method

JP2024541921A5Pending Publication Date: 2025-10-20カウンタゲン·アーベー
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024524711
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-10-25
Filing Date
2022-10-25
Publication Date
2025-10-20

AI Technical Summary

Technical Problem

Existing methods for quantifying rolling circle amplification products (RCPs) in liquid samples face challenges in matching the reaction volume to the focal volume of optical devices, leading to low concentration issues and the need for extensive sample analysis to achieve statistical significance, while existing bead-based methods do not allow for digital quantification or efficient concentration of RCPs onto small areas.

Method used

A method involving magnetic beads to capture polynucleotides/oligonucleotides and concentrate them onto a small surface area using a magnetic source, allowing for high detection sensitivity and simple optical readout.

Benefits of technology

Enables concentration of RCPs within a single field of view, enhancing fluorescence intensity and facilitating accurate digital quantification without the need for extensive sample analysis, thereby improving detection sensitivity and efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein is a method for analyzing a sample containing a plurality of polynucleotides and / or oligonucleotides of interest, the method comprising (i) providing a sample solution containing a plurality of polynucleotides and / or oligonucleotides of interest, (ii) binding the polynucleotides / oligonucleotides to magnetic beads to provide bead-bound polynucleotides / oligonucleotides, thereby providing a further sample solution, (iii) applying the further sample solution to a first surface of a sample support element, and (iv) providing a magnetic source to draw (e.g., attract) the bead-bound polynucleotides / oligonucleotides to positions on the first surface of the sample support element. The present invention also relates to a sample analysis device for use in the method, as well as a kit of parts for use in the method of the invention.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to sample analysis methods, in particular to such sample analysis methods for measuring, analysing and quantifying polynucleotides and / or oligonucleotides, such as rolling circle amplification (RCA) products (RCPs). [Background technology]

[0002] Accurate quantification of biomolecules, especially nucleic acids, is of paramount importance for biomedical research, genetic engineering, and drug development. Single molecule solutions have proven superior to bulk measurements because they allow for the detection of subtle differences in quantity; for example, digital polymerase chain reaction (PCR) has many advantages over conventional PCR.

[0003] RCA is a single molecule amplification technique that can be used to detect individual copies of molecules. RCA is inherently digital, meaning that it does not require compartmentalization into droplets or wells as digital PCR does, so that single molecule copies in a complex solution can be distinguished. RCPs are most frequently detected by optical sensors when they are labeled with fluorophores. However, other optical and non-optical readout modes have been explored as well. The main challenge for quantifying RCPs from liquid samples containing RCPs is to match the final reaction volume with the focal volume of the optical device. This creates a mismatch and even though the absolute number of RCPs in a sample may be high enough to be detected, the concentration of RCPs in the sample may be low, which may require that the entire sample volume must be analyzed to detect all or a substantial proportion of all RCPs in the liquid sample to reach statistical significance.

[0004] RCPs in a liquid sample can be applied and spread onto a two-dimensional (2D) surface, such as a glass slide, and the total number of RCPs can then be determined by imaging the entire glass slide. However, such a procedure requires sophisticated automated microscopes with scanning stages that can acquire images of several adjacent fields of the microscope optical objective with high precision to capture the entire area.

[0005] Capturing nucleic acids on beads has been shown to be useful for a variety of applications.

[0006] For example, Sato et al.Microbead-based rolling circle amplification in a microchip for sensitive DNA detection.Lab Chip(2010);10:1262-1266 report the use of microbeads for the amplification of RCPs in beads and their subsequent digital quantification. However, this system requires loading with the reaction, and the bead-bound products cannot be easily concentrated in a small surface area. In another example, Soares et al.Silica bead-based microfluidic device with integrated photodiodes for the rapid capture and detection of rolling circle amplification products in the femtomolar range,Biosens.Bioelectron.(2019),1;128:68-75 report the trapping of RCPs in silica microbeads for fluorescence intensity-based readout. However, this system requires continuous flow, uses large beads of tens of micrometers in size, and does not allow digital quantification of RCPs. Yet another example, Donolato et al.Quantification of rolling circle amplified DNA using magnetic nanobeads and a Blu-ray optical pick-up unit.Biosens.Bioelectron.(2014);67:649-655, published the use of nanobeads for the capture and subsequent magneto-optical quantification of RCPs. However, RCPs are bound to multiple magnetic beads to increase the magnetic momentum, and digital quantification of single RCPs is not possible. In summary, none of these methods report the possibility of concentrating bead-bound RCPs into small regions for digital quantification of nucleic acids within a single field of view. Furthermore, the observed increase in fluorescence intensity of bead-bound RCPs is not reported.

[0007] Provided herein is a novel method that uses magnetic beads to capture (or generate on) polynucleotides and / or oligonucleotides in a liquid sample and concentrate them on or toward a small surface area using a magnetic source. This method allows the initial number of polynucleotides / oligonucleotides in the sample volume to be maintained, effectively increasing the local concentration of polynucleotides / oligonucleotides within a single field of view of an optical sensing device such as a microscope objective. The sample analysis method facilitates the analysis of samples containing RCPs with a simple optical readout, while still achieving high detection sensitivity.

[0008] Also provided herein is a sample analysis device for use in the method. Summary of the Invention

[0009] According to a first aspect of the present invention there is provided a method of analysing a sample comprising a plurality of polynucleotides and / or oligonucleotides of interest, the method comprising: (i) providing a sample solution containing a plurality of polynucleotides and / or oligonucleotides of interest; (ii) binding polynucleotides / oligonucleotides to magnetic beads to provide bead-bound polynucleotides / oligonucleotides, thereby providing a further sample solution; (iii) applying additional sample solution to the first surface of the sample support element; (iv) providing a magnetic source to attract (e.g., attract) the bead-bound polynucleotides / oligonucleotides to a location on the first surface of the sample support element, the method being hereinafter referred to as the "method of the invention."

[0010] It is an object of the present disclosure to overcome, or at least alleviate, one or more of the problems discussed above, and to provide advantages and aspects not heretofore offered by known art.

[0011] A particular objective of the method of the present invention is to allow for the concentration and focus of polynucleotides / oligonucleotides from a further sample solution onto / into a small defined area. This and other objectives are met by the invention disclosed herein.

[0012] To further explain, in step (iv) where it is stated that the magnetic source attracts (e.g. attracts) the bead-bound polynucleotides / oligonucleotides to a position on the first surface of the sample support element, this means that before providing the magnetic source, the bead-bound polynucleotides / oligonucleotides are distributed in a further sample solution, which is applied to the first surface of the sample support element. Following the provision of the magnetic source, the magnetic beads are attracted (e.g. attracted) towards a predefined position on the first surface of the sample support element. For the avoidance of doubt, it is not necessary for the magnetic beads to come into contact with the first surface of the sample support element in order to put the invention into practice, as long as the magnetic beads are attracted (e.g. attracted) towards an area that allows analysis and / or visualization.

[0013] By the term "attracted" we include that the bead-bound polynucleotides / oligonucleotides are "attracted" to a location on the first surface of the sample by a magnetic source, or that the bead-bound polynucleotides / oligonucleotides are "repelled" to a location on the first surface of the sample by a magnetic source. In effect, the bead-bound polynucleotides / oligonucleotides are attracted to a location by a combination of attractive and repelling forces provided by an arrangement of multiple magnetic sources such that the combination of forces provides a focal point to which the bead-bound polynucleotides / oligonucleotides are attracted. As used herein, the term "attract" can be replaced with either "attract" or "repel".

[0014] That is, in step (iv) a magnetic source may be provided to attract bead-bound polynucleotides / oligonucleotides to locations on the first surface of the sample support element.

[0015] In step (iv), a magnetic source may be provided on a second surface of the sample support element opposite the first surface, by which is referred to as a magnetic source, e.g. a magnet, in contact with the second surface of the sample support element.

[0016] Alternatively, a magnetic source may be provided in the vicinity of the sample support element so as to attract (e.g., attract) the bead-bound polynucleotides / oligonucleotides to a position on the first surface of the sample support element. By this is meant that a magnetic source, or indeed a plurality of magnetic sources, is provided in sufficient proximity to the sample support element so that their magnetic fields are focused to attract (e.g., attract) the bead-bound polynucleotides / oligonucleotides to a position on the first surface of the sample support element. This means that the magnetic source does not necessarily have to be in contact with the sample support element to put the invention into practice. For example, the magnetic source may be an array of magnets or electromagnets, or a combination thereof, spatially configured around the sample support element to generate a focused magnetic field that attracts (e.g., attracts) the bead-bound polynucleotides / oligonucleotides to a position on the first surface of the sample support element.

[0017] Furthermore, the magnetic source may be located proximate a second surface of the sample support element opposite the first surface, or may in fact be located proximate the first surface of the sample support element.

[0018] The term "polynucleotide" as used herein refers to a biological polymer composed of nucleotide monomers in a chain, e.g., DNA and / or cDNA and / or RNA. Typically, a polynucleotide comprises at least 14 nucleotides in a chain.

[0019] The term "oligonucleotide" as used herein refers to any short single strand of synthetic DNA or RNA. Typically, an oligonucleotide contains about 3 to 20 nucleotides in the strand.

[0020] As used herein, the term "multiple" refers to at least two of the characteristics of interest. For example, a plurality of polynucleotides / oligonucleotides in a sample solution means that the sample solution contains at least two polynucleotides / oligonucleotides. Furthermore, the multiple polynucleotides / oligonucleotides can be the same, or the sample solution can actually contain multiple different polynucleotides / oligonucleotides for analysis.

