Transgenic mammals and methods of use thereof
Patent Information
- Application Number
- JP2024527321
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-11-10
- Filing Date
- 2022-11-09
- Publication Date
- 2025-11-17
AI Technical Summary
Current methods for producing monoclonal antibodies in mice for use in cats are inefficient due to the need for amino acid sequence changes to prevent harmful immune responses, and there is a lack of effective methods for generating feline-specific antibodies in non-feline mammals.
The production of transgenic mammals with heterologous feline immunoglobulin loci, specifically incorporating feline immunoglobulin variable region genes into non-feline mammalian hosts using recombinase-mediated cassette exchange (RMCE) to create chimeric B cells capable of producing feline monoclonal antibodies.
This method allows for the efficient production of feline-specific monoclonal antibodies in non-feline mammals, overcoming immune response issues and enabling their use for therapeutic and diagnostic applications in cats.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to the production of immunoglobulin molecules and includes methods for generating transgenic mammals capable of producing antigen-specific antibody-secreting cells for the generation of feline monoclonal antibodies. [Background technology]
[0002] In the following discussion, certain articles and methods are described for background and introductory purposes. Nothing contained herein should be construed as an "admission" of prior art. Applicant expressly reserves the right to demonstrate, where appropriate, that the articles and methods referred to herein do not constitute prior art under applicable statutory provisions.
[0003] Antibodies have emerged as important biological medicines because (i) they exhibit exquisite binding properties that allow them to target antigens in diverse molecular forms, (ii) they are physiological molecules that are well tolerated and exhibit favorable pharmacokinetics in treated humans and animals, and (iii) they possess potent immunological properties that allow them to naturally eliminate infectious agents. Furthermore, established techniques exist for the rapid isolation of antibodies from laboratory animals, and specific antibody responses can be easily generated against virtually any foreign substance not naturally present in the body.
[0004] In their most basic form, antibodies contain two identical heavy (H) chains, each paired with an identical light (L) chain. Both the H and L chains contain variable domains (V H and V L ) that confers unique antigen-binding specificity to the paired HL chain.
[0005] Antibody V H Area and V L The exons encoding these regions are not present in germline DNA. Instead, each V H The exons are randomly selected V sequences present in the immunoglobulin heavy chain locus. H , D H , and J.H It is generated by genetic rearrangement of gene segments. Similarly, each V L The exons are randomly selected V sequences present in the light chain locus. L and J L They are produced by chromosomal rearrangements of gene segments.
[0006] Mammals typically contain two alleles expressing heavy chains, two alleles expressing kappa (κ) light chains, and two alleles expressing lambda (λ) light chains (one allele from each parent). The immunoglobulin heavy chain locus contains multiple V H , D H , and J. H There are multiple V gene segments in the immunoglobulin kappa (IGK) and immunoglobulin lambda (IGL) light chain loci. L and J. L There are gene segments (Collins and Watson (2018) Immunoglobulin Light Chain Gene Rearrangements, Receptor Editing and the Development of a Self-Tolerant Antibody Repertoire. Front. Immunol. 9:2249. (doi: 10.3389 / fimmu.2018.02249)).
[0007] The heavy chain locus also contains exons for the expression of different antibody classes (isotypes). For example, in felines, the encoded isotypes are IgM, IgD, IgG1a, IgG2, IgE, and IgA2.
[0008] During B cell development, gene rearrangement occurs first on one of the two homologous chromosomes containing the heavy chain variable gene segment. In pre-B cells, the resulting V H The exon then undergoes C at the RNA level for IgM H chain (μH chain) expression. μThe majority of μ heavy chains synthesized by pre-B cells are retained in the endoplasmic reticulum (ER), and the partially unfolded C H The μ heavy chain is ultimately degraded through noncovalent interactions between its 1 domain and the endoplasmic reticulum-resident chaperone BiP (Haas and Wabl, Nature, 306:387-9, 1983; Bole et al., J Cell Biol. 102:1558, 1986). However, a small proportion of the μ heavy chain associates with an alternative light chain complex containing the invariant λ5 and VpreB proteins. This association displaces BiP, allowing the μ heavy chain / λ5 / VpreB complex to exit the ER and be transported via the secretory pathway to the plasma membrane as the pre-B cell receptor (preBCR) along with the Igα / β signaling molecule heterodimer.
