyribonucleotide described herein (e.g., the polyribonucleotide cargo of a circular polyribonucleotide) comprises one or more expressed (or coding) sequences, where each expressed sequence encodes a polypeptide. In some embodiments, a circular polyribonucleotide comprises two, three, four, five, six, seven, eight, nine, ten or more expressed (or coding) sequences.

[0182] Each encoded polypeptide may be linear or branched. In various embodiments, the polypeptide has a length of about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, polypeptides have a length of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less that may be useful.

[0183] The polypeptides included herein may include naturally occurring or non-naturally occurring polypeptides. In some embodiments, the polypeptide is or includes a functional fragment or variant of a reference polypeptide (e.g., an enzymatically active fragment or variant of an enzyme). For example, the polypeptide may be a functionally active variant of any of the polypeptides described herein that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of a polypeptide described herein or a naturally occurring polypeptide, e.g., over a specific region or over the entire sequence. In some cases, a polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) identity to a protein of interest.

[0184] Some examples of polypeptides include, but are not limited to, a fluorescent tag or marker, an antigen, a therapeutic polypeptide, or a polypeptide for agricultural use.

[0185] The therapeutic polypeptide may be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., oxidoreductases, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, lysosomal enzymes, desaturases), a cytokine, an antigen-binding polypeptide (e.g., an antigen-binding antibody or antibody-like fragment, such as a single chain antibody, nanobody or other polypeptide comprising an Ig heavy or light chain), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenetic protein, an interferon, an interleukin, and a thrombolytic agent.

[0186] Polypeptides for agricultural use may be bacteriocins, lysins, antibacterial polypeptides, antifungal polypeptides, nodule C-rich peptides, bacteriocyte regulatory peptides, peptide toxins, pesticidal polypeptides (e.g., insecticidal or nematicidal polypeptides), antigen-binding polypeptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single chain antibodies, nanobodies or other Ig heavy or light chain-containing polypeptides), enzymes (e.g., nucleases, amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones, and transcription factors.

[0187] In some cases, the circular polyribonucleotide expresses a non-human protein.

[0188] In some embodiments, the cyclic polyribonucleotide expresses an antibody, e.g., an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the cyclic polyribonucleotide can be any isotype, such as IgA, IgD, IgE, IgG, IgM, etc. In some embodiments, the cyclic polyribonucleotide expresses a portion of an antibody, e.g., a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, or further portions thereof. In some embodiments, the cyclic polyribonucleotide expresses one or more portions of an antibody. For example, the cyclic polyribonucleotide can include two or more expression (or coding) sequences, each of which expresses a portion of an antibody, the sum of which can constitute an antibody. In some cases, the cyclic polyribonucleotide includes one expression sequence that encodes a heavy chain of the antibody, and another expression sequence that encodes a light chain of the antibody. In some cases, when the cyclic polyribonucleotide is expressed in a cell or in a cell-free environment, the light and heavy chains can undergo appropriate modification, folding, or other post-translational modifications to form a functional antibody.

[0189] In embodiments, the polypeptide comprises multiple polypeptides, e.g., multiple copies of a single polypeptide sequence, or multiple different polypeptide sequences, In embodiments, the multiple polypeptides are connected by linker or spacer amino acids.

[0190] In an embodiment, the polynucleotide cargo comprises a sequence encoding a signal peptide. Many signal peptide sequences have been described, for example, the Tat (twin arginine translocation) signal sequence is typically an N-terminal peptide sequence containing a consensus SRRxFLK "twin arginine" motif that serves to translocate folded proteins containing such Tat signal peptides through lipid bilayers. See also, for example, the signal peptide database publicly available at www[dot]signalpeptide[dot]de. Signal peptides are also useful for directing proteins to specific organelles; see, for example, the experimentally measured and computationally predicted signal peptides disclosed in the Spdb signal peptide database publicly available at proline[dot]bic[dot]nus[dot]edu[dot]sg / spdb.

[0191] In embodiments, the polynucleotide cargo comprises a sequence encoding a cell penetrating peptide (CPP). Hundreds of CPP sequences have been described; see, for example, CPPsite, a database of publicly available cell penetrating peptides at crdd[dot]osdd[dot]net / raghava / cppsite / . An example of a commonly used CPP sequence is a poly-arginine sequence, such as octoarginine or nonoarginine, which can be fused to the C-terminus of a CGI peptide.

[0192] In embodiments, the polynucleotide cargo comprises a sequence encoding a self-assembling peptide; see, e.g., Miki et al. (2021) Nature Communications, 21:3412, DOI:10.1038 / s41467-021-23794-6.

[0193] In some embodiments, the expressed (or coding) sequence comprises a polyA sequence (e.g., at the 3' end of the expressed sequence). In some embodiments, the length of the polyA sequence is more than 10 nucleotides in length. In one embodiment, the polyA sequence is more than 15 nucleotides in length (e.g., is at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides in length). In some embodiments, the polyA sequence is designed according to the description of polyA sequences in paragraphs

[0202] to

[0204] of WO 2019 / 118919 A1, the entirety of which is incorporated herein by reference. In some embodiments, the expression sequence lacks a polyA sequence (e.g., at the 3' end of the expression sequence).

[0194] In some embodiments, the cyclic polyribonucleotide comprises a polyA, lacks a polyA, or has a modified polyA to modulate one or more characteristics of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide lacks a polyA or has a modified polyA to improve one or more functional properties, such as immunogenicity (e.g., the level of one or more markers of an immune or inflammatory response), half-life, and / or expression efficiency.

[0195] Therapeutic Polypeptides In some embodiments, the cyclic polyribonucleotides described herein (e.g., the polyribonucleotide cargo of the cyclic polyribonucleotide) comprise at least one expression sequence that encodes a therapeutic polypeptide. A therapeutic polypeptide is a polypeptide that provides some therapeutic benefit when administered to or expressed in a subject. Administration of a therapeutic polypeptide to a subject or expression in a subject can be used to treat or prevent a disease, disorder, or condition or a symptom thereof. In some embodiments, the cyclic polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more therapeutic polypeptides.

[0196] In some embodiments, the circular polyribonucleotide comprises an expression sequence that encodes a therapeutic protein. The protein can treat a disease in a subject in need thereof. In some embodiments, the therapeutic protein can compensate for a mutated, under-expressed, or absent protein in a subject in need thereof. In some embodiments, the therapeutic protein can target, interact with, or bind to a cell, tissue, or virus in a subject in need thereof.

[0197] A therapeutic polypeptide can be a polypeptide that can be secreted from the cell or that can be localized in the cytoplasm, nucleus, or membrane compartment of the cell.

[0198] Therapeutic polypeptides can be any of a variety of therapeutic polypeptides, including hormones, neurotransmitters, growth factors, enzymes (e.g., oxidoreductases, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, lysosomal enzymes, desaturases), cytokines, transcription factors, antigen-binding polypeptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single chain antibodies, nanobodies, or other polypeptides comprising an Ig heavy or light chain), Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, interferons, interleukins, thrombolytic agents, antigens (e.g., tumor, viral, or bacterial antigens), nucleases (e.g., Cas proteins, endonucleases such as Cas9), membrane proteins (e.g., chimeric antigen receptors (CARs), transmembrane receptors, G protein-coupled receptors (GPCRs), receptor tyrosine kinases (RTKs), antigen receptors, ion channels, or membrane transporters), secreted proteins, gene editing proteins (e.g., CRISPR-Cas, TALENs, or Zn fingers), or gene writing proteins. The present invention may also be directed to a method for the preparation of a medicament for the treatment of a cancer, such as the administration of a medicament for the treatment of a cancer.

[0199] In some embodiments, the therapeutic polypeptide is an antibody, e.g., a full-length antibody, an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the cyclic polyribonucleotide can be of any isotype, such as IgA, IgD, IgE, IgG, IgM, etc. In some embodiments, the cyclic polyribonucleotide expresses a portion of the expressed antibody, e.g., a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, or further portions thereof. In some embodiments, the cyclic polyribonucleotide expresses one or more portions of an antibody. For example, the cyclic polyribonucleotide can include two or more expression sequences, each of which expresses a portion of an antibody, the sum of which may constitute an antibody. In some cases, the cyclic polyribonucleotide includes one expression sequence that encodes a heavy chain of the antibody, and another expression sequence that encodes a light chain of the antibody. When the cyclic polyribonucleotide is expressed subcellularly, the light and heavy chains may undergo appropriate modification, folding, or other post-translational modifications to form a functional antibody.

[0200] In some embodiments, the cyclic polyribonucleotides produced as described herein are used as effectors in therapy or agriculture. For example, the cyclic polyribonucleotides produced by the methods described herein (e.g., the cell-free methods described herein) can be administered to a subject (e.g., in a pharmaceutical, animal, or agricultural composition). In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject of the method is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxonomic group such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In embodiments, the subject is an invertebrate that is an invertebrate agricultural pest or a parasite on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgo), fern, horsetail, club moss, or bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is an agriculturally or horticulturally important plant, such as row crops, fruit-bearing plants and trees, vegetables, trees, and ornamentals, e.g., ornamental flowers, shrubs, trees, ground covers, and turf.

[0201] Secreted Polypeptide Effectors In some embodiments, the cyclic polyribonucleotides described herein (e.g., the polyribonucleotide cargo of the cyclic polyribonucleotide) comprise at least one coding sequence that encodes a secreted polypeptide effector. Exemplary secreted polypeptide effectors or proteins that may be expressed include, for example, cytokines and cytokine receptors, polypeptide hormones and receptors, growth factors, clotting factors, therapeutic replacement enzymes and therapeutic non-enzymatic effectors, regeneration, repair, and fibrosis factors, transformation factors, and proteins that stimulate cell regeneration, non-limiting examples of which are described herein, for example, in the Table below.

[0202] Cytokines and Cytokine Receptors In some embodiments, the effector described herein comprises a cytokine of Table 1, or a functional variant or fragment thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 1, e.g., by reference to its UniProt ID. In some embodiments, the functional variant binds to a corresponding cytokine receptor with a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher or lower than the Kd of the corresponding wild-type cytokine for the same receptor under the same conditions. In some embodiments, the effector comprises a fusion protein comprising a first region (e.g., a cytokine polypeptide of Table 1, or a functional variant or fragment thereof) and a second heterologous region. In some embodiments, the first region is a first cytokine polypeptide of Table 1. In some embodiments, the second region is a second cytokine polypeptide of Table 1, and the first and second cytokine polypeptides form a cytokine heterodimer with each other in wild-type cells. In some embodiments, a polypeptide of Table 1, or a functional variant thereof, comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector or a heterologous signal sequence.

[0203] In some embodiments, the effector described herein comprises an antibody or fragment thereof that binds to a cytokine in Table 1. In some embodiments, the antibody molecule comprises a signal sequence.

[0204] [Table 1-1]

[0205] [Table 1-2]

[0206] Polypeptide Hormones and Receptors In some embodiments, the effector described herein comprises a hormone of Table 2, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 2, e.g., by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type hormone for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 2 or a functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector or a heterologous signal sequence.

[0207] In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds to a hormone in Table 2. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds to a hormone receptor in Table 2. In some embodiments, the antibody molecule comprises a signal sequence.

[0208] [Table 2-1]

[0209] [Table 2-2]

[0210] growth factors In some embodiments, the effector described herein comprises a growth factor of Table 3, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 3, e.g., by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type growth factor for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 3 or a functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector or a heterologous signal sequence.

[0211] In some embodiments, the effector described herein comprises an antibody or fragment thereof that binds to a growth factor of Table 3. In some embodiments, the effector described herein comprises an antibody molecule (e.g., an scFv) that binds to a growth factor receptor of Table 3. In some embodiments, the antibody molecule comprises a signal sequence.

[0212] [Table 3-1]

[0213] [Table 3-2]

[0214] clotting factors In some embodiments, the effector described herein comprises a polypeptide of Table 4, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 4, e.g., by reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate that is 10%, 20%, 30%, 40%, or 50% or more lower or higher than the wild-type protein. In some embodiments, the polypeptide of Table 4, or a functional variant thereof, comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence.

[0215] [Table 4]

[0216] Therapeutic replacement enzymes In some embodiments, the effectors described herein comprise an enzyme of Table 5, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 5, e.g., by reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate that is 10%, 20%, 30%, 40%, or 50% more or less slower than the wild-type protein.

[0217] [Table 5-1]

[0218] [Table 5-2]

[0219] [Table 5-3]

[0220] [Table 5-4]

[0221] [Table 5-5]

[0222] Other nonenzymatic effectors In some embodiments, the therapeutic polypeptides described herein include those of Table 6, or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 6, by reference to its UniProt ID.

[0223] [Table 6-1]

[0224] [Table 6-2]

[0225] Regeneration, repair, and fibrosis factors Therapeutic polypeptides described herein also include, for example, growth factors disclosed in Table 7, or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 7, by reference to its NCBI protein accession number. Also included are antibodies or fragments thereof against such growth factors, or miRNAs that promote regeneration and repair.

[0226] [Table 7]

[0227] Transforming factors Therapeutic polypeptides described herein also include transforming factors, e.g., protein factors that transform fibroblasts into differentiated cells, e.g., factors disclosed in Table 8 or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 8, e.g., by reference to its UniProt ID.

[0228] [Table 8]

[0229] Proteins that stimulate cell regeneration Therapeutic polypeptides described herein also include proteins that stimulate cell regeneration, such as proteins disclosed in Table 9 or functional variants thereof, e.g., proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 9, e.g., by reference to its UniProt ID.

[0230] [Table 9]

[0231] In some embodiments, the cyclic polyribonucleotide comprises one or more expression sequences (coding sequences) and is designed for sustained expression in the cells of a subject in vivo. In some embodiments, the cyclic polyribonucleotide is designed so that the expression of one or more expression sequences in the cells at a later time point is equal to or higher than at an earlier time point. In such embodiments, the expression of one or more expression sequences can either be maintained at a relatively stable level or can increase over time. The expression of the expression sequences can be relatively stable over an extended period of time. For example, in some cases, the expression of one or more expression sequences in the cells over at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23 days or more does not decrease by 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%. In some cases, expression of one or more expression sequences in the cells is maintained at a level that does not change by more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% for at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23 days or more.

[0232] Plant Modified Polypeptides In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one expressible sequence that encodes a plant modified polypeptide. A plant modified polypeptide refers to a polypeptide that can modify the genetic characteristics of a plant (e.g., increase gene expression, decrease gene expression, or otherwise modify the nucleotide sequence of DNA or RNA), modify the epigenetic characteristics, or modify the physiological or biochemical characteristics in a manner that results in a change in the plant's physiology or phenotype, such as an increase or decrease in the fitness of the plant. In some embodiments, a polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more different plant modified polypeptides, or multiple copies of one or more plant modified polypeptides. A plant modified polypeptide can be one that can modify the physiology or phenotype of various plants, or increase or decrease the fitness of various plants, or that can effect such changes in one or more particular plants (e.g., a particular species or genus of plants).

[0233] Examples of polypeptides that can be used herein include enzymes (e.g., metabolic recombinases, helicases, integrases, ribonucleases, deoxyribonucleases, or ubiquitinating proteins), pore-forming proteins, signaling ligands, cell-penetrating peptides, transcription factors, receptors, antibodies, nanobodies, gene editing proteins (e.g., CRISPR-Cas endonucleases, TALENs, or Zn fingers), riboproteins, protein aptamers, or chaperones.

[0234] Agricultural polypeptide In some embodiments, the polyribonucleotides described herein (e.g., the polyribonucleotide cargo of the polyribonucleotide) comprise at least one expression sequence encoding an agricultural polypeptide. An agricultural polypeptide is a polypeptide suitable for agricultural use. In embodiments, the agricultural polypeptide is applied to a plant or seed (e.g., by foliar spray, dusting, injection, or seed coating) or to the plant's environment (e.g., by soil drench or granular soil application) resulting in an alteration of the plant's physiology, phenotype, or fitness. Embodiments of agricultural polypeptides include polypeptides that alter the level, activity, or metabolism of one or more microorganisms resident in or on a plant or non-human animal host, which alteration results in an increase in the fitness of the host. In some embodiments, the agricultural polypeptide is a plant polypeptide. In some embodiments, the agricultural polypeptide is an insect polypeptide. In some embodiments, the agricultural polypeptide has a biological effect when contacted with a non-human vertebrate, invertebrate, microorganism, or plant cell.

[0235] In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more agricultural polypeptides, or multiple copies of one or more agricultural polypeptides.

