Compositions and methods for producing fragrances

Abstract

The present invention provides compositions comprising microbial biomass, and food products, beverage products, or feeds comprising microbial biomass. Described herein are uses of said compositions and food products, beverage products, or feeds to produce food-like aromas and / or flavors when heated, in particular to undergo the Maillard reaction. Methods for producing food-like aromas and / or flavors are also provided.

Description

[Technical field]

[0001] Related Applications This application claims priority to Australian Provisional Application No. 2021903367 filed on October 20, 2022, Australian Provisional Application No. 2021904213 filed on December 22, 2021, Australian Provisional Application No. 2022900516 filed on March 3, 2021, Australian Provisional Application No. 2022901282 filed on May 13, 2022, and Australian Provisional Application No. 2022902576 filed on September 7, 2022, the entire contents of which are incorporated herein by reference in their entireties.

[0002] The present invention broadly relates to the use of microbial biomass (e.g., Mortierella species biomass) in a food product, beverage product, or feed, compositions comprising the biomass, and food products, beverage products, or feeds comprising the biomass. The present invention further relates to such compositions and food products, beverage products, or feeds for producing food-like aromas and / or flavors when heated, in particular for undergoing the Maillard reaction. The present invention further relates to methods for producing food-like aromas and / or flavors. [Background technology]

[0003] As the world population soars to a projected 9 billion by 2050, the demand for meat and dairy products for human nutrition is expected to continue to increase. However, meat and dairy production worldwide accounts for 70% of freshwater consumption, 38% of total agricultural land use, and contributes to 19% of global greenhouse gas emissions. There is growing interest in finding alternative sources of protein and fat with a smaller environmental footprint. Also, the market for non-animal sources of high-quality protein and fat, for example from plant sources, which are considered more sustainable and environmentally friendly, is growing worldwide. Cultural and religious reasons also contribute to the growth of the market for non-animal proteins. However, many current plant-based alternatives for meat and dairy use fats derived from blends of vegetable oils such as coconut oil, soybean oil, and palm oil, which may provide insufficient flavor and functionality. Fats and oils add flavor, lubricity, and texture to foods and contribute to a feeling of fullness upon ingestion, and therefore food and beverage products incorporating lipids from animal sources are still often preferred by consumers.

[0004] The aroma and flavor characteristics of cooked meat are important factors for meat palatability and are highly correlated with consumer acceptance and liking. The aroma and flavor characteristics are derived from a large number of volatile and non-volatile compounds that are generated during the heating of meat, such as by cooking or roasting (see, for example, the reviews by Dashdorj et al. (2015) and Mottram (1998)). These compounds result from several types of chemical reactions, namely the Maillard reaction of amino acids or peptides with reducing sugars, lipid oxidation, interactions between Maillard reaction products and lipid oxidation products, and the decomposition of other compounds, such as some sulfur-containing compounds, during cooking or roasting. The reaction products, especially the volatile ones, are organic and of low molecular weight, including aldehydes, ketones, alcohols, esters, aliphatic hydrocarbons, thiazoles, oxazoles and pyrazines, as well as oxygenated heterocyclic compounds such as lactones and alkylfurans. Many of these compounds are not produced during cooking of meat substitutes made with vegetable proteins and fats such as coconut oil, soybean oil, and palm oil, leading to poor consumer acceptance of these non-animal products.

[0005] There remains a need for alternative non-animal products that provide meat-like flavors and aromas for human nutrition. Summary of the Invention

[0006] The present invention is based, at least in part, on the unexpected determination that certain biomasses can impart a strong and pleasant food-like, particularly meat-like, aroma and / or flavor to food. This can be achieved using relatively small amounts of biomass, thereby providing an efficient and cost-effective method for enhancing the aroma and flavor of foods, feeds and beverages. In particular, the inventors have demonstrated that various fungal isolates, particularly Mortierella species, are effective as flavor and aroma enhancers.

[0007] Thus, in one aspect, there is provided a composition capable of producing a food-like aroma and / or flavor when heated, comprising: a) Mortierella sp. biomass containing phospholipids; b) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and c) A composition is provided that comprises one or more amino acids or derivatives or salts thereof, or compounds that contain an amino group (e.g., thiamine).

[0008] Optionally, the composition comprises less than 5% by weight of protein other than protein provided by the Mortierella sp. biomass.

[0009] In some examples, the composition comprises at least about 0.25 mg / mL or mg / g dry Mortierella spp. biomass, based on the volume or weight of the composition excluding Mortierella spp. biomass. In one example, the composition comprises at least about 10 mg / mL or mg / g dry Mortierella spp. biomass, based on the volume or weight of the composition excluding Mortierella spp. biomass. In another example, the composition comprises from about 10 mg / mL or mg / g to about 50 mg / mL or mg / g dry Mortierella spp. biomass or an equivalent amount of wet biomass, based on the volume or weight of the composition excluding Mortierella spp. biomass. In certain embodiments, the food-like aroma and / or flavor is a meaty aroma and / or flavor.

[0010] In one embodiment, the Mortierella species is Mortierella alpina, Mortierella elongata, or Mortierella isabellina.

[0011] In certain instances, the phospholipid comprises one or more esterified ω6 fatty acids, such as arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid ω6 (DPAω6), or γ-linolenic acid (GLA).

[0012] In one embodiment, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are present in the composition in an amount sufficient to produce a food-like aroma and / or flavor when the composition is heated. In some examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are present in the composition in an amount sufficient to produce a food-like aroma and / or flavor when the composition is heated. In some examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are present in the composition in an amount sufficient to produce a food-like aroma and / or flavor when the composition is heated. In some examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are present in the composition in an amount sufficient to produce a food-like aroma and / or flavor when the composition is heated. and wherein the volatile compounds are present in the composition in an amount sufficient to produce one or more volatile compounds selected from cutanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, and 1,3,5-titriane. In one example, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof are present in the composition in an amount sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl 1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol when the composition is heated.

[0013] In certain embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount of about 5 mmol to about 100 mmol per kg or L of the composition, based on the volume or weight of the composition excluding the Mortierella sp. biomass. In further embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount of at least about 15 mmol per kg or L of the composition, based on the volume or weight of the composition excluding the Mortierella sp. biomass.

[0014] In one embodiment, the one or more amino acids or derivatives or salts thereof are present in the composition in an amount of about 5 mmol to about 100 mmol, based on the volume or weight of the composition excluding the Mortierella sp. biomass. In one example, the one or more amino acids or derivatives or salts thereof are present in the composition in an amount of at least about 15 mmol per kg or L of the composition, based on the volume or weight of the composition excluding the Mortierella sp. biomass.

[0015] In some examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives include glucose and / or ribose. In particular examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives include ribose and glucose.

[0016] In further examples, the one or more amino acids or derivatives or salts thereof include cysteine ​​and / or cystine. The one or more amino acids may additionally or alternatively include glutamic acid or a salt thereof. In some examples, the composition includes glutamic acid or a salt thereof and an additional amino acid, derivative or salt thereof.

[0017] The composition may also include any one or more or any combination of an iron source, yeast extract, thiamine, herbs and / or spices, and an aqueous component. In certain embodiments, the composition does not include yeast extract.

[0018] In one embodiment, the composition comprises: a) Mortierella sp. biomass containing phospholipids; b) glucose and / or ribose, b) cysteine ​​and / or cystine, d) yeast extract, e) glutamic acid or its salts, f) thiamine, and g) Contains an aqueous component.

[0019] In one embodiment, the composition produces a meaty aroma and / or flavor when heated.

[0020] In one embodiment, the composition is in the form of a food product, beverage product, or feed, such that the food product, beverage product, or feed produces a meaty aroma and / or flavor when heated.

[0021] In another embodiment, the composition may be mixed with or added to a food product, beverage product, or feed, for example, the composition is in the form of a powder, particulate, or granular mixture. The composition may be mixed with or added to a food product, beverage product, or feed before heating the composition, after heating, and / or after heating the food product, beverage product, or feed. Upon heating the composition, or the mixed composition and the food product, beverage product, or feed, a meat-like aroma and / or flavor may be produced.

[0022] In another aspect, a food product, beverage product, or feed is provided comprising a Mortierella spp. biomass comprising phospholipids or a composition of the invention, and optionally the food product, beverage product, or feed comprises less than 5% by weight of dry Mortierella spp. biomass or an equivalent amount of wet biomass. In some examples, the food product, beverage product, or feed has a meat-like aroma and / or flavor. In certain examples, the food product, beverage product, or feed produces a meat-like aroma and / or flavor when heated. In some embodiments, the Mortierella spp. is Mortierella albina, Mortierella elongata, or Mortierella exigua.

[0023] In some embodiments of the food product, beverage product, or feed, the phospholipid comprises one or more esterified ω6 fatty acids, such as arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA).

[0024] In some examples, the food product, beverage product, or feed is meat or a meat-like product, such as a burger, sausage, hot dog, minced or ground meat, steak, streaks, strips, tenderloins, grilled meat, breasts, thighs, wings, meatloaf, fingers, nuggets, cutlets, diced meat, bacon, soup, gravy, sliced ​​meat, meatballs, fish, fried fish, or seafood, or a imitation thereof. In one embodiment, the food product, beverage product, or feed does not contain any animal or animal-derived ingredients. In another embodiment, the food product, beverage product, or feed contains an animal or animal-derived ingredients, and optionally the animal or animal-derived ingredients are meat.

[0025] In certain examples, the food product, beverage product, or feed contains one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof, or compounds containing an amino group (e.g., thiamine). In one example, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof are present in the food product, beverage product, or feed in an amount sufficient to produce a food-like aroma and / or flavor when the food product, beverage product, or feed is heated. In some embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are converted to 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol; 1-octanol; 2-heptanone; 3-octylfuran; 4-hexylfuran; 5-hexylfuran; 6-hexylfuran; 7-hexylfuran; 8-hexylfuran; 9-hexylfuran; 10-hexylfuran; 11-hexylfuran; 12-hexylfuran; 13-hexylfuran; 14-hexylfuran; 15-hexylfuran; 16-hexylfuran; 17-hexylfuran; 18-hexylfuran; 19-hexylfuran; 20-hexylfuran; 21-hexylfuran; 22-hexylfuran; 23-hexylfuran; 24-hexylfuran; 25-hexylfuran; 26-hexylfuran; 27-hexylfuran; 28-hexylfuran; 29-hexylfuran; 30-hexylfuran; 31-hexylfuran; 32-hexylfuran; 33-hexylfuran; 34-hexylfuran; 35-hexylfuran; 36-hexylfuran; 37-hexylfuran; 38-hexyl and wherein the volatile compounds are present in the food product, beverage product, or feed in an amount sufficient to produce one or more volatile compounds selected from 1,3-bis(1,1-dimethylethyl)-benzene, 2-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, or 1,3,5-titriane.In a further embodiment, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof are present in the food product, beverage product, or feed in an amount sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol when the food product, beverage product, or feed is heated.

[0026] In some examples, the food, beverage product, or feed comprises an extracted lipid from Mortierella species that includes phospholipids.

[0027] In one embodiment, the food product, beverage product, or feed may contain up to about 2.5% by weight dry Mortierella spp. biomass or an equivalent amount of wet biomass.

[0028] Also provided is a method of producing a food product, beverage product, or feed product, comprising combining a Mortierella sp. biomass containing phospholipids, or a composition of the invention, with one or more additional ingestible ingredients.

[0029] Also provided is a method of producing a food product, beverage product, or feed comprising combining a) Mortierella sp. biomass comprising phospholipids; one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or thiamine, or b) a composition according to the invention with one or more additional ingestible ingredients, wherein the food product, beverage product, or feed comprises about 2.5% by weight or less of dry Mortierella sp. biomass or an equivalent amount of wet biomass.

[0030] Also provided is a method of making a composition according to the invention, comprising combining a) a Mortierella sp. biomass containing phospholipids, b) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and c) one or more amino acids or derivatives or salts thereof, or thiamine, with one or more additional ingestible ingredients, wherein the composition comprises about 2.5% by weight or less of dry Mortierella sp. biomass or an equivalent amount of wet biomass.

[0031] Also provided is a method of producing a food-like aroma and / or flavour comprising heating a composition, food product, beverage product or feed of the invention. Also provided is a method of producing a food-like aroma and / or flavour comprising mixing or adding a composition according to the invention to a food product, beverage product or feed and heating. Also provided is a method of producing a food-like aroma and / or flavour comprising heating a composition according to the invention and mixing or adding the heated composition to a food product, beverage product or feed.

[0032] In another aspect, a method of imparting a food-like aroma and / or flavor to a food product, beverage product, or feed is provided, the method comprising contacting the food product, beverage product, or feed with a Mortierella sp. biomass comprising phospholipids or a composition of the invention, and heating the food product, beverage product, or feed and the Mortierella sp. biomass or composition.

[0033] In a further aspect, there is provided a method of enhancing the food-like aroma and / or flavor associated with a food product, beverage product, or feed comprising contacting the food product, beverage product, or feed with a Mortierella sp. biomass comprising phospholipids or a composition of the invention; and heating the food product, beverage product, or feed and the Mortierella sp. biomass or composition comprising phospholipids.

[0034] There is also provided a method for enhancing the food-like aroma and / or flavor associated with a food product, beverage product, or feed, comprising a) heating the composition of the invention; and b) contacting the food product, beverage product, or feed with the composition obtained in step a).

[0035] In some examples of the above methods, the food product, beverage product, or feed is a meat or meat-like product. In further examples, the Mortierella spp. biomass is present in the food product, beverage product, or feed or contacted with the food product, beverage product, or feed in an amount of less than 5% by weight of the dry Mortierella spp. biomass or an equivalent amount of wet biomass. In one embodiment, the food-like aroma and / or flavor is a meaty aroma and / or flavor. In certain embodiments, the composition, food product, beverage product, or feed is heated to at least about 130° C. and / or for at least about 1 hour.

[0036] In a further aspect, there is provided a use of Mortierella sp. biomass containing phospholipids in a composition, food product, beverage product, or feed, wherein the composition, food product, beverage product, or feed comprises less than 5% by weight of dry Mortierella sp. biomass or an equivalent amount of wet biomass. In some examples, the use is to impart a food-like (e.g., meaty or meat-like) aroma and / or flavor to the composition, food product, beverage product, or feed.

[0037] In some examples, the Mortierella species in the composition, food product, beverage product, or feed is Mortierella alpina, Mortierella elongata, or Mortierella exigua. In certain embodiments, the phospholipid comprises one or more esterified ω6 fatty acids (e.g., arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA)).

[0038] In some examples of the use of the present invention, the food product, beverage product, or feed is meat or meat-like product, such as burger, sausage, hot dog, minced or ground meat, steak, streaks, strips, tenderloins, grilled meat, breast meat, thigh meat, wings, meatloaf, fingers, nuggets, cutlets, diced meat, bacon, soup, gravy, sliced ​​meat, meatballs, fish, fried fish, or seafood, or imitations thereof. In one example, the food product, beverage product, or feed does not contain any animal or animal-derived ingredients. In another example, the food product, beverage product, or feed contains an animal or animal-derived ingredients, and optionally the animal or animal-derived ingredients are meat.

[0039] In certain embodiments of the use of the present invention, the food product, beverage product, or feed comprises one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof, or compounds containing an amino group (e.g., thiamine). In some examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof (or compounds containing an amino group) are present in the composition, food product, beverage product, or feed in an amount sufficient to produce a food-like aroma and / or flavor when the composition, food product, beverage product, or feed is heated. In certain examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are converted to 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octan ... and wherein the volatile compound is present in the composition, food product, beverage product, or feed in an amount sufficient to produce one or more volatile compounds selected from acetone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, or 1,3,5-titriane.In one example, the one or more sugars, sugar alcohols, sugar acids or sugar derivatives and one or more amino acids or derivatives or salts thereof are present in the composition, food product, beverage product, or feed in an amount sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl 1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol when the composition, food product, beverage product, or feed is heated.

[0040] In some examples of the uses of the present invention, the composition, food product, beverage product, or feed further comprises extracted lipids from Mortierella species that contain phospholipids.

[0041] In a particular embodiment of the use of the present invention, the composition, food product, beverage product, or feed comprises about 2.5% by weight or less of dry Mortierella spp. biomass or an equivalent amount of wet biomass.

[0042] Also provided is an isolated strain of Mortierella species selected from: i) yNI0125, deposited at the National Measurement Institute Australia under V21 / 019953 on 12 October 2021; ii) yNI0126, deposited at the Australian National Metrology Laboratory under V21 / 019951 on 12 October 2021; iii) yNI0127, deposited at the Australian National Metrology Laboratory under V21 / 019952 on 12 October 2021; and iv) yNI0132, deposited at the Australian National Metrology Laboratory on 12 October 2021 under V21 / 019954.

[0043] Also provided is an isolate of Mucor hiemalis yNI0121, deposited at the Australian National Metrology Laboratory on 4 February 2021 under deposit accession number V22 / 001757.

[0044] Exemplary embodiments of the present disclosure are herein described, by way of non-limiting example only, with reference to the following drawings: [Brief description of the drawings]

[0045] [Figure 1] 1 shows the biosynthetic pathway of polyunsaturated fatty acids.

[0046] [Diagram 2] 1 shows a schematic diagram of the pathway for phospholipid synthesis.

[0047] [Diagram 3] Figure 1 shows the profile of volatile compounds released by heating extracted lipids with a mixture of ribose and cysteine ​​as in Example 5, Experiment 3, as measured by gas chromatography-mass spectrometry (GC-MS). The level of each identified compound is shown as an area percentage (%) of the total compounds identified (left column, YL ARA PL%, right column, YL PL%).

[0048] [Figure 4-1] 1 shows the profile of volatile compounds released by the Maillard reaction of mixtures containing 2.5 or 5.0 mg of 18:0 / 18:1-phosphatidylcholine (PC) or ARA-PC as described in Example 5, Experiment 5, as measured by gas chromatography-mass spectrometry (GC-MS). For each compound, from left to right: Con-2.5, Con-5.0, ARA PC2.5, ARA PC5.0. [Figure 4-2] 1 shows the profile of volatile compounds released by the Maillard reaction of mixtures containing 2.5 or 5.0 mg of 18:0 / 18:1-phosphatidylcholine (PC) or ARA-PC as described in Example 5, Experiment 5, as measured by gas chromatography-mass spectrometry (GC-MS). For each compound, from left to right: Con-2.5, Con-5.0, ARA PC2.5, ARA PC5.0. [Figure 4-3]1 shows the profile of volatile compounds released by the Maillard reaction of mixtures containing 2.5 or 5.0 mg of 18:0 / 18:1-phosphatidylcholine (PC) or ARA-PC as described in Example 5, Experiment 5, as measured by gas chromatography-mass spectrometry (GC-MS). For each compound, from left to right: Con-2.5, Con-5.0, ARA PC2.5, ARA PC5.0.

[0049] [Diagram 5] Figure 1 shows the results of a sensory evaluation of meatiness of food product samples containing processed vegetable protein and various amounts of Mortierella alpina biomass. For each amount (percentage value), the columns from left to right are: aroma; taste; total.

[0050] [Figure 6] Figure 1 shows the results of a sensory evaluation of the pleasantness of food product samples containing processed vegetable protein and various amounts of Mortierella alpina biomass. For each amount (percentage value), the columns from left to right are: aroma; taste; total.

[0051] [Figure 7] The combined meatiness and agreeableness results of a sensory evaluation of food product samples containing processed vegetable protein and varying amounts of Mortierella alpina biomass are shown. The top of each row represents the total meatiness and the bottom of each row represents the total agreeableness.

[0052] [Figure 8] Figure 1 shows the meatiness results of the sensory evaluation of samples containing various concentrations of Maillard reaction matrix and Mortierella alpina biomass. For each concentration, the columns are (from left to right): odor; taste; total.

[0053] [Figure 9] Figure 1 shows the results of sensory pleasantness of samples containing various concentrations of Maillard reaction matrix and Mortierella alpina biomass. For each concentration, the columns are (from left to right): odor; taste; total.

[0054] [Figure 10] The results of the sensory evaluation of samples containing different concentrations of Maillard reaction matrix and Mortierella alpina biomass in terms of meatiness and pleasantness are shown.

[0055] [Figure 11] Figure 1 shows the combined meatiness and agreeableness results of the sensory evaluation of samples containing Maillard reaction products with Mortierella alpina biomass or Mortierella isabellina biomass. For each sample, the columns from left to right are agreeableness, meatiness, overall.

[0056] [Figure 12] Results of sensory evaluation of samples containing Mortierella alpina biomass and various amounts of Maillard reaction products with cystine are shown. In A and B, for each sample, columns are (from left to right): aroma; taste; total. In C, for each sample, columns are (from left to right): pleasantness total; meatiness total; total score.

[0057] [Figure 13] Results of sensory evaluation of food samples containing Mortierella alpina biomass and various amounts of Maillard reaction products with cystine. In A and B, for each sample, columns are (from left to right): aroma; taste; total. In C, for each sample, columns are (from left to right): pleasantness total; meatiness total; total score.

[0058] [Figure 14] Results of sensory evaluation of samples containing Mortierella alpina biomass and Maillard reaction products with various amounts of dextrose are shown. In A and B, for each sample, columns are, from left to right: aroma; taste; total. In C, for each sample, columns are, from left to right: pleasantness total; meatiness total; total score.

[0059] [Figure 15]Figure 1 shows the results of a sensory evaluation of food samples containing Mortierella alpina biomass and various amounts of Maillard reaction products with dextrose. In A and B, for each sample, columns are, from left to right: aroma; taste; total. In C, for each sample, columns are, from left to right: pleasantness total; meatiness total; total score.

[0060] [Figure 16] Figure 1 shows the results of a sensory evaluation of food samples containing Mortierella alpina biomass and Maillard reactants with various combinations of cysteine, cystine, ribose, and dextrose. In A and B, for each sample, the columns are, from left to right: aroma; taste; total. In C, for each sample, the columns are, from left to right: pleasantness total; meatiness total; total score.

[0061] [Figure 17] 3 shows the relative amounts of 57 volatile compounds identified by GC-MS in eight samples (S1-S8 as defined in Table 37) described in Example 17.

[0062] [Figure 18] 2 shows the results of a sensory evaluation of a composition comprising a Maillard reaction product with Mortierella biomass as described in Example 21.

[0063] [Figure 19] FIG. 1 shows a phylogenetic analysis of Mortierella species as described in Example 22. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0064] definition Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, exemplary methods and materials are described.

[0065] Throughout this specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" and "comprising" are understood to mean the inclusion of the stated steps or elements or integers or groups of steps or elements or integers, but not to the exclusion of any other steps or elements or integers or groups of steps or elements or integers. Thus, in the context of this specification, the term "comprising" means "including primarily, but not necessarily only."

[0066] In the context of this specification, the articles "a" and "an" refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0067] In the context of this specification, the term "about" is understood to refer to a range of numbers that one of skill in the art would consider equivalent to the recited value in the context to achieve the same function or result.

[0068] In the context of this specification, reference to a range of numbers disclosed herein (e.g., 1-10) also incorporates reference to all rational numbers within that range (e.g., 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9, and 10) and also any range of rational numbers within that range (e.g., 2-8, 1.5-5.5, and 3.1-4.7), and thus all subranges of all ranges explicitly disclosed herein are hereby expressly disclosed. These are only examples of what is specifically intended, and all possible combinations of numerical values ​​between the lowest and highest values ​​recited should be considered to be expressly set forth in this application as well.

[0069] As used herein, the term "and / or" means "and" or "or," or both.

[0070] The term "optionally" is used herein to mean that a subsequently described feature may or may not be present, or that a subsequently described event or circumstance may or may not occur. Thus, the specification will be understood to include and encompass embodiments in which a feature is present and embodiments in which a feature is not present, as well as embodiments in which an event or circumstance occurs and embodiments in which it does not occur.

[0071] As used herein, "lipid" refers to any of the classes of organic compounds that contain fatty acids, either esterified or unesterified, or their derivatives, which are insoluble in water but soluble in organic solvents, such as chloroform. As used herein, the term "extracted lipid" refers to a lipid composition extracted from microbial cells. The extracted lipid may be, for example, a relatively crude composition obtained by lysing the cells and separating the lipids, or a more purified composition in which most, if not all, of one or more or each of the water, nucleic acids, proteins, and carbohydrates derived from the cells have been removed. Examples of purification methods are described below. The extracted lipid may, for example, comprise at least about 10% by weight, at least about 20% by weight, at least about 30% by weight, at least about 40% by weight, at least about 50% by weight, at least about 60% by weight, at least about 70% by weight, at least about 80% by weight, at least about 90% by weight, or at least about 95% by weight (w / w) lipid of the composition. In certain embodiments, the extracted lipid comprises about 10% to 95% lipid by weight, e.g., about 10% to about 50% or about 50% to 95% lipid by weight. The lipid may be solid or liquid at room temperature (25° C.), or a mixture of the two; if liquid, it is considered to be an oil, and if solid, it is considered to be a fat. In one embodiment, the extracted lipid is not blended with another lipid produced from another source, e.g., animal lipid. Alternatively, the extracted lipid may be blended with a different lipid. The extracted lipid may contain all the lipids initially present in the microbial cell, or may contain only a portion of the lipids initially present in the microbial cell, e.g., the extracted lipid may have been processed to remove some or all of a particular type of lipid, e.g., to remove some or all of the neutral lipids (e.g., triacylglycerols (triglycerides, “TAGs”)) and retain the polar lipids (e.g., phospholipids).

[0072] As used herein, the term "polar lipid" refers to amphipathic lipid molecules with a hydrophilic head and a hydrophobic tail, including phospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine, phosphatidylglycerol, diphosphatidylglycerol), cephalin, sphingolipids (sphingomyelin and glycosphingolipids), phosphatidic acid, cardiolipin, and glyceroglycolipids. Phospholipids are composed of the following main structural units: fatty acids, glycerol, phosphoric acid, and amino alcohols. They are generally considered to be structural lipids that play an important role in the structure of plant, microbial, and animal membranes. From their chemical structure, polar lipids exhibit bipolarity and are soluble or partially soluble in both polar and nonpolar solvents.

[0073] The term "phospholipid" as used herein refers to an amphipathic molecule with a hydrophilic head and a hydrophobic tail, with a glycerol backbone esterified to the phosphate "head" group and two fatty acids providing the hydrophobic tail. The phosphate group can be modified with simple organic molecules such as choline, ethanolamine, or serine. With a charged head group at neutral pH, phospholipids are polar lipids and have some solubility in solvents such as chloroform as well as ethanol. Phospholipids are important components of all cell membranes. They can form lipid bilayers due to their amphipathic properties. Well-known phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidic acid (PA), phosphatidylglycerol (PG), diphosphatidylglycerol, and cardiolipin.

[0074] As used herein, the term "non-polar lipid" refers to fatty acids and their derivatives that are soluble in organic solvents but insoluble in water. The fatty acids can be free fatty acids and / or esterified forms. Examples of esterified forms include, but are not limited to, triacylglycerols (TAG), diacylglycerols (DAG), monoacylglycerols (MAG). Non-polar lipids also include sterols, sterol esters, and wax esters. Non-polar lipids are also known as "neutral lipids" or, in some contexts, "oils." Non-polar lipids can be liquid or solid at room temperature, depending on the degree of unsaturation of the fatty acids in the non-polar lipid. Typically, the more saturated the fatty acid content, the higher the melting temperature of the lipid.

[0075] As used herein, the term "fatty acid" refers to a carboxylic acid consisting of an aliphatic hydrocarbon chain and a terminal carboxyl group. The hydrocarbon chain can be either saturated or unsaturated. Unsaturated fatty acids include monounsaturated fatty acids, which have only one carbon-carbon double bond, and polyunsaturated fatty acids (PUFAs), which have at least two carbon-carbon double bonds, typically 2-6 carbon-carbon double bonds. The fatty acids may be free fatty acids (FFAs) or esterified to glycerol or glycerol-phosphate molecules (e.g., as phospholipids), CoA molecules, or other head groups known in the art.

[0076] As used herein, the term "total fatty acid (TFA) content" or variations thereof refers to the total amount of fatty acids, for example, in extracted lipids or microbial cells, on a weight basis. TFAs can be expressed as a weight percentage of cells or other fractions, for example, as a percentage of polar lipids. Unless otherwise stated, weights relative to cell weight are dry cell weights (DCW). In one embodiment, TFA content is measured by converting fatty acids to fatty acid methyl esters (FAMEs) or fatty acid butyl esters (FABEs) and measuring the amount of FAMEs or FABEs by GC, using the addition of a representative fatty acid standard of known amount as a quantitative standard in GC. Typically, the amount and fatty acid composition of lipids or compositions containing only fatty acids in the C10-C24 range are determined by conversion to FAMEs, while lipids or compositions containing fatty acids in the C4-C10 range are determined by conversion to FABEs. Thus, TFAs represent the weight of only fatty acids, not the weight of fatty acids and their combined moieties in the lipid or composition.

[0077] "Saturated fatty acids" do not contain any double bonds or other functional groups along the acyl chain. The term "saturated" refers to hydrogen in that all carbons (except the carboxylic acid [-COOH] group) contain as many hydrogens as possible.

[0078] An "unsaturated fatty acid" is one in which there are one or more alkene functional groups along the chain, and each alkene is linked to a single bond in the chain, -CH 2 -CH 2 They are of similar form to saturated fatty acids, except that a "-" moiety is replaced with a double bond "-CH=CH-" moiety (i.e., a carbon double bonded to another carbon). The two adjacent carbon atoms in the chain attached to either side of the double bond can be in a cis or trans configuration, preferably in the cis configuration.

[0079] As used herein, the term "monounsaturated fatty acid" refers to a fatty acid that contains at least 12 carbon atoms in the carbon chain and contains only one alkene group (carbon-carbon double bond) in the chain. Monounsaturated fatty acids include C12:1Δ9, C14:1Δ9, C16:1Δ9 (palmitoleic acid), C18:1Δ9 (oleic acid), and C18:1Δ11 (vaccenic acid).