[0009] Thereafter, V L -J L Rearrangement of the L chain allele occurs simultaneously, and the L chain polypeptide then associates with an IgM H chain homodimer to form a fully functional, antigen-specific B cell receptor (BCR), which is expressed on the surface of immature B cells.
[0010] Immature B cells migrate to secondary lymphoid organs, where they differentiate into mature B cells capable of responding to cognate antigens, antibody-secreting plasma cells, and memory B cells. With the help of T cells, B cells can change their antibody isotype from IgM to IgG, IgA, or IgE by isotype switching, or by V cell recombination. H Area and V L These mutations can occur in somatic hypermutations that alter the amino acid sequence of the V H and V L B cells with high affinity for the immunizing antigen, despite randomly introduced exons, are preferentially activated because they are better able to take up, process, and present the antigen to T follicular helper cells than B cells with low or no affinity for the antigen. As a result, somatic hypermutation becomes concentrated in complementarity-determining regions (CDRs) 1, 2, and 3, which are the V domains that interact with the antigen.H Area and V L Because it is a realm of realms.
[0011] The genes encoding various mouse immunoglobulins have been extensively characterized. For example, Blankenstein and Krawinkel described the mouse variable heavy chain region in Eur. J. Immunol., 17:1351-1357 (1987). Information on the feline immunoglobulin heavy chain locus is scarce, but studies of lymphoid malignancies and responses to viruses have shown that V H Several regional sequences have been included [e.g., Rout et al., Vet. Clin. Pat. 45:48 Suppl. 1 (2019) and Lu et al., Scientific Reports 7:12713 (2017)]. Lu et al. also characterized the sequences of feline IgG1a, IgG2, and IgA. The feline kappa and lambda LC loci have been extensively characterized and are fully annotated in the IMGT (International ImMunoGeneTics) information system.
[0012] The generation of transgenic animals, such as mice, with altered immunoglobulin loci has enabled the use of such transgenic animals in a variety of research and development applications, such as drug discovery and basic research in various biological systems. For example, the generation of transgenic mice with human immunoglobulin genes is described in International Application Nos. WO 90 / 10077 and WO 90 / 04036. WO 90 / 04036 describes transgenic mice incorporating human immunoglobulin "mini" loci. WO 90 / 10077 describes vectors containing an immunoglobulin dominant control region for use in generating transgenic animals.
[0013] Numerous methods have been developed to modify endogenous immunoglobulin variable region loci in mice, e.g., with human immunoglobulin sequences, to generate partially or fully human antibodies for drug discovery purposes. Examples of such mice include those described in, e.g., U.S. Patents 7,145,056; 7,064,244; 7,041,871; 6,673,986; 6,596,541; 6,570,061; 6,162,963; 6,130,364; 6,091,001; 6,023,010; 5,593,598; 5,877,397; 5,874,299; 5,814,318; 5,789,650; 5,661,016; 5,612,205; and 5,591,669.
[0014] The use of antibodies as medicines is not limited to the prevention or treatment of human diseases. Domestic animals, such as cats, suffer from diseases similar to those in humans, such as cancer, atopic dermatitis, and chronic pain. A monoclonal antibody targeting nerve growth factor (Bedinvetmab) is already in veterinary use for the treatment of osteoarthritis in cats, but it has not yet been approved for the treatment of cancer or atopic dermatitis. However, before clinical use, the mouse-produced monoclonal antibody had to be felinized; that is, the amino acid sequence had to be changed from mouse to feline to prevent adverse immune reactions in the recipient cat. Summary of the Invention
[0015] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended for use in limiting the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will become apparent from the following Detailed Description, including aspects illustrated in the accompanying drawings and defined in the appended claims.
[0016] This specification describes a method for producing a murine antibody having a feline immunoglobulin variable region. In one embodiment, an antibody having a feline variable region is provided that can be produced in a transgenic mammal or in in vitro cell culture.
[0017] In one embodiment, a non-feline mammalian cell or mammal is provided, the genome of which comprises a heterologous partly feline immunoglobulin locus. In one embodiment, the heterologous locus comprises coding sequences of feline immunoglobulin variable region genes and non-coding sequences based on the endogenous immunoglobulin variable region locus of the non-feline mammalian host. In one embodiment, the non-feline mammalian cell or mammal is capable of expressing a chimeric B cell receptor (BCR) or antibody comprising feline heavy (H) and light (L) chain variable regions and a constant region endogenous to the non-feline mammalian host cell or mammal. In one embodiment, the transgenic mammalian host cell or mammal has a genome in which some or all of the endogenous immunoglobulin variable region locus has been deleted.