[0236] Embodiments of polypeptides useful for agricultural applications include, for example, bacteriocins, lysins, antimicrobial peptides, rhizocine C-rich peptides, and fungal cell regulatory peptides. Such polypeptides can be used to modify the levels, activity, or metabolism of target microorganisms to increase the fitness of insects such as honeybees and silkworms. Embodiments of agriculturally useful polypeptides include peptide toxins, such as those naturally produced by insect pathogens (e.g., Bacillus thuringiensis, Photorhabdus luminescens, Serratia entomophila, or Xenorhabdus nematophila), as known in the art. Embodiments of agriculturally useful polypeptides include polypeptides (including small peptides such as cyclodipeptides or diketopiperazines) for controlling agriculturally important pests or pathogens, e.g., antibacterial or antifungal polypeptides for controlling disease in plants, or pesticidal polypeptides (e.g., insecticidal or nematocidal polypeptides) for controlling invertebrate pests such as insects or nematodes. Embodiments of agriculturally useful polypeptides include antibodies, nanobodies, and fragments thereof, e.g., antibodies or nanobody fragments that retain at least a portion (e.g., at least 10%) of the specific binding activity of an intact antibody or nanobody. Embodiments of agriculturally useful polypeptides include transcription factors, e.g., plant transcription factors; see, e.g., the "AtTFDB" database, which lists transcription factor families identified in the model plant Arabidopsis thaliana, publicly available at agris-knowledgebase[dot]org / AtTFDB / . Embodiments of agriculturally useful polypeptides include nucleases, e.g., exonucleases or endonucleases (e.g., Cas nucleases, such as Cas9 or Cas12a).Embodiments of agriculturally useful polypeptides further include cell penetrating peptides, enzymes (e.g., amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones (e.g., yeast mating pheromones, invertebrate reproductive and larval signaling pheromones, see, e.g., Altstein (2004) Peptides, 25:1373-1376).

[0237] Internal ribosome entry sites In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises one or more internal ribosome entry site (IRES) elements. In some embodiments, the IRES is operably linked to one or more expression sequences (e.g., each IRES is operably linked to one or more expression sequences). In embodiments, the IRES is located between the heterologous promoter and the 5' end of the coding sequence.

[0238] IRES elements suitable for inclusion within a polyribonucleotide comprise an RNA sequence capable of associating with a eukaryotic ribosome, hi some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.

[0239] In some embodiments, the IRES element is derived from DNA of organisms including, but not limited to, viruses, mammals, and Drosophila. Such viral DNA can be derived from, but is not limited to, encephalomyocarditis virus (EMCV) cDNA and poliovirus cDNA, as well as picornavirus complementary DNA (cDNA). In one embodiment, the Drosophila DNA from which the IRES element is derived includes, but is not limited to, the antennapedia gene from Drosophila melanogaster.

[0240] In some embodiments, if present, the IRES sequence is selected from the group consisting of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invictavirus 1, Rhopalopsis aphid virus, Reticuloendotheliosis virus, Fuman poliovirus 1, German winged stink bug enteric virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Tea budworm picorna-like virus, Encephalomyocarditis virus (EMCV), Drosophila melanogaster C virus, Crucifer tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black queen brood virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus virus), classical swine fever virus, human FGF2, human SFTPAl, human AMLl / RUNXl, Drosophila antennapedia, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Salivirus, cosavirus, parechovirus, Drosophila hairless, yeast (S. cerevisiae) TFIID, yeast (S.cerevisiae YAP1, human c-src, human FGF-1, picomavirus, Turnip crinkle virus, an aptamer for eIF4G, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2) IRES sequence. In yet another embodiment, the IRES is a Coxsackievirus B3 (CVB3) IRES sequence. In a further embodiment, the IRES is an encephalomyocarditis virus IRES sequence.

[0241] In some embodiments, the polyribonucleotide comprises at least one IRES flanking at least one (e.g., two, three, four, five or more) expressed sequence. In some embodiments, an IRES flanks both sides of at least one (e.g., two, three, four, five or more) expressed sequence. In some embodiments, the polyribonucleotide comprises one or more IRES sequences on either or both sides of each expressed sequence, providing for isolation of the resulting peptides and / or polypeptides.

[0242] In some embodiments, the polyribonucleotide cargo comprises an IRES. For example, the polyribonucleotide cargo may comprise a circular RNA IRES, for example, as described in Chen et al. Mol. Cell 81:1-19, 2021, the entirety of which is incorporated herein by reference.

[0243] Adjustment element In some embodiments, a polyribonucleotide described herein (e.g., a polyribonucleotide cargo of a polyribonucleotide) comprises one or more regulatory elements. In some embodiments, a polyribonucleotide comprises a regulatory element, e.g., a sequence that regulates expression of an expression sequence within the polyribonucleotide.

[0244] Regulatory elements may include sequences located adjacent to the expression sequence that codes for the expression product. Regulatory elements may be operably linked to adjacent sequences. Regulatory elements may increase the amount of expressed product compared to the amount of expressed product in the absence of the regulatory element. Furthermore, one regulatory element may increase the amount of expressed product for multiple expression sequences that are linked side by side. Thus, one regulatory element can promote the expression of one or more expression sequences. Multiple regulatory elements are well known to those skilled in the art.

[0245] In some embodiments, the regulatory element is a translation modulator. The translation modulator may regulate the translation of an expressed sequence in the polyribonucleotide. The translation modulator may be a translation enhancer or suppressor. In some embodiments, the polyribonucleotide comprises at least one translation modulator adjacent to at least one expressed sequence. In some embodiments, the polyribonucleotide comprises a translation modulator adjacent to each expressed sequence. In some embodiments, the translation modulator is on one or both sides of each expressed sequence, resulting in the separation of the expression products, e.g., peptides and / or polypeptides.

[0246] In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.

[0247] Further examples of regulatory elements are described, for example, in paragraphs

[0154] to

[0161] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0248] Translation initiation sequence In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one translation initiation sequence. In some embodiments, a polyribonucleotide comprises a translation initiation sequence that is operably linked to an expression sequence.

[0249] In some embodiments, the polyribonucleotide may encode a polypeptide and include a translation initiation sequence, e.g., a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the polyribonucleotide includes a translation initiation sequence, e.g., a Kozak sequence, flanking the expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, a translation initiation sequence, e.g., a Kozak sequence, is present on one or both sides of each expression sequence to provide separation of the expression products. In some embodiments, the polyribonucleotide includes at least one translation initiation sequence flanking the expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the polyribonucleotide. In some embodiments, the translation initiation sequence is within a substantially single-stranded region of the circular polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs

[0163] to

[0165] of WO 2019 / 118919, which is incorporated herein by reference in its entirety.

[0250] A polyribonucleotide may comprise two or more start codons, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60 or more than 60 start codons. Translation may begin at the first start codon or may begin downstream of the first start codon.

[0251] In some embodiments, the polyribonucleotide may initiate at the first start codon, e.g., a codon that is not AUG. Translation of the polyribonucleotide may initiate at an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG / CUG (SEQ ID NO: 74), GTG / GUG (SEQ ID NO: 75), ATA / AUA (SEQ ID NO: 76), ATT / AUU (SEQ ID NO: 77), TTG / UUG (SEQ ID NO: 78). In some embodiments, translation initiates at an alternative translation initiation sequence under selective conditions, e.g., stress-inducing conditions. As a non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation initiation sequence, e.g., ACG. As another non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation initiation sequence, CTG / CUG (SEQ ID NO: 74). As another non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation initiation sequence, GTG / GUG (SEQ ID NO: 75). As another non-limiting example, a polyribonucleotide may initiate translation at alternative translation initiation sequences, including repeat-associated non-AUG (RAN) sequences, e.g., short stretches of repetitive RNA, e.g., CGG, GGGGCC (SEQ ID NO: 79), CAG, CTG.

[0252] Termination sequence In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one termination sequence. In some embodiments, the polyribonucleotide comprises a termination sequence that is operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination sequence.

[0253] In some embodiments, the polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence. In some embodiments, the polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence, such that the polyribonucleotide is continuously translated. Exclusion of the termination sequence may result in rolling circle translation or continuous expression of the expression product.

[0254] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, each of which may lack a termination sequence, such that the circular polyribonucleotide is translated continuously. The exclusion of the termination sequence may result in rolling circle translation or continuous expression of expression products, such as peptides or polypeptides, due to lack of ribosome stalling or shedding. In such embodiments, the rolling circle translation expresses continuous expression products through each expression sequence. In some other embodiments, the termination sequence of the expression sequence may be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide include a termination sequence. However, rolling circle translation or expression of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences in the circular polyribonucleotide is performed. In such cases, the expression product may be shedding from the ribosome when the ribosome encounters a termination sequence, such as a stop codon, and terminates translation. In some embodiments, translation is terminated while the ribosome, eg, at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.

[0255] In some embodiments, the circular polyribonucleotide comprises a termination sequence at the end of one or more expressed sequences. In some embodiments, the one or more expressed sequences comprise two or more subsequent termination sequences. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome is completely separated from the circular polyribonucleotide. In some such embodiments, the generation of the subsequent (e.g., second, third, fourth, fifth, etc.) expressed sequences in the circular polyribonucleotide may require the ribosome to reassociate with the circular polyribonucleotide before the start of translation. Generally, the termination sequence comprises an in-frame nucleotide triplet, e.g., UAA, UGA, UAG, that signals the termination of translation. In some embodiments, one or more termination sequences in the circular polyribonucleotide are frame-shifted termination sequences, such as, but not limited to, off-frame or -1 and +1 shifted reading frames (e.g., cryptic stops), that may terminate translation. Frameshifted termination sequences include the triple nucleotides TAA, TAG, and TGA that occur in the second and third reading frames of the expressed sequence.Frameshifted termination sequences can be important to prevent misreading of mRNA, which is often harmful to cells.In some embodiments, the termination sequence is a stop codon.

[0256] Further examples of termination sequences are described in paragraphs

[0169] to

[0170] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0257] Untranslated Regions In some embodiments, the circular polyribonucleotide comprises an untranslated region (UTR). The UTR of a genomic region that comprises a gene may be transcribed but not translated. In some embodiments, the UTR may be included upstream of the translation initiation sequence of the expression sequence described herein. In some embodiments, the UTR may be included downstream of the expression sequence described herein. In some cases, one UTR for a first expression sequence is the same as, contiguous with, or overlaps with another UTR for a second expression sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, such as ZKSCAN1.

[0258] Exemplary untranslated regions are described in paragraphs

[0197] to

[0201] of International Publication No. 2019 / 118919, the entirety of which is incorporated herein by reference.

[0259] In some embodiments, the cyclic polyribonucleotide comprises a polyA sequence. Exemplary polyA sequences are described in paragraphs

[0202] to

[0205] of WO 2019 / 118919, the entirety of which is incorporated herein by reference. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence.

[0260] In some embodiments, the cyclic polyribonucleotide comprises a UTR that contains one or more stretches of adenosines and uridines. These AU-rich signatures may increase the turnover rate of the expression product.

[0261] The introduction, removal, or modification of AU-rich elements (AREs) in the UTRs can be useful for modulating the stability or immunogenicity (e.g., the level of one or more markers of immune or inflammatory response) of a cyclic polyribonucleotide. When modifying a particular cyclic polyribonucleotide, one or more copies of an ARE may be introduced into the cyclic polyribonucleotide, and the copies of the ARE may modulate the translation and / or production of the expression product. Similarly, AREs can be identified and removed or modified into a cyclic polyribonucleotide to modulate the intracellular stability, which in turn affects the translation and production of the resulting protein.

[0262] It should be understood that any UTR from any gene may be incorporated into each flanking region of the circular polyribonucleotide.

[0263] In some embodiments, the circular polyribonucleotide lacks a 5'UTR and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a 3'UTR and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a polyA sequence and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a termination sequence and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks an internal ribosome entry site and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a cap and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a 5'UTR, a 3'UTR, and an IRES and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding an exogenous gene, a sequence encoding a therapeutic, a regulatory element (e.g., a translation modulator, e.g., a translation enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids (e.g., siRNA, lncRNA, shRNA) targeting an endogenous gene, and a sequence encoding a therapeutic mRNA or protein.

[0264] In some embodiments, the cyclic polyribonucleotide lacks a 5' UTR. In some embodiments, the cyclic polyribonucleotide lacks a 3' UTR. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence. In some embodiments, the cyclic polyribonucleotide lacks a termination sequence. In some embodiments, the cyclic polyribonucleotide lacks an internal ribosome entry site. In some embodiments, the cyclic polyribonucleotide lacks susceptibility to degradation by exonucleases. In some embodiments, the fact that the cyclic polyribonucleotide lacks susceptibility to degradation can mean that the cyclic polyribonucleotide is not degraded by exonucleases or is degraded to a limited extent in the presence of exonucleases, e.g., is equivalent or similar in the absence of exonucleases. In some embodiments, the cyclic polyribonucleotide is not degraded by exonucleases. In some embodiments, the cyclic polyribonucleotide has reduced degradation when exposed to exonucleases. In some embodiments, the cyclic polyribonucleotide lacks binding to cap-binding proteins. In some embodiments, the circular polyribonucleotide lacks a 5' cap.

[0265] Stagger Element In some embodiments, the cyclic polyribonucleotide comprises at least one stagger element adjacent to the expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element adjacent to each expressed sequence. In some embodiments, the stagger element is on one or both sides of each expressed sequence, resulting in separation of the expression products, e.g., peptides and / or polypeptides. In some embodiments, the stagger element is a portion of one or more expressed sequences. In some embodiments, the cyclic polyribonucleotide comprises one or more expressed sequences, each of which is separated from the subsequent expressed sequence by a stagger element in the cyclic polyribonucleotide. In some embodiments, the stagger element prevents the generation of a single polypeptide from (a) two translations of a single expressed sequence, or (b) one or more translations of two or more expressed sequences. In some embodiments, the stagger element is a sequence separated from one or more expressed sequences. In some embodiments, the stagger element comprises a portion of an expressed sequence of one or more expressed sequences.

[0266] In some embodiments, the circular polyribonucleotide comprises a stagger element. To maintain rolling circle translation while avoiding the production of continuous expression products, such as peptides or polypeptides, the inclusion of a stagger element may induce ribosome stalling during translation. In some embodiments, the stagger element is at the 3' end of at least one of the one or more expressed sequences. The stagger element may be designed to stall the ribosome during rolling circle translation of the circular polyribonucleotide. The stagger element may include, but is not limited to, a 2A-like or CHYSEL (SEQ ID NO: 71) (cis-acting hydrolase element) sequence. In some embodiments, the stagger element encodes a sequence with a C-terminal consensus sequence that is X1X2X3EX5NPGP (SEQ ID NO: 72), where X1 is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid. In some embodiments, the sequence contains a non-conserved sequence of amino acids with strong alpha-helical character followed by the consensus sequence -D(V / I)EXNPGP (SEQ ID NO:73), where x=any amino acid. Some non-limiting examples of stagger elements include GDVESNPGP (SEQ ID NO:52), GDIEENPGP (SEQ ID NO:53), VEPNPGP (SEQ ID NO:54), IETNPGP (SEQ ID NO:55), GDIESNPGP (SEQ ID NO:56), GDVELNPGP (SEQ ID NO:57), GDIETNPGP (SEQ ID NO:58), GDVENPGP (SEQ ID NO:59), GDVEENPGP (SEQ ID NO:60), GDVEQNPGP (SEQ ID NO:61), IESNPGP (SEQ ID NO:62), GDIELNPGP (SEQ ID NO:63), HDIETPGP (SEQ ID NO:64), HDVETNPGP (SEQ ID NO:65), HDVEMNPGP (SEQ ID NO:66), GDMESNPGP (SEQ ID NO:67), GDVETNPGP (SEQ ID NO:68) GDIEQNPGP (SEQ ID NO:69), and DSEFNPGP (SEQ ID NO:70).

[0267] In some embodiments, the stagger elements described herein cleave the expression product, such as between the G and P of the consensus sequences described herein. As one non-limiting example, the cyclic polyribonucleotide comprises at least one stagger element for cleaving the expression product. In some embodiments, the cyclic polyribonucleotide comprises a stagger element adjacent to at least one expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element after each expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element present on one or both sides of each expressed sequence to cause translation of individual peptides and / or polypeptides from each expressed sequence.

[0268] In some embodiments, the stagger element comprises one or more modified or non-natural nucleotides that induce ribosome stalling during translation. Non-natural nucleotides may include peptide nucleic acids (PNAs), morpholinos and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Examples such as these are distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule. Exemplary modifications may include any modification to the sugar, nucleobase, internucleoside bond (e.g., linking phosphate / phosphodiester bond / phosphodiester backbone), and any combination thereof, that may induce ribosome stalling during translation. Some of the exemplary modifications provided herein are described elsewhere herein.

[0269] In some embodiments, the stagger element is present in other forms in the circular polyribonucleotide. For example, in some exemplary circular polyribonucleotides, the stagger element comprises a termination sequence of the first expressed sequence in the circular polyribonucleotide and a nucleotide spacer sequence that separates the termination sequence from the first translation initiation sequence of the expression contiguous to the first expressed sequence. In some examples, the first stagger element of the first expressed sequence is present upstream (5' to) the first translation initiation sequence of the expression contiguous to the first expressed sequence in the circular polyribonucleotide. In some cases, the first expressed sequence and the expression sequence contiguous to the first expressed sequence are two separate expressed sequences in the circular polyribonucleotide. The distance between the first stagger element and the first translation initiation sequence may allow for the continuous translation of the first expressed sequence and its contiguous expressed sequence.