[0080] As used herein, the term "polyunsaturated fatty acid" or "PUFA" refers to a fatty acid that typically contains at least 12 carbon atoms in the carbon chain and contains at least two alkene groups (carbon-carbon double bonds). Usually, the number of carbon atoms in the carbon chain of a fatty acid refers to an unbranched carbon chain. If the carbon chain is branched, the number of carbon atoms excludes the carbon atoms in the side groups, unless otherwise stated. In particular, "ω6 fatty acid", "omega-6 fatty acid", or "n-6 fatty acid" (these three terms are used interchangeably herein) has a final unsaturation (carbon-carbon double bond) at the sixth carbon-carbon bond from the methyl end of the fatty acid. Examples of ω6 fatty acids include arachidonic acid (ARA, C20:4Δ5,8,11,14; ω6), dihomo-γ-linolenic acid (DGLA, C20:3Δ8,11,14; ω6), eicosadienoic acid (EDA, C20:2Δ11,14; ω6), docosatetraenoic acid (DTA, C22:4Δ7,10,13,16; ω6), docosapentaenoic acid-ω6 (DPA-ω6, C22:5Δ4,7,10,13,16; ω6), γ-linolenic acid (GLA, C18:3Δ6,9,12; ω6) and linoleic acid (LA, C18:2Δ9,12; ω6). Omega-3 / n-3 fatty acids have a final unsaturation (carbon-carbon double bond) at the third carbon-carbon bond from the methyl end of the fatty acid. Examples of omega-3 fatty acids include alpha-linolenic acid (ALA, C18:3Δ9,12,15; ω3), hexadecatrienoic acid (C16:3ω3), eicosapentaenoic acid (EPA, C20:5Δ5,8,11,14,17; ω3), docosapentaenoic acid (DPA, C22:5Δ7,10,13,16,19; ω3), docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19; ω3), eicosatetraenoic acid (ETA, C20:4Δ8,11,14,17; ω3), and eicosatrienoic acid (ETrA, C20:3Δ11,14,17; ω3).

[0081] As used herein, "C12:0" refers to lauric acid. As used herein, "C14:0" refers to myristic acid. As used herein, "C15:0" refers to n-pentadecanoic acid. As used herein, "C16:0" refers to palmitic acid. As used herein, "C17:1" refers to heptadecenoic acid. As used herein, "C16:1Δ9" refers to palmitoleic acid or -hexadec-9-enoic acid. As used herein, "C18:0" refers to stearic acid. As used herein, "C18:1Δ9", sometimes shortened to "C18:1", refers to oleic acid. As used herein, "C18:1Δ11" refers to vaccenic acid. As used herein, "C20:0" refers to eicosanoic acid. As used herein, "C20:1" refers to eicosenoic acid. As used herein, "C22:0" refers to docosanoic acid. As used herein, "C22:1" refers to erucic acid. As used herein, "C24:0" refers to tetracosanoic acid.

[0082] A "triacylglyceride", "triglyceride", or "TAG" is a glyceride in which glycerol is esterified with three fatty acids, which may be the same (e.g., as in triolein) or, more commonly, different. All three of the fatty acids may be different, or two of the fatty acids may be the same and the third different. In the Kennedy pathway of TAG synthesis, DAG is formed as described below, and then the third acyl group is esterified to the glycerol backbone by the activity of diglyceride acyltransferase (DGAT). TAG is a form of non-polar lipid. The three acyl groups esterified in the TAG molecule are referred to as being esterified at the sn-1, sn-2, and sn-3 positions, referring to their positions in the glycerol backbone of the TAG molecule. Although the sn-1 and sn-3 positions are chemically identical, biochemically, the acyl groups esterified at the sn-1 and sn-3 positions differ in that separate and distinct acyltransferase enzymes catalyze the esterification.

[0083] "Diacylglyceride", "diglyceride" or "DAG" is a glyceride in which glycerol is esterified with two fatty acids, which may be the same or preferably different. As used herein, DAG does not include hydroxyl groups at the sn-1,3 or sn-2 positions, and therefore does not include phosphorylated glycerolipid molecules (e.g., PA or PC). In the Kennedy pathway of DAG synthesis, the precursor sn-glycerol-3-phosphate (G3P) is esterified to two acyl groups, each derived from a fatty acid coenzyme A ester, in the first reaction catalyzed by glycerol-3-phosphate acyltransferase (GPAT) at the sn-1 position to form LysoPA, followed by a second acylation at the sn-2 position catalyzed by lysophosphatidic acid acyltransferase (LPAAT) to form phosphatidic acid (PA). This intermediate is then dephosphorylated by PAP to form DAG.

[0084] As used herein, an "oil" is a composition that contains primarily lipids and is liquid at room temperature.

[0085] As used herein, an "oleaginous" cell or microorganism is one that can store lipids of at least 20% of its cell mass on a dry weight basis, such as 20% to 70%. The lipid content can vary depending on the culture conditions, as is known in the art. It is understood that as long as a microorganism can synthesize and accumulate at least 20% lipids on a dry cell weight basis under at least one set of culture conditions, it is considered an oleaginous cell, even if it accumulates less than 20% lipids under different conditions.

[0086] As used herein, a "heterotrophic" cell is a cell that can utilize organic matter as a carbon source for metabolism and growth. Heterotrophic organisms may also be capable of growing autotrophically under suitable conditions.

[0087] As used herein, "fermentation" refers to a metabolic process that produces chemical changes in organic substrates through the action of enzymes in cells under conditions that either lack oxygen or have reduced levels of oxygen compared to air.

[0088] As used herein, "meat-like flavor and / or aroma" or "meat-related flavor and / or aroma" or "meat-like flavor and / or aroma" refers to flavors and / or aromas that are the same as or similar to one or more meats, e.g., beef, steak, chicken, e.g., roasted chicken or skin, pork, lamb, duck, venison, chicken or other meat soups, broth or liver. Such aromas are typically detected by human participants, e.g., by a qualified sensory panel. Meat-like or meat-related flavors and / or aromas can also be detected by evaluating volatile compounds that arise after cooking of a composition or foodstuff. Volatile compounds exhibiting meat-like or meat-related aromas and flavors are known in the art and include 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanol, 1-octanol, 2-hexan ... Examples of such amines include, but are not limited to, tanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, and 1,3,5-titriane, as exemplified herein.

[0089] Compositions, food and beverage products and feed The present invention relates to the use of phospholipid-containing microbial biomass, such as phospholipid-containing Mortierella sp. biomass, in a composition, food product, beverage product, or feed. The present invention further relates to a composition, food product, beverage product, or feed comprising a microbial biomass, such as a phospholipid-containing Mortierella sp. biomass. The present invention also relates to a composition capable of producing a food-like aroma when heated, the composition comprising a microbial biomass, one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives thereof.

[0090] As will be appreciated, the compositions of the present invention may include food products, beverage products, or feed. Thus, the term "composition" encompasses non-food compositions and compositions that are food products, beverage products, or feed. In certain embodiments, the compositions are concentrated liquid or solid "flavoring compositions" that can be added to other ingredients to produce food products, beverage products, or feed with a desired flavor. In other embodiments, the term composition is used interchangeably with food products, beverage products, or feed.

[0091] In certain embodiments, the present invention provides a composition capable of producing a food-like aroma and / or flavor when heated, comprising: a) a biomass containing phospholipids, such as a Mortierella species biomass; b) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and c) Compositions comprising one or more amino acids or derivatives or salts thereof, or compounds containing an amino group (e.g., thiamine).

[0092] The compositions, food products, beverage products, or feeds of the present disclosure are suitable for human or animal consumption, typically at least for human consumption.

[0093] The present invention relates to a food product, a beverage product, or a feed, including a composition and a food product, a beverage product, or a feed comprising the composition of the present invention. The composition of the present invention can be incorporated into a food product, a beverage product, or a feed to provide a desired food-like aroma. The food product, the beverage product, or the feed is suitable for human or animal consumption, typically at least for human consumption. A food product, a beverage product, or a feed is a preparation for human or animal consumption, which when incorporated into the body (a) functions to nourish or build tissues or provide energy, and / or (b) maintain, restore, or support proper nutritional status or metabolic function. A "food product" may generally be considered to include solid, semi-solid, or flavored liquid products, a "beverage product" may generally be considered to include liquid drinkable products, and a "feed" may generally be considered to include animal food, such as livestock. It will be understood that there is an overlap in meaning between the terms "food product", "beverage product", and "feed stock", and that these terms may be used interchangeably in some contexts.

[0094] In certain embodiments, the food product, beverage product, or feed is a meat or fish substitute, i.e., a food product or beverage product intended to mimic a food product or beverage product that typically contains meat or fish, for example for use in a vegetarian or vegan diet. In some alternative embodiments, the food product, beverage product, or feed may be a product that contains meat or fish, and the composition of the present invention may be included to provide an additional or alternative flavor or aroma to the product. For example, the food product, beverage product, or feed product may include meat obtained from an animal and / or cultivated or cultured meat (i.e., meat produced by culturing animal cells in vitro). In some examples, the food product, beverage product, or feed product is a blend of meat (e.g., meat obtained from an animal and / or cultivated or cultured meat) and non-animal protein (e.g., plant or microbial protein). Suitable food products, beverage products, or feeds include, but are not limited to, meat or fish substitutes or meat or fish-based products, soup bases, stew bases, snack foods, bouillon powders, bouillon cubes, flavor packets, seasonings, or frozen food products. For example, in some particular embodiments, the food or beverage product may be, or may be intended to imitate, e.g., a burger, sausage, hot dog, minced or ground meat, steak, streaks, strips, tenderloins, grilled meat, breasts, thighs, wings, meatloaf, fingers, nuggets, cutlets, diced meat, bacon, soup, gravy, sliced ​​meat, meatballs, fish, fried fish, or seafood.

[0095] In a particularly preferred embodiment, the food product is a meat or meat-like product. A "meat-like product" is readily understood to refer to a product that resembles a meat product, but does not necessarily contain any meat, such as a meat substitute burger, sausage, minced meat, meatballs, strips, or other product. In some examples, the meat-like product does not include animal products. In other examples, the meat or meat-like product includes cultured meat (i.e., meat produced by culturing animal cells in vitro).

[0096] Ingredients and methods for producing foods, feeds, and beverages, including meat substitutes, are well known in the art (see, e.g., WO2008124370, WO2013010042, WO2015153666, and WO2017070303, the entire contents of which are incorporated by reference in their entireties), and can be used with microbial biomass (e.g., Mortierella sp. biomass) or the compositions of the invention to produce foods, feeds, or beverages.

[0097] The biomass and / or extracted lipids comprising phospholipids disclosed herein, and / or the compositions of the present invention can be used to adjust the flavor and / or aroma of a food product, beverage product, or feed by enhancing or changing the flavor and / or aroma of the food product, beverage product, or feed. For example, the biomass and any extracted lipids comprising phospholipids disclosed herein, and / or the compositions of the present disclosure can enhance or change the flavor and / or aroma of a food product, beverage product, or feed, for example, by enhancing a meat-, fish-, or vegetable-like flavor and / or aroma, or by introducing such a flavor and / or aroma into the food product, beverage product, or feed. In some embodiments, the biomass and any extracted lipids comprising phospholipids disclosed herein, or the compositions, food product, beverage product, or feed of the present disclosure, are intended to be added as an ingredient to a separate product to enhance or adjust the taste and / or aroma of the separate product to which it is added, for example, by enhancing the meatiness or fishiness of the separate product, or by changing the aroma or flavor of the product. The biomass and any extracted lipids comprising the phospholipids disclosed herein, or the compositions, food products, beverage products, or feeds of the present disclosure, can be used to enhance or modify the taste and / or aroma profile of, for example, meat substitutes, meat substitutes, tofu, seitan, mock duck or gluten-based vegetable products, processed plant proteins such as processed soy protein, pork, fish, lamb, or poultry products such as chicken or turkey products, and can be applied to other food products before or during cooking. In some embodiments, the biomass and any extracted lipids comprising the phospholipids disclosed herein, or the compositions, food products, beverage products, or feeds described herein can be used to impart a particular meat-like taste and odor, for example, beef taste and odor, to a non-meat or poultry product.

[0098] In particularly preferred embodiments, the compositions of the present disclosure contain less than 20% protein derived from a source other than the Mortierella sp. (or other microbial) biomass, optionally less than 15%, less than 10%, less than 5%, or no protein other than that provided by the Mortierella sp. (or other microbial) biomass. In contrast, the food products, beverage products, and feeds of the present disclosure may optionally contain more than 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40% added protein.

[0099] As exemplified herein, the inventors have found that certain microbial biomasses, including Mortierella spp. biomasses containing phospholipids, produce food-like aromas, particularly meaty aromas, in compositions, food products, beverage products, or feeds of the invention when heated, which are believed to be due to the occurrence of the Maillard reaction. Mortierella spp. biomasses containing phospholipids are used to provide aromas and / or flavors to food products and beverage products and feeds, or to enhance the aromas and / or flavors of food products and beverage products and feeds, particularly meaty and fishy aromas and / or flavors, for example, in meat or fish substitute food products that do not contain animal meat, fish, or other animal products. It has been found that the inclusion of Mortierella spp. biomasses containing phospholipids in such compositions or food products, beverage products, or feeds is particularly effective in producing food-like aromas, such as meaty aromas. The biomass typically comprises whole cells of the microorganism, and may be a crude mixture of cells and cell-derived compounds, such as lipids, proteins, carbohydrates, such as sugars and glucans, and nucleic acids. The cells may be live, inactivated, dead, or a mixture thereof.

[0100] The exact amount of microorganism (e.g., Mortierella spp. or Yarrowia spp.) and / or extracted lipid, preferably phospholipid, in the compositions of the present disclosure can vary depending, for example, on the identity of the microorganism, the morphology and moisture content of the biomass of the microorganism, the total lipid or phospholipid content and profile contained in the microorganism, the intensity of the desired flavor and / or aroma, and the intended use of the composition. In some examples, the composition (e.g., concentrated flavor composition) comprises at least or about 1%, 2%, 3%, 4%, 5%, 5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, or 25% dry biomass or an equivalent amount of wet biomass. In some examples, the compositions of the invention comprise 1%-50%, 1%-40%, 1%-30%, 1%-20%, 5%-30%, 5%-20%, or 5%-15% by weight of dry biomass or an equivalent amount of wet biomass. In preferred embodiments, the food product, beverage product, or feed of the invention comprises less than 5% dry biomass (e.g., less than 5% by weight of dry Mortierella spp.) or an equivalent amount of wet biomass. As demonstrated herein, an unpleasant taste profile may result when the amount of biomass in a food product, beverage product, or feed exceeds a certain level. Thus, in some examples, the food product, beverage product, or feed of the present invention comprises about 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% by weight or less of dry biomass (e.g., dry Mortierella spp. biomass) or an equivalent amount of wet biomass.

[0101] In some embodiments, the compositions (e.g., concentrated flavor compositions) of the present disclosure comprise at least about 1 mg of wet microbial (e.g., Mortierella spp.) biomass per gram of dry composition or slurry, or per mL of liquid composition, in particular at least about 5 mg, preferably at least about 10 mg, more preferably at least about 15 mg of wet biomass, e.g., at least about 20 mg, at least about 25 mg, at least about 30 mg, or at least about 40 mg of wet biomass. In embodiments in which dry biomass is used, the compositions of the present disclosure comprise at least about 0.25 mg, at least about 0.5 mg, at least about 1 mg, at least about 1.25 mg, at least about 1.5 mg, at least about 2 mg, at least about 3 mg, at least about 5 mg, at least about 7 mg, or at least about 10 mg of dry biomass per gram of dry composition or slurry, or per mL of liquid composition, weight or volume being measured based on the weight or volume of the composition excluding / before the addition of biomass and any extracted lipids. In certain embodiments, compositions of the present disclosure (e.g., concentrated flavor compositions) include from about 1 mg to about 200 mg of wet biomass per gram of dry composition or slurry, or per mL in the case of a liquid composition, e.g., from about 5 mg to about 200 mg, from about 7 mg to about 200 mg, from about 10 mg to about 200 mg, from about 20 mg to about 200 mg, from about 25 mg to about 200 mg, from about 30 mg to about 200 mg, from about 40 mg to about 200 mg, from about 30 mg to about 175 mg, or from about 40 mg to about 175 mg of wet biomass. In certain embodiments in which dry biomass is used, the composition of the present disclosure (e.g., concentrated flavor composition) may contain about 0.25 mg to about 100 mg, such as about 0.5 mg to about 100 mg, for example, about 1 mg to about 100 mg, for example, about 5 mg to about 100 mg, for example, about 10 mg to about 100 mg, for example, about 10 mg to about 80 mg, for example, about 10 mg to about 70 mg, for example, about 15 mg to about 60 mg, for example, about 10 mg to about 50 mg of dry biomass per gram of dry composition or slurry, or per mL in the case of a liquid composition.

[0102] According to some embodiments, the composition may comprise, for example, at least about 5 mg of phospholipids extracted from a microorganism (e.g., Mortierella sp.), e.g., at least about 10 mg or at least about 15 mg of phospholipids extracted from a microorganism, per gram of dry composition or slurry, or per mL in the case of a liquid composition, the weight or volume being measured based on the weight or volume of the composition excluding / before the addition of biomass and extracted lipid. According to some embodiments, the composition comprises about 10 mg to about 100 mg, e.g., about 10 mg to about 80 mg, e.g., about 10 to about 70 mg, e.g., about 10 to about 60 mg, particularly preferably about 10 to about 50 mg of extracted lipids comprising phospholipids extracted from a microorganism. According to some embodiments, the composition of the present disclosure provides at least about 15 mg, e.g., at least about 20 mg of extracted lipids comprising phospholipids extracted from a microorganism.

[0103] The food products, beverage products, and feeds of the present disclosure, particularly meat or meat-like food products, may, according to preferred embodiments, comprise less than about 5% by weight dry biomass (e.g., Mortierella species biomass) or less than about 20% by weight wet biomass. In some embodiments, the food products, beverage products, or feeds of the present disclosure, particularly meat or meat-like food products, comprise less than about 4.5% by weight, less than about 4.0% by weight, less than about 3.5% by weight, less than about 3% by weight, less than about 2.5% by weight, less than about 2% by weight, less than about 1.5% by weight, less than about 1% by weight, or less than about 0.5% by weight dry biomass, or less than about 18% by weight, less than about 16% by weight, less than about 15% by weight, less than about 14% by weight, less than about 12% by weight, less than about 10% by weight, less than about 8% by weight, less than about 6% by weight, less than about 5% by weight, less than about 4% by weight, less than about 3% by weight, less than about 2% by weight, or less than about 1% by weight wet biomass. In some particular embodiments, the food products, beverage products, or feeds of the present disclosure, particularly meat or meat-like food products, comprise about 2.5% or less by weight dry biomass or about 10% or less by weight wet biomass.

[0104] Food products, beverage products, and feeds of the present disclosure, particularly meat or meat-like food products, according to some embodiments, may comprise at least about 0.005%, at least about 0.01%, at least about 0.025%, at least about 0.05%, at least about 0.1%, at least about 0.5%, at least about 1%, or at least about 1.25% by weight of dry biomass (e.g., Mortierella species biomass), or at least about 0.05%, at least about 0.1%, at least about 0.25%, at least about 0.5%, at least about 1%, at least about 2.5%, or at least about 5% by weight of wet biomass. In certain embodiments, food products, beverage products, or feeds of the present disclosure, particularly meat or meat-like food products, comprise at least about 0.025% by weight of dry biomass or at least about 0.1% by weight of wet biomass.

[0105] The food products, beverage products, and feeds of the present disclosure, particularly meat or meat-like food products, according to some particular embodiments, may have an omega-3 fatty acid content of about 0.005% to about 5% by weight (or less than about 5% by weight, such as about 4% by weight or 3% by weight or 2% by weight or 1% by weight), about 0.001% to about 5% by weight (or less than about 5% by weight, such as about 4% by weight or 3% by weight or 2% by weight or 1% by weight), about 0.025% to about 5% by weight (or less than about 5% by weight, such as about 4% by weight or 3% by weight or 2% by weight or 1% by weight), for example about 0.05% to about 5% by weight (or less than about 5% by weight, such as about 0.005% to about 5% by weight). % (or less than about 20 wt %), such as about 0.1% to about 5% (or less than about 5% by weight, such as about 4% or 3% or 2% or 1% by weight), of dry biomass (e.g., Mortierella sp. biomass), or about 0.05% to about 20% (or less than about 20 wt %), 0.1% to about 20% (or less than about 20 wt %), such as about 0.25% to about 20% (or less than about 20 wt %), such as about 1% to about 20% (or about 20 wt %) of wet biomass. In some preferred embodiments, the food products, beverage products, and feeds of the present disclosure, particularly meat or meat-like food products, comprise from about 0.025% to about 5%, from about 0.025% to about 4%, or from about 0.025% to about 3% by weight of dry biomass, or from about 0.1% to about 20%, from about 0.1% to about 15%, or from about 0.1% to about 10% by weight of wet biomass.

[0106] The compositions of the invention include a microbial biomass, particularly a Mortierella species biomass, that contains phospholipids; one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or compounds that contain an amino group (e.g., thiamine). It is believed that the presence of one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof, or compounds that contain an amino group (e.g., thiamine) aids in the Maillard reaction that occurs when the composition (or the food product, beverage product, or feed in which the composition is present) is heated. In some embodiments, the phospholipid-containing biomass and / or the extracted lipids that contain phospholipids are used in a food product, beverage product, or feed, and the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof, or compounds that contain an amino group (e.g., thiamine) are provided by other ingredients in the food product, beverage product, or feed. The references below to preferred characteristics of one or more sugars, sugar alcohols, sugar acids or sugar derivatives, and one or more amino acids or derivatives or salts thereof when used in a composition of the invention may apply to the sugars, sugar alcohols, sugar acids or sugar derivatives, and amino acids or derivatives or salts thereof when present in a food product, beverage product or feed according to the invention.

[0107] Suitable sugars, sugar alcohols, sugar acids, or sugar derivatives are well known to those skilled in the art. In this context, the sugars, sugar alcohols, sugar acids, or sugar derivatives are suitable for use in the Maillard reaction for food, beverage, or feed applications. In this context, the sugars, sugar alcohols, sugar acids, or sugar derivatives are components other than the microorganisms or components thereof and amino acids or derivatives or salts thereof, even if the biomass or components thereof themselves contain sugars, sugar alcohols, sugar acids, or sugar derivatives. Suitable sugars, sugar alcohols, sugar acids, and sugar derivatives include glucose, fructose, ribose, sucrose, arabinose, glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate, inositol, maltose, molasses, maltodextrin, glycogen, galactose, lactose, ribitol, gluconic acid and glucuronic acid, amylose, amylopectin, or xylose. In particularly preferred embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives comprise one or more of ribose, glucose (dextrose), a combination of glucose and fructose, and xylose. In certain embodiments, the compositions, food products, beverage products, or feeds of the present invention comprise ribose. In other embodiments, the compositions, food products, beverage products, or feeds of the present invention comprise glucose (i.e., dextrose). In other embodiments, the compositions, food products, beverage products, or feeds of the present disclosure comprise both glucose and ribose.

[0108] According to some embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount of about 1 mmol to about 1000 mmol, e.g., about 5 mmol to about 500 mmol, about 5 mmol to about 300 mmol, about 20 mmol to about 500 mmol, about 20 mmol to about 300 mmol, about 5 mmol to about 200 mmol, about 5 mmol to about 100 mmol, about 5 mmol to about 80 mmol, about 5 mmol to about 70 mmol, about 10 mmol to about 70 mmol, about 15 mmol to about 70 mmol, or about 30 mmol to about 60 mmol, per kg of dry composition or slurry, or per L in the case of a liquid composition, measured based on the weight or volume of the composition excluding / before the addition of biomass and any extracted lipids. In some embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount of at least about 5 mmol, at least about 10 mmol, at least about 15 mmol, at least about 20 mmol, or at least about 30 mmol per kg of dry composition or slurry, or per L of liquid composition, measured based on the weight or volume of the composition excluding / before the addition of biomass and any extracted lipids. In some such embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives comprise ribose and / or glucose.

[0109] In some embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the food, feed, or beverage in a total amount of about 0.1 mmol to about 100 mmol, about 0.5 mmol to about 30 mmol, about 0.5 mmol to about 50 mmol, about 1 mmol to about 50 mmol, about 2 mmol to about 40 mmol, about 2 mmol to about 30 mmol, about 1 mmol to about 25 mmol, about 1 mmol to about 20 mmol, about 1 mmol to about 10 mmol, about 7 mmol to about 20 mmol, or about 7 mmol to about 15 mmol per kg of dry food or slurry, or per L in the case of a liquid food (e.g., beverage), measured based on the weight or volume of the food, feed, or beverage excluding / prior to the addition of microbial biomass and / or lipids. In some examples, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the food, feed, or beverage in an amount of at least about 0.5 mmol, at least about 1 mmol, at least about 1.5 mmol, at least about 2 mmol, or at least about 3 mmol per kg of dry food, feed, or beverage, or per L in the case of liquid food, feed, or beverage, measured based on the weight or volume of the composition excluding / before the addition of biomass and any extracted lipids. In some embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives comprise ribose and / or glucose.

[0110] Sugar "derivatives" are intended to encompass sugars that include modifications from naturally occurring sugars, for example, by modification of a substituent such as a hydroxyl group. For example, sugar derivatives may be modified to include alternative substituents such as amino groups, acid groups, phosphate groups, acetate groups, etc. Sugar derivatives include, but are not limited to, amino sugars, deoxy sugars, glycosylamines, and sugar phosphates.

[0111] The amino acid or its derivative or salt used in the present invention is suitable for use in the Maillard reaction for food, beverage or feed applications.In this context, an amino acid or its derivative or salt is a component other than a microorganism (e.g., Mortierella species biomass) or its components and sugar, sugar alcohol, sugar acid, or sugar derivative, even if the biomass or its components themselves contain amino acids or their derivatives or salts.In certain embodiments, one or more amino acids or their derivatives or salts contain free amino groups.Thus, in some embodiments, reference to an amino acid or derivative refers to a free amino acid that does not exist in the context of a peptide or protein. Suitable amino acids and their derivatives include cysteine, cystine, homocysteine, selenocysteine, cysteine ​​sulfoxide, allicin, selenocysteine, methionine, isoleucine, leucine, lysine, phenylalanine, threonine, tryptophan, 5-hydroxytryptophan, valine, arginine, histidine, alanine, asparagine, aspartic acid, glutamic acid or glutamic acid, glutamine, monosodium glutamate, glycine, proline, serine, taurine and tyrosine. In particularly preferred embodiments, the amino acid is cysteine ​​and / or cystine. In particularly preferred embodiments, the composition comprises cysteine. In some preferred embodiments, the composition, food product, beverage product, or feed comprises glutamic acid or a salt thereof. In some particularly preferred embodiments, the composition, food product, beverage product, or feed comprises glutamic acid or a salt thereof (e.g., monosodium glutamate, or MSG) in addition to one or more amino acids or derivatives or salts thereof. In some embodiments, for example, the composition, food product, beverage product, or feed comprises glutamic acid or a salt thereof and cysteine ​​(or cystine) or a salt thereof. In some embodiments, the one or more amino acids or derivatives or salts thereof comprise a sulfur-containing amino acid (e.g., cysteine, methionine, homocysteine, or taurine) or a salt. Amino acid salts suitable for human or animal consumption and therefore suitable for incorporation into the compositions, food products, beverage products, or feeds of the present disclosure are well known to and can be readily selected by those of skill in the art.

[0112] Amino acid "derivatives" are intended to encompass amino acids that contain chemical modifications, for example, by introducing groups into the side chain of the amino acid, such as a nitro group in tyrosine or iodine in tyrosine, by converting a free carboxyl group into an ester or amide group, by converting an amino group into an amide by acylation, by acylation of a hydroxy group into an ester, by alkylation of a primary amine into a secondary amine, or by attachment of a hydrophilic moiety to the amino acid side chain. Other derivatives can be obtained by oxidation or reduction of the side chain of the amino acid. Modification of an amino acid can also include derivatization of the amino acid by addition and / or removal of chemical groups to / from the amino acid, and may include the use of amino amino acid analogs (such as phosphorylated amino acids) or unnatural amino acids such as N-alkylated amino acids (e.g., N-methyl amino acids), D-amino acids, β-amino acids, or γ-amino acids. Exemplary derivatives include derivatives obtained by attaching a derivative moiety, i.e., a substituent, to the amino acid. The term "derivative" in the context of an amino acid will be readily understood by one of skill in the art.

[0113] According to some embodiments, each of the one or more amino acids or derivatives or salts thereof is present in the composition in an amount of about 1 mmol to about 500 mmol, about 1 mmol to about 300 mmol, about 1 mmol to about 200 mmol, about 2 mmol to about 200 mmol, about 2 mmol to about 100 mmol, about 2 mmol to about 200 mmol, about 5 mmol to about 100 mmol, about 5 mmol to about 80 mmol, about 5 mmol to about 70 mmol, about 10 mmol to about 70 mmol, about 15 mmol to about 70 mmol, about 30 mmol to about 60 mmol, about 1 mM to about 50 mM, or about 130 mM per kg of dry composition or slurry, or per L in the case of a liquid composition, calculated based on the weight or volume of the composition excluding / before the addition of the phospholipid-containing biomass and any extracted lipids. In some embodiments, the one or more amino acids or derivatives or salts thereof are present in the composition in an amount of at least about 1 mmol, such as at least about 5 mmol, such as at least about 10 mmol, such as at least about 15 mmol, such as at least about 20 mmol, per kg of dry composition or slurry, or per L in the case of a liquid composition, measured based on the weight or volume of the composition excluding / before the addition of biomass and any extracted lipids. In some such embodiments, the one or more amino acids comprise cysteine ​​or cystine.

[0114] According to some embodiments, the one or more amino acids or derivatives or salts thereof are each present in the food, feed, or beverage in a total amount of about 0.1 mmol to about 50 mmol, about 0.1 mmol to about 40 mmol, about 0.1 mmol to about 30 mmol, about 0.5 mmol to about 40 mmol, about 0.5 mmol to about 30 mmol, about 1 mmol to about 10 mmol, about 1.5 mmol to about 10 mmol, about 0.5 to about 5 mmol, about 1 mmol to about 5 mmol, or about 5 to about 10 mmol per kg of dry composition or slurry, or per L in the case of a liquid food (e.g., beverage), calculated based on the weight or volume of the food, feed, or beverage excluding / before the addition of microbial biomass and / or lipids. In a preferred embodiment, the one or more amino acids comprise cysteine ​​and / or cystine.

[0115] The one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof, or compounds containing an amino group (e.g., thiamine) are present in a composition of the present disclosure or a food product, beverage product, or feed of the present disclosure in an amount sufficient to produce a food-like aroma, such as a meaty aroma, when the composition, food product, beverage product, or feed is heated. In certain embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are converted to 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1- One or more volatile compounds selected from pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, and 1,3,5-titriane are present in a composition of the present disclosure or a food product, beverage product, or feed of the present disclosure in an amount sufficient to produce, for example, two or more, three or more, four or more, or five or more of the above compounds.In some particular embodiments, the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof are present in a composition of the present disclosure, or a food product, beverage product, or feed of the present disclosure, in an amount sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol when the composition, food product, beverage product, or feed is heated.

