Modified binding proteins and therapeutic uses thereof
Patent Information
- Application Number
- JP2024522258
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-12
- Filing Date
- 2022-10-12
- Publication Date
- 2025-10-22
AI Technical Summary
Current TCR gene therapy faces challenges in achieving a long-lasting binding event between the T cell receptor and peptide-MHC complex, and low abundance peptides often fail to stimulate T cells effectively.
Introduce a covalent linkage through a cysteine residue in the TCR complementarity determining region (CDR) to form a disulfide bond with the peptide bound to an MHC protein, stabilizing the TCR-peptide/MHC interaction.
This approach enhances the longevity of the TCR-peptide/MHC interaction, allowing T cell activation even with low abundance peptides, and expands the range of targetable antigens, including those with low expression or non-classical MHC presentation.
Smart Images

Figure 00000068_0000 
Figure 00000068_0001 
Figure 00000068_0002
Abstract
Description
[Technical field]
[0001] The present invention relates to modified binding proteins, such as T cell receptors, and their uses in treating various diseases or conditions, particularly cancer and autoimmune diseases.
[0002] Related Applications This application claims priority to Australian Provisional Application No. 2021903279, the entire contents of which are incorporated herein by reference. [Background technology]
[0003] T cell receptors (TCRs) mediate the recognition of specific antigens by T cells and are therefore essential for the functioning of cell populations of the immune system. Native TCRs are heterodimeric cell surface proteins of the immunoglobulin superfamily that associate with invariant proteins of the CD3 complex involved in mediating signal transduction. TCRs exist in αβ and γδ forms, which are structurally similar but have quite different anatomical locations and functions. TCRs recognize antigens in the form of peptides presented by major histocompatibility complex (MHC) proteins. MHC class I and class II ligands are also immunoglobulin superfamily proteins, but they are specialized for antigen presentation, with highly polymorphic peptide binding sites that allow them to present a wide variety of peptide fragments on the surface of antigen-presenting cells (APCs).
[0004] Two additional classes of proteins are known to be capable of functioning as TCR ligands. CD1 antigens are MHC class I-associated molecules whose genes are located on different chromosomes than classical MHC class I and class II. CD1 molecules can present peptides and non-peptide (e.g., lipids, glycolipids) moieties to T cells in a manner similar to conventional class I and class II MHC-peptide complexes. See, for example, (Barclay et al. (1997) The Leucocyte Antigen Factsbook 2nd ed., Academic Press) and (Bauer (1997) Eur J Immunol 27 (6) 1366-1373)). Bacterial superantigens are soluble toxins that can bind both class II MHC molecules and a subset of TCRs (Fraser (1989) Nature 339 221-223). Many superantigens exhibit specificity for one or two V beta segments, while others exhibit more promiscuous binding. In any case, superantigens are capable of polyclonally stimulating subsets of T cells and thus eliciting enhanced immune responses.
[0005] The extracellular portion of the native heterodimeric αβ and γδ TCRs consists of two polypeptides, each of which has a membrane-proximal constant domain and a membrane-distal variable domain. Each of the constant and variable domains contains an intrachain disulfide bond, and the two chains of each heterodimer are linked by interchain disulfide bonds. The variable domains contain highly polymorphic loops similar to the complementarity determining regions (CDRs) of antibodies. CDR3 of the αβ TCR primarily interacts with peptides presented by the MHC, while CDR1 and 2 of the αβ TCR primarily interact with peptides and MHC. TCR variable domain sequence diversity arises through somatic rearrangement of linked variable (V), diversity (D), and joining (J) genes.
[0006] T cell activation depends on the simultaneous αβ T cell antigen receptor (TCR) recognition of peptide antigens presented by MHC molecules on the surface of APCs.
[0007] Recent advances in cellular immunotherapy involve adoptive transfer of T cells that efficiently recognize tumor antigens. These T cells can be derived from tumor-infiltrating lymphocytes (TILs) or peripheral blood T cells (TCR-T) that can efficiently recognize tumor antigens after being genetically modified with antigen-specific TCRs. Adoptive T cell therapy includes chimeric antigen receptor (CAR)-based CAR-T therapy and T cell receptor-based TCR-T therapy. Unlike CAR T cells that recognize surface-expressed proteins, TCRs can recognize tumor-specific proteins inside the cells.
[0008] A major challenge with TCR gene therapy is achieving a binding event between the TCR and peptide-MHC (pMHC) that lasts long enough to induce T cell stimulation. Furthermore, low abundance peptides may not be able to stimulate T cells, limiting current TCR therapy.
[0009] There is a need for new and / or improved cell-based therapies, particularly T cell-based therapies, or TCR-based therapies, for the treatment of a variety of conditions, including cancer and autoimmune diseases.
[0010] The reference in this specification to any prior art is not an admission or suggestion that this prior art forms part of the common general knowledge in any scope, or that this prior art would be understood, considered relevant to, and / or could reasonably be expected to be combined with other parts of the prior art, by a person skilled in the art. [Prior art documents] [Patent documents]
[0011] [Patent Document 1] WO97 / 09433 [Patent Document 2] US Patent Application Publication No. 2004 / 0087025 [Patent Document 3] US2011 / 0243972 [Patent Document 4] US2011 / 0189141 [Patent Document 5] WO2016 / 141357 [Non-patent literature]
[0012] [Non-Patent Document 1] Barclay et al. (1997) The Leucocyte Antigen Factsbook 2nd edition, Academic Press [Non-Patent Document 2] Bauer (1997) Eur J Immunol 27 (6) 1366~1373 [Non-Patent Document 3] Fraser (1989) Nature 339 221~223 [Non-Patent Document 4] J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984) [Non-Patent Document 5] J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) [Non-Patent Document 6] In T. A. Brown (ed.), Essential Molecular Biology: A Practical Approach, volumes 1 and 2, IRL Press (1991) [Non-Patent Document 7] In D. M. Glover and B. D. Hames (eds.), DNA Cloning: A Practical Approach, volumes 1-4, IRL Press (1995 and 1996) [Non-Patent Document 8] FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all current editions) [Non-Patent Document 9] Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988) [Non-Patent Document 10] J. E. Coligan et al. (eds.), Current Protocols in Immunology, John Wiley & Sons (including all current editions) [Non-Patent Document 11] Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., 1987 and 1991 [Non-Patent Document 12] Bork et al., J Mol. Biol. 242, 309–320, 1994 [Non-Patent Document 13] Chothia and Lesk J. Mol Biol. 196:901-917, 1987 [Non-Patent Document 14] Chothia et al., Nature 342, 877-883, 1989 [Non-Patent Document 15] Al-Lazikani et al., J Mol Biol 273, 927–948, 1997 [Non-Patent Document 16] Lehninger, Biochemistry, 2nd ed.; Worth Publishers, Inc. NY, NY, pp. 71-77, 1975. [Non-Patent Document 17] Lewin, Genes IV, Oxford University Press, NY and Cell Press, Cambridge, MA, 8 pages, 1990 [Non-Patent Document 18] Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd ed., Current Biology Publications, p. 4:33, 1997 [Non-Patent Document 19] Jores et al., Proc. Nat'l. Acad. Sci. USA 57:9138, 1990 [Non-Patent Document 20] Chothia et al., EMBO J. 7:3745, 1988 [Non-Patent Document 21] Lefranc et al., Dev. Comp. Immunol. 27:55, 2003 [Non-Patent Document 22] Young et al., FASEB J (1995): 9, 26-36 [Non-Patent Document 23] Rammensee et al., Curr Opin Immunol (1995): 7: 85-96 [Non-Patent Document 24] Lefkovits (Immunology Methods Manual: The Comprehensive Sourcebook of Techniques, 1998) [Non-Patent Document 25] Current Protocols in Immunology; Weir, Handbook of Experimental Immunology, Blackwell Scientific, Boston, MA (1986) [Non-Patent Document 26] Mishell and Shigii (eds.) Selected Methods in Cellular Immunology, Freeman Publishing, San Francisco, CA (1979) [Non-Patent Document 27] Green and Reed, Science 281:1309 (1998) [Non-Patent Document 28] Robins et al., Blood 114:4099, 2009 [Non-Patent Document 29] Robins et al., Sci. Translat. Med. 2:47ra64, 2010 [Non-Patent Document 30] Robins et al., (September 10) J. 1mm. Meth. Epub ahead of print, 2011 [Non-Patent Document 31] Warren et al., Genome Res. 2 1:790, 2011 [Non-Patent Document 32] Schmitt et al., Hum. Gen. 20:1240, 2009 [Non-Patent Document 33] Dossett et al., Mol. Ther. 77:742, 2009 [Non-Patent Document 34] Till et al., Blood 772:2261, 2008 [Non-Patent Document 35] Wang et al., Hum. Gene Ther. 75:712, 2007 [Non-Patent Document 36] Kuball et al., Blood 709:2331, 2007 [Non-Patent Document 37] en et al., Ann. Rev. Immunol. 25:243, 2007 [Non-Patent Document 38] Hague et al. (2012) J. Immunol., 189: 2338-36 [Non-Patent Document 39] Hague et al. (2019) JCI Insight, 4: pii 126471 [Non-Patent Document 40] Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, 3rd ed., edited by B. N. Fields et al., Lippincott-Raven Publishers, Philadelphia, 1996
Non-Patent Document 41
Non-Patent Document 42
Non-Patent Document 43
Non-Patent Document 44
Non-Patent Document 45
Non-Patent Document 46
Non-Patent Document 47
Non-Patent Document 48
Non-Patent Document 49
Non-Patent Document 50
Non-Patent Document 51
Non-licensed Document 52
Non-licensed Document 53
Non-licensed Document 54
Non-licensed Document 55
Non-licensed Document 56
Non-licensed Document 57
Non-licensed Document 58
Non-licensed Document 59
Non-licensed Document 60
Non-licensed Document 61
Non-licensed Document 62
Non-licensed Document 63
Non-licensed Document 64
Non-licensed Document 65
Non-licensed Document 66
Non-licensed Document 67
Non-licensed Document 68
Non-licensed Document 69
Non-licensed Document 70
[0013] The inventors have identified that it is possible to form a covalent linkage between a TCR complementarity determining region (CDR) and a peptide bound to an MHC protein, also called a human leukocyte antigen (HLA) molecule, typically a disulfide bond formed between a cysteine in the TCR CDR and a cysteine in the peptide bound to the MHC molecule.
[0014] In one aspect, the invention provides a binding protein comprising a variable domain that includes a complementarity determining region (CDR) that can contact a peptide bound to an HLA molecule, wherein the CDR includes a cysteine that can form a disulfide bond with a cysteine in the peptide bound to the HLA molecule.
[0015] In any aspect of the invention, the binding protein may be an antigen binding protein, such as an antibody or an antigen binding fragment thereof, or a T cell receptor or a fragment thereof. In one embodiment, the T cell receptor is a soluble T cell receptor. In one embodiment, the antigen binding protein or T cell receptor may be part of a chimeric or fusion protein, e.g., the antigen binding protein may be part of a chimeric antigen receptor (CAR). In one embodiment, the chimeric or fusion protein comprises a soluble T cell receptor of the invention as described herein.
[0016] In any embodiment of the invention where the binding protein is an antibody, the variable domain may be a heavy or light chain variable domain. Preferably, the CDR is CDR3. Thus, the CDR3 containing the cysteine may be in the heavy or light chain variable domain.
[0017] In any embodiment of the invention where the binding protein is a T cell receptor, the variable domain may be an alpha chain variable domain (Vα) or a beta chain variable domain (Vβ). Thus, the CDR3 containing a cysteine may be in the alpha chain or in the beta chain. Preferably, the binding protein comprises both an alpha chain variable domain and a beta chain variable domain, and the CDR containing a cysteine that can form a disulfide bond with a cysteine in a peptide bound to the HLA molecule is present in the alpha chain variable domain or the beta chain variable domain, but not both. For example, the CDR3 may comprise, consist essentially of, or consist of an amino acid sequence as shown in Table 3 or Table 4, with the cysteine residues present at the positions shown.
[0018] In one embodiment, the TCR has an alpha chain variable domain comprising a CDR3 as set out in Table 3 or Table 4 and a beta chain variable domain comprising a CDR3 as set out in Table 3 or Table 4, wherein the residue shown in the ValphaCDR3 or VbetaCDR3 is replaced with a cysteine.
[0019] In any aspect of the present invention, the HLA can be any HLA molecule or any HLA-like molecule that can present peptide antigens on the cell surface. In any embodiment, the HLA can be HLA class I or HLA class II. Furthermore, the HLA can be an HLA-like molecule such as HLA-E. HLA corresponding to MHC class I includes HLA-A, HLA-B, and HLA-C. HLA corresponding to MHC class II includes HLA-DP, HLA-DQ, and HLA-DR.
[0020] In any aspect of the invention, the binding protein can be a recombinant binding protein, a synthetic binding protein, a purified binding protein, or a substantially purified binding protein.
[0021] Typically, cysteines are introduced into the CDRs by mutation or modification of existing residues.
[0022] In any aspect of the invention, the CDR is preferably CDR3.
[0023] In any aspect of the invention, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in the peptide bound to an HLA molecule, where the cysteine in the peptide is at one of positions P1, P2, P3, P4, P5, P6, P7, P8 or P9, and where in MHC class I, peptide position (P2) is the amino acid that occupies or is closest to the B pocket of the MHC class I molecule, and in MHC class II, peptide position 1 is the amino acid that occupies or is closest to the P1 pocket of the MHC class II molecule.
[0024] In any aspect of the invention, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in the peptide bound to an HLA class I molecule, where the cysteine in the peptide is at one of positions P4, P5, P6, P7, P8 or P9, and where in MHC class I, peptide position (P2) is the amino acid that occupies or is closest to the B pocket of the MHC class I molecule, and in MHC class II, peptide position 1 is the amino acid that occupies or is closest to the P1 pocket of the MHC class II molecule.
[0025] In any aspect of the invention, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in the peptide bound to an HLA class II molecule, where the cysteine in the peptide is at one of positions P1, P2, P4, P5, P6, P7 or P8, and where in MHC class I, peptide position (P2) is the amino acid that occupies or is closest to the B pocket of the MHC class I molecule, and in MHC class II, peptide position 1 is the amino acid that occupies or is closest to the P1 pocket of the MHC class II molecule.
[0026] In one embodiment, where the CDR is in a TCR alpha chain variable domain, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in a peptide bound to an HLA molecule, preferably the cysteine in the peptide is at one of positions P4, P5 or P6. Preferably, the HLA is HLA class I. In another embodiment, where the CDR is in a TCR beta chain variable domain, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in a peptide bound to an HLA molecule, preferably the cysteine in the peptide is at one of positions P4, P5, P6, P7, P8 or P9. Preferably, the HLA is HLA class I.
[0027] In one embodiment, the CDR is present in a TCR alpha chain variable domain, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in a peptide bound to an HLA molecule, where the cysteine in the peptide is at one of positions P1, P2 or P5. Preferably, the HLA is HLA class II. In another embodiment, the CDR is present in a TCR beta chain variable domain, a cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in a peptide bound to an HLA molecule, where the cysteine in the peptide is at one of positions P4, P5, P6, P7 or P8. Preferably, the HLA is HLA class II.
[0028] In any aspect of the invention where the CDR is present in a TCR alpha chain variable domain, a cysteine is present in the CDR at a position that allows for disulfide bond formation with a cysteine present in a peptide shown in Table 2 or Table 3 that is bound to an HLA class I molecule.
[0029] In any aspect of the invention where the CDR is present in a TCR β chain variable domain, a cysteine is present in the CDR at a position that allows for disulfide bond formation with a cysteine present in a peptide shown in Table 2 or Table 3 that is bound to an HLA class I molecule.
[0030] In any aspect of the invention where the CDR is present in a TCR alpha chain variable domain, a cysteine is present in the CDR at a position that allows for disulfide bond formation with a cysteine present in a peptide shown in Table 1 or Table 4 that is bound to an HLA class II molecule.
[0031] In any aspect of the invention where the CDR is present in a TCR β chain variable domain, a cysteine is present in the CDR at a position that allows for disulfide bond formation with a cysteine present in a peptide shown in Table 1 or Table 4 that is bound to an HLA class II molecule.
[0032] In any aspect of the invention, the peptide may bind to an HLA class I molecule selected from HLA-A, HLA-B, HLA-C or HLA-E.
[0033] In any aspect of the invention, the peptide may bind to an HLA class I molecule selected from HLA-A*02:01, HLA-B*07:02, HLA-B*44:05, HLA-A*02:01, HLA-B*35:01, HLA-A*01:01, HLA-B*35:08, HLA-B*37:01, HLA-B*08:01, HLA-A*11:01, HLA-B*27:05, HLA-A*24:02, HLA-B*51:01, and HLA-E*01:03.
[0034] In any aspect of the invention, the peptide may bind to an HLA class II molecule selected from HLA-DR, HLA-DP, or HLA-DQ.
[0035] In any aspect of the invention, the peptide is selected from the group consisting of HLA-DQA1*0508_HLA-DQB1*0201, HLA-DQA1*0501_HLA-DQB1*0201, HLA-DQA1*0301_HLA-DQB1*0302, HLA-DRA*0101_HLA-DBR1*0101, HLA-DRA*0101_HLA-DRB3*0301, HLA-DRA*0101_HLA-DBR5*0101, HLA-DRA*0101_HLA-DBR1*0401, HLA - capable of binding to an HLA class II molecule selected from HLA-DPB1*2602, HLA-DQA1*0501_HLA-DQB1*0302, HLA-DRA*0101_HLA-DRB1*1101, HLA-DRA*0101_HLA-DRB1*1502, HLA-DRA*0101_HLA-DRB1*0101, HLA-DQA1*0301_HLA-DQB1*0305, HLA-DQA1*0201_HLA-DQB1*0201
[0036] In any aspect of the invention, the cysteine capable of forming a disulfide bond with a cysteine in a peptide bound to an HLA molecule is present in the CDR at position 3, 4, 5, 6, 7, 8, 9 or 10, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e., the amino acid at the N-terminus of the CDR is position 1).
[0037] In any aspect of the invention where the CDR is present in a TCR alpha chain variable domain, the cysteine is present in the CDR at position 3, 4, 5, 6, 7, 8, 9 or 10, with numbering relative to the amino acid at the N-terminus of the CDR (i.e. the amino acid at the N-terminus of the CDR is position 1). Preferably the cysteine allows for disulfide bond formation with a cysteine present in the peptide bound to the HLA class I molecule, more preferably a cysteine present at position P4, P5 or P6.
[0038] In any aspect of the invention where the CDR is present in a TCR β chain variable domain, the cysteine is present in the CDR at position 3, 4, 5, 6, 7, 8, 9 or 10, with numbering relative to the amino acid at the N-terminus of the CDR (i.e. the amino acid at the N-terminus of the CDR is position 1). Preferably the cysteine allows for disulfide bond formation with a cysteine present in a peptide bound to an HLA class II molecule, more preferably a cysteine present at position P4, P5, P6, P7, P8 or P9.
[0039] In any aspect of the invention where the CDR is present in a TCR alpha chain variable domain, the cysteine is present in the CDR at position 5, 6, 7, 8 or 11, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e. the amino acid at the N-terminus of the CDR is position 1). Preferably the cysteine allows for disulfide bond formation with a cysteine present in the peptide bound to the HLA class II molecule, more preferably a cysteine present at position P1, P2 or P5.
[0040] In any aspect of the invention where the CDR is present in a TCR β chain variable domain, the cysteine is present in the CDR at position 5, 6, 7, 8 or 9, with numbering relative to the amino acid at the N-terminus of the CDR (i.e. the amino acid at the N-terminus of the CDR is position 1). Preferably the cysteine allows for disulfide bond formation with a cysteine present in a peptide bound to an HLA class II molecule, more preferably a cysteine present at position P4, P5, P6, P7 or P8.
[0041] In any aspect of the invention, the peptide that binds to the HLA molecule may contain a naturally occurring or introduced cysteine at any one of the positions mentioned herein.
[0042] In another aspect, the invention provides a chimeric or fusion protein comprising a binding protein of any aspect of the invention.
[0043] In another aspect, the invention provides a nucleic acid comprising, consisting essentially of, or consisting of a nucleotide sequence encoding a binding protein or chimeric or fusion protein of any aspect of the invention.