[0270] In some embodiments, the first stagger element comprises a termination sequence and separates the expression product of the first expressed sequence from the expression product of the contiguous expressed sequence, thereby creating a separate expression product. In some cases, a circular polyribonucleotide comprising a first stagger element upstream of a first translation initiation sequence of a contiguous sequence in the circular polyribonucleotide is continuously translated, while a corresponding circular polyribonucleotide comprising a stagger element of a second expressed sequence present upstream of a second translation initiation sequence of a contiguous expressed sequence in the second expressed sequence is not continuously translated. In some cases, there is only one expressed sequence in the circular polyribonucleotide, and the first expressed sequence and the contiguous expressed sequence are the same expressed sequence. In some exemplary circular polyribonucleotides, the stagger element comprises a first termination sequence of the first expressed sequence in the circular polyribonucleotide and a nucleotide spacer sequence that separates the termination sequence from the downstream translation initiation sequence. In some such examples, the first stagger element is upstream (5' to) of the first translation initiation sequence of the first expressed sequence in the circular polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation sequence allows for continuous translation of the first expressed sequence and any consecutive expressed sequences.

[0271] In some embodiments, the first stagger element separates the product of one expression of the first expression sequence from the product of the next expression of the first expression sequence, thereby creating separate expression products. In some cases, a circular polyribonucleotide that includes a first stagger element upstream of a first translation initiation sequence of a first expression sequence in a circular polyribonucleotide is continuously translated, while a corresponding circular polyribonucleotide that includes a stagger element upstream of a second translation initiation sequence of a second expression sequence in a corresponding circular polyribonucleotide is not continuously translated. In some cases, the distance between the second stagger element and the second translation initiation sequence is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold greater in the corresponding circular polyribonucleotide than the distance between the first stagger element and the first translation initiation sequence in the circular polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation sequence is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or more. In some embodiments, the distance between the second stagger element and the second translation initiation sequence is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or more, greater than the distance between the first stagger element and the first translation initiation sequence. In some embodiments, the circular polyribonucleotide comprises two or more expressed sequences.

[0272] Examples of stagger elements are described in paragraphs

[0172] to

[0175] of International Publication No. WO 2019 / 118919, the entirety of which is incorporated herein by reference.

[0273] Non-coding sequences In some embodiments, a polyribonucleotide described herein (e.g., the polyribonucleotide cargo of a polyribonucleotide) comprises one or more non-coding sequences, e.g., sequences that do not code for expression of a polypeptide. In some embodiments, a polyribonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 non-coding sequences. In some embodiments, a polyribonucleotide does not code for a polypeptide expression sequence.

[0274] The non-coding sequence may be a natural or synthetic sequence. In some embodiments, the non-coding sequence may modify cell behavior, such as lymphocyte behavior. In some embodiments, the non-coding sequence is antisense to a cellular RNA sequence.

[0275] In some embodiments, the polyribonucleotide comprises a regulatory nucleic acid that is typically an RNA or RNA-like structure of about 5-500 base pairs (bp) (depending on the particular RNA structure (e.g., miRNA of 5-30 bp, lncRNA of 200-500 bp) and may have a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene in a cell. In embodiments, the circular polyribonucleotide comprises a regulatory nucleic acid that encodes an RNA precursor, e.g., a miRNA precursor, that is processable into a smaller RNA, which may be about 50 to about 1000 bp, that is processable into a smaller miRNA intermediate or mature miRNA.

[0276] Long non-coding RNA (IncRNA) is defined as a non-protein-coding transcript longer than 100 nucleotides. Many IncRNAs are characterized as tissue-specific. Diverse IncRNAs that are transcribed in the opposite direction to nearby protein-coding genes comprise a significant proportion (e.g., about 20% of all IncRNAs in mammalian genomes) and likely regulate the transcription of nearby genes. In one embodiment, the polyribonucleotide provided herein comprises the sense strand of an IncRNA. In one embodiment, the polyribonucleotide provided herein comprises the antisense strand of an IncRNA.

[0277] In embodiments, the polyribonucleotide encodes a regulatory nucleic acid that is substantially complementary or completely complementary to all or at least a fragment of an endogenous gene or gene product (e.g., mRNA). In embodiments, the regulatory nucleic acid complements sequences at intron-exon boundaries, between exons, or adjacent to exons to prevent the maturation of newly generated nuclear RNA transcripts of a particular gene into mRNA during transcription. A regulatory nucleic acid that is complementary to a particular gene may hybridize with the mRNA for that gene and block its translation. An antisense regulatory nucleic acid may be DNA, RNA, or derivatives or hybrids thereof. In some embodiments, the regulatory nucleic acid comprises a protein binding site that may bind to a protein involved in regulating the expression of an endogenous or exogenous gene.

[0278] In embodiments, the polyribonucleotide encodes a regulatory RNA that hybridizes to a transcript of interest, where the regulatory RNA has a length of about 5-30 nucleotides, about 10-30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more than 30 nucleotides. In embodiments, the degree of sequence identity of the regulatory RNA to the targeted transcript is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0279] In embodiments, the polyribonucleotide encodes a microRNA (miRNA) molecule identical to about 5 to about 25 contiguous nucleotides of the target gene, or encodes a precursor of that miRNA. In some embodiments, the miRNA has a sequence that enables the mRNA to recognize and bind to a specific target mRNA. In embodiments, the miRNA sequence starts with the dinucleotide AA, contains about 30-70% (about 30-60%, about 40-60%, or about 45%-55%) GC content, and does not share a high percentage of identity with any nucleotide sequence other than the target in the genome of the subject (e.g., mammal) that is to be introduced as determined, for example, by a standard BLAST search.

[0280] In some embodiments, the polyribonucleotide comprises at least one miRNA (or miRNA precursor), e.g., 2, 3, 4, 5, 6, or more miRNAs or miRNA precursors. In some embodiments, the polyribonucleotide comprises a sequence encoding a miRNA (or a precursor thereof) having at least about 75%, 80%, 85%, 90% 95%, 96%, 97%, 98%, or 99% or 100% nucleotide sequence complementarity to a target sequence.

[0281] siRNAs and shRNAs resemble intermediates in the processing pathway of endogenous microRNA (miRNA) genes. In some embodiments, siRNAs can function as miRNAs and vice versa. Like siRNAs, microRNAs use RISC to downregulate target genes, but unlike siRNAs, most animal miRNAs do not cleave mRNAs. Instead, miRNAs reduce protein output through translational repression or polyA removal and mRNA degradation. Known miRNA binding sites are within the 3'UTR of mRNAs; miRNAs appear to target sites with near perfect complementarity to nucleotides 2-8 from the 5' end of the miRNA. This region is known as the seed region. Because mature siRNAs and miRNAs are interchangeable, exogenous siRNAs downregulate mRNAs with seed complementary to the siRNA.

[0282] Lists of known miRNA sequences can be found in databases maintained by research organizations such as the Wellcome Trust Sanger Institute, Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are easily designed and generated by techniques known in the art. In addition, computational tools exist that increase the chances of finding effective specific sequence motifs.

[0283] Protein Binding Sequences In some embodiments, the cyclic polyribonucleotide comprises one or more protein binding sites that allow proteins, such as ribosomes, to bind to internal sites within the RNA sequence.By designing a protein binding site, such as a ribosome binding site, into the cyclic polyribonucleotide, the cyclic polyribonucleotide can evade or reduce detection by the host's immune system by masking the cyclic polyribonucleotide from components of the host's immune system, regulating degradation, or regulating translation.

[0284] In some embodiments, the cyclic polyribonucleotide comprises at least one immunity protein binding site, e.g., to evade an immune response, e.g., a CTL (cytotoxic T lymphocyte) response. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and aids in masking the cyclic polyribonucleotide as exogenous. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and aids in masking the cyclic polyribonucleotide as exogenous or foreign.

[0285] The traditional mechanism of ribosome association to linear RNA involves ribosome binding to the capped 5' end of the RNA. The first peptide bond is formed as soon as the ribosome moves from the 5' end to the start codon. According to the present disclosure, internal initiation of translation of a circular polyribonucleotide (i.e., cap-independent) does not require a free or capped end. Rather, the ribosome binds to an uncapped internal site, whereby the ribosome initiates polypeptide elongation at the start codon. In some embodiments, the circular polyribonucleotide comprises one or more RNA sequences that include a ribosome binding site, e.g., a start codon.

[0286] Natural 5'UTRs have characteristics that play a role in translation initiation. They contain signatures such as the Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates the translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO:79), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another "G". 5'UTRs are also known to form secondary structures involved in elongation factor binding.

[0287] In some embodiments, the cyclic polyribonucleotide encodes a protein binding sequence that binds to a protein. In some embodiments, the protein binding sequence targets or localizes the cyclic polyribonucleotide to a specific target. In some embodiments, the protein binding sequence specifically binds to an arginine-rich region of a protein.

[0288] In some embodiments, the protein binding sites include, but are not limited to, ACIN1, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, EIF4G2, EL AVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMR1, FUS, FXR1, FXR2, GNL3, GTF2F1, HNRNPA1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPL, HNRNPM, HNRNPU, HNRNPUL1, IGF2BP1, IGF2BP2, IGF2BP3, ILF3, KHDRBS1, LARP7, LIN28A, LIN28B , m6A, MBNL2, METTL3, MOV10, MSI1, MSI2, NONO, NONO-, NOP58, NPM1, NUDT21, PCBP2, POLR2A, PRPF8, PTBP1, RBFO X2, RBM10, RBM22, RBM27, RBM47, RNPS1, SAFB2, SBDS, SF3A3, SF3B4, SIRT7, SLBP, SLTM, SMNDC1, SND1, SRRM4, SRS Binding sites for proteins such as F1, SRSF3, SRSF7, SRSF9, TAF15, TARDBP, TIA1, TNRC6A, TOP3B, TRA2A, TRA2B, U2AF1, U2AF2, UNK, UPF1, WDR33, XRN2, YBX1, YTHDC1, YTHDF1, YTHDF2, YWHAG, ZC3H7B, PDK1, AKT1, and any other protein that binds RNA.

[0289] Spacer sequence In some embodiments, the polyribonucleotides described herein comprise one or more spacer sequences. A spacer refers to any adjacent nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. A spacer may be present between any of the nucleic acid elements described herein. A spacer may also be present within the nucleic acid elements described herein.

[0290] For example, a nucleic acid may include any two or more of the following elements: (A) the 3' half of a group I catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' half of a group I catalytic intron fragment; a spacer region may be present between any one or more of the elements. Any of elements (A), (B), (C), (D), (E), (F), or (G) may be separated by a spacer sequence, as described herein. For example, a spacer may be present between (A) and (B), between (B) and (C), between (C) and (D), between (D) and (E), between (E) and (F), or between (F) and (G).

[0291] In some embodiments, the polyribonucleotide further comprises a first spacer region between the 5' exon fragment of (C) and the polyribonucleotide cargo of (D). The spacer may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, the polyribonucleotide further comprises a second spacer region between the polyribonucleotide cargo of (D) and the 5' exon fragment of (E). The spacer may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, each spacer region is at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. Each spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a polyA sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a polyAC sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a polyAG sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a polyAT sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a random sequence.

[0292] Spacers may also be present within the nucleic acid regions described herein. For example, a polynucleotide cargo region may include one or more spacers. A spacer may separate regions within a polynucleotide cargo.

[0293] In some embodiments, the spacer sequence can be, for example, at least 10 nucleotides in length, at least 15 nucleotides in length, or at least 30 nucleotides in length. In some embodiments, the spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the spacer sequence is 20-50 nucleotides in length. In certain embodiments, the spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length.

[0294] The spacer sequence can be a polyA sequence, a polyAC sequence, a polyC sequence, or a polyU sequence.

[0295] In some embodiments, the spacer sequence can be polyAT, polyAC, polyAG, or a random sequence.

[0296] Spacer sequences can be used to separate the IRES from adjacent components to preserve the structure and function of the IRES or adjacent elements. Spacers can be specifically modified depending on the IRES. In some embodiments, RNA folding computer software such as RNAFold can be used to guide the design of various elements of the vector, including spacers.

[0297] In some embodiments, the polyribonucleotide comprises a 5' spacer sequence (e.g., between the 5' annealing region and the polyribonucleotide cargo). In some embodiments, the 5' spacer sequence is at least 10 nucleotides in length. In another embodiment, the 5' spacer sequence is at least 15 nucleotides in length. In further embodiments, the 5' spacer sequence is at least 30 nucleotides in length. In some embodiments, the 5' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is 20-50 nucleotides in length. In certain embodiments, the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 5' spacer sequence is a polyA sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In some embodiments, the 5' spacer sequence comprises a polyAG sequence. In some embodiments, the 5' spacer sequence comprises a polyAT sequence. In some embodiments, the 5' spacer sequence comprises a random sequence.

[0298] In some embodiments, the polyribonucleotide comprises a 3' spacer sequence (e.g., between the 3' annealing region and the polyribonucleotide cargo). In some embodiments, the 3' spacer sequence is at least 10 nucleotides in length. In another embodiment, the 3' spacer sequence is at least 15 nucleotides in length. In further embodiments, the 3' spacer sequence is at least 30 nucleotides in length. In some embodiments, the 3' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 3' spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 3' spacer sequence is 20-50 nucleotides in length. In certain embodiments, the 3'spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 3'spacer sequence is a polyA sequence. In another embodiment, the 5'spacer sequence is a polyAC sequence. In some embodiments, the 5'spacer sequence comprises a polyAG sequence. In some embodiments, the 5'spacer sequence comprises a polyAT sequence. In some embodiments, the 5'spacer sequence comprises a random sequence.

[0299] In one embodiment, the polyribonucleotide comprises a 5' spacer sequence but does not comprise a 3' spacer sequence. In another embodiment, the polyribonucleotide comprises a 3' spacer sequence but does not comprise a 5' spacer sequence. In another embodiment, the polyribonucleotide does not comprise a 5' or 3' spacer sequence. In another embodiment, the polyribonucleotide does not comprise an IRES sequence. In a further embodiment, the polyribonucleotide does not comprise an IRES sequence, a 5' spacer sequence or a 3' spacer sequence.

[0300] In some embodiments, the spacer sequence is at least 3 ribonucleotides, at least 4 ribonucleotides, at least 5 ribonucleotides, at least about 8 ribonucleotides, at least about 10 ribonucleotides, at least about 12 ribonucleotides, at least about 15 ribonucleotides, at least about 20 ribonucleotides, at least about 25 ribonucleotides, at least about 30 ribonucleotides, at least about 40 ribonucleotides, at least about 50 ribonucleotides, at least about 60 ribonucleotides, at least about 70 ribonucleotides, at least about 80 ribonucleotides, ribonucleotides, at least about 90 ribonucleotides, at least about 100 ribonucleotides, at least about 120 ribonucleotides, at least about 150 ribonucleotides, at least about 200 ribonucleotides, at least about 250 ribonucleotides, at least about 300 ribonucleotides, at least about 400 ribonucleotides, at least about 500 ribonucleotides, at least about 600 ribonucleotides, at least about 700 ribonucleotides, at least about 800 ribonucleotides, at least about 900 ribonucleotides, or at least about 100 ribonucleotides.

[0301] Generation method Cell-free production method The present disclosure also provides a method for generating circular RNA.For example, deoxyribonucleotide template can be transcribed in cell-free system (for example, by in vitro transcription) to generate linear RNA.Linear polyribonucleotide generates splicing-compatible polyribonucleotide, which can self-splice to generate circular polyribonucleotide.

[0302] In some embodiments, the disclosure provides methods of producing a circular polyribonucleotide (e.g., in a cell-free system) by providing a linear polyribonucleotide; and a self-splicing linear polyribonucleotide under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide; thereby producing a circular polyribonucleotide.

[0303] In some embodiments, the disclosure provides methods of producing a circular polyribonucleotide by providing deoxyribonucleotides encoding a linear polyribonucleotide; transcribing the deoxyribonucleotides in a cell-free system to produce a linear polyribonucleotide; optionally purifying the splicing-compatible linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide.

[0304] In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by providing deoxyribonucleotides encoding a linear polyribonucleotide; transcribing the deoxyribonucleotides in a cell-free system to produce a linear polyribonucleotide, where the transcription is performed in solution under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5' split-intron and a 3' split-intron (e.g., a self-splicing construct to produce a circular polyribonucleotide). In some embodiments, the linear polyribonucleotide comprises a 5' annealing region and a 3' annealing region.