[0116] In some embodiments, the composition comprises glutamic acid or a salt or derivative thereof (e.g., MSG) in addition to one or more amino acids or derivatives or salts thereof. In some embodiments, the glutamic acid or salt thereof is present in an amount of about 1 mmol to about 200 mmol or about 2 mmol to about 100 mmol, such as about 2 mmol to about 50 mmol, such as about 2 mmol to about 40 mmol, such as about 2 mmol to about 40 mmol, such as about 5 mmol to about 40 mmol, such as about 5 mmol to about 30 mmol, per kg of dry composition or slurry, or per L in the case of a liquid composition, calculated based on the volume of the composition excluding / before the addition of the biomass containing phospholipids and any extracted lipids. In some embodiments, glutamic acid or a salt thereof is present in an amount of at least about 1 mmol, such as at least about 2 mmol, such as at least about 3 mmol, such as at least about 4 mmol, such as at least about 5 mmol, such as at least about 7 mmol, such as at least about 10 mmol per kg of dry composition or slurry, or per L in the case of a liquid composition, measured based on the weight or volume of the composition excluding / before the addition of biomass and any extracted lipids. In some embodiments, the glutamate salt is monosodium glutamate.

[0117] In some embodiments, the food or beverage product or feed of the invention comprises, in addition to one or more amino acids or derivatives or salts thereof, glutamic acid or a salt or derivative thereof (e.g., MSG), wherein the glutamic acid is present in an amount of from about 0.1 mmol to about 20 mmol, from about 0.1 mmol to about 15 mmol, from about 0.3 mmol to about 15 mmol, from about 0.5 mmol to about 10 mmol, from about 0.5 mmol to about 5 mmol, or from about 1 mmol to about 5 mmol per kg of dry composition or slurry, or per L in the case of a liquid composition (e.g., a beverage), calculated based on the volume of the food, feed, or beverage excluding / before the addition of microbial biomass and / or lipids.

[0118] In some embodiments, the composition comprises glutamic acid or a salt thereof and a further amino acid or a salt or derivative thereof selected from cysteine ​​and cystine (or a salt or derivative thereof), and the glutamic acid or salt thereof is present in an amount of about 1 mmol to about 200 mmol, or about 2 mmol to about 100 mmol, for example, 2 mmol to about 50 mmol, for example, about 2 mmol to about 40 mmol, for example, about 2 mmol to about 40 mmol, for example, about 5 mmol to about 40 mmol, for example, about 5 mmol to about 40 mmol, for example, about 5 mmol to about 5 ... For example, it is present in an amount of about 5 mmol to about 30 mmol, and cysteine ​​or cystine (or a salt or derivative thereof) is present in an amount of about 5 mmol to about 200 mmol or about 5 mmol to about 100 mmol, for example, about 5 mmol to about 80 mmol, for example, about 5 mmol to about 70 mmol, for example, about 10 mmol to about 70 mmol, for example, about 15 mmol to about 70 mmol, for example, about 30 mmol to about 60 mmol, the amounts being calculated based on the weight or volume of the composition excluding / before the addition of the phospholipid-containing biomass and any extracted lipids. In some embodiments the composition comprises glutamic acid or a salt thereof and a further amino acid selected from cysteine ​​and cystine or a salt or derivative thereof, wherein the glutamic acid or salt thereof is present in an amount of at least about 1 mmol, such as at least about 2 mmol, for example at least about 3 mmol, such as at least about 4 mmol, for example at least about 5 mmol, such as at least about 7 mmol, for example at least about 10 mmol per kg of dry composition or slurry, or per L in the case of a liquid composition, and the cysteine ​​or cystine (or a salt or derivative thereof) is present in an amount of at least about 5 mmol, such as at least about 10 mmol, for example at least about 15 mmol, for example at least about 20 mmol, calculated based on the weight or volume of the composition excluding / before the addition of the biomass including phospholipids and any extracted lipids.

[0119] In some embodiments, the food product, beverage product, or feed comprises glutamic acid or a salt thereof and a further amino acid or a salt or derivative thereof selected from cysteine ​​and cystine (or a salt or derivative thereof), and the glutamic acid or salt thereof is present in an amount of about 0.1 mmol to about 20 mmol, or about 0.2 mmol to about 10 mmol, for example, 0.2 mmol to about 5 mmol, for example, about 0.2 mmol to about 4 mmol, for example, about 0.5 mmol to about 4 mmol, for example, about 0.5 mmol to about 5 mmol, per kg of dry composition or slurry, or per L in the case of a liquid composition. and cysteine ​​or cystine (or a salt or derivative thereof) is present in an amount of about 0.5 mmol to about 50 mmol or about 0.5 mmol to about 20 mmol, such as about 0.5 mmol to about 10 mmol, for example, about 0.5 mmol to about 8 mmol, for example, about 0.5 mmol to about 7 mmol, such as about 1 mmol to about 7 mmol, for example, about 1.5 mmol to about 7 mmol, for example, about 3 mmol to about 6 mmol, the amounts being calculated based on the weight or volume of the composition excluding / before the addition of the phospholipid-containing biomass and any extracted lipids. In some embodiments the composition comprises glutamic acid or a salt thereof and a further amino acid selected from cysteine ​​and cystine or a salt or derivative thereof (or a salt or derivative thereof), wherein the glutamic acid or salt thereof is present in an amount of at least about 0.1 mmol, such as at least about 0.2 mmol, for example at least about 0.3 mmol, such as at least about 0.4 mmol, for example at least about 0.5 mmol, such as at least about 0.7 mmol, for example at least about 1 mmol per kg of dry composition or slurry or per L in the case of a liquid, and the cysteine ​​or cystine (or a salt or derivative thereof) is present in an amount of at least about 0.5 mmol, such as at least about 1 mmol, for example at least about 1.5 mmol, for example at least about 2 mmol, the amounts being calculated based on the weight or volume of the composition excluding / before the addition of the biomass including phospholipids and any extracted lipids.

[0120] The composition, food product, beverage product, or feed of the present invention may include an iron source according to some preferred embodiments. Iron may enhance the meaty flavor and / or aroma produced by the composition, food product, beverage product, or feed of the present invention. In some embodiments, the iron source is an iron salt, preferably a ferrous salt. Any iron salt suitable for ingestion may be used, such salts being well known to those skilled in the art, for example, chelated forms of iron. In some embodiments, the iron source is ferrous fumarate. Ferrous fumarate is available, for example, as iron tablets from APOHEALTH Pty Ltd (New South Wales, Australia). Even if the biomass or a component thereof itself contains iron, the iron source is a component other than the biomass or a component thereof, an amino acid or a salt or derivative thereof, and a sugar, a sugar alcohol, a sugar acid, or a sugar derivative.

[0121] In certain embodiments, the compositions of the invention comprise an iron source in an amount equivalent to up to about 100 mg of elemental iron per kg of dry composition or slurry, or per L of liquid composition. In some embodiments, the compositions comprise an iron source in an amount equivalent to up to about 50 mg, e.g., about 20 to about 50 mg, e.g., about 30 to about 40 mg, the concentration being calculated based on the volume of the composition excluding / before the addition of biomass, including phospholipids, and any extracted lipids.

[0122] In a particularly preferred embodiment, the composition, food product, beverage product, or feed of the present disclosure comprises an aqueous component. The presence of some moisture in the composition promotes the production of food-like flavors and / or aromas upon heating. The aqueous component may be water. In some embodiments, the aqueous component may be an aqueous buffer, such as, for example, a phosphate buffer. In certain embodiments, the composition, food product, beverage product, or feed of the present disclosure comprises an aqueous component apart from any water incidentally contained in other components, such as any moisture present in a microbial biomass. The composition of the present disclosure is, in some preferred embodiments, not dry or substantially not dry.

[0123] In one embodiment, the composition, food product, beverage product, or feed is a dry composition. In another embodiment, the composition, food product, beverage product, or feed is a liquid composition. In one embodiment, the composition, food product, beverage product, or feed is in the form of a powder, solution, suspension, slurry, or emulsion. In some embodiments, the composition, food product, beverage product, or feed is provided excluding aqueous components (i.e., a dry composition), and aqueous components (such as water) are added to the composition, food product, beverage product, or feed before or in conjunction with heating.

[0124] In some embodiments, the composition, food product, beverage product, or feed of the present disclosure may further comprise an aqueous buffer. The buffer maintains the pH of the composition and provides moisture to the composition, food product, beverage product, or feed, which promotes the production of food-like flavor and / or aroma upon heating, as described above. In some embodiments, the buffer may be a phosphate buffer. In some embodiments, the buffer may be a buffer with a pH of about 5.0 to about 7, such as about 5 to about 6, such as about 5.3 or about 6.0. In a particular embodiment, the buffer is a phosphate buffer with a pH of about 6.0.

[0125] The composition, food product, beverage product, or feed of the present invention may further comprise one or more additional ingredients. Such ingredients may be, for example, flavor precursors intended to participate in the Maillard reaction that occurs when the composition, food product, beverage product, or feed is heated. For example, such additional ingredients may include oils (e.g., vegetable oils), free fatty acids, alpha-hydroxy acids, dicarboxylic acids, nucleosides, nucleotides, vitamins, peptides, protein hydrolysates, extracts, phospholipids, lecithin, carbohydrates, and organic molecules. In a particular example, the composition of the present invention may be a flavoring composition (e.g., for incorporation into a food product, feed, or beverage to provide a food-like flavor, such as a meat-like flavor), and comprises less than 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or 30% by weight of protein other than that provided by the biomass (e.g., Mortierella species biomass).

[0126] In some embodiments, the composition, food product, beverage product, or feed comprises thiamine or a derivative thereof. For example, thiamine can be present as a compound containing an amino group, thus enabling the Maillard reaction. Thus, the composition, food product, beverage product, or feed of the present invention may comprise a) biomass, b) a sugar, a sugar alcohol, a sugar acid, or a sugar derivative, and c) thiamine. In other examples, the composition, food product, beverage product, or feed of the present invention may comprise a) biomass, b) a sugar, a sugar alcohol, a sugar acid, or a sugar derivative, c) one or more amino acids or derivatives or salts thereof, and d) thiamine. Thus, thiamine may enhance the meaty aroma and / or flavor produced by the composition, food product, beverage product, or feed of the present invention. In some embodiments, thiamine may be present in the composition in an amount of about 0.1 to about 20 mmol, such as about 0.1 to about 10 mmol, such as about 0.5 to about 5 mmol, such as about 0.5 to about 3 mmol, per kg of dry composition or slurry, or per L in the case of a liquid composition. In some embodiments, thiamine is present in an amount of at least about 0.1 mmol, such as at least about 0.2 mmol, such as at least about 0.3 mmol, such as at least about 0.4 mmol, such as at least about 0.5 mmol, such as at least about 0.7 mmol, the concentration being calculated based on the weight or volume of the composition excluding / before the addition of biomass including phospholipids and any extracted lipids. In some embodiments, thiamine may be present in the food product, feed, or beverage in an amount of about 0.01 to about 2 mmol, such as about 0.01 to about 1 mol, such as about 0.05 to about 0.5 mmol, or about 0.1 to about 0.3 mmol, per kg of dry composition or slurry, or per L in the case of a liquid composition (e.g., a beverage), the amount being calculated based on the weight or volume of the food, feed, or beverage excluding / before the addition of microbial biomass and / or lipids.In some embodiments, thiamine is present in the food, feed, or beverage in an amount of at least about 0.01 mmol, such as at least about 0.02 mmol, such as at least about 0.03 mmol, such as at least about 0.04 mmol, such as at least about 0.05 mmol, such as at least about 0.07 mmol, the concentration being calculated based on the weight or volume of the food, feed, or beverage excluding / prior to the addition of the biomass including phospholipids and any extracted lipids.

[0127] In some embodiments, the composition, food product, beverage product, or feed further comprises yeast extract. In the field of food science, "yeast extract" is generally understood to refer to the water-soluble portion of autolyzed yeast and is commercially available from various suppliers. See, for example, Sigma Aldrich, Cat. No. Y1625 Yeast Extract. Yeast extract does not contain whole yeast cell biomass. The presence of yeast extract may enhance the meaty aroma and / or flavor produced by the composition, food product, beverage product, or feed when heated. The yeast extract may be a general unflavored yeast extract or may be, for example, a beef flavored or roasted chicken skin flavored yeast extract. In some embodiments, the composition, food product, beverage product, or feed is suitable for producing a food-like aroma and / or flavor that is a meat-like aroma and / or flavor, and the composition, food product, beverage product, or feed comprises yeast extract. The presence of yeast extract can enhance the meaty aroma and / or flavor produced by the compositions, food products, beverage products, or feeds of the present disclosure, as observed in the examples below.

[0128] In some embodiments, the yeast extract is present in the composition in an amount of about 10 g to about 200 g, such as about 15 g to about 200 g, for example about 20 g to about 200 g, for example about 30 g to about 200 g, for example about 40 g to about 200 g, for example about 50 g to about 200 g, for example about 50 g to about 180 g, for example about 60 g to about 180 g, per kg of dry composition or slurry, or per L in the case of a liquid composition, calculated based on the volume of the composition excluding / before the addition of microbial biomass and any extracted lipids. In some embodiments, the yeast extract is present in the composition in an amount of at least about 5 g, such as at least about 7 g, such as at least about 10 g, such as at least about 15 g, such as at least about 20 g, such as at least about 25 g, such as at least about 30 g, such as at least about 40 g, such as at least about 50 g, such as at least about 60 g per kg of dry composition or slurry, or per L of liquid composition. In a particular embodiment, the yeast extract is present in the composition in an amount of at least about 30 g per kg of dry composition or slurry, or per L of liquid composition.

[0129] In some embodiments, the yeast extract is present in the composition in an amount of at least about 5 g, such as at least about 7 g, such as at least about 10 g, such as at least about 15 g, such as at least about 20 g, such as at least about 25 g, such as at least about 30 g, such as at least about 40 g, such as at least about 50 g, such as at least about 60 g, per kg of dry composition or slurry, or per L of liquid composition. In certain embodiments, the yeast extract is present in the composition in an amount of at least about 30 g, such as at least about 1 g, such as at least about 1.5 g, such as at least about 2 g, such as at least about 2.5 g, such as at least about 3 g, such as at least about 4 g, such as at least about 5 g, such as at least about 6 g, per kg of dry composition or slurry, or per L of liquid composition. In some embodiments, the yeast extract is present in the food, feed, or beverage in an amount of at least about 0.5 g, such as at least about 0.7 g, such as at least about 1 g, such as at least about 1.5 g, such as at least about 2 g, such as at least about 2.5 g, such as at least about 3 g, such as at least about 4 g, such as at least about 5 g, such as at least about 6 g, per kg of dry composition or slurry, or per L of liquid. In certain embodiments, the yeast extract is present in the food, feed, or beverage in an amount of at least about 3 g per kg of dry composition or slurry, or per liter in the case of a liquid composition.

[0130] In some embodiments, the composition, food product, beverage product, or feed does not contain yeast extract. Since the presence of yeast extract can enhance the meaty aroma and / or flavor produced by the composition, food product, beverage product, or feed, yeast extract can be omitted if an alternative food-like flavor and / or aroma is desired, such as, for example, fishy or vegetable or herbal aroma and / or flavor. The absence of yeast extract can prevent potential masking of desired aroma and / or flavor, such as fishy aroma and / or flavor, by the meaty aroma and / or flavor enhanced by the presence of yeast extract. Thus, in some embodiments, the food-like aroma and / or flavor is fishy aroma and / or flavor, vegetable and / or herbal aroma and / or flavor, and the composition, food product, beverage product, or feed does not contain yeast extract.

[0131] In some embodiments, the composition, food product, beverage product, or feed further comprises one or more herbs and / or spices. As demonstrated by the examples herein, compositions comprising herbs, such as fenugreek (Trigonella foenum-graecum), have been found in some instances to enhance the vegetable, soupy, and / or herbal flavors and / or aromas produced by the compositions of the present invention. These herbal, vegetable, and / or soupy flavors and / or aromas can in some embodiments partially or completely mask the meat / fishy aromas and / or flavors, allowing for adjustment of the overall aroma and / or aroma produced by the compositions, food products, beverage products, or feed of the present disclosure. Herbs and / or spices are understood in the art to refer to plant parts or extracts that have aromatic properties. Typically, herbs are understood to refer to the leaves, green parts, or flowering parts of the plant, while spices are typically understood to refer to other parts of the plant (usually dried), such as seeds, bark, roots, and fruits. The herbs or spices may be whole plant parts, or chopped, crushed, or rolled plant parts, or in dried, e.g., powder form. In certain embodiments, the one or more herbs and / or spices include fenugreek. Fenugreek also contains several bioactive ingredients and is claimed to be capable of providing health benefits to the consumer. In some embodiments, the one or more herbs and / or spices include fenugreek leaves.

[0132] In some embodiments, the composition, food, feed, or beverage comprises: a) a Mortierella sp. biomass (or other microbial biomass) containing phospholipids; b) glucose and / or ribose, b) cysteine ​​and / or cystine and / or methionine and / or thiamine, and e) Contains an aqueous component.

[0133] In some embodiments, the composition, food, feed, or beverage comprises: a) a Mortierella sp. biomass (or other microbial biomass) containing phospholipids; b) glucose and / or ribose, b) cysteine ​​and / or cystine and / or methionine and / or thiamine, c) glutamic acid or its salts, and d) Contains an aqueous component.

[0134] In some embodiments, the composition comprises: a) a Mortierella sp. biomass (or other microbial biomass) containing phospholipids; b) glucose and / or ribose, b) cysteine ​​and / or cystine, d) yeast extract, e) glutamic acid or its salts, f) thiamine, and g) Contains an aqueous component.

[0135] In some embodiments, the composition comprises: a) a Mortierella sp. biomass (or other microbial biomass) containing phospholipids; b) glucose and / or ribose, b) cysteine ​​and / or cysteine, d) an iron source, such as an iron salt; e) glutamic acid or its salts, f) thiamine, g) an aqueous component, e.g., as an aqueous buffer, e.g., a phosphate buffer, having a pH of, e.g., about 5 to about 6, e.g., about 5.3 or about 6.0; and h) optionally containing yeast extract.

[0136] In some embodiments, the composition comprises: a) a Mortierella sp. biomass (or other microbial biomass) containing phospholipids; b) ribose, b) cysteine, d) an iron source, such as an iron salt; e) glutamic acid or its salts, f) thiamine, g) an aqueous component, e.g., as an aqueous buffer, e.g., a phosphate buffer, having a pH of, e.g., about 5 to about 6, e.g., about 5.3 or about 6.0; and h) optionally containing yeast extract.

[0137] In some embodiments, the composition comprises (apart from biomass and any extracted lipids) the components shown in "Matrix A" or "Matrix B" in Table 1 below, or "Matrix C" in Table 2 below (as prepared from the stock feedstocks shown below), or equal concentrations of the components of Matrix A, B, or CB if prepared by other methods. [Table 1]

[0138] Stock materials / reagents / chemical solutions for constructing matrix bases A and B are as follows: Potassium phosphate buffer 50mM, pH 6.0 Cysteine ​​100mM Ribose 100mM Thiamine 44mM Glutamic Acid 100mM Iron (iron tablets, Apohealth), 65.7 mg Fe 2 + / - 100mL Yeast extract (general, 75mg / 100mL) [Table 2]

[0139] The present disclosure further relates to a method for producing a food product, beverage product, or feed, comprising combining a biomass comprising phospholipids as disclosed herein and any optional extracted lipids or compositions of the present disclosure with one or more additional ingestible ingredients. Suitable additional ingredients that may be included in such food products, beverage products, or feed products are discussed below. For example, a biomass comprising phospholipids as disclosed herein and any optional extracted lipids or compositions of the present disclosure can be combined with other ingestible ingredients by mixing, by applying to the surface of the other ingredients, or by soaking / marinating the other ingredients. In one embodiment, a food, feed, or beverage product is prepared by (a) heating a biomass comprising phospholipids as disclosed herein and any optional extracted lipids or compositions of the present invention, and (b) mixing the product from (a) with other food, feed, or beverage ingestible ingredients, or by (a) mixing a biomass comprising phospholipids as disclosed herein and any optional extracted lipids or compositions of the present disclosure with other food, feed, or beverage ingestible ingredients, and (b) heating the mixture resulting from (a).

[0140] The food product, beverage product, or feed may be in either solid or liquid form and may be intended to be frozen, refrigerated, or stored at room temperature before cooking. In some embodiments, the food product, beverage product, feed, or composition is provided as a dry product excluding aqueous components, and aqueous components (such as water) are added to the food product, beverage product, feed, or composition before, during, or after heating, in particular before heating.

[0141] In some embodiments, the composition may be in a solid or liquid form that is mixed with or added to a food or beverage product or feed before or after heating of the composition and / or the food or beverage product or feed. The composition may be in a solid or liquid form, for example a concentrated mixture that is mixed with or added to a food product, beverage product, or feed. The mixture may be in the form of a powder, particulate, or granular mixture, for example.

[0142] Food products, beverage products, or feeds may contain edible macronutrients, proteins, carbohydrates, vitamins, and / or minerals in amounts desired for a particular application. The amounts of these ingredients will vary depending on whether the composition is intended for use by normal individuals or individuals with special needs, such as those suffering from metabolic disorders, etc.

[0143] According to some particular embodiments, the food product, beverage product, or feed of the present invention does not contain animal-derived ingredients. In a preferred embodiment, at least some of the raw materials are plant materials or plant-derived materials. Such embodiments are advantageously suitable for vegan or vegetarian diets. In some embodiments, the food product, beverage product, or feed can be soy-free, wheat-free, yeast-free, MSG-free, and / or protein hydrolysate-free. The food product, beverage product, or feed preferably has a food-like taste or aroma, such as a meaty or fishy aroma, as provided by the biomass containing phospholipids and any extracted lipids or compositions of the present disclosure disclosed herein.

[0144] Examples of suitable additional raw materials with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins. Examples of such edible fats other than phospholipids contained in the composition of the present disclosure include, but are not limited to, palm oil, canola oil, corn oil, sunflower oil, safflower oil, coconut oil, borage oil, fungal oil, blackcurrant oil, soybean oil, blends thereof, and mono- and diglycerides. Examples of carbohydrates include, but are not limited to, glucose, edible lactose, and hydrolyzed starch. Examples of proteins include, but are not limited to, soy protein, fungal protein (mycoprotein) (e.g., Lysobacterium rhizae protein), seitan, pea protein, potato protein, electrodialyzed whey, electrodialyzed skim milk, whey, or hydrolysates of these proteins. In some examples, the protein is a processed or structured protein product that includes a protein fiber network and / or aligned protein fibers that produce a meat-like texture. It can be obtained from the dough following application of mechanical energy (e.g., extrusion, spinning, stirring, shaking, shear, pressure, turbulence, collision, confluence, beating, friction, waves), radiation energy (e.g., microwave, electromagnetic), thermal energy (e.g., heating, steam processing), enzymatic activity (e.g., transglutaminase activity), chemical reagents (e.g., pH adjusters, kosmotropic salts, chaotropic salts, gypsum, surfactants, emulsifiers, fatty acids, amino acids), other methods that result in protein denaturation and protein fiber alignment, or a combination of these methods, followed by fixation of the fibrous and / or aligned structure (e.g., by rapid temperature and / or pressure changes, rapid dehydration, chemical fixation, redox), and optional post-treatments (e.g., hydration, marination, drying, coloring) after the fibrous and / or aligned structure is generated and fixed.

[0145] With regard to vitamins and minerals, the following may be added to the food product, beverage product, or feed of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and vitamins A, E, D, C, and B complex. Other such vitamins and minerals may also be added.

[0146] Additional ingredients that may be included in the food or beverage product or feed include edible oils such as canola oil, corn oil, sunflower oil, soybean oil, olive oil, or palm oil, seasonings such as edible salts (e.g., sodium or potassium chloride) or herbs (e.g., rosemary, thyme, basil, sage, or mint), flavorings, proteins (e.g., soy protein isolate, wheat gluten, pea vicilin, and / or pea legumin), protein concentrates (e.g., soy protein concentrate), emulsifiers (e.g., lecithin), gelling agents (e.g., kappa-carrageenan or gelatin), fiber (e.g., bamboo fillet or inulin), or minerals (e.g., iodine, zinc, and / or calcium).

[0147] The food products, beverage products, and feeds described herein may also contain natural colorants, such as turmeric or beet juice, or artificial colorants, such as azo dyes, triphenylmethane, xanthene, quinine, indigoid, titanium dioxide, Red #3, Red #40, Blue #1, or Yellow #5.

[0148] The food products, beverage products, and feeds described herein may also include meat shelf life extension agents such as carbon monoxide, nitrites, sodium metabisulfite, Bombal, Vitamin E, rosemary extract, green tea extract, catechins, and other antioxidants.

[0149] The ingredients utilized in the food, beverage, or feed products of the present invention may be of semi-refined or refined origin, by which is meant materials prepared by purification of natural materials or by de novo synthesis.

[0150] The food products, feed, beverage products, and compositions described herein can be packaged in a variety of ways, including sealed in individual packets or shakers so that the composition can be sprinkled or spread onto the food product before or during cooking.

[0151] The compositions, food products, beverage products, and feeds described herein can be evaluated for flavor and aroma using human panelists. It will be understood that panelists' evaluation of aroma involves a degree of subjectivity, and the exact description of aromas and whether they are attractive / unattractive may vary somewhat between panelists. Nevertheless, the trends and general nature of aromas can be effectively evaluated by panelists. Evaluation can involve the viewing, feeling, chewing, smelling, and tasting of the product to determine the product's appearance, color, integrity, texture, flavor, mouthfeel, etc., and preferably involves at least smelling the composition, food product, beverage product, or feed to evaluate aroma. Panelists can be presented with samples under red or white light. Scales can be used to rate the overall acceptability or quality of the food, or specific quality attributes such as meatiness, texture, and flavor. The compositions, food products, beverage products, and feeds can also be fed to animals, such as pet animals, to evaluate their attractiveness to the animals.

[0152] In some embodiments, a food product, beverage product, feed, or composition described herein can be compared to another product (e.g., meat or meat substitute) based on olfactometer readings. In various embodiments, the olfactometer can be used to evaluate odor concentration and odor threshold, odor threshold exceedance compared to a reference gas, hedonic scale score to determine degree of acceptability, or relative odor intensity.

[0153] In some embodiments, the identified volatile chemicals can be evaluated using GCMS. For example, a person can rate the experience of smelling the chemicals responsible for a particular peak. This information can be used to further refine the profile of flavor and aroma compounds produced by the food product, beverage product, feed, or composition of the present invention.

[0154] The invention further relates to methods of producing a composition, food product, beverage product, or feed by combining biomass with any one or more of the above-mentioned ingredients, optionally in the amounts described above.

[0155] Food-like aroma and / or flavor The composition, food product, beverage product, or feed of the present disclosure produces a food-like flavor and / or aroma, preferably a meat-like flavor and / or aroma, when heated. Heating refers to raising the temperature of the composition, food product, beverage product, or feed, for example above room temperature, to any temperature and for any time sufficient to produce a food-like flavor and / or aroma. In this context, the temperature is raised high enough and long enough for the Maillard reaction to occur between the amino groups and sugars in the composition and further reaction with lipids, preferably phospholipids, in the composition, food product, beverage product, or feed to produce a food-like flavor and / or aroma. Selection of suitable temperatures and times can be easily performed by those skilled in the art. As used herein, "heated" or "heating" and the like should be understood to mean heating under conditions sufficient to produce a food-like aroma, unless otherwise specified. For compositions that are added to food products, beverage products, or feed, heat may be applied to the composition of the present invention before it comes into contact with the food product, beverage product, or feed, or after application to the food product, beverage product, or feed, or both. Such heating of the composition, food product, beverage product, or feed may be carried out, for example, in an oven, a frying pan, a wok, etc., or on a barbecue.

[0156] The exact temperature to which the composition, food product, beverage product, or feed should be heated to produce a food-like flavor and / or aroma, preferably a meat-like flavor and / or aroma, can vary depending, for example, on the exact composition and the time the composition is heated and the amount of composition heated, but in some embodiments the composition or food product, beverage product, or feed produces a food-like flavor and / or aroma when heated to a temperature of at least about 100° C., such as at least about 110° C., for example at least about 120° C. or at least about 130° C., or at least about 140° C. In particular embodiments, the composition or food product, beverage product, or feed produces a food-like flavor and / or aroma when heated to about 140° C.

[0157] Similarly, the compositions and food products, beverage products, or feeds of the present disclosure may produce food-like flavors and / or aromas, preferably meat-like flavors and / or aromas, when heated for various periods of time, depending, for example, on the temperature to which the composition or food product, beverage product, or feed is heated, the exact nature of the composition, food product, beverage product, or feed, and the amount of the composition, food product, beverage product, or feed heated. Nevertheless, in some embodiments, the composition, food product, beverage product, or feed may produce food-like flavors and / or aromas when heated for at least 5 minutes or at least 10 minutes, such as at least 15 minutes. In some embodiments, the composition, food product, beverage product, or feed may produce food-like flavors and / or aromas when heated for at least about 30 minutes, such as at least about 45 minutes. In some embodiments, the composition, food product, beverage product, or feed may produce food-like flavors and / or aromas when heated for at least about 1 hour, such as about 1 hour. Preferably, heat is applied for a length of time that does not produce a burnt flavor and / or aroma, as would be understood by one of skill in the art.

[0158] In some embodiments, the composition, food product, beverage product, or feed of the present invention may produce a food-like flavor and / or aroma, preferably a meat-like flavor and / or aroma, when heated at a temperature of at least about 100° C. for at least 5 minutes or at least 10 minutes. In some embodiments, the composition, food product, beverage product, or feed of the present invention may produce a food-like flavor and / or aroma when heated at a temperature of at least about 100° C. for at least 30 minutes. In some embodiments, the composition, food product, beverage product, or feed of the present invention may produce a food-like flavor and / or aroma when heated at a temperature of at least about 120° C. for at least 30 minutes. In some embodiments, the composition, food product, beverage product, or feed of the present invention may produce a food-like flavor and / or aroma when heated at a temperature of at least about 130° C. for at least 30 minutes. In some embodiments, the composition, food product, beverage product, or feed of the present invention may produce a food-like flavor and / or aroma when heated at a temperature of at least about 130° C. for at least 1 hour. In some embodiments, the compositions, food products, beverage products, or feeds of the present invention may produce a food-like flavor and / or aroma when heated for at least 1 hour at a temperature of at least about 140° C. In some particular embodiments, the compositions, food products, beverage products, or feeds may produce a food-like flavor and / or aroma when heated for about 1 hour at about 140° C.

[0159] It will be appreciated that the compositions, food products, beverage products, or feeds of the present invention may, according to some embodiments, produce food-like flavors and / or aromas when heated to temperatures and for times different from those outlined above, although in some embodiments the compositions, food products, beverage products, or feeds may produce stronger and / or more desirable food-like flavors and / or aromas when heated to the temperatures and / or for the periods of time discussed above.