[0021] Those skilled in the art will understand that the phrase "polynucleotides and / or oligonucleotides of interest" as used herein refers to polynucleotides and / or oligonucleotides to be amplified and / or analyzed. Those skilled in the art will understand that such polynucleotides and / or oligonucleotides can refer to synthetic and / or naturally occurring polynucleotides and / or oligonucleotides.

[0022] For the avoidance of doubt, when referring to polynucleotides / oligonucleotides herein without using the term "plurality", a reference is made to a plurality of polynucleotides and / or oligonucleotides.

[0023] The magnetic beads may have an average size of about 10 nm to about 5 μm, for example, about 10 nm to about 2 μm, for example, about 500 nm to about 2 μm. In this regard, the magnetic beads may have an average diameter of about 10 nm to about 5 μm, for example, about 10 nm to about 2 μm, such as about 500 nm to about 2 μm, or about 10 nm to about 1 μm, such as about 10 nm to about 500 nm, for example, about 30 nm to about 200 nm or about 50 nm to about 200 nm.

[0024] The coefficient of variation (CV), also commonly referred to as the relative standard deviation (RSD), of the size of the magnetic beads can be less than about 10%, for example, less than about 5%.

[0025] Those skilled in the art will be aware of suitable methods for determining the size of magnetic beads in the nm to μm range, including, but not limited to, dynamic light scattering (DLS), transmission electron microscopy (TEM), scanning electron microscopy (SEM), atomic force microscopy (AFM), and laser diffraction analysis.

[0026] As used herein, the term "magnetic beads" refers to beads that are magnetic and / or have magnetic properties.

[0027] The magnetic beads can be ferrimagnetic or superparamagnetic. Preferably, the magnetic beads are superparamagnetic.

[0028] The magnetic beads may comprise iron, nickel, cobalt, or a combination thereof. Preferably, the magnetic beads comprise an iron oxide, such as magnetite (Fe3O4).

[0029] Examples of magnetic beads that can be used include Dynabeads (e.g., Dynabeads™ MyOne™ Streptavidin T1 (Thermo Fisher Scientific), Dynabeads™ MyOne™ Streptavidin C1 (Thermo Fisher Scientific), Dynabeads™ M-270 Streptavidin (Thermo Fisher Scientific), Dynabeads™ M-280 Streptavidin (Thermo Fisher Scientific), Dynabeads™ MyOne™ Silane (Thermo Fisher Scientific)), MACS® MicroBeads and MACSxpress® Beads (Miltenyi Biotec), Turbobeads (Turbobeads LLC), Sera-Mag™ beads (Cytiva), Ni-NTA magnetic agarose beads (QIAGEN), SuperMag streptavidin magnetic beads (Ocean NanoTech), and MagSi (AMSBIO).

[0030] Those skilled in the art will understand that "binding" polynucleotides and / or oligonucleotides to magnetic beads may include binding of such polynucleotides and / or oligonucleotides using methods standard in the art, such as via adsorption and / or conjugation, or a combination thereof. Preferably, binding is performed via conjugation.

[0031] In the case of binding of polynucleotides and / or oligonucleotides to magnetic beads via conjugation, such conjugation can be either direct or indirect (e.g., via a complementary capture oligonucleotide) to the polynucleotide and / or oligopeptide of interest.

[0032] The magnetic beads may include a surface coating and / or modification configured to allow binding of polynucleotides and / or oligonucleotides to the magnetic beads. Such surface coatings may include reactive groups for conjugation to polynucleotides / oligonucleotides, which may be selected from the group consisting of carbodiimides (e.g., 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)), amines (e.g., alkylamines), succinimides (e.g., N-hydroxysuccinimide esters), imidates (e.g., imidoesters), imides (e.g., maleimides), haloacetyls, disulfides (e.g., pyridyl disulfides), hydrazines, diazirines or azides (e.g., aryl azides), avidins (e.g., streptavidin and neutravidin), biotin, carboxyls, alkynes, and thiols.

[0033] It should also be understood that the polynucleotide and / or oligonucleotide of the method of the present invention may comprise a compound for conjugating to the surface coating of the magnetic beads. Such a compound may comprise a reactive group for conjugating to the polynucleotide / oligonucleotide, and such a reactive group may be selected from the group consisting of carbodiimide (such as 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)), amine (e.g., alkylamine), succinimide (e.g., N-hydroxysuccinimide ester), imidate (e.g., imidoester), imide (e.g., maleimide), haloacetyl, disulfide (e.g., pyridyl disulfide), hydrazine, diazirine or azide (such as aryl azide), avidin (e.g., streptavidin and neutravidin), biotin, carboxyl, alkyne, and thiol.

[0034] Polynucleotide / oligonucleotide can be conjugated to the surface coating of magnetic beads via click chemistry.For example, the surface of magnetic beads can comprise azide group, and polynucleotide / oligonucleotide can comprise alkyne group that conjugates via click chemistry.For avoidance of doubt, conjugation groups can be reversed, for example, magnetic beads surface can comprise alkyne group, and polynucleotide / oligonucleotide can comprise azide group.

[0035] Additionally, the surface of the magnetic beads may include a layer, such as a silver or gold layer, to enhance the conjugation of the surface-coated reactive groups to the magnetic bead surface.

[0036] Step (i) of the method of the present invention involves providing a sample solution comprising a plurality of polynucleotides and / or oligonucleotides of interest. It should be understood that the method may comprise a step prior to step (i), comprising the generation of a plurality of polynucleotides and / or oligonucleotides of interest as hereinbefore described, by suitable amplification methods according to those known in the art.

[0037] Alternatively or additionally, after step (ii) of binding the polynucleotides / oligonucleotides to the magnetic beads, the method may comprise a step of amplifying the bead-bound polynucleotides / oligonucleotides. In this sense, the polynucleotides / oligonucleotides bound to the beads for amplification may be padlock probes used to generate RCPs on the beads.

[0038] The aforementioned "amplification methods" include single molecule amplification methods such as polymerase chain reaction (PCR), strand displacement assay (SDA), transcription-mediated assay (TMA), and hybridization chain reaction (HCR), in particular rolling circle amplification (RCA).

[0039] RCA is a well-known single molecule amplification method that allows digital quantification without compartmentalization. After labeling RCA products (hereinafter referred to as "RCPs") with molecules of defined optical properties, such as fluorophores, the amplified molecules can be detected as single dots that can be individually quantified. Circular oligonucleotide templates for performing RCA can be designed and generated by several highly target-specific means, and these targets can be virtually any nucleotide sequence.

[0040] RCA uses highly processive polymerases on circular DNA targets to generate long ssDNA (i.e., single-stranded DNA) concatemers in the hundreds of nanometers to micrometers range (Baner, J.; Nilsson, M.; Mendel-Hartvig, M.; Landegren, U. Signal Amplification of Padlock Probes by Rolling Circle Replication. Nucleic Acids Res. 1998, 26(22), 5073-5078). RCA is often combined with "padlock probes" (PLPs), in which sequence-specific oligonucleotides bind in a circular fashion to the target strands that can then be covalently linked by a ligation step. The PLP-based RCA assay provides extreme stringency with single-base precision (Nilsson, M.; Malmgren, H.; Samiotaki, M.; Kwiatkowski, M.; Chowdhary, BP; Landegren, U. Padlock Probes: Circularizing Oligonucleotides for Localized DNA Detection. Science. 1994, 265(5181), 2085-2088). Similar to PLP, "selector" probes can be combined with RCA and targets circularized prior to RCA (Johansson, H.; Isaksson, M.; Soerqvist, EF; Roos, F.; Stenberg, J.; Sjoeblom, T.; Botling, J.; Micke, P.; Edlund, K.; Fredriksson, S.; Kultima, HG; Ericsson, O.; Nilsson, M. Targeted Resequencing of Candidate Genes Using Selector Probes. Nucleic Acids Res. 2011, 39(2), e8).

[0041] As used herein, the term "rolling circle amplification product" refers to products generated by rolling circle amplification (RCA), such as long repetitive single-stranded amplicons consisting of hundreds of reverse-complementary elements of a circular template arranged in a single molecule. For the avoidance of doubt, polynucleotides and / or oligonucleotides generated by RCA may hereinafter be referred to as "RCA products" or "RCPs."

[0042] Hybridization chain reaction (HCR) is also a well-known single-molecule amplification method similar to RCA, but does not rely on the use of enzymes for amplicon generation.

[0043] The polynucleotides and / or oligonucleotides in the method of the invention as defined herein above are preferably rolling circle amplification products or hybridization chain reaction products.

[0044] The inventors have found that the method typically reaches only one polynucleotide or oligonucleotide that binds to one magnetic bead. Thus, in an embodiment, a single polynucleotide or oligonucleotide binds to each magnetic bead. Without wishing to be bound by theory, the inventors have two hypotheses for this occurrence. The first hypothesis is that the amplification of the polynucleotide or oligonucleotide occurs at a rate that it locally uses up all the reagents in order to initiate another amplification at the same location. The second hypothesis is that once an amplification product is formed, it inhibits other amplification events from occurring due to steric hindrance. In a similar manner, if an amplification product is already formed for capture on a bead (rather than being formed on the bead), it is a stochastic process, and once an amplification product becomes bead-bound, it repels others from binding to the same bead due to the size of the bead and the amplification product.