[0305] Suitable conditions for in vitro transcription and self-splicing can include any conditions (e.g., a solution or buffer, such as an aqueous buffer or solution) that recapitulate physiological conditions in one or more respects. In some embodiments, suitable conditions include 0.1-100 mM Mg2+ ions or a salt thereof (e.g., 1-100 mM, 1-50 mM, 1-20 mM, 5-50 mM, 5-20 mM, or 5-15 mM). In some embodiments, suitable conditions include 1-1000 mM K+ ions or a salt thereof, such as KCl (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include 1-1000 mM Cl- ions or a salt thereof such as KCl (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include 0.1-100 mM Mn2+ ions or a salt thereof such as MnCl2 (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include dithiothreitol (DTT) (e.g., 1 to 1000 μM, 1 to 500 μM, 1 to 200 μM, 50 to 500 μM, 100 to 500 μM, 100 to 300 μM, 0.1 to 100 mM, 0.1 to 50 mM, 0.1 to 20 mM, 0.1 to 10 mM, 0.1 to 5 mM, 0.1 to 2 mM, 0.5 to 50 mM, 0.5 to 20 mM, 0.5 to 15 mM, 0.5 to 5 mM, 0.5 to 2 mM, or 0.1 to 10 mM). In some embodiments, suitable conditions include 0.1 mM and 100 mM ribonucleoside triphosphates (NTPs) (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-10 mM, 1-100 mM, 1-50 mM, or 1-10 mM). In some embodiments, suitable conditions include a pH of 4-10 (e.g., a pH of 5-9, a pH of 6-9, or a pH of 6.5-8.5).In some embodiments, suitable conditions include a temperature between 4°C and 50°C (e.g., between 10°C and 40°C, between 15°C and 40°C, between 20°C and 40°C, or between 30°C and 40°C).

[0306] In some embodiments, the linear polyribonucleotide is generated from a deoxyribonucleic acid, such as a deoxyribonucleic acid described herein, such as a DNA vector, a linearized DNA vector, or a cDNA. In some embodiments, the linear polyribonucleotide is transcribed from a deoxyribonucleic acid by transcription in a cell-free system (e.g., in vitro transcription).

[0307] How is it produced in cells? The present disclosure also provides a method of producing circular RNA in a cell, e.g., a prokaryotic or eukaryotic cell. In some embodiments, an exogenous polyribonucleotide is provided to the cell (e.g., a linear polyribonucleotide described herein or a DNA molecule encoding the transcription of a linear polyribonucleotide described herein). The linear polyribonucleotide may be transcribed within the cell from an exogenous DNA molecule provided to the cell. The linear polyribonucleotide may be transcribed within the cell from an exogenous recombinant DNA molecule transiently provided to the cell. In some embodiments, the exogenous DNA molecule is not integrated into the genome of the cell. In some embodiments, the linear polyribonucleotide is transcribed within the cell from a recombinant DNA molecule integrated into the genome of the cell.

[0308] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the prokaryotic cell comprising the polyribonucleotide described herein may be a bacterial cell or an archaeal cell. For example, prokaryotic cells comprising the polyribonucleotides described herein can be selected from the group consisting of E. coli, halophilic archaea (e.g., Haloferax volcaniii), Sphingomonas, cyanobacteria (e.g., Synechococcus elongatus, Spirulina (Arthrospira) spp., and Synechocystis spp.), Streptomyces, actinomycetes (e.g., Nonomuraea, Kitasatospora, or Thermobifida), Bacillus spp. (e.g., Bacillus subtilis, Bacillus anthracis, Bacillus subtil ... The prokaryotic cell may be Bacillus anthracis, Bacillus cereus, betaproteobacteria (e.g., Burkholderia), alphaproteobacterial (e.g., Agrobacterium), Pseudomonas (e.g., Pseudomonas putida), and enterobacteria. The prokaryotic cell may be grown in a culture medium. The prokaryotic cell may be contained within a bioreactor.

[0309] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell comprising the polyribonucleotide described herein is a unicellular eukaryotic cell. In some embodiments, the unicellular eukaryotic organism is a unicellular fungal cell, such as a yeast cell (e.g., Saccharomyces cerevisiae and other Saccharomyces species), Brettanomyces species, Schizosaccharomyces species, Torulaspora species, and Pichia species. In some embodiments, the unicellular eukaryotic cell is a unicellular animal cell. The unicellular animal cell may be a cell isolated from a multicellular animal and grown in culture, or a daughter cell thereof. In some embodiments, the unicellular animal cell may be dedifferentiated. In some embodiments, the unicellular eukaryotic cell is a unicellular plant cell. The unicellular plant cell may be a cell isolated from a multicellular animal and grown in culture, or a daughter cell thereof. In some embodiments, the unicellular plant cell may be dedifferentiated. In some embodiments, the unicellular plant cell is derived from a plant callus. In embodiments, the unicellular cell is a plant cell protoplast. In some embodiments, the unicellular eukaryotic cell is a unicellular eukaryotic algae cell, such as a unicellular green algae, diatom, euglenid, or dinoflagellate.Non-limiting examples of unicellular eukaryotic algae of interest include Dunaliella salina, Chlorella vulgaris, Chlorella zofingiensis, Haematococcus pluvialis, Neochloris oleoabundans and other Neochloris species, Protosiphon botryoides, Botryococcus braunii, Cryptococcus species, Chlamydomonas reinhardtii and other Chlamydomonas species. In some embodiments, the unicellular eukaryotic cell is a protist cell. In some embodiments, the unicellular eukaryotic cell is a protozoan cell.

[0310] In some embodiments, the eukaryotic cell is a cell of a multicellular eukaryotic organism. For example, the multicellular eukaryotic organism may be selected from the group consisting of a vertebrate, an invertebrate, a multicellular fungus, a multicellular alga, and a multicellular plant. In some embodiments, the eukaryotic organism is a human. In some embodiments, the eukaryotic organism is a non-human vertebrate. In some embodiments, the eukaryotic organism is an invertebrate. In some embodiments, the eukaryotic organism is a multicellular fungus. In some embodiments, the eukaryotic organism is a multicellular plant. In embodiments, the eukaryotic cell is a human cell or a cell of a non-human mammal, such as a non-human primate (e.g., monkey, ape), ungulate (e.g., bovids including cows, buffalo, bison, sheep, goats, and muskoxen; pigs; camelids including camels, llamas, and alpacas; deer, antelope; and equines including horses and donkeys), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse, guinea pig, hamster, squirrel), or lagomorph (e.g., rabbit, hare). In embodiments, the eukaryotic cell is an avian, e.g., a member of the avian taxon Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, geese), Paleaognathae (e.g., ostrich, emu), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrot) cell. In embodiments, the eukaryotic cell is an arthropod (e.g., insect, arachnid, crustacean), nematode, annelid, worm, or mollusc cell. In embodiments, the eukaryotic cell is a cell of a multicellular plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgoes), ferns, horsetails, club mosses, or the like. In embodiments, the eukaryotic cell is a cell of a eukaryotic multicellular alga.

[0311] The eukaryotic cells may be grown in a culture medium. The eukaryotic cells may be contained within a bioreactor.

[0312] Purification method One or more purification steps may be included in the methods described herein. For example, in some embodiments, the linear polyribonucleotide is substantially concentrated or pure (e.g., purified) before self-splicing the linear polyribonucleotide. In other embodiments, the linear polyribonucleotide is not purified before self-splicing the linear polyribonucleotide. In some embodiments, the resulting circular RNA is purified.

[0313] Purification may include separating or concentrating the desired reaction product from one or more undesired components, such as any unreacted starting materials, by-products, enzymes, or other reaction components. For example, purification of linear polyribonucleotides after transcription in a cell-free system (e.g., in vitro transcription) may include separation or concentration from the DNA template before the linear polyribonucleotide self-splices. Purification of the circular RNA product after splicing can be used to separate or concentrate the circular RNA from its corresponding linear RNA. Methods for purifying RNA are known to those of skill in the art and include enzymatic purification or chromatographic purification.

[0314] In some embodiments, the purification method results in circular polyribonucleotides having less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) linear polyribonucleotides.

[0315] Bioreactor In some embodiments, any method for producing circular polyribonucleotides described herein may be carried out in a bioreactor. A bioreactor refers to any container in which a chemical or biological process involving an organism or a biochemically active substance derived from such an organism is carried out. A bioreactor may be adapted for the cell-free method for producing circular RNA described herein. Containers for bioreactors may include culture flasks, dishes, or bags, which may be single-use (disposable), autoclavable, or sterilizable. Bioreactors may be made of glass, or may be polymer-based, or may be manufactured from other materials.

[0316] Examples of bioreactors include, but are not limited to, stirred tank (e.g., well-mixed) and flat plate (e.g., plug flow) bioreactors, air-lift bioreactors, membrane stirred tanks, spin filter stirred tanks, vibratory mixers, fluidized bed reactors, and membrane bioreactors. The mode of operation of a bioreactor may be a batch or continuous process. A bioreactor is continuous when the streams of reagents and products are continuously fed and removed from the system. A batch bioreactor may have a continuous recirculation flow but may not have a continuous feed of reagents or product withdrawal.

[0317] Some methods of the present disclosure are directed to large-scale production of cyclic polyribonucleotides. For large-scale production methods, the methods can be carried out in volumes ranging from 1 liter (L) to 50 L or more (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L, or more). In some embodiments, the method can be performed with a volume of 5L to 10L, 5L to 15L, 5L to 20L, 5L to 25L, 5L to 30L, 5L to 35L, 5L to 40L, 5L to 45L, 10L to 15L, 10L to 20L, 10L to 25L, 20L to 30L, 10L to 35L, 10L to 40L, 10L to 45L, 10L to 50L, 15L to 20L, 15L to 25L, 15L to 30L, 15L to 35L, 15L to 40L, 15L to 45L, or 15L to 50L.

[0318] In some embodiments, the bioreactor may produce at least 1 g of circular RNA. In some embodiments, the bioreactor may produce 1-200 g of circular RNA (e.g., 1-10 g, 1-20 g, 1-50 g, 10-50 g, 10-100 g, 50-100 g, 50-200 g of circular RNA). In some embodiments, the amount produced is measured per liter (e.g., 1-200 g per liter), per batch or reaction (e.g., 1-200 g per batch or reaction), or per unit of time (e.g., 1-200 g per hour or day).

[0319] In some embodiments, two or more bioreactors can be utilized in series to increase production capacity (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 bioreactors can be used in series).

[0320] How to use In some embodiments, the circular polyribonucleotides generated as described herein are used as effectors in therapy or agriculture.

[0321] For example, a cyclic polyribonucleotide produced by the methods described herein may be administered to a subject (e.g., in a pharmaceutical, veterinary, or agricultural composition). In some embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxonomic group such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In embodiments, the subject is an invertebrate that is an invertebrate agricultural pest or a parasite on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgo), fern, horsetail, club moss, or bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is an agriculturally or horticulturally important plant, such as row crops, fruit-bearing plants and trees, vegetables, trees, and ornamentals, e.g., ornamental flowers, shrubs, trees, ground covers, and turf.

[0322] In some embodiments, the disclosure provides a method of modifying a subject by providing a composition or preparation described herein to the subject. In some embodiments, the composition or preparation is or comprises a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule described herein), and the polynucleotide is provided to a eukaryotic subject. In some embodiments, the composition or preparation is or comprises a eukaryotic or prokaryotic cell that contains a nucleic acid described herein.

[0323] In some embodiments, the disclosure provides a method of treating a condition in a subject in need thereof by providing to the subject a composition or preparation described herein. In some embodiments, the composition or preparation is or comprises a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule described herein), and the polynucleotide is provided to a eukaryotic subject. In some embodiments, the composition or preparation is or comprises a eukaryotic or prokaryotic cell that contains a nucleic acid described herein.

[0324] In some embodiments, the present disclosure provides methods of providing a circular polyribonucleotide to a subject by providing to a subject a eukaryotic or prokaryotic cell that comprises a polynucleotide described herein.

[0325] preparation In some embodiments of the present disclosure, the cyclic polyribonucleotides described herein can be formulated in a composition, such as an agricultural, animal, or pharmaceutical composition, for delivery to a cell, a plant, an invertebrate, a non-human vertebrate, or a human subject. In some embodiments, the cyclic polyribonucleotides are formulated in a pharmaceutical composition. In some embodiments, the composition comprises a cyclic polyribonucleotide and a diluent, a carrier, an adjuvant, or a combination thereof. In certain embodiments, the composition comprises a cyclic polyribonucleotide described herein and a carrier or a diluent without any carrier. In some embodiments, a composition comprising a cyclic polyribonucleotide and a diluent without any carrier is used for naked delivery of the cyclic polyribonucleotide to a subject.

[0326] salt In some cases, the compositions or pharmaceutical compositions provided herein include one or more salts. To control osmolality, physiological salts such as sodium salts can be included in the compositions provided herein. Other salts can include potassium chloride, potassium dihydrogen phosphate, disodium phosphate, and / or magnesium chloride, and the like. In some cases, the compositions are formulated with one or more pharma- ceutically acceptable salts. The one or more pharma-ceutically acceptable salts can include those of inorganic ions, such as, for example, sodium, potassium, calcium, and magnesium ions. Such salts can include salts of inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluenesulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid, or maleic acid. Polyribonucleotides can exist in either linear or cyclic form.

[0327] Buffer / pH The compositions or pharmaceutical compositions provided herein may include one or more buffers, such as Tris buffer, borate buffer, succinate buffer, histidine buffer (e.g., with aluminum hydroxide adjuvant), or citrate buffer, etc. The buffers are in some cases within the range of 5-20 mM.

[0328] The compositions or pharmaceutical compositions provided herein can have a pH between about 5.0 and about 8.5, between about 6.0 and about 8.0, between about 6.5 and about 7.5, or between about 7.0 and about 7.8. The compositions or pharmaceutical compositions can have a pH of about 7. Polyribonucleotides can exist in either linear or circular form.

[0329] Detergents / Surfactants The compositions or pharmaceutical compositions provided herein may contain, depending on the intended route of administration, one or more detergents and / or surfactants, such as polyoxyethylene sorbitan ester surfactants (commonly referred to as "Tween®"), such as polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and / or butylene oxide (BO), such as linear EO / PO block copolymers, sold under the trade name DOWFAX™; octoxynols, which may vary in the number of repeating ethoxy(oxy-1,2-ethanediyl) groups, such as octoxynol-9 (Triton® X-100, or t-octylphenoxypolyethoxyethanol); (octylphenoxy)polyethoxyethanol (IGEPAL®); CA-630 / NP-40; phospholipids such as phosphatidylcholine (lecithin); nonylphenol ethoxylates such as the Tergitol™ NP series; polyoxyethylene fatty ethers derived from lauryl alcohol, cetyl alcohol, stearyl alcohol and oleyl alcohol (known as Brij® surfactants), such as triethylene glycol monolauryl ether (Brij® 30); and sorbitan esters (commonly known as “SPAN®”) such as sorbitan trioleate (Span® 85) and sorbitan monolaurate, octoxynol (such as octoxynol-9 (Triton® X-100) or t-octylphenoxypolyethoxyethanol), cetyltrimethylammonium bromide ("CTAB"), or sodium deoxycholate. One or more detergents and / or surfactants may be included only in trace amounts. In some examples, the composition may contain less than 1 mg / ml each of octoxynol-10 and polysorbate 80. Non-ionic surfactants may be used herein. Surfactants may be classified by their "HLB" (hydrophilic / lipophilic balance). In some examples, the surfactant has an HLB of at least 10, at least 15, and / or at least 16.The polyribonucleotide may be included in a linear or circular form.

[0330] Diluent In some embodiments, the compositions of the present disclosure comprise a cyclic polyribonucleotide and a diluent. In some embodiments, the compositions of the present disclosure comprise a linear polyribonucleotide and a diluent.

[0331] The diluent may be a non-carrier excipient. The non-carrier excipient serves as a vehicle or medium for the composition, such as the cyclic polyribonucleotide described herein. The non-carrier excipient serves as a vehicle or medium for the composition, such as the linear polyribonucleotide described herein. Non-limiting examples of non-carrier excipients include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersions, suspension aids, surfactants, isotonicity agents, thickening agents, emulsifiers, preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersants, granulating agents, disintegrants, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof. The non-carrier excipient may be any of the inactive ingredients listed in the Inactive Ingredient Database that are approved by the United States Food and Drug Administration (FDA) and do not exhibit cell-penetrating effects. A non-carrier excipient can be, for example, any inactive ingredient suitable for administration to a non-human animal suitable for veterinary use. Modifications of compositions suitable for administration to humans to make them suitable for administration to a variety of animals are well understood and a veterinary pharmacologist of ordinary skill can design and / or make such modifications with only routine experimentation, if any.

[0332] In some embodiments, the cyclic polyribonucleotides can be delivered as a naked delivery formulation, such as one that includes a diluent. Naked delivery formulations deliver the cyclic polyribonucleotides to cells without a carrier and without modification or partial or complete encapsulation of the cyclic polyribonucleotides, capped polyribonucleotides, or complexes thereof.