[0044] In another aspect, the invention provides a vector comprising a nucleotide sequence encoding a nucleic acid of any aspect of the invention or a binding protein or a chimeric or fusion protein of any aspect of the invention. Typically, the vector allows expression of the nucleotide sequence in a cell, resulting in the presentation of the binding protein on the surface of said cell. The vector may be a retroviral vector, preferably a lentiviral vector. Typically, the vector allows expression of the nucleotide sequence in a T cell, preferably a helper T cell, such as a CD4+ T cell. The CD4+ T cell may be a regulatory T cell (Treg), preferably a CD4+CD25high T cell. Alternatively, the T cell may be a CD8+ T cell.
[0045] In one embodiment, the vector comprises a nucleic acid of the invention operably linked to a promoter.
[0046] In embodiments of the invention directed to a single polypeptide chain binding protein, the expression construct may include a promoter linked to the nucleic acid encoding that polypeptide chain.
[0047] In embodiments of the invention directed to multiple polypeptide chains forming a binding protein, the vector comprises a nucleic acid encoding a polypeptide comprising, e.g., Vα operably linked to a promoter, and a nucleic acid encoding a polypeptide comprising, e.g., Vβ operably linked to a promoter.
[0048] In another example, an expression construct may include, for example, the following operably linked components in 5' to 3' order: (i) a promoter; (ii) a nucleic acid encoding a first polypeptide; (iii) an internal ribosome entry site, preferably a 2A peptide cleavage motif derived from a picornavirus, and (iv) a nucleic acid encoding a second polypeptide. wherein a first polypeptide comprises Vα and a second polypeptide comprises Vβ, or vice versa. Preferably, the vector allows translation of a nucleotide sequence encoding Vβ before translation of a nucleotide sequence encoding Vα.
[0049] In another embodiment, the present invention also contemplates separate vectors, one of which encodes a first polypeptide comprising Vα and another of which encodes a second polypeptide comprising Vβ. For example, the present invention also contemplates (i) a first expression construct comprising a nucleic acid encoding a polypeptide comprising a Vα operably linked to a promoter; and (ii) a second expression construct comprising a nucleic acid encoding a polypeptide comprising a Vβ operably linked to a promoter; A composition comprising:
[0050] In another aspect, the invention provides a cell comprising a vector or a nucleic acid described herein. Preferably, the cell is isolated, substantially purified, or recombinant. In one example, the cell comprises a vector or a nucleic acid of the invention. (i) a first expression construct comprising a nucleic acid encoding a polypeptide comprising a Vα operably linked to a promoter; and (ii) a second expression construct comprising a nucleic acid encoding a polypeptide comprising a Vβ operably linked to a promoter; wherein the first and second polypeptides associate to form the binding protein of the invention. Preferably, the cell is a T cell, more preferably a helper T cell, such as a CD4+ T cell. The CD4+ T cell may be a regulatory T cell (Treg), preferably a CD4+CD25high T cell.
[0051] In another aspect, the invention provides a cell expressing a binding protein of the invention on its surface. Preferably, the cell is a T cell, more preferably a CD4+ T cell. The CD4+ T cell may be a regulatory T cell (Treg), preferably a CD4+CD25high T cell.
[0052] In another aspect, the invention provides a method of preparing a population of regulatory T cells for use in the treatment of an autoimmune disease, comprising the steps of: - providing a population of regulatory T cells; - introducing a nucleic acid or vector of the invention into a population of regulatory T cells, - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of regulatory T cells; thereby preparing a population of regulatory T cells for use in treating an autoimmune disease. The autoimmune disease may be any one of those described herein.
[0053] In another aspect, the invention provides a method of preparing a population of regulatory T cells for use in treating or preventing transplant rejection, comprising the steps of: - providing a population of regulatory T cells; - introducing a nucleic acid or vector of the invention into a population of regulatory T cells, - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of regulatory T cells; thereby providing a method for preparing a population of regulatory T cells for use in treating or preventing transplant rejection.
[0054] In another aspect, the invention provides a method of preparing a population of cytotoxic T cells for use in the treatment of cancer or an infectious disease, comprising the steps of: - providing a population of cytotoxic T cells; - introducing a nucleic acid or vector of the invention into a population of cytotoxic T cells, - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of cytotoxic T cells; thereby preparing a population of cytotoxic T cells for use in treating cancer or an infectious disease. The cancer or infectious disease may be any of those described herein.
[0055] In another aspect, the invention provides a method for preparing an ex vivo population of T cells exhibiting at least one characteristic of regulatory T cells, comprising: - providing a population of T cells that exhibit at least one characteristic of a regulatory T cell; - introducing a nucleic acid or vector of the invention into a population of T cells, the nucleic acid or vector encoding a binding protein, chimeric or fusion protein of the invention, and - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of T cells wherein the T cells exhibit at least one characteristic of a regulatory T cell are derived from a biological sample from a subject with an autoimmune disease.
[0056] T cells exhibiting at least one characteristic of regulatory T cells for use in the methods or uses of the invention may be selected from a subject diagnosed with an autoimmune disease or from a healthy subject. The T cells may be isolated from a histocompatible donor.
[0057] In an alternative embodiment, the invention provides a method for preparing an ex vivo population of T cells exhibiting at least one characteristic of regulatory T cells, comprising: - providing a population of T cells exhibiting at least one characteristic of conventional T cells, optionally the population of T cells being a mixed population of T cells; - introducing a nucleic acid or vector of the invention into a population of T cells, the nucleic acid or vector encoding a binding protein, chimeric or fusion protein of the invention, - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of T cells; and - providing conditions that allow for conversion of a population of T cells into regulatory T cells; The present invention provides a method for preparing an ex vivo population of T cells, comprising: (a) administering to the subject a therapeutically effective amount of T cells that is capable of expressing at least one of the characteristics of a regulatory T cell; and (b) administering to the subject a therapeutically effective amount of T cells that is capable of expressing at least one of the characteristics of a regulatory T cell. Preferably, the T cells that exhibit at least one characteristic of a conventional T cell or a mixed population of T cells are derived from a biological sample from a subject with an autoimmune disease. Alternatively, the T cells may be derived from a histocompatible donor.
[0058] In another aspect, the invention provides a method for preparing an ex vivo population of T cells exhibiting at least one characteristic of a cytotoxic T cell, comprising the steps of: - providing a population of T cells exhibiting at least one characteristic of a cytotoxic T cell; - introducing a nucleic acid or vector of the invention into a population of T cells, the nucleic acid or vector encoding a binding protein, chimeric or fusion protein of the invention, and - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of T cells wherein the T cells exhibit at least one characteristic of a cytotoxic T cell are derived from a biological sample from a subject having cancer or an infectious disease.
[0059] T cells exhibiting at least one characteristic of a cytotoxic T cell for use in the method or use of the invention may be selected from a subject diagnosed with cancer or an infectious disease or from a healthy subject. The T cells may be isolated from a histocompatible donor.
[0060] In an alternative embodiment, the invention provides a method for preparing an ex vivo population of T cells exhibiting at least one characteristic of a cytotoxic T cell, comprising the steps of: - providing a population of T cells exhibiting at least one characteristic of conventional T cells, optionally the population of T cells being a mixed population of T cells; - introducing a nucleic acid or vector of the invention into a population of T cells, the nucleic acid or vector encoding a binding protein, chimeric or fusion protein of the invention, - providing conditions that allow expression of the binding protein, chimeric or fusion protein on the surface of T cells; and - providing conditions that allow for conversion of the population of T cells into cytotoxic T cells; and thereby preparing an ex vivo population of T cells exhibiting at least one characteristic of a cytotoxic T cell. Preferably, the T cells exhibiting at least one characteristic of a conventional T cell or a mixed population of T cells are derived from a biological sample from a subject with cancer or an infectious disease. Alternatively, the T cells may be derived from a histocompatible donor.
[0061] In another aspect, the present invention also relates to a composition of regulatory T cells, wherein more than 20% of the cells express the binding protein, chimera or fusion protein of the invention. Preferably, the composition comprises more than 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 or 99% of the cells expressing the binding protein, chimera or fusion protein of the invention.
[0062] In another aspect, the invention also relates to a composition of cytotoxic T cells, wherein more than 20% of the cells express the binding protein, chimera or fusion protein of the invention. Preferably, the composition comprises more than 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 or 99% of the cells expressing the binding protein, chimera or fusion protein of the invention.
[0063] In any aspect or embodiment, the conditions to allow for conversion of a conventional T cell or a mixed population of T cells into a regulatory T cell may include contacting the conventional T cell or the mixed population of T cells with one or more agents or increasing expression of one or more factors suitable for conversion of a conventional T cell into a regulatory T cell. The one or more agents or factors may include TGF-β, Foxp3, or an agent for increasing expression thereof.
[0064] In another aspect, the invention provides a method of treating or preventing an autoimmune disease in a subject, comprising administering to the subject a binding protein, chimeric or fusion protein, nucleic acid, cell, or composition of the invention, thereby treating or preventing an autoimmune disease in the subject.
[0065] In another aspect, the invention provides a method of treating or preventing transplant rejection in a subject, comprising administering to the subject a binding protein, chimeric or fusion protein, nucleic acid, cell, or composition of the invention, thereby treating or preventing transplant rejection in the subject.
[0066] In another aspect, the invention provides a method of treating or preventing cancer or an infectious disease in a subject, comprising administering to the subject a binding protein, chimeric or fusion protein, nucleic acid, cell, or composition of the invention, thereby treating or preventing cancer or an infectious disease in the subject.
[0067] In another aspect, the invention provides the use of a binding protein, chimeric or fusion protein, nucleic acid, cell, or composition of the invention in the manufacture of a medicament for treating or preventing an autoimmune disease in a subject.
[0068] In another aspect, the invention provides the use of a binding protein, chimeric or fusion protein, nucleic acid, cell or composition of the invention in the manufacture of a medicament for treating or preventing transplant rejection in a subject.
[0069] In another aspect, the invention provides the use of a binding protein, chimeric or fusion protein, nucleic acid, cell or composition of the invention in the manufacture of a medicament for treating or preventing cancer or an infectious disease in a subject.
[0070] In another aspect, the invention provides a binding protein, chimeric or fusion protein, peptide, cell, nucleic acid or composition of the invention for use in treating or preventing cancer or an infectious disease in a subject.
[0071] In another aspect, the invention provides a binding protein, chimeric or fusion protein, peptide, cell, nucleic acid, or composition of the invention for use in treating or preventing an autoimmune disease in a subject.
[0072] In another aspect, the invention provides a binding protein, chimeric or fusion protein, peptide, cell, nucleic acid, or composition of the invention for use in treating or preventing transplant rejection in a subject.
[0073] In another aspect, the invention provides a method for identifying a residue position in a CDR3 of a binding protein which, if a cysteine is present at that residue position, can form a disulfide bond with a cysteine present in a peptide / MHC, comprising: analyzing the TCR-peptide / MHC interface or the antibody or antigen-binding fragment thereof / MHC interface for one or more residues that are in close contact between the CDR3 and a cysteine residue in the peptide; mutating residues in CDR3 identified as being in close contact with cysteine residues in the peptide; The interatomic distance between the sulfur atom of the cysteine introduced into CDR3 and the sulfur atom of the cysteine in the peptide is between 0.01 and 3 Å (angstroms), and two sets of SSCs β determining that a disulfide bond is likely to form when the dihedral angle between planes passing through atoms (typically having S-S atoms) is less than 30° from either -87° or +97°; thereby identifying residue positions in the CDR3 of a binding protein which, if a cysteine is present at that residue position, can form a disulfide bond with a cysteine present in the peptide / MHC without structural rearrangement of the CDR3 or the peptide.
[0074] In this aspect, the binding protein can be any binding protein described herein.
[0075] In this aspect, the TCR-peptide / MHC interface, or the antibody or antigen binding fragment thereof / MHC interface, may be determined by any known means, such as X-ray crystallography or NMR, or from an in silico model of the interaction.
[0076] In this embodiment, the step of mutating residues in CDR3 identified as being in close contact with cysteines may be performed in silico.
[0077] In this embodiment, the method further comprises the step of confirming the formation of a disulfide bond between the CDR3 and the peptide, which comprises: providing a nucleic acid encoding a CDR3, preferably encoding a binding protein comprising a CDR3, introducing a cysteine at a residue position in the CDR3 of the binding protein which, if a cysteine is present at that residue position, can form a disulfide bond with a cysteine present in the peptide / MHC, producing a binding protein comprising a CDR3 with an introduced cysteine, providing the binding protein and peptide / MHC under conditions allowing disulfide bond formation; Determining the formation of disulfide bonds Further includes.
[0078] In this embodiment, the step of generating a binding protein comprising a CDR3 with an introduced cysteine can be performed by any method known in the art, including the methods described herein.
[0079] In another aspect, the invention provides a method of making a binding protein of the invention, or a chimeric or fusion protein as described herein, comprising culturing a cell comprising a nucleic acid or vector of the invention as described herein under conditions that allow expression of the binding protein of the invention, or a chimeric or fusion protein as described herein.
[0080] In another aspect, the invention provides a method of making a binding protein, or a chimeric or fusion protein, of the invention described herein, comprising the steps of: providing a nucleic acid encoding a CDR3, preferably encoding a binding protein, chimeric or fusion protein comprising a CDR3, introducing a cysteine at a residue position in the CDR3 of the binding protein, chimera or fusion protein which, if a cysteine is present at that residue position, can form a disulfide bond with a cysteine present in the peptide / MHC, Producing a binding protein, chimeric or fusion protein comprising a CDR3 with an introduced cysteine. The present invention provides a method comprising:
[0081] In this embodiment, the step of generating a binding protein, chimeric or fusion protein comprising a CDR3 with an introduced cysteine can be performed by any method known in the art, including the methods described herein. Additionally, the method may further comprise the step of purifying or isolating the binding protein.
[0082] In another aspect, the present invention provides a method for identifying a mutant TCR that has a reduced rate of dissociation from an HLA-bound target peptide (pHLA) compared to a non-mutated TCR, comprising: - generating a plurality of TCRs having a mutation that introduces a cysteine residue into the α chain CDR3 sequence and / or the β chain CDR3 sequence; - determining the interaction of members of said plurality of mutant TCRs with a target pHLA; and - selecting one or more members that have a reduced rate of dissociation from the target pHLA compared to the unmutated TCR; The present invention provides a method comprising:
[0083] In another aspect, the present invention provides a method for identifying a mutant TCR that has a reduced rate of dissociation from an HLA-bound target peptide (pHLA) compared to a non-mutated TCR, comprising: - generating a plurality of TCRs having a mutation that introduces a cysteine residue into the α chain CDR3 sequence and / or the β chain CDR3 sequence; - determining the interaction of members of said plurality of mutant TCRs with a target pHLA; and - selecting one or more members that have a reduced rate of dissociation to the target pHLA compared to the non-mutated TCR, wherein the reduced rate of dissociation is due to disulfide bond formation, - Optionally, checking the formation of a disulfide bond between the introduced cysteine residue and a cysteine in the target pHLA. The present invention provides a method comprising:
[0084] In one embodiment, the reduction in the rate of dissociation is at least 5, 10, or 20 fold.
[0085] In one embodiment, the dissociation rate between the TCR (mutated or not) and the pHLA is determined by a cell-based tetramer dissociation assay and / or a surface plasmon resonance assay.
[0086] In one embodiment, the peptide is a low abundance peptide. In another embodiment, the TCR before the introduction of a cysteine residue has an affinity for a given pHLA of 1 mM, 100 μM, 10 μM, 1 μM, or 100 nM or more. Introducing a cysteine may be desirable to enhance low affinity interactions or enhance high affinity interactions throughout this range.
[0087] As used herein, unless the context otherwise requires, the term "comprise" and conjugations of that term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additional elements, components, integers or steps.