[0160] The food-like flavor and / or aroma produced by the composition, food product, beverage product, or feed of the present disclosure may include, according to preferred embodiments, a meat-like flavor and / or aroma. In certain embodiments, the food-like flavor and / or aroma may be the aroma of cooked meat or meat-based food. For example, the food-like flavor and / or aroma may be beef, steak, chicken, such as roasted chicken or chicken skin, pork, lamb, duck, venison, chicken or other meat soup, meat broth, liver, or anything "meaty" in general. In some examples, the meat-like flavor or aroma is the flavor or aroma of chicken (e.g., roasted or sautéed chicken), beef (e.g., roasted or sautéed beef), or pork (e.g., roasted or sautéed pork). Such aromas are typically detected by human subjects, for example by a qualified sensory panel. In this context, a composition, food product, beverage product, or feed is said to produce a food-like or meat-like flavor and / or aroma if at least one third, e.g., at least half, of the number of participants in a taste / smell panel detect a food-like or meat-like flavor and / or aroma in a double-blind test of the composition, food product, beverage product, or feed. It will be appreciated that in some cases, there is some variability in how various flavors and / or aromas are perceived by different subjects experiencing those aromas, and subjects may describe the exact flavor and / or aroma slightly differently.

[0161] The food-like flavors and / or aromas produced by the compositions, food products, beverage products, or feeds of the present disclosure, according to some embodiments, can include fish-like flavors and / or aromas, such as the flavors and / or aromas of cooked fish, e.g., the flavors and / or aromas of fried fish.

[0162] The food-like flavors and / or aromas produced by the compositions, food products, beverage products, or feeds of the present disclosure can include vegetable and / or herbal flavors and / or aromas, such as cooked vegetable and / or herbal flavors and / or aromas, such as soup, mushroom, onion, vegetable, herbal or roasted vegetable flavors and / or aromas.

[0163] In some embodiments, the composition, food product, beverage product, or feed comprises ribose, and the food-like flavor and / or aroma includes a meaty, e.g., cooked meat-like, flavor and / or aroma, and / or a fishy, ​​e.g., cooked or fried fish-like, flavor and / or aroma.

[0164] In some embodiments, volatile compounds exhibiting meat-like or meat-related aromas and flavors include, for example, 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanol, 1 ... Volatile compounds such as ethane, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, and 1,3,5-titriane. In some examples, volatile compounds exhibiting meat-like or meat-related aromas and flavors are produced, including 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol. In other embodiments, volatile compounds exhibiting meat-like or meat-related aromas and flavors are produced, including 1-pentanal, 3-octanone, 2-octen-1-ol, 1-nonanol, and 1-octanol, and optionally 1,3-bis(1,1-dimethylethyl)-benzene.

[0165] In some embodiments the composition, food product, beverage product, or feed comprises glutamic acid in addition to a further amino acid, such as cysteine, or a salt or derivative thereof, and the food-like flavor and / or aroma includes meat-like, e.g. cooked meat-like, and / or fish-like, e.g. cooked fish or fried fish-like, flavor and / or aroma.

[0166] In some embodiments, the composition, food product, beverage product, or feed comprises yeast extract and the food-like flavors and / or aromas include meat, e.g., cooked meat, flavors and / or aromas. In some embodiments, the composition, food product, beverage product, or feed does not comprise yeast extract and the food-like flavors and / or aromas include fish-like, e.g., cooked or fried fish-like, vegetable and / or herbal aromas and / or flavors.

[0167] In a preferred embodiment, the microorganism is a Mortierella species, e.g., Mortierella alpina, and the food-like flavor and / or aroma includes a meat-like flavor and / or aroma, e.g., a chicken-like flavor and / or aroma, e.g., the flavor and / or aroma of cooked chicken, e.g., the flavor and / or aroma of roasted chicken, chicken skin, or chicken broth.

[0168] In some embodiments, the microorganism is a Mortierella species, such as Mortierella alpina, Mortierella elongata, or Mortierella exigua, and the food-like flavor and / or aroma includes a meat-like flavor and / or aroma, such as a beef-like flavor and / or aroma.

[0169] In some embodiments, the composition, food product, beverage product, or feed comprises one or more herbs and / or spices, such as fenugreek, e.g. fenugreek leaves, and the food-like flavors and / or aromas include vegetable, soup and / or herbal flavors and / or aromas.

[0170] In certain embodiments, the composition, food product, beverage product, or feed of the present disclosure may produce food-like flavor and food-like aroma. Such food-like flavor may be a flavor corresponding to the food-like aroma disclosed herein. Thus, references to aroma in this specification may be understood to refer to aroma and / or flavor as appropriate according to certain aspects.

[0171] In some embodiments, the biomass and any optional extracted lipids comprising the phospholipids disclosed herein, or the compositions of the invention, are incorporated into a food product, beverage product, or feed before or during heating, such that when the food product or beverage product is heated (e.g., during cooking), the biomass and any optional extracted lipids comprising the phospholipids disclosed herein or the compositions produce the associated food-like aroma (by Maillard and related reactions). In some embodiments, the biomass and any optional extracted lipids, or the compositions of the invention are heated prior to incorporation or addition to the food product, beverage product, or feed. In some examples, the biomass and optionally extracted lipids may be, prior to incorporation into a food product, extracted with, for example, sugars and amino acids or derivatives, one or more (e.g., at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 26, 28, 29, 30, or 31) volatile compounds exhibiting meat-like or meat-related aromas and flavors, such as, for example, 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-diphenyl-2-propanediol ... It has been heated under suitable conditions to produce volatile compounds such as methyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, and 1,3,5-titriane.In some examples, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, or 9) volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol are produced. In other embodiments, one or more (e.g., 2, 3, 4, or 5) volatile compounds selected from 1-pentanal, 3-octanone, 2-octen-1-ol, 1-nonanol, and 1-octanol, and optionally 1,3-bis(1,1-dimethylethyl)-benzene are produced. As will be appreciated, the amounts and ratios of various fatty acids (and in particular ω6 fatty acids (e.g., ARA, GLA, DGLA, EDA, DTA, and / or DPA-ω6) in the biomass and optional extracted microbial lipids will change as one or more of these volatile compounds are produced from reactions between fatty acids, sugars, and amino acids on the polar lipids. As a result, the lipids in the biomass or in the optional extracted lipids remaining after the reaction may have a different fatty acid profile compared to the "starting" biomass or extracted microbial lipids. Thus, in some examples, the food, beverage, or feed of the present invention may be prepared from biomass or any other biomass-derived or biodegradable food. The biomass and optionally lipids are products of a reaction between a microbial biomass (e.g., Mortierella species biomass) or extracted microbial lipids, amino acids or derivatives, and sugars under conditions suitable to produce at least two compounds having meat-related flavors and / or aromas. In particular examples, the conditions include heating at a temperature of, for example, at least about 100° C., 110° C., 120° C., 130° C., or 140° C. for a period of time (e.g., as described further below) with an amount or concentration of sugars and amino acids or derivatives sufficient to produce volatile compounds.

[0172] In some embodiments, heating a composition, food product, beverage product, or feed of the present disclosure results in the production of one or more compounds, preferably volatile compounds, having a food-like aroma, such as a meat-like aroma. In some particular embodiments, such heating results in the production of a greater amount of said one or more compounds than heating a food product, beverage product, or feed that does not include a biomass comprising the phospholipids disclosed herein or a composition according to the present disclosure.

[0173] In one embodiment, applying heat to the composition, food product, beverage product, or feed can include the following: 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octanol, 1,2-octanediol, 1,3-dimethylbenzene, p-xylene, ethylbenzene, 2-heptanone, 2-pentylfuran, octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octanol, 1,3-octanol, 1,4-octanol, 1,5-octanol, 1,6-octanol, 1,7-octanol, 1,8-octanol, 1,9-octanol, The reaction results in the production of two or more (e.g., at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 26, 28, 29, 30, or 31) volatile compounds selected from 1,3,5-titriene, 1,3,5-di-tert-butylphenol, 1,3 ... In embodiments, the production of three or more, four or more, or five or more of the aforementioned compounds results from the application of heat to the composition, food product, beverage product, or feed. In other embodiments, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, or 9) volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol are produced. In other embodiments, one or more (e.g., 2, 3, 4, or 5) volatile compounds selected from 1-pentanal, 3-octanone, 2-octen-1-ol, 1-nonanol, and 1-octanol, and optionally 1,3-bis(1,1-dimethylethyl)-benzene are produced upon heating of the composition, food product, beverage product, or feed.

[0174] Characteristic flavor and aroma components are mostly generated during the cooking process by chemically reactive molecules, including amino acids, fats, and sugars found in plants and meat. Thus, in some embodiments, food products, beverage products, or feeds are tested for similarity to meat during or after cooking. In some embodiments, human ratings, human evaluations, olfactometer readings, or GC-MS measurements, or a combination thereof, are used to create an olfactory map of the food product, beverage product, or feed for the meat substitute. Similarly, an olfactory map of a comparison product, such as meat, can be created. These maps can be compared to assess how similar the cooked food, beverage, or feed is to meat.

[0175] The present invention further relates to a method for producing a food-like flavor and / or aroma comprising heating a food product, beverage product, or feed comprising a biomass comprising phospholipids as disclosed herein and any optional extracted lipids or compositions of the present invention.

[0176] The present invention further relates to a method of providing or enhancing a food-like flavor and / or aroma to a food product, beverage product, or feed comprising contacting the food product, beverage product, or feed with a biomass comprising phospholipids and any optional extracted lipids as disclosed herein or a composition according to the present invention, and heating the food product, beverage product, or feed and the composition or the biomass comprising phospholipids and any optional extracted lipids.

[0177] The present invention further relates to a method of preparing a food product, beverage product or feed for consumption, comprising heating the food product, beverage product or feed of the present invention to produce a food-like flavour and / or aroma, such as a meat or fish-like flavour and / or aroma.

[0178] The present invention further relates to a method for enhancing food-like flavor and / or aroma, in particular meat- or fish-like flavor and / or aroma, such as the meat-like flavor and / or aroma associated with a food product, beverage product, or feed, comprising heating a food product, beverage product ingredient, and a composition according to the present invention or a biomass comprising phospholipids as disclosed herein and any optional extracted lipids under conditions sufficient to produce a food-like flavor and / or aroma.

[0179] The present invention further relates to a method for enhancing food-like flavor and / or aroma, particularly meat- or fish-like flavor and / or aroma, such as meat-like flavor and / or aroma associated with a food product, beverage product, or feed, comprising contacting the food product, beverage product, or feed with a composition according to the present disclosure or a biomass comprising phospholipids and any optional extracted lipids disclosed herein, and heating under conditions sufficient to produce a food-like flavor and / or aroma. In some embodiments, the composition of the present disclosure or a biomass comprising phospholipids and any optional extracted lipids disclosed herein is added or incorporated into the food product, beverage product, or feed prior to heating, and the food product, beverage product, or feed comprising the composition or the biomass comprising phospholipids and any optional extracted lipids is then heated to produce the food-like flavor and / or aroma.

[0180] In some alternative embodiments of the present disclosure, the biomass comprising phospholipids disclosed herein and any optional extracted lipids or the composition of the present disclosure is heated before being added to a food product, beverage product, or feed. The biomass comprising phospholipids disclosed herein and any optional extracted lipids or the composition of the present disclosure can be optionally allowed to cool after heating and before contacting with a food product, beverage product, or feed. Thus, the present disclosure further provides a method for improving the food-like aroma and / or flavor associated with a food product, beverage product, or feed, comprising: a) heating a composition according to any one of claims 6 to 30; and then b) contacting the food product, beverage product, or feed with the composition obtained in step a).

[0181] It will be understood that the exact time and temperature at which the composition, food product, beverage product, or feed should be heated to produce food-like flavors and / or aromas will vary depending on a variety of factors, including the nature of the composition, the nature of the food product, beverage product, or feed, and the amount of biomass, including phospholipids, and any optional extracted lipids incorporated into the composition or food product, beverage product, or feed. Throughout this specification, "heating" should be understood to mean "heating under conditions sufficient to produce food-like flavors and / or aromas". Nevertheless, in some embodiments, the method of producing food-like flavors and / or aromas may include heating the composition, food product, beverage product, or feed to a temperature of at least about 100°C, such as at least about 110°C, such as at least about 120°C, or at least about 130°C. In certain embodiments, the method includes heating the composition, food product, beverage product, or feed to a temperature of about 140°C.

[0182] According to some embodiments, the method of producing a food-like flavor and / or aroma may include, according to some embodiments, heating the composition, food product, beverage product, or feed for at least 10 minutes, such as at least 15 minutes. In some embodiments, the method of producing a food-like aroma may include heating the composition, food product, beverage product, or feed for at least about 30 minutes, such as at least about 45 minutes. In some embodiments, the method of producing a food-like aroma may include heating the composition, food product, beverage product, or feed for at least about 1 hour, such as about 1 hour.

[0183] In some embodiments, the method of producing a food-like aroma may comprise heating the composition, food product, beverage product, or feed for at least 10 minutes at a temperature of at least about 100° C. In some embodiments, the method of producing a food-like aroma may comprise heating the composition, food product, beverage product, or feed at about 140° C. for about 1 hour.

[0184] microorganisms As used herein, the term "microorganism" refers to an organism that can live and reproduce in a single-cell form. The single cells may clump together or associate with other cells in clusters, or may remain attached to sibling or progeny cells, e.g., as a hyphal or mycelium form for fungi such as molds. The terms "microorganism" and "microbial cell" may be used interchangeably herein.

[0185] A variety of microorganisms can be used in the present invention, whether as microbial biomass or as a source of phospholipids. In certain embodiments, the microorganisms are suitable for fermentation, but can also be cultured under ambient oxygen concentrations. In certain embodiments, the microorganisms are oleaginous microorganisms, preferably oleaginous eukaryotic microorganisms, or are preferably derived from pro-oleaginous microorganisms, such as pro-eukaryotic oleaginous microorganisms. In another embodiment, the microorganisms are heterotrophic microorganisms, preferably heterotrophic eukaryotic microorganisms. The microorganisms may have at least two of these characteristics, or may be characterized by all of these characteristics, according to some embodiments. The microorganisms used as a source of biomass according to the present invention may be live, inactivated, or dead, or a combination of live, inactivated, or dead microbial cells may be used. The microorganisms may be inactivated or killed using any technique known to those skilled in the art, including, for example, heating, pasteurization, and fermentation.

[0186] The microorganism used according to the present invention may be a Mortierella species. For example, the microorganism may be Mortierella elongata, Mortierella alpina, Mortierella exigua, or Mortierella isabellina. Other Mortierella species include M. humilis, M. camargensi, M. lignicola, M. zonata, M. sepedonioides, M. stylospora, M. polycephala, M. alliacea, M. claussenii, M. globalpina, M. globulifera, M. pusilla, M. strangulata, M. rostafinskii, M. bainieri, M. beljakovae, M. clonocystis, M. epigama, M. gemiforme, M. cephala ... Examples of suitable microbial organisms include Mortierella gemmifera, M. hyalina, M. hygrophila, M. kuhlmanii, M. marburgensis, M. minutissima, M. nigrescens, M. sarnyensis, M. sclerotiella, M. selenospora, M. polycephala, M. gam- sii, M. nantahalensis, M. oligospora, M. parvispora, M. pulcheria, M. reticulata, M. spinosa, M. umbellata, and M. zychae. In one embodiment, the microorganism is not Mortierella isabellina, which has low or undetectable levels of arachidonic acid. In some preferred embodiments, the microorganism is Mortierella alpina, Mortierella exigua, or Mortierella elongata. In particularly preferred embodiments, the microorganism is Mortierella alpina. As demonstrated by the examples below, M. alpina, M. elongata, and M. exigua have been incorporated into compositions effective to provide food-like aromas, particularly meat-like aromas, such as beef-like aromas.

[0187] The Mortierella species used in the present invention may be a wild-type Mortierella species, such as wild-type Mortierella alpina. Alternatively, the Mortierella species used in the present invention may be a genetically modified Mortierella species.

[0188] Mortierella species, or other microorganisms used in the present invention described below, contain phospholipids. In some preferred embodiments, the Mortierella species biomass (or other microbial biomass) contains at least about 1% by weight, such as at least about 2% by weight, of phospholipids (as a percentage of dry cell weight). In some particular embodiments, the biomass contains at least about 3%, such as at least about 4%, such as about 5% or more of phospholipids. In this regard, the total fatty acid content of the phospholipids in the microbial biomass (e.g., Mortierella species biomass) and / or the extracted lipids contains at least 10% by weight of ω6 fatty acids excluding linoleic acid (LA), more preferably at least 10% by weight of ω6 fatty acids having 20 or 22 carbons in the acyl chain. More preferably, the total fatty acid content of the phospholipids in the microbial (e.g., Mortierella sp.) biomass and / or extracted lipid comprises 10% by weight to 70% by weight, or 10% by weight to 60% by weight, or 20% by weight to 70% by weight, or 20% by weight to 60% by weight of ω6 fatty acids excluding linoleic acid (LA), and even more preferably 10% by weight to 70% by weight, or 10% by weight to 60% by weight, or 20% by weight to 70% by weight, or 20% by weight to 60% by weight of ω6 fatty acids having 20 or 22 carbons in the acyl chain.

[0189] The amount of phospholipids contained in a microorganism can be measured by extracting the phospholipids as described below and measuring the amount of phospholipids as a percentage of the dry cell weight of the microorganism.

[0190] In some alternative aspects, biomass from a microorganism other than Mortierella spp. and / or extracted lipids from a microorganism other than Mortierella spp. are used in place of Mortierella spp. A variety of microorganisms can be used, whether as microbial biomass or to extract phospholipids. In one embodiment, the microorganism is a unicellular organism. Examples of microorganisms that can be used in the present invention include bacterial cells, as well as eukaryotic cells such as fungal cells and algal cells. Eukaryotic microorganisms are preferred over bacterial (prokaryotic) microorganisms. In some particular embodiments, the microorganism can be a yeast, such as, but not limited to, a Yarrowia species, such as Yarrowia lipolytica. In particular examples, the yeast has been genetically engineered to synthesize arachidonic acid or has been cultured in arachidonic acid such that arachidonic acid is present in an amount of at least or about 10%, 20%, 30%, 40%, or 50% of the total fatty acid content of the polar lipids of the yeast. Other yeasts that may be engineered or cultured in such a manner include, but are not limited to, Pichia species, such as Pichia pastoris, Candida species, such as Candida rugosa, Aspergillus species, such as Aspergillus niger, Cryptococcus species, such as Cryptococcus curvatus, Lipomyces species, such as Lipomyces starkeyi, Rhodosporidium species, such as Rhodosporidium toruloides, Rhodotorula species, such as Rhodotorula glutinis, and Trichosporon species, such as Trichosporon fermentans.

[0191] In other embodiments, the microorganism is a fungus other than a Mortierella species, particularly a fungus having arachidonic acid present in an amount of at least or about 10%, 20%, 30%, 40%, or 50% of the total fatty acid content of the polar lipids of the yeast. Non-limiting examples of such fungi include Pythium species, such as Pithium ultimum, Pithium debaryanum, and Pithium insidiosum.

[0192] In some embodiments, the microorganism is Yarrowia lipolytica strain W29 or a genetically modified derivative thereof. As demonstrated by the examples below, such microorganisms are particularly effective at producing food-like, and particularly meaty, aromas.

[0193] In some embodiments, the microorganism is an algae, such as a microalgae or a Bacillariophyceae. More specifically, the microorganism is an algae having arachidonic acid esterified in the polar lipid, preferably esterified in the phospholipid, for example, the arachidonic acid is present in an amount of at least or about 10%, 20%, 30%, 40%, or 50% of the total fatty acid content of the polar lipid. Non-limiting examples of such algae include Porphyridium purpureum, Euglena gracilis, Parietochloris incisa, Pavlova lutheri, Porphyridium cruentum, Ceramium rubrum, and Rodomella subfusca.

[0194] In certain embodiments, the microorganisms utilized in the present invention, such as Mortierella species, contain arachidonic acid. In certain embodiments, the arachidonic acid is esterified in the polar lipids, preferably in the phospholipids. In some examples, the microorganisms, such as Mortierella species, contain arachidonic acid esterified in the polar lipids, preferably in the phospholipids, and the arachidonic acid is present in an amount of at least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the total fatty acid content of the polar lipids. In some examples, the arachidonic acid is present in an amount of about 10% to about 60% (e.g., 20% to 50%) of the total fatty acid content of the polar lipids, or is present as at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, or at least about 55% of the total fatty acid content of the polar lipids. Optionally, other ω6 fatty acids, such as γ-linolenic acid (GLA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), and / or docosapentaenoic acid-ω6 (DPA-ω6), are also present in the polar lipid. In some examples, DGLA is present in an amount of at least 0.1% (e.g., at least 0.2%, 0.5%, 1%, 1.5%, 2%, or 2.5%), or from about 0.1% to about 5% of the total fatty acid content of the polar lipid, and GLA is present in an amount of at least 1% (e.g., at least 2%, 3%, 4%, 5%, or 6%), or from about 1% to about 10% of the total fatty acid content of the polar lipid.

[0195] The microorganisms used in the present invention, typically Mortierella species, can be prepared by any suitable culture process and conditions. Effective culture conditions are known to those skilled in the art and include, but are not limited to, suitable media, bioreactors, temperature, pH and oxygen conditions that allow the desired phospholipid production. A suitable medium refers to any medium in which cells are cultured to produce the microorganisms defined herein. Such media typically include aqueous media having assimilable carbon, nitrogen and phosphate sources, as well as other nutrients such as appropriate salts, minerals, metals and vitamins. The cells defined herein can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes and petri dishes. The culture can be carried out at temperatures, pH and oxygen content suitable for the recombinant cells. Such culture conditions are within the expertise of those skilled in the art.

[0196] In some embodiments, the microorganism (e.g., Mortierella sp.) is cultured under conditions that increase or optimize the amount of phospholipids contained therein and / or increase or optimize the amount of omega-6 fatty acids esterified in the phospholipids.

[0197] In some embodiments, the microorganism is cultured by a process that includes feeding an ω6 fatty acid to increase the amount of the ω6 fatty acid incorporated into phospholipids in the microorganism. For example, a microorganism such as a Yarrowia species (e.g., Yarrowia lipolytica) can be cultured by a culture process, e.g., a fermentation process, that includes introducing a feed of arachidonic acid (as demonstrated in the Examples). The feeding is typically performed by culturing the cells in a medium that includes one or more of the ω6 fatty acids, e.g., LA, GLA, DGLA, EDA, ARA, DTA, or DPA ω6. In some embodiments, the feed ω6 fatty acid is a free fatty acid or a fatty acid salt.

[0198] In some alternative embodiments, the microbial biomass or microorganism from which the extracted lipids are extracted may be Yarrowia lipolytica, for example strain W29, and may be prepared by a cultivation process, particularly a fermentation process that includes feeding arachidonic acid.

[0199] In some embodiments, the compositions, food products, beverage products, and feeds of the present disclosure comprise biomass of two or more different microorganisms, for example, the biomass of two Mortierella species, or the biomass of one Mortierella species and another microorganism.

[0200] The present invention involves the use of microbial biomass, such that the compositions, food products, beverage products, and feeds of the present invention comprise microbial biomass. Microorganisms, typically Mortierella species, can exist as dry biomass or wet biomass (i.e., biomass that retains some moisture and the water has not been substantially or completely dried). Typically, biomass containing less than about 10% water by weight can be considered "dry", while biomass containing more than 10% water by weight, e.g., about 70% water or more by weight, can be considered "wet". In a typical embodiment, a "dry" biomass can be about 25% of the mass of a "wet" biomass. In this context, and as understood in the art, "biomass" refers to a material that contains at least some whole cells of a microorganism, not just components that have been separated from the microorganism, but may contain both whole cells and cellular components. Microorganisms / biomass, such as those obtained by fermentation processes, may have been processed, for example, by washing, drying, heat inactivation, freezing, and / or lyophilization, but still contain at least a portion, and preferably a majority, of the whole cellular material of the microorganism. Although the biomass may be referred to as "whole cell biomass", it is understood that the microbial cells contained in the compositions of the present invention may be present in a disrupted form, e.g., having undergone physical or chemical lysis. The biomass / microorganism still contains substantially all cellular material. "Biomass" and "microorganism" are not meant to refer to, for example, oils or proteins extracted or isolated from a microorganism, nor to oils or proteins separated from other components of a cell. As demonstrated by the following examples, compositions containing microorganisms (i.e., microbial biomass) containing phospholipids have been found to be particularly effective in producing enhanced food-like aromas, e.g., meaty or fishy aromas, when heated.

[0201] The microorganisms contained in the compositions of the present disclosure may be in suspension, frozen form, dried form, or any other suitable form. The microbial cells may be live or dead, or may be a mixture of live and dead cells, for example, at least 99% of the cells may be dead. The cells may be heat-treated to render them unable to replicate.

[0202] Phospholipids Phospholipids are amphipathic molecules with a hydrophilic head and a hydrophobic tail, comprising a glycerol backbone esterified to the phosphate "head" group and two fatty acids providing the hydrophobic tail. According to a particularly preferred embodiment, the phospholipids of the invention (whether as part of a microorganism or extracted from a microorganism) comprise one or more esterified ω6 fatty acids. The biosynthesis of ω6 fatty acids in organisms such as microalgae, mosses, and fungi usually occurs as a series of oxygen-dependent desaturation and elongation reactions (Figure 1).

[0203] Examples of ω6 fatty acids include, but are not limited to, arachidonic acid (ARA, C20:4Δ5,8,11,14; ω6), dihomo-γ-linolenic acid (DGLA, C20:3Δ8,11,14; ω6), eicosadienoic acid (EDA, C20:2Δ11,14; ω6), docosatetraenoic acid (DTA, C22:4Δ7,10,13,16; ω6), docosapentaenoic acid-ω6 (DPA-ω6, C22:5Δ4,7,10,13,16; ω6), γ-linolenic acid (GLA, C18:3Δ6,9,12; ω6), and linoleic acid (LA, C18:2Δ9,12; ω6). According to some preferred embodiments, the phospholipids include esterified arachidonic acid (ARA, C20:4Δ5,8,11,14;ω6). According to some embodiments, the phospholipids include esterified docosapentaenoic acid-ω6 (DPA-ω6, C22:5Δ4,7,10,13,16;ω6). According to some embodiments, the phospholipids include one or more esterified ω6 fatty acids other than linoleic acid (LA, C18:2Δ9,12;ω6).

[0204] According to some embodiments, the ω6 fatty acid comprises arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA). In some embodiments, the ω6 fatty acid comprises two, three, or four of arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA).

[0205] According to some embodiments, the omega-6 fatty acids include one or two or all three of eicosadienoic acid (EDA), docosatetraenoic acid (DTA), and docosapentaenoic acid-omega-6 (DPA-omega-6).

[0206] According to a particularly preferred embodiment, the omega-6 fatty acid comprises arachidonic acid (ARA), or ARA is the predominant omega-6 fatty acid in the phospholipids.

[0207] In some examples, ARA is present in an amount of about 10% to about 60% of the total fatty acid content of the polar lipid, DGLA is present in an amount of about 0.1% to about 5% of the total fatty acid content of the polar lipid, and GLA is present in an amount of about 1% to about 10% of the total fatty acid content of the polar lipid.In other examples, ARA is present in an amount of about 20% to about 50% of the total fatty acid content of the polar lipid, DGLA is present in an amount of about 1% to about 5% of the total fatty acid content of the polar lipid, and GLA is present in an amount of about 3% to about 10% of the total fatty acid content of the polar lipid.

[0208] According to some preferred embodiments, the phospholipids contain at least about 5% by weight, such as at least about 7% by weight, such as at least about 10% by weight, such as at least about 12% by weight, such as at least about 15% by weight, such as at least about 17% by weight, such as at least about 20% by weight, each as a percentage of the total fatty acid content of the phospholipid. In some embodiments, the phospholipids contain at least about 30% by weight, such as at least about 40% by weight, such as at least about 50% by weight, of omega-6 fatty acids.

[0209] In some embodiments, the amount of omega-6 fatty acids refers to omega-6 fatty acids excluding linoleic acid (LA, C18:2Δ912; omega-6).

[0210] According to some embodiments, the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, as a weight percentage of the total fatty acid content of the phospholipids in the total fatty acid content of the phospholipids in the microbial (e.g., Mortierella sp.) biomass and / or extracted lipid, is at least about 5% by weight, such as at least about 10% by weight, of the TFA content of the phospholipids. In some embodiments, the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA in the phospholipids is about 10% to about 70% by weight, or about 10% to about 75% by weight, or about 10% to about 80% by weight of the total fatty acid content of the phospholipids. These amounts of ω6 fatty acids in the phospholipids of the microorganism or extracted lipid may also be applied to the TAG in the microorganism or extracted lipid.

[0211] According to some embodiments, the phospholipids comprise at least two, and preferably all three or four, of phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG) and cardiolipin (Car), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA. The PC, PE, PI and PS content of phospholipids can be determined by two-dimensional thin layer chromatography (TLC) analysis using two solvent systems as described in Zhou et al. (2014), "Lipidomic analysis of Arabidopsis seed genetically engineered to contain DHA", Frontiers in Plant Science, 5, 419 (https: / / doi.org / 10.3389 / fpls.2014.00419).

[0212] In some embodiments, (i) the content of ω6 fatty acids in the phospholipid that are C20 or C22 fatty acids is about 5% to about 60%, preferably about 10% to about 60%, of the total fatty acid content of the phospholipid, and / or (ii) ω6 fatty acids having 3, 4, or 5 carbon-carbon double bonds is about 5% to about 70%, preferably about 10% to about 70%, more preferably about 40% to about 70%, or about 45% to about 70%, or about 50% to about 70% of the total fatty acid content of the phospholipid.

[0213] According to some preferred embodiments, phospholipid contains at least about 10% by weight, such as at least about 15% by weight, such as at least about 20% by weight, such as at least about 25% by weight, such as at least about 30% by weight, such as at least about 35% by weight, such as at least about 40% by weight, such as at least about 45% by weight, such as at least about 50% by weight of arachidonic acid (ARA).In some embodiments, phospholipid contains at least about 20% by weight of ARA.

[0214] For the embodiments referred to herein, the amount of individual fatty acids in the total fatty acid content in a microbial or lipid sample is preferably determined by GC analysis of fatty acid methyl esters (FAMEs) as described in Example 1.

[0215] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial (e.g., Mortierella spp.) biomass or extracted from the microbial organism as extracted polar lipids or more broadly derived lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that comprises ω6 fatty acids, at least a portion of which are esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising two, three, four or more fatty acids selected from the group consisting of arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), and γ-linolenic acid (GLA); (b) the phospholipids in the polar lipids comprise at least two, and preferably all three or four, of phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG) and cardiolipin (Car), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA; (c) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (d) the polar lipids comprise a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (C16:1Δ9 cis); (e) omega-3 fatty acids are either absent from the polar lipid or are present in a total amount of less than about 3% by weight of the TFA content of the polar lipid, and / or the polar lipid lacks C16:2, C16:3 omega-3, EPA, and DHA.