[0333] Naked delivery formulations are formulations that do not contain carriers, where the cyclic polyribonucleotide does not have a covalent modification that is attached to a moiety that aids in delivery to cells, or does not have partial or complete encapsulation of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to cells is a polyribonucleotide that is not covalently attached to a protein, small molecule, particle, polymer, or biopolymer. The cyclic polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to cells does not contain modified phosphate groups. For example, the cyclic polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to cells does not contain phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoroamidates, phosphorodiamidates, alkyl or aryl phosphonates, or phosphotriesters.

[0334] In some embodiments, the naked delivery formulation does not include any or all of a transfection reagent, a cationic carrier, a carbohydrate carrier, a nanoparticle carrier, or a protein carrier. In certain embodiments, the naked delivery formulation is selected from the group consisting of phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydrous modified phytoglycogen β-dextrin, lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-β-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 1-[2-(oleoyloxy)ethyl]-2-oleyl-3 -(2-Hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N,N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HCl), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.

[0335] In some embodiments, the naked delivery formulation comprises a non-carrier excipient. In some embodiments, the non-carrier excipient comprises an inactive ingredient that does not exhibit a cell-penetrating effect. In some embodiments, the non-carrier excipient comprises a buffer, such as PBS. In some embodiments, the non-carrier excipient is a solvent, a non-aqueous solvent, a diluent, a suspending aid, a surfactant, an isotonicity agent, a thickener, an emulsifier, a preservative, a polymer, a peptide, a protein, a cell, a hyaluronidase, a dispersant, a granulating agent, a disintegrant, a binder, a buffer, a lubricant, or an oil.

[0336] In some embodiments, the naked delivery formulation comprises a diluent. The diluent can be a liquid diluent or a solid diluent. In some embodiments, the diluent is an RNA solubilizing agent, a buffer, or an isotonic agent. Examples of RNA solubilizing agents include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of buffers include 2-(N-morpholino)ethanesulfonic acid (MES), Bis-Tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3-(N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), Tris, Tricine, Gly-Gly, Bicine, or phosphate. Examples of isotonicity agents include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose.

[0337] Carrier In some embodiments, the compositions of the present disclosure comprise a cyclic polyribonucleotide and a carrier. In some embodiments, the compositions of the present disclosure comprise a linear polyribonucleotide and a carrier.

[0338] In certain embodiments, the compositions comprise a circular polyribonucleotide as described herein in a vesicle or other membrane-based carrier. In certain embodiments, the compositions comprise a linear polyribonucleotide as described herein in a vesicle or other membrane-based carrier.

[0339] In other embodiments, the composition comprises a cyclic polyribonucleotide in or through a cell, vesicle, or other membrane-based carrier. In other embodiments, the composition comprises a linear polyribonucleotide in or through a cell, vesicle, or other membrane-based carrier. In one embodiment, the composition comprises a cyclic polyribonucleotide in a liposome or other similar vesicle. In one embodiment, the composition comprises a linear polyribonucleotide in a liposome or other similar vesicle. Liposomes are spherical vesicular structures composed of a mono- or multi-membrane lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood-brain barrier (BBB) ​​(see, e.g., for review, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155 / 2011 / 469679).

[0340] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to produce liposomes as drug carriers. Methods for the preparation of multilamellar vesicle lipids are known in the art (see, for example, U.S. Pat. No. 6,693,086, the teachings of which are incorporated herein by reference for their related preparation of multilamellar vesicle lipids). When lipid membranes are mixed with aqueous solution, vesicle formation can occur spontaneously, but it can also be promoted by applying force in the form of shaking, by using homogenizers, sonicators, or extrusion devices (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011.doi:10.1155 / 2011 / 469679 for review). Extruded lipids can be prepared by extrusion through reduced size filters as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which regarding the preparation of extruded lipids are incorporated herein by reference.

[0341] In certain embodiments, the compositions of the present disclosure include cyclic polyribonucleotides and lipid nanoparticles, such as lipid nanoparticles, as described herein. In certain embodiments, the compositions of the present disclosure include linear polyribonucleotides and lipid nanoparticles. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for cyclic polyribonucleotide molecules as described herein. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for linear polyribonucleotide molecules as described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the properties of SLNs, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a new type of carrier that combines liposomes and polymers, can also be used. These nanoparticles have the complementary advantages of PNPs and liposomes. PLN consists of a core-shell structure; the polymer core provides a stable structure, and the phospholipid shell provides good biocompatibility. Thus, the two components increase drug encapsulation efficiency, facilitate surface modification, and prevent leakage of water-soluble drugs. For a review, see, for example, Li et al. 2017, Nanomaterials 7, 122; doi:10.3390 / nano7060122.

[0342] Further non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), protein carriers (e.g., proteins covalently attached to cyclic polyribonucleotides or proteins covalently attached to linear polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfection reagents). Non-limiting examples of carbohydrate carriers include phytoglycogen octenyl succinate, phytoglycogen β-dextrin, and anhydride-modified phytoglycogen β-dextrin. Non-limiting examples of cationic carriers include lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)-2-hydroxypropyl]-2-hydroxypropyl-2-hydroxypropyl, and the like. N,N-diisopropyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N\N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HC1), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), and N,N-dioleyl-N,N-dimethylammonium chloride (DODAC). Non-limiting examples of protein carriers include human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.

[0343] Exosomes can also be used as drug delivery vehicles for the circular RNA compositions or preparations described herein.Exosomes can also be used as drug delivery vehicles for the linear polyribonucleotide compositions or preparations described herein.For review, see Ha et al.July 2016.Acta Pharmaceutica Sinica B.Volume 6, Issue 4, Pages 287-296;https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0344] Ex vivo differentiated erythrocytes may also be used as a carrier for the circular RNA compositions or preparations described herein.Ex vivo differentiated erythrocytes may also be used as a carrier for the linear polyribonucleotide compositions or preparations described herein. See, for example, WO 2015 / 073587; WO 2017 / 123646; WO 2017 / 123644; WO 2018 / 102740; WO 2016 / 183482; WO 2015 / 153102; WO 2018 / 151829; WO 2018 / 009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; U.S. Pat. No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. See USA.111(28):10131-10136.

[0345] For example, fusosome compositions as described in WO 2018 / 208728 may also be used as carriers for delivering the circular polyribonucleotide molecules described herein. For example, fusosome compositions as described in WO 2018 / 208728 may also be used as carriers for delivering the linear polyribonucleotide molecules described herein.

[0346] Virosomes and virus-like particles (VLPs) can also be used as carriers for delivering the circular polyribonucleotide molecules described herein to target cells. Virosomes and virus-like particles (VLPs) can also be used as carriers for delivering the linear polyribonucleotide molecules described herein to target cells.

[0347] For example, plant nanovesicles and plant messenger packs (PMPs), as described in International Patent Publication Nos. WO 2011 / 097480, WO 2013 / 070324, WO 2017 / 004526, or WO 2020041784, may also be used as carriers for delivering the circular RNA compositions or preparations described herein. Plant nanovesicles and plant messenger packs (PMPs) may also be used as carriers for delivering the linear polyribonucleotide compositions or preparations described herein.

[0348] Microbubbles can also be used as a carrier for delivering the circular polyribonucleotide molecules described herein.Microbubbles can also be used as a carrier for delivering the linear polyribonucleotide molecules described herein.See, for example, U.S. Pat. No. 7,115,583;Beeri, R. et al., Circulation.2002 Oct 1;106(14):1756-1759;Bez, M. et al., Nat Protoc.2019 Apr;14(4):1015-1026;Hernot, S. et al., Adv Drug Deliv Rev.2008 Jun 30;60(10):1153-1166;Rychak, JJ et al., Adv Drug Deliv Rev.2014 Jun;72:82-93.In some embodiments, the microbubbles are albumin-coated perfluorocarbon microbubbles.

[0349] A carrier comprising a cyclic polyribonucleotide as described herein may comprise a plurality of particles. The particles may have a median article size of 30-700 nanometers (e.g., 30-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 100-500, 50-500, or 200-700 nanometers). The size of the particles may be optimized to favor deposition of the payload comprising cyclic polyribonucleotide into cells. Deposition of cyclic polyribonucleotide into specific cell types may favor different particle sizes. For example, the particle size may be optimized for deposition of cyclic polyribonucleotide into antigen-presenting cells. The particle size may be optimized for deposition of cyclic polyribonucleotide into dendritic cells. Additionally, the particle size may be optimized for deposition of cyclic polyribonucleotide into draining lymph node cells.

[0350] Lipid Nanoparticles The compositions, methods, and delivery systems provided by the present disclosure may use any suitable carrier or delivery modality, including, in certain embodiments, lipid nanoparticles (LNPs) as described herein. The lipid nanoparticles, in certain embodiments, include one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic, or amphoteric lipids); one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers as described in Table 5 of International Publication No. WO2019217941, which is incorporated herein by reference in its entirety); and one or more sterols (e.g., cholesterol).

[0351] Lipids (e.g., lipid nanoparticles) that can be used in nanoparticle formation include, for example, those described in Table 4 of WO2019217941, which is incorporated by reference - for example, a lipid-containing nanoparticle can include one or more of the lipids in Table 4 of WO2019217941. The lipid nanoparticle can include additional elements, such as a polymer, for example, a polymer described in Table 5 of WO2019217941, which is incorporated by reference.

[0352] In certain embodiments, the conjugated lipid, if present, is PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-0-(2',3'-di(tetradecyl)glycerol), PEG-glyceryl-2,3-diamino-2-(trimethylsilyl)-1,1-dimethylethyl)-2,2-dimethylethyl)-1,1-dimethylethyl)-2,3-dimethylethyl ... The polyoxyalkylene glycols may include one or more of the following: N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, N-(carbonyloxypropyl-l-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of WO2019051289 (incorporated by reference), as well as combinations of the above.

[0353] In some embodiments, sterols that may be incorporated into the lipid nanoparticles include one or more of cholesterol or cholesterol derivatives, such as those described in WO 2009 / 127060 or U.S. Patent Publication No. 2010 / 0130588, which are incorporated by reference. Further exemplary sterols include plant sterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated by reference herein.

[0354] In some embodiments, the lipid particles include an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be independently varied to achieve desired properties. For example, in some embodiments, the lipid nanoparticles include an ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid (in other embodiments, it can be 20-70% (mol), 30-60% (mol), or 40-50% (mol); about 50 mol% to about 90 mol% of the total lipid present in the lipid nanoparticle), a non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid, a conjugated lipid in an amount of about 0.5 mol% to about 20 mol% of the total lipid, and a sterol in an amount of about 20 mol% to about 50 mol% of the total lipid. The ratio of total lipid to nucleic acid can be varied as needed. For example, the ratio of total lipid to nucleic acid (mass or weight) can be about 10:1 to about 30:1.

[0355] In certain embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to obtain a desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. Generally, the total lipid content of the lipid nanoparticle formulation can range from about 5 mg / ml to about 30 mg / mL.

[0356] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the delivery of the compositions described herein, e.g., the nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)), include the following: [ka] In certain embodiments, an LNP comprising formula (i) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0357] [ka] In certain embodiments, an LNP comprising formula (ii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0358] [ka] In certain embodiments, an LNP comprising formula (iii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0359] [ka] In certain embodiments, an LNP comprising formula (v) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0360] [ka] In certain embodiments, an LNP comprising formula (vi) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0361] [ka] In certain embodiments, an LNP comprising formula (viii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0362] [ka] In certain embodiments, an LNP comprising formula (ix) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell. [ka] During the ceremony, X 1 But, O, NR 1 or a direct bond, X 2 is C2-5 alkylene, and X 3 is C(=O) or a direct bond, and R 1 is H or Me, and R 3 is C1-3 alkyl, R 2 is C1-3 alkyl, or R 2 The nitrogen atom to which it is attached and X 2 together with 1 to 3 carbon atoms of X to form a 4-, 5-, or 6-membered ring, or 1 But NR 1 and R 1 and R 2 together with the nitrogen atom to which they are attached form a 5- or 6-membered ring, or R 2 But R 3 and together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered ring; Y 1 is C2-12 alkylene, and Y 2 but, [ka] is selected from n is 0 to 3, R 4 is C1-15 alkyl, Z 1is C1-6 alkylene or a direct bond, Z 2 but [ka] (in either orientation) or absent, with the proviso that Z 1 is a direct bond, and Z 2 If is non-existent; R 5 is C5-9 alkyl or C6-10 alkoxy, R 6 is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, R 7 is H or Me, or a salt thereof, with the proviso that R 3 and R 2 is a C2 alkyl group, and X 1 is O and X 2 is a linear C3 alkylene, and X 3 But C(=0) and Y 1 is a linear Ce alkylene, (Y 2 )nR 4 but, [ka] and R 4 is a linear C5 alkyl; Z 1 is C2 alkylene, and Z 2 is absent, W is methylene, and R 7 If H, then R 5 and R 6 But Cx is not alkoxy.

[0363] In certain embodiments, an LNP comprising formula (xii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0364] [ka] In certain embodiments, an LNP comprising formula (xi) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0365] [ka] In certain embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

[0366] [ka] In certain embodiments, an LNP comprising formula (xv) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0367] [ka] In some embodiments, an LNP comprising a formulation of formula (xvi) is used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell. [ka]

[0368] In certain embodiments, the lipid compounds used to form lipid nanoparticles for delivery of the compositions described herein, e.g., the nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)), are made by one of the following reactions: [ka]

[0369] In some embodiments, LNPs comprising formula (xxi) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxi) are LNPs described by WO2021113777 (e.g., lipids of formula (1), such as lipids in Table 1 of WO2021113777). [ka] During the ceremony, Each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)- * or -C(O)O- * In the formula, * " refers to the point of attachment to R1 or R3; R1 and R3 are each independently oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclylalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclyl)(alkyl)aminoalkyl, heterocyclyl, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkyl linear or branched C9-C alkyl groups optionally substituted with one or more substituents selected from the group consisting of oxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclylalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl, and alkylsulfonealkyl;20 Alkyl or C9-C 20 alkenyl; and R2 is [ka] is selected from the group consisting of:

[0370] In some embodiments, LNPs comprising formula (xxii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxii) are LNPs described by WO2021113777 (e.g., lipids of formula (2), such as lipids in Table 2 of WO2021113777). [ka] During the ceremony, each n is independently an integer from 1 to 15; R1 and R2 each independently represent [ka] is selected from the group consisting of:

[0371] R3 is, [ka] is selected from the group consisting of:

[0372] In some embodiments, LNPs comprising formula (xxiii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxiii) are LNPs described by WO2021113777 (e.g., lipids of formula (3), such as lipids in Table 3 of WO2021113777). [ka] During the ceremony, X is -O-, -S-, or -OC(O)-. * is selected from the group consisting of * indicates the point of attachment to R1; R1 is, [ka] is selected from the group consisting of R2 is [ka] is selected from the group consisting of:

[0373] In some embodiments, the compositions described herein (e.g., nucleic acids (e.g., circular polyribonucleotides, linear polyribonucleotides) or proteins) are provided in LNPs that include an ionizable lipid. In some embodiments, the ionizable lipid is heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), e.g., as described in Example 1 of U.S. Pat. No. 9,867,888, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is 9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecanedioate (LP01), e.g., as synthesized in Example 13 of WO 2015 / 095340, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is di((Z)-non-2-en-1-yl)9-((4-dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., as synthesized in Examples 7, 8, or 9 of U.S. Patent Publication No. 2012 / 0027803, which is incorporated herein by reference in its entirety. In one embodiment, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), for example, as synthesized in Examples 14 and 16 of WO 2010 / 053572, which is incorporated by reference in its entirety.In certain embodiments, the ionizable lipid is the imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,14,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, e.g., structure (I) from WO 2020 / 106946, which is incorporated herein by reference in its entirety.

[0374] In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, for example, a cationic lipid that may exist in a positively charged or neutral form depending on pH, or an amine-containing lipid that may be easily protonated. In some embodiments, the cationic lipid is a lipid that may be positively charged, for example, under physiological conditions. Exemplary cationic lipids include one or more amine groups with a positive charge. In some embodiments, the lipid particles include cationic lipids in a combination with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structured lipids (e.g., sterols), PEG, cholesterol, and polymer-conjugated lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids disclosed herein may have an effective pKa greater than 6.0. In some embodiments, the lipid nanoparticle may include a second cationic lipid that has a different effective pKa (e.g., higher than the first effective pKa) than the first cationic lipid. The lipid nanoparticles can include 40-60 mol percent cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and a therapeutic agent, such as a nucleic acid described herein (e.g., RNA (e.g., cyclic polyribonucleotides, linear polyribonucleotides)) encapsulated within or associated with the lipid nanoparticles. In some embodiments, the nucleic acid is formulated simultaneously with the cationic lipids. The nucleic acid can be adsorbed to the surface of the LNP, e.g., LNPs including cationic lipids. In some embodiments, the nucleic acid can be encapsulated within the LNP, e.g., LNPs including cationic lipids. In some embodiments, the lipid nanoparticles can include a targeting moiety, e.g., coated with a targeting agent. In some embodiments, the LNP formulation is biodegradable.In some embodiments, lipid nanoparticles comprising one or more lipids described herein, e.g., formula (i), (ii), (vii) and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98% or 100% of the RNA molecules.