[0045] In step (i), the sample solution comprises a plurality of polynucleotides and / or oligonucleotides that are not bead-bound, and after step (ii), the plurality of polynucleotides and / or oligonucleotides are then bead-bound, thus providing a further sample solution, in which case the sample solution in step (i) may be referred to as a first sample solution and the sample solution prepared in step (ii) may be referred to as a second sample solution.

[0046] For the avoidance of doubt, the methods of the present invention do not require that all polynucleotides and / or oligonucleotides that become bead-bound in step (ii) to be put into practice, and those skilled in the art will appreciate that due to thermodynamic and kinetic factors, it is possible that not all polynucleotides and / or oligonucleotides will become bead-bound in the sample solution, even if there is an excess of magnetic beads.

[0047] Step (iii) of the method of the present invention involves applying a further sample solution containing bead-bound polynucleotides / oligonucleotides to a first surface of a sample support element. That is, the sample support element comprises a first surface (e.g., a planar surface) to which the further sample solution can be applied and held in position on the sample support element. Such a support element may have a second surface opposite the first surface.

[0048] The sample support element may comprise any material, provided that it allows for the application and retention of additional sample solution at the surface in position for further analysis / visualization. For example, the sample support element may be a microscope slide (e.g., a glass microscope slide) or a membrane. Alternatively, the first surface of the sample support element may form the bottom of a sample receiving well for receiving additional sample solution, and optionally the well includes an opening for introducing the additional sample solution into the sample receiving well.

[0049] The amount of further sample solution added to the first surface of the sample support element may be in the range of about 1 to about 50 μL, such as about 5 to about 20 μL.

[0050] Step (iv) of the method of the invention involves providing a magnetic source to attract (eg attract) the bead-bound polynucleotides to locations on the first surface of the sample support element.

[0051] According to the method of the present invention, the magnetic source defined above (e.g., in step (iv) of the method of the present invention) can attract (e.g., attract) the bead-bound polynucleotides / oligonucleotides to a location on the first surface of the sample support element that is comparable to or smaller than the field of view of the optical sensing device. Alternatively, a funnel can be used to restrict the sample solution to multiple wells, and then a magnetic source spanning multiple wells can be used to attract the bead-bound polynucleotides to multiple locations on the first surface of each well of the sample support element.

[0052] The magnetic source may be a permanent or non-permanent magnet, such as a neodymium magnet or an electromagnet. Additionally, the magnetic source may be an array of magnets or electromagnets, or a combination thereof, spatially configured around the sample support element to generate a focused magnetic field that draws (e.g., attracts) the bead-bound polynucleotides / oligonucleotides to positions on the first surface of the sample support element.

[0053] The magnet is attached to the support element by approximately 0.75 mm. 2 ~Approx. 12cm 2 etc. approx. 0.75 mm 2 ~about 25cm 2 , for example, about 7 mm 2 ~Approx. 12cm 2 The surface area may be in the range of

[0054] The magnetic holding force (also commonly referred to as pulling force) of the magnetic source may range from about 1 g to about 50 kg, such as from about 1 g to about 500 g, for example, from about 250 g to about 500 g. For the avoidance of doubt, those skilled in the art will understand that the magnetic holding force of a magnet is the force required to pull the magnet straight away from a 3.175 mm thick steel plate.

[0055] Following the provision of the magnetic source, the method may include an incubation step at room temperature until a time sufficient for the bead-bound polynucleotides / oligonucleotides to migrate towards a location on the first surface of the sample support element. For the avoidance of doubt, the term "incubation" in this sense means that the sample is left undisturbed for a certain period of time, and does not necessarily mean that the sample is heated, for example, the incubation may be at room temperature. However, the incubation may also be carried out under a controlled temperature, such as a temperature of about 25 to about 50°C, such as about 25 to about 40°C.

[0056] It should be noted that the step of providing a magnetic source includes a magnetic source that is already present in the vicinity of the second surface of the sample support element when the further sample solution is applied. For example, the magnetic source can be a magnet that is fixed to the second surface of the sample support element, which means that when the sample solution is applied to the first surface, the bead-bound polynucleotides / oligonucleotides immediately, or at least substantially immediately, start to be attracted towards the magnetic source.

[0057] After step (iv), the bead-bound polynucleotides / oligonucleotides can be visualized and / or quantified using an optical device such as a microscope, e.g. a fluorescent microscope, preferably an epifluorescence microscope. Thus, the method can include a step of labeling the polynucleotides / oligonucleotides.

[0058] As described in Examples 4 and 5, the inventors have unexpectedly found that the fluorescent signal of bead-bound polynucleotides / oligonucleotides is greater than the sum of the fluorescence of the beads and the polynucleotides / oligonucleotides alone.

[0059] A variety of labels can be used, including fluorophores, colorimetric labels, chemiluminescent labels, phosphorescent labels, and particles such as gold and silver particles, as well as quantum dots. For example, polynucleotides / oligonucleotides can be labeled with fluorescently tagged oligonucleotides or biotin tagged oligonucleotides. Polynucleotides / oligonucleotides can be labeled before or after binding to beads.

[0060] Prior to visualization, the bead-bound polynucleotides / oligonucleotides may be washed, i.e., after step (iv) of drawing (e.g. attracting) the bead-bound polynucleotides / oligonucleotides to positions on the first surface of the sample support element, a volume of solution (i.e., supernatant) may be removed and the bead-bound polynucleotides / oligonucleotides may be washed with further solution.

[0061] The additional solution for washing may include a surfactant, such as a polysorbate surfactant, e.g., polysorbate 20, also commonly referred to by the trade name Tween 20. The surfactant may be present in an amount of about 0.1-5% (v / v).

[0062] The washing solution may also contain a salt, such as sodium chloride, in an amount of about 20 to about 200 mM, such as about 50 to about 150 mM.

[0063] The wash solution may also optionally include a chelating agent, such as EDTA, in an amount of about 1 to about 20 mM, such as about 2 to about 10 mM.

[0064] The wash solution may optionally further comprise a buffering agent, such as tris(hydroxymethyl)aminomethane (commonly referred to as Tris), in an amount of about 1 to about 20 mM, such as about 5 to about 15 mM.

[0065] Alternatively, after removal of the volume of solution, a further portion of the sample solution containing the bead-bound polynucleotides / oligonucleotides can be applied to the first surface of the sample support element, and then the bead-bound polynucleotides / oligonucleotides in the further portion are also attracted to positions on the first surface of the sample support element. This allows the dilute sample to be concentrated in a quick and simple manner, and allows the optical sensing device to visualize / quantify in a single field of view. To avoid misunderstanding, after addition of the further portion of the sample solution, the bead-bound polynucleotides / oligonucleotides can be washed.

[0066] After being attracted (e.g., attracted) to a position on the first surface of the sample support element, the method may include immobilizing or anchoring the bead-bound polynucleotides / oligonucleotides on the first surface of the sample support element. Once anchored, the sample support element is removed from the vicinity of the magnetic source for visualization. In this manner, a magnetic field does not need to be consistently applied to hold the bead-RCP complexes in place for subsequent imaging.

[0067] The bead-bound polynucleotides / oligonucleotides can be immobilized / fixed in a gel-like structure after providing a magnetic source. Compounds that can be used to cast / make the gel can be selected from the group consisting of polyacrylamide, agarose, hardening mounting media (e.g., VECTASHIELD Vibrance Antifade Mounting Media), UV-curing chemicals such as (meth)acrylate monomers, (meth)acrylated oligomers and photoinitiators (e.g., diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide (TPO)), as well as epoxies, adhesives, e.g., cyanoacrylate-based (Superglue) and silicones, or combinations of the above gel chemicals.

[0068] It is also to be understood that the polynucleotides and / or oligonucleotides or beads of the methods of the invention may comprise a compound for conjugating to the coating on the first surface of the sample support element.

[0069] Such compounds for coating the first surface of the sample support element may comprise reactive groups for conjugating to polynucleotides / oligonucleotides or beads, which may be selected from the group consisting of carbodiimides (e.g., 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)), amines (e.g., alkylamines), succinimides (such as N-hydroxysuccinimide esters), imidates (e.g., imidoesters), imides (e.g., maleimides), haloacetyls, disulfides (e.g., pyridyl disulfides), hydrazines, diazirines or azides (such as aryl azides), avidins (e.g., streptavidin and neutravidin), biotin, carboxyls, alkynes, and thiols, or combinations thereof.

[0070] The present invention relates to a sample analysis device, as described below, which allows for focusing polynucleotides and / or oligonucleotides of interest from a sample solution onto a small defined area corresponding to the area of ​​a single field of view of an optical sensing device, such as a microscope objective. The sample analysis device facilitates the analysis of samples containing polynucleotides and / or oligonucleotides of interest with a simple optical readout, while still achieving high detection sensitivity.

[0071] Thus, according to a second aspect of the present invention there is provided a sample analysis device comprising a sample support element having first and second surfaces, a magnetic source attached to the second surface of the sample analysis device.

[0072] The size of the magnetic source may be comparable to or smaller than the field of view of the optical sensing device and may include any of the features outlined above in relation to the first aspect of the invention.

[0073] The magnetic source may be an array of magnets or electromagnets, or a combination thereof, spatially configured around the sample support element to generate a focused magnetic field that draws (e.g., attracts) bead-bound polynucleotides / oligonucleotides to positions on the first surface of the sample support element.

[0074] The sample analysis device may be configured to allow polynucleotides and / or oligonucleotides of interest in a sample solution as defined herein to be concentrated in a small defined area corresponding to the area of ​​a single field of view of an optical sensing device, such as a microscope objective.