[0018] To produce chimeric feline monoclonal antibodies in a non-feline mammalian host, the host genome must have at least one locus that expresses a chimeric feline immunoglobulin heavy or light chain. In one embodiment, the host genome contains one heavy chain locus and two light chain loci that express chimeric feline immunoglobulin heavy and light chains, respectively.
[0019] In some embodiments, the partial feline immunoglobulin locus is a feline V H Coding sequences and endogenous V in non-feline mammalian hosts H In some embodiments, the partial feline immunoglobulin locus comprises a feline V H coding sequences, and endogenous V of non-feline mammalian hosts H In one embodiment, the partial feline immunoglobulin locus comprises a cat D Hand J. H Gene segment coding sequences, as well as endogenous D of the non-feline mammalian host cell genome H and J. H In one embodiment, the partial feline immunoglobulin locus comprises a gene segment containing non-coding sequences. H and J. H Gene segment coding sequences, as well as endogenous D of the non-feline mammalian host cell genome H and J. H This includes non-coding regulatory sequences or scaffold sequences present in gene segments.
[0020] In other embodiments, the partial feline immunoglobulin locus is a feline V L Coding sequences and endogenous V in non-feline mammalian hosts L In other embodiments, the partial feline immunoglobulin locus comprises a feline V L Coding sequences and endogenous V in non-feline mammalian hosts L In one embodiment, the heterologous partial feline immunoglobulin locus comprises a feline V L Coding sequence and cat J L Gene segment coding sequences, as well as endogenous J sequences of the non-feline mammalian host cell genome. L and non-coding sequences present in gene segments. In one embodiment, the heterologous partial feline immunoglobulin locus is a feline V L Coding sequence and cat J L Gene segment coding sequences, as well as endogenous J sequences of the non-feline mammalian host cell genome. L This includes non-coding regulatory sequences or scaffold sequences present in gene segments.
[0021] In one embodiment, the non-feline mammal is a rodent, such as a mouse or a rat.
[0022] In one embodiment, a method for generating a non-feline mammalian cell containing a partial feline immunoglobulin locus is provided. In one embodiment, the method comprises: a) introducing two or more recombinase target sites into the genome of a non-feline mammalian host cell to target an endogenous immunoglobulin V gene. H Gene, D H Gene, and J H Gene, or endogenous V L Gene and J L b) integration of at least one site upstream and at least one site downstream of the genomic region containing the gene into a non-feline mammalian host cell via recombinase-mediated cassette exchange (RMCE). H , D H , and J. H Gene, or Cat V L and J. L Introducing a heterologous partial feline immunoglobulin variable region locus comprising coding sequences of a gene and non-coding sequences based on non-coding sequences present in an endogenous immunoglobulin variable region locus of a non-feline mammalian host.
[0023] In another embodiment, the method comprises deleting an endogenous immunoglobulin variable region in the genome of the host animal that is flanked by two heterologous recombinase target sites prior to introducing the heterologous partial feline immunoglobulin variable locus into the non-feline mammalian host cell via RMCE.
[0024] In one embodiment, the heterologous partial feline immunoglobulin locus is a feline V H Gene segment coding sequence, cat D H and J. H Gene segment coding sequences and endogenous D in the genome of non-feline mammalian hosts H Cat D based on sequences present upstream of the gene segment HThe gene segment includes a non-coding regulatory sequence or scaffold sequence (Pre-D sequence, FIG. 1) upstream of the gene segment. In one embodiment, the upstream scaffold sequence includes a non-immunoglobulin gene, such as Adam6a (FIG. 1), which is involved in male fertility [Nishimura et al., Developmental Biol. 233(1): 204-213 (2011)]. In one embodiment, the partial feline immunoglobulin locus is located on the same chromosome as the endogenous immunoglobulin V gene. H Upstream and endogenous J loci H It is introduced into host cells using a recombinase target site previously introduced downstream of the gene locus.
[0025] In one embodiment, the scaffold sequence comprises a naturally occurring nucleic acid sequence from another biological species. In one embodiment, the scaffold sequence can be designed based on a naturally occurring nucleic acid sequence from another biological species, for example, the scaffold sequence can comprise a naturally occurring nucleic acid sequence from another biological species that has been modified, for example, by one or more nucleic acid substitutions, insertions, deletions, or other modifications. In one embodiment, the scaffold sequence can comprise an artificial sequence. In one embodiment, the scaffold sequence comprises a combination of a sequence present in the immunoglobulin locus of the feline genome and another sequence, for example, a scaffold sequence from another species.