[0375] Exemplary ionizable lipids that may be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of International Publication No. WO2019051289, which is incorporated herein by reference. Additional exemplary lipids include, but are not limited to, one or more of the following formulas: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; No. Ic; U.S. Patent Application Publication No. 2013 / 0178541, No. A; U.S. Patent Application Publication No. 2013 / 0303587 or U.S. Patent Application Publication No. 2013 / 0123338, No. I; U.S. Patent Application Publication No. 2015 / 0141678, No. I; U.S. Patent Application Publication No. 2015 / 0239926, No. II, III, IV, or V; U.S. Patent Application Publication No. 2017 / 0119904, No. I; WO 2017 / 117528, No. I or II; U.S. Patent Application Publication No. 2012 / 0149894 A; U.S. Patent Application Publication No. 2015 / 0057373 A; WO 2013 / 116126 A; U.S. Patent Application Publication No. 2013 / 0090372 A; U.S. Patent Application Publication No. 2013 / 0274523 A; U.S. Patent Application Publication No. 2013 / 0274504 A; U.S. Patent Application Publication No. 2013 / 0053572 A; WO 2013 / 0 16058, A; WO 2012 / 162210, A; U.S. Patent Application Publication No. 2008 / 042973, I; U.S. Patent Application Publication No. 2012 / 01287670, I, II, III, or IV; U.S. Patent Application Publication No. 2014 / 0200257, I or II; U.S. Patent Application Publication No. 2015 / 0203446, I, II, or III; U.S. Patent Application Publication No. 2015 / 0005363, I or III;U.S. Patent Application Publication No. 2014 / 0308304, I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV; U.S. Patent Application Publication No. 2013 / 0338210; WO 2009 / 132131, I, II, III, or IV; U.S. Patent Application Publication No. 2012 / 01011478, A; U.S. Patent Application Publication No. 2012 / 0027796, I or XXXV; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; No. 2013 / 0323269; U.S. Patent Application Publication No. I of U.S. Patent Application Publication No. 2011 / 0117125; U.S. Patent Application Publication No. I, II, or III of U.S. Patent Application Publication No. 2011 / 0256175; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, IX, X, XI, or XII of U.S. Patent Application Publication No. 2012 / 0202871; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011 / 0076335; U.S. Patent Application Publication No. 2006 / 008378 I or II of the specification; I of U.S. Patent Application Publication No. 2013 / 0123338; ​​I or XAYZ of U.S. Patent Application Publication No. 2015 / 0064242; XVI, XVII, or XVIII of U.S. Patent Application Publication No. 2013 / 0022649; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I or II of U.S. Patent Application Publication No. 2010 / 0062967; U.S. Patent Application Publication No. 2013 / 0189351 I-X of US Patent Application Publication No. 2014 / 0039032; V of US Patent Application Publication No. 2018 / 0028664; I of US Patent Application Publication No. 2016 / 0317458; I of US Patent Application Publication No. 2013 / 0195920; 5, 6, or 10 of US Patent Application Publication No. 10,221,127; III-3 of WO 2018 / 081480; I-5 or I-8 of WO 2020 / 081938; 18 or 25 of US Patent Application Publication No. 9,867,888;US2019 / 0136231A;WO2020 / 219876II;US2012 / 0027803A1;US2019 / 0240349OF-02;US10,086,013A23;cKK-E12 / A6 of Miao et al (2020);C12-200 of WO2010 / 053572;7C1 of Dahlman et al (2017);Whitehead et al al., 304-O13 or 503-O13; TS-P4C2 of U.S. Pat. No. 9,708,628; I of WO 2020 / 106946; I of WO 2020 / 106946; and (1), (2), (3) or (4) of WO 2021 / 113777. Exemplary lipids further include any one of the lipids in Tables 1 to 16 of WO 2021 / 113777.

[0376] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,3lZ)-heptatriaconta-6,9,28,3l-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), as described in, for example, Example 9 of WO2019051289A9 (incorporated herein in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, as described in, for example, Example 10 of WO2019051289A9 (incorporated herein in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocosa-13,16-diene-1-amine (compound 32), e.g., as described in Example 11 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, e.g., as described in Example 12 of WO2019051289A9 (incorporated herein by reference in its entirety).

[0377] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidyl 16-O-dimethyl-1, ... PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), diercoyl phosphatidylcholine (DEPC), palmitoyl oleoyl ... dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine phatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Further exemplary lipids include, in certain embodiments, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. Such lipids include, in certain embodiments, plant lipids that have been shown to improve hepatic transfection with mRNA (e.g., DGTS).

[0378] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin, etc. Other non-cationic lipids are described in WO 2017 / 099823 or US 2018 / 0028664, the entire contents of which are incorporated herein by reference.

[0379] In some embodiments, the non-cationic lipid is oleic acid or a compound of formula I, II, or IV of US Patent Publication No. 2018 / 0028664 (herein incorporated by reference in its entirety). The non-cationic lipid may, for example, comprise 0-30% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticle. In embodiments, the molar ratio of ionizable lipid to neutral lipid is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0380] In some embodiments, the lipid nanoparticles do not contain any phospholipids.

[0381] In some embodiments, the lipid nanoparticles may further comprise components such as sterols to provide membrane integrity. One exemplary sterol that may be used in the lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2 , 4'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO 2009 / 127060 and U.S. Patent Publication No. 2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0382] In some embodiments, components that provide membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipid present in the lipid nanoparticle (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components comprise 20-50% (mol) 30-40% (mol) of the total lipid content of the lipid nanoparticle.

[0383] In some embodiments, the lipid nanoparticles may contain polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit lipid nanoparticle aggregation and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a (methoxypolyethylene glycol)-conjugated lipid.

[0384] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-0-(2',3'-di(tetradecanoyloxy)propyl)propionate (PEG-DMG ...dialkyloxypropyl (DAA), PEG-phospholipid, PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, propyl-l-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-l,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Further exemplary PEG-lipid conjugates are described, for example, in U.S. Pat. No. 5,885,613, U.S. Pat. No. 6,287,591, U.S. Patent Application Publication No. 2003-2006, and the like. No. 2003 / 0077829, U.S. Patent Application Publication No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904, and U.S. Patent Application No. 099823, all of which are incorporated herein by reference in their entireties. In some embodiments, the PEG-lipid is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Application Publication No. 2018 / 0028664, the entire contents of which are incorporated herein by reference. In some embodiments, the PEG-lipid is of formula II of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224, both of which are incorporated herein by reference in their entireties.In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[β]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB ( PEG-lipids may be one or more of PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000], 3,4-ditetradecoxylbenzyl-[ω]-methyl-poly(ethylene glycol) ether, and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, ... [ka] The present invention includes a structure selected from the following:

[0385] In some embodiments, lipids conjugated with molecules other than PEG can be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates can be used in place of or in addition to PEG-lipids.

[0386] Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO2019051289A9, all of which are incorporated herein by reference in their entireties.

[0387] In some embodiments, the PEG or conjugated lipid may comprise 0-20% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipid present in the lipid nanoparticle. The molar ratios of ionizable lipid, non-cationic lipid, sterol, and PEG / conjugated lipid may be varied as needed. For example, the lipid particles may comprise 30-70% ionizable lipid per mole or total weight of the composition, 0-60% cholesterol per mole or total weight of the composition, 0-30% non-cationic lipid per mole or total weight of the composition, and 1-10% conjugated lipid per mole or total weight of the composition. Preferably, the composition comprises 30-40% ionizable lipid per mole or total weight of the composition, 40-50% cholesterol per mole or total weight of the composition, and 10-20% non-cationic lipid per mole or total weight of the composition. In some other embodiments, the composition is 50-75% ionizable lipid per mole or total weight of the composition, 20-40% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition and 1-10% conjugated lipid per mole or total weight of the composition. The composition may contain 60-70% ionizable lipid per mole or total weight of the composition, 25-35% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition. The composition may also contain up to 90% ionizable lipid per mole or total weight of the composition and 2-15% non-cationic lipid per mole or total weight of the composition.Formulations may also be used that contain, for example, 8-30% ionizable lipid per mole or total weight of the composition, 5-30% non-cationic lipid per mole or total weight of the composition, and 0-20% cholesterol per mole or total weight of the composition; 4-25% ionizable lipid per mole or total weight of the composition, 4-25% non-cationic lipid per mole or total weight of the composition, 2-25% cholesterol per mole or total weight of the composition, 10-35% conjugated lipid per mole or total weight of the composition, and 5% cholesterol per mole or total weight of the composition; or The lipid nanoparticle formulation may comprise 2-30% ionizable lipid per mole or total weight of the composition, 2-30% non-cationic lipid per mole or total weight of the composition, 1-15% cholesterol per mole or total weight of the composition, 2-35% conjugated lipid per mole or total weight of the composition, and 1-20% cholesterol per mole or total weight of the composition; or up to 90% ionizable lipid per mole or total weight of the composition and 2-10% non-cationic lipid per mole or total weight of the composition, or 100% cationic lipid per mole or total weight of the composition. In some embodiments, the lipid particle formulation comprises ionizable lipid, phospholipid, cholesterol, and PEGylated lipid in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipid, cholesterol, and PEGylated lipid in a molar ratio of 60:38.5:1.5.

[0388] In one embodiment, the lipid particle comprises an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, where the molar ratio of lipids is in the range of 20-70 mole percent for the ionizable lipid with a target of 40-60, the molar percent of the non-cationic lipid is in the range of 0-30 with a target of 0-15, the molar percent of the sterol is in the range of 20-70 with a target of 30-50, and the molar percent of the PEGylated lipid is in the range of 1-6 with a target of 2-5.

[0389] In one embodiment, the lipid particles comprise an ionizable lipid / non-cationic lipid / sterol / conjugated lipid molar ratio of 50:10:38.5:1.5.

[0390] In one aspect, the disclosure provides a lipid nanoparticle formulation comprising a phospholipid, a lecithin, a phosphatidylcholine, and a phosphatidylethanolamine.

[0391] In some embodiments, one or more additional compounds may also be included. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain other compounds in addition to the nucleic acid or at least a second nucleic acid different from the first nucleic acid. The other additional compounds may be selected from the group consisting of, but are not limited to, small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptidomimetics, nucleic acids, nucleic acid analogs and derivatives, extracts made from biological materials, or any combination thereof.

[0392] In some embodiments, the LNPs comprise a biodegradable, ionizable lipid, hi some embodiments, the LNPs comprise (9Z,l2Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,l2-dienoate (also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,l2Z)-octadeca-9,l2-dienoate)) or another ionizable lipid. See, e.g., the lipids in WO 2019 / 067992, WO 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086, and the references provided therein. In certain embodiments, the terms cationic and ionizable with respect to LNP lipids are synonymous, e.g., ionizable lipids are cationic depending on the pH.

[0393] In certain embodiments, the average LNP diameter of an LNP formulation can be tens of nm to hundreds of nm, e.g., as measured by dynamic light scattering (DLS). In certain embodiments, the average LNP diameter of an LNP formulation can be about 40 nm to about 150 nm, e.g., about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be about 80 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation is in the range of about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.

[0394] LNPs may be relatively homogeneous in some cases. Polydispersity index may be used to indicate the homogeneity of LNPs, e.g., the size distribution of lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow size distribution. LNPs may have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs may be about 0.10 to about 0.20.

[0395] The zeta potential of LNPs can be used to indicate the electrokinetic potential of a composition. In some embodiments, the zeta potential can represent the surface charge of LNPs. Lipid nanoparticles with relatively low positive or negative charges are generally desirable, since more highly charged species can undesirably interact with cells, tissues, and other elements in the body. In certain embodiments, the zeta potential of the LNP can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0396] The efficiency of protein and / or nucleic acid encapsulation represents the amount of protein and / or nucleic acid encapsulated or otherwise associated with the LNP after preparation compared to the initial amount provided. It is desirable for the encapsulation efficiency to be high (e.g., near 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after disintegrating the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (e.g., RNA) in a solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid (e.g., RNA) in a solution. For the lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids may be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0397] The LNPs may optionally include one or more coatings. In some embodiments, the LNPs may be formulated into capsules, films, or tablets with coatings. The capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0398] Additional exemplary lipids, formulations, methods, and characterizations of LNPs are taught by WO 2020 / 061457 and WO 2021 / 113777, each of which is incorporated by reference in its entirety. Additional exemplary lipids, formulations, methods, and characterizations of LNPs are taught by Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). doi.org / 10.1038 / s41578-021-00358-0, which is incorporated by reference in its entirety (see, e.g., exemplary lipids and lipid derivatives in Figure 2 of Hou et al.).

[0399] In certain embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA Transfection Reagent (Mirus Bio). In certain embodiments, LNPs are formulated using GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, LNPs are formulated using 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or Dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3), the formulation and in vivo use of which are taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012) (incorporated herein by reference in its entirety).

[0400] LNP formulations optimized for delivery of CRISPR-Cas systems, e.g., Cas9-gRNA RNP, gRNA, Cas9 mRNA, are described in WO2019067992 and WO2019067910 (both incorporated by reference) and are useful for delivery of circular polyribonucleotides and linear polyribonucleotides as described herein.

[0401] Additional specific LNP formulations useful for delivery of nucleic acids (e.g., circular polyribonucleotides, linear polyribonucleotides) are described in U.S. Pat. Nos. 8,158,601 and 8,168,775 (both of which are incorporated by reference), including the formulations used in patisiran, which is sold under the name ONPATTRO.

[0402] Exemplary dosages of polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) LNPs can include about 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4, 5, 6, 8, 10, or 100 mg / kg (RNA). Exemplary dosages of AAVs including polyribonucleotides (e.g., cyclic polyribonucleotide, linear polyribonucleotide) can include about 10 11 , 10 12 , 10 13 , and 10 14 The antibody may include an MOI of vg / kg. EXAMPLES

[0403] The following examples are presented to provide one of ordinary skill in the art with an illustration of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely illustrative of the disclosure and are not intended to limit the scope of what the inventors regard as their invention.

[0404] Example 1: Design of Anabaena self-splicing replacement intron-exon (PIE) constructs with extended annealing regions This example describes the design of an Anabaena self-splicing replacement intron-exon (PIE) sequence with an extended annealing region to provide better circularization efficiency.

[0405] Schematic diagrams depicting exemplary designs of DNA constructs are presented in Figures 1A and 1B. In this example, the construct comprises, from 5' to 3': the 3' half of the group I catalytic intron fragment (3' half-intron in Anabaena), a 3' splice site, a 3' exon fragment (E2 in Anabaena), a spacer element, a polynucleotide cargo, a 5' exon fragment (E1 in Anabaena), a 5' splice site, and a 5' half of the group I catalytic intron fragment (5' half-intron in Anabaena). E2 has a 5 nucleotide complementary sequence (5'-TCCGT-3') (SEQ ID NO: 1) to E1 (5'-ACGGA-3') (SEQ ID NO: 2) (Figures 1A and 1B, black lines on E2 and E1). To generate a construct with an extended annealing region between E2 and E1, 5 nucleotides from E2 were inserted into E1 ( [ka] E2 and E1 were mutated to have an extended annealing region of 7 nucleotides (E2; 5'-TCCGTAGCGTCT-3' (SEQ ID NO:5), E1; 5'-AGACGCTACGGA-3' (SEQ ID NO:6)) (FIG. 1B). The total annealing region from the Anabaena replacement intron-exon (PIE) with the extended annealing region is 12 nucleotides (E2; 5'-TCCGTAGCGTCT-3' (SEQ ID NO:5), E1; 5'-AGACGCTACGGA-3' (SEQ ID NO:6)) (FIG. 1B).

[0406] The RNA structure was evaluated by the RNA structure prediction tool RNAfold (rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi).The enhancement of E2-E1 interaction brought about by the sequence modification leads to proper E2-E1 interaction and aggregation of the self-splicing intron structure (Figures 2A and 2B).

[0407] Constructs with Anabaena PIE with a 5-nucleotide annealing region (Anabaena1) and an annealing sequence with an extended annealing region (Anabaena2) were designed to compare circularization efficiency. An Anabaena PIE construct (Anabaena3) described in Wesselhoeft, et al. 2018 (Nat. Commun. 9:2629) was also used for comparison. In this example, constructs were designed to contain polyA50 as a spacer element and a combination of EMCV internal ribosome entry site (IRES) and ORF as polynucleotide cargo. Two different ORFs were tested: Gaussia luciferase (Gluc) ORF (558 nucleotides) and SARS-CoV-2 spike protein ORF (3822 nt). The size of the circular RNA was 1.2 Kb for Gluc ORF and 4.5 Kb for SARS-CoV-2 spike protein ORF.