[0075] The sample analysis device may be used to concentrate polynucleotides and / or oligonucleotides of interest from a sample according to the methods of the present invention containing low concentrations of such polynucleotides and / or oligonucleotides onto a sensor detection zone, so that detection of the polynucleotides and / or oligonucleotides requires only a single measurement to detect all the polynucleotides and / or oligonucleotides of interest contained in the sample, thereby avoiding the need to measure in several different areas of the detection field and avoiding the use of complicated imaging tools.

[0076] The sample analysis device is specifically designed to analyze and quantify polynucleotides / oligonucleotides generated (i.e. amplified) by rolling circle amplification.

[0077] The first surface of a sample support element according to the sample analysis device of the present invention may form the bottom of a sample receiving well for receiving sample molecules.

[0078] The sample receiving wells of the sample analysis device of the present invention may include an opening for introducing a sample solution into the sample receiving well. Those skilled in the art will understand that such wells may also be open wells. Alternatively, the wells may be at least partially covered by a material that is preferably optically transparent.

[0079] In the methods of the invention, a sample solution may be introduced into the well through the opening, and after step (iv) of attracting the bead-bound polynucleotides / oligonucleotides to positions on the first surface of the sample support element, the supernatant may be removed to leave the bead-bound polynucleotides / oligonucleotides in position, followed by the introduction of a further aliquot of sample solution containing further bead-bound polynucleotides / oligonucleotides, or a wash solution (e.g. 10 mM Tris-HCl (pH 7.5), 5 mM EDTA, 100 mM NaCl, and 0.1% (v / v) Tween-20) to wash the bead-bound polynucleotides / oligonucleotides.

[0080] Additionally, the wells may contain an absorbent material located at one end of the well away from the area to which the bead-bound polynucleotides / oligonucleotides are attracted, which acts to draw in the sample solution via capillary forces and then allows additional sample solution to be added.

[0081] There is further provided an alternative sample analysis device according to the second aspect of the invention for use in the method of the invention, the sample analysis device comprising: a sample support element including a plurality of wells for receiving a sample solution; a base element including a plurality of magnetic sources, the base element adapted to allow the sample support element to be positioned on top of the base element, the plurality of magnetic sources spatially configured to generate a magnetic field such that a focal point of the magnetic field is provided toward the center of the bottom of each well in the sample support element.

[0082] For the avoidance of doubt, the bottom of each well in the sample support element should be taken as the first surface of the sample support element as defined herein in relation to the methods of the present invention.

[0083] The sample support element and the base element may be configured such that they are only matable in one orientation. This ensures that the spatial location of the magnetic source is correct each time the sample support element is placed on the base element. For example, the sample support element and the base element may be shaped in a corresponding manner such that they are only matable in one orientation. Alternatively, or additionally, the base element may include a pin and the sample support element may include a through hole, such that the sample support element fits onto the base element only if the pin and through hole are aligned.

[0084] This sample analysis device is useful in the present invention in that once a sample solution is placed in each well, a sample support element can be placed on top of the base element, and the bead-bound polynucleotides / oligonucleotides are attracted (e.g., attracted) to the center of the bottom of each well. Following this, the sample support element can be removed and analyzed. For example, the sample support element can be a 96-well plate that can be placed in a holder of a visualization device to allow for the analysis of multiple samples.

[0085] As outlined above, the sample can be immobilized / fixed following the bead-bound polynucleotides / oligonucleotides being attracted (e.g., attracted) to the center of the bottom of each well. To allow for fixation, the bottom of each well in the sample support element can include a coating of reactive groups for conjugating to polynucleotides / oligonucleotides or beads. Suitable coating compounds are outlined above with respect to the methods of the invention.

[0086] For the avoidance of doubt, a two-part device is useful when visualization is desired without the presence of a magnet, however it is also contemplated that the sample in the well can be visualized while the sample support element and base element remain attached.

[0087] In all embodiments in which the sample analysis device is intended to be visualized in the presence of a magnet, the bottom of the sample support element may include an opaque layer between the magnetic sources to reduce reflection and refraction of the fluorescent signal from the magnet.

[0088] According to a third aspect of the present invention, i) a container or containers containing rolling circle amplification and / or hybridization chain reaction reagents; ii) a container containing magnetic beads, such as those described herein; There is also provided a kit of parts comprising a sample analysis device according to the second aspect of the invention and / or instructions for use according to the method of the first aspect of the invention.

[0089] According to a fourth aspect of the present invention, i) a container or containers containing rolling circle amplification and / or hybridization chain reaction reagents; ii) a container containing magnetic beads, such as those described herein; and iii) instructions for use of the kit in a method according to the first aspect of the invention.

[0090] The kit of parts according to the third or fourth aspect of the invention may further comprise a container comprising a reagent for coating the first surface of the sample support element, which reagent comprises a reactive group for conjugating to a polynucleotide / oligonucleotide or a bead. Suitable compounds for coating the first surface of the sample support element are described above in relation to the method of the invention.

[0091] The kit of parts according to the third or fourth aspect of the invention may further comprise a container containing reagents for casting / making a gel for immobilizing bead-bound polynucleotides / oligonucleotides. Suitable reagents for preparing such gels are outlined above in relation to the method of the invention.

[0092] Whenever the word "about" is used herein in the context of absolute amounts, such as weight, volume, size, diameter, etc., or relative amounts (e.g., percentages), of individual components of a composition or components of a composition (including concentrations and ratios), parameters such as time frames, and temperatures, it is to be understood that such variables are approximate and therefore may vary by ±10%, such as ±5%, preferably ±2% (e.g., ±1%) from the actual numbers specified herein. This is true even when such numbers are first presented as percentages (e.g., "about 10%" may mean ±10%, which is around the number 10, being anywhere from 9% to 11%).

[0093] The embodiments, together with further objects and advantages thereof, may best be understood by reference to the following description of the drawings taken together with examples. [Brief description of the drawings]

[0094] [Figure 1] 1 illustrates the main operation and principles of the sample analysis module, the capture principle of RCP, padlock probe, or target DNA with padlock probe on carrier bead, and a side view in cross section of an embodiment of the sample analysis module. The RCP can capture after the RCA reaction, or the target DNA and / or padlock probe can be captured on beads and directly amplified thereon. [Diagram 2] 1A-1D are cross-sectional side views of exemplary embodiments of a sample analysis module showing different design layouts. The open channel structure and the use of an absorbent pad can increase the loading volume, thereby further increasing the detection sensitivity. A) Exemplary chip design 1 with one inlet and one outlet, B) Exemplary chip design 2 with one inlet and one chamber to hold liquid, C) Exemplary chip design 3 with a well that can be sealed with a cover slip prior to image acquisition, and D) Exemplary chip design 4 with one inlet and an absorbent pad at the opposite end that can fill more liquid within the chip. [Diagram 3]Images of fluorescently labeled RCP immobilized on (A) a glass slide and (B) in a sample receiving well of an embodiment of a sample analysis module. A. Shows 1 pM RCP under a coverslip on a glass slide imaged with a 20x microscope objective. B. The same 1 pM RCP solution from (A) is shown using a 20x microscope objective after using the concentration method described herein. [Figure 4A] Graphs showing quantification of serial dilutions of RCP using an embodiment of the sample analysis module: A. Showing increased detection sensitivity compared to detection on a glass slide; B. Showing linear regression with serial dilutions; The average of two individual measurements is shown. [Figure 4B] Graphs showing quantification of serial dilutions of RCP using an embodiment of the sample analysis module: A. Showing increased detection sensitivity compared to detection on a glass slide; B. Showing linear regression with serial dilutions; The average of two individual measurements is shown. [Diagram 5] Image of fluorescently labeled RCPs from human genomic DNA immobilized by an embodiment of the Sample Analysis Module. The RCPs are labeled with different fluorescent barcodes to distinguish between probes for control, target, and reference genes. The number of RCPs should be equal for all three genes (ratio 1:1:1), which is confirmed by RCA in conjunction with the Sample Analysis Module, which visualizes the low concentration of RCPs in solution. The inset image shows the respective RCPs for each of the fluorescent barcodes. [Figure 6A] Graphs and images of an exemplary RCP showing the fluorescence intensity enhancement properties of bead-bound RCP compared to "free" / unbound RCP. The enhancement properties are illustrated here by three different fluorescence channels. A. Graph of the fluorescence intensity of RCP on slide and on beads. A population of RCPs results from the same reaction, highlighting the increased intensity of the exemplary bead-bound RCP shown in the three fluorescence channels. B. A series of images showing a single exemplary RCP in solution (on a glass slide) and bound to a bead. The images were thresholded at the same time, showing the increased intensity and size of the bead-bound RCP. [Figure 6B]Graphs and images of an exemplary RCP showing the fluorescence intensity enhancement properties of bead-bound RCP compared to "free" / unbound RCP. The enhancement properties are illustrated here by three different fluorescence channels. A. Graph of the fluorescence intensity of RCP on slide and on beads. A population of RCPs results from the same reaction, highlighting the increased intensity of the exemplary bead-bound RCP shown in the three fluorescence channels. B. A series of images showing a single exemplary RCP in solution (on a glass slide) and bound to a bead. The images were thresholded at the same time, showing the increased intensity and size of the bead-bound RCP. [Figure 7] Example images showing that the fluorescence intensity of bead-bound RCP is greater than the sum of beads and RCP on their own. A. Example images of magnetic beads, RCP, and bead-bound RCP on a microscope slide under a fluorescent microscope. The number in the left corner corresponds to the highest fluorescence intensity of the image. B. Calculations of an example image demonstrating the surprising fact that the sum of beads and RCP is less than bead-bound RCP. [Figure 8A] Graphs and images showing a comparison of autofluorescence of nitrocellulose membranes and magnetic beads. A. Graph of autofluorescence levels of nitrocellulose membranes and MyOne Dynabeads C1 in different fluorescence channels. B. Example images and inset of FITC-labeled RCP on membrane and beads binding. RCP is clearly distinguishable upon magnetic enrichment using beads, but autofluorescence of nitrocellulose masks RCP. [Figure 8B] Graphs and images showing a comparison of autofluorescence of nitrocellulose membranes and magnetic beads. A. Graph of autofluorescence levels of nitrocellulose membranes and MyOne Dynabeads C1 in different fluorescence channels. B. Example images and inset of FITC-labeled RCP on membrane and beads binding. RCP is clearly distinguishable upon magnetic enrichment using beads, but autofluorescence of nitrocellulose masks RCP. [Figure 9]FIG. 1 shows an exemplary embodiment of a two-component sample analysis module with a (disposable) quantification tip and a reusable tip holder. A. A top view of an exemplary tip and tip holder design, and assembly of both. B. A schematic side view of an exemplary assembled embodiment. C. A photograph of an exemplary assembled embodiment. [Figure 10] Two example concepts of magnet arrangements and designs that produce a homogeneous magnetic field at the center of the magnet or magnet arrangement. A. An example schematic of an inverted microscope for imaging through a well that will not function if a magnet is placed between the chamber and the objective lens so as to block the view. B and C show an arrangement of four magnets around the chamber, while D and E show an arrangement of a single ring magnet that produces a homogeneous magnetic field at its center. [Figure 11] Two exemplary multi-well designs that allow for high throughput screening using the methods disclosed herein: A. Illustrative and example of a multi-well plate and a plate holder that accommodates the annular magnetic source described in Figures 3D and E. Figure 11B. Illustrative and example of a multi-well plate and a plate holder that accommodates a disk-shaped magnetic source. [Figure 12A] Graphs and images of exemplary RCPs showing the fluorescence intensity enhancement properties of bead-bound RCPs compared to "free" / unbound RCPs, and independence of bead size (within a particular size range). A. Box plots of fluorescence intensity of RCPs on a slide and bound to beads. B. A series of images showing a single exemplary RCP in solution (on a glass slide) and bound to beads (on the same glass slide). [Figure 12B] Graphs and images of exemplary RCPs showing the fluorescence intensity enhancement properties of bead-bound RCPs compared to "free" / unbound RCPs, and independence of bead size (within a particular size range). A. Box plots of fluorescence intensity of RCPs on a slide and bound to beads. B. A series of images showing a single exemplary RCP in solution (on a glass slide) and bound to beads (on the same glass slide). [Figure 13] Images illustrating the non-trivial optical differences between six exemplary bead sizes. Scale bar represents 40 μm. [Figure 14] 13. Images of five exemplary RCP-bound bead sizes and their non-trivial behavior and optical differences under magnetic force. Scale bar represents 20 μm. [Explanation of symbols]