[0088] Further aspects of the invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example and with reference to the accompanying drawings, in which: [Brief description of the drawings]
[0089] [Figure 1]TCR and peptide antigen sequences. (A) Details of the 6218, 6218αC and 6218βC TCRs. (B) Names and sequences of peptide antigens used in the figures. These peptide antigens bind to the mouse MHC class I protein H2-Db. [Diagram 2] Confirmation of disulfide bond formation using X-ray crystallography. (A) Superposition of three TCR-pMHC structures with the 6218 TCR-PA / H2-Db complex in pink, 6218 TCR-PA4C / H2-Db in gold, and 6218αC TCR-PA4C / H2-Db in purple. (B) Zoom-in view of the TCR-peptide interface with the addition of the PA4C / H2-Db structure with the peptide in light blue. (C) Top view of the H2-Db antigen-binding cleft in white schematic with the centers of mass (spheres) of each variable domain of the TCRs from the three complexes aligned in panel (A) (same color coding). (D) Structure of the 6218 TCR in complex with PA / H2-Db, showing the TCR and peptide in pink and the H2-Db in white. (E) Structure of 6218 TCR (gold) in complex with PA4C peptide (gold) presented by H2-Db (white). (F) Structure of 6218αC TCR (blue) in complex with PA4C / H2-Db (peptide in blue, MHC in white) showing disulfide bonds formed at the interface. (G) Superposition of 6218 TCR-PA / H2-Db (pink) and 6218αC TCR-PA4C / H2-Db (blue) complexes in the same orientation as in (D) and (F). [Diagram 3] Disulfide bond formation increases T cell sensitivity to peptide antigens. Supernatant IL-2 concentrations after 16 hours of co-culture of 5KC T cell line expressing CD8αβ and either 6218 TCR or 6218αC TCR with DC2.4 cell line with graded concentrations of PA4C peptide. Control cultures included 5KC cells with 50 μM PA4C peptide (T only), 5KC cells with DC2.4 cells without peptide (T+DC), and 5KC cells with plate-bound anti-CD3 (α-CD3). Symbols indicate the mean of two wells per condition, error bars indicate the range of two wells per condition. Data are representative of three separate experiments. [Figure 4] Assay for disulfide bonds between immobilized TCR and soluble peptide / MHC. (A) Surface plasmon resonance (SPR) sensorgrams of immobilized 6218 (black) or 6218αC (red) TCR exposed to sequentially injected PA4C / H2-Db at increasing concentrations. (B) Inhibition of persistent binding by reducing agent. PA4C / H2-Db monomers were incubated overnight in reducing agent (DTT) and then SPR analysis was performed as in (A). (C) Progression of disulfide bond formation over time. Immobilized 6218αC TCRs were first exposed to a 1 min injection of negative (irrelevant pMHC) and positive (PA / H2-Db) control pMHC monomers (not shown), followed by a 1, 5 or 20 min injection of PA4C / H2-Db, followed by a buffer injection. (D) Short half-life of the short-lived 6218αC TCR-PA4C / H2-Db complex. SPR data over a 12-second period spanning the transition from pMHC monomer to buffer injection. Some data points between -0.5 and 0 seconds are outside the limits of the y-axis. The sensorgrams are aligned such that the onset of measurable dissociation occurs at time = 0.1 seconds. Error bars indicate the range of two experiments for 6218 TCR-PA / H2-Db, three experiments for 6218 TCR-PA4C / H2-Db (two without DTT and one with DTT), and one experiment for 6218αC TCR-PA4C / H2-Db (with DTT). [Diagram 5]Exposed cysteines in CDR3 promote suprathreshold TCR signaling and T cell tolerance induction in the thymus. (A) Altered thymocyte development with Cys-containing CDR3. Pooled bone marrow (BM) cells from Rag1- / - mice (7 females and 6 males; 37-134 days old) were transduced with retroviruses encoding GFP and 6218, 6218αC or 6218βC TCRs, and the cells were then mixed 1:1 with T cell-depleted wild-type BM cells from male B6 mice before injection into irradiated Rag1- / - mice (3 females and 1 male for 6218; 4 females for 6218αC and 5 males for 6218βC). The resulting TCR retrogenic mice were analyzed 5 weeks after BM transfer, at ages 90-171 days. Plots show fluorescence activated cell sorting (FACS) phenotypes of live thymocytes analyzed for GFP / CCR7 (top) and GFP / TCRβ (bottom), with gates for GFP+TCRβ+ thymocytes analyzed for CD4 / CD8β (third row) and PD-1 / NK1.1 (fourth row). (B) Spleen-derived lymphocytes were phenotyped for GFP / TCRβ using a gate for the GFP+TCRβ+ subset (top), and the GFP+TCRβ+ subset was analyzed for a CD8α / CD8β phenotype (bottom). (C) Small intestine-derived CD45+ cells were phenotyped for GFP / TCRγδ using a gate for the GFP+TCRγδ- subset (top), and the GFP+TCRγδ- subset was analyzed for a CD8α / CD8β phenotype (bottom). Graphs show the percentage of gated events or the absolute number of gated events per mouse (#) calculated by multiplying the percentage of gated events by the total number of cells per organ. Each symbol in the graph represents one mouse, with the circle symbol representing 6218, the square symbol representing 6218αC, and the triangle symbol representing 6218βC. Statistical analysis was performed using one-way ANOVA with Tukey's multiple comparison test. [Figure 6]Exposed cysteines in CDR3 affect the abundance and distribution of developing T cells in the thymus. Immunofluorescence histology of thymus from TCR retrogenic mice expressing 6218 or 6218αC TCR. Thymic sections were stained for GFP and medullary portions were identified by staining for cytokeratin-14 (K14). Dashed lines demarcate the border between cortex (C) and medulla (M). Scale bar: 200 μm. TCR retrogenic mice were analyzed 5 weeks after bone marrow transfer at 99-138 days of age (n=4 for 6128; n=4 for 6218αC). Graphical overview (bottom) shows GFP+ cell density (number of GFP+ cells per section (top) or per mm2 (bottom)) in the cortical and medullary portions. Each symbol in the graph represents one mouse. Statistical analysis used unpaired two-tailed Student's t-test. [Figure 7] Cysteine residues do not affect the probability of binding of TCRs to closely related pMHC tetramers in cell-based tetramer staining assays. (A) Substitution at P7 of the PA4C peptide reduces TCR binding by pMHC tetramers. Plots show FACS phenotypes of TCR transfectants expressing 6218 or 6218αC TCR stained with anti-TCRβ and H2-Db tetramers complexed with the indicated peptides (top). Numbers on plots indicate tetramer mean fluorescence intensity (MFI) divided by TCRβ MFI, normalized to 6218 TCR-PA / H2-Db samples. (B) For the indicated TCR-peptide / H2-Db combinations (right), symbols show the average tetramer binding, calculated as in (A), as a function of Keq determined by surface plasmon resonance (SPR), with dotted lines connecting measurements from the same pMHC. Error bars indicate a range of 3 to 6 samples from 2 to 3 experiments (y-axis) or standard error of the mean from 2 experiments with a total of 4 samples per combination (x-axis). [Figure 8]Substitutions at P7 of the peptide affect the probability of TCR binding to pMHC monomers, regardless of the presence of a cysteine residue. SPR sensorgrams of immobilized 6218 TCR (black) or 6218αC TCR (red) exposed to increasing concentrations of soluble pMHC monomers, annotated on each graph. The sensorgrams in the left panel show the PA peptide and its variants without P4-Cys, while the sensorgrams on the right are for the PA4C peptide and its variants. The bottom panel is a table of KD values derived from the sensorgrams above. Pink arrows indicate the level of pMHC retention after injection, indicating disulfide bond formation. [Figure 9] Disulfide bond formation prevents dissociation of the TCR from peptide / MHC. (A) Disulfide bond formation proceeds over time. SPR sensorgrams show binding to 6218αC TCR by H2-Db monomer (100 μM) complexed with PA4C (red), PA4C7K (blue), or PA4C7A (gray) injected for 20 min, or PA4C7L (black) injected for 50 min, prior to buffer injection. (B) Disulfide bond formation inhibits tetramer dissociation. TCR transfectants expressing 6218 or 6218αC stained with pMHC tetramer as in Figure 7 were washed and resuspended in buffer containing 25 μg / mL anti-H2-Db / Kb to prevent tetramer reassociation for 10, 30, or 60 min prior to FACS analysis. The graph shows tetramer+ cell frequency as a percentage relative to the corresponding sample without anti-H2-Db / Kb at time = 0 min. Symbols indicate the mean of 4 samples per condition, compiled from 2 experiments, and error bars indicate the range of 4 samples per condition, compiled from 2 experiments. [Figure 10]Disulfide bond formation results in increased T cell sensitivity to peptide antigens and reduced discrimination of peptide antigens compared to non-covalent antigen recognition. (A) Supernatant IL-2 concentrations following co-culture of 5KC T cells expressing CD8αβ and either 6218 TCR or 6218αC TCR with DC2.4 cells with graded concentrations of the indicated peptides (indicated at the top left of each graph). Control cultures included 5KC cells and 50 μM peptide (T only), 5KC cells and DC2.4 cells without peptide (T+DC), and 5KC cells and plate-bound anti-CD3 (α-CD3). Symbols indicate the mean of two wells per condition from one experiment, error bars indicate the range of two wells per condition from one experiment, and are representative of at least two experiments. Hill slope (h) values were determined using non-linear regression. For curves that did not reach a plateau, the reported EC50 values indicate the minimum estimate of the EC50. Data are shown as in Figure 3 and are representative of two separate experiments. (B) For each TCR / peptide combination, graphs show relative tetramer binding (x-axis) plotted against EC50 (left) or time (right) values determined from a total of at least four dilution series per peptide analyzed in at least two experiments. Error bars indicate 95% confidence intervals for EC50 and time, and dotted lines connect measurements from the same pMHC. [Figure 11] Distribution of engineerable disulfide bonds in TCR-peptide / MHCI complexes. The panels summarize the results of the analysis of TCR-peptide / MHCI complexes shown in Table 3, which shows the total number of distinct high-fidelity engineerable TCR-peptide bonds involving the TCR α chain (above the x-axis) or the TCR β chain (below the x-axis), with each graph representing a given position in the peptide (shown above the graph). [Figure 12]Distribution of engineerable disulfide bonds in TCR-peptide / MHCII complexes. The panels summarize the results of the analysis of TCR-peptide / MHCII complexes shown in Table 4, which shows the total number of distinct high-fidelity engineerable TCR-peptide bonds involving the TCR α chain (above the x-axis) or the TCR β chain (below the x-axis), with each graph representing a given position in the peptide (shown above the graph). [Figure 13] Role of Zap70 and MHC in cysteine-ligated T cell fate bias. (A) Attenuation of TCR signaling prevents the effect of Cys-containing CDR3 on T cell fate. Pooled bone marrow (BM) cells from Zap70mrd / mrt mice (11 females and 9 males; 33-60 days old) were transduced with retroviruses encoding GFP and 6218, 6218αC or 6218βC TCRs, and the cells were then injected into irradiated male Zap70mrd / mrt mice. Spleen cells from TCR retrogenic mice were analyzed for GFP / TCRβ phenotype using a gate on GFP+TCRβ+ cells. Graph shows absolute number of GFP+TCRβ+ spleen cells, with each symbol representing one mouse: 6218 (circle symbols), 6218αC (square symbols), 6218βC (triangle symbols). (B) Differential expression of Cys-containing CDR3s in polyclonal T cell subsets requires robust TCR signaling in response to pMHC ligands. Sorted preselected thymocytes, intestinal CD8ααIELs, splenic CD4+ T-conv and splenic CD8+ T-conv populations were analyzed by TCR sequencing. Graphs show the percentage of unique TCRα (○) or TCRβ (×) sequences with a Cys within 2 positions from the central CDR3 amino acid (cysteine index), and each symbol on the graph represents a sample from one mouse: left panel, wild-type (n=11; 6 females and 5 males, aged 45-133 days); middle panel, Zap70mrd / mrt mice (n=3; aged 37-74 days); right panel, B2m- / -H2-A- / - mice (n=1 female and 4 males, aged 98-140 days). p values in the left panel were determined using two-way ANOVA with Sidak's multiple comparison test. [Figure 14]Context-dependent effect of Cys on TCR-pMHC binding. TCR transfectants expressing mouse CD3, GFP, and 6218, 6218αC, or 6218βC TCR were incubated with anti-TCRβ and tetramers of H2-Db presenting the indicated PA or PA4C peptides (left). FACS plots show tetramer staining versus TCRβ expression in live GFP+TCRβ+ cells. Data are representative of six experiments for cells expressing 6218 TCR or 6218αC TCR, and one experiment for cells expressing 6218βC TCR. [Figure 15] Generation of CD4+ T cell hybridomas that bind to the α3 / DR15 antigen as demonstrated by staining for the α3 / DR15-APC tetramer. FACS plot shows tetramer staining versus CD4+ expression in hybridoma cells. [Figure 16] T cell activation assay using LS1 hybridoma to identify reactivity to variants of α3 peptide with cysteine substitutions at TCR exposed positions. (A) Histograms show fluorescein signal in LS1 hybridoma cells incubated for 16 hours with CellTrace Violet (CTV)-labeled splenocytes from naive DR15 transgenic Fcgr2b− / − mice in the absence or presence of the peptide named above each histogram (50 μg / mL). (B) FACS dot plots show fluorescein (x-axis) versus side scatter (y-axis) in LS1 hybridoma cells incubated for 16 hours with CTV-labeled bone marrow-derived dendritic cells from naive DR15 transgenic Fcgr2b− / − mice in the absence or presence of the peptide named above each histogram (50 μg / mL). [Figure 17] Details of the variable (TRAV / TRBV) and joining (TRAJ / TRBJ) gene segments and CDR3 amino acid sequences of the TCR α and TCR β chains expressed by the LS1 T cell hybridoma. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0090] It will be understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or apparent from the text or drawings, all of which different combinations constitute various alternative aspects of the invention.
[0091] Further aspects of the invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example and with reference to the accompanying drawings, in which:
[0092] Certain specific embodiments of the present invention will now be described in detail. While the present invention will be described in conjunction with the embodiments, it will be understood that the intention is not to limit the present invention to these embodiments. Rather, the present invention is intended to encompass all alternatives, modifications, and equivalents that may be included within the scope of the present invention as defined by the claims.
[0093] T cell activation depends on the simultaneous recognition of T cell antigen receptors (TCRs) of peptide antigens presented by major histocompatibility complex (MHC) molecules on the surface of antigen presenting cells (APCs). We have found that TCR-peptide disulfide bonds stabilize the interaction between TCRs and their peptide / MHC ligands. We have shown this using both cell-bound and soluble TCRs. Considering two interactions with a high probability of TCR binding to pMHC but distinguished by their ability to form disulfide bonds, the interaction that allows disulfide bond formation can promote T cell activation at a lower concentration of peptide than the interaction that does not allow disulfide bond formation. Furthermore, considering two interactions with a low probability of TCR binding to pMHC but distinguished by their ability to form disulfide bonds, the interaction that allows disulfide bond formation can promote T cell activation, whereas the interaction that does not allow disulfide bond formation cannot promote T cell activation.
[0094] TCR gene therapy provides patients with T cells that have been genetically engineered to express a desired TCR. Thus, the use of engineered TCRs that form disulfide bonds with naturally expressed peptides enhances conventional TCR gene therapy of T cells for cancer (TCR-T cell therapy) (1) and TCR gene therapy of regulatory T cells for autoimmune diseases (TCR Treg therapy) (2). This is because the longevity of the interaction between the TCR and peptide / MHC is no longer a limiting factor for TCR gene therapy. Furthermore, a new field of lower abundance peptides may become an accessible target for TCR gene therapy.
[0095] An important advantage of TCR-peptide disulfide bonds is the long half-life of TCR-peptide / MHC interactions, which overcomes a major challenge of TCR gene therapy, i.e., achieving sufficient persistence of the TCR / peptide-MHC recognition unit to induce T cell activation. An important consequence is that disulfide-competent T cells can be activated by disulfide-competent peptides with low expression levels, which opens up a new field of peptides for T cell recognition.
[0096] Cysteine engineered TCRs may enable T cell recognition of antigens that could not previously be targeted by TCR-T cell therapy, e.g., antigens with low expression or low presentation to T cells by MHC, peptides presented by non-classical MHC (e.g. HLA-E, HLA-F).
[0097] TCR gene therapy provides patients with autologous T cells that are genetically engineered to express desired αβTCR.TCR gene therapy can be used to treat cancer.TCR gene therapy of regulatory T cells has potential as a treatment for autoimmune disease.It is envisioned that TCR gene therapy using disulfide-capable TCR can allow T cell stimulation with low-abundance peptides that cannot otherwise stimulate T cells.
[0098] General Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a singular step, composition, step, or composition shall be understood to include one and more (i.e., one or more) such steps, compositions, steps, or compositions. Thus, as used herein, the singular forms "a," "an," and "the" include plural aspects, and vice versa, unless the context clearly dictates otherwise. For example, reference to "a" includes the singular and more than one, reference to "an" includes the singular and more than one, reference to "the" includes the singular and more than one, etc.
[0099] Those skilled in the art will understand that the present invention is capable of variations and modifications other than those specifically described. It should be understood that the present invention includes all such variations and modifications. The present invention also includes all steps, features, compositions, and compounds individually or collectively referred to or shown in this specification, and any combination of any two or more of said steps or features.
[0100] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention, and the present invention is in no way limited to the methods and materials described.
[0101] All patents and publications mentioned herein are incorporated by reference in their entirety.
[0102] The present invention is not to be limited in scope by the specific examples described herein, which are intended for the purpose of illustration only. Functionally equivalent products, compositions, and methods are clearly within the scope of the invention.
[0103] Any example or embodiment of the invention herein shall be understood to apply mutatis mutandis to any other example or embodiment of the invention, unless specifically stated otherwise.
[0104] Unless specifically defined otherwise, all technical and scientific terms used herein shall be understood to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).
[0105] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in this disclosure are standard procedures, well known to those skilled in the art. Such techniques are described in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), TA Brown (ed.), Essential Molecular Biology: A Practical Approach, vols. 1 and 2, IRL Press (1991), DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, vols. 1-4, IRL Press (1995 and 1996), and FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all current editions), Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and JE Coligan et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all current editions), These are described and explained throughout the literature in such sources as Protocols in Immunology, John Wiley & Sons (including all current editions).
[0106] The descriptions and definitions of variable regions and portions thereof, T-cell receptors and fragments thereof herein may be further clarified by the discussions in Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., 1987 and 1991, Bork et al., J Mol. Biol. 242, 309-320, 1994, Chothia and Lesk J. Mol Biol. 196:901-917, 1987, Chothia et al., Nature 342, 877-883, 1989, and / or Al-Lazikani et al., J Mol Biol 273, 927-948, 1997.
[0107] The term "and / or," e.g., "X and / or Y," shall be understood to mean either "X and Y" or "X or Y," and shall be understood to provide explicit support for both meanings or either meaning.
[0108] As used herein, the term "derived from" shall be understood to indicate that a specified integer can be obtained, although not necessarily directly, from a particular source.
[0109] References herein, for example to ranges of residues, will be understood to be inclusive, e.g., reference to "a region comprising amino acids 1-15" will be understood to be inclusive, i.e., the region includes the sequence of amino acids numbered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15 in the specified sequence.
[0110] The term "consisting essentially of" limits the scope of a claim to the specified materials or steps, or to materials or steps that do not materially affect the essential characteristics of the claimed invention. For example, a protein domain, region, or module (e.g., a binding domain, hinge region, linker module) or protein (which may have one or more domains, regions, or modules) "consists essentially of" a particular amino acid sequence (e.g., amino acids at the amino or carboxy termini, or between domains) if the amino acid sequence of the domain, region, module, or protein contains extensions, deletions, mutations, or combinations thereof that together contribute up to 20% (e.g., up to 15%, 10%, 8%, 6%, 5%, 4%, 3%, 2% or 1%) of the length of the domain, region, module, or protein and do not substantially affect (i.e., do not reduce) the activity of the domain, region, module, or protein (e.g., the target binding affinity of a binding protein).
[0111] As used herein, "nucleic acid" or "nucleic acid molecule" refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, such as fragments generated by polymerase chain reaction (PCR) or in vitro translation, and fragments generated by either ligation, cleavage, endonuclease, or exonuclease action. In certain embodiments, the nucleic acids of the present disclosure are generated by PCR. Nucleic acids may be composed of monomers that are naturally occurring nucleotides (e.g., deoxyribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., a-enantiomeric forms of naturally occurring nucleotides), or combinations of both. Modified nucleotides can have modifications or replacements of sugar moieties, or pyrimidine or purine base moieties. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates, phosphoroanilidates, phosphoramidates, etc. Nucleic acid molecules can be single-stranded or double-stranded.
[0112] The term "isolated" means that a material is removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring nucleic acid or polypeptide present in a living animal is not isolated, but the same nucleic acid or polypeptide separated from some or all of the coexisting materials in the natural system is isolated. Such a nucleic acid can be part of a vector and / or such a nucleic acid or polypeptide can be part of a composition (e.g., a cell lysate) and is still isolated in that such a vector or composition is not part of the natural environment of the nucleic acid or polypeptide. The term "gene" refers to a segment of DNA involved in producing a polypeptide chain, including the regions preceding and following the coding region "leader and trailer", as well as the intervening sequences (introns) between individual coding segments (exons).
[0113] As used herein, the term "recombinant" refers to a cell, microorganism, nucleic acid molecule, or vector that has been genetically engineered by human intervention, i.e., modified by the introduction of an exogenous or heterologous nucleic acid molecule, or to a cell or microorganism that has been altered so that the expression of an endogenous nucleic acid molecule or gene is controlled, deregulated, or constitutive. Human-produced genetic modifications can include, for example, modifications that introduce a nucleic acid molecule (which may include expression control elements, such as a promoter) that encodes one or more proteins or enzymes, or the addition, deletion, substitution, or other functional disruption or addition of other nucleic acid molecules to the genetic material of a cell. Exemplary modifications include modifications in the coding region of a heterologous or homologous polypeptide or functional fragment thereof from a reference or parent molecule.
[0114] "Conservative substitution" is recognized in the art as the substitution of one amino acid with another amino acid with similar properties.Exemplary conservative substitutions are well known in the art (see, for example, WO97 / 09433, p. 10; Lehninger, Biochemistry, 2nd ed.; Worth Publishers, Inc. NY, NY, p. 71-77, 1975; Lewin, Genes IV, Oxford University Press, NY and Cell Press, Cambridge, MA, p. 8, 1990).
[0115] Binding Proteins "Binding protein," as used herein, refers to a proteinaceous molecule or portion thereof (e.g., peptide, oligopeptide, polypeptide, protein) capable of specifically and non-covalently associating with, combining with, or combining with a target (e.g., a protein, peptide or fragment thereof, peptide-MHC complex). Binding proteins may be purified, substantially purified, synthetic, or recombinant. Exemplary binding proteins include single chain immunoglobulin variable regions (e.g., scTCR, scFv).
[0116] In certain embodiments, any of the binding proteins of the present invention is a T cell receptor (TCR), a chimeric antigen receptor, or an antigen-binding fragment of a TCR, each of which may be chimeric, humanized, or human. In any embodiment, the binding protein may be a chimeric or fusion protein. In further embodiments, the antigen-binding fragment of a TCR comprises a single chain TCR (scTCR) or a chimeric antigen receptor (CAR). In certain embodiments, the binding protein is a TCR.
[0117] "T cell receptor" (TCR) refers to an immunoglobulin superfamily member (having a variable binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail; see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd ed., Current Biology Publications, p. 4:33, 1997) that can specifically bind to an antigenic peptide bound by an MHC receptor. TCRs may be found on the surface of cells or in soluble form and are generally composed of heterodimers with α (alpha) and β (beta) chains (also known as TCRα and TCRβ, respectively), or γ and δ chains (also known as TCRγ and TCRδ, respectively). Like immunoglobulins, the extracellular portion of a TCR chain (e.g., α chain, β chain) consists of two immunoglobulin domains: a variable domain at the N-terminus (e.g., α chain variable domain or Vα, β chain variable domain or Vβ; typically amino acids 1-116 according to Kabat numbering in Kabat et al., "Sequences of Proteins of Immunological Interest," US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5th ed.) and one constant domain adjacent to the cell membrane (e.g., α chain constant domain or C α, typically amino acids 117-259 according to Kabat, and a β-chain constant domain or Cβ, typically amino acids 117-295 according to Kabat). Also, similar to immunoglobulins, the variable domains contain complementarity determining regions (CDRs) separated by framework regions (FRs) (see, e.g., Jores et al., Proc. Nat'l. Acad. Sci. USA 57:9138, 1990; Chothia et al., EMBO J. 7:3745, 1988; see also Lefranc et al., Dev. Comp. Immunol. 27:55, 2003). In certain embodiments, the TCR is found on the surface of a T cell (or T lymphocyte) and is associated with the CD3 complex. The source of the TCR used in this disclosure can be various animal species, e.g., human, mouse, rat, rabbit, or other mammals. The TCRs referred to herein can be cell-bound TCRs or soluble TCRs. The cell-bound or soluble TCR may be part of a chimeric or fusion protein.