[0408] Unmodified linear RNA was synthesized by in vitro transcription using T7 RNA polymerase from a DNA template in the presence of 7.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease for 20 min. The synthesized linear RNA was purified with an RNA clean-up kit (New England Biolabs, T2050). Self-splicing occurred during transcription; no additional reaction was required. To monitor self-splicing efficiency, 200 ng of column-purified in vitro transcribed RNA was mixed with gel loading buffer II (Thermo Fisher, AM8546G), heated at 95°C for 3 min, and then incubated on ice for 3 min. Samples were then separated by 6% urea polyacrylamide gel electrophoresis (urea PAGE), and RNA bands were stained using gel stain and visualized using an image processing system.

[0409] Extension of the annealing sequence from 5 to 12 nucleotides increased the circularization efficiency by up to 2-fold, with Anabaena3 exhibiting similar circularization efficiency for 1.2 Kb circular RNAs (Figure 3A). For 4.5 Kb circular RNAs, the Anabaena PIE with the extended annealing region (Anabaena2) exhibited a circularization efficiency that was 40% better than Anabaena3 and 3-fold higher than the Anabaena PIE with a 5-nucleotide annealing region (Anabaena1) (Figure 3B).

[0410] Anabaena PIE (Anabaena2), designed with an extended E2-E1 annealing sequence, showed 2-3 times better circularization efficiency than Anabaena PIE (Anabaena1) with a 5-nucleotide annealing region, independent of the size of the circular RNA, similar circularization efficiency for the easy-to-circularize 1.2 Kb construct, and 40% better circularization efficiency for the difficult-to-circularize 4.5 Kb construct.

[0411] Example 2: Protein expression from circular RNA generated by Anabaena self-splicing PIE with extended annealing region In this example, we demonstrate protein expression from circular RNA generated by an Anabaena self-splicing PIE with an extended annealing region.

[0412] In this example, constructs with Anabaena PIE with 5 nucleotide annealing region (Anabaena1) and extended annealing sequence (Anabaena2) were designed as described in Example 1 to compare protein expression. In this example, constructs were designed to contain polyA50 as a spacer element and a combination of EMCV IRES and ORF as polynucleotide cargo. Two different ORFs were tested: Gluc (558 nts) and SARS-CoV-2 spike protein (3822 nts). Anabaena3 as described in Example 1 was also tested for comparison.

[0413] Linear RNA was synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease for 20 min. Synthesized linear RNA was purified with an RNA clean-up kit (New England Biolabs, T2050). Circular RNA encoding Gluc was purified by urea PAGE, eluted with buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA), ethanol precipitated, and resuspended in RNAse-free water. Circular RNA encoding the spike protein from SARS-CoV-2 was purified by reversed-phase chromatography and fractions were buffer exchanged with sodium citrate and then water through ultrafiltration using an Amicon Ultra Centrifugal filter (Sigma Aldrich).

[0414] To compare the expression of circular RNA encoding Gluc, circular RNA produced by Anabaena1 and Anabaena2 was prepared. For comparison, circular RNA produced by Anabaena3 was also prepared. HeLa cells (10,000 cells / well in 96-well plates) were transfected with 0.1 pmole of purified circular RNA using LIPOFECTAMINE® MessengerMAX transfection reagent (Invitrogen) according to the manufacturer's protocol. The cell medium was collected and replaced with fresh medium at 24, 48 and 72 hours, and Gluc activity was measured. To measure Gluc activity, 10 μl of collected cell medium was transferred to a white 96-well plate and a bioluminescence reporter assay system was used according to the manufacturer's instructions (Pierce Gaussia Luciferase Flash® Assay Kit, 16158, Thermo Scientific). The plate was read in a luminometer device (Promega).

[0415] To compare the expression of circular RNAs encoding the SARS-CoV-2 spike protein, circular RNAs produced by Anabaena PIE with a 5-nucleotide annealing region (Anabaena1) and Anabaena PIE with an extended annealing region (Anabaena2) were prepared. For comparison, circular RNAs produced by Anabaena3 were also prepared. HeLa cells (1,200,000 cells / well in 6-well plates) were transfected with 4 picomoles of purified circular RNA using LIPOFECTAMINE® MessengerMAX (Invitrogen) transfection agent according to the manufacturer's instructions. After 48 hours of transfection, cells were harvested by trypsinization and resuspended in cold serum-free medium. Cells were then stained with anti-SARS-CoV-2 RBD antibody for 1 hour, followed by incubation with anti-mouse IgG1 antibody AF647 for 30 minutes. The stained population was measured by flow cytometry.

[0416] Circular RNAs produced by Anabaena PIEs with extended annealing regions (Anabaena2) showed similar expression to those produced by Anabaena PIEs with 5-nucleotide annealing regions (Anabaena1) and by Anabaena3 when encoding Gluc as polynucleotide cargo (Figure 4). For circular RNAs encoding the SARS-CoV-2 spike protein, circular RNAs produced by Anabaena2 showed approximately 3-fold better expression than those produced by Anabaena3 and 50% more expression than those produced by Anabaena1 (Figure 5).

[0417] Example 3: Effect of annealing region length on circularization efficiency in Anabaena self-splicing PIEs In this example, we demonstrate the effect of annealing region length on circularization efficiency in Anabaena self-splicing PIEs.

[0418] In Example 1 above, the inventors showed that extending the annealing region from 5 to 12 nucleotides by mutating the E2 sequence enhanced the circularization efficiency of Anabaena PIE.

[0419] To examine the effect of the length of the annealing region on circularization efficiency, three additional constructs were designed with an additional extended annealing region between E2 and E1 by including additional sequences at the 5' end of E1 that is complementary to E2: (1) a 5 nucleotide extension (5'-CGTTT-3') (SEQ ID NO:7), (2) a 10 nucleotide extension (5'-ACGACCGTTT-3') (SEQ ID NO:8), and (3) a 15 nucleotide extension (5'-CCCACACGACCGTTT-3') (SEQ ID NO:9). The complementary sequences in E2 are a 5 nucleotide extension (5'-AAACG-3') (SEQ ID NO:10), a 10 nucleotide extension (5'-AAACGGTCGT-3') (SEQ ID NO:11), or a 15 nucleotide extension (5'-AAACGGTCGTGTGGG-3') (SEQ ID NO:12), respectively. The total annealing sequences are 17, 22, or 27 nucleotides, respectively. A schematic diagram depicting an exemplary design of a DNA construct with an extended annealing region between E2 and E1 is presented in FIG.

[0420] To compare circularization efficiency, constructs were designed with extended annealing sequences (Anabaena2) and extended annealing regions (5 nucleotide extension, 10 nucleotide extension, and 15 nucleotide extension). In this example, constructs were designed to contain polyA50 as a spacer element and a combination of EMCV IRES and Gluc as polynucleotide cargo.

[0421] Linear RNA was synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease for 20 minutes. The synthesized linear RNA was purified with an RNA cleanup kit (New England Biolabs, T2050).

[0422] Self-splicing occurred during transcription; no additional reaction was required. To monitor self-splicing efficiency, 200 ng of column-purified in vitro transcribed RNA was mixed with gel loading buffer II (Thermo Fisher, AM8546G), heated at 95°C for 3 min, and then incubated on ice for 3 min. Samples were then separated by 6% urea PAGE, and RNA bands were stained using gel stain and visualized using an image processing system.

[0423] Further extension of the annealing region between E2 and E1 (5 nt extension, 10 nt extension, or 15 nt extension) showed a circularization efficiency comparable to that of the Anabaena PIE with an extended annealing region (Anabaena2) (Figure 7). A 15 nucleotide extension of the annealing region showed a 30% better circularization efficiency compared to Anabaena2 (Figure 7). This data indicates that the E2-E1 interaction is important for efficient circularization and that further extension of the annealing region can increase the circularization efficiency.

[0424] Example 4: Protein expression from circular RNA generated by Anabaena self-splicing PIE with extended annealing sequences In this example, we demonstrate protein expression from circular RNA generated by an Anabaena self-splicing PIE with an extended annealing sequence.

[0425] In this example, constructs with an extended annealing sequence (Anabaena2) and constructs with extended annealing regions (5 nucleotide extension, 10 nucleotide extension, and 15 nucleotide extension) were designed and compared for protein expression as described in Example 3. In this example, constructs were designed to contain polyA50 as the spacer element and a combination of EMCV IRES and Gluc as the polynucleotide cargo.

[0426] Linear RNA was synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease for 20 min. Synthesized linear RNA was purified with an RNA cleanup kit (New England Biolabs, T2050). Circular RNA encoding Gluc was purified by urea PAGE, eluted with buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA), ethanol precipitated, and resuspended in RNAse-free water.

[0427] To compare the expression of circular RNA encoding Gluc, circular RNA produced by Anabaena2 and Anabaena PIE with further extended annealing regions (5-nucleotide extension, 10-nucleotide extension, or 15-nucleotide extension) was prepared as described in Example 3. HeLa cells (10,000 cells / well in 96-well plates) were transfected with 0.1 picomole of purified circular RNA using LIPOFECTAMINE® MessengerMAX transfection agent according to the manufacturer's instructions. Transfectants were prepared separately for each time point. At 6, 24, and 48 hours, the medium was collected. To measure Gluc activity, 10 μl of collected cell medium was transferred to a white 96-well plate and a bioluminescence reporter assay system was used according to the manufacturer's instructions (Pierce Gaussia Luciferase Flash® Assay Kit, 16158, Thermo Scientific). The plate was read in a luminometer device (Promega).

[0428] Circular RNAs produced by Anabaena PIEs with further extended annealing regions (5 nt, 10 nt, or 15 nt extensions) showed similar or superior expression to that of circular RNAs produced by Anabaena2 (Figure 8). For example, circular RNAs produced by Anabaena PIEs with a 15 nt extension (total of 27 nt) showed 3-fold higher expression than Anabaena PIEs with a 12 nt extended annealing region (Anabaena2). This data indicates that the extension of the annealing region is important not only for circularization efficiency but also for expression.

[0429] Example 5: Design of Tetrahymena self-splicing replacement intron-exon (PIE) with extended annealing region This example describes the design of a Tetrahymena self-splicing replacement intron-exon (PIE) with an extended annealing region.

[0430] Schematics depicting exemplary designs of DNA constructs are presented in Figures 9A and 9B.

[0431] In this example, the construct comprises, from 5' to 3': the 3' half of the group I catalytic intron fragment (Tetrahymena 3' half-intron), a 3' splice site, a 3' exon fragment (Tetrahymena E2), a spacer element, a polynucleotide cargo, a 5' exon fragment (Tetrahymena E1), a 5' splice site, and a 5' half of the group I catalytic intron fragment (Tetrahymena 5' half-intron). E2 has a 6 nucleotide complementary sequence (5'-AAGGTA-3') (SEQ ID NO: 13) to the 5' half-intron (5'-TACCTT-3') (SEQ ID NO: 14) that forms helix P10 (Figure 9, black lines on E1 and the 5' half-intron). To generate a construct with an extended annealing region between E2 and the 5' half-intron, 6 nucleotides were added to the 3' end of the annealing region in E2 (5'-AATATT-3' (SEQ ID NO: 15), grey box on E2 in Figures 9A and 9B). The entire annealing region from a Tetrahymena self-splicing PIE with an extended annealing region is 12 nucleotides (E2; [ka] , 5' intron; [ka] , bold letters represent extended annealing regions) (Figure 9B).

[0432] The RNA structure was evaluated by the RNA structure prediction tool RNAfold (rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi). Enhancing the E2-5' half-intron interaction with additional sequences led to the formation of the proper helix P10 and the aggregation of the self-splicing intron structure (Figures 10A and 10B).

[0433] To compare circularization efficiency, constructs were designed with Tetrahymena replacement intron-exon with 6 nucleotide annealing region (Tetrahymena1) and extended annealing sequence (Tetrahymena2). In this example, constructs were designed to contain polyA50 as a spacer element and a combination of EMCV IRES and hEPO ORF as polynucleotide cargo. The size of the circular RNA was 1.2 Kb.

[0434] Linear RNA was synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease for 20 minutes. The synthesized linear RNA was purified with an RNA cleanup kit (New England Biolabs, T2050).

[0435] Self-splicing occurred during transcription; no additional reaction was required. To monitor circularization efficiency, 200 ng of column-purified in vitro transcribed RNA was mixed with gel loading buffer II (Thermo Fisher, AM8546G), heated to 95°C for 3 min, and then incubated on ice for 3 min. Samples were then separated by 6% urea PAGE, and RNA bands were stained using gel stain and visualized using an image processing system. The extension of the annealing sequence from 6 nucleotides to 12 nucleotides (Tetrahymena2) showed similar circularization efficiency as the Tetrahymena self-splicing PIE with a 6 nucleotide annealing region (Tetrahymena1) (Figure 11). This data indicates that the extension of the annealing sequence in the Tetrahymena self-splicing PIE did not disrupt circularization.

[0436] Example 6: Protein expression from circular RNA generated by Tetrahymena PIE with extended annealing regions In this example, we describe protein expression from circular RNA generated by Tetrahymena self-splicing PIE with an extended annealing region.

[0437] To compare protein expression, DNA constructs containing Tetrahymena self-splicing PIEs with a 6 nucleotide annealing region (Tetrahymena1) and an extended annealing sequence (Tetrahymena2) were designed as described in Example 5. The constructs are designed to contain polyA50 as a spacer element and a combination of the EMCV IRES and Gluc ORF as polynucleotide cargo.

[0438] Linear RNA is synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA is removed by treatment with deoxyribonuclease. Synthesized linear RNA is purified with an RNA clean-up kit (New England Biolabs, T2050). Circular RNA encoding Gluc is purified by urea PAGE, eluted with buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA), ethanol precipitated, and resuspended in RNAse-free water.

[0439] To compare the expression of circular RNA encoding Gluc, circular RNA produced by Tetrahymena PIE with 6 nucleotide annealing region (Tetrahymena1) and Tetrahymena PIE with extended annealing region (Tetrahymena2) is prepared as described above. HeLa cells (10,000 cells / well in 96-well plate) are transfected with 0.1 picomole of purified circular RNA using LIPOFECTAMINE® MessengerMAX (Invitrogen) transfection agent according to the manufacturer's instructions. Transfectants are prepared separately for each time point. At 6, 24 and 48 hours, medium is collected. To measure Gluc activity, the collected cell medium is transferred to a white 96-well plate and a bioluminescence reporter assay system is used according to the manufacturer's instructions. The plate is read in a luminometer device.

[0440] Example 7: Design of T4 phage self-splicing replacement intron-exon (PIE) with extended annealing region In this example, we describe the design of a T4 phage self-splicing PIE with an extended annealing region.

[0441] Schematic diagrams depicting exemplary designs of DNA constructs are presented in Figures 12A and 12B. The constructs contain, from 5' to 3': the 3' half of the group I catalytic intron fragment (3' half-intron of T4 phage), a 3' splice site, a 3' exon fragment (E2 of T4 phage), a spacer element, a polynucleotide cargo, a 5' exon fragment (E1 of T4 phage), a 5' splice site, and a 5' half of the group I catalytic intron fragment (5' half-intron of T4 phage). E2 has a two-nucleotide complementary sequence (5'-CT-3') to the 5' half-intron (5'-AG-3') that forms helix P10 (Figures 12A and 12B, black lines on E2 and 5' half-intron). To generate constructs with an extended annealing region between E2 and 5' half-intron, four nucleotides from E2 were inserted into the 5' half-intron (5'-AG-3'). [ka] , bold letters represent mutated sequences). The total annealing region from T4 phage PIE with the extended annealing region is 7 nucleotides (E2; [ka] , 5′ half-intron; [ka] , bold letters represent extended annealing sequences) (Figures 12A and 12B).

[0442] To compare circularization efficiency, constructs were designed with T4 phage PIE with a 2-nucleotide annealing region (T4 phage 1) and an extended annealing region (T4 phage 2). In this example, the constructs were designed to contain polyA50 as a spacer element, a combination of EMCV IRES and Gluc ORF as polynucleotide cargo. The size of the circular RNA was 1.2K.

[0443] Linear RNA was synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease. The synthesized linear RNA was purified with an RNA cleanup kit (New England Biolabs, T2050).

[0444] Self-splicing occurred during transcription; no additional reaction was required. To monitor circularization efficiency, 200 ng of column-purified in vitro transcribed RNA was mixed with gel loading buffer II (Thermo Fisher, AM8546G), heated to 95°C for 3 min, and then incubated on ice for 3 min. Samples were then separated by 6% urea PAGE, and RNA bands were stained using gel stain and visualized using an image processing system.

[0445] The expansion of the annealing sequence (T4 phage 2) showed a circularization efficiency similar to that of the T4 phage self-splicing PIE with a 6-nucleotide annealing region (T4 phage 1) ( FIG. 13 ). This data indicates that the expansion of the annealing sequence in the T4 phage self-splicing PIE did not disrupt circularization.

[0446] Example 8: Protein expression from circular RNA generated by T4 phage self-splicing PIE with extended annealing region In this example, we describe the expression of circular RNA generated by a T4 phage self-splicing PIE with an extended annealing region.