[0095] In the figures the following reference numbers are used: 1. Solution containing rolling circle amplification products 2. Capture molecules (triangles in the diagram). Chemical or biological, e.g., thiols or biotin. Capture molecules can be added either during hybridization, reaction, or strand synthesis. 3. Fluorescent dyes (stars in the figure), e.g., sequence-specific or intercalating 4. Magnetic particles with functional groups; chemical or biological (e.g., streptavidin functionalized or with capture oligonucleotides) 5. DNA Circle or Ligated Padlock Probes 6.Target DNA 7. Rolling circle amplification products bound / immobilized to magnetic particles 7. Sample Support Element 8. First surface of the sample support element 9. Second surface of the sample support element 10. Solution with bead-bound rolling circle amplification products 11. Magnetic sources, e.g. permanent or electrical 12. Surface-enriched and magnetically immobilized rolling circle amplification products 13. Microscope objective, e.g., 10x or 20x with a field of view corresponding to the concentrated rolling circle amplification product region. 14.Aperture 15. A thin layer of glass, plastic, or other transparent material that allows imaging at short working distances. Can be the same material as the tip itself 16. Absorbent pads, e.g., paper or cotton 17. Transparent top layer 18.Through hole 19. Concentration chamber / channel 20. Concentrated Chip 21. Magnet 22. Pins to hold the chip in place 23. Chip holder 24. Wells / Chambers 25. Well / chamber plate holder that houses the magnetic source 26. Well / chamber plates, e.g., 96-well plates 27. Well / chamber plate holder combined with well / chamber plate Throughout the drawings, the same reference numbers are used for similar or corresponding elements. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0096] 1 shows in detail the capture principle of RCP, padlock probe or target DNA with padlock probe on carrier bead (4) illustrating the main operation and principle of the sample analysis module, and a cross-sectional side view of an embodiment of the sample analysis module. RCP can be captured after the RCA reaction or target DNA and / or padlock probe can be captured on beads and directly amplified thereon.

[0097] A sample solution (1) containing the rolling circle amplification products (7) is provided in an Eppendorf tube, and magnetic particles (4) bearing functional groups (chemical or biological, e.g., streptavidin functionalized) or capturing oligonucleotides (2) are provided and added to the sample solution. After a period of time allowing the rolling circle amplification products to bind to the magnetic beads, bead-bound RCP is achieved (7) and the sample solution is transferred to a first surface (8) of a glass slide acting as a sample support element.

[0098] A magnet (11) was then provided on a second surface (9) of the slide opposite the first surface to attract the beads to a specific area on the slide (12) that was equal to or smaller than the field of view of an optical imaging device (13), such as a fluorescence microscope.

[0099] Figure 2 shows four further embodiments of a sample analysis device according to the second aspect of the invention. Embodiment A shows a device in which the first surface (8) of the support element forms the bottom of a well in which a sample solution is placed. The sample analysis device has a top layer (17) that is transparent to allow visualization, and the device comprises two openings (14) that allow sample solutions to be added and removed as required.

[0100] Embodiment B is similar to embodiment A, except that the device includes only one opening (14). Embodiment C is similar to embodiment A, except that rather than having a separate opening, a glass cover slip (15) is provided over the well opening to seal the volume.

[0101] Embodiment D is similar to embodiment A, except that on one side of the device, the opening (14) is filled with an absorbent material (16) that absorbs excess sample solution through capillary forces to allow further sample solution to be added once the bead-bound polynucleotides are held in position by the magnetic source.

[0102] FIG. 9 shows an example of a two-component sample analysis module with a (disposable) quantification / enrichment tip (20) and a reusable tip holder (23). The quantification tip has through holes (18) that allow for precise positioning and fits onto tip holder pins (22). This allows imaging with upright and inverted imaging systems. The eight enrichment channels (19) are 9 mm apart from each other and can be added with a standard multichannel pipette. FIG. 9A shows a top view of an exemplary tip (20) and tip holder (23) design, as well as the assembly of both. FIG. 9B is a schematic side view of an exemplary assembled embodiment. FIG. 9C is a photograph of an assembled exemplary embodiment. To reduce reflection and refraction of the fluorescent signal from the magnet (21), the tip holder can be layered with a non-light absorbing paint, or the enrichment tip itself has an opaque bottom layer, both cases have been investigated with similar results.

[0103] Figure 10 shows two exemplary concepts of magnet (11) placement and design that generate a uniform magnetic field in the center of the magnet or magnet arrangement. These magnet settings allow to generate a uniform magnetic field for enrichment of bead-bound RCPs, while at the same time keeping the center of the chamber free to allow image acquisition from the bottom (inverted microscope). Figure 10A shows an exemplary schematic of an inverted microscope (13) for imaging through the well (24), which does not work if the magnets are placed so as to block the view between the chamber and the objective lens. Figures 10B and 10C show the placement of four magnets (11) around the chamber (side and top views, respectively), generating a uniform magnetic field in the center of the magnet arrangement.

[0104] The configuration and generation of such magnetic fields is well known and well reported in the literature, examples of which are Tretiak, O., Bluemler, P., & Bougas, L. (2019). Variable single-axis magnetic-field generator using permanent magnets. AIP Advances, 9(11), 115312. doi:10.1063 / 1.5130896, Manz, B., Benecke, M., & Volke, F. (2008); and a simple, small and low-cost permanent magnet design to produce homogeneous magnetic fields. Journal of Magnetic Resonance, 192(1), 131-138. doi:10.1016 / j.jmr.2008.02.011.

[0105] The importance of such an arrangement is to ensure equal distances between the magnets from each other (d1) and their equal distance to the chamber (d2). Figures 10D and 10E show an arrangement of a single ring magnet that generates a uniform magnetic field at its center. When a chamber with a RCP (12)-containing solution is placed at the center of the magnet (d3), the RCPs are concentrated at the center. The two configurations shown in Figures 10B and 10C, and 10D and 10E, will both allow inverted microscopy through the bottom layer of the chamber.

[0106] Figure 11 shows two exemplary multi-well designs that allow high-throughput screening using the methods disclosed herein. Figure 3 shows an exemplary chip design in the size of a standard microscope slide (2.5 cm x 7.5 cm), where the exemplary plate is a standard 96-well plate that can be adapted to various standardized image acquisition units such as microscopes and plate readers. Figure A is an illustration and example of a plate holder housing that accommodates the multi-well plate and annular magnetic source described in Figures 3D and 3E. This concept allows the processing and analysis of 96 samples at a time. Figure B is an illustration and example of a plate holder that accommodates the multi-well plate and disk-shaped magnetic source.