[0118] For MHCCI, pockets A-F are defined in Young et al., FASEB J (1995): 9, 26-36. For MHCII, pockets 1-9 in MHCII are named for the residues of the peptides they contain. See, e.g., Rammensee et al., Curr Opin Immunol (1995): 7: 85-96.
[0119] Methods useful for isolating and purifying recombinantly produced soluble TCRs (which may be part of a chimeric or fusion protein) may include, by way of example, obtaining the supernatant from a suitable host cell / vector system that secretes the recombinant soluble TCR into the culture medium, followed by concentrating the medium using a commercially available filter. After concentration, the concentrate may be applied to a suitable purification matrix or a series of suitable matrices, such as affinity matrices or ion exchange resins. One or more reverse phase HPLC steps may be used to further purify the recombinant polypeptide. These purification methods may also be used when isolating immunogens from their natural environment. Methods for large-scale production of one or more isolated / recombinant soluble TCRs described herein include batch cell cultures that are monitored and controlled to maintain appropriate culture conditions. Purification of soluble TCRs may be performed according to methods described herein and known in the art.
[0120] The binding proteins or domains described herein can be functionally characterized according to any of a number of art-accepted methodologies for assaying T cell activity, including determining T cell binding, activation, or induction, including determining T cell responses that are antigen-specific. Examples include determining T cell proliferation, T cell cytokine release, antigen-specific T cell stimulation, MHC-restricted T cell stimulation, CTL activity (e.g., by detecting Cr release from preloaded target cells), changes in T cell phenotypic marker expression, and other indicators of T cell function. Procedures for performing these and similar assays can be found, for example, in Lefkovits (Immunology Methods Manual: The Comprehensive Sourcebook of Techniques, 1998). See also Current Protocols in Immunology; Weir, Handbook of Experimental Immunology, Blackwell Scientific, Boston, MA (1986); Mishell and Shigii (eds.) Selected Methods in Cellular Immunology, Freeman Publishing, San Francisco, CA (1979); Green and Reed, Science 281:1309 (1998), and references cited therein.
[0121] As used herein, MHC and HLA are used interchangeably and all instances of HLA can be substituted for MHC. Mouse MHC is also called H2.
[0122] In any aspect or embodiment, a cysteine is introduced into a CDR (e.g., of a binding protein, or of a variable domain of a chimeric or fusion protein) by mutation or modification of an existing residue. In other words, the native amino acid at a particular position may not be a cysteine, but the native amino acid is mutated to a cysteine residue or modified in any manner that allows the residue to form a disulfide bond with a cysteine present in the peptide bound to the HLA molecule. Exemplary methods are described herein, e.g., in the Examples, which describe mutating a nucleotide sequence at the relevant position that encodes a variable domain of a binding protein, or of a chimeric or fusion protein, to encode a cysteine residue. When a cysteine is introduced, e.g., by mutation or modification, it may be referred to as a non-native cysteine, and any binding protein, chimeric or fusion protein that contains an introduced cysteine may be referred to as a binding protein, chimeric or fusion protein that includes a non-native cysteine.
[0123] A protein disulfide bond is a covalent link between the sulfur atoms of the thiol groups (-SH) of two cysteine residues. A disulfide (also called an S-S bond, disulfide bridge, or bridge) is formed by the oxidation of two thiols, thus linking two cysteines and their respective peptide backbones by a covalent disulfide bond.
[0124] The binding protein may comprise any amino acid sequence, for example any CDR1, CDR2 or CDR3 amino acid sequence of Vα and / or Vβ as described herein, for example in the Examples and in Figure 17. Preferably, the binding protein contains a cysteine residue introduced into the CDR by mutation or modification of an existing residue.
[0125] Adoptive Cell Therapy / Engineered Cells The invention provides methods of preparing cells for adoptive cell therapy, methods of using the cells to treat or prevent a disease or condition described herein in a subject, and the cells themselves.
[0126] In certain embodiments, nucleic acid molecules encoding the binding proteins, or chimeric or fusion proteins of the invention are used to transfect / transduce host cells (e.g., CD8+ T cells, Treg cells) for use in adoptive transfer therapy.
[0127] In an alternative embodiment, one or more peptides of the present invention are used to activate and / or expand a population of T cells to generate T cells with specificity for the peptide (e.g., CD8+ T cells, Treg cells).
[0128] Advances in TCR sequencing have been described (e.g., Robins et al., Blood 114:4099, 2009; Robins et al., Sci. Translat. Med. 2:47ra64, 2010; Robins et al., (September 10) J. Immun. Meth. Epub ahead of print, 2011; Warren et al., Genome Res. 21:790, 2011) and may be used in the course of practicing embodiments according to the present disclosure. Similarly, methods for transfecting / transducing T cells with a desired nucleic acid have been described (e.g., U.S. Patent Application Publication No. 2004 / 0087025), including adoptive transfer procedures using T cells of a desired antigen specificity (e.g., Schmitt et al., Hum. Gen. 20:1240, 2009; Dossett et al., Mol. Ther. 77:742, 2009; Till et al., Blood 772:2261, 2008; Wang et al., Hum. Gene Ther. 75:712, 2007; Kuball et al., Blood 709:2331, 2007; US2011 / 0243972; US2011 / 0189141; en et al., Ann. Rev. Immunol. 25:243, 2007), therefore, the adaptation of these methodologies to embodiments of the present disclosure is contemplated based on the teachings herein, including those directed to the binding proteins of the present invention.
[0129] The T cells may be selected from the group consisting of tumor infiltrating lymphocytes genetically engineered to express a T cell receptor or chimeric antigen receptor (CAR), peripheral blood lymphocytes, γδ T cells enriched using mixed lymphocyte tumor cell cultures (MLTC) or cloned using autologous antigen presenting cells and tumor-derived peptides. The lymphocytes may be isolated from a histocompatible donor or the subject.
[0130] CD8+ T cells can be obtained using conventional cell sorting techniques that can be used to identify and separate T cells based on T cell surface markers and obtain an isolated population of CD8+ T cells for use in the compositions and methods of the invention. For example, a biological sample containing blood and / or peripheral blood lymphocytes can be obtained from an individual and CD8+ T cells can be isolated from the sample using commercially available devices and reagents, thereby obtaining an isolated population of CD8+ T cells.
[0131] Human CD8+ T cell types and / or populations can be identified using the phenotypic cell surface markers CD62L, CCR7, CD27, CD28 and CD45RA or CD45RO. As used herein, CD8+ T cell types and / or populations have the following characteristics or patterns of expression of cell surface markers: naive T cells are characterized as CD45RA+, CD27+, CD28+, CD62L+ and CCR7+, CD45RO+ central memory T cells are CD45RA-, CD27+, CD28+, CD62L+ and CCR7+, CD45RO+ effector memory T cells are defined by the lack of expression of these five markers (CD45RA-, CD27-, CD28-, CD62L- and CCR7-), and terminally differentiated effector memory CD45RA+ T cells are characterized as CD45RA+, CCR7-, CD27-, CD28-, CD62L-. Terminally differentiated effector memory cells further upregulate markers such as CD57, KLRG1, CX3CR1, and exhibit potent cytotoxic properties characterized by the ability to produce high levels of granzymes A and B, perforin, and IFNγ. Thus, various populations of T cells can be separated from other cells and / or from each other based on the expression or lack of expression of these markers.
[0132] Different CD8+ T cell types may also exhibit specific functions including, for example, secretion of IFN-γ, secretion of IL-2, production of Granzyme B, expression of FasL, and expression of CD107. However, while the expression patterns of cell surface markers are believed to be characteristic of each particular CD8+ T cell type and / or population described herein, the functional attributes of each cell type and / or population may vary depending on the amount of stimulation the cells receive.
[0133] A population of cells containing cytotoxic or regulatory T (Treg) cells can be derived from any source in which cytotoxic or Treg cells exist, such as peripheral blood, thymus, lymph nodes, spleen, and bone marrow.
[0134] The population of cells comprising Treg cells may also be derived from a mixed population of T cells or a population of conventional T cells. As described herein, the mixed population or conventional T cells may be contacted with a desired peptide / MHC ligand to enhance the antigen specificity of the T cells. Alternatively, the mixed population or conventional T cells may be transduced with a nucleic acid encoding a binding protein of the invention. The T cells may then be converted to Treg cells using standard techniques known to those skilled in the art for the generation of Treg cells. In certain embodiments, the mixed population of T cells or conventional T cells are cultured in conditions that allow for increased expression of TGF-beta and Foxp3. This includes culturing the cells with anti-CD3 / anti-CD28 antibodies, inhibition of CDK8 / 19, high doses of IL-2, TGF-beta, and rapamycin. In further embodiments, the population of converted or enhanced Treg cells is stabilized (e.g., by contacting the cells with vitamin C or other agents to stabilize Tregs).
[0135] The Treg cells used for infusion (or indeed the mixed population of Tconv or T cells used to generate Tregs) can preferably be isolated from an HLA-matched allogeneic donor, or from a subject diagnosed with a condition associated with an aberrant, unwanted, or otherwise inappropriate immune response to self-proteins.
[0136] T cells may also be generated from differentiation of induced pluripotent cells (iPSCs) or embryonic stem cells, preferably embryonic stem cell lines. Those skilled in the art will be familiar with standard techniques for generating Treg cells from stem cells, including iPSCs. Examples of these techniques are described in Hague et al., (2012) J. Immunol., 189: 2338-36, and Hague et al., (2019) JCI Insight, 4: pii 126471).
[0137] Furthermore, in the context of a mixed population of T cells, one of skill in the art would be familiar with standard techniques for isolating a subpopulation of T cells that are CD4+CD25+ T cells (Treg cells). For example, CD4+CD25+ T cells (Treg cells) can be obtained from a biological sample from a subject by negative and positive immunoselection and cell sorting.
[0138] In any of the methods of the present invention, the Treg cells cultured in the presence of the nucleic acid or vector can be transferred to the same subject from which the cells were obtained. In other words, the cells used in the methods of the present invention can be autologous cells, i.e., can be obtained from the subject in which the medical condition is to be treated or prevented. Alternatively, the cells can be allogeneically transferred to another subject. Preferably, the cells are autologous to the subject in the method of treating or preventing a medical condition in the subject.
[0139] As used herein, the term "ex vivo" or "ex vivo therapy" refers to a therapy in which cells are obtained from the patient or a suitable alternative source, such as a suitable allogeneic donor, and modified, such that the modified cells can be used to treat a disease that may be ameliorated by the therapeutic benefit provided by the modified cells. Treatment involves the administration or reintroduction of the modified cells into the patient. The benefit of ex vivo therapy is that the benefit of the treatment can be provided to the patient without exposing the patient to undesirable collateral effects from the treatment.
[0140] The term "administered" refers to the administration of a therapeutically effective dose of the above-mentioned composition comprising the respective cells to an individual. A "therapeutically effective amount" refers to a dose that produces the effect for which it is administered. The exact dose may depend on the purpose of the treatment and may be ascertained by one of ordinary skill in the art using known techniques. As known in the art and described above, adjustments to systemic versus local delivery, age, weight, general health, sex, diet, time of administration, drug interactions, and severity of the condition may be required and may be ascertained by one of ordinary skill in the art through routine experimentation.
[0141] An "enriched" or "purified" population of cells is an increase in the ratio of a particular cell to other cells, e.g., compared to the cells as found in a subject's body or compared to the ratio before exposure to a peptide, nucleic acid, or vector of the invention. In some embodiments, in an enriched or purified population of cells, a particular cell comprises at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95% or 99% of the total cell population. A population of cells may be defined by one or more cell surface markers and / or characteristics.
[0142] The Treg cells expressing the binding protein or chimeric or fusion protein of the present invention can be administered to the subject by any method, including, for example, injection, infusion, deposition, implantation, oral ingestion, or topical administration, or any combination thereof. The injection can be, for example, intravenous, intramuscular, intradermal, subcutaneous, or intraperitoneal, preferably intravenous injection. Single or multiple doses can be administered over a given period of time depending on the condition, its severity, and the overall health of the subject, which can be determined by one of skill in the art without undue experimentation. Injections can be performed at multiple sites.
[0143] Treg cells can be administered alone or in combination with other therapeutic agents. Each dose is about 10×10 3 CD8+ T cells, 20×10 3 cells, 50 x 10 3 cells, 100 x 103 cells, 200 x 10 3 cells, 500 x 10 3 cells, 1 x 10 6 cells, 2 x 10 6 cells, 20 x 10 6 cells, 50 x 10 6 cells, 100 x 10 6 cells, 200 x 10 6 , 500×10 6 , 1×10 9 cells, 2 x 10 9 cells, 5 x 10 9 cells, 10 x 10 9 The frequency of administration can be, for example, once a week, twice a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, etc. The total number of days over which administration is performed can be 1 day, 2 days, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, etc. It is understood that any given administration can involve two or more injections on the same day. With respect to administration, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% of the administered Treg cells exhibit at least one characteristic of Treg cells.
[0144] peptide As described herein, the binding proteins, chimeras or fusion proteins of the invention may bind to peptides bound to MHC molecules, preferably HLA molecules. The peptides may be endogenous or exogenous, i.e. self or non-self. The peptides include any of the peptides mentioned herein, where a cysteine residue is present or where a cysteine is introduced at a designated position that allows the formation of a disulfide bond with the cysteine in the binding proteins of the invention.
[0145] A low abundance peptide is one that fails to detectably affect the number or differentiation state of T cells that specifically bind to a peptide / MHC complex. The peptide may be endogenous or exogenous. Endogenous peptides may be any described herein, including tumor antigens. The T cell population may be described as "unaware" of the low abundance peptide. In the mouse thymus, recognized low abundance peptides were found to be expressed on 0.003%-0.015% of EpCAM+ epithelial cells and 0.0003%-0.001% of dendritic cells.
[0146] MHC class I and II proteins are important in the adaptive immune system. Both classes of proteins share the task of presenting peptides on their surface for recognition by T cells. MHC class I peptide complexes are presented on nucleated cells and recognized by cytotoxic CD8+ T cells. In contrast, MHC class II peptide complexes are present on the surface of professional antigen-presenting cells such as dendritic cells, macrophages, or B cells, and act to activate CD4+ T cells, leading to the coordination and regulation of effector functions.
[0147] Major histocompatibility complexes class I and class II share a similar overall fold. The binding platform consists of two domains originating from a single α-heavy chain (HC) in the case of MHC class I, and two chains (α and β) in the case of MHC class II. The two domains have a curved β-sheet as a base and two upper α-helices separated enough to accommodate a peptide chain between them. Two membrane-proximal immunoglobulin (Ig) domains support the peptide-binding unit. One Ig domain is present in each chain of MHC class II, while the second Ig-type domain of MHC class I is provided by the non-covalent association of the constant light chain beta-2 microglobulin (β2m) with the HC. Transmembrane helices anchor both the HC of MHC class I and the chains of MHC class II to the membrane.
[0148] The groove between the two helices accommodates peptides based on (i) the formation of a set of conserved hydrogen bonds between the side chains of the MHC molecule and the backbone of the peptide, and (ii) the occupation of a defined pocket by the peptide side chains (anchor residues P2 or P5 / 6 and PΩ in MHC class I, and P1, P4, P6, and P9 in MHC class II). The type of interaction between individual peptide side chains and the MHC depends on the geometry, charge distribution, and hydrophobicity of the binding groove.
[0149] Non-limiting examples of HLA class I molecules include HLA-C*07:01, HLA-A*2402, HLA-A*2, HLA-A*24, HLA-A*02:01, HLA-B*07:02, HLA-B*44:05, HLA-B*35:01, HLA-A*01:01, HLA-B*37:01, HLA-B*08:01, HLA-A*11:01, HLA-B*08:01, HLA-B*27:05, HLA-B*35:08, HLA-A*24:02, HLA-B*51:01, and HLA-E*01:03.
[0150] Non-limiting examples of HLA class II molecules include HLA-DQA1*0508_HLA-DQB1*0201, HLA-DQA1*0501_HLA-DQB1*0201, HLA-DQA1*0301_HLA-DQB1*0302, HLA-DRA*0101_HLA-DBR1*0101, HLA-DRA*0101_HLA-DRB3*0301, HLA-DRA*0101_HLA-DBR5*0101, HLA-DRA*0101_HLA-DB R1*0401, HLA-DPA1*0103_HLA-DPB1*2602, HLA-DQA1*0501_HLA-DQB1*0302, HLA-DRA*0101_HLA-DRB1*1101, HLA-DRA*0101 Examples include _HLA-DRB1*1502, HLA-DRA*0101_HLA-DRB1*0101, HLA-DQA1*0301_HLA-DQB1*0305, and HLA-DQA1*0201_HLA-DQB1*0201.
[0151] Reference to "peptide" includes reference to a peptide, polypeptide, or protein, or portions thereof. A peptide may be glycosylated or non-glycosylated and / or may contain a wide variety of other molecules fused, linked, conjugated, or otherwise associated with the protein, such as amino acids, lipids, carbohydrates, or other peptides, polypeptides, or proteins. Hereinafter, reference to "peptide" includes peptides comprising a series of amino acids, and peptides that are associated with other molecules, such as amino acids, lipids, carbohydrates, or other peptides, polypeptides, or proteins.
[0152] "Derivatives" include fragments, parts, portions, and variants from natural, synthetic, or recombinant sources, including fusion proteins. Parts or fragments include, for example, active regions of the peptide of interest. Derivatives may result from amino acid insertions, deletions, or substitutions. Amino acid insertion derivatives include amino and / or carboxyl terminal fusions, as well as intrasequence insertions of single or multiple amino acids. Insertion amino acid sequence variants are those in which one or more amino acid residues are introduced at a predetermined site in the protein, although random insertion with suitable screening of the resulting product is also possible. Deletion variants are characterized by the removal of one or more amino acids from the sequence.
[0153] Substitutional amino acid variants are those in which at least one residue in a sequence is removed and a different residue is inserted in its place. One example of a substitutional amino acid variant is a conservative amino acid substitution. Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Additions to amino acid sequences include fusions with other peptides, polypeptides or proteins. In one embodiment, a cysteine residue is replaced with a serine, as exemplified herein.
[0154] Chemical and functional equivalents of the subject peptides should be understood as molecules that exhibit any one or more of the functional activities of these molecules, which may be derived from any source, such as chemically synthesized or identified via a screening process, such as natural product screening.
[0155] Analogs contemplated herein include, but are not limited to, modifications to the side chains, the incorporation of unnatural amino acids and / or their derivatives during peptide, polypeptide or protein synthesis, and the use of cross-linking agents and other methods to impose conformational constraints on a proteinaceous molecule or its analog.
[0156] Examples of side chain modifications contemplated by the present invention include reductive alkylation by reaction with an aldehyde followed by reduction with NaBH4; amidination with methyl acetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2,4,6-trinitrobenzenesulfonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and modification of amino groups by pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH4, and the like.
[0157] The guanidine groups of arginine residues can be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal, and glyoxal. Carboxyl groups can be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivatization, for example, to the corresponding amide. Sulfhydryl groups can be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of mixed disulfides with other thiol compounds; reaction with maleimide, maleic anhydride, or other substituted maleimides; formation of mercuric derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulfonic acid, phenylmercuric chloride, 2-chloromercuri-4-nitrophenol, and other mercuric preparations; carbamoylation with cyanate at alkaline pH. Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides, while tyrosine residues may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
[0158] Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carboethoxylation with diethylpyrocarbonate.
[0159] Examples of incorporation of unnatural amino acids and derivatives during protein synthesis include, but are not limited to, the use of norleucine, 4-aminobutyric acid, 4-amino-3-hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienylalanine, and / or D-isomers of amino acids.
[0160] The crosslinking agent is, for example, (CH2) nHomobifunctional crosslinkers such as bifunctional imidoesters with spacer groups, glutaraldehyde, N-hydroxysuccinimide esters, and heterobifunctional reagents that typically contain an amino-reactive moiety and a reactive moiety specific for another group, such as N-hydroxysuccinimide, can be used to stabilize 3D conformations.
[0161] The structure of the peptides according to the invention can be modified for various purposes, for example to increase solubility, enhance therapeutic or prophylactic effectiveness, enhance stability, or increase resistance to proteolysis. Modified peptides can be made in which the amino acid sequence is altered, such as by amino acid substitution, deletion, or addition, to modify immunogenicity. Similarly, multiple moieties can be added to the peptides of the invention to achieve the same result.