[0447] To compare protein expression, DNA constructs containing T4 phage PIE with a dinucleotide annealing region (T4 phage 1) and an extended annealing sequence (T4 phage 2) are designed as described in Example 7. In this example, the constructs are designed to contain polyA50 as a spacer element and a combination of EMCV IRES and Gluc ORF as polynucleotide cargo.

[0448] Linear RNA is synthesized by in vitro transcription using T7 RNA polymerase in the presence of 7.5 mM NTPs. Template DNA is removed by treatment with deoxyribonuclease. Synthesized linear RNA is purified with an RNA clean-up kit (New England Biolabs, T2050). Circular RNA encoding Gluc is purified by urea PAGE, eluted with buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA), ethanol precipitated, and resuspended in RNAse-free water.

[0449] To compare the expression of circular RNA encoding Gluc, circular RNAs produced by T4 phage PIE with 2-nucleotide annealing region (T4 phage 1) and T4 phage PIE with extended annealing region (T4 phage (page) 2) are prepared as described above. HeLa cells (10,000 cells / well in 96-well plates) are transfected with 0.1 picomole of purified circular RNA using LIPOFECTAMINE® MessengerMAX (Invitrogen) transfection agent according to the manufacturer's instructions. Transfectants are prepared separately for each time point. At 6, 24 and 48 hours, medium is collected. To measure Gluc activity, the collected cell medium is transferred to a white 96-well plate and a bioluminescence reporter assay system is used according to the manufacturer's instructions. The plate is read in a luminometer device.

[0450] Example 9: Design of self-splicing replacement intron-exon (PIE) constructs with extended annealing regions In this example, we describe the design of various self-splicing replacement intron-exon (PIE) sequences with extended annealing regions to provide better circularization efficiency.

[0451] Schematics depicting an exemplary design of a DNA construct are presented in Figures 14A and 14B. In this example, the construct comprises, from 5' to 3': the 3' half of a group I catalytic intron fragment (3'half-intron), a 3' splice site, a 3' exon fragment (E2), a spacer element, a polynucleotide cargo, a 5' exon fragment (E1), a 5' splice site, and the 5' half of a group I catalytic intron fragment (5'half-intron).

[0452] Different group I introns have complementary sequences of different lengths (Figure 19). For example, E2 of Synechococcus elongatus PCC6301 has a 7-nucleotide complementary sequence to E1 of Synechococcus elongatus PCC6301; E2 of Anabaena azollae, Anabaena cylindrica, and Scytonema hofmanni has a 5-nucleotide complementary sequence to E1 of Anabaena azollae, Anabaena cylindrica, and Scytonema hofmanni, respectively. To generate a construct with an extended annealing region between E2 and E1, the sequence in E2 was mutated to have an extended annealing region with E1 as shown in Figure 19. The total annealing region from the group I substituted intron-exon (PIE) with extended annealing region is 17 nucleotides.

[0453] The original (1) annealing region and the extended (2) annealing region from FIG. 19 are as follows: Synechococcus 1 TCCGCTGACTGTAAAGG (SEQ ID NO: 92) Synechococcus2 TCCGCTGCGTCTACCGT (SEQ ID NO: 93) Anabaena azollae1 TCCGTTGACTGTAAAAA (SEQ ID NO: 94) Anabaena azollae2 TCCGTAGCGTCTACCAT (SEQ ID NO: 95) Anabaena cylindrica1 TCCGTTGACCTTAAACG (SEQ ID NO: 96) Anabaena cylindrica2 TCCGTAGCGTCTACCAT (SEQ ID NO: 97) Scytonema1 CCCGAAGGTCAGTGGTT (SEQ ID NO: 98) Scytonema2 CCCGACGAGCTACCAGG (SEQ ID NO: 99)

[0454] The RNA structure was evaluated by the RNA structure prediction tool RNAfold (rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi).The enhancement of E2-E1 interaction brought about by the sequence modification leads to proper E2-E1 interaction and aggregation of the self-splicing intron structure (Figures 15A-15B, 16A-16B, 17A-17B, and 18A-18B).

[0455] To compare circularization efficiency, constructs were designed with PIE with the original annealing region and annealing sequence with the extended annealing region. For comparison, Anabaena1 and Anabaena2 constructs were also used. In this example, the constructs were designed to include a spacer element and a combination of EMCV IRES and 3822 nucleotide ORF as polynucleotide cargo. The size of the circular RNA was 4.5 Kb.

[0456] Unmodified linear RNA was synthesized by in vitro transcription from a DNA template using T7 RNA polymerase in the presence of 12.5 mM NTPs. Template DNA was removed by treatment with deoxyribonuclease for 20 min. Synthesized linear RNA was purified with an RNA clean-up kit (New England Biolabs, T2050). Self-splicing occurred during transcription; no additional reaction was required. To monitor self-splicing efficiency, column-purified in vitro transcribed RNA was separated on an anion exchange (AEX) column via HPLC. The percentage of linear and circular peaks was measured, and circularization efficiency was normalized to that of the construct with PIE with the original annealing region.

[0457] Extension of the annealing sequence increased the circularization efficiency by up to 5-fold in the cases of Anabaena (Anabaena2), Synechococcus elongatus PCC6301 (Synechococcus2), and Anabaena cylindrica (Anabaena cylindrica2) and up to 10-fold in the case of Anabaena azollae (Anabaena azollae2), but no increase in the circularization efficiency was observed in the case of Scytonema hofmanni (Scytonema2) (Figure 20). This indicates that circularization efficiency can be increased by modifying other group I introns using the same or similar methods as described here for the Anabaena intron.

[0458] Example 10: Design of Anabaena self-splicing replacement intron-exon (PIE) constructs with extended stem regions to enhance end-to-end interactions This example describes the design of an Anabaena self-splicing replacement intron-exon (PIE) sequence with an extended stem region to provide better circularization efficiency by enhancing end-to-end interactions.

[0459] A schematic diagram depicting an exemplary design of the DNA construct is presented in FIG. 21B. In this example, the construct contains, from 5' to 3': the 3' half of the group I catalytic intron fragment (Anabaena 3' half-intron), a 3' splice site, a 3' exon fragment (Anabaena E2), a spacer element, a polynucleotide cargo, a 5' exon fragment (Anabaena E1), a 5' splice site, and a 5' half of the group I catalytic intron fragment (Anabaena 5' half-intron). Two versions of the construct with extended stem regions were designed. In the Anabaena 4 design, an additional stem region (5'-GUAAGUU-3') was placed next to each other. In the Anabaena 5 design, the stem was filled in with the bulge region in P6b to create the stem.

[0460] Unmodified linear RNA was synthesized by in vitro transcription from a DNA template using T7 RNA polymerase in the presence of 12.5 mM NTPs. Template DNA was removed by treatment with DNase for 20 min. Synthesized linear RNA was purified with an RNA clean-up kit (New England Biolabs, T2050). Self-splicing occurred during transcription; no additional reaction was required. To monitor self-splicing efficiency, column-purified in vitro transcribed RNA was separated on an anion exchange (AEX) column via HPLC. The percentages of linear and circular peaks were measured, and circularization efficiency was normalized to that of the corresponding original construct.

[0461] Constructs with extended stem regions showed comparable circularization efficiency to constructs with an Anabaena PIE with an extended annealing region (Anabaena2) and to constructs with an Anabaena PIE with a 5 nucleotide annealing region (Anabaena1) (Figure 22). Synechococcus elongatus PCC6301: 3' half-intron E2 [ka] Synechococcus elongatus PCC6301:E1 5' half-intron ACGGTAGACGCAGCGGACTTAGAAAACTGGGCCTCGATCGCGAAAGGGATCGAGTGGCAGCTCTCAAACTCAGGGAAACCTAAAACTTTAAACATTMAAGTCATGGCAATCCTGAGCCAAGCTAAAGC (SEQ ID NO: 81) Anabaena azollae: 3' half-intron E2 [ka] Anabaena azollae: E1 5' half-intron [ka] Anabaena cylindrica: 3' half-intron E2 [ka] Anabaena cylindrica: E1 5' half-intron [ka] Scytonema hofmanni: 3' half-intron E2 [ka] Scytonema hofmanni: E1 5' half-intron [ka] Anabaena4:3' half-intron E2 [ka] Anabaena4:E1 5' half-intron [ka] Anabaena5:3' half-intron E2 [ka] Anabaena5:E1 5' half-intron AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT (SEQ ID NO: 91)

[0462] Other embodiments While the invention has been described in connection with particular embodiments thereof, it will be understood that it is capable of further modifications, and that this application is intended to cover any variations, uses, or adaptations of the invention which generally follow the principles of the invention and include such departures from the invention which are within known or customary practice contained in the art to which the invention pertains, may be applied to the essential features previously described, and fall within the scope of the claims. Other embodiments are within the scope of the claims.

Claims

1. Formula 5'-(A)-(B)-(C)-(D)-(E)-(F)-(G)-3' (in the formula, (A) contains the 3′ half of the group I catalytic intron fragment; (B) contains the 3' splice site; (C) contains the 3' exon fragment; (D) comprises a polyribonucleotide cargo; (E) contains the 5' exon fragment; (F) contains the 5' splice site; and (G) contains the 5′ half of the group I catalytic intron fragment; and (A), (B), or (C) comprises a first annealing region comprising 8 to 50 ribonucleotides, and (E), (F), or (G) comprises a second annealing region comprising 8 to 50 ribonucleotides, the first annealing region and the second annealing region have 80% to 100% complementarity; or A linear polyribonucleotide, wherein the first annealing region and the second annealing region comprise 0 to 10 mismatched base pairs.

2. i) (A) or (C) comprises the first annealing region, and (E) or (G) comprises the second annealing region; and / or ii) the 3' exon fragment of (C) comprises the first annealing region, and the 5' exon fragment of (E) comprises the second annealing region; or the 3' half of the Group I catalytic intron fragment of (A) comprises the first annealing region, and the 5' exon fragment of (E) comprises the second annealing region; and / or iii) the first annealing region comprises 10 to 30, 10 to 20, or 10 to 15 ribonucleotides, and the second annealing region comprises 10 to 30, 10 to 20, or 10 to 15 ribonucleotides; and / or iv) the 3' half of the group I catalytic intron fragment of (A) and the 5' half of the group I catalytic intron fragment of (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena or a pre-rRNA of Tetrahymena; The linear polyribonucleotide of claim 1.

3. the first annealing region and the second annealing region are i) has 90% to 100% complementarity; ii) contains zero or one mismatched base pair; and / or iii) are 100% complementary; A linear polyribonucleotide according to claim 1 or 2.

4. i) the 3' half of the group I catalytic intron fragment of (A) and the 5' half of the group I catalytic intron fragment of (G) are derived from a pre-tRNA-Leu gene of the cyanobacterium Anabaena; and (C) the 3' exon fragment comprises the first annealing region, and (E) the 5' exon fragment comprises the second annealing region; Optionally, the first annealing region comprises 10 to 15 ribonucleotides and the second annealing region comprises 10 to 15 ribonucleotides; or ii) the 3' half of the group I catalytic intron fragment in (A) and the 5' half of the group I catalytic intron fragment in (G) are derived from Tetrahymena pre-rRNA; and the 3' half of the Group I catalytic intron fragment of (A) comprises the first annealing region, and the 5' exon fragment of (E) comprises the second annealing region; Optionally, the first annealing region comprises 10 to 16 ribonucleotides and the second annealing region comprises 10 to 16 ribonucleotides; or iii) the 3' half of the group I catalytic intron fragment of (A) and the 5' half of the group I catalytic intron fragment of (G) are derived from the td gene of T4 phage, and the 3' exon fragment of (C) comprises the first annealing region, and the 5' half of the group I catalytic intron fragment of (G) comprises the second annealing region; Optionally, the first annealing region comprises 2 to 16 ribonucleotides, and the second annealing region comprises 2 to 16 ribonucleotides. The linear polyribonucleotide of claim 1.

5. i) the 3' half of the Group I catalytic intron fragment of (A) is the 5' end of the linear polynucleotide; and / or ii) the 5' half of the Group I catalytic intron fragment of (G) is the 3' end of the linear polyribonucleotide; and / or iii) the linear polyribonucleotide does not include an annealing region 3′ of (A) that contains partial or complete nucleic acid complementarity with an annealing region 5′ of (G); and / or iv) the polyribonucleotide cargo of (D) comprises expressed sequences, non-coding sequences, or expressed sequences and non-coding sequences; and / or v) the polyribonucleotide cargo of (D) comprises an expressible sequence encoding a polypeptide; and / or vi) the polyribonucleotide cargo of (D) comprises an IRES operably linked to an expression sequence encoding a polypeptide; and / or vii) the polyribonucleotide cargo of (D) comprises an expressible sequence encoding a polypeptide having a biological effect on a subject; A linear polyribonucleotide according to any one of claims 1 to 4.

6. A linear polyribonucleotide according to any one of claims 1 to 5, which does not comprise an additional annealing region.

7. A linear polyribonucleotide as described in claim 6, which does not contain an additional annealing region containing at least 6 ribonucleotides.

8. i) the linear polyribonucleotide further comprises a first spacer region between the 3' exon fragment of (C) and the polyribonucleotide cargo of (D); and / or ii) the linear polyribonucleotide further comprises a second spacer region between the polyribonucleotide cargo of (D) and the 5' exon fragment of (E); preferably, each spacer region is at least 5 ribonucleotides in length, more preferably, each spacer region is 5-500 ribonucleotides in length; A linear polyribonucleotide according to any one of claims 1 to 7.

9. 9. The linear polyribonucleotide of claim 8, wherein the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a polyA sequence; or a polyA-C sequence.

10. i) the linear polyribonucleotide is 300 to 20,000 ribonucleotides in length; and / or ii) the linear polyribonucleotide is at least 1,000 ribonucleotides in length, and optionally the linear polyribonucleotide is at least 3,000 ribonucleotides in length; A linear polyribonucleotide according to any one of claims 1 to 9.

11. Formula 5'-(A)-(B)-(C)-(D)-(E)-(F)-(G)-3' (in the formula, (A) contains the 3' portion of the group I catalytic intron fragment; (B) contains the 3' splice site; (C) comprises a 3' exon fragment comprising a first annealing region comprising 8 to 50 ribonucleotides, wherein said first annealing region is flanked on both sides by a portion of said 3' exon fragment; (D) comprises a polyribonucleotide cargo; (E) comprises a 5' exon fragment comprising a second annealing region comprising 8 to 50 ribonucleotides capable of hybridizing to said first annealing region; (F) contains the 5' splice site; and (G) contains the 5' portion of the group I catalytic intron fragment. A linear polyribonucleotide having the formula:

12. A linear polyribonucleotide as described in claim 11, which does not contain an additional annealing region containing at least 6 ribonucleotides.

13. A DNA vector comprising an RNA polymerase promoter operably linked to a DNA sequence encoding the linear polyribonucleotide of any one of claims 1 to 12.

14. A circular polyribonucleotide produced from the linear polyribonucleotide of any one of claims 1 to 12 or the DNA vector of claim 13.

15. A circular polyribonucleotide comprising a splice bond connecting a 5' exon fragment and a 3' exon fragment, the 3' exon fragment comprises a first annealing region comprising 8 to 50 ribonucleotides, and the 5' exon fragment comprises a second annealing region comprising 8 to 50 ribonucleotides; and the first annealing region and the second annealing region comprise 80% to 100% complementarity, or the first annealing region and the second annealing region comprise 0 to 10 mismatched base pairs; cyclic polyribonucleotides.

16. The cyclic polyribonucleotide further comprising a polyribonucleotide cargo; i) preferably, said polyribonucleotide cargo comprises expressed sequences, non-coding sequences, or a combination of expressed and non-coding sequences; and ii) more preferably, said polyribonucleotide cargo comprises an expressible sequence encoding a polypeptide; and iii) More preferably, said polyribonucleotide comprises an IRES operably linked to an expression sequence encoding a polypeptide; and iv) More preferably, the circular polyribonucleotide further comprises a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment; and v) more preferably, the spacer region is at least 5 ribonucleotides in length; and vi) More preferably, the spacer region is 5 to 500 ribonucleotides in length.

17. 17. The cyclic polyribonucleotide of claim 16, wherein the spacer region comprises a poly A sequence; or a poly A-C sequence.

18. i) the cyclic polyribonucleotide is at least 500 ribonucleotides in length; optionally, the cyclic polyribonucleotide is 500-20,000 ribonucleotides in length; and / or ii 14.) A linear polyribonucleotide according to any one of claims 1 to 12 or a vector according to claim 13, A cyclic polyribonucleotide according to any one of claims 15 to 17.

19. 19. A method for expressing a polypeptide in a cell, the method comprising providing the cell with a linear polyribonucleotide according to any one of claims 1 to 12, a DNA vector according to claim 13, or a circular polyribonucleotide according to any one of claims 14 to 18.

20. 13. A method for producing a cyclic polyribonucleotide from a linear polyribonucleotide according to any one of claims 1 to 12, comprising providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce the cyclic polyribonucleotide.

Images