[0216] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that includes ω6 fatty acids, at least some of the ω6 fatty acids being esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA), or any combination thereof; (b) the phospholipids in the polar lipids comprise phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG), and cardiolipin (Car), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA; (c) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (d) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis);

[0217] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that includes ω6 fatty acids, at least some of the ω6 fatty acids being esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA), or any combination thereof; (b) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (c) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis); (d) omega-3 fatty acids are either absent from the polar lipid or are present in a total amount of less than about 3% by weight of the TFA content of the polar lipid, and / or the polar lipid lacks C16:2, C16:3 omega-3, EPA, and DHA.

[0218] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that includes ω6 fatty acids, at least some of the ω6 fatty acids being esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA), or any combination thereof; (b) the phospholipids in the polar lipids comprise phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG), and cardiolipin (Car), each of which comprises one or more of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA; (c) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (d) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis);

[0219] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that includes ω6 fatty acids, at least some of the ω6 fatty acids being esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising one, two, or all three of eicosadienoic acid (EDA), docosatetraenoic acid (DTA), and docosapentaenoic acid-ω6 (DPA-ω6); (b) gamma-linolenic acid (GLA) is either absent or present in polar lipids; (c) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (d) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis);

[0220] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that comprises ω6 fatty acids, at least a portion of which are esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising two, three, four or more fatty acids selected from the group consisting of arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), and γ-linolenic acid (GLA); (b) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (c) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis); (d) The polar lipids lack C16:2, C16:3ω3, EPA, and DHA.

[0221] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that includes ω6 fatty acids, at least a portion of which are esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids of the polar lipids comprising an amount of arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6) or γ-linolenic acid (GLA), or any combination thereof, each amount expressed as a percentage by weight of the total fatty acid content of the polar lipid, and the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-ω6 and GLA is at least about 10%; (b) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (c) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis);

[0222] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that includes ω6 fatty acids, at least a portion of which are esterified in the polar lipids in the form of phospholipids, the ω6 fatty acids of the polar lipids comprising an amount of arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA), or any combination thereof, wherein the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA is preferably at least about 5% by weight, more preferably at least about 10% by weight, of the TFA content of the polar lipid; (b) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (c) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis);

[0223] In some embodiments, the phospholipids form part of the polar lipids (whether contained within the microbial biomass or extracted from the microorganism as extracted polar lipids or more widespread lipids), which may comprise, consist essentially of, or consist of phospholipids; (a) the polar lipids comprise a total fatty acid (TFA) content that comprises ω6 fatty acids, at least a portion of which are esterified in the form of phospholipids in the polar lipids, the ω6 fatty acids comprising one, two, three, four or more fatty acids selected from the group consisting of arachidonic acid (ARA), dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), and γ-linolenic acid (GLA); (b) the polar lipids comprise a total saturated fatty acid content that includes palmitic acid and stearic acid; (c) the polar lipids comprise a total monounsaturated fatty acid content including oleic acid and palmitoleic acid (C16:1Δ9 cis);

[0224] In one embodiment, when the polar lipids include DPA-ω6, one or more or all of GLA, DGLA, EDA, ARA, and DTA are also present.

[0225] In one embodiment, the polar lipid comprises EDA and one, two, or all three of arachidonic acid (ARA), dihomo-gamma-linolenic acid (DGLA), and gamma-linolenic acid (GLA) esterified in the polar lipid, and the level of EDA in the polar lipid is at least about 1% of the total fatty acid content of the polar lipid.

[0226] In one embodiment, the polar lipids lack one, two, three, or all four of C16:2, C16:3ω3, EPA, and DHA. In a preferred embodiment, the polar lipids lack C16:3ω3, EPA, and DHA. In a further embodiment, the polar lipids also lack ALA or have less than 1% ALA.

[0227] In one embodiment, the extracted lipid comprises three, four or more fatty acids selected from the group consisting of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, such as a combination of ARA, DGLA, and GLA, or a combination of fatty acids other than ARA, DGLA, and GLA, preferably a combination of ARA, DGLA, GLA, and at least one of EDA, DTA, and DPA-ω6. In one embodiment, the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA is about 10% to about 70%, or about 10% to about 75%, or about 10% to about 80%, each amount expressed as a percentage of the total fatty acid content of the polar lipid. In one embodiment, the ω6 fatty acid present in the greatest amount in the total fatty acid content of the polar lipid is neither LA nor ARA. In one embodiment, where the omega-6 fatty acid present in the greatest amount is GLA or DGLA, the polar lipid comprises one or more of EDA, DTA, or DPA-omega-6.

[0228] In one embodiment, the phospholipid comprises at least two, at least three, or all four of phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), and phosphatidylserine (PS), each of which comprises one, two, three, or more than three of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA, and optionally one or more or all of phosphatidic acid (PA), phosphatidylglycerol (PG), and cardiolipin (Car), each of which comprises one, two, three, or more than three of ARA, DGLA, EDA, DTA, DPA-ω6, and GLA.

[0229] In one embodiment, the polar lipid comprises myristic acid (C14:0) in an amount less than about 2% by weight of the total fatty acid content of the polar lipid. In a preferred embodiment, the polar lipid comprises myristic acid (C14:0) in an amount less than about 1% by weight of the total fatty acid content of the polar lipid.

[0230] In some embodiments, stearic acid is present at a level of less than about 14%, or less than about 12%, or less than about 10% of the total fatty acid content of the polar lipid. In preferred embodiments, stearic acid is present at a level of less than about 7%, or less than about 6%, or less than about 5%, preferably less than 4% or less than 3%, of the total fatty acid content of the polar lipid.

[0231] In some embodiments, ARA is present in an amount of about 10% to about 60% by weight, about 10% to about 30% by weight, about 10% to about 25% by weight, about 15% to about 60% by weight, about 20% to about 60% by weight, or about 30% to about 60% by weight of the TFA content of the polar lipid. In preferred embodiments, ARA is present in an amount of about 20% to about 60% by weight, or about 30% to about 60% by weight, or about 40% to about 60% by weight, or about 50% to about 60% by weight of the TFA content of the polar lipid. In some embodiments, ARA is present in an amount of at least or about 10%, 15%, 20%, 25%, or 30% by weight of the TFA content of the polar lipid.

[0232] In one embodiment, the polar lipids include one or more or all of EDA, DTA, and DPA-ω6.

[0233] In one embodiment, when the polar lipids comprise DGLA and ARA, or GLA, DGLA, and ARA, at least one of the following applies: (a) at least one of EDA, DTA, and DPA-ω3 is also present in polar lipids; (b) the ratio of PC to PE or the ratio of PC to phospholipids other than PC is less than 3:1, less than 2:1, less than 1.5:1, less than 1.25:1, less than 1:1, 3:1 to 1:1, 2:1 to 1:1, or 3:1 to 0.5:1.

[0234] In one embodiment, GLA is present in the polar lipid in an amount that is one or more of: (i) less than the sum of the amounts of ARA, DGLA, EDA, DTA, and DPAω6 in the polar lipid; or (ii) less than the amount of ARA, less than the amount of DGLA, less than the amount of EDA, less than the amount of DTA, and less than the amount of DPA-ω6, or any combination thereof.

[0235] In some embodiments, the saturated fatty acid content of the polar lipids comprises one or more or all of lauric acid (C12:0), myristic acid (C14:0), C15:0 fatty acid, C20:0, C22:0 and C24:0, preferably C14:0 and C24:0 or C14:0, C15:0 and C24:0, more preferably C14:0, C15:0 and C24:0, but not including C20:0 and C22:0.

[0236] In some embodiments, lauric acid and myristic acid are not present in the polar lipid, or lauric acid and / or myristic acid are present in the polar lipid, and the sum of the amount of lauric acid and myristic acid in the polar lipid is less than about 2%, or less than about 1%, preferably less than about 0.5%, and more preferably less than about 0.2% of the total fatty acid content of the polar lipid.

[0237] In some embodiments, C15:0 is not present in the polar lipids, or C15:0 is present in the polar lipids in an amount less than about 3%, preferably less than about 2% or less than about 1% of the total fatty acid content of the polar lipids.

[0238] In some embodiments, palmitic acid is present in the polar lipid in an amount from about 3% to about 45%, or from about 10% to about 40%, or from about 20% to about 45% of the total fatty acid content of the polar lipid.

[0239] In some embodiments, palmitoleic acid is present in the polar lipid in an amount from about 3% to about 45%, or from about 3% to about 25%, or from about 3% to about 20%, or from about 3% to about 15% of the total fatty acid content of the polar lipid.

[0240] In some embodiments, oleic acid is present in the polar lipid in an amount of from about 3% to about 60%, or from about 3% to about 40%, or from about 3% to about 25%, or from about 20% to about 60% of the total fatty acid content of the polar lipid.

[0241] In some embodiments, vaccenic acid is not present in the polar lipid, or vaccenic acid is present in the polar lipid in an amount less than about 2%, preferably less than about 1% or about 0.5% of the total fatty acid content of the polar lipid.

[0242] In some embodiments, linoleic acid is present in the polar lipid in an amount from about 3% to about 45%, or from about 3% to about 30%, or from about 3% to about 20% of the total fatty acid content of the polar lipid.

[0243] In some embodiments, gamma-linoleic acid is not present in the polar lipid, or gamma-linoleic acid is present in the polar lipid in an amount between about 3% and about 12%, or between about 3% and about 8%, or between about 3% and about 6%, or less than about 3% of the total fatty acid content of the polar lipid.

[0244] In some embodiments, eicosadienoic acid is not present in the polar lipid, or eicosadienoic acid is present in the polar lipid in an amount between about 3% and about 12%, or between about 3% and about 8%, or between about 3% and about 6%, or less than about 3% of the total fatty acid content of the polar lipid.

[0245] In some embodiments, dihomo-gamma-linolenic acid is not present in the polar lipid, or dihomo-gamma-linolenic acid is preferably present in the polar lipid in an amount of less than about 2%, between 0.1% and about 2%, or between about 10% and about 60% of the total fatty acid content of the polar lipid.

[0246] In some embodiments, C20:0 and C22:0 are not present in the polar lipid, or C20:0 and / or C22:0 are present in the polar lipid and the sum of the amount of C20:0 and C22:0 in the polar lipid is less than about 1.0% or less than about 0.5%, preferably less than 0.2%, of the total fatty acid content of the polar lipid.

[0247] In some embodiments, C24:0 is not present in the polar lipids, or C24:0 is present in the polar lipids in an amount less than about 1.0%, less than about 0.5%, preferably less than 0.3% or less than 0.2% of the total fatty acid content of the polar lipids.

[0248] In some embodiments, C17:1 is not present in the polar lipids, or C17:1 is present in the polar lipids in an amount less than about 5%, preferably less than about 4% or less than about 3%, more preferably less than about 2% of the total fatty acid content of the polar lipids.

[0249] In some embodiments, monounsaturated fatty acids that are C20 or C22 fatty acids are not present in the polar lipid, or C20:1 and / or C22:1 are present in the polar lipid, and the sum of the amount of C20:1 and C22:1 in the polar lipid is less than about 1.0%, less than about 0.5%, preferably less than 0.2% of the total fatty acid content of the polar lipid.

[0250] In some embodiments, (i) the ω6 fatty acids in the polar lipids that are C20 or C22 fatty acids are from about 5% to about 60%, preferably from about 10% to about 60%, of the total fatty acid content of the polar lipids, and / or (ii) the ω6 fatty acids having 3, 4 or 5 carbon-carbon double bonds are from about 5% to about 70%, preferably from about 10% to about 70%, more preferably from about 40% to about 70% or from about 45% to about 70% or from about 50% to about 70% of the total fatty acid content of the polar lipids.

[0251] In some embodiments, C16:3ω3 is absent from polar lipids, or both C16:2 and C16:3ω3 are absent from polar lipids.

[0252] In some embodiments, the polar lipids or more broadly extracted microbial lipids contain PC and / or lack cyclopropane fatty acids, preferably lacking C15:0c, C17:0c, and C19:0c.

[0253] The ω6 fatty acid content of phospholipids / polar lipids can be measured, for example, by lipid derivatization to fatty acid methyl esters (FAMEs) and subsequent gas chromatography (GC) analysis, as described in Example 1 below.

[0254] Phospholipid Extraction In addition to the microbial biomass, extracted lipids from such microorganisms, including phospholipids, may be present in the composition, food product, beverage product, or feed according to the invention. The extracted lipids are typically extracted from Mortierella species according to preferred embodiments. The extracted lipids may include only polar lipids, such as only phospholipids, or may include other lipid fractions. For example, the extracted lipids may include non-polar lipids such as TAG, DAG, and MAG, or free fatty acids, or any combination thereof, in addition to the extracted phospholipids. The extracted lipids may include phospholipids alone, in a vehicle / carrier, and / or as part of a broader extracted lipid, such as a polar lipid fraction, extracted from the microorganism, which may include polar lipids other than phospholipids, such as cephalin, sphingolipids (sphingomyelin and glycosphingolipids), phosphatidic acid, cardiolipin, and / or glyceroglycolipids. In an embodiment, the extracted lipids in which phospholipids are present include one or more sterols, such as yeast cells, ergosterol, and / or ergosterol esters. In some embodiments, phospholipids are present in a broader range of extracted lipids, including polar lipids and optionally including non-polar lipids, and in some embodiments, when present, non-polar lipids are present in the extracted lipids in lesser amounts than polar lipids.

[0255] Lipids may be extracted from microorganisms such as Mortierella species for use in the present invention according to any suitable process known to those of skill in the art. An exemplary method of such extraction is disclosed in Example 1 below. Extraction of phospholipids from microorganisms disclosed herein, such as as a component of a broader lipid fraction, may use methods known to those of skill in the art for lipid extraction from oleaginous microorganisms, for example, as described in Patel et al. (2018) Molecules 23:1562. For example, extraction may be performed by solvent extraction in which an organic solvent (e.g., hexane or a mixture of hexane and ethanol, chloroform and / or a mixture of chloroform and methanol) is mixed with at least the biomass of the microorganism, preferably after drying and grinding the biomass, but may also be performed under wet conditions. The solvent dissolves the lipids in the cells, and the solution may then be separated from the biomass by physical action (e.g., sonication). Sonication is one of the most widely used pretreatment methods to disrupt the cellular integrity of microbial cells. Other pretreatment methods can include microwave irradiation, high-speed homogenization, high-pressure homogenization, bead beating, autoclaving, and pyrolysis.The solvent / lipid solution can be separated from the biomass, for example, by filtration (e.g., using a filter press or similar device) or centrifugation.The organic solvent can then be separated from the non-polar lipids (e.g., by distillation).This second separation step obtains the non-polar lipids from the cells, and if conventional steam recovery is used, can obtain reusable solvent.

[0256] Phospholipids may be separated from the broader lipid fraction extracted from the microorganism by any suitable method, for example, by use of solvent extraction as described below in Example 2. For example, lipids may be extracted from the lipid source by dissolving in ethanol or another alcohol, such as isopropanol, evaporating the ethanol or other alcohol, and then the phospholipids may be further separated from the neutral lipids by precipitating the phospholipids from cold acetone.

[0257] The lipid extracted from the microbial cells may be subjected to conventional oil processing procedures. As used herein, the term "refined", when used in connection with the lipids disclosed herein, means that the extracted lipid has been subjected to one or more processing steps that improve the purity of the lipid components. For example, the refining step may include one or more or all of the group consisting of degumming, deodorizing, bleaching, drying, and / or fractionation of the extracted oil, as described below. However, as used herein, the term "refining" does not include transesterification processes or other processes that change the fatty acid composition of the lipids or oils of the present invention so as to change the fatty acid composition of the total fatty acid content. In other words, in a preferred embodiment, the fatty acid composition of the refined lipid is essentially the same as the fatty acid composition of the unrefined lipid.

[0258] Degumming is an initial step in the purification of lipids in liquid form (oil), whose main objective is the separation of most of the phospholipids from the oil, which may be present as about 1-2% of the total lipids extracted. Addition of about 2% water, typically containing phosphoric acid, to the crude oil at 70-80°C separates most of the phospholipids along with trace metals and pigments. The insoluble material removed is mainly a mixture of phospholipids, also known as lecithin. Degumming can be performed by adding concentrated phosphoric acid to the crude extracted lipid to convert non-hydratable phosphatides to a hydratable form and chelate any trace metals present. The gums are separated from the oil by centrifugation. If purified phospholipids are the desired end product, the insoluble material containing the phospholipids can be dried, for example, by spray drying.

[0259] Alkaline refining is one of the refining processes for treating lipids in the form of oils, sometimes called neutralization. It usually follows degumming and precedes bleaching. Following degumming, the oil can be treated by adding an amount of alkaline solution sufficient to titrate out all of the fatty acids and phosphoric acids, thus removing the soaps formed. Suitable alkaline substances include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate, and ammonium hydroxide. This process is typically carried out at room temperature and removes the free fatty acid fraction. The soaps are removed by centrifugation or extraction into a soap solvent, and the neutralized oil is washed with water. If necessary, any excess alkali in the oil may be neutralized with a suitable acid, such as hydrochloric acid or sulfuric acid.

[0260] Bleaching is a refining process in which oil is heated at 90-120°C for 10-30 minutes in the presence of bleaching earth (0.2-2.0%) and in the absence of oxygen, with nitrogen or steam, or by operating in a vacuum. This step in oil processing is designed to remove unwanted pigments; the process also removes oxidation products, trace metals, sulfur compounds, and traces of soaps.

[0261] Deodorization is the treatment of oils and fats at high temperatures (200-260°C) and low pressures (0.1-1 mmHg). It is typically accomplished by introducing steam into the oil at a rate of about 0.1 mL / min per 100 mL of oil. After sparging for about 30 minutes, the oil is allowed to cool under vacuum. Typically, the oil is transferred to glass containers and flushed with argon before being stored under refrigeration. This treatment improves the color of the oil and removes most of the volatiles or odorous compounds, including any residual free fatty acids, monoacylglycerols, and oxidation products.

[0262] As used herein, "transesterification" refers to the process of exchanging fatty acids within and between TAGs (transesterification) or phospholipids, or transferring fatty acids to another alcohol to form esters. This may involve first releasing the fatty acid from the TAG or PL as a free fatty acid, or may directly produce a fatty acid ester, preferably a fatty acid methyl ester or ethyl ester. In the transesterification reaction of TAG or PL with an alcohol, such as methanol or ethanol, the alkyl group of the alcohol forms an ester bond with the acyl group (including SCFA) of the TAG.

[0263] In some embodiments, both Mortierella species biomass (or other microbial biomass) containing phospholipids and extracted lipids from microorganisms such as Mortierella species containing phospholipids are used in the compositions, food products, beverage products, and feeds according to the present invention. Such embodiments can result in enhanced food-like, e.g., meaty or fishy, ​​aromas. In some such embodiments, the Mortierella species biomass present in the composition is the same as the Mortierella species from which the phospholipids are extracted. In some alternative embodiments, the Mortierella species biomass present in the composition is different from the microorganism, such as Mortierella species, from which the extracted lipids containing phospholipids are extracted.

[0264] The microorganisms or phospholipids extracted from microorganisms according to the present disclosure are not "yeast extracts" as commonly referred to in the art. The term "yeast extract" is understood in the art to generally refer to the water-soluble portion of autolyzed yeast and typically does not contain a phospholipid fraction (see, for example, Sigma Aldrich, Catalog No. Y1625 Yeast Extract). As used herein, the term "yeast extract" includes compositions that are commercially available and labeled as yeast extracts. These are water-soluble fractions of yeast cells that contain amino acids, carbohydrates, vitamins and minerals, and are typically sold in dry powder form.

[0265] Genetic modification According to some embodiments of the invention, the microorganisms can be genetically modified by suitable methods to contain a desired amount or profile of phospholipids, for example, increased amounts of phospholipids / polar lipids and / or increased amounts of phospholipids / polar lipids and / or increased amounts of ω-6 fatty acids esterified in the phospholipids. Thus, the microorganisms can include one or more genetic modifications that result in the synthesis or increased synthesis of one or more ω6 fatty acids, increased total fatty acid synthesis and / or accumulation in the microorganism, increased total polar lipid synthesis and / or accumulation in the microorganism, decreased TAG synthesis and / or accumulation in the microorganism, or increased TAG catabolism, such as increased TAG lipase activity, or decreased catabolism of total fatty acids.

[0266] The genetic modification may include the introduction of an exogenous polynucleotide, the mutation or deletion of a gene or regulatory sequence, or any other known genetic modification. Suitable techniques for genetically modifying microorganisms are well known to those skilled in the art. For example, suitable recombinant DNA techniques are described in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Usubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988), and J. E. Coligan. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date). See also International Application No. PCT / AU2022 / 050177, the disclosure of which is incorporated herein in its entirety.

[0267] By way of example only, polynucleotides encoding desaturase and elongase enzymes can be used to genetically engineer microorganisms to produce lipids for use in the present invention. Desaturase and elongase proteins that may be used in the present invention, and the genes encoding them, are any of those known in the art, or homologs or derivatives thereof. See also International Application No. PCT / AU2022 / 050177, the disclosure of which is incorporated herein in its entirety.

[0268] As used herein, the term "desaturase" refers to an enzyme capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate, which is typically in an esterified form, e.g., an acyl-CoA ester. The acyl group may be esterified to a phospholipid, such as phosphatidylcholine (PC), or to an acyl carrier protein (ACP), or preferably to CoA. Desaturase enzymes that have been shown to be involved in ω6 fatty acid biosynthesis belong to the group of so-called "front-end" desaturases.

[0269] Fatty acid elongation consists of four steps: condensation, reduction, dehydration, and a second reduction. In the context of the present invention, "elongase" refers to a polypeptide that catalyzes the condensation step in the presence of other members of the elongation complex under suitable physiological conditions. It has been shown that heterologous or homologous expression in cells of only the condensing component ("elongase") of the elongation protein complex is required for the elongation of each acyl chain.

[0270] Any embodiment herein should be construed as applying to any other embodiment unless specifically stated otherwise.

[0271] The present invention may also be broadly said to consist of any or all combinations of any two or more of the parts, elements and features referred to or indicated in the specification of this application, either individually or collectively, and where a specific integer number having known equivalents in the art to which the invention pertains is referred to herein, such known equivalents are deemed to be incorporated herein as if individually set forth.

[0272] Reference in this specification to any prior publication (or information derived therefrom), or to any known matter, is not, and should not be construed as, an acknowledgement or admission, or any form of suggestion, that the prior publication (or information derived therefrom) or known matter forms part of the common general knowledge in the field of endeavor to which this specification pertains.

[0273] The present disclosure will now be described with reference to the following specific examples, which should not be construed in any way as limiting the scope of the invention. EXAMPLES

[0274] Example 1. Materials and Methods Media and Chemicals YPD medium is a rich medium containing 10 g / L yeast extract (Sigma Aldrich, Catalog No. Y1625), 20 g / L peptone (Sigma Aldrich, Catalog No. P0556), and 20 g / L glucose (Sigma Aldrich, Catalog No. G7021). YPD plates also contain 20 g / L agar. SD-Ura medium contained Yeast Synthetic Drop-out Medium (Sigma, Catalog No. Y1501) at the recommended amount per liter. This medium was supplemented with uracil as needed. SD agar plates contained 6.7 g / L yeast nitrogen base, 20 g / L glucose, and 20 g / L agar.

[0275] Chemicals were supplied as follows unless otherwise stated: L-cysteine ​​(Sigma, Cat. No. 168149), D-(-) ribose (Sigma, Cat. No. R7500), thiamine hydrochloride (Sigma, Cat. No. 47858), ferrous fumarate (Fe 2+ , Apohealth, New South Wales, Australia; code #MH / Drugs / 25-KD / 617), L-glutamic acid monosodium salt hydrate (Sigma, catalog number G5889), potassium phosphate dihydrogen (Sigma, catalog number 1048731000).

[0276] Media for larger scale yeast cultures Unless otherwise stated, the medium used to prepare seed cultures for larger scale yeast cultivation (2 L or more) contained 10.64 g of potassium dihydrogen orthophosphate (KH 2 O) per liter. 2 PO 4 ), 4.0 g of diammonium orthophosphate ((NH 4 ) 2 HPO 4 ), and basal medium (BM) containing 1.7 g citric acid (monohydrate). These ingredients were dissolved in approximately 70% of the required volume of water purified by reverse osmosis, adjusted to pH 6.0 with 2 M NaOH, and made up to the required volume using purified water. The BM was sterilized at 121° C. for 20 minutes and cooled to room temperature. The following ingredients were then added separately (per liter): 30 mL 660 g / L glucose (autoclaved) (final concentration 20 g / L), 10 mL 1 M magnesium sulfate heptahydrate (autoclaved), 10 mL trace metals solution (see below, filter sterilized), 10 mL 15 g / L thiamine hydrochloride (filter sterilized), and 3 mL 10% (v / v) Sigma Antifoam 204 (autoclaved).

[0277] Fermentation medium (FM) for yeast cultures of 2 L or greater volume also used BM as the base medium unless otherwise stated. The required amount was added to the bioreactor and sterilized at 121°C for 60 minutes in a fluid cycle for autoclavable bioreactors or 30 minutes for steam-in-place bioreactors and cooled to 30°C. Per liter of base medium, the following ingredients were added: 121 mL of 660 g / L glucose (autoclaved) (final concentration 80 g / L), 5 mL of 1 M magnesium sulfate heptahydrate (autoclaved), 5 mL of trace metals solution (see below, filter-sterilized), 5 mL of 15 g / L thiamine hydrochloride (filter-sterilized), and 50 mL of 200 g / L ammonium chloride (filter-sterilized). Glucose, magnesium, trace metals solution, and thiamine solution were mixed and added together to the bioreactor. After the medium was formulated, the pH was checked and was normally slightly below 6.0. Ammonia solution was added to the medium using a pH controller to bring the pH to 6.0.

[0278] Small scale (50 mL) and larger scale yeast cultures of 2 L or more to induce more TAG synthesis were also grown in a defined medium (DM-Glyc-LowN) containing 8% (w / v) glycerol and a lower nitrogen content, in which glucose was replaced with 80 g / L glycerol (final concentration) as the carbon source and (NH 4 ) 2 HPO 4 The same as DM-Gluc, except that the content was reduced to 2.0 g / L or even 0.5 g / L as indicated. For larger yeast cultures, starter cultures were grown for 24-48 hours in either YPD or SD-Ura medium supplemented with uracil and any amino acid as required. Samples of the starter cultures were centrifuged and the cells were used to inoculate larger cultures. These cultures were incubated for 48-96 hours and the pH was maintained at 6.0 unless otherwise stated.

[0279] The trace metals stock solution (TMS) used in the above medium contained 2.0 g CuSO per liter.4 5H 2 0, 0.08 g NaI, 3.0 g MnSO 4 H 2 0.2 g NaMoO 4 2H 2 0, 0.02 g H 3 BO 3 , 0.5 g CoCl 2 6H 2 0, 7.0 g ZnCl 2 , 22.0 g FeSO 4 7H 2 0, 0.50 g CaSO 4 2H 2 The solution contained 1 mL of 0.5 mL of 100 mM KCl, 1 mL of 100 mM NaCl, and 1 mL of sulfuric acid. The reagents were added in the order listed. The addition of sulfuric acid resulted in the dissolution of calcium sulfate. The trace metals solution was sterilized by filtration through a 0.2 μm filter and stored at 2-8 °C in a bottle wrapped in aluminum foil.

[0280] One pH control solution contains 118 mL of 85% H 3 PO 4 One was a phosphoric acid solution (10% w / v) prepared by adding 100 mL of 30% ammonia solution to 882 mL of purified water. The solution was sterilized by autoclaving. The other was an ammonia solution (10% v / v) prepared by adding 330 mL of 30% ammonia solution to 670 mL of purified water. This solution was assumed to be self-sterilizing. An antifoam solution was prepared by mixing 100 mL of Sigma antifoam 204 with 900 mL of purified water to obtain a concentration of 10%. The mixture was sterilized by autoclaving.

[0281] A feed solution was prepared by adding 134 mL of filter-sterilized 200 g / L ammonium chloride to 1 L of 660 g / L glucose and sterilized by autoclaving.

[0282] microbial strains S. cerevisiae strain D5A (ATCC 200062) was used as the yeast for experiments on the production of lipids, including phospholipids. Several yeast strains of this species, Yarrowia lipolytica, such as the wild-type strain W29, were also used and were obtained from the American Type Culture Collection (Manassesa, VA, USA) (Casaregola et al., 2000).

[0283] The fungal strain described herein as yNI0121 (Mucor hiemalis) was deposited under the Budapest Treaty at the National Metrology Laboratory, Port Melbourne, VIC3207, Australia, on 4 February 2021, and has been designated the following deposit number: yNI0121 deposit accession number V22 / 001757. The fungal strains described herein as yNI0125 (Mortierella elongata), yNI0126 (Mortierella spp.), yNI0127 (Mortierella spp.), and yNI0132 (Mortierella alpina) were deposited at the National Metrology Laboratory, Port Melbourne, VIC 3207, Australia, on 12 October 2021 under the Budapest Treaty and have been designated yNI0125 deposit accession number V21 / 019953, yNI0126 deposit accession number V21 / 019951, yNI0127 deposit accession number V21 / 019952, and yNI0132 deposit accession number V21 / 019954.

[0284] Growth of S. cerevisiae and Y. lipolytica cultures for lipid analysis To provide inoculum for yeast cultures for fatty acid production, extraction, and analysis, small-scale cultures of Y. lipolytica or S. cerevisiae were grown in 5 mL or 10 mL YPD medium for 24 hours at 29°C. For experiments, the inoculum culture was diluted into growth medium with a volume (volume), for example, 50-2000 mL, to an optical density at 600 nm (OD600) of approximately 0.1. Smaller scale cultures were grown in polypropylene tubes for 10 mL cultures or in glass flasks for larger volumes, with the vessel having a volume at least 5 times larger than the culture volume. The vessel was sealed with 3M Micropore Medical Tape (Cat. No. 1530-1) tape and incubated in a shaker at 200 rpm for aeration at the prescribed temperature of 29°C unless otherwise specified.

[0285] When SD-Ura medium was used, carbon sources such as 2% glycerol or raffinose (w / v) (MP Chemicals, USA, Cat. No. 4010022) were used. Cultures were incubated overnight at 28°C with shaking for aeration. Inoculum cultures were diluted into 10 mL of SD-Ura medium containing 2% (w / v) glycerol or raffinose, or other volumes as specified, to obtain an initial OD600 of 0.1. Cultures in 50 mL tubes or 250 mL flasks were incubated in a shaker at 28°C and 200 rpm for aeration. OD600 was checked at 15 or 30 min time intervals, and exogenous compounds (if present) as potential substrates were added to the medium when OD600 reached 0.3.

[0286] Providing lipid substrates to cells For substrate feeding experiments, yeast inoculation cultures were diluted into their respective growth media containing 1% Tergitol (Sigma Aldrich Cat. No. NP40S) or Tween® 100 at an OD600 of 0.1 and incubated with shaking for a certain period of time, typically 2 hours. Lipid substrates, such as fatty acids, oils or oil hydrolysates, were then added to the medium and the cultures were further incubated for different periods of time. Unless otherwise stated, fatty acid substrates were dissolved in ethanol and fed to the cultures to a final concentration of 0.5 mg / mL, or sodium salts of fatty acids were fed in aqueous solutions.