[0162] For example, peptides can be modified to exhibit the ability to induce T cell anergy. In this case, the critical binding residues for the T cell receptor can be determined using known techniques (e.g., substituting each residue and determining the presence or absence of T cell reactivity). In one example, residues shown to be essential for interacting with the T cell receptor can be modified by replacing the essential amino acid with another, preferably a similar amino acid residue whose presence has been shown to modify T cell reactivity or T cell function (conservative substitution). In addition, amino acid residues that are not essential for T cell receptor interaction can be modified by replacing them with another amino acid, the incorporation of which may then modify T cell reactivity or T cell function but does not, for example, eliminate binding to the relevant MHC protein.
[0163] Exemplary conservative substitutions are detailed below and include:
[0164] [ka]
[0165] Such modifications may result in the creation of molecules that fall within the scope of "variants" of the subject peptides as defined herein. "Variants" should be understood as a reference to peptides that exhibit one or more structural features or functional activities that differ from those exhibited by the non-mutated peptide counterpart.
[0166] The peptides of the invention may also be modified to incorporate one or more polymorphisms resulting from natural allelic variation, and D-amino acids, unnatural amino acids, or amino acid analogs may be substituted in the peptide to generate modified peptides that fall within the scope of the invention. The peptides may also be modified by conjugation with polyethylene glycol (PEG) by known techniques. Reporter groups may also be added to facilitate purification and potentially increase the solubility of the peptides according to the invention. Other well-known types of modifications, including the insertion of specific endoprotease cleavage sites, the addition of functional groups, or the replacement of hydrophobic residues with less hydrophobic residues, and site-directed mutagenesis of DNA encoding the peptides of the invention, may also be used to introduce modifications that may be useful for a variety of purposes. The various modifications to the peptides according to the invention mentioned above are mentioned only as examples and are intended merely to illustrate the wide range of modifications that can be made.
[0167] Nucleic Acids and Vectors In another aspect, the invention provides a nucleic acid molecule composition comprising one or more nucleic acid molecules that encode or are complementary to sequences encoding the binding proteins, or chimeric or fusion proteins, and peptides of the invention, or derivatives, homologs, or analogs thereof. The nucleic acid molecules of the invention can be used to make the binding proteins, chimeric or fusion proteins, or peptides of the invention, or can be used for cell therapy to treat the diseases or conditions described herein.
[0168] The term "construct" refers to any polynucleotide that contains a recombinant nucleic acid molecule. A construct may be present in a vector (e.g., bacterial vector, viral vector) or integrated into a genome. A "vector" is a nucleic acid molecule capable of transporting another nucleic acid molecule. A vector may be, for example, a plasmid, cosmid, virus, RNA vector, or a linear or circular DNA or RNA molecule that may include chromosomal, non-chromosomal, semisynthetic, or synthetic nucleic acid molecules. Exemplary vectors are those capable of autonomous replication (episomal vectors) or those capable of expression of nucleic acid molecules to which they are linked (expression vectors).
[0169] Viral vectors include retroviruses, adenoviruses, parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative-stranded RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies and vesicular stomatitis viruses), paramyxoviruses (e.g., measles and Sendai), positive-stranded RNA viruses such as picornaviruses and alphaviruses, and double-stranded DNA viruses such as adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togaviruses, flaviviruses, reoviruses, papovaviruses, hepadnaviruses, and hepatitis viruses. Examples of retroviruses include avian leukosis-sarcoma viruses, mammalian types C, B and D viruses, the HTLV-BLV complex, lentiviruses and spumaviruses (Coffin, JM, Retroviridae: The viruses and their replication, In Fundamental Virology, 3rd ed., BN Fields et al., eds., Lippincott-Raven Publishers, Philadelphia, 1996).
[0170] "Lentiviral vector" as used herein refers to an HIV-based lentiviral vector for gene delivery, which may be integrative or nonintegrative, has a relatively large packaging capacity, and can transduce a wide variety of cell types. Lentiviral vectors are usually generated as a result of transient transfection of three or more (packaging, envelope, and transfer) plasmids into producer cells. Like HIV, lentiviral vectors enter target cells through the interaction of viral surface glycoproteins with cell surface receptors. Once inside, viral RNA undergoes reverse transcription mediated by viral reverse transcriptase complex. The product of reverse transcription is double-stranded linear viral DNA, which is the substrate for viral integration into the DNA of infected cells.
[0171] The term "operably linked" refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence if it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). "Unlinked" means that the associated genetic elements are not in close association with each other such that the function of one is not affected by the other.
[0172] As used herein, "expression vector" refers to a DNA construct containing a nucleic acid molecule operably linked to a suitable control sequence capable of effecting expression of the nucleic acid molecule in a suitable host. Such control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence to control the termination of transcription and translation. A vector can be a plasmid, a phage particle, a virus, or simply a potential genome insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, can integrate itself into the genome. In this specification, "plasmid", "expression plasmid", "virus" and "vector" are often used interchangeably.
[0173] The term "expression", as used herein, refers to the process by which a polypeptide is produced based on a coding sequence of a nucleic acid molecule such as a gene. This process can include transcription, post-transcriptional regulation, post-transcriptional modification, translation, post-translational regulation, post-translational modification, or any combination thereof.
[0174] The term "introduced" in the context of inserting a nucleic acid molecule into a cell means "transfection," or "transformation," or "transduction," and includes reference to the incorporation of a nucleic acid molecule into a eukaryotic or prokaryotic cell, where the nucleic acid molecule may be incorporated into the genome of the cell (e.g., a chromosome, a plasmid, a plastid, or mitochondrial DNA), converted into an autonomous replicon, or expressed transiently (e.g., a transfected mRNA).
[0175] As used herein, a "heterologous" or "exogenous" nucleic acid molecule, construct, or sequence refers to a nucleic acid molecule or a portion of a nucleic acid molecule that is not native to the host cell, but may be homologous to the nucleic acid molecule or portion of the nucleic acid molecule from the host cell. The source of the heterologous or exogenous nucleic acid molecule, construct, or sequence may be of different genera or species. In certain embodiments, a heterologous or exogenous nucleic acid molecule is added to the host cell or host genome (i.e., not endogenous or native), for example, by conjugation, transformation, transfection, electroporation, etc., where the added molecule may be integrated into the host genome or may exist as extrachromosomal genetic material (e.g., as a plasmid or other form of self-replicating vector), and may be present in multiple copies. In addition, "heterologous" refers to a non-native enzyme, protein, or other activity that is encoded by an exogenous nucleic acid molecule introduced into a host cell, even if the host cell encodes the homologous protein or activity.
[0176] As described herein, more than one heterologous or exogenous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as multiple individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof. For example, as disclosed herein, a host cell can be engineered to express two or more heterologous or exogenous nucleic acid molecules encoding a desired TCR (e.g., TCRα and TCR-β) specific to a WT-1 antigenic peptide. It is understood that when two or more exogenous nucleic acid molecules are introduced into a host cell, the two or more exogenous nucleic acid molecules can be introduced as a single nucleic acid molecule (e.g., on a single vector) on separate vectors that are integrated into the host chromosome at a single site or multiple sites, or any combination thereof. The number of heterologous nucleic acid molecules or protein activities referred to refers to the number of encoding nucleic acid molecules or protein activities, not the number of separate nucleic acid molecules introduced into the host cell.
[0177] As used herein, the term "endogenous" or "native" refers to a gene, protein, or activity that is normally present in a host cell. Furthermore, a gene, protein, or activity that has been mutated, overexpressed, shuffled, duplicated, or otherwise altered compared to a parent gene, protein, or activity is still considered endogenous or native to that particular host cell. For example, an endogenous control sequence (e.g., promoter, translational attenuation sequence) from a first gene can be used to alter or regulate the expression of a second native gene or nucleic acid molecule, where the expression or regulation of the second native gene or nucleic acid molecule differs from the normal expression or regulation in the parent cell.
[0178] The term "homolog" or "homolog" refers to a molecule or activity found or derived from a host cell, species, or strain. For example, a heterologous or exogenous nucleic acid molecule can be homologous to a native host cell gene and can optionally have altered expression levels, a different sequence, an altered activity, or any combination thereof.
[0179] "Sequence identity" as used herein refers to the percentage of amino acid residues in a sequence that are identical to those in another reference polypeptide sequence, after aligning the sequences and introducing gaps as necessary to achieve the maximum sequence identity percentage, and conservative substitutions are not considered as part of the sequence identity.Percentage sequence identity values can be obtained using the NCBI BLAST2.0 software as defined by Altschul et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402, with parameters set to default.
[0180] As used herein, the term "host" refers to a cell (e.g., a Treg cell) or microorganism that is targeted for genetic modification with a heterologous or exogenous nucleic acid molecule to generate a polypeptide of interest (e.g., a high or enhanced affinity anti-WT-1 TCR). In certain embodiments, the host cell may optionally already have or be modified to include other genetic modifications that confer desired properties related or unrelated to the biosynthesis of the heterologous or exogenous protein (e.g., inclusion of a detectable marker; deletion, alteration, or truncation of an endogenous TCR; increased co-stimulatory factor expression). In some embodiments, the host cell is genetically modified to express a protein or fusion protein that modulates immune signaling in the host cell, for example, to promote an advantage of the modified cell in terms of survival and / or proliferation (see, e.g., immune-modulating fusion proteins in WO2016 / 141357, which are incorporated herein by reference in their entirety).
[0181] The nucleic acid molecule may be ligated into an expression vector capable of expression in a prokaryotic cell (e.g., E. coli) or a eukaryotic cell (e.g., a yeast cell, a fungal cell, an insect cell, a mammalian cell, or a plant cell). The nucleic acid molecule may be ligated or fused, or otherwise associated, with a nucleic acid molecule encoding another entity, such as, for example, a signal peptide. The nucleic acid molecule may also comprise additional nucleotide sequence information fused, linked, or otherwise associated with the nucleic acid molecule at either the 3'-terminal portion or the 5'-terminal portion, or at both the 3'-terminal portion and the 5'-terminal portion. The nucleic acid molecule may also be part of a vector, such as an expression vector. The latter embodiment facilitates the production of recombinant forms of the binding proteins or peptides of the invention.
[0182] Such nucleic acids may be useful for the recombinant production of the binding proteins or peptides of the invention or proteins containing them by insertion into an appropriate vector and transfection into a suitable cell line. Such expression vectors and host cell lines also form aspects of the present invention.
[0183] When the peptide is produced by recombinant techniques, host cells transformed with a nucleic acid having a sequence encoding the binding protein, chimeric or fusion protein, or peptide according to the invention, or a functional equivalent of the nucleic acid sequence, are cultured in a medium suitable for the particular cell in question. The binding protein, chimeric or fusion protein, or peptide can then be purified from the cell culture medium, the host cells, or both, using techniques well known in the art, such as ion exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, or immunopurification using antibodies specific for the binding protein or peptide.
[0184] Nucleic acids encoding the binding proteins or peptides of the invention can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells, such as Chinese hamster ovary cells (CHO). Suitable expression vectors, promoters, enhancers and other expression control elements are mentioned in Sambruck et al. (1989). Other suitable expression vectors, promoters, enhancers and other expression elements are well known to those skilled in the art. Examples of suitable expression vectors in yeast include Yep Sec 1 (Balderi et al., 1987, Embo J., 6:229-234); pMFa (Kurjan and Herskowitz., 1982, Cell., 30:933-943); JRY88 (Schultz et al., 1987, Gene., 54:113-123) and pYES2 (Invitrogen, San Diego, CA). These vectors for baculovirus and mammalian expression systems are freely available. For example, baculovirus systems are commercially available for expression in insect cells (ParMingen, San Diego, Calif.) and pMsg vectors are commercially available for expression in mammalian cells (Pharmacia, Piscataway, NJ).
[0185] For expression in E. coli, suitable expression vectors include, inter alia, pTrc (Amann et al., 1998, Gene., 69:301-315), pGex (Amrad, Melbourne, Australia); pMal (NE Biolabs, Beverley, MA); pRit5 (Pharmacia, Piscataway, NJ); pEt-11d (Novagen, Maddison, WI) (Jameel et al., 1990, J. Virol., 64:3963-3966), and pSem (Knapp et al., 1990, Bio Techniques., 8:280-281). For example, the use of pTRC and pEt-11d can result in the expression of non-fusion proteins. The use of pMal, pRit5, pSem and pGex may result in the expression of proteins or peptides fused with maltose E binding protein (pMal), protein A (pRit5), truncated galactosidase (PSEM), or glutathione S-transferase (pGex). When the binding protein or peptide is expressed as a fusion protein, it is particularly advantageous to introduce an enzyme cleavage site at the fusion junction between the carrier protein and the peptide. The binding protein or peptide of the invention can then be recovered from the fusion protein via enzymatic cleavage at the enzyme site and biochemical purification using conventional techniques for purifying proteins and peptides. Different vectors also have different promoter regions that allow for constitutive or inducible expression or temperature induction. In addition, it may be appropriate to express recombinant peptides in different E. coli hosts with altered capabilities to degrade recombinantly expressed proteins. Alternatively, it may be advantageous to modify the nucleic acid sequence to use codons preferentially utilized by E. coli, where such nucleic acid modifications would not affect the amino acid sequence of the expressed protein.
[0186] Host cells can be transformed to express the nucleic acids of the invention using conventional techniques, such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran mediated transfection, or electroporation. Suitable methods for transforming host cells can be found in Sambruck et al. (1989), and other laboratory textbooks. The nucleic acid sequences of the invention may also be chemically synthesized using standard techniques.
[0187] In addition to recombinant production of peptides according to the invention, the nucleic acids may be utilized as probes for experimental or purification purposes.
[0188] Condition being treated The identification and synthesis of the binding proteins, chimeric or fusion proteins, peptides, cells, nucleic acids, vectors and compositions of the invention disclosed herein now facilitates the development of a wide range of prophylactic and therapeutic treatment protocols for use in relation to autoimmune diseases, cancer and infectious diseases. It also facilitates the development of reagents for use therein. Thus, the invention should be understood to extend to the use of the peptides or their functional derivatives, homologues or analogues in the therapeutic and / or prophylactic treatment of patients. Such methods of treatment include, but are not limited to, the following: Infectious diseases and cancers include any of those mentioned in Table 2, Table 3, and Table 4. Autoimmune diseases include any of those mentioned in Table 1, Table 3, and Table 4. Transplant rejection and conditions related to transplant rejection.
[0189] Administration of the binding proteins, chimeric or fusion proteins, peptides, cells, nucleic acids, vectors and compositions of the invention to a subject is a means of treating or preventing cancer or infectious diseases. This can be achieved, for example, by introducing a TCR / peptide-MHC class I disulfide bond to enhance the cytotoxic activity of CD8 T cells, thereby enhancing anti-tumor (for cancer) or anti-pathogen (for infectious diseases) responses. Without being bound by theory, the introduction of a disulfide bond between a CD8 T cell and an antigen-presenting cell (any nucleated cell), in the context of MHC class I, can result in greater cytotoxicity or killing of infected (for infectious diseases) or transformed (for cancer) target cells. Alternatively, the introduction of a disulfide bond between a CD8 T cell and an antigen-presenting cell (any nucleated cell), in the context of MHC class I, can result in greater cytokine / chemokine production, resulting in a pro-inflammatory response.
[0190] Non-limiting examples of potential cancers that can be treated or prevented by the present invention include melanoma, lung cancer, kidney cancer, prostate cancer, breast cancer, colorectal cancer, and fibrosarcoma.Preferably, bone cancer, pancreatic cancer, skin cancer, cancer of the head and neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's disease, non-Hodgkin's lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemia, acute myeloid Leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, tumors of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, and combinations of the above cancers.
[0191] By introducing a TCR / peptide-MHC class I disulfide bond to enhance the cytotoxic activity of CD8 T cells, this can be used to treat or prevent infectious diseases. Non-limiting examples of potential infectious diseases that can be treated or prevented by the present invention include Epstein-Barr virus, influenza, dengue virus, HIV, Hepatitis C virus, and cytomegalovirus.
[0192] Administration of the binding proteins, chimeric or fusion proteins, peptides, cells, nucleic acids, vectors and compositions of the present invention to a subject is a means of treating or preventing autoimmune diseases. This can be achieved, for example, by introducing a TCR / peptide-MHC class II disulfide bond to enhance the regulatory activity of Treg cells, thereby inhibiting or suppressing the autoimmune response. Non-limiting examples of potential autoimmune diseases that can be treated or prevented by the present invention include celiac disease, nickel sensitivity, multiple sclerosis, beryllium sensitivity, and diabetes.
[0193] Administration of the binding proteins, chimeric or fusion proteins, peptides, cells, nucleic acids, vectors and compositions of the invention to a subject is a means of treating or preventing transplant rejection. This can be accomplished, for example, by introducing a TCR / peptide-MHC class II disulfide bond to enhance the regulatory activity of Treg cells, thereby inhibiting or suppressing immune responses directed against the transplant. Treatments include treating inflammation associated with tissue graft rejection. By "transplant tissue rejection" or "graft rejection" is meant any immune response initiated by the host against the transplant, including but not limited to HLA antigens, blood group antigens, and the like. Transplant rejection and graft-versus-host disease can be hyperacute (humoral), acute (T cell mediated), or chronic (unknown etiology), or a combination thereof. Thus, the present invention is used to inhibit and / or ameliorate symptoms associated with hyperacute, acute, and / or chronic rejection and / or rejection of any tissue, including but not limited to the liver, kidney, pancreas, pancreatic islet cells, small intestine, lung, heart, cornea, skin. Graft tissue can be obtained from any donor and can be transplanted into any recipient host, or from one part of the body to another.
[0194] The phrase "therapeutically effective amount" generally refers to an amount of cells expressing a binding protein or peptide of the invention that (i) treats a particular disease, condition, or disorder; (ii) reduces, ameliorates, or eliminates one or more symptoms of a particular disease, condition, or disorder; or (iii) delays the onset of one or more symptoms of a particular disease, condition, or disorder described herein.
[0195] As used herein, "preventing" or "prevention" is intended to refer to at least a reduction in the likelihood of risk (or susceptibility to) acquiring a disease or disorder (i.e., causing at least one clinical symptom of an undeveloped disease in an individual who may have been exposed to or susceptible to the disease, but has not yet experienced or exhibited symptoms of the disease). Biological and physiological parameters for identifying such patients are provided herein and are well known by physicians.
[0196] In particularly preferred embodiments, the methods of the invention are for preventing the recurrence or symptoms of, or reducing the severity of, or inhibiting or minimizing the progression of, a disease or condition described herein, and thus have utility as treatments and prophylaxis.
[0197] The term "treatment" or "treating" of a subject includes the objective of delaying, retarding, stabilizing, curing, curing, mitigating, alleviating, altering, curing, inhibiting the worsening, ameliorating, improving, or affecting a disease or condition, symptoms of a disease or condition, or the risk of (or susceptibility to) a disease or condition. The term "treating" refers to any indicator of successful treatment or amelioration of infectious diseases, cancer, or autoimmune diseases and related conditions described herein, including any objective or subjective parameter, such as remission; remission; reduction in the rate of deterioration; reduction in the severity of the condition; stabilization, reduction in symptoms, or making the condition more tolerable to the individual; slowing the rate of degeneration or decline; making the end point of degeneration less debilitating; or improving the physical or mental health of the subject.
[0198] It will also be appreciated that the methods described herein can be used in combination with existing standard therapeutic treatments / therapy for infectious diseases, cancer, or autoimmune diseases.
[0199] A "subject" as used herein is preferably a human subject. Although the present invention finds application in humans, the present invention is also useful for veterinary purposes. The present invention is useful for domestic or livestock animals such as cattle, sheep, horses and poultry; companion animals such as cats and dogs; and zoo animals. It will be understood that the terms "subject" and "individual" are interchangeable in the context of an individual in need of treatment according to the present invention.
[0200] composition Administration of the binding protein, chimeric or fusion protein, peptide, cell, nucleic acid, vector or composition of the invention in the form of a pharmaceutical composition (herein referred to as "agent") may be performed by any convenient means. It is contemplated that the agent of the pharmaceutical composition exhibits therapeutic activity when administered in an amount that depends on the particular case. The variation depends, for example, on the human or animal and agent selected. A wide range of doses may be applicable. Considering the patient, for example, about 0.01 μg to about 1 mg of agent per dose may be administered. The dosing regimen may be adjusted to achieve the optimal therapeutic response. For example, several divided doses may be administered daily, weekly, monthly, or at other suitable time intervals, or the dose may be proportionally reduced as indicated by the exigencies of the situation. In another example, the composition is administered initially to induce tolerance, and then, if necessary, booster doses of the composition are administered to maintain tolerance. These boosters may be administered, for example, monthly, and may be administered for any period of time, including the patient's lifetime.