[0107] array SEQ ID NO:1 Padlock Probe 1 PO4-GGGCAGCTGTCTAATTTTTGAGTCGGAAGTACTACTCTCTGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGTATCCTCGGAGAAGGTT SEQ ID NO:2 Synthetic target 1 AGACCTGTTACATCTGGGTGCTTTCCTATAATGCACGACAGAACAAAAATTAGACAGCTGCCCAACCTTCTCCGAGGATAC SEQ ID NO:3 Detection probe for padlock probe 1 Cy3-AGTCGGAAGTACTACTCTCT SEQ ID NO:4 Capture Oligo Biotin-TTTTTCCTCAGTAATAGTGTCTTAC SEQ ID NO:5 RPP30 Padlock Probe PO4-TTGTTGAGTGTTGGCGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCGTCGCGTGCATAACCAGGCCA SEQ ID NO:6 NRXN1 Unedited Padlock Probe PO4-CGGCGGCCGCCTGCAGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGGCCTTATTCCGGTGCTATGCTGATTCTGACGCG SEQ ID NO:7 NRXN1 Reference Padlock Probe PO4-AATAAGGGTCCCGAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACAGAGAGTAGTACTTCCGACTACACCGTGACGAAGA SEQ ID NO:8 Detection probe for RPP30 Cy3-ATTTAGCATACATCGTCGCG SEQ ID NO:9 Detection probe for unedited NRXN1 FITC-GGGCCTTATTCCGGTGCTAT SEQ ID NO:10 Detection probe for NRXN1 Cy5-AGAGAGTAGTACTTCCGACT SEQ ID NO:11 Outer primer TACTGAGGAGCTGCATAC*A*C SEQ ID NO:12 External primer ACACTATTACTGAGG SEQ ID NO:13 Detection probe 2 for NRXN1 FITC-AGAGAGTAGTACTTCCGACT Note that the "*" indicates the phosphonothioate base. EXAMPLES

[0108] List of abbreviations RCA = Rolling Circle Amplification DNA = deoxyribonucleic acid BSA = bovine serum albumin dNTP = deoxynucleotide triphosphate RCP(s) = rolling circle amplification product(s) EDTA = Ethylenediaminetetraacetic acid Tth = Thermus Thermophilus NAD = Nicotinamide adenine dinucleotide PBS = phosphate buffered saline

[0109] Example 1 This example demonstrates increased RCA product numbers per field using the present invention when compared to standard quantification on a slide by spreading the RCA products under a coverslip. This example is shown in Figure 3 and shows that without capture on magnetic beads and magnetically drawn into position, the number of RCA amplicons in a single field is much lower than the number captured on magnetic beads.

[0110] RCP production By performing a padlock probe ligation reaction templated by a synthetic single-stranded DNA target mimicking that of a conserved 40-nt region of the hemagglutinin gene from influenza B, we generated a functional circular template for subsequent RCA. Ligation of the padlock probe was performed using a mixture consisting of 100 pM padlock probe (PO4-GGGCAGCTGTCTAATTTTTGAGTCGGAAGTACTACTCTCTGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGTATCCTCGGAGAAGGTT, SEQ ID NO: 1), 1 pM synthetic target (AGACCTGTTACATCTGGGTGCTTTCCTATAATGCACGACAGAACAAAAATTAGACAGCTGCCCAACCTTCTCCGAGGATAC, SEQ ID NO: 2), Tth ligase buffer (20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl2, 0.5 mM NAD, and 0.01% (v / v) Triton® X-100) with 5 U Tth DNA ligase (Blirt SA) in a final volume of 20 μL. The mixture was incubated at 55° C. for 20 min.

[0111] The resulting circles were then amplified by target-primed RCA with a mixture containing 0.2 μg / μL BSA (Fisher Scientific), 125 μM dNTPs (Fisher Scientific), and 8 U of phi29 DNA polymerase (Blirt SA) in a final volume of 30 μL. The RCA reaction was incubated at 37° C. for 2 h and 65° C. for 2 min.

[0112] RCP sign The resulting RCP was labeled using fluorescently and biotin-tagged oligonucleotides that were complementary to the repeats in the RCP. For this, the RCP product was mixed with 30 μL of labeling buffer (10 mM Tris-HCl (pH 8.0), 10 mM ethylenediaminetetraacetic acid (EDTA), 0.05% (v / v) Tween 20, 1 M NaCl) containing 5 nM cyanine 3 (Cy3)-(Cy3-AGTCGGAAGTACTACTCTCT, SEQ ID NO: 3) and biotin-tagged oligonucleotide (biotin-TTTTTCCTCAGTAATAGTGTCTTAC, SEQ ID NO: 4). The labeling reaction was incubated at 75° C. for 2 min and at 55° C. for 15 min.

[0113] Capture of RCPs on beads The resulting labeled RCP was captured on Dynabeads™ MyOne™ Streptavidin T1 (Thermo Fisher Scientific). Dynabeads™ MyOne™ Streptavidin T1 beads are superparamagnetic beads with a diameter of 1 μm that have a single layer of recombinant streptavidin covalently bound to their surface, not multilayers, and are additionally blocked with BSA. For this, the beads were prepared according to the manufacturer's instructions and then added to the RCP solution at a concentration of 0.125 μg / μL. The capture reaction was incubated for 20 min at 37° C., followed by washing the beads once with washing buffer and resuspending them in the same buffer.

[0114] Imaging of RCP To visualize the resulting bead-bound RCP, 10 μL of the capture reaction was placed on a Superfrost glass slide (Thermo Fisher Scientific). A 1.5 mm ring magnet (Supermagnete) was attached to the slide to allow localized concentration of the bead-bound RCP on a small surface area. To spread the solution, a 24 × 24 mm 2 A coverslip was placed on top of the solution. The slide was incubated at room temperature for 5 minutes to allow the beads to concentrate. After incubation, the slide was viewed under a 20× magnification objective and a 0.65×0.65 μm2 Images were taken with an Olympus IX72 inverted fluorescent microscope with a field of view of 100 nm.

[0115] To visualize RCPs that were not captured by magnetic beads, a similar procedure was used, but no magnet was attached to the glass slide, as RCPs are not affected by magnetic forces.

[0116] In conclusion, there is a noticeable difference in the number of RCPs observed in Figure 3a compared to Figure 3b. When using the magnetic enrichment method, the number of RCPs is much higher in the same field of view, since RCPs are attracted to a small surface area. The result is an increased sensitivity and therefore also a simplified detection, since it is not necessary to scan samples containing low concentrations of RCPs, thereby overcoming one of the main limitations of RCA: the detection of RCPs at low concentrations.

[0117] Example 2 Analytical capabilities of the present invention. This example demonstrates the increased analytical capacity using the present invention compared to conventional readout on a slide and is shown in FIG.

[0118] RCPs were prepared in the same manner as described in Example 1. Briefly, different synthetic target concentrations were circularized via ligation and amplified into RCPs for 2 h. The RCPs were then labeled with fluorescent and biotin probes.

[0119] In the enrichment method, RCPs were incubated with magnetic beads as described in Example 1. Sample solution (10 μL of a 60 μL reaction volume) was added to a cell counter slide (BioRad) that had a 1.5 mm diameter magnet attached to its bottom. After 5 minutes, the cell counter slide was placed on the microscope stage and the enriched RCPs were visualized using a 20× objective.

[0120] In the comparative method, the labeled RCP was not captured by the beads. The sample solution (10 μL of the 60 μL reaction volume) was added to a cell counter slide, but no magnet was attached. After 5 minutes, the RCP was allowed to settle and could be visualized using the same 20× objective.

[0121] RCP quantification The acquired images were analyzed using a custom-made pipeline in CellProfiler software (version 4.1.3, https: / / cellprofiler.org, by the Broad Institute and originally published by Lamprecht et al. CellProfiler: free, versatile software for automated biological image analysis, Biotechniques (2007); 42(1): 71-75). The pipeline consisted of image enhancement and object identification with manual thresholding.

[0122] In conclusion, the results confirm the increased sensitivity of the enrichment method disclosed herein when compared to the normal readout on a microscope slide. Using the enrichment method, RCPs can be detected at concentrations where the normal readout appears blank (Figure 4a). Additionally, the number of detected RCPs is linearly correlated with the concentration of the input target, thereby confirming the concentration-independent enrichment of RCPs (Figure 4b). Another advantage is that the normal pathway for identifying RCPs can be used, making the application of this method almost barrier-free.

[0123] Example 3 Quantification of human genomic DNA This example demonstrates the ability to quantify different genes in genomic DNA and is illustrated in Figure 5. In this example, three different padlock probes were used to detect three different gene segments. One padlock probe served as an assay control if all steps were performed correctly (marked as control), one padlock probe was used as a reference (marked as reference) to quantify the editing level for the gene of interest as it relates to the gene of interest, and one padlock probe served to identify the location of the gene edit (marked as target gene). This means that in a wild type experiment, an equal number of RCPs is expected for all three padlock probes, while in an edited genome, an equal number of RCPs is expected for the control and reference, but a reduced number for the target gene. In this sample, wild type human genomic DNA was used, and therefore the number of RCPs in each of the padlock probes is equal.