[0287] Seed culture for larger scale cultivation For the primary seed culture, a frozen glycerol stock of the yeast strain was used to inoculate 100 mL of DM in a 1 L plastic baffled Erlenmeyer flask with a vented cap. This was incubated for 24 ± 2 hours at 28°C with shaking at 200 rpm for aeration. The optical density at 600 nm (OD600) was measured at the end of incubation. The secondary seed culture was prepared by using the primary seed culture to inoculate 500 mL of DM in a 2 L plastic baffled Erlenmeyer flask with a vented cap to a starting OD600 of 0.04. The second seed culture was incubated for 16 ± 2 hours at 28°C with shaking at 200 rpm. The OD600 was measured at the end of incubation. This culture was used to inoculate the large-scale fermentation.

[0288] Cell harvesting, washing, and lyophilization Cells from smaller scale cultures were harvested by centrifugation at 4600g for 15 min, e.g. in 50 mL tubes, and washed twice with 10 mL and finally with 1 mL MilliQ water. For the final wash to measure dry cell weight, the cell suspension was transferred to a pre-weighed 2 mL Eppendorf tube, centrifuged, and the cell pellet was lyophilized (VirTis Bench Top freeze dryer, SP Scientific) prior to weighing and lipid extraction. When lipid substrates such as ARA, DGLA, γ-linolenic acid (GLA), or other fatty acids were added to the growth medium, the cell pellet was washed successively with 1 mL 1% tergitol (v / v), 1 mL 0.5% tergitol, and finally with 1 mL water to remove residual substrates from outside the cells and lyophilized as above. When oil was added to the growth medium, cells were harvested by centrifugation as above, but the cell pellet was washed successively with 5 mL 10% Tergitol (v / v), 5 mL 5% Tergitol, 5 mL 1% Tergitol, 5 mL 0.5% Tergitol, and finally with 5 mL water to remove residual oil from the exterior of the cells. In some cases, microscopic observation after staining with Bodipy confirmed the absence of oil staining in the cell wall. At the last wash, the pellet was transferred to a pre-weighed 2 mL Eppendorf tube and lyophilized prior to weighing and lipid extraction.

[0289] Lipid extraction from yeast cells In some experiments, total cellular lipids may be prepared from S. cerevisiae or Y. lipolytica by using a method modified from Bligh and Dyer (1959). Approximately 50 mg of lyophilized cells were homogenized in a 2 mL Eppendorf tube with 0.6 mL of a chloroform / methanol (2 / 1, v / v) mixture containing 0.5 g of zirconium oxide beads (catalog number ZROB05, Next Advance, Inc., USA) for 5 min at speed 6 using a Bullet Blender Blue (Next Advance, Inc.). The mixture was then sonicated for 5 min in a sonication water bath and 0.3 mL of 0.1 M KCl was added. The mixture was shaken for 10 min and centrifuged at 10,000 g for 5 min. The organic lower phase containing lipids was transferred to a glass vial and the remaining lipids were extracted from the upper phase containing cell debris by mixing with 0.4 mL of chloroform for 20 min and centrifuging. The lower phase was collected and combined with the first extract in a glass vial. The solvent was evaporated from the lipid samples under a stream of nitrogen and the extracted lipids were resuspended in a measured volume of chloroform. If necessary, the lipid samples were stored at -20°C until further analysis.

[0290] Lipid extraction from larger biomass To extract total lipids from larger biomasses, different methods of cell homogenization were used with larger volumes of solvent unless otherwise stated. In one method, cells were homogenized in chloroform / methanol (2 / 1, v / v) for 3 min or the stated times using an Ultra-Turrax T25 homogenizer (IKA Labortechnik Staufen, Germany). One volume of 1 M KCl was added to each mixture, followed by further homogenization for 2 min. The mixtures were centrifuged at 6000 g for 3 min. The lower phase was transferred to a new tube (tube B) and the solvent was evaporated under a nitrogen stream at room temperature. The upper phase was mixed with 1 g of glass beads in a Vibramax mixer for 10 min, during which it was vortexed vigorously for 1 min. One volume of chloroform was added to each tube and mixed again for 3 min. After centrifugation, the lower phase was transferred to tube B and the solvent was evaporated under a nitrogen stream at room temperature. To extract the remaining lipids, the upper phase of tube A was mixed with another volume of chloroform and mixed for 3 min. After centrifugation, the lower phase was transferred again to tube B, and 0.5 volumes each of methanol and 0.1 M KCl were added to tube B and mixed for 3 min. The lower phase was transferred to a Falcon tube, and the solvent was evaporated under a stream of nitrogen gas at room temperature. The extracted lipids were dissolved in chloroform / methanol (2 / 1, v / v) and stored at -20°C.

[0291] When hexane was used as the extraction solvent for extracting total lipids, the wet biomass of cells was first washed twice with ethanol to remove water. If this was not done, the hexane-water solvent system would tend to separate as two phases, which could reduce the extraction efficiency due to less mixing. When a hexane / ethanol mixture (60 / 40 or 40 / 60 v / v) was used, this ethanol washing step was not necessary. Similar extraction and disruption methods using solvents were used as described in the examples.

[0292] Lipid extraction from fungal biomass Unless otherwise stated, the following method was used to extract lipids from fungal biomass such as Mortierella or Mucor, which preferentially extracts polar lipids, including phospholipids (PL), based on the differential solubility of PL and neutral lipids, first in ethanol as the solvent, and then in hexane for residual lipids. A known weight of wet fungal biomass was washed with ethanol to remove water, then resuspended in ethanol using 2 mL of ethanol per gram of biomass. The mixture was homogenized for 3 minutes using an Ultra-Turrax, then sonicated for 5 minutes. The homogenization and sonication steps were repeated two more times for a total of three times. Samples were observed under a light microscope to ensure mycelium disruption had occurred. The mixture was centrifuged to pellet the cell debris, which was weighed. The ethanol supernatant was collected, and the solvent was evaporated to recover the polar lipids. The cell debris was mixed with hexane, and neutral lipids and any remaining polar lipids were extracted using 5 mL of hexane per gram of cell debris. The mixture in hexane was homogenized for 3 minutes using an Ultra-Turrax. The mixture was then shaken for 2 hours, centrifuged, and the hexane supernatant was collected. The solvent was evaporated to recover the lipids, which mainly contained TAG.

[0293] Lipid fractionation by thin-layer chromatography To separate different lipid types such as TAG, DAG, free fatty acids (FFA), and polar lipids such as PL on an analytical scale, total lipids were fractionated on thin-layer chromatography (TLC) plates (silica gel 60; catalog number 1.05626.0001, MERCK, Darmstadt, Germany) using hexane:diethyl ether:acetic acid (70 / 30 / 1 v / v / v) as the solvent system. Samples of lipid standards such as 18-6A containing TAG, DAG, FFA, and MAG (Nu-Chek Prep Inc, USA) were run in adjacent lanes to identify different lipid spots. After chromatography, the plate was sprayed with a solution of primulin (catalog number 206865, Sigma, Taufkirchen, Germany) prepared at a concentration of 5 mg / 100 mL in acetone:water (80 / 20 v / v), and lipid bands were visualized under UV light. The silica containing lipids was scraped off from each spot and transferred to a tube. The lipid fraction was extracted from the silica for derivatization using methylation and subjected to GC analysis to determine and quantitate the fatty acid composition.

[0294] Preparative-scale fractionation of PL and TAG from total lipids by TLC PL and TAG were fractionated from approximately 100 mg of total lipids by loading lipids onto the 18 cm line of each of eight TLC plates (silica gel 60; catalogue no. 1.05626.0001, Merck, Darmstadt, Germany) and chromatographed with a solvent mixture consisting of hexane / diethyl ether / acetic acid (70:30:1, v:v:v). An aliquot of lipid standards (18-6A; NuChek Inc, USA) containing TAG, DAG, FFA, and MAG was run in parallel to aid in the identification of lipid bands. After staining the plates with primulin and visualization under UV light, the PL band located at the origin and the TAG band with the same mobility as the TAG standard were collected and transferred to a Falcon tube. The lipid / silica samples were extracted with a mixture of 6 mL chloroform and 3 mL methanol, mixed vigorously for 5 min, then 3 mL water was added and mixed for another 5 min. After centrifugation at 3000g for 5 min, the organic lower phase was transferred to a new tube. After centrifugation at 3000rcf for 5 min, the lower phase was transferred to a Falcon tube. The upper phase was mixed with 5mL of chloroform for 5 min to extract any remaining lipids. After centrifugation, the lower phase was combined with the first extract. The solvent was evaporated under a stream of nitrogen gas. The TAG or PL of the extracted lipids were dissolved in a small amount of chloroform and filtered through a 0.2μm microspin filter (Chromservis, EU, Cat. No. CINY-02) to remove any particulate matter. The fatty acid composition and amount of each PL and TAG fraction was determined by preparation and GC analysis of FAMEs. Such preparations were used, for example, to separate different polar lipid classes such as PC, PE, PI, and PS, or in the Maillard reaction for aroma testing or for the detection of volatile compounds as reaction products.

[0295] Lipid derivatization to fatty acid methyl esters (FAMEs) For analysis by GC, fatty acid methyl esters (FAMEs) were prepared from total extracted lipids or purified TAG or polar lipid fractions containing PL samples by treatment with 0.7 mL methanolic HCl 1N (Sigma Aldrich, Cat. No. 90964) for 2 h at 80 °C in 2 mL glass vials with PTFE-lined screw caps. A known amount of heptadecanoin (Nu-Chek Prep, Inc., Cat. No. N-7-A, Waterville, Maine, USA) dissolved in toluene was added to each sample before processing as an internal standard for quantification. After cooling the vials, 0.3 mL (w / v) of 0.9% NaCl and 0.1 mL of hexane were added and the mixture was vortexed for 5 min. The mixture was centrifuged at 1700 g for 5 min and the hexane upper phase containing FAMEs was analyzed by GC.

[0296] Analysis and quantification of FAMEs by GC Individual FAMEs were identified and quantified by GC using an Agilent 7890A GC (Palo Alto, CA, USA) equipped with a 30 m SGE-BPX70 column (70% cyanopropyl polysilphenylene-siloxane, 0.25 mm inner diameter, 0.25 μm film thickness), a split / splitless injector and an Agilent Technologies 7693 Series autosampler and injector, and a flame ionization detector (FID). Samples were injected in split mode (50:1 ratio) with an oven temperature of 150° C. The column temperature was programmed to be 150° C. for 1 min, ramped to 210° C. at 3° C. / min, held for 2 min, reached 240° C. at 50° C. / min, and then held at 240° C. for 0.4 min. The injector temperature was set to 240° C. and the detector was set to 280° C. Helium was used as the carrier gas at a constant flow rate of 1.0 mL / min. FAME peaks were identified based on FAME standards (GLC-411, GLC-674; NuChek Inc., USA). Peaks were integrated using Agilent Technologies ChemStation software (Rev B.04.03(16), Palo Alto, CA, USA) based on the response of known amounts of external standard GLC-411 (NuChek) and C17:0-ME internal standard. The data obtained provide fatty acid composition on a weight basis, in terms of the percentage (wt%) of each fatty acid in a total fatty acid content of 100%. These weight percentages could be easily converted to molar percentages (mol%) based on the known molecular weight of each fatty acid.

[0297] Peak identity by GC-MS The identity of unknown or uncertain peaks in the GC-FID chromatograms was confirmed by gas chromatography mass spectrometry (GC-MS) analysis. Samples were subjected to GC-MS operating in electron ionization mode at 70 eV to confirm peak identities and to identify extra peaks that may correspond to possible contaminants, degradation products, or reagent signals. A Shimadzu GC-MS QP2010 Plus (Shimadzu Corporation, Japan) system coupled to an HTX-Pal liquid autosampler was used with the following parameters: 1 or 2 μL injection volume using a split / splitless inlet with a 15:1 split at a temperature of 250 °C. The oven temperature program used was the same as for the GC-FID. The MS ion source and interface temperatures were 200 °C and 250 °C, respectively. Data were collected at a scan rate of 1000 and a scan range of 40-500 m / z. Peak separation was achieved by Stabilwax or Stabilwax-DA (Restek / Shimadzu) capillary columns (30 m×0.25 mm id, 0.25 μm film thickness) using He as carrier gas at 30 cm / sec. Mass spectral correlation was performed using the NIST library, retention indices, and matching retention times of available standards. Identified SCFAs were set as present when the signal to noise ratio was greater than 10:1. Instrumental and procedural blanks were run for quality control purposes.

[0298] Example 2. Lipid fractionation Crude lipid preparations can be fractionated with organic solvents to provide purer polar lipids or fractions with mostly neutral (non-polar) lipids, including TAG (e.g., U.S. Pat. No. 7,550,616). For example, some reported methods use the differential solubility of neutral and polar lipids in organic solvents, such as ethanol or acetone. To test some of these methods, we attempted fractionation of several lipids, including egg yolk lipids and krill lipids, as model systems, with a mixture of substantially neutral and polar lipids.

[0299] Lipids in chicken eggs are mainly present in the yolk fraction, which constitutes about 33% of lipids by weight. Lipids closely associated with proteins in egg yolk are mostly TAGs (66% by weight), with lesser amounts of phospholipids (PL, 28%) and cholesterol and its esters (6%) (Belitz et al., 2009). PL contains some ω3 and ω6 fatty acids (Gladkowski et al., 2011). Based on the method of Palacios and Wang (2005), Gladkowski et al. (2012) purified PL by extracting it from egg yolk with ethanol and then removing neutral lipids by precipitating the PL with cold acetone.

[0300] Fresh egg yolk (17 g), egg lecithin powder (20.4 g; Lesen Bio-Technology Co, Xi'an, China), and krill oil from Antarctic krill (Euphhausia superba) (17.7 g) obtained from commercial krill oil capsules (Bioglan Red Krill Oil; Natural Bio Pty Ltd, Warriewood, New South Wales, Australia) were each mixed with 60 mL of ethanol and stirred for 30 min. After the mixture was centrifuged, the ethanol supernatant was collected. The precipitate was extracted two more times with 60 mL of ethanol each time. The extraction mixture was centrifuged and the ethanol supernatants were combined. Each precipitate was retained for extraction of neutral lipids. The ethanol from the combined supernatants was evaporated using a SR-100 rotary evaporator (Buchi, Switzerland). The SR-100 rotary evaporator was operated at 400 rpm under a vacuum of 15 mbar, the chiller was set at -16 °C, and the water bath was set at 37 °C. This resulted in 3.2 g of PL-enriched lipid extract from 17 g of fresh egg yolk, 5.86 g from 20.4 g of egg lecithin powder, and 17.83 g of enriched PL recovered from the krill oil. The lipids recovered from the krill oil probably still contained small amounts of solvent. Nevertheless, the essentially 100% recovery indicated that the krill oil from the capsules was initially highly enriched for PL.

[0301] Aliquots of the recovered lipids were analyzed by TLC using hexane:diethyl ether:acetic acid (70:30:1; v / v / v) as the solvent as described in Example 1. The ethanol extracts from fresh egg yolk and egg yolk lecithin powder were observed to contain significant amounts of polar lipids and small amounts of TAGs, whereas the krill oil extract had no detectable TAGs.

[0302] To further purify the polar lipids from fresh egg yolk, the dried extract was dissolved in 30 mL of hexane and the solution was cooled to 0 °C in an ice bath. Then, 60 mL of cold acetone (-20 °C) was slowly added to the solution and the mixture was kept cold for at least 20 min to precipitate the PL. Other experiments showed that more precipitate was formed by keeping the mixture at 0 °C overnight. The precipitate was collected and dried under vacuum. A sample of the lipids was dissolved in chloroform and analyzed by TLC to estimate the polar lipid and TAG content. The acetone precipitate was shown to have mainly polar lipids with some TAG. To further purify the polar lipids, the precipitate was washed five times with 20 mL portions of cold acetone (-20 °C) to remove more TAG and other neutral lipids such as cholesterol. Residual solvent was removed from the washed precipitate by rotary evaporation at room temperature for 10 h. The lipid yield was determined gravimetrically and a small aliquot was used for analysis of fatty acid composition by GC quantification of FAMEs. From an initial input of 17 g of fresh egg yolk, 1.1 grams of purified polar lipids were recovered. An aliquot of this extracted lipid was analyzed by TLC and observed to be essentially devoid of any neutral lipids, including TAG. These observations were consistent with those reported by Gladkowski et al. (2012), who found the extract to be 96% pure PL.

[0303] Neutral lipids were extracted from the egg yolk and the precipitate after ethanol extraction of the egg yolk powder by extracting the precipitate twice with 50 mL of hexane. The combined hexane solution containing the neutral lipids was washed four times with 50 mL of 90% ethanol each time. The hexane was then evaporated under reduced pressure to obtain purified neutral lipids from the egg yolk.

[0304] To determine the fatty acid composition of the extracted lipids, the total fatty acids in the aliquots were converted to FAMEs for GC analysis as described in Example 1. This included a sample after ethanol extraction but before hexane / acetone precipitation (first precipitate), and a sample after hexane / acetone precipitation (second precipitate). The results are shown in Table 3. The ethanol-soluble lipids isolated from fresh egg yolk and the acetone-precipitated lipids purified therefrom contained C16:0 and C18:0 as the major saturated fatty acids. The first lipid precipitate from fresh egg yolk contained 24.7% (C16:0) and 15.6% (C18:0), while the more purified polar lipids contained 27% (C16:0) and 16% (C18:0). The amount of LA in the second precipitate was slightly higher than in the first precipitate. LA is more abundant in PL than TAG. Both the fresh egg yolk and the purer polar lipid preparation also contained ω6 and ω3 LC-PUFAs. For example, the first precipitate of fresh egg yolk contained 5.3% C20:4 (ARA), 2.3% C20:5 (EPA), and 5% C22:6 (DHA), while the more refined polar lipid preparation contained 5.3% ARA and 4% DHA. The first precipitate from krill oil and the more refined polar lipids from krill oil had C16:0 as their major saturated fatty acid. The first precipitate from krill oil and the more refined polar lipids also contained significant amounts of ω3 LC-PUFAs, namely 1.1% ARA, 34.7% EPA, and 19.0% DHA in the first precipitate, while the more refined polar lipids contained 1.1% ARA, 48.1% EPA, and 25.7% DHA. Lipids precipitated from egg yolk lecithin powder had 17% C16:0 and 4% C18:0, but were low in the LC-PUFAs EPA and DHA. The low LC-PUFA content of the lecithin powder was likely due to oxidative degradation of these polyunsaturated fatty acids during its production or storage.

[0305] An alternative method to purify polar lipids by fractionation from total lipid preparations is to use silica-based column chromatography, for example using SPE columns (HyperSep aminopropyl, ThermoFisher, UK). [Table 3]

[0306] Example 3. Maillard reaction The Maillard reaction is a chemical reaction between reducing sugars and amino groups, for example in free amino acids, by the application of heat. Like caramelization, it is a form of nonenzymatic browning. In this reaction, amino groups react with the carbonyl groups of sugars to produce N-substituted glycosylamines and water. Unstable glycosylamines undergo Amadori rearrangement to produce ketosamines. Ketosamines can further react in different ways to produce reductones, diacetyl, aspirin, pyruvaldehyde, and other short-chain hydrolytic split products. Finally, furan derivatives may be obtained, which react with other components and polymerize to become nitrogen-containing dark, insoluble substances.

[0307] The outcome of the Maillard reaction varies depending on temperature, time and pH. For example, the reaction is slower at low temperatures, low pH and low water activity (Aw) levels. Browning occurs more rapidly under alkaline conditions because the amino groups remain in the basic form. The reaction peaks at intermediate water activities such as Aw of 0.6 to 0.7. In addition to color, many volatile aroma compounds are typically formed during the Maillard reaction. Flavor-intensive compounds can be formed in the presence of the sulfur-containing amino acids methionine or cysteine, or other sulfur-containing compounds such as thiamine. Unsaturated fatty acids and aldehydes formed from fatty acids also contribute to the formation of heterocyclic flavor compounds during the Maillard reaction (Gehard Feiner, 2006). Given this contribution of unsaturated fatty acids to flavor and aroma formation, we tested the extracted egg yolk polar lipid preparation from Example 2 as a model system for the Maillard reaction.

[0308] In the first experiment, 26 mixtures for the Maillard reaction were combined containing a matrix of components in basal medium, either containing 15 mg of extracted egg yolk polar lipids (Example 2) or lacking lipids (control). The reactions were carried out in 20 mL glass vials with a tightly sealed screw top in a volume of 2 mL. To deposit the correct amount of extracted lipids in the vials, the lipids were dissolved in hexane at a concentration of 1 mg / μL of solvent. An aliquot of 50 μL of lipid solution containing 50 mg of concentrated polar lipids was pipetted into the vials for the reactions with lipids. The hexane was then evaporated under a stream of nitrogen. The other components in each mixture were added to the vials in the following order: The components were added to obtain a final concentration of 10 mM xylose as the sugar, 0.1 mM thiamine hydrochloride, and either 5 mM cysteine ​​or 5 mM cystine as the sulfur-containing amino acid. These components were dissolved in potassium phosphate buffer (pH 6.0 or 5.3) prepared from potassium dihydrogen phosphate and dipotassium hydrogen phosphate at a final concentration of 32.6 mM. Some mixtures also contained 15 mg / mL yeast extract, 3.5 mg / L iron in the form of ferrous fumarate, and 1.5 mg / L ferric fumarate. 2+ (Apohealth, New South Wales, Australia) and L-glutamic acid monosodium salt hydrate 2 mM. The presence or absence of yeast extract was intended to test whether it masked or enhanced the aroma produced from the extracted lipids with PL, or had no effect.

[0309] The combined mixture was sonicated for 30 minutes and then heated in an oven set at 146 °C for 15 minutes. The vials were tightly sealed during the heat treatment. The vials were allowed to cool, became warm to the touch after about 15 minutes, and were then briefly opened for sniffing by a panel of four applicants (P1-P4). The applicants included two males and two females, with ages ranging from 24 to 65 years. The applicants were unaware of the composition of any of the vials before sniffing the contents, and the vials were sniffed in a random order selected by the applicants. The applicants sniffed coffee beans between sniffing each test sample to restore their olfactory sense. Aroma descriptions were recorded without sharing any comments until the sniffing was completed.

[0310] The four participants differed considerably in their descriptions of the detected aromas of the 26 mixtures. Despite these variations, the reaction mixtures containing added polar lipid preparations were generally perceived as having a stronger meaty / meat-like aroma compared to the control samples lacking polar lipids, confirming the role of lipids in contributing to meaty aromas following the heat-induced Maillard reaction. Samples containing yeast extract, ferrous fumarate, or both were identified as having a stronger meaty or meat-related aroma, described as beef or chicken, by three of the four participants. Therefore, the base composition with these ingredients was selected for further investigation.

[0311] Several further experiments were performed to test variations of the Maillard reaction mixture with respect to the composition of the basal medium. In one experiment, xylose was replaced with either glucose or ribose as the sugar component. In another experiment, fenugreek (Trigonella foenum-graecum) leaf powder was added to some of the mixtures at 10 mg per mL of reaction. Fenugreek leaf powder was tested because it has long been used in food preparation to enhance the flavor of dishes such as those in curries, or in combination with other herbs or spices such as cumin and coriander. Some reaction mixtures contained 30 mg of yeast extract powder, while others did not. Control reactions had the same basal medium composition but lacked the extracted polar lipid preparation. The reaction mixture was sonicated as a batch by placing the vials in a floating bubble and placing them in a sonicator (Soniclean, Thermoline) set at medium power for 30 min, then heat treated in an oven at 140 °C for approximately 60 min. The vials containing the reaction mixture were slowly cooled over approximately 15 min and were warm to the touch. Each of the 10 applicants briefly opened a vial, smelled the contents, and recorded an aroma description. Applicants ranged in age from 29 to 65 years and were from a variety of ethnic backgrounds. Responses were coded with random three-digit numbers to avoid bias, and applicants sniffed the coffee beans between vials as before.

[0312] The recorded responses to smelling the reaction mixtures were generally consistent with those of previous experiments. Most of the mixtures containing extracted lipids elicited favorable comments, especially those containing ribose rather than glucose for meaty aroma. The use of yeast extract could enhance meaty aroma, but did not appear to produce species-specific aromas, e.g., beef aroma vs. chicken aroma. The addition of the herb powder fenugreek to the mixtures improved the sensation of soup or vegetable aroma with a pleasant vegetable note. It was concluded that various media compositions and ingredients could be used with the extracted lipids, and that ribose was preferred over glucose as the sugar component.

[0313] Example 4. Feeding omega-6 fatty acids to yeast and incorporation into polar lipids The present inventors have produced phospholipids (PL) containing ω6 fatty acids by incorporation into microbial PL, specifically by supplementing Y. lipolytica and S. cerevisiae cultures with ω6 fatty acids such as ARA, GLA, and DGLA by first feeding the microorganisms with ω6 fatty acids during the growth of the cultures, then extracting the lipids from the cells and fractionating them to isolate the polar lipids, including the PL.

[0314] Preparation of fatty acid substrates from ARA oil As a source of ARA in the feeding experiment, ARA-containing oil with 50% ARA in the total fatty acid content was obtained from Jinan Boss Chemical Industry Co., Ltd (China) (Table 4). We hydrolyzed a part of the oil to convert its TAG to free fatty acids as follows. Two similar methods were tested to hydrolyze the TAG in the ARA-rich oil, both using KOH to release the free fatty acids from the glycerol backbone in salt form. Method 1 was based on the method described in Lipid Analysis book, 2 ndedition, Christie. In this method, 0.5 g of ARA-rich oil was mixed with 1.5 mL of 1 M KOH in 95% ethanol in a glass tube (A) for 1 h. After cooling the solution, 1 mL of water and 1 mL of hexane were added to the mixture and vortexed for 5 min. After centrifugation at 1700 g for 5 min, the hexane upper phase was transferred to a glass tube (B). To further extract fatty acids, 1 mL of hexane was added to the lower phase, vortexed for 5 min, centrifuged for 5 min, and the upper phase was removed and added to tube B. The solvent from tube B was evaporated under a stream of nitrogen and the dried extract was dissolved in 0.3 mL of chloroform. Method 2, based on Salimon 2011, was identical to method 1, except that 0.5 g of ARA-rich oil was treated with 1.5 mL of 1.75 M KOH in 90% ethanol at 65 °C for 1 h. Fatty acids were extracted into hexane as in method 1. Again, the hexane was evaporated under a stream of nitrogen and the dried lipids were dissolved in 0.3 mL of chloroform. In both methods, the alkali was not neutralized prior to hexane extraction, which was done for the later preparation of the hydrolysates. However, in this experiment, the hydrolyzed fatty acids were isolated by TLC and recovered, so neutralization was not required.

[0315] To determine the extent of TAG hydrolysis, 10 μL aliquots of the fatty acid preparations were chromatographed on TLC plates (Silica 60, Merck) using hexane / diethyl ether / acetic acid (70 / 30 / 1; v / v / v) as the solvent system described in Example 1. Both methods resulted in efficient hydrolysis of the ARA oil, as indicated by the presence of bands corresponding to FFAs and the absence of bands for TAGs on the TLC plates. The fatty acid composition of the hydrolysates and fatty acids purified by TLC was nearly identical to the starting ARA oil, with approximately 51% ARA in the total fatty acid content of the preparations.

[0316] For larger scale hydrolysis of ARA oil, a third method was tested and proved successful. 50 g of ARA-rich oil was added to 300 mL of a solution containing 1.75 M KOH dissolved in 90% ethanol and mixed thoroughly. The solution was heated in an oven at 65° C. for 2 hours and the mixture was shaken by hand every 30 minutes. After the solution was cooled to room temperature, the pH was adjusted to 7 with HCl and the total volume was brought to 345 mL. Upon cooling the solution, a precipitate of 280 mg KCl, along with some FFA salts, slowly settled. To determine the extent of TAG hydrolysis, an aliquot of the supernatant was chromatographed on a TLC plate (Silica 60, Merck) using hexane / diethyl ether / acetic acid (70 / 30 / 1; v / v / v) as the solvent system described above. Efficient hydrolysis of ARA oil was confirmed by the presence of bands corresponding to FFA and much less DAG or MAG on the TLC plate, and the absence of a band for TAG.

[0317] The supernatant with approximately 131 mg / mL FFA was used to supplement the yeast culture. Free fatty acids (FFAs) for use in medium supplementation experiments, such as γ-linolenic acid (GLA, Catalog No. U-63-A), dihomo-γ-linolenic acid (DGLA, Catalog No. U-69-A), arachidonic acid (ARA, Catalog No. U-71-A), docosatetraenoic acid-N6 (DTA, Catalog No. U-83-A), and docosapentaenoic acid-ω6 (DPAω6, Catalog No. U-102-AX), were also obtained from NuChek Prep (USA). Free fatty acids were dissolved in ethanol and added to the culture to a final concentration of 0.5 mg / mL.

[0318] Incorporation of omega-6 fatty acids into phospholipids by supplementation of culture medium To test for the incorporation of different ω6 fatty acids into polar lipids, cells of the yeast species Y. lipolytica strain W29 and S. cerevisiae strain INVSc1 were separately cultured in the presence of GLA, DGLA or ARA in the free fatty acid form or in the absence of added fatty acids. The strains were each inoculated into 20 mL of YPD medium in a 100 mL bottle. The four media also contained 1% Tergitol (NP40) to aid in solubilization of fatty acids. The initial cell density was an OD600 of 0.1 and the cultures were incubated at 28°C with shaking at 200 rpm for aeration. After 2 h of incubation, the fatty acids GLA, DGLA and ARA (NuChek Inc, USA), each 99% pure, were added to a final concentration of 0.5 mg / mL dissolved in ethanol and incubation was continued. W29 and INVSc1 cells were harvested after 2 and 4 days of culture, respectively, due to their different growth rates. The harvested cells were pelleted by centrifugation at 4600g for 15 minutes. The cell pellet was washed twice to remove any remaining FFAs by resuspension in water and centrifugation, and the cell pellet was lyophilized. Lipid extraction and analysis of both the content and fatty acid composition of extracted polar lipids and TAGs were performed as described in Example 1.