[0201] The agent can be administered in a convenient manner, for example, orally, intravenously (if water soluble), intraperitoneally, intramuscularly, subcutaneously, intradermally (with or without the use of traditional needles or other transdermal delivery devices), transdermal, intranasal, sublingual or suppository routes, or by implantation (e.g., using a sustained release molecule). Preferably, the composition is administered intradermally. The agent can be administered in the form of a pharma-ceutically acceptable non-toxic salt, for example an acid addition salt, or a metal complex (which is considered to be a salt for the purposes of this application), for example with zinc, iron, and the like. Examples of such acid addition salts are hydrochloride, hydrobromide, sulfate, phosphate, maleate, acetate, citrate, benzoate, succinate, malate, ascorbate, tartrate, and the like. When the active ingredient is administered in tablet form, the tablet may contain a binder, such as tragacanth, corn starch, or gelatin; a disintegrating agent, such as alginic acid; and a lubricant, such as magnesium stearate. In the context of a peptide for administration, a composition comprising said peptide may be in the form of a liposome or may be conjugated to a nanoparticle. A person skilled in the art will be familiar with standard techniques for formulating a peptide for administration to a subject in need thereof.
[0202] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions, or may be in the form of creams or other forms suitable for topical application. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of superfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. Osmotic adjusting agents are useful for keeping the preparation isotonic with human plasma, thus avoiding tissue damage. Commonly used osmotic agents include dextrose, trehalose, glycerin and mannitol. Glycerol and sodium chloride are other options, but their use is less common. In many cases, it will be preferable to include an isotonic agent, such as sugar or sodium chloride. Prolonged absorption of injectable compositions can be achieved by using agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.
[0203] Sterile injection solution is prepared by incorporating the required amount of active compound into a suitable solvent that contains various other ingredients listed above, which are required, and then sterilized by filtration.Generally, dispersion is prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains basic dispersion medium and other ingredients that are required from those listed above.For the preparation of sterile powder for sterile injection solution, the preferred preparation method is vacuum drying and freeze-drying technology, which can obtain the powder of active ingredient and any additional desired ingredients from the solution that has been previously sterilized and filtered.
[0204] When the active ingredient is suitably protected, it may be orally administered, for example, with an inert diluent or an assimilable edible carrier, enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or mixed directly with dietary food. For oral therapeutic administration, the active compound may be mixed with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of the active compound. Naturally, the percentage of the compositions and preparations may vary and may conveniently be between about 5 and about 80% by weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 μg and 1000 μg of active compound.
[0205] Tablets, troches, pills, capsules, etc. may also contain the following ingredients: binders, such as gum, gum arabic, corn starch, or gelatin; excipients, such as dicalcium phosphate; disintegrating agents, such as corn starch, potato starch, alginic acid, etc.; lubricants, such as magnesium stearate; and sweeteners, such as sucrose, lactose, or saccharin (which may be added), or flavoring agents, such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it may contain a liquid carrier in addition to materials of the above type. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both. A syrup or elixir may contain the active compound, sucrose as a sweetener, methyl and propylparabens as preservatives, a dye, and a flavoring, such as cherry or orange flavoring. Of course, any material used in preparing any dosage unit form should be pharma- ceutically pure and substantially non-toxic in the amounts employed.In addition, the active compounds may be incorporated into sustained-release preparations and formulations.
[0206] The pharmaceutical composition may also include genetic molecules such as vectors capable of transfecting target cells, where the vector carries a nucleic acid molecule encoding a modulating agent. The vector may be, for example, a viral vector.
[0207] Routes of administration include, but are not limited to, respiratory (e.g., intranasal or oral by aerosol), intratracheal, nasopharyngeal, intravenous, intraperitoneal, subcutaneous, intracranial, intradermal, transdermal, intramuscular, intraocular, intrathecal, intracerebral, intranasal, infusion, oral, rectal, IV drip patch, implant, and sublingual. Preferably, the route of administration is intravenous, subcutaneous, intradermal, transdermal, or intranasal, more preferably intravenous.
[0208] Yet another aspect of the present invention relates to a composition as defined above when used in any method of the present invention. EXAMPLES
[0209] Prior to the observations described herein, intercellular disulfide bonds had not been described in immunology or, to the best of the inventors' knowledge, in biology. It was unclear whether the intercellular environment could support disulfide bond formation between proteins expressed on the surface of different cells. It was unclear whether the immune synapse between a T cell and an antigen-presenting cell (APC) could support disulfide bond formation between the TCR of the T cell and the peptide-MHC ligand of the APC. It was unclear whether such disulfide bond formation could require structural rearrangements of the TCR or the peptide.
[0210] Results on increasing the affinity and / or lifetime of TCR-pMHC interactions to the supraphysiological range have yielded puzzling results. Some engineered TCRs with supraphysiological affinity and lifetime for peptide-MHC ligands elicited suboptimal T cell activation. To explain these findings, it was hypothesized that the TCR-pMHC complex is only capable of signaling for a limited time, and that antigen sensitivity is optimized by intermediate affinity TCRs repeatedly unbinding and rebinding to pMHC, described as "continuous binding." Disulfide bond formation would be expected to prevent "continuous binding" between TCR and pMHC, and thus may be incompatible with T cell activation.
[0211] Consistent with a requirement for "continuous binding" between TCR and pMHC in T cell activation, artificial cross-linking of preformed TCR-pMHC complexes was found to abolish T cell activation.
[0212] In healthy human and mouse mature T cells, the amino acid cysteine is rarely present in the TCRα or TCRβ peptide binding sites, called complementarity determining region 3 (CDR3). The inventors hypothesized that such T cells are selectively eliminated during development in the thymus as a result of long-term interactions with antigen-presenting cells. These long-lived interactions are a direct consequence of cysteines in the TCR CDR3 forming disulfide bonds with cysteines in self-peptides presented by MHC molecules. All data are consistent with this hypothesis.
[0213] Example 1 Methods for predicting disulfide bond formation between TCR and peptides TCR-peptide / MHC or TCR-peptide / HLA structures were downloaded from the Protein Data Bank (www.rcsb.org) and analyzed using Coot software. The TCR-peptide interface was analyzed for close contacts between the TCR CDR3 loops and the peptide. Residue pairs in close proximity between the TCR and the peptide were mutated to Cys in silico. The rotamer (orientation) of each Cys residue was edited to bring the sulfur (S) atoms facing each other, without changing the position of the β carbon atom. Cys-Cys pairs in which the interatomic distance between the sulfur (S) atoms was 4 angstroms (Å) or more, or the S atoms collided with each other, were classified as unlikely to form disulfide bonds. These residues are shown as non-bold text in Tables 3 and 4; Cys-Cys pairs where the interatomic distance between the sulfur (S) atoms was >3 Å and <4 Å (indicating that a disulfide bond could be formed with some movement of adjacent residues in the TCR and / or peptide) were classified as "low confidence". These residues are shown as bold and underlined text in Tables 3 and 4; Cys-Cys pairs with interatomic distances between the sulfur (S) atoms between 0.01 and 3.0 Å were classified as likely to form disulfide bonds with "high confidence." These residues are shown as bold (non-underlined) text in Tables 3 and 4.
[0214] In addition, the angle between the S atoms is important. The optimal angle formed by the two β carbon atoms for the S-S bond should be near 90° or -90°. If the observed angles are more than 30° away from these optimal values, the disulfide bond is unlikely to form without structural rearrangement. These residues are represented as non-bold text in Tables 3 and 4.
[0215] Peptide residues were not mutated in silico to Cys if they were (i) buried in the MHC cleft or (ii) proline. CDR3 residues were not considered likely to form disulfide bonds with "high confidence" if the residue to be substituted was Pro or Gly.
[0216] The results of these analyses are shown in Table 3 for MHC class I and Table 4 for MHC class II. An overview of the positions of residues in the CDR3 of TCRα or TCRβ that, when replaced with cysteine, are likely to form disulfide bonds with corresponding or pairing cysteines in MHC / HLA bound peptides is shown in Figure 11 for MHCCI / HLAI and Figure 12 for MHCII / HLAII.
[0217] Example 2 Identification of self-peptide / MHC class II targets for TCR-Treg therapy in autoimmune diseases A list of autoantigens and high-risk MHC class II alleles in autoimmune diseases was compiled. In the following examples, autoantigens in type I diabetes, multiple sclerosis (MS) and rheumatoid arthritis were taken from Ross KA. PLoS One 2014; 9: e101093 and Pianta A et al., J Clin Invest 2017; 127: 2946-56. Autoantigen protein sequences were obtained (https: / / asia.ensembl.org / Homo_sapiens).
[0218] Each of the possible 15-mer peptides derived from the autoantigen protein sequence was assessed for binding affinity to the relevant high-risk MHC class II alleles using NetMHCIIpan (https: / / services.healthtech.dtu.dk / service.php?NetMHCIIpan-3.2).
[0219] The following table shows: a. has a Cys at a potentially TCR-exposed position (P-1, P2, P3, P5, P7 or P8) (where "P-1" means the position that is one N-terminal to the P1 position); b. Predicted binding affinity to MHCII is greater than 90% of 200,000 random peptides evaluated by NetMHCIIpan The peptides are shown.
[0220] [Table 1]
[0221] Example 3 Identification of self-peptide / MHC class I targets for TCR-T cell therapy in cancer Naturally occurring cancer-associated peptides containing cysteine targeted by CTL were searched using TANTIGEN 2.0: Tumor T-cell Antigen Database (http: / / projects.met-hilab.org / tadb / ). Of 148 peptide antigens classified as "shared tumor-specific antigens" and presented by HLA class I molecules, 6 peptides were found to meet the criteria of (i) having a cysteine at position 4, 5, 6, 7, or 8, and (ii) being proven as antigenic targets of CTL clones. These peptides are found in the table below.
[0222] [Table 2]
[0223] TCRs specific for these peptides can be engineered to introduce cysteines that allow for boosting of CTL activity by forming disulfide bonds between the TCR of the CTL and peptide-HLA complexes expressed on human cancer cells.
[0224] Example 4 TCR and peptide sequences used to form model TCR-peptide disulfide bonds Materials and Methods Mouse 6218 TCR expresses H2-D b(Day EB et al., Proc Natl Acad Sci USA, 2011; doi: 10.1073 / pnas.1106851108). Based on the TCR-pMHC structure (Day EB et al., Proc Natl Acad Sci USA, 2011), we predicted that a variant of the 6218 TCR with a Cys instead of Ser at the central position (tip) of CDR3α (6218αC) could form a disulfide bond with a variant of the PA peptide with a cysteine at position 4 (PA4C). We also performed experiments with a variant of the 6218 TCR (6218βC) that has a Cys instead of Gly at the tip of the CDR3β, and with variants of the PA and PA4C peptides in which Arg at position 7 was replaced with Lys (K), Ala (A) or Leu (L) (Figure 1).
[0225] Example 5 Confirmation of disulfide bond formation using X-ray crystallography. Materials and Methods To synthesize TCR and peptide / MHC (pMHC) molecules, DNA fragments optimized for bacterial expression encoding the mouse variable domains of the 6218 TCR (Day EB et al., Proc Natl Acad Sci USA, 2011) and the human constant domains were cloned into the pET30 expression vector (Genscript). In addition, the 6218αC TCR, in which Ser110α was replaced with Cys110α, was cloned as well. The 6218 TCRα, 6218 TCRβ, and 6218αC TCRα chains were expressed separately as inclusion bodies in BL21 E. coli cells. Functional soluble TCRs were generated by refolding equal amounts of α and β chains for 3 days as described (Day EB et al., Proc Natl Acad Sci USA, 2011), followed by dialysis into 10 mM Tris-HCl pH 8.0. The refolded TCRs were purified by anion exchange and size exclusion chromatography. Human β2m and H2-D fused to BirA-substrate peptide b The heavy chain (residues 1-274) was expressed separately in BL21 E. coli cells and extracted as inclusion bodies. These inclusion bodies (30 mg of H2-D b and 10 mg β2m) were refolded with 4 mg of either PA peptide (SSLENFRAYV) or variant peptide (Genscript) for 3 h. Folded pMHC complexes were purified by anion exchange and size exclusion chromatography.
[0226] To perform X-ray crystallography, a crystal screen was set up by sitting drop vapor diffusion at 20° C., 1:1 protein:reservoir drop ratio, 3 mg / mL concentration in 10 mM Tris-HCl pH 8, 150 mM NaCl. b , 6218-PA4C / H2-D b and 6218αC-PA4C / H2-D bCrystals of the complex were grown in 20% (w / v) PEG3350, 0.2 M NaF, 0.05 M Na formate, and 3% (w / v) 1,5-diaminopentane dihydrochloride. b Crystals of were grown at 3 mg / mL in 20% (w / v) PEG2000, 0.1 M KSCN and 2% (w / v) 2-methyl-2,4-pentanediol. All crystals were immersed in a cryoprotectant solution containing a mother liquor solution with increasing PEG3350 concentration to 30% (w / v) and then flash frozen in liquid nitrogen. Data were collected using the AS GUI on the MX2 beamline at the Australian Synchrotron, a division of ANSTO, Australia (Aragao D. et al., J Synchrotron Radiat, 2018; doi: 10.1107 / S1600577518003120). Data were processed using XDS(BUILT=20161205) (Kabsch W, Acta Crystallogr D Biol Crystallogr, 2010; doi: 10.1107 / S0907444909047337). Data were scaled and reduced using Pointless and Aimless programs from the CCP4 suite (version 7.0.077) (Evans PR, Acta Crystallogr D Biol Crystallogr, 2011; doi: 10.1107 / S090744491003982X). The structure was derived from PDB ID: 3PQY for H2-D without the peptide. bThe nucleotide sequence was determined by molecular replacement using the PHASER program (version 2.8.3) (McCoy AJ, J Appl Crystallogr 2007; doi: 10.1107 / S0021889807021206) from the CCP4 suite (1994) (version 7.0.077) using the model of . Manual model building was performed using COOT (version 0.8.9.2) (Emsley P, Acta Crystallogr D Biol Crystallogr, 2010; doi: 10.1107 / S0907444910007493) followed by refinement with BUSTER (version 2.10.3) (Smart OS et al., Acta Crystallogr D Biol Crystallogr, 2012; doi: 10.1107 / S0907444911056058). All molecular graphical representations were generated using PyMOL.
[0227] result 6218 TCR-PA / H2-D b , 6218 TCR-PA4C / H2-D b and 6218αC TCR-PA4C / H2-D b Overlay of the complexes revealed a similar binding mode (Fig. 2A-C, G). We observed a disulfide bond between the free Cys of 6218αC TCR and P4-Cys in the PA4C peptide (Fig. 2F). The disulfide bond formed without the need for structural rearrangements of either the peptide, the CDR3, or the binding topology of the TCR chain (Fig. 2A-G). The P4-Cys rotamer in the disulfide bond (Fig. 2F) was found to be the most stable rotamer in the unbound PA4C / H2-D peptide. b Structure (Figure 2B) and 6218 TCR-PA4C / H2-D b This differs from the P4-Cys rotamer observed in the complex (Figure 2E), which indicates that some 6218αC TCRs remain in the PA4C / H2-D complex in solution until disulfide bond formation occurs. b This provides a potential explanation for why the monomers are bound and released (see below).
[0228] Example 6 Disulfide bond formation increases T cell sensitivity to peptide antigens. Materials and Methods 5KC-73.8.20 (5KC) cells, which lack endogenous TCR β chains (White J. et al., J Exp Med, 1993; doi: 10.1084 / jem.177.1.119), were selected for loss of CD4 and CD4 - CD8 - Cell lines were established and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco, Amarillo, TX, catalog number 10437028), 2 mM L-glutamine (Gibco, catalog number 25030149), 1 mM sodium pyruvate (Gibco, catalog number 11360070), 100 μM non-essential amino acids (Gibco, catalog number 11140050), 5 mM HEPES buffer (Gibco, catalog number 15630080), 55 μM 2-mercaptoethanol (Gibco, catalog number 21985023), 100 units / mL penicillin and 100 μg / mL streptomycin (Gibco, catalog number 15140122) (cDMEM). 5KC cells were transduced to express murine CD8αβ and either 6218 TCR or 6218αC TCR encoded by pMIGII retroviral vector and selected for equal expression of CDαβ and TCRβ. 4 10 transduced 5KC cells were cultured in the absence or presence of graded concentrations of peptide or anti-CD3 (10 μg / mL prebound to the plate overnight). 5 The cells were incubated with DC2.4 mouse dendritic cells (Shen Z. et al., The Journal of Immunology 158, 2723-2730 (1997)) for 16 hours. Supernatants were collected and assayed for IL-2 concentration using the BD OptEIA Mouse IL-2 Enzyme-Linked Immunosorbent Assay (ELISA) kit. EC 50 and Hill slope (h) values were determined using nonlinear regression (4-parameter dose-response curves) in GraphPad Prism.
[0229] result Increased T cell sensitivity to peptide antigens was observed in cells transduced with the 6218αC TCR. 50 ), whereas 49 nM was required to induce a similar response in 6218 TCR cells. The dose-response curve was also steeper as demonstrated by the larger h values for cells expressing the 6218αC TCR (Figure 3).
[0230] Example 7 Assay for disulfide bonds between purified TCR and peptide / MHC proteins. Materials and Methods To perform surface plasmon resonance (SPR) assays, each soluble TCR was immobilized on a CM5 sensor chip via amine coupling. The 6218αC TCR forms disulfide-linked homodimers that are not amenable to PA / H2-D unless TCR dimerization is released using a 10-min injection of 1 mM DTT at 10 μL / min. b Also PA4C / H2-D b The DTT-treated flow cells were then equilibrated in running buffer for 3 hours to achieve a stable baseline. b or PA4C / H2-D b was flowed over the TCR in a series of 1 min injections of increasing concentrations (1.5 μM, 4.4 μM, 13.3 μM, 40 μM and 120 μM) using a 1 in 3 dilution ratio. b To demonstrate induction of dissociation for the 6218αC TCR, PA4C / H2-D b Samples were treated with 2 mM DTT overnight at 4°C and then diluted in running buffer without DTT. In assays with longer pMHC injection times, a negative control pMHC (influenza virus NP 265~274 / HLA-A*03) and positive control pMHC(PA / H2-D b) for 1 min, followed by 5 or 20 min of PA4C / H2-D b Prior to monomer injection, all pMHC monomer concentrations in these assays were 100 μM. To account for differences in the amount of immobilized 6218αC TCR between sensor chips for assays with pMHC injection times greater than 1 min, we used the formula K D = [6218αC] × [PA / H2-D b ] / [6218αC-PA / H2-D b ] was used to normalize the response units (RU). D = 64.1 μM and [PA / H2-D b When [R] = 100 μM, a "normalized RU" value = 1 (corresponding to 100% estimated 6218αC TCR occupancy) indicates that PA / H2-D b The positive control was set as 1.641 times the RU detected at equilibrium when run over 6218αC TCR. Experiments were performed on a BIAcore T100 instrument at 25° C. using 10 mM Tris-HCl, pH 8, 150 mM NaCl, 0.005% surfactant P20 containing 0.1% bovine serum albumin to avoid non-specific binding. Data were exported using BIAevaluation 3.0 and data points were analyzed using Prism version 9 (GraphPad Software, La Jolla California USA).