[0124] This statement is quite general, since some cell lines may have various chromosome and / or gene copy numbers, and therefore it is recommended to standardize genome editing experiments on wild-type samples to avoid potential bias.

[0125] RCP production Human genomic DNA (Merck) was used to generate circular templates for the RCA reaction. Three different regions in genomic DNA were targeted: one region in the RPP30 gene and two regions in the NRXN1 gene. First, 1 μg of human genomic DNA was fragmented in a fragmentation mixture consisting of buffer (20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl2, 0.5 mM NAD, and 0.01% (v / v) Triton® X-100) and 15 U of AluI (New England Biolabs) in a total volume of 20 μL. The reaction was incubated at 37° C. for 5 minutes.

[0126] Ligation was performed using Tth ligase buffer (20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl, 0.5 mM NAD, and 0.01% (v / v) Triton® X-100), 1 nM padlock probe (PO4-TTGTTGAGTGTTGGCGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCGTCGCGTGCATAACCAGGCCA, SEQ ID NO: 5, PO4-CGGCGGCCGCCTGCAGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGGCCTTATTCCGGTGCTATGCTGATTCTGACGCG, SEQ ID NO: 6, and PO4-AATAAGGGTCCCGAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACAGAGAGTAGTACTTCCGACTACACCGTGACGAAGA, SEQ ID NO: 7), and 7.5 U of Tth 10 μL of ligation mixture containing DNA ligase was added. The ligation reaction was incubated at 98° C. for 3 min and 55° C. for 45 min.

[0127] The resulting circles were then amplified by RCA, for which the mixture contained 0.2 μg / μL BSA, 125 μM dNTPs, 5 nM outer primers (TACTGAGGAGCTGCATAC*A*C, SEQ ID NO:11, the star indicates a phosphonothioate base that avoids the exonuclear activity of the polymerase), 10.5 U of exoI (New England Biolabs), and 28 U of phi29 DNA polymerase in a final volume of 35 μL. The RCA reaction was incubated at 37° C. for 3 hours and at 65° C. for 2 minutes.

[0128] RCP sign The resulting RCP was labeled using fluorescently tagged and biotin tagged oligonucleotides as described in Example 1. Briefly, the RCP product was mixed with 15 μL containing 5 nM cyanine 3 (Cy3)-(Cy3-ATTTAGCATACATCGTCGCG, SEQ ID NO: 8), biotin-(biotin-TTTTTCCTCAGTAATAGTGTCTTAC, SEQ ID NO: 4), AlexaFluor 488 (FITC)-(FITC-GGGCCTTATTCCGGTGCTAT, SEQ ID NO: 9), and cyanine 5 (Cy5)-tagged oligonucleotide (Cy5-AGAGAGTAGTACTTCCGACT, SEQ ID NO: 10) in labeling buffer (10 mM Tris-HCI (pH 8.0), 10 mM ethylenediaminetetraacetic acid (EDTA), 0.05% (v / v) Tween 20, 1 M NaCl). The labeling reaction was incubated at 75° C. for 2 min and 55° C. for 15 min.

[0129] Trapping RCP on beads and imaging of RCP Capture of labeled RCP, imaging, and subsequent image analysis were performed as described in Examples 1 and 2.

[0130] In conclusion, Figure 5 shows the composite of all three channels. The inset shows the RCPs for each of the three channels individually. As can be seen, the number of RCPs in each channel is equal, thereby confirming the notion that this human genomic DNA does not have any editing.

[0131] Example 4 This example demonstrates the increased fluorescence intensity of bead-bound RCP when compared to unbound / solution RCP. The results of this example are shown in FIG.

[0132] RCPs were generated and quantified as described in Example 3. For analysis of RCP fluorescence intensity, the CellProfiler pipeline was adapted to include a separate module that measures the fluorescence intensity of each subject.

[0133] The results of this example show that RCP bound to beads is brighter than unbound (Figure 6A). Furthermore, the increased fluorescence intensity made the RCP appear larger compared to the RCP in solution (Figure 6B). The comparison was based on an average of several hundred RCPs acquired in solution and bound to beads.

[0134] The conclusion drawn from this example is that the invention of binding and visualizing RCP with magnetic beads results in unexpected increased fluorescence intensity, making quantification easier, e.g. requiring shorter exposure times and less sensitive optical devices.

[0135] Example 5 This example confirms that bead-bound RCP exhibits higher fluorescence intensity than the sum of blank magnetic beads (no bound RCP) and unbound RCP. RCP was generated and quantified as described in Example 3. For the exemplary calculation, blank magnetic beads (no bound RCP), RCP in solution, and bead-bound RCP were manually selected, and the maximum pixel intensity was obtained via ImageJ software. The sum of blank beads and RCP in solution is less than the fluorescence intensity observed with bead-bound RCP. This effect is illustrated by three fluorescence channels (Cy3, FITC, and Cy5).

[0136] The fluorescence intensity results can be seen in Figure 7. When Cy3 was used as the fluorescent label, the intensity of the signal from the beads alone was 494 and RCP alone was 1555, while the bead-bound RCP intensity was 2461, equating to a 20.1% increase in intensity compared to the sum of the beads and RCP alone.

[0137] When FITC was used as the fluorescent label, the intensity of the signal from beads alone was 472 and RCP alone was 1732, while the bead-bound RCP intensity was 3078, equivalent to a 39.7% increase in intensity compared to the sum of beads and RCP alone.

[0138] When Cy5 was used as the fluorescent label, the intensity of the signal from beads alone was 1985 and RCP alone was 2661, whereas the bead-bound-RCP intensity was 5233, a 12.6% increase in intensity compared to the sum of beads and RCP alone.

[0139] Example 6 This example demonstrates the improved RCP quantification capabilities of the described method compared to capturing RCPs on a membrane. An example is shown in FIG.

[0140] The membrane and beads were imaged using a 20x objective in different fluorescence channels using the same exposure time. The membrane was wetted with PBS and the beads were eluted in PBS. The fluorescence intensity was measured using ImageJ software to obtain the overall fluorescence intensity of the microscopic images.

[0141] For the comparison of RCP intensities in Figure 8B, RCP was generated as described in Example 3. Here, only FITC-labeled RCP is shown on the membrane and magnet, with the difference being most pronounced for the shorter wavelengths. The top left image shows FITC-labeled RCP on a nitrocellulose membrane, and the enlargement on the right shows that the RCP is not easily degraded due to its high autofluorescence. The bottom left image shows RCP from the same solution, but bound to beads and concentrated. As is evident from the enlargement on the bottom right, the FITC-labeled RCP can be easily degraded and quantified, showing the advantage of the magnetic concentration approach over the membrane one.

[0142] The membrane chip was manufactured by Aline, Inc. The filtration membrane was a Protran™ NC nitrocellulose membrane (GE Healthcare lifesciences) with a pore size of 0.1 μm, the absorbent layer was a cellulose fiber sample pad sheet (Merck), the spacing layer was a form of pressure-sensitive adhesive (Aline), and the liquid impermeable layer was polyethylene terephthalate (Aline). The sample receiving well had a diameter of 1.5 mm. The sample analysis device was manufactured to have 10 sample receiving wells aligned on the sample analysis device and have the dimensions of a standard microscope slide, 25 × 75 mm. The complete characteristics of this membrane chip are described in PCT / EP2020 / 060771 (published as WO2020 / 212531).

[0143] To image and concentrate RCPs on the membrane, 10 μL of sample solution was added to the sample receiving well. After the liquid had passed through the membrane, 10 μL of Slowfade Gold (Fisher Scientific) was added onto the membrane and a cover slip (Menzel) was placed on top.

[0144] The advantages of concentrating RCPs using the method of the present invention are: The bead-bound RCP can be washed, leading to lower background from assay or biological sample components. · Because the bead-bound RCP can be magnetically attracted to a small area that coincides with the field of view of the imaging device, sensitivity appears to increase per field of view when compared to spreading the solution on a glass slide. The possibility of spectral labeling in this method is increased because magnetic beads exhibit low autofluorescence when compared to membrane enrichment.

[0145] Example 7 This example confirms that bead-bound RCP exhibits higher fluorescence intensity than the sum of blank magnetic beads (without bound RCP) and bound RCP.

[0146] Human genomic DNA (Roche) was used to generate circular templates for the RCA reaction. Three different regions in genomic DNA were targeted: a region of the GAPDH gene, one region of the NRXN1 gene, and one region of the PLA3G6 gene. First, 1 μg of human genomic DNA was fragmented in a fragmentation mixture consisting of buffer (20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl2, 0.5 mM NAD, and 0.01% (v / v) Triton® X-100) and 2.5 U of AluI (New England Biolabs) in a total volume of 20 μL. The reaction was incubated at 37° C. for 15 minutes.

[0147] For ligation, 10 μL of ligation mix was added containing Tth ligase buffer (20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl2, 0.5 mM NAD, and 0.01% (v / v) Triton® X-100), 100 ng salmon sperm DNA (Thermo Fisher Scientific), 5 nM outer primer (ACACTATTA CTGAGG, SEQ ID NO: 12), 1 nM padlock probe (PO4-AATAAGGGTCCCGAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACAGAGAGTAGTACTTCCGACTACACCGTGACGAAGA, SEQ ID NO: 7), and 1.26 U of Tth DNA ligase. The ligation reaction was incubated at 98° C. for 10 min and 55° C. for 20 min.

[0148] The resulting circles were then amplified by RCA, for which the mixture contained 125 μM dNTPs, 4 U of exoI (New England Biolabs), and 5.32 U of phi29 DNA polymerase in a final volume of 35 μL. The RCA reaction was incubated at 37° C. for 2 h and 65° C. for 2 min.