[0319] Data on the fatty acid composition of polar lipid and TAG fractions from cells are provided in Table 5 for Y. lipolytica and Table 6 for S. cerevisiae. High levels of incorporation of different ω6 fatty acids were observed in the polar lipid fractions of Y. lipolytica. The percentages of GLA, DGLA, and ARA were 47.1%, 29.4%, and 20.5%, respectively, of the total fatty acid content of the polar lipid fractions extracted from these cells. S. cerevisiae showed even higher levels of GLA, DGLA, or ARA incorporation in the polar lipid fractions after 4 days of incubation, at 60.7%, 59.6%, and 50.8%, respectively (Table 6). The TAG fractions from yeast cells also showed high levels of these ω6 fatty acids. S. cerevisiae cells showed TAGs with incorporation of 78.1%, 80.2%, and 76.8% of GLA, DGLA, and ARA, respectively, indicating high activity of acyltransferases in S. cerevisiae towards these exogenous ω6 fatty acids and efficient incorporation into TAGs. Polar lipid content was higher in Y. lipolytica cells, over 2.0% of DCW, while S. cerevisiae contained approximately 1% polar lipids by dry weight. [Table 4] [Table 5] [Table 6]

[0320] Larger scale production of phospholipids with omega-6 fatty acids (Experiment B005) In a larger scale experiment with a 25 L culture, wild type Y. lipolytica strain W29 was grown in a Braun fermentor with the addition of ARA to the medium in an attempt to generate more cell biomass, increase the polar lipid:TAG ratio, and improve incorporation of ω6 fatty acids into polar lipids. Since the experiment aimed to incorporate ω6 fatty acids into phospholipids and provide a larger PL:TAG ratio, the fermentation was terminated towards the end of active growth rather than stationary phase, as follows: The growth medium was based on rich YPD medium, which favors biomass production over TAG production. The base medium contained 3 g / L yeast extract, 3 g / L malt extract, 5 g / L soy peptone, and 10 g / L dextrose monohydrate as the main carbon source. The pH was initially adjusted to 6.0. This medium was prepared and sterilized in the fermentor by autoclaving in situ, then cooled by direct cooling to the fermentor jacket. After the medium was cooled to 29°C, ARA was aseptically added to the medium by overpressure in the form of 12.5 g ARA (NuChek) as free fatty acids in 300 mL of 17% Triton®-X-100 to give a final concentration in the fermenter of 0.5 g / L ARA and 0.2% Triton®-X-100, and an additional 100 mL of non-hydrolyzed ARA oil was added to give a concentration of 0.4% (v / v) non-hydrolyzed ARA oil in addition to FFA. A seed culture was prepared in 400 mL of YM medium at 29°C with shaking at 180 rpm overnight to give an inoculum with an OD600 of 4.23. When the medium temperature was at 29°C, 400 mL of the seed culture was transferred to the fermenter by overpressure to give an initial cell density (OD600) of 0.07 by calculation.

[0321] Initial fermentation parameters at the time of inoculation were DO 7.92, pH 7.01, air input 10 mL / min, agitation at 5% of full speed, and back pressure 11 psi. DO, citric acid production, and pH changes were followed to track log growth, as the initial OD600 was 3.35 and was almost entirely from the surfactant / oil emulsion. In particular, these parameters were followed approximately 15 hours after inoculation for signs of slowing log growth. Agitation and airflow were low to avoid excessive foaming from the surfactant. Back pressure (11 psi) was applied to ensure good oxygen transfer at low agitation speeds. pH was not controlled. Little antifoam (20% Silfax D3 food product grade) was used during this experiment.

[0322] According to citric acid production, exponential growth began 6-7 hours after inoculation and began to slow 16 hours after inoculation, at which time the broth was cooled and the cells were harvested by centrifugation. Growth could have been slowed by carbon limitation or because a suboptimal pH had been reached. The starting medium contained 10 g / L glucose and 3 g / L maltose, and if all was consumed at maximum yield, the yeast cell density was expected to be approximately 6.5 g / L assuming a 50% yield. The DCW at harvest was 4.2 g / L. This indicated that carbon limitation was likely not achieved, consistent with the objective of harvesting cells in late log phase to avoid carbon limitation and subsequent digestion of ARA-PL. To maximize polar lipid content and ARA uptake, the culture was terminated in late log phase and not heat treated at the end of fermentation. At harvest, the cells had budded as observed by light microscopy, and few stained with methylene blue, thus the oil content, and therefore the TAG content, was not as low as intended. A final yield of 294 g of wet paste was obtained from 21 L of culture with a moisture content of about 72%, i.e., solids of about 28% w / w. The cell paste was frozen and then lyophilized in three batches to obtain 73 g of dried yeast cake. The dried yeast cake was milled to a fine powder and distributed into three portions: a 3 g portion for lipid analysis, a 35 g portion for food application testing, and a 35 g portion for further processing to obtain a crude lipid fraction.

[0323] Lipids were extracted from 35 g of yeast powder by adding 900 mL of 60% hexane / 40% dry ethanol in a 1 L bottle. The bottle was shaken in an orbital shaker at 180 rpm at 29° C. for 4 h. Using this approach, the yeast powder was well suspended in the solvent. After 4 h of extraction, the solvent was filtered into a glass flask using a ceramic Buchner funnel and glass filter (Advantec GA-100, 125 mm diameter). Some yeast debris bypassed the filter, so the solution was refiltered by gravity into a 2 L round-bottom flask. The solvent was evaporated under vacuum to a final volume of approximately 20 mL and transferred to a glass culture tube for transport.

[0324] As shown in Table 9, the fatty acid composition of the polar lipid fraction from the extracted lipids included 16.4% ARA and 25% LA. There were small amounts of other ω6 fatty acids GLA, EDA and DGLA present in the total fatty acid content, and trace amounts of the ω3 fatty acid ALA. The monounsaturated fatty acids present included oleic acid 32.7%, the most prevalent fatty acid in the polar lipid fraction, and palmitoleic acid 7.4%. Saturated fatty acids (SFA) were present in lower amounts in the total fatty acid content of the polar lipid fraction, mainly palmitic acid present at 12.7%, and surprisingly stearic acid at a low level of 0.5%. In contrast, the fatty acid composition of the TAG fraction was different, containing 22.1% ARA. Other ω6 fatty acids were absent or were less present than in the polar lipids, for example LA at 16.7%. Again, oleic acid was the predominant fatty acid in the TAG fraction. In this experiment, where we intended not to produce much TAG due to the culture conditions used, the TAG content was indeed low, with a favorable polar lipid to TAG ratio of about 20 in the total lipid content.

[0325] Further and larger-scale production of phospholipids with omega-6 fatty acids in Yarrowia (B009) In an attempt to increase the biomass yield per liter while maintaining the level of ARA incorporation into PL after supplementation, several experiments were performed similar to B005 at the 25 L scale, except that some modifications were made to the culture medium and conditions. In experiment B009, three different fungal lipases (100 mg each) were added to the culture medium to aid in ARA oil hydrolysis and ARA incorporation, even though Y. lipolytica is known to produce and secrete TAG lipase. In addition, ARA as FFA and ARA non-hydrolyzed oil were first mixed with 200 mL of inoculum and then transferred to the fermenter. Therefore, the non-ionic surfactant Triton® X-100 was added to the YPD broth at the same final concentration (0.2% v / v) as used previously, prior to sterilization, and autoclaved in situ with the broth.

[0326] The dissolved oxygen (DO) probe provided an unexpectedly low reading 20 min after inoculation, therefore, pH, OD, and dry weight were the only parameters used to monitor the growth of the culture in this experiment. The pH of the culture medium was not controlled in this experiment and dropped from pH 6.7 to 3.3 at 16 h due to acid production from cell metabolism. The cell density (dry weight) was 9.4 g / L at 16 h, while the optical density of the washed cell samples increased from 0.1 to 29.3 at 0 and 16 h, respectively. No bacterial growth was observed during the fermentation process, as determined by testing for coliforms and Salmonella, and aerobic plate counts. The culture was cooled 16 h after inoculation, the cells were harvested, and the cell pellet was washed three times with cold deionized water. The cell paste was then heat treated at a temperature greater than 76° C. and less than 82° C. for 3 min with the aim of inactivating the cells, and then cooled by immersing the container in a water bath containing ice. The fermentation was terminated after 16 hours and produced 1390 g of wet cell paste with a dry cell weight of 236 g. The cell paste was freeze-dried.

[0327] Lipids were extracted from biomass samples using 25 mL of 60% hexane:40% ethanol as solvent per gram of lyophilized cells for 3.5 hours at 30° C. The solvent extract was evaporated under vacuum at 50° C. and then cooled to 37° C. with 10 L / min of CO. 2 The cells were dried under gas. The total lipid content of the 16-h freeze-dried sample was 4.6% on a dry weight basis. The extracted lipids were resuspended in chloroform at a concentration of 200 mg / mL and chromatographed on a TLC plate as before. The TLC results showed that a significant amount of polar lipids had been extracted from the cells for 16 h. The ARA levels in the lipids extracted from the biomass, as analyzed by GC, were 7.7% and 2.6% in the TAG and PL, respectively, and 2.4% and 2.5% of the total fatty acid content in the TAG and polar lipid fractions, respectively. In this B009 experiment, biomass production was much higher, but the rate of ARA incorporation was reduced. Thus, there appeared to be an inverse relationship between the amount of biomass produced and the level of ARA incorporation.

[0328] Experiments B012 and B013 All previous experiments at the 25 L scale with Y. lipolytica strain W29 were cultured in YPD broth supplemented with 100 mL ARA oil and 0.2 mL / L Triton® X-100 to solubilize 10 g ARA as FFAs. All fermentations were completed in approximately 16 hours. These experiments were varied with respect to lipase addition, cell density at harvest, and ARA levels in the polar lipids of the harvested biomass. In experiment B012, lipase was bled from the culture, back pressure was set at 15 psi, and airflow was set at 12 to provide approximately 10 ppm dissolved oxygen during cultivation. The inoculum cell density (OD600) was 9.19, so 200 mL was added to the 25 L medium in the fermenter to achieve a calculated starting OD600 of 0.08. ARA oil and FFAs were added as before. The pH decreased from an initial 7.08 at 0 h to 4.63 at 15.68 h, but began to rise in the last 30 min of cultivation. At this point, the culture may have reached stationary phase and glucose was exhausted. After glucose was exhausted, cells may have begun to break down phospholipids for maintenance. Therefore, it was considered important to harvest the culture before reaching stationary phase. The optical density calculated at T0 and corrected by washing the cells with water at 16 h increased from 0.08 to 27.4 at 16 h, resulting in a culture density of 9 g / L on a dry weight basis.

[0329] The cell biomass was harvested from the culture and the pellet was washed twice with cold deionized water. The washed cells were heat inactivated at a temperature of about 95° C. for 3 minutes and then the container was cooled by immersion in a water bath containing ice. Heat inactivation of the yeast cells was successful as indicated by the absence of viable cells when plated. This experiment produced 225 g of dried cell biomass. Total lipids were extracted from the biomass samples and analyzed as before. The freeze-dried cells contained about 4.7% crude lipids. The polar lipid fractions from this experiment had 4.1% ARA as a percentage of the total fatty acid content of these fractions and the TAG fraction had 4.0% ARA (Table 8). The total lipids also had less TAG, MAG, and FFA than the previous experiment as indicated by TLC. This was believed to indicate that the cells were taking up ARA and it was incorporated into the PL in the cell membrane under the defined culture conditions, but that glucose depletion in the medium was degrading the PL to some extent to maintain cell activity.

[0330] Another experiment (B013) was performed with the following adjustments to the culture conditions: the OD600 of the starter culture was 4-5, the ARA FFA and ARA oil were formulated with 5% Triton® X-100 as a concentrated premix and then added to the fermentor prior to inoculation, and the pH trend was used to estimate the optimal harvest point by monitoring above 4.0. The pH trend was closely monitored from 14 hours to confirm culture termination and cell harvest before glucose exhaustion occurred and the pH began to rise. To make the culture medium for this experiment, 50 mL of Triton® X-100 was dissolved in 1 L of deionized water and autoclaved. The Triton® X-100 separated from the water as the sterile solution cooled overnight and needed to be redissolved by warming to approximately 50°C with shaking. After Triton® X-100 was completely dissolved, it was vigorously mixed with 10.0 g ARA and 100 mL ARA oil to form an emulsion, which was then pumped into the fermenter. Finally, 400 mL of inoculum culture was transferred to the fermenter by overpressure. The calculated culture density (OD600) at the time of inoculation was 0.07.

[0331] During the cultivation, the dissolved oxygen level dropped to 0 6 hours after inoculation under the initial settings of 10 L / m airflow, 10 psi pressure, and DO of 15.9. The temperature was gradually lowered from 28°C to 23°C overnight as the culture density was insufficient to generate heat. The temperature reduction was likely beneficial in reducing the culture growth rate as indicated by the gradual decrease in pH drop. At 14 hours, the DO was increased by changing the airflow, agitation speed, and back pressure, and the temperature was also increased. The OD600 was 7.4 at 14 hours, so the fermentation was extended for 2 hours until the OD600 was above 10 and the pH began to stabilize at pH 5. The cultivation was carried out for 16 hours without pH control, and the pH naturally decreased from pH 6.96 to 5.07 due to acid production from cell metabolism. The cell density (dry weight) was 5.27 g / L at 16 hours, while the OD600 increased from 0.07 to 12.1 at 16 hours. The culture assimilated 4.5 g / L of glucose, which was 51% of the 8.9 g / L of glucose supplied in the starting medium.

[0332] The harvested cells were heat inactivated at a temperature of 95°C for 3 minutes as before, yielding a biomass of 584g wet weight, corresponding to a dry weight of 114g. Lipids were extracted from the freeze-dried sample and analyzed as before. The total lipid content of cells freeze-dried for 16 hours was 3.4%. TLC analysis showed that there were more polar lipids present than in experiment B012. ARA levels in the polar lipid and TAG fractions were 10.2% and 13.3%, respectively. Data on fatty acid composition are provided in Table 9.

[0333] It was concluded that experiment B013 provided useful biomass content and reasonable levels of ARA incorporation into polar lipids, even though further optimization of both parameters is desired. The cell biomass produced in B013 and lipids extracted from these cells were used in Maillard reactions simulating food preparations as described in Examples 8-10 below. [Table 7] [Table 8]

[0334] Example 5. Maillard reaction and volatile substance testing using polar lipids containing ω6 FA Polar lipids containing PL with one or more of the ω6 fatty acids GLA, DGLA, or ARA were produced in yeast cells, extracted, and purified as described in Example 4. In initial experiments to determine whether the Maillard reaction could be induced in these lipid extracts and what properties the resulting products would have, polar lipid preparations containing GLA or ARA were mixed with cysteine ​​and ribose in glass vials and heated in an oven at 140° C. for 1 hour. This example describes these experiments and results.

[0335] Experiment 1. Maillard reaction Polar lipid samples were prepared by extraction and fractionation from yeast cells supplemented with GLA or ARA as described in Example 4. Samples of 8.0 mg polar lipids from cells fed with ARA, 7.6 mg polar lipids from cells fed with GLA, 9.0 mg polar lipids from control cells, and 16.0 mg polar lipids extracted from pork were each dissolved in chloroform and transferred to 20 mL glass vials. The solvent was evaporated at room temperature under a stream of nitrogen. 2 mL of 0.1 M potassium phosphate buffer (pH 7.2) containing 4.5 mg / mL ribose (catalog number R9629, Sigma-Aldrich) and 5.0 mg / mL cysteine ​​(catalog number 30089, Sigma-Aldrich) was added to each vial, and the vials were tightly closed with a metal cap with a PTTF liner. The control vial contained buffer but no polar lipids. The vials were subjected to ultrasonic treatment in a 40°C water bath for 1 hour and then heated in a 140°C oven for 1 hour by placing the vials on the bottom metal surface of the oven. After heating, the mixtures all appeared orange-brown, suggesting that a chemical reaction had occurred. Unexpectedly, the vial containing the polar lipids from the ARA-fed cells leaked, and a distinct roasted meat-like aroma was noted that diffused inside and even outside the laboratory. The other vials were then cooled, opened, and smelled. The heated mixtures with the ARA-fed polar lipids and the pork polar lipids gave off a pleasant meat-like aroma, while the mixtures containing the GLA-fed polar lipids had a weak garlic-like aroma. In contrast, the mixtures with polar lipids from Y. lipolytica that had been fed amino acids (control) and the control mixture lacking lipids gave off a sulfurous odor. The inventors concluded that polar lipids containing ARA produced a stronger meaty aroma than polar lipids containing GLA, even when GLA was present in the polar lipids in amounts three times greater than ARA. The inventors also concluded that the presence of ARA in polar lipids produced a meaty aroma that was not produced by the corresponding polar lipids lacking ARA.

[0336] Spurred by these observations, the inventors carried out further testing using extracted lipids containing ω6 fatty acids to determine their ability to provide meat-like flavour and aroma compounds, as well as to measure volatiles by GC-MS as follows. Experiments were also carried out using whole cells with ω6 fatty acids in the polar lipids, rather than extracted lipids from cells, as follows.

[0337] Experiment 2. Prompted by the results of the first experiment, a second experiment was conducted, which included a sensory evaluation by a panel of applicants to detect aroma. Polar lipids were extracted from Y. lipolytica strain W29 cells as before. The fatty acid composition of polar lipids was determined by GC-FID of FAMEs, showing the presence of 16.3% ARA (Table 9). A sample of 15 mg of polar lipids was treated as in experiment 1. An additional control mixture was prepared with a buffer containing ribose but no cysteine ​​to test the effect of omitting sulfur-containing amino acids. Other mixtures were prepared (Example 4) containing either soy lecithin (The Ingredients Centre, Victoria, Australia) or ARA-containing oil (Jinan Boss Chemical Industry Co, China) containing 50% ARA as a percentage of the total fatty acid content. As before, 2.0 mL of 0.1 M potassium phosphate buffer (pH 7.2) containing 4.5 mg / mL ribose and optionally 5.0 mg / mL cysteine ​​was added to each 10 mL SPME vial, and the vials were tightly closed with PTFE-lined screw-top caps. The vials were then subjected to sonication in a 40° C. water bath for 1 hour, and heated at 140° C. for 1 hour as before. After heat treatment, the mixtures with ribose but no cysteine ​​had a dark brown coffee-like color, while the mixtures with both ribose and cysteine ​​were a lighter brown color.

[0338] After the vials had cooled to room temperature, they were subjected to a sensory analysis by nine applicants, five males and four females, aged 30-65 years, from different backgrounds. The identity of the samples was not revealed until after the completion of the sensory evaluation. Each vial was gently shaken, uncapped and aroma-smelled. The vial containing lipids and ribose without cysteine ​​was presented first, followed by the vials containing lipids, ribose and cysteine, in the following order: vials 1, 4, 6, 2, 5, 7, and 3. The applicants' responses were recorded (Table 10). Although there was some diversity in the responses, it was evident that vial 3 was consistently referred to as providing a pleasant, meaty or roasted beef aroma.

[0339] The samples were then analyzed for volatiles by HS-SPME-GCMS as described in Example 1. GC-MS analysis revealed volatile compounds present in the mixture containing ARA-fed polar lipids, but not in the mixture containing polar lipids from non-fed cells. These compounds were 1,3-dimethylbenzene, p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol; 2-decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde, and 2,3,4,5-tetramethylcyclopent-2-en-1-ol. It was concluded that these compounds were associated with the roasted meat-like aroma of the mixture in vial 3.

[0340] In a repeat of the experiment, the concentrations of ribose and cysteine ​​were halved in an attempt to reduce the sulfur aroma. Similar results were obtained as before, with some reduction in the sulfur component of the aroma. Responses from six other applicants confirmed that polar lipids from Y. lipolytica fed with ARA provided a roasted beef-like aroma that was distinct from the aroma from the soy lecithin and ARA oil mixture. Of note, one of the applicants had a pet dog that showed great interest in the aroma. [Table 9] [Table 10]

[0341] Experiment 3. In separate experiments, 15 mg samples of extracted polar lipid preparations, soy lecithin, or ARA oil were mixed separately with 2 mL of potassium phosphate buffer (pH 7.2) containing 2.25 mg / mL ribose and 2.5 mg / mL cysteine ​​in a 12 mL glass tube rather than in a SPME vial. The fatty acid composition of the Y. lipolytica derived preparations and soy lecithin (crude and TLC purified) is provided in Table 10. The lipids tested were: 1. Polar lipids from Y. lipolytica grown in the presence of ARA (YlARA) 2. Polar lipids from Y. lipolytica grown in the absence of ARA (Yl) (control) 3. Soy Lecithin (The Ingredients Centre) 4.ARA oil (Jinan Boss Chemical Industry Co, China) 5. No lipid (control)

[0342] In the first attempt, the mixture was sonicated in a 12 mL Pyrex glass tube with a plastic cap lined with a PTFE seal, then heated at 140°C for 1 hour. The tube was placed on a rack in the oven rather than in contact with the metal surface of the oven. At this time, the mixture was not brownish in color, but rather cloudy but colorless. GC-MS analysis showed only low levels of volatiles, indicating that the Maillard reaction had not gone to completion. We believe that insufficient heating or a reduced surface area of ​​the mixture in the tube could have contributed to the reduced reaction. Therefore, the remaining mixture was transferred to an SPME vial and heated again at 140°C for 2 hours by placing the vial on aluminum foil in the oven. At this time, the color of the mixture changed to light brown, as in the previous experiment. The vial was cooled and stored at -20°C. For GC-MS analysis of volatile compounds, 0.5 mL of each sample was transferred to a new SPME vial for injection in split 1:20 mode, and another 0.2 mL was transferred to a new vial for injection by splitless mode.

[0343] Volatile compounds released by the process The profile of volatile compounds released by heating the extracted lipids with a mixture of ribose and cysteine ​​was evaluated by headspace solid-phase microextraction combined with gas chromatography-mass spectrometry (HS-SPME-GCMS) as described in Example 1. The majority of volatiles are produced by a combination of lipid oxidation and other decomposition processes, as well as Strecker and Maillard reaction products, including the production of aldehydes, alcohols, ketones, pyrazines, and furans. The GC-MS data is shown in Table 12 and Figure 3, which shows the levels of each of the identified compounds as area percentage (%) of the total identified compounds for reaction mixtures containing ARA-polar lipids (YL ARA) or non-fed polar lipids (YL).

[0344] Samples containing polar lipids from Y. lipolytica cells fed with ARA were heated in the presence of cysteine ​​and ribose under conditions that produce the Maillard reaction, producing certain volatile compounds such as 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, 1-octanol, trans-2-octen-1-ol, and 1-nonanol. These compounds were not detected in the Maillard products from polar lipid extracts from control Y. lipolytica cells grown in the absence of ARA (YL). Of these, 3-octanone and 1-nonanol were only detected in the reaction with YL ARA polar lipids, i.e., not in any of the other vials. Other compounds, namely 2-heptanone, 2,3-octanedione, 1-hexanol, and 1-octanol, were only detected in the reactions with YL ARA and soybean lecithin. ω6 fatty acids in reactions with polar lipids containing ARA clearly produced chemical differences related to the sensory differences observed by the applicants, with an increased amount of lipid oxidation products and a decreased amount of heterocyclic compounds such as pyrazines. The presence of certain ketone and alcohol compounds noted here was also observed in the volatile profile of meat flavor as a result of lipid oxidation. 2-heptanone, a ketone present in samples containing YL ARA and soybean lecithin, was attributed to lipid oxidation and was thought to be related to ethereal, buttery, or spicy flavors. The volatile compound 1,3-bis(1,1-dimethylethyl)-benzene was the main compound produced (Figure 3) and was significantly increased in amount in reaction mixtures made with ARA polar lipids compared to the control ARA-polar lipids from Y. lipolytica cells. This compound has a characteristic beef-like aroma.

[0345] Results from the experiment showed that the compound acetylthiazole, common to all samples tested and shown in Table 11, has a sulfurous and roasted meat aroma resulting from reaction with cysteine ​​and ribose. The aldehydes hexanal and nonanal were produced from all mixtures except the "no fat" control sample and were produced from lipid oxidation. Hexanal is associated with the oxidation of omega-6 fatty acids such as LA and ARA. Nonanal contributes to tallow and fruity flavors and is one of the important volatiles in cooked beef along with octanal. Octanal was produced from samples containing YL ARA, YL, and soy lecithin, i.e., all three polar lipid samples, but not from ARA oil and the lipid-free sample. The unsaturated alcohol 1-octen-3-ol was also produced in all oil-containing samples tested (YL ARA, YL, soy lecithin, and ARA oil) and may contribute to the herbal aroma resulting from the thermal decomposition of methyl linoleate hydroperoxide. The compound 2-pentylfuran, present in all but the lipid-free mixture, was derived from LA. Furan-containing compounds were also occasionally produced from the pyrolysis of sugars. [Table 11-1] [Table 11-2]

[0346] Experiment 4. Optimization of the amount of lipid in the reaction To test whether smaller amounts of polar lipids can be heat treated and the reaction products are still detected by GC-MS, experiments were performed varying the amount of lipid used in the Maillard reaction. The purpose of the experiment was to define the optimal amount that would produce a chromatogram that simultaneously detects the majority of compounds and produces the maximum overall intensity. Samples containing 0.5, 2.5, 5.0, or 7.5 mg of 18:0 / 18:1-phosphatidylcholine (Cat. No. 850467C, Avanti Polar Lipids) in chloroform were transferred to 20 mL SPME vials. Aliquots of 2.5 or 7.5 mg of soybean lecithin powder or 2.5 or 7.5 mg of polar lipids extracted from soybean lecithin powder by TLC were also transferred to SPME vials. The fatty acid composition of unpurified and TLC-purified soybean lecithin is shown in Table 10. Purification had little effect on fatty acid composition. After evaporating the chloroform under a stream of nitrogen, 1 mL of 0.2 M potassium phosphate buffer (pH 7.2) containing 2.25 mg / mL ribose and 2.5 mg / mL cysteine ​​was added to the vial and the lid was tightly closed. The vials were subjected to ultrasonic treatment in a water bath at 40 °C for 1 h to emulsify the mixture, and then incubated at 140 °C for 1 h by placing the vials on aluminum foil in an oven. After cooling the vials, the volatile compounds in the headspace of each vial were analyzed by solid phase microextraction coupled with gas chromatography-mass spectrometry (HS-SPME-GCMS) as before. The reaction mixture containing 0.5 mg of lipid showed peaks for volatile compounds, but at lower intensity than desired, and some compounds were not detected. Intermediate lipid amounts (2.5 and 5.0 mg) showed improved response for most of the compounds, while the highest amount of polar lipid tested (7.5 mg) showed an overall decrease in intensity, probably due to overloading. Therefore, a mixture with 2.5 mg of polar lipid in 1 mL reaction volume showed optimal performance without suffering from any drawbacks. That amount of polar lipid was considered optimal for further experiments. A mixture with 5.0 mg of polar lipid in 1 mL reaction volume was also considered suitable for analysis.

[0347] Comparison of reaction products in mixtures with either purified or unpurified soybean lecithin by TLC revealed the presence of some hydrocarbon compounds in the reaction mixture with purified soybean lecithin, which were not present in the corresponding reaction mixtures made with unpurified soybean lecithin, and therefore were considered to be artifacts of the preparation method.In the GC-MS chromatogram, these hydrocarbons included both short-chain alkanes and long-chain alkanes.We concluded that these hydrocarbon compounds could also be obtained by other polar lipid preparations purified by TLC, and therefore these compounds were excluded from the quantification of the GC-MS trace of Y. lipolytica polar lipids resulting from the sample preparation method. The hydrocarbons that were not considered in the analysis for this reason were: hexane, 2,4-dimethyl-; dodecane, 4,6-dimethyl-; hexadecane; heptadecane; undecane, 3,8-dimethyl-; triacontane; hentriacontane; tetradecane, 5-methyl-; decane, 3,3,6-trimethyl-; and hexadecane, 2,6,10,14-tetramethyl-.

[0348] Experiment 5. Maillard reaction of ARA-PC and 18:1-PC Another experiment was performed to identify volatile compounds specifically resulting from ARA-PC by comparing the reaction products from the Maillard reaction to mixtures containing pure ARA-PC or 18:0 / 18:1-PC as a comparison. Samples containing 2.5 or 5.0 mg of 18:0 / 18:1-PC (catalog number 850467C, Avanti Polar Lipids) or ARA-PC (Avanti Polar Lipids) were processed in 1 mL volumes as in the previous experiment. HS-SPME-GCMS analysis of the volatiles generated after the heating step showed the presence of a number of compounds that were either increased or decreased in the mixtures with ARA-PC compared to the mixtures with 18:0 / 18:1-PC, or that were present in one mixture and either absent or not detected in the other mixture.

[0349] The results are shown in FIG. 4. The results of this experiment demonstrated that alcohols, aldehydes, furans, and thiophenes were important volatile compounds found in the reaction mixture with ARA-PC lipids. The mixture derived from ARA-PC showed compounds consistent with those observed in the previous experiment, such as 1-pentanal, 3-octanone, 2-octen-1-ol, 1-nonanol, and 1-octanol. The presence of other compounds, namely, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, and 1,3,5-triazine, was also observed. The compound 2-pentylthiophene has a characteristic aroma described as chicken, roasted hazelnut, or meaty. In contrast, the compound 2-pentylfuran has an aroma described as fruity, earthy, or has a vegetal aroma.

[0350] Experiment 6. Larger scale cultures of Y. lipolytica strain W29 were grown in the presence of ARA, harvested, and polar lipids were isolated from the wet cell pellet using hexane / ethanol extraction, as described in Example 4. The yield of extracted lipids from the ethanol phase was 6.4 g, of which 1.974 g (30.7%) was lipid. Of the lipids, 95% were polar lipids and 5% were free fatty acids (FFAs). The extracted lipids appeared to be completely devoid of TAGs. The level of ARA in the total fatty acid content of the polar lipid fraction was only 3.2% (Table 9), which was less than optimal. Nevertheless, we tested this polar lipid in a Maillard reaction under similar conditions as in experiment 5, except that we used 15, 30, or 60 mg of polar lipid per 2 mL volume reaction to increase the amount of ARA polar lipid. Control polar lipid extracts were prepared from Y. lipolytica cells that were not fed ω6 fatty acids in the medium. Control reactions were set up with an aliquot of the polar lipid extract but lacking ribose and cysteine.

[0351] The aromas from the reactions were smelled by three volunteers. Mixtures with ARA-PL produced weak aromas described as "pork-like, pork crackling, meaty, fatty" or "grilled roasted chicken, weaker aroma" or "roasted fish-like," while control mixtures with polar lipids from Y. lipolytica that were not supplied with ARA were described as sulfurous or "burnt" in their aroma. Mixtures lacking ribose and cysteine ​​were described as "burnt vegetables."

[0352] The inventors concluded that polar lipid extracts with a lower ARA level of 3.2% can impart a meaty aroma, but that levels of ARA of 10% or more in the total fatty acid content of the polar lipids are better at imparting a stronger aroma.