[0231] result PA4C / H2-D b PA4C / H2-D bound similarly to 6218 and 6218αC TCRs during the association phase, but affected the dissociation of pMHC from the TCR. The sensorgram of 6218αC TCR showed that PA4C / H2-D b After injection, the patient did not return to baseline and 6218αC TCR was transfected with PA4C / H2-D b Short exposure to 6218αC TCR-PA4C / H2-D b These results suggest that distinct short- and long-lived subpopulations of the complex arise (Figure 4A). Addition of the reducing agent dithiothreitol (DTT), which inhibits disulfide bond formation, reduced the PA4C / H2-D bAfter the injection was completed, the 6218αC TCR sensorgram returned to baseline, and the 6218αC TCR-PA4C / H2-D b We demonstrated that the long-lived subpopulation of the complex was dependent on disulfide bond formation (Figure 4B). Increasing the time of injection from 1 to 5 or 20 min reduced the PA4C / H2-D b Increased the percentage of binding that persisted after the infusion was terminated (Figure 4C). b The complex persisted for 1 h (Figure 4A) and was short-lived. b The half-life of the complex was less than 1 second (Figure 4D). The long-lived complex accumulated on a time scale of minutes, whereas the short-lived 6218αC TCR-PA4C / H2-D b The complexes were replaced within seconds, so that 6218αC TCR and PA4C / H2-D b These data support the conclusion that most associations between covalently bound 6218αC TCR-PA4C / H2-D do not result in disulfide bond formation. b The 6218αC TCR and PA4C / H2-D complexes are maintained until disulfide bonds form. b This is not inconsistent with the occurrence of a reversible interaction between
[0232] Example 8 Exposed cysteines in CDR3 promote suprathreshold TCR signaling and T cell tolerance induction in the thymus. Materials and Methods DNA encoding the 6218 TCRα and TCRβ genes separated by a "cleavable" P2A peptide was synthesized (Genscript Biotech, Piscataway, NJ). A codon encoding Cys was introduced into the CDR3α (replacing Ser110α with Cys110α) or CDR3β (replacing Gly109β with Cys109β) sequence using PCR mutagenesis. The DNA constructs were cloned into the pMSCV-IRES-GFP II (pMIGII) vector, which encodes GFP under the control of an internal ribosome entry site (Holst J. et al., Nat Protoc, 2006; doi: 10.1038 / nprot.2006.61). Rag1 - / - BM cells were retrovirally transduced in vitro as described (Holst J. et al., Nat Protoc, 2006). T cells were depleted from BM cells from C57BL / 6 (B6) mice using the Mouse CD3ε MicroBead Kit (Miltenyi, Bergisch Gladbach, Germany, Cat. No. 130-094-973) and an autoMACS instrument (Miltenyi). Rag1 cells exposed to retroviruses were depleted. - / - BM cells were mixed with T cell-depleted B6 BM cells at a 1:1 ratio, and then Rag1 - / - 2 x 10 per recipient 6 The recipients were X-rayed the same day earlier (two doses of 5 Gy given 4 hours apart). TCR retrogenic mice were analyzed 37 days after BM transfer.
[0233] For analysis of TCR retrogenic mice, single cell suspensions were prepared from thymus, spleen or small intestine samples. +To detect cells, single-cell thymocyte suspensions were incubated for 60 min at 37°C in pre-warmed FACS buffer (PBS containing 2% v / v heat-inactivated bovine serum and 0.01% m / v sodium azide) containing phycoerythrin (PE)-conjugated anti-CCR7 (BioLegend, San Diego, CA, catalog no. 120105). Alternatively or additionally, cells were incubated for 30 minutes at 4° C. in FACS buffer containing a combination of various anti-mouse antibodies: Brilliant Violet 510 anti-TCRβ (BioLegend, Catalog No. 109233), Alexa Fluor 700 anti-CD4 (BioLegend, Catalog No. 100430), APC / Fire anti-CD8α (BioLegend, Catalog No. 100766), PE / Cy7 anti-CD8β.2 (BioLegend, Catalog No. 140416), VioBlue anti-CD45 (Miltenyi, Catalog No. 130-102-430), and propidium iodide solution (BioLegend, Catalog No. 421301). Samples were then washed in FACS buffer and analyzed using an LSRFortessa X-20 flow cytometer (Becton Dickinson, Franklin Lakes, NJ). Data was analyzed using FlowJo software (FlowJo LLC, Ashland, Oregon).
[0234] result GFP + Thymocyte frequency is determined by, for example, immature CCR7 - During development, it was significantly lower in the 6218αC and 6218βC groups (Figure 5A). The 6218 TCR induced efficient thymic differentiation of naive T cells characterized by high expression of CCR7, whereas the 6218αC and 6218βC TCRs did not (Figure 5A). In the spleen, conventional CD8 + GFP expressing CD8αβ characteristic of T cells + TCRβ +The number of cells was highest in the 6218 group (Figure 5B). However, the intestinal CD8αα intraepithelial lymphocyte (IEL) population was larger in the 6218αC and 6218βC groups (Figure 5C). Induction of thymocyte deletion and CD8ααIEL differentiation indicates that the 6218αC and 6218βC TCRs induced stronger TCR signaling than the 6218 TCR.
[0235] Example 9 Exposed cysteines in CDR3 affect the abundance and distribution of developing T cells in the thymus. Materials and Methods Thymus samples from TCR retrogenic mice were immersed in 50% ethanol / 5% acetic acid / 45% water for 10 min, then transferred to 10% neutral buffered formalin overnight. Fixed samples were then exposed to 4-h cycles of graded ethanol and xylene using a Peloris II Tissue Processor (Leica, Wetzlar, Germany), embedded in Paraplast wax (P3558, Sigma-Aldrich, St. Louis, MO), and sectioned at 4 μm thickness onto Superfrost Plus slides using an RM2235 microtome (Leica). The primary antibodies chicken anti-GFP (ab13970, Abcam, Cambridge, UK) and rabbit anti-cytokeratin 14 (K14) (ab197893, Abcam) were used at a dilution of 1:200, and the secondary antibodies goat anti-chicken IgY A647 (ab150175, Abcam) and donkey anti-rabbit IgG A488 (711-545-152, Jackson ImmunoResearch, West Grove, PA) were used at a dilution of 1:500. Staining was performed using an Autostainer Link 48 (Dako, Glostrup, Denmark) with the following incubations, each separated by one or two 5 min incubations in wash buffer (K8007, Agilent, Santa Clara, CA): target retrieval solution S1699 (Agilent) for 30 min at 98°C, protein block X0909 (Agilent) for 60 min at room temperature (RT), primary antibody for 60 min at RT, secondary antibody for 60 min at RT, and DAPI for 15 min at RT. Imaging was performed on an Olympus VS120 virtual slide microscope equipped with a UPLS APO 20x lens with 0.75 NA and captured with an Olympus XM10 digital camera. A DAPI / FITC / CY5 filter set was used at the same exposure settings for all sections. GFP + Cell density, cortex, K14 - The medulla was defined as the K14 region. +Areas were defined as and determined using Fiji (J. Schindelin J. et al., Nat Methods, 2012; doi: 10.1038 / nmeth.2019). Images were generated using cellSens Dimension version 4.1 software (Olympus Corporation, Tokyo, Japan).
[0236] result 6218 TCR expressing GFP + Thymocytes were present in the cortex and medulla of the thymus, reflecting the expected migration from cortex to medulla during naive T cell differentiation (Figure 6). In comparison, 6218αC expresses less GFP. + Thymocytes were detected in the cortical and medullary regions of thymus sections, consistent with abrogation, alteration or arrest of development (FIG. 6).
[0237] Example 10 Substitutions at P7 of the peptide, regardless of the cysteine residue, affect the probability of binding to the pMHC tetramer of the TCR. Materials and Methods To generate TCR transfectants, 293T (human embryonic kidney cell line) cells maintained in cDMEM were mixed with FuGENE 6 transfection reagent (Promega, Cat. No. E2691) and two pMIG II plasmids encoding GFP. One plasmid contained DNA sequences encoding mouse CD3γ, CD3δ, CD3ε, and CD3ζ separated by a 2A peptide. The other plasmid contained DNA sequences encoding the TCRα and TCRβ chains of the 6218 or 6218αC TCR separated by DNA encoding the 2A peptide. 48 hours after transfection, the TCR transfectants were incubated with PE-conjugated pMHC tetramers for 1 hour at RT. Cells were washed and incubated with APC anti-TCRβ (BioLegend, Cat. No. 109212) and LIVE / DEAD Fixable Aqua DEAD CELL Stain (Thermofisher, Waltham, MA, Cat. No. L34957) for 30 min, then washed before flow cytometry analysis. To generate pMHC tetramers, pMHC molecules prepared with the peptide variants described above were biotinylated using BirA biotin ligase with the addition of D-biotin (Astral Scientific, Sydney, Australia, Cat. No. BIOBB0078) and tetramerized by the addition of PE-streptavidin (BioLegend, Cat. No. 405204) at a molar ratio of 4:1. DNA encoding BirA biotin ligase was cloned into the pcDNA3.1 expression vector with a His tag (Genscript Biotech) and the protein was expressed in BL21 E. coli cells and then purified using Ni-NTA agarose beads (Machery-Nagel, Dueren, Germany, Cat. No. 745400.100).
[0238] result In cell-based pMHC tetramer binding assays, P7 substitutions in the PA4C peptide resulted in graded changes in binding levels, including the absence of detectable binding, but at each step of the change we obtained similar results for the 6218 and 6218αC TCRs (Figure 7).
[0239] Example 11 Substitutions at P7 of the peptide, regardless of the cysteine residue, affect the probability of binding between purified TCR and pMHC proteins. Materials and Methods SPR assays were performed using increasing pMHC concentrations (maximum concentration of 120 μM or PA4C7L / H2-D b and PA7L / H2-D b The assay was performed as described above using a series of 1 min injections of 100 μg / mL of 100 μg / mL of 100 μM ...
[0240] result SPR results revealed that each P7 substitution reduced binding to both the 6218 and 6218αC TCRs (Figure 8).
[0241] Example 12 Disulfide bond formation prevents dissociation of the TCR from the peptide / MHC. Materials and Methods Immobilized TCRs were prepared as described above for the SPR assay. We also used a negative control pMHC (influenza virus NP 265~274 / HLA-A*03) and positive control pMHC(PA / H2-D b ) for 1 min followed by 20 or 50 min of test pMHC monomer [PA4C / H2-D b , PA4C7K / H2-D b , PA4C7A / H2-D b , or PA4C7L / H2-D b] injection was performed followed by a buffer injection. All pMHC monomer concentrations were 100 μM. SPR data were analyzed as described above and presented as "normalized RU". For tetramer dissociation assays, TCR transfectants were stained with 5 μg / mL pMHC tetramer for 1 h at RT, then washed and stained with 25 μg / mL anti-H2-D b / K b (BD Biosciences, clone 28-8-6, Cat. No. 553575) for 10, 30, or 60 minutes to prevent tetramer reassociation, followed by washing and staining with anti-TCRβ-APC and LIVE / DEAD Stain prior to analysis by flow cytometry. + The cell frequency was measured using anti-H2-D b / K b The values are shown as percentages of the corresponding samples without (time = 0 min). Symbols indicate the mean of 4 samples per condition, compiled from 2 experiments, and error bars indicate the range of 4 samples per condition, compiled from 2 experiments.
[0242] result Extending the SPR injection time revealed persistent interactions between all P4-Cys-containing pMHC monomers and the 6218αC TCR (Figure 9A). Furthermore, P4-Cys-containing pMHC tetramers did not dissociate from cells expressing the 6218αC TCR (Figure 9B). Thus, although P7 substitution reduced the probability of TCR binding to pMHC in SPR and tetramer assays (Figures 7 and 8), persistent interactions still occurred between all P4-Cys-containing pMHC molecules and the 6218αC TCR, consistent with disulfide bond formation (Figure 9).
[0243] (Example 13) Disulfide bond formation reveals a trade-off between T cell sensitivity to and recognition of peptide antigens. Materials and Methods T cell stimulation assays using 5KC T cells and DC2.4 murine dendritic cells were performed as described above using the PA4C, PA4C7K, PA4C7A, PA, PA7K and PA4C7L peptides.
[0244] result Cells expressing the 6218 TCR were not activated by any peptides with a P7 substitution, whereas cells expressing the 6218αC TCR were activated by all peptides with P4-Cys (Figure 10A). Thus, the lower T cell sensitivity in non-covalent antigen recognition compared to covalent antigen recognition (Figure 3) is coupled with superior discrimination of peptide antigens (Figure 10A). However, the EC of P4-Cys-containing peptides was significantly higher than that of non-covalent antigen recognition (Figure 3). 50 and the slopes (h) of the dose-response curves corresponded to a hierarchy of their probability of binding to the 6218αC TCR in the tetramer and SPR assays (Figures 7 and 8), such that a level of peptide discrimination was maintained in covalent antigen recognition.
[0245] Thus, by introducing a Cys residue into a model TCR-pMHC combination and making further substitutions at P7 of the peptide, we investigated interactions where the observed binding between TCR and pMHC varied from the physiological antiviral range to below the detection limit in tetramer and SPR assays. The Cys residue allowed persistent binding between TCR and pMHC, consistent with the formation of a disulfide bond that prevented dissociation of the covalently bound TCR-pMHC complex. However, at each step of the binding transition, the Cys residue reduced the binding of the TCR to pMHC both for fluorescence in the cell-based tetramer assay and for K in the SPR assay. D There was also little effect on the values (Fig. 10B).
[0246] Based on the equal probability of TCR binding to pMHC, approximately 1 nM of PA4C peptide in a co-culture assay would be expected to induce equal rates of TCR-pMHC complex formation in cells expressing either the 6218 TCR or the 6218αC TCR. The ability of approximately 1 nM of PA4C peptide to activate cells expressing the 6218αC TCR but not those expressing the 6218 TCR is likely not due to differences in the rate of TCR-pMHC complex formation, but rather due to the covalently bound 6218αC TCR-PA4C / H2-D complex that persists long enough to activate the TCR signaling cascade. b However, cells expressing 6218αC TCR required more than 2 nM of PA4C7A or PA4C7L peptide to activate, suggesting that the probability of binding to 6218αC TCR is higher than that of PA4C7A / H2-D. b and PA4C7L / H2-D b In PA4C / H2-D b At low pMHC densities, the lifetime of the TCR-pMHC interaction is the limiting factor during non-covalent antigen recognition, whereas the probability of TCR binding to pMHC is the limiting factor during covalent antigen recognition.
[0247] Example 14 Role of Zap70 and MHC in cysteine-ligated T cell fate polarization. In mice with reduced function of the TCR signaling protein Zap70, normally deleted thymocytes express CD4 + or CD8αβ + To explain this finding, it is believed that TCR-pMHC interactions, which should induce strong TCR signaling, induce only weak TCR signaling due to attenuated signaling via mutant Zap70. To test whether Cys-containing CDR3 normally induces strong TCR signaling in vivo, we investigated whether thymocytes with Cys-containing CDR3 express Zap70. mrd / mrtWe sought evidence of abnormal progression to T-conv cells in mice. We used Zap70 transduced with 6218, 6218αC, or 6218βC TCR. mrd / mrt We analyzed TCR retrogenic mice bearing BM cells. GFP in the spleen + TCRβ + The number of cells expressing these TCRs is mrd / mrt When expressed in cells, the levels were comparable, although relatively low (Figure 13A). These data support the hypothesis that Cys-containing CDR3s normally induce strong TCR signaling in vivo.
[0248] Although the above TCR retrogenic experiments provide functional evidence that Cys in CDR3 biases T cell fates, those experiments were limited to monoclonal T cell populations. To generalize those findings, we sequenced the TCR repertoires of polyclonal T cell populations, including those in mice with genetic defects in TCR-pMHC signaling.
[0249] Materials and Methods Whole thymus or spleen suspensions were prepared by pushing the organs through a 70 μm sieve in sorting buffer (PBS containing 2% v / v heat-inactivated fetal bovine serum and 2 mM EDTA). The small intestine was cut longitudinally and then into pieces of approximately 0.5 cm length while kept moist with washing medium (WM, DMEM containing 2.5% v / v heat-inactivated bovine serum and 10 mM HEPES) and placed in a 50 mL tube containing approximately 15 mL ice-cold WM. The intestinal contents were removed by cycles of vortexing for 5 seconds, followed by removal of the supernatant by using a strainer to retain the intestinal tissue, and resuspension in 15 mL WM until the supernatant was clear.
[0250] The tissue pieces were then incubated in dissociation buffer (calcium- and magnesium-free PBS containing 5% v / v heat-inactivated bovine serum and 2 mM EDTA) with gentle rotation for 15 min at 37° C. After vortexing for 15 s, the tissue pieces were removed using a strainer and discarded, and the supernatant was passed through a 70 μm sieve, pelleted by centrifugation, resuspended in 5 mL 40% Percoll, and layered over 5 mL 80% Percoll in a 15 mL tube.
[0251] After centrifugation at 900 g for 20 min at 20° C., the material at the interface was collected, transferred to a fresh 15 mL tube containing 10 mL of selection buffer, pelleted, and incubated with fluorescently conjugated antibodies for FACS analysis.
[0252] For CCR7 staining of thymocytes, the suspension was incubated in 1 mL pre-warmed sorting buffer containing phycoerythrin (PE)-conjugated anti-CCR7 (BioLegend, San Diego, Calif., Cat. No. 120105) for 60 min at 37° C. For staining of other cell surface markers, each thymus or spleen sample was incubated in 1 mL sorting buffer containing fluorescently conjugated antibodies for 30 min at 4° C., and each small intestine sample was incubated in 0.5 mL sorting buffer containing fluorescently conjugated antibodies for 30 min at 4° C.
[0253] After washing, cells were passed through a 40 μm sieve and then T cell subsets (typically 5×104 cells per sample) were sorted using an Influx Cell Sorter instrument (Becton Dickinson, Franklin Lakes, New Jersey) into 1.5 mL Eppendorf tubes containing 350 μL of Buffer RLT from an RNeasy Mini Kit (Qiagen, Hilden, Germany, Cat. No. 74106). Samples were then frozen by pressing against dry ice and stored at −80° C. until RNA isolation.
[0254] RNA was isolated using the RNeasy Mini kit in an elution volume of 22 μL, from which 12 μL was used to synthesize cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Cat. No. 205311). Using 5 μL of cDNA per reaction, TCRβ transcripts were PCR amplified using the Q5® High-Fidelity PCR Kit (New England BioLabs, Ipswich, MA, Cat. No. E0555L) and a mix of 19 Trbv-specific forward primers and a single Trbc-specific reverse primer, and TCRα transcripts were PCR amplified using a mix of 23 or 24 Trav-specific forward primers and a single Trac-specific reverse primer (purchased from GeneWorks, Adelaide, Australia). The forward and reverse primers had separate 5' overhang adapter sequences that allowed for the addition of sample-specific indexes and P5 / P7 sequencing adapters in the second PCR using the Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA, Cat. No. FC-131-1096). Prior to the second PCR, AMPure XP magnetic beads (Beckman Coulter, Brea, CA, Cat. No. A63881) were used to enrich for amplification products >100 bp. Conditions for the first PCR were 98°C for 5 min, 20 cycles of 98°C for 10 s, 60°C for 30 s, and 72°C for 30 s, followed by 72°C for 2 min. Conditions for the second PCR were 72°C for 3 min, 98°C for 30 s, 20 cycles of 98°C for 10 s, 63°C for 30 s, and 72°C for 30 s, followed by 72°C for 1 min.
[0255] After determining the amplification product concentration using a QIAxcel capillary electrophoresis instrument (Qiagen), equimolar amounts of amplification products from up to 270 samples were pooled into a single tube and concentrated using AMPure XP magnetic beads, and then 300-500 bp amplification products were gel purified and then sequenced on a NextSeq instrument (Illumina) using a short read 1 of 6 bases followed by a 145 base read 2.
[0256] Sequences were aligned to mouse TCR genes using molecular identifier groups-based error correction (MIGEC) software (version 1.2.6). Subsequent analysis was performed using RStudio software (version 2022.02.3, build 492). Sequences with CDR3s that were out of frame or contained stop codons were excluded. A clone was defined as a unique combination of Trav or Trbv gene and CDR3 nucleotide sequence. Each clone was counted only once per sample, regardless of its number of reads.
[0257] CDR3 length was determined using the CDR3-IMGT definition, which excludes the conserved N-terminal Cys and the C-terminal Trp or Phe from the CDR3. For a CDR3 sequence of n amino acids, the amino acid at the highest position not exceeding (n / 2+1) was defined as the central CDR3 position (tip). The cysteine index of each sample is equal to the percentage of clones with a Cys within 2 positions from the CDR3 tip. Sequences detected only once or twice in any given sample were excluded from the cysteine index calculation. For samples that did not have a clonotype with a Cys within 2 positions from the CDR3 tip, the cysteine index was defined as the reciprocal of the number of clones in the sample and expressed as a percentage. We excluded Trbv1 sequences with CDR3 lengths of less than 8 amino acids, because they may have a germline-encoded Cys at position 2 of the CDR3 that is within 2 positions from the tip of a CDR3 sequence that is less than 8 amino acids long.