[0149] Labeling and capture of RCP The resulting RCP was labeled using fluorescently and biotin-tagged oligonucleotides that are complementary to the repeats in the RCP. For this, the RCP product was incubated with 5 nM AlexaFluor488 (FITC)-(FITC-AGAGAGTAGTACTTCCGACT, SEQ ID NO: 13), biotin-tagged oligonucleotide (biotin-TTTTTCCTCAGTAATAGTGTCTTAC, SEQ ID NO: 4), and 0.025 μg / μL SuperMag streptavidin magnetic beads, 50 nm (Ocean Nano The beads were mixed with 10 μL of labeling buffer (10 mM Tris-HCl (pH 8.0), 10 mM ethylenediaminetetraacetic acid (EDTA), 0.05% (v / v) Tween 20, 120 mM NaCl, 10 mM MgCl2) containing 10 mM EDTA (Microelectronics Tech). The labeling reaction was incubated at 75° C. for 2 min and at 55° C. for 10 min. The SuperMag Streptavidin Magnetic Beads described above are superparamagnetic beads with a diameter of 50 nm that have a monolayer of recombinant streptavidin covalently bound to their surface, rather than a multilayer, and are further blocked with BSA.

[0150] Trapping RCP on beads and imaging RCP Labeled RCPs were captured and imaged as described in Example 1. The resulting images were analyzed using a custom-made pipeline in ImageJ software, which consisted of image enhancement, object identification using manual thresholding, and fluorescence intensity measurement for each object.

[0151] This example confirms the surprising increase in the fluorescence intensity of bead-bound RCP, which exceeds the sum of blank magnetic beads and unbound RCP. For the exemplary calculation, blank magnetic beads, RCP in solution, and bead-bound RCP were selected, and the maximum pixel intensity was obtained via ImageJ software. The sum of blank beads and RCP in solution is less than the fluorescence intensity observed for bead-bound RCP.

[0152] The fluorescence intensity results can be seen in Figure 12. Figure 12A shows the increased fluorescence intensity in multiple RCPs, and Figure 12B shows this synergistic effect in an exemplary case. When FITC was used as the fluorescent label, the exemplary intensity of the signal from beads alone was 1786, RCP alone was 2549, while the bead-bound RCP intensity was 5236, which equates to a 20.8% increase in intensity compared to the sum of beads and RCP alone.

[0153] Example 8 This example confirms that 50 nm magnetic beads show the best performance in terms of low autofluorescence background, enrichment capacity, and binding efficiency.

[0154] For comparison of the fluorescence intensity of blank beads, 0.025 μg / μL of TurboBeads Streptavidin (Turbobeads GmbH), 0.025 μg / μL of the aforementioned 50-200 nm SuperMag Streptavidin Magnetic Beads (Ocean NanoTech), 0.125 μg / μL of the aforementioned Dynabeads™ MyOne™ Streptavidin T1 (Thermo Fisher Scientific), and 0.125 μg / μL of Dynabeads™ M-270 Carboxylic Acid (Thermo Fisher Scientific) were prepared in Milli-Q water (Sigma-Aldrich). 10 μL of sample was prepared for and imaged on a microscope slide as described in Example 1, and quantified as described in Example 7. An exemplary image of bare nanoparticles is shown in FIG. 13, while nanoparticles with RCP (enriched) under a magnetic field are shown in FIG. 14.

[0155] When using the FITC channel, 30 nm beads were not visible, up to 200 nm beads, while 1 μm beads showed some autofluorescence and 2.8 μm beads showed high levels of autofluorescence intensity. The intensity of the signal from beads with diameters between 30 and 200 nm was approximately 1500 AU and indistinguishable from the background. For Dynabeads™ MyOne™ Streptavidin T1 with a diameter of 1 μm, the fluorescence intensity was 3108 AU, while for Dynabeads™ M-270 Carboxylic Acid with a size of 2.8 μm, the fluorescence intensity was even higher at 7451 AU. These results are shown in Figure 13 with exemplary images.

[0156] To further evaluate the beads in terms of optical behavior and RCP capture and enrichment efficiency, in FIG. 14, beads were decorated with RCPs and enriched under a magnetic field, where 30 nm Turbobeads show high levels of autofluorescence and aggregation at an intensity level of approximately 6748 AU, which does not allow quantification of RCPs. For 50 nm beads, the number of RCPs in a single field of view is the highest compared to 100 nm, 200 nm, and 1 μm beads. Additionally, 1 μm beads start to form mosaic-like structures when under magnetic force, increasing the overall background intensity (noise) and making image analysis of events more difficult. This indicates that the ideal bead size for the beads shown is 30 nm to 100 nm, which is a counter-intuitive result, since large particles (several μm to mm) are often used to capture long polynucleotide sequences, for example in genome extraction kits.

Claims

1. 1. A method for analyzing a sample containing a plurality of polynucleotides and / or oligonucleotides of interest, said method comprising: (i) providing a sample solution containing a plurality of polynucleotides and / or oligonucleotides of interest; (ii) binding said polynucleotides / oligonucleotides to magnetic beads to provide bead-bound polynucleotides / oligonucleotides, thereby providing a further sample solution; (iii) applying the further sample solution to a first surface of the sample support element; (iv) providing a magnetic source to attract (e.g., attract) the bead-bound polynucleotides / oligonucleotides to a location on the first surface of the sample support element.

2. The method of claim 1, wherein the magnetic beads have an average size of about 10 nm to about 5 μm, such as about 10 nm to about 2 μm, such as about 500 nm to about 2 μm.

3. The method of claim 2, wherein the magnetic beads have an average size of about 30 nm to about 200 nm.

4. The method of any one of claims 1 to 3, wherein the magnetic beads are superparamagnetic beads, optionally comprising iron, nickel, cobalt, or mixtures thereof.

5. 10. The method of claim 1, wherein the plurality of polynucleotides / oligonucleotides are bound to the magnetic beads via adsorption or conjugation, or a combination thereof.

6. 10. The method of claim 1, wherein the magnetic beads comprise a surface coating configured for conjugation to the polynucleotide / oligonucleotide directly or indirectly (e.g., via a complementary capture oligonucleotide).

7. 7. The method of claim 6, wherein the surface coating comprises a reactive group for conjugating to the polynucleotide / oligonucleotide, optionally the reactive group is selected from the group consisting of a carbodiimide (e.g., 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)), an amine (e.g., an alkylamine), a succinimide (such as an N-hydroxysuccinimide ester), an imidate (e.g., an imidoester), an imide (e.g., a maleimide), a haloacetyl, a disulfide (e.g., a pyridyl disulfide), a hydrazine, a diazirine, or an azide (such as an aryl azide), an avidin (e.g., streptavidin and neutravidin), a biotin, a carboxyl, a thiol, an alkyne, and mixtures thereof.

8. The method of claim 6 or 7, wherein the plurality of polynucleotides / oligonucleotides comprises a compound for conjugating to the surface coating of the magnetic beads.

9. 9. The method of claim 8, wherein the compound for conjugating to the surface coating of the magnetic beads comprises a reactive group selected from the group consisting of carbodiimides (e.g., 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)), amines (e.g., alkylamines), succinimides (such as N-hydroxysuccinimide esters), imidates (e.g., imidoesters), imides (e.g., maleimides), haloacetyls, disulfides (e.g., pyridyl disulfides), hydrazines, diazirines, or azides (such as aryl azides), avidin (e.g., streptavidin and neutravidin), biotin, carboxyls, alkynes, thiols, and mixtures thereof.

10. 2. The method of claim 1, wherein the magnetic source attracts the bead-bound polynucleotides / oligonucleotides to a location on the first surface of the sample support element that is equal to or smaller than the field of view of an optical sensing device.

11. 10. The method of claim 1, wherein the plurality of polynucleotides / oligonucleotides are rolling circle amplification products or padlock probes.

12. 12. The method of claim 11, wherein the plurality of polynucleotides / oligonucleotides is prepared by a rolling circle amplification step or a hybridization chain reaction step.

13. A sample analysis device according to the second aspect of the invention for use in the method of the invention, comprising: a sample support element including a plurality of wells for receiving a sample solution; A sample analysis device comprising: a base element including a plurality of magnetic sources, the base element adapted to allow the sample support element to be placed on top of the base element, the plurality of magnetic sources spatially configured to generate the magnetic field such that a focal point of the magnetic field is provided toward the center of the bottom of each well in the sample support element.

14. A sample analysis device comprising a sample support element having a first and second surface, a magnetic source attached to the second surface of the sample analysis device.

15. 15. The sample analysis device of claim 14, wherein the size of the magnetic source is comparable to or smaller than the field of view of an optical sensing device.

16. 16. The sample analysis device of claim 14 or 15, wherein the first surface of the sample support element forms the bottom of a sample receiving well for receiving a sample solution.

17. 17. The sample analysis device of claim 16, wherein the sample receiving well includes an opening for introducing a sample solution into the sample receiving well.

18. A kit of parts, i) a container or containers containing rolling circle amplification and / or hybridization chain reaction reagents; ii) a vessel containing magnetic beads; iii) a sample analysis device according to claim 13 or 14. A kit of parts comprising:

19. A kit of parts, i) a container or containers containing rolling circle amplification and / or hybridization chain reaction reagents; ii) a vessel containing magnetic beads; iii) instructions for using said kit in the method of claim 1.