[0353] Experiment 7. Aroma production using whole cells containing ω6-polar lipids Y. lipolytica strain W29 cells producing polar lipids containing PL as described in Example 4 were grown in 25 L cultures either in the presence of ARA (Yl-ARA) or in the absence of ARA (Yl) in the growth medium. The fatty acid composition of polar lipids in Y. lipolytica cells is shown in Table 10 for experiments 2 and 3. Notably, ARA was present at 16.4% of the total fatty acid content of the polar lipids, GLA at 1.4%, and DGLA at 1.9%. The harvested cells were then freeze-dried and the dried material milled into a powder. The cells were not heat-treated or otherwise treated to kill or inactivate the cells. We wished to test the ability of dried yeast cells to provide aroma compounds after heating the cells in the presence of sugars (e.g., D-xylose) and amino acids (e.g., L-cysteine). A series of reactions were prepared to test the effect of different amounts of sugars, amino acids, and different amounts of freeze-dried cells (Table 13). Briefly, L-cysteine ​​powder (catalog no. 30089, Sigma-Aldrich), D-xylose powder (catalog no. X1500, Sigma-Aldrich), sodium citrate dihydrate (catalog no. W302600, Sigma-Aldrich), and wheat flour were weighed in the indicated amounts into 10 mL GC headspace analysis vials (catalog no. 23084, Restek, USA), followed by the addition of freeze-dried yeast cells from cultures with or without ARA. Water (2 mL or 3 mL) was added to each vial, tightly capped, and mixed by brief vortexing. The pH of the mixture in vial no. 1 was 6.0 based on buffering with sodium citrate. The vials were then incubated in a preheated oven at 120° C. for 60 or 45 minutes, followed by cooling on ice. The vials were allowed to warm to room temperature before opening and the contents were smelled. The aroma from each vial was recorded (Table 12). It was noted that the cap on vial 13 had been loosened, so the reaction was repeated as with vial 19. It was presumed that the loosened cap on vial 13 had allowed some of the volatile compounds to escape during heating.Duplicate samples of vials 18-20 were prepared without water and held at ambient temperature for 5 or 7 days, after which water was added and then heated at 120° C. for 60 minutes. These vials provided the same aroma results as vials 18-20, which had been prepared, heated immediately, and then frozen for a week, demonstrating that the mixtures could be stored stably at room temperature for at least a week.

[0354] Some observations were noteworthy. Reaction vials 2-4 compared to 5-7 were designed to test the effect of whole yeast cells containing ARA in the lipids compared to yeast cells not containing ARA in the lipids. The difference was clearly noticeable with respect to the production of roasted meat aroma from cells with ARA compared to vials 2-4 where the aroma was not discernible. When the amount of cysteine ​​was lowered to 0.05 g per vial (e.g., vial 17), it was also difficult to detect the desired roasted meat aroma. In contrast, when cysteine ​​was at the highest level (e.g., vial 20), the roasted meat aroma was more discernible but was somewhat overpowered or masked by the sulfur aroma. A similar effect was noted with the amount of xylose, i.e., this was related to the cysteine ​​concentration, as lower xylose concentrations resulted in less pronounced undesirable aromas even in the presence of relatively high cysteine ​​concentrations (e.g., vial 13). It was concluded that amino acid and sugar levels can be empirically balanced to provide optimal aroma, i.e., to achieve adequate production of aroma volatiles from ω6-PUFAs without them being masked by stronger smelling undesirable compounds.

[0355] Heating time was also a factor to consider. Vials 14-16 and 17-19 were designed to compare this variable with 45 or 60 minutes of heating. Shorter heating times resulted in significantly lighter colored mixtures, while longer cooking times produced significant browning. This darkening effect also appeared to correlate with cysteine ​​levels; more cysteine ​​generally produced a darker reaction, as long as the appropriate sugars were present.

[0356] Similarly, the concentration of whole cells was important for desirable aroma development, as demonstrated by vials 8-10. The lower amount of whole cells used in vial 8 produced a faint meaty aroma, whereas increasing the amount (vials 9 and 10) produced a more easily discernible roasted meat aroma. Thus, it was important to use a sufficient amount of whole cells to provide sufficient ω6-PUFA to be incorporated into the polar lipids for the desirable aroma. Again, this characteristic can be empirically determined.

[0357] This experiment also tested whether yeast cells would change their aroma profile in the presence of more complex food-like substances. Most of the reactions tested had simple chemical mixtures, but vials 8-10 also contained whole wheat flour added to mimic the effects of the presence of plant proteins, carbohydrates, nucleic acids, and other components. The aromas from these vials were noticeably different from the corresponding vials without added flour. The aroma of unpleasant sulfur compounds was mitigated, but the aroma of roasted meat was still present, resulting in a more pleasant aroma. We concluded that the use of whole cells that produce ω6 fatty acids in PL is likely to result in desirable aromas when the cells are incorporated into a food containing plant proteins.

[0358] The main conclusion from this experiment was that the addition of ω6 PUFA-containing phospholipids in whole yeast cells worked similarly in producing meaty aroma as the addition of extracted lipids containing phospholipids with ω6 PUFAs, i.e., this experiment demonstrated that it is not necessary to extract ω6-containing phospholipids from the producing cells to be effective in the Maillard or Amadori reactions to produce desirable aroma volatiles. [Table 12]

[0359] Example 6. Isolation of Mortierella and Mucor strains from soil samples Mortierella alpina is a filamentous and saprophytic fungus of the family Zygomycetes that is commonly found inhabiting soils from temperate grasslands. Several strains of this species are used commercially to produce oils containing polyunsaturated fatty acids (PUFAs), specifically the ω6 fatty acids arachidonic acid (C20:4; ARA), linoleic acid (C18:2; LA), and γ-linolenic acid (C18:3; GLA). Another fungal species, Mucor hiemalis, is a zygosporic fungus of the order Mucorales that is ubiquitous in nature and can be found, for example, in unspoiled food. It is also used industrially as a biotransformation agent for pharmacological and chemical compounds, as well as a potential source of ω6 fatty acids. Therefore, we attempted to isolate strains of Mortierella alpina, Mucor hiemalis, and related species from soil samples obtained from several temperate regions of Australia.

[0360] The Biomes of Australian Soil Environments (BASE) project database contains integrated microbial diversity and functional information for microbial isolates from over 1400 soil samples collected from 902 locations across Australia. The database contains relevant metadata for all of the soil samples across a wide environmental gradient, including information from phylogenetic marker sequencing of bacterial 16S rRNA, archaeal 16S rRNA, and eukaryotic 18S rRNA genes to characterize microbial diversity in the communities. Fungal diversity was informed by 18S rRNA gene amplicon sequences. However, because fungi are an important group of soil organisms and the internal transcribed spacer (ITS) region is more informative than 18S rRNA for many fungal groups, we also included ITS sequences by sequencing fungal-specific ITS amplicons to characterize fungal communities. These amplicons span a diverse range of microorganisms that inhabit soil.

[0361] Therefore, the BASE database was examined to identify soil samples from the BASE archive that may house fungal species of the genus Mortierella or Mucor. To examine, M. alpina strain ATCC32222 internal transcribed spacer 1 (ITS; SEQ ID NO:1) was used as a query. More than 12 soil samples were identified as candidates containing these strains from these genera. One such soil sample, designated 102.100.100 / 14183, was identified and retrieved from the archive for the isolation of fungal strains. Furthermore, two other soil samples, designated Namadgi sample I and Namadgi sample II, were collected from vacant grassland from the temperate Namadgi region of the Australian Capital Territory, Australia. Approximately 5–10 mg of fine soil from each sample was suspended in 3 mL of PBS and vortexed for 2 min. For each soil sample, 100 μL of the soil suspension was spread onto each of ten plates of malt extract agar (MEA) containing 20 g / L malt extract and 20 g / L agar and incubated at 4°C in the dark (Botha et al. 1998). The plates were periodically observed for fungal colony growth. After 8–12 days, mycelium from the edges of different colonies was transferred through an agar slice to a fresh MEA plate and incubated at 4°C until the colonies were 1–4 cm in diameter. To further purify the colonies, mycelium from the edge of each colony was transferred through an agar slice to a fresh MEA plate and incubated at ambient temperature for 4 days. Colonies that appeared pure by visual inspection were inoculated into 5 mL of malt extract broth and grown in static culture at ambient temperature for 5 days. A total of 67 fungal strains were thereby isolated from the three soil samples.

[0362] Genomic DNA was isolated from each mycelial biomass using the YeaStar Genomic DNA Kit (Zymo research, Cat. No. D2002). The internal transcribed spacer (ITS) was amplified by PCR as described by Ho and Chen (2008) using oligonucleotide primers xMaF1 GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO:2) and xMaF2 TCCCCGCTTATTGATATGC (SEQ ID NO:3). The nucleotide sequence of the ITS from the amplicons from each isolate was determined by Sanger sequencing. The resulting sequences were compared to sequences in the NCBI repository using BLAST. The closest hit with at least 95% nucleotide sequence identity for each isolate, often 98% or 99% identity, was used to identify the species for each fungal isolate. Classification of species such as Mortierella using ITS homology is standard in the art.

[0363] At least four different fungal species were identified based on ITS homology, which correlated with four distinct morphological features observed when fungal colonies were grown on MEA plates. Interestingly, three of these species were isolated primarily from one of the three soil samples but not the others. Mucor hiemalis was found primarily in the Namaji I soil, Mortierella alpina was found in the soil from sample 102.100.100 / 14183, and a putative Mortierella species isolate was found in the Namaji II soil. Single colonies of Mortierella elongata were isolated from each of the Namaji I and II soil samples. No ITS sequences from putative Mortierella species isolates identified from the Namaji II soil sample were found in the NCBI database at a minimum of 95% identity level. Nevertheless, based on the lower homology hits of the ITS sequences, these isolates were most likely to be Mortierella species or species closely related to the Mortierella genus. The nucleotide sequences of the ITS regions and the deduced species names of the 43 fungal isolates are listed in Table 14. Selected isolates were designated as strains yNI0121-yNI0131 and yNI0133-yNI0135 (Table 13).

[0364] The ITS regions amplified with primers xMaF1 and xMaF2 generated amplicons with lengths between 639 and 647 base pairs for the Mucor hiemalis strains, between 668 and 672 base pairs for the M. alpina strains, between 628 and 652 base pairs for the M. sp. isolates, and between 640 and 659 for the two M. elongata strains. The lengths of the ITS amplicons were therefore useful in helping to distinguish between the four species. [Table 13]

[0365] Fatty acid composition and oil content of fungal isolates For the analysis of lipids in these fungal isolates, agar slices from the edge of the colony were placed on fresh SD agar plates and grown at ambient temperature for 4-6 days until the colony was over 3 cm in diameter. SD medium was used in this experiment because it does not have yeast extract, which may have some lipids that may contaminate the fungal biomass. The mycelial biomass was harvested from the plate and suspended in sterile water for pelleting. After washing the mycelial biomass with ethanol, lipids were extracted using chloroform / methanol solvent (Bligh and Dyer, 1959) and fractionated on TLC plates to obtain TAG and polar lipid fractions. The fatty acid composition of the TAG and polar lipid fractions was determined by GC analysis of FAMEs as described in Example 1.

[0366] Data for strains yNI0121-yNI0131 and yNI0133-yNI0135 are shown in Table 14. Fatty acid composition showed clear differences among the four species, but also some similarities. All four species produced polyunsaturated ω6 fatty acids with 18 or 20 carbons and 3 or 4 unsaturations in the acyl chain, i.e., only GLA in the case of Mucor hiemalis, or all three of the ω6 fatty acids GLA, DGLA, and ARA for all Mortierella isolates. Nearly all isolates produced at least 20% and up to about 38% of such PUFAs (the sum of GLA, DGLA, and ARA) in the polar lipid fractions as a percentage by weight of the total fatty acid content in these fractions. Mucor hiemalis strains yNI0121-yNI0124 all produced approximately 10% GLA in the total fatty acid content of TAG and 26%-30% GLA in polar lipids. It was concluded that these Mucor strains preferentially accumulated ω6 PUFAs in their polar lipids. These strains did not produce detectable or even trace amounts of ARA or DGLA levels in the polar lipid fraction, indicating that they do not have the ability to elongate GLA to DGLA, i.e., they lack fatty acid Δ6 elongase. This is consistent with published reports on Mucor strains (Certik et al., 1993). LA (C18:2ω6) was the most abundant fatty acid in the TAG fraction of Mucor strains, but not in any of the three Mortierella species. These strains produced 12-18% TAG and relatively high amounts, up to about 7%, of polar lipids by dry weight under the growth conditions on SD agar plates used to culture the strains for this analysis. Considering that the extraction and recovery of lipid fractions from the process including TLC fractionation was less than 100%, the total lipid content of these Mucor hiemalis strains was greater than 20%, and therefore these strains are oleaginous.

[0367] In contrast to the Mucor hiemalis strains, the M. alpina strains yNI0133-yNI0135 produced abundant ARA as well as GLA and DGLA. The ARA levels in both TAG and polar lipids were about 30% by weight of the total fatty acid content in these fractions. Thus, these M. alpina strains did not show any preference for accumulating ω6 PUFAs in polar lipids compared to TAG. The GLA and DGLA levels were about 2% and about 6%, respectively, in TAG, and about 4-7% and about 2-4%, respectively, in polar lipids. Compared to the ARA levels, this indicated that the M. alpina strains possess efficient Δ6 elongase and Δ5 desaturase enzymes. Genes encoding such enzymes have been isolated from other strains of M. alpina (Huang et al., 1999; Knutzon et al., 1998). The Mortierella alpina strain also produced approximately 4–5% C24:0 in the TAG fraction.

[0368] Again, in contrast to Mucor, the putative Mortierella species strains yNI0126–yNI0130 produced ARA and DGLA in addition to GLA and accumulated these ω6 PUFAs in both TAGs and polar lipids. However, in contrast to the M. alpina strains, the Mortierella species strains accumulated 2–4 times more ARA in their polar lipids than in their TAGs. It was concluded that these Mortierella species strains, like the Mucor strains, preferentially accumulate their ω6 PUFAs in polar lipids compared to TAGs. The two Mortierella elongata strains yNI0125 and yNI0131 were similar to the Mortierella species strains in many characteristics, such as producing ARA and DGLA in addition to GLA and accumulating these ω6 PUFAs in both TAGs and polar lipids. They also show a preference to accumulate more ARA in their polar lipids than in their TAGs. M. elongata strains could be distinguished from M. spp. in the levels of some of the other fatty acids or in the ratios between pairs of related fatty acids, reflecting the conversion rate of one fatty acid to another, e.g., GLA to DGLA. Nevertheless, further phylogenetic analyses need to be performed to determine the relationships of M. spp. strains to M. elongata strains.

[0369] All strains tested had significant amounts of monounsaturated and saturated fatty acids in both the TAG and polar lipid fractions. Oleic acid was the most abundant fatty acid in both the TAG and polar lipid fractions of Mucor hiemalis, Mortierella species, and Mortierella elongata strains, but not in Mortierella alpina strains, where ARA was the most abundant fatty acid. Palmitic acid was the most abundant SFA in both the TAG and polar lipid fractions in all strains tested. With one or two exceptions, the amount of stearic acid was relatively low, about 3-10% in the TAG and about 2-6% in the polar lipids. Other SFAs present in all strains were myristic acid (C14:0), pentadecanoic acid (C15:0), arachidic acid (C20:0), behenic acid (C22:0), and lignoceric acid (C24:0). The monounsaturated fatty acids C16:1Δ7, C17:1, C18:1Δ11 (vaccenic acid), and C22:1 were present at low but detectable levels in all strains.

[0370] Next, we cultivated selected strains yNI0121 (Mucor hiemalis), yNI0125 (Mortierella elongata), yNI0127 (Mortierella sp.), and yNI0132 (Mortierella alpina) to generate larger quantities of fungal biomass to evaluate mycelium disruption methods and to generate sufficient amounts of extracted lipids for food uptake experiments. yNI0132 was also isolated from the 102.100.100 / 14183 soil sample and identified as M. alpina based on ITS homology (yNI0132 ITS is shown in SEQ ID NO: 47), and showed similar fatty acid profiles in polar lipid and TAG fractions as yNI0133, yNI0134, and yNI0135. Fungal biomass from yNI0121, yNI0125, yNI0127, and yNI0132 were also tested to determine whether whole cell biomass, either in wet form or dried as a powder, could be used in Maillard-type reactions to produce meaty aromas from these fungi containing PL with ω6 fatty acids. This also allows for comparison of strains with approximately equal levels of ω6 fatty acids in the TAG and polar lipid fractions, and strains with more ω6 fatty acids in the polar lipids compared to TAG.

[0371] To prepare seed cultures for larger cultures, fungal strains yNI0121, yNI0125, yNI0127, and yNI0132 were freshly propagated by agar slice growth, and 0.5 × 0.5 cm agar pieces with fungal mycelium were taken from the edge of the colonies and placed in the center of new MEA plates. The plates were kept at ambient temperature for 3–5 days until the new colonies were at least 3 cm in diameter. Intermediate cultures were then prepared for each strain by inoculating six 0.5 × 0.5 cm agar pieces containing mycelium into 10 mL malt extract medium, incubating these at 26 °C with shaking for 3 days, and then leaving them stationary for 2 days. The complete cultures were then used to inoculate 50 mL malt extract medium in a 250 mL baffled flask and incubating at 26 °C with shaking for 3 days. These cultures were then used to inoculate 10 mL of malt extract medium in a 250 mL baffled flask with 60 g glucose, 10 g yeast extract, 5 g malt extract, KH2 PO 4 4g, (NH 4 ) 2 HPO 4 3g, and MgSO 4 0.6 g was inoculated into 600 mL of medium adjusted to pH 6.0 with 2 M NaOH. These larger cultures were incubated with shaking at 26° C., the cultures were sampled after 2 days, and the biomass was harvested by centrifugation after 3 days, lyophilized, and then frozen. [Table 14-1] [Table 14-2]

[0372] The wet weights and corresponding dry weights for the three M. spp. and the three M. spp. and Mucor hiemalis strains in the first culture are shown in Table 15. [Table 15]

[0373] Improving biomass production in fungal strains Two culture media were compared in an attempt to improve the biomass weight achieved in the cultures. To test the first medium, three Mortierella isolates yNI0125, yNI0127, and yNI0132 and Mucor hiemalis strain yNI00121 were cultured in a mixture of (per liter) 20 g glucose, 6 g yeast extract, 5 g malt extract, KH 2 PO 4 3g, (NH 4 ) 2 HPO 4 3g, and MgSO 4 7H 2The strain was grown in a seed culture containing 3 g KOH. The seed culture was used to inoculate a 600 mL culture in medium 1 (per liter): 20 g glucose, 5 g yeast extract, 10 g peptone, and incubated at 26° C. with shaking at 200 rpm for aeration. A parallel culture of 800 mL was also grown in medium 1 containing 30 g glycerol, 0.85 g yeast extract, 10 g KH. 2 PO 4 8.7g, (NH 4 ) 2 HPO 4 They were grown simultaneously in a second medium, Medium 2, pH 6.2, containing 1-9 g and incubated at 26° C. with shaking at 200 rpm for aeration. Growth was significantly faster in Medium 1, reaching approximately 14 g / L dry weight in 70 h.

[0374] The dried whole cell biomass from these strains was used in the Maillard reaction (Example 7).

[0375] Extraction of total lipids from fungal biomass Total lipids were extracted from the recovered wet fungal biomass (Table 15, experiment 2) using hexane as a solvent as follows: Most of the water was removed by washing the cell biomass with ethanol using 2 mL of ethanol per gram of cell biomass (wet weight) followed by centrifugation each time to recover the cell biomass. The pelleted cells were resuspended in hexane using 5 mL of hexane per gram of cell biomass. The suspension was homogenized and the cells were disrupted with an UltraTurrax (IKA, Malaysia) for 3 minutes followed by sonication for 5 minutes, this pair of treatments was repeated twice for a total of three times. The mixture was shaken at room temperature for 3 hours, although later experiments showed that more lipids were extracted when the mixture was shaken overnight. Microscopic observation of samples from the mixture showed that many, but not all, of the cells were destroyed by the treatment. The mixture was centrifuged and the hexane phase was collected. The hexane was evaporated from each extract using a nitrogen stream and the dried lipid extract was weighed. This yielded 0.99 g from yNI0121 (Mucor hiemalis), 1.33 g from yNI0125 (Mortierella elongata), 0.69 g from yNI0127 (Mortierella spp.), and 0.78 g from yNI0132 (Mortierella alpina). Samples of these lipids were chromatographed on TLC plates, and polar lipids were extracted from silica and analyzed for fatty acid composition by GC of FAMEs as described in Example 1.

[0376] Extraction of partially purified polar lipids from fungal biomass Based on the greater solubility of polar lipids in ethanol compared to neutral lipids, an alternative extraction method was tested as a means to preferentially extract polar lipids by extraction into ethanol. Dried biomass (45.63 g) harvested after fermentation of Mortierella alpina and 60 mL of ethanol were blended and at least partially disrupted using an UltraTurrax homogenizer. The sample was then mixed with stirring for 30 min and centrifuged. The ethanol supernatant was removed. This extraction of M. alpina biomass with ethanol was repeated twice and the supernatants combined. If desired, the precipitate can be retained for extraction of neutral lipids. Ethanol was evaporated from the combined supernatant in a rotary evaporator programmed with a vacuum pump at 15 mbar, a chiller at -16 °C, a water bath at 37 °C and 400 rpm. From an initial input of 45.63 g of M. alpina dried biomass, 5.7 g of precipitate rich in phospholipids was recovered. The precipitate at this stage also contained some TAG. The phospholipid-rich precipitate was dissolved in 30 mL of hexane and cooled at 0° C. in an ice bath. Then, 120 mL of cold acetone (−20° C.) was added to the stirred mixture to precipitate the phospholipids. The precipitate was washed five times with 30 mL portions of cold acetone (−20° C.). Residual solvent in the extracted and purified phospholipid preparation was removed in a rotary evaporator at room temperature for 10 h. Polar lipid yield was determined gravimetrically and a small aliquot was used for FAME analysis. Another aliquot was chromatographed on TLC to confirm purity. From an initial input of 45.63 g of M. alpina dried biomass, 1.1 g of relatively pure phospholipids was recovered.

[0377] Example 7. Larger scale production of fungal biomass We then generated whole cell biomass and lipid extracts from biomass containing PLs containing omega-6 fatty acids such as ARA from the fungal isolates described in Example 6. The fungal isolates were cultivated at a 35 L scale, fungal mass was harvested from the cultures, and lipids were extracted. In some experiments, lipids were fractionated to isolate polar lipids including PLs, as well as both whole cell and extracted lipids for use in the Maillard reaction and food preparation.

[0378] Larger scale production of fungal biomass and extraction of lipids containing omega-6 fatty acids (B017) In a larger scale experiment generating a 35 L culture, M. alpina strain yNI0132 was grown in a Braun fermenter in a rich medium containing glucose as the main carbon source in the hope of producing more cell biomass and favorable polar lipids. Even though M. alpina is an oleaginous species naturally capable of producing abundant TAGs, with ω6 fatty acids incorporated into the polar lipids, the growth medium was based on a rich yeast extract-malt extract medium that favors biomass production over TAG production. The seed culture for inoculation and the medium used for inoculation of the first phase of the culture were (per liter) 60 g glucose, 10 g yeast extract, 5 g malt extract, (NH 4 ) 2 SO 4 3g, KH 2 PO 4 1g MgSO 4 7H 2 O0.6g, CaCl 2 0.06g, and ZnSO 4 The second stage of the culture contained (per liter) 5 g malt extract, 0.001 g (NH 4 ) 2 SO 4 7.5g, KH 2 PO 4 1g MgSO 4 7H 2 O6.0g, CaCl 2 0.3g ZnSO 4 A 5 L feed solution containing 0.005 g glucose monohydrate but no yeast extract was used. These media used ammonium sulfate rather than urea as the nitrogen source. Phase 1 culture media was prepared and sterilized in the fermentor by autoclaving in situ at 121°C for 15 min and then cooled by direct cooling to the fermentor jacket. A glucose stock solution (438 g glucose monohydrate + 563 mL water) was autoclaved separately as a 40% solution and added to the fermentor while still warm at 45°C.

[0379] Inoculum cultures were prepared in 4 x 200 mL YM broth in 500 mL flasks using starter cultures from agar plates. The inoculum cultures were incubated at 30 °C with shaking at 180 rpm for 71.5 h, at which point the inoculum cultures showed vigorous growth. The inoculum cultures were introduced into the fermenter without homogenizing the culture. During the first phase of cultivation with the aim of maximizing biomass production, a high aeration rate was maintained at approximately 0.6-1.0 vvm (18-30 L / min) without subjecting the culture to excessive shear forces, and mixing was kept low at 50-150 rpm to maintain dissolved oxygen above 1 ppm. After 76 h of cultivation, nutrient feed solution was added to the fermenter. The pH was constantly controlled at 6.0 by addition of NaOH, and the temperature was maintained at 30 °C. The cultures were sampled (50 mL) every 24 h after inoculation. Parameters measured daily were cell density (dry cell weight), glucose level by HPLC, total nitrogen level by Kjeldahl method, phosphate and sulfate levels by colorimetric strips, and fungal appearance by light microscopy. Dry weight (dry cell weight) was measured by weighing the material recovered on glass microfiber, obtained by filtering 20 mL of culture using a Büchner funnel and vacuum pump, followed by drying in an oven and then weighing. Cultures were harvested 94 hours later when the cell density reached 19.5 g / L (wet weight / w). Biomass was harvested by filtering through nylon gauze (200 microns). Biomass was resuspended and washed twice, each time with 2 volumes of cold water relative to the volume of biomass. Mycelial biomass was grey-white in color. Excess water was removed by passing the wet mycelial cake through a filter cloth and squeezing by hand. This yielded 2.27 kg of washed biomass with a dry weight of approximately 590 g. The biomass cake was spread into a 1–2 cm layer in a Ziploc bag and frozen. [Table 16]

[0380] Most of the fungal growth occurred between 20 and 50 hours, as indicated by DW and pH. The culture reached stationary phase at approximately 50 hours, likely due to nitrogen depletion, and no further pH adjustments were made after that time point. Kjeldahl nitrogen was exhausted at 70.3 hours. Further addition of nitrogen through the feed s...

Claims

1. 1. A composition capable of producing a food-like aroma and / or flavor, optionally a meaty aroma and / or flavor, when heated, comprising: a) a Mortierella spp. biomass comprising phospholipids, optionally at least about 0.005% dry Mortierella spp. biomass, based on the volume or weight of the composition excluding the Mortierella spp. biomass; b) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and c) one or more amino acids or derivatives or salts thereof, or thiamine Including, The composition is in the form of a food product, a beverage product, or a feed, and the composition comprises less than 2.5% by weight of dry Mortierella species biomass or an equivalent amount of wet biomass.

2. 2. The composition of claim 1, wherein the phospholipids comprise one or more esterified ω6 fatty acids, optionally comprising arachidonic acid (ARA), optionally wherein the ARA is present as at least about 10%, at least about 15%, or at least about 20% of the total fatty acid content of the polar lipids of the biomass, and optionally comprising dihomo-γ-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-ω6 (DPA-ω6), or γ-linolenic acid (GLA).

3. The one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and the one or more amino acids or derivatives or salts thereof are converted to 1,3-dimethylbenzene; p-xylene; ethylbenzene; 2-heptanone; 2-pentylfuran; octanal; 1,2-octadecanediol; 2,4-diethyl-1-heptanol; 2-nonanone; nonanal; 1-octen-3-ol when the composition is heated. 2-Decanone; 2-octen-1-ol, (E)-; 2,4-dimethyl-benzaldehyde; 2,3,4,5-tetramethylcyclopent-2-en-1-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-1-hexanol, trans-2-octen-1-ol, 1-nonanol, 1,3-bis(1,1-dimethylethyl)-benzene, 2-octen-1-ol, adamantanol-like compounds, hexanal, 2-pentylfuran, 1-octen-3-ol, 2-pentylthiophene, heptanal, 10. The composition of claim 1, wherein the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount sufficient to produce one or more volatile compounds selected from benzeneacetaldehyde, thiazole, 2,4-di-tert-butylphenol, acetylacetone, and 1,3,5-titriane, and optionally the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount from about 0.1 mmol to about 100 mmol per kg or L of composition, based on the volume or weight of the composition excluding the Mortierella species biomass.

4. 2. The composition of claim 1, wherein the one or more sugars, sugar alcohols, sugar acids or sugar derivatives comprise glucose and / or ribose, and / or the one or more amino acids or derivatives or salts thereof comprise cysteine, cystine and / or glutamic acid or salts thereof.

5. The composition of claim 1 , wherein the composition does not include yeast extract.

6. a) Mortierella sp. biomass containing phospholipids; b) glucose and / or ribose; b) cysteine ​​and / or cystine; d) yeast extract, e) glutamic acid or a salt thereof; f) thiamine, and g) Aqueous component Including, 10. The composition of claim 1, further comprising extracted lipids from Mortierella species comprising phospholipids.

7. 10. The composition of claim 1, wherein the food product, beverage product, or feed is a meat or meat-like product.

8. 1. A method for producing a food product, beverage product, or feed, comprising combining Mortierella sp. biomass containing phospholipids; one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or thiamine, with one or more additional ingestible ingredients, wherein the food product, beverage product, or feed comprises about 2.5% by weight or less of dry Mortierella sp. biomass or an equivalent amount of wet biomass.

9. 10. A method for producing a food-like aroma and / or flavor, optionally a meaty aroma and / or flavor, comprising heating the composition of claim 1, optionally to at least about 130°C.

10. 1. A method for imparting a food-like aroma and / or flavor, optionally a meaty aroma and / or flavor, to a food product, beverage product, or feed, or for enhancing the food-like aroma and / or flavor associated with a food product, beverage product, or feed, comprising contacting the food product, beverage product, or feed with a Mortierella species biomass comprising phospholipids, or a composition comprising: a) a Mortierella species biomass comprising phospholipids, b) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and c) one or more amino acids or derivatives or salts thereof, or thiamine; and optionally heating the food product, beverage product, or feed and Mortierella species biomass or composition to at least about 130°C, wherein the heated food product, beverage product, or feed comprises no more than about 2.5% by weight of dry Mortierella species biomass or an equivalent amount of wet biomass.

11. 1. A method for imparting a food-like aroma and / or flavor, optionally a meaty aroma and / or flavor, to a food product, beverage product, or feed, or for enhancing the food-like aroma and / or flavor associated with a food product, beverage product, or feed, comprising: a) optionally heating a composition comprising: i) a Mortierella sp. biomass comprising phospholipids; ii) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and iii) one or more amino acids or derivatives or salts thereof, or thiamine, to at least about 130° C.; and then b) contacting a food product, a beverage product, or a feed with the composition obtained in step a); A method comprising:

12. The method of any one of claims 9 to 11, wherein the composition is heated for at least about 1 hour.

13. 1. Use of Mortierella sp. biomass containing phospholipids in a food product, beverage product, or feed, wherein the composition, food product, beverage product, or feed contains less than 2.5% by weight of dry Mortierella sp. biomass or an equivalent amount of wet biomass.

14. 14. Use according to claim 13 for imparting a food-like aroma and / or flavour, optionally a meaty aroma and / or flavour, to said food product, drink product or feed upon heating.

15. 15. The use according to claim 13 or 14, wherein the food product, drink product or feed is meat or a meat-like product.

Images