[0258] result In wild-type mice (left panel, FIG. 13B), Cys-containing CDR3s were enriched in CD8ααIELs and depleted in CD4+ and CD8+ T-conv cells compared to preselected thymocytes. mrd / mrt Preselected thymocytes and mature T cell subsets in mice had comparable frequencies of Cys-containing CDR3 (middle panel, FIG. 13B), and Zap70 mrd / mrt We have shown that polyclonal thymocytes with Cys-containing CDR3 undergo aberrant development into T-conv cells in mice. To test whether the effect of Cys-containing CDR3 depends on pMHC ligands, we used B2m thymocytes lacking cell surface expression of MHC proteins. - / - H2-Aa - / - We sequenced the TCR repertoire of mice. - / - H2-Aa - / - We found comparable frequencies of Cys-containing CDR3s in preselected thymocytes and mature T cells from mice (right panel, FIG. 13B). Together, these results demonstrate that the differential expression of Cys in the mature TCR repertoire is a direct consequence of Cys-containing CDR3s inducing potent TCR signaling in the thymus in response to pMHC ligands.
[0259] Example 15 Context-dependent effects of Cys on TCR-pMHC binding. Materials and Methods 293T TCR transfectants expressing CD3 and 6218, 6218αC, or 6218βC TCR, prepared as described above, were incubated with H2-D b and analyzed by FACS.
[0260] result PA / H2-D b and PA4C / H2-D bThe tetramer bound to cells expressing 6218 or 6218αC TCR but not to cells expressing 6218βC TCR (Figure 14). The absence of binding to the 6218βC TCR was expected because the Gly to Cys substitutions introduced a bulkier side chain, which likely altered the conformation of the CDR3 β loop and prevented a close interaction between its backbone and the Arg at P7 of the peptide. To assess the effect of these Cys substitutions on the TCR-pMHC interface, we applied X-ray crystallography (see Example 5, Figure 2).
[0261] (Example 16) A TCR engineered to form a disulfide bond with the alpha 3 chain (alpha3) of type IV collagen in Goodpasture's disease Perhaps the best understood human autoimmune disease is Goodpasture's disease, which is associated with the MHC class II (MHCII) allele HLA-DRB1*15:01 (DR15). + Humans and mice develop Goodpasture's disease due to proinflammatory T and B cell responses against the α3 chain of type IV collagen (α3), a component of the basement membrane in the kidney and lung. However, co-expression of the MHCII allele HLA-DRB1*01:01 (DR1) induces the formation of α3 / DR1-specific T-reg cells that prevent Goodpasture's disease.
[0262] Notably, DR15 and DR1 express the same peptide to CD4 +DR15 and DR15-presented T cells confer susceptibility and resistance to the disease, respectively. However, their peptide anchor residues are shifted by one position, so that the TCR "sees" different amino acids in the peptide when it is presented by DR15 versus DR1 (Ooi, JD, et al., Dominant protection from HLA-linked autoimmunity by antigen-specific regulatory T cells. Nature. 545, 243-247 (2017). doi: 10.1038 / nature22329).
[0263] CD4 binding to the α3 / DR15 antigen + Generation of T-cell hybridomas To study the pathogenesis of Goodpasture's disease, we investigated the CD4 + T cell hybridomas were generated.
[0264] To generate T cell hybridomas, two 80-day-old female DR15 transgenic Fcgr2b mice were cultured in vitro. - / - Mice were each subcutaneously immunized with 100 μg of α3 peptide (KKDWVSLWKGFSFKK; SEQ ID NO: 211) emulsified in complete Freund's adjuvant in a total volume of 100 μL, and then re-immunized 7 and 14 days later with 100 μg of α3 peptide emulsified in incomplete Freund's adjuvant in a total volume of 100 μL (for a total of three immunizations). The lysine residues at the N- and C-termini make the α3 peptide more soluble in aqueous solutions.
[0265] Mice were sacrificed 34 days after the first immunization and CD4+ memory T cells were isolated from pooled spleen and lymph node cells using the EasySep Mouse Memory CD4+ T Cell Isolation Kit (StemCell Technologies, Cat. No. 19767). 2×10 5CD4+ memory T cells were cultured at 2 × 10 in the presence of 30 U / mL human IL-2 (Genscript, Cat. No. Z00368-1). 5 The cells were cultured in a single well of a 24-well plate with Dynabeads Mouse T-Activator CD3 / CD28 for T-Cell Expansion and Activation (ThermoFisher Scientific, Cat. No. 11453D) in 500 μL of culture medium.
[0266] After 48 hours of culture, 2.2 × 10 5 10 CD4+ T cells 7 NFAT-lacZ transgene) per well in 96-well plates.
[0267] Ten days after fusion, half the volume from all wells in each 96-well plate was pooled and incubated with APC-conjugated HLA-DR15 tetramers loaded with α3 peptide (α3 / DR15-APC, NIH Tetramer Core Facility, Emory University, Altanta) to identify one plate with an elevated frequency (0.2%) of α3 / DR15-APC+ cells.
[0268] On day 14 post-fusion, pooled cells from all 96 wells of the plate of interest (identified on day 10) were incubated with α3 / DR15-APC tetramers, and 420 α3 / DR15-APC+ cells were FACS sorted into a single well of a 96-well plate into 100 μL of hybridoma medium containing 1× HAT Supplement using an Influx Cell Sorter instrument (Becton Dickinson, Franklin Lakes, New Jersey).
[0269] On day 27 post-fusion, 750 α3 / DR15-APC+ cells were sorted into 100 μL of hybridoma medium containing 1×HT Supplement (ThermoFisher Scientific, Cat. No. 41065012) using the same protocol.
[0270] On day 40 post-fusion, individual α3 / DR15-APC+ cells were sorted into 200 μL of hybridoma medium in separate wells of a 96-well plate using the same protocol.
[0271] At day 50 post-fusion, expanded clone FACS analysis demonstrated that over 98% of cells were α3 / DR15-APC+ and CD4+ (FIG. 15).
[0272] A T cell hybridoma activation assay to identify reactivity to variants of α3 peptide with cysteine substitutions at TCR-exposed positions This hybridoma, designated LS1, harbors an inducible NFAT-lacZ β-galactosidase transgene derived from BWZ.36 cells (Sanderson and Shastri, Int Immunol. 1994 March;6(3):369-76). Peptide-dependent TCR engagement induces transcription from the NFAT promoter and translation of lacZ β-galactosidase (lacZ) in activated cells, where lacZ converts its substrate, fluorodeoxyglucose (FDG), to fluorescein. To provide DR15+ antigen-presenting cells, naive DR15 transgenic Fcgr2b - / - Spleen cells from mice were labeled with CellTrace Violet (CTV, ThermoFisher Scientific, Cat. No. C34557). CTV+DR15+ antigen-presenting cells were cultured with LS1 cells in 200 μL of cDMEM in the absence or presence of one of the various peptides (50 μg / mL). After 16 hours, cells were osmotically loaded with FDG (Nolan et al., Proc Natl Acad Sci US A. 1988 Apr;85(8):2603-7) and analyzed by FACS. Fluorescein was detected in CTV cells cultured with α3 peptide. - (LS1) cells but not in similar cells cultured without the α3 peptide (FIG. 16).
[0273] Because we plan to engineer disulfide bonds for the LS1-α3 / DR15 complex, we tested whether the LS1 TCR would respond to variants of the α3 peptide with cysteine substitutions at TCR-exposed positions (Ooi, JD et al., Nature. 545, 243-247 (2017)) (Figure 16). LS1 cells were activated with a variant peptide with a cysteine substitution for the serine at position (P)2 (α3_S2C; KKDWVCLWKGFSFKK; SEQ ID NO: 212) or a variant peptide with a cysteine substitution for the serine at P8 (α3_S8C; KKDWVSLWKGFCFKK; SEQ ID NO: 213). LS1 cells were not activated by a variant of the α3 peptide with a cysteine substitution for the tryptophan at P-1 (α3_W-1C; KKDCVSLWKGFSFKK; SEQ ID NO: 214), nor by a variant of the α3 peptide with a cysteine substitution for the lysine at P5 (α3_K5C; KKDWVSLWCGFSFKK; SEQ ID NO: 215), nor by a negative control peptide derived from myelin basic protein (MBP) (KKENPVVHFFKNIVTPKK; SEQ ID NO: 216). Thus, the TCR expressed by LS1 cells promotes T cell activation by α3 / DR15 and some, but not all, ligands closely related to α3 / DR15. In other words, these data suggest that the LS1 TCR binds α3 / DR15 with demonstrable specificity, similar to many antimicrobial or autoimmune TCR-pMHC interactions characterized to date.
[0274] Sequencing of TCR .ALPHA. and TCR .BETA. chains expressed by LS1 cells to identify candidate residues for cysteine substitution. To sequence the TCR chains expressed by the LS1 hybridoma, RNA isolated from LS1 cells was reverse transcribed using Template Switching RT Enzyme Mix (New England BioLabs, Cat. No. M0466L). The reverse transcription primers were CGTCTGAACTGGGGTAGGTG (SEQ ID NO: 217) for TCRα and CTGAAAGCCCATGGAACTGC (SEQ ID NO: 218) for TCRβ. The template switch DNA-RNA oligonucleotide primer was GAATTCACCTATCAACGCAGAGTACATXXX (where X represents riboguanosine (rG), SEQ ID NO: 219). The cDNA was used as template in a PCR using forward primer AATTGAATTCCTATCAACGCAGAG (SEQ ID NO: 220) and reverse primer AATTCTCGAGAGTCGGTGAACAGGCAGAG (SEQ ID NO: 221) for TCRα or reverse primer AATTCTCGAGTGGACCTCCTTGCCATTCAC (SEQ ID NO: 222) for TCRβ. The PCR product was digested with EcoRI and XhoI and then ligated into pMSCV-IRES-mCherry FP plasmid (Addgene, Cat. No. 52114) which was used to transform 10-beta competent E. coli (New England BioLabs, Cat. No. C3019H). Miniprep DNA isolated and purified from the subsequent E. coli culture was subjected to Sanger sequencing using primer CCTCACATTGCCAAAAGACG (SEQ ID NO: 223).
[0275] Sequences were aligned against mouse TCR nucleotide sequences using IMGT / V-Quest (https: / / www.imgt.org / IMGT_vquest / input). Details of the variable (TRAV / TRBV) and joining (TRAJ / TRBJ) gene segments and CDR3 amino acid sequences of the TCR alpha and TCR beta chains (LS1 TCR) expressed by the LS1 T cell hybridoma are shown in FIG.
[0276] The inability of the α3_W-1C peptide to activate LS1 cells suggests that the LS1 TCR contacts the tryptophan at P-1 of the α3 peptide, and that the LS1 TCR does not bind centrally to the α3 / DR15 ligand but instead toward the more N-terminal portion of the α3 peptide. The Ob.1A12 TCR, specific for MBP / DR15 and obtained from a patient with multiple sclerosis (Wucherpfennig et al., J Exp Med. 1994 Jan. 1;179(1):279-90. doi: 10.1084 / jem.179.1.279), has a non-conventional binding topology that is shifted towards the N-terminal part of the peptide (Hahn et al., Unconventional topology of self peptide-major histocompatibility complex binding by a human autoimmune T cell receptor. Nat Immunol. 6, 490-496(2005). doi: 10.1038 / ni1187). The center of the Ob.1A12 TCR is located on the P2 of the peptide, rather than the P5 of the peptide that is often observed in other TCR-pMHC complexes (Hahn et al., 2005).
[0277] Ob.1A12 TCR has a shorter CDR3α (12aa) than CDR3β (14aa). Interestingly, we found that in LS1, CDR3α (10aa) is also shorter than CDR3β (13aa). This asymmetry may orient LS1 TCR toward a tilted binding topology for α3 / DR15 ligands, i.e., DR15β helix, as observed in Ob.1A12-MBP / DR15 complex (Hahn et al., 2005). LS1 TCR responds to α3 peptides in the form of either serine or cysteine at P2. The α3_S2C variant may be considered a good candidate to allow SS bond formation with variants of LS1 TCR with cysteine substitutions in either CDR3α or CDR3β.
[0278] Engineering disulfide bonds in the LS1-α3 / DR15 complex The present inventors have
[0279] [ka]
[0280] For CDR3β,
[0281] [ka]
[0282] We generate ten variants of the LS1 TCR with cysteine substitutions at each of the CDR3 positions shown in bold italics (Figure 17). We generate T cell lines expressing LS1 or one of its ten variants described above and test the reactivity of these T cell lines on DR15+ antigen presenting cells incubated with α3, α3W-1C, α3S2C, α3K5C, α3S8C, or a variant with a cysteine instead of leucine at position 3 (α3L3C, KKDWVSCWKGFSFKK, SEQ ID NO: 226). Disulfide bond formation is expected to increase T cell sensitivity to peptide antigens, as demonstrated by T cell activation in response to lower concentrations of peptide antigens in vitro.
[0283] To confirm disulfide bond formation, each TCR of interest together with mouse CD3 is transfected into 293T cells to achieve cell surface TCR expression. We obtain DR15 tetramers containing the peptide of interest (e.g., α3W-1C, α3S2C, α3K5C, α3S8C, α3L3C). We screen each TCR / peptide combination in the presence of an anti-MHCII antibody, clone L243, using a tetramer dissociation assay (described herein) (Lampson and Levy, J Immunol. July 1980;125(1):293-9). Lack of tetramer dissociation can provide evidence of disulfide bonds between the TCR and the peptide.
[0284] Investigating the effect of covalent antigen recognition on CD4+ T cell activation in vitro and in vivo using an engineered LS1-α3 / DR15 complex Engineering disulfide bonds on the LS1-α3 / DR15 complex may allow for the examination of the effect of covalent antigen recognition on CD4+ T cell activation in vitro and in vivo. For example, T-reg function can be assessed in vitro using methods similar to those described herein. To allow for in vivo experiments, DR15 transgenic Fcgr2b encoding the α3 peptide was used. - / - Mouse germline DNA can be modified to introduce cysteine at desired positions using CRISPR-Cas9 gene editing. This approach has the advantage that α3 protein and peptides are expressed and presented to T cells in a manner that is important for protection and susceptibility to autoimmune disease in humans and humanized mouse models. Such an approach can provide a new model for testing whether TCR-Treg cells engineered to form disulfide bonds with target antigens can provide superior efficacy in treating autoimmune disease.
[0285] It will be understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or apparent from the text or drawings, all of which different combinations constitute various alternative aspects of the invention.
[0286] For clarity and the avoidance of doubt, as used herein, unless the context otherwise requires, the term "comprise" and conjugations of that term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additional elements, components, integers or steps.
[0287] [Table 3A]
[0288] [Table 3B]
[0289] [Table 3C]
[0290] [Table 3D]
[0291] [Table 3E]
[0292] [Table 3F]
[0293] [Table 3G]
[0294]
Table 4A
[0295]
Table 4B
[0296]
Table 4C
[0297]
Table 4D
Claims
1. 1. A binding protein comprising a variable domain comprising a complementarity determining region (CDR) capable of contacting a peptide bound to an HLA molecule, wherein the CDR comprises a cysteine capable of forming a disulfide bond with a cysteine in the peptide bound to the HLA molecule, the cysteine being introduced into the CDR by mutation or modification of an existing residue.
2. 10. The binding protein of claim 1 which is an antigen binding protein.
3. The binding protein is an antigen-binding protein, wherein the antigen-binding protein comprises: - an antibody or an antigen-binding fragment thereof, - a T-cell receptor or a fragment thereof, or - chimeric or fusion proteins 2. The binding protein of claim 1, wherein
4. 2. The binding protein of claim 1, wherein the binding protein is a chimeric antigen receptor (CAR).
5. 2. The binding protein of claim 1, wherein the CDR is CDR3.
6. 2. The binding protein of claim 1, comprising an alpha chain variable domain (Vα) or a beta chain variable domain (Vβ).
7. 7. The binding protein of claim 6, wherein the CDR containing the cysteine is present in the alpha chain variable domain or the CDR containing the cysteine is present in the beta chain variable domain.
8. 2. The binding protein of claim 1, wherein the CDRs comprise or consist of an amino acid sequence as set forth in Table 3 or Table 4, with cysteine residues at the positions indicated.
9. the HLA is HLA class I, Optionally, the HLA class I is HLA-A, HLA-B, or HLA-C; Optionally, the HLA class I is HLA-E, HLA-F, or HLA-G. or the HLA is HLA class II, Optionally, the HLA class II is HLA-DR, HLA-DP, or HLA-DQ.
2. The binding protein of claim 1.
10. 2. The binding protein of claim 1, wherein the cysteine capable of forming a disulfide bond with a cysteine in a peptide bound to an HLA molecule is present in the CDR at position 3, 4, 5, 6, 7, 8, 9 or 10, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e., the amino acid at the N-terminus of the CDR is position 1).
11. the CDR is present in a TCR alpha chain variable domain, and the cysteine is present in the CDR at position 3, 4, 5, 6, 7, 8, 9 or 10, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e., the amino acid at the N-terminus of the CDR is position 1), thereby allowing disulfide bond formation with a cysteine present in a peptide bound to an HLA class I molecule, preferably a cysteine present at position P4, P5 or P6; or the CDR is present in a TCR β chain variable domain, and the cysteine is present in the CDR at position 3, 4, 5, 6, 7, 8, 9 or 10, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e., the amino acid at the N-terminus of the CDR is position 1), thereby allowing disulfide bond formation with a cysteine present in a peptide bound to an HLA class I molecule, preferably a cysteine present at position P4, P5, P6, P7, P8 or P9; Optionally, the cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in a peptide shown in Table 3 that is bound to an HLA class I molecule.
2. The binding protein of claim 1.
12. the CDR is present in a TCR alpha chain variable domain, and the cysteine is present in the CDR at position 5, 6, 7, 8 or 11, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e., the amino acid at the N-terminus of the CDR is position 1), thereby allowing disulfide bond formation with a cysteine present in a peptide bound to an HLA class II molecule, more preferably a cysteine present at position P-1, P2 or P5; or the CDR is in a TCR β chain variable domain, and the cysteine is in position 5, 6, 7, 8 or 9 in the CDR, the numbering being relative to the amino acid at the N-terminus of the CDR (i.e., the amino acid at the N-terminus of the CDR is position 1), thereby allowing disulfide bond formation with a cysteine present in a peptide bound to an HLA class II molecule, more preferably a cysteine present at position P4, P5, P6, P7 or P8; Optionally, the cysteine is present in the CDR at a position that allows for the formation of a disulfide bond with a cysteine present in a peptide shown in Table 1 or Table 4 that is bound to an HLA class II molecule.
2. The binding protein of claim 1.
13. The binding protein of claim 1 in a soluble form.
14. A nucleic acid comprising or consisting of a nucleotide sequence encoding the binding protein of claim 1.
15. A vector comprising a nucleic acid comprising or consisting of a nucleotide sequence encoding the binding protein of claim 1.
16. A cell comprising the nucleic acid of claim 14, comprising the vector of claim 15, and / or expressing the binding protein of claim 1 on its surface, Optionally, the cell is an immune cell; Preferably, the immune cell is a NK cell or a T cell, and optionally, the T cell is a CD4+ T cell, a CD8+ T cell, or a regulatory T cell.
17. 1. A method of preparing a population of regulatory T cells for use in the treatment of an autoimmune disease or for use in the treatment or prevention of transplant rejection, comprising: - providing a population of regulatory T cells; - introducing the nucleic acid of claim 14 or the vector of claim 15 into the population of regulatory T cells; and - providing conditions that allow expression of the binding protein on the surface of said regulatory T cells. thereby preparing a population of regulatory T cells for use in the treatment of autoimmune disease or in the treatment or prevention of transplant rejection.
18. 17. The binding protein of claim 1, the nucleic acid of claim 14, the vector of claim 15, or the cell of claim 16 for use in treating or preventing cancer, an infectious disease, an autoimmune disease, or transplant rejection in a subject.
19. A method for identifying a mutant TCR that has a reduced dissociation rate from an HLA-bound target peptide (pHLA) compared to a non-mutated TCR, comprising: - generating a plurality of TCRs having mutations that introduce cysteine residues into the α chain CDR3 sequence and / or the β chain CDR3 sequence; - determining the interaction of a member of said plurality of TCRs with said target pHLA; and - selecting one or more members that have a reduced rate of dissociation from said target pHLA compared to said unmutated TCR, wherein the decrease in the rate of dissociation is due to the formation of a disulfide bond. A method comprising:
20. 17. A method of producing the binding protein of claim 1, comprising culturing the cell of claim 16 under conditions that allow expression of the binding protein.