[0026] In another embodiment, the heterologous partial feline immunoglobulin locus is feline immunoglobulin V L Gene segment coding sequence, cat J L The heterologous partial feline immunoglobulin locus comprises a gene segment coding sequence and a non-coding sequence based on the non-coding sequence present in the endogenous L chain locus of the non-feline mammalian host cell genome. In one embodiment, the non-coding sequence comprises a regulatory sequence or a scaffold sequence. In one embodiment, the heterologous partial feline immunoglobulin locus is based on the endogenous immunoglobulin V locus on the same chromosome. L Upstream and endogenous J loci L It is introduced into host cells using a recombinase target site previously introduced downstream of the gene locus.
[0027] In one embodiment, the heterologous partial feline immunoglobulin locus is synthesized as a single nucleic acid and introduced into the non-feline mammalian host cell as a single nucleic acid region. The heterologous partial feline immunoglobulin locus may also be synthesized in two or more contiguous segments and introduced into the mammalian host cell as separate segments. The heterologous partial feline immunoglobulin locus may also be produced using recombinant methods and isolated prior to introduction into the non-feline mammalian host cell. In one embodiment, a partial feline immunoglobulin heavy chain variable region locus can be generated in silico as follows: The genomic sequence of the mouse heavy chain immunoglobulin locus is cloned into the feline V H , D H , and J. H The coding sequence, as well as the sequence of the coding sequence, can be obtained, for example, from the National Center for Biotechnology Information or the International ImMunoGeneTics (IMGT) information system. H , D H , and J. H The coding sequence can be analyzed using commercially available software, for example, H , D H , and J. H Advantageously, V H , D, and J H Coding sequences can be replaced, leaving the intervening murine non-coding sequences intact. Similarly, a partial feline immunoglobulin light chain variable region locus can be generated in silico as follows: the genomic sequence of the mouse light chain immunoglobulin locus, as well as the feline V L and J. L Coding sequences are obtained, for example, from the National Center for Biotechnology Information or the International ImMunoGeneTics (IMGT) information system. L and J. L The coding sequence can be analyzed using commercially available software, for example, L and J. LThe coding sequence is replaced in silico. L and J L The coding sequence of the mouse can be replaced, leaving the intervening non-coding sequences intact. Methods are known for synthesizing DNA sequences containing partial feline immunoglobulin loci based on in silico sequences.
[0028] In another embodiment, a method for generating a non-feline mammalian cell comprising a heterologous partial feline immunoglobulin locus is provided. In one embodiment, the method comprises: a) introducing into the genome of the non-feline mammalian host cell two or more sequence-specific recombination sites that are unable to recombine with each other, wherein at least one recombination site is introduced upstream of an endogenous immunoglobulin variable region locus and at least one recombination site is introduced downstream of the same endogenous immunoglobulin variable region locus; b) generating a heterologous partial feline immunoglobulin locus having i) a feline immunoglobulin variable region gene coding sequence, and ii) a non-coding regulatory sequence or scaffold sequence based on the endogenous immunoglobulin variable region locus of the host cell genome. providing a vector comprising a heterologous partial feline immunoglobulin locus, wherein the partial feline immunoglobulin locus is flanked by the same two sequence-specific recombination sites that flank the host cell's endogenous immunoglobulin variable region locus; c) introducing into the host cell the vector of step b) and a site-specific recombinase capable of recognizing the two recombination sites; d) causing a recombination event to occur between the genome of the cell and the heterologous partial feline immunoglobulin locus, resulting in replacement of the endogenous immunoglobulin variable region locus with the heterologous partial feline immunoglobulin variable region locus. In one embodiment, the partial feline immunoglobulin locus is a feline V H Immunoglobulin gene segment coding sequences, and i) cat D H and J. H gene segment coding sequences, ii) each V endogenously present in the genome of the non-feline mammalian host H , D H , and J. Hand iii) a pre-D sequence based on the endogenous genome of the non-feline mammalian host cell. In one embodiment, the recombinase target site is an endogenous immunoglobulin V H Upstream and endogenous J loci H It is introduced downstream of the gene locus.
[0029] In one embodiment, a transgenic rodent is provided having a genome in which the rodent's endogenous immunoglobulin variable locus has been deleted and replaced with a heterologous partial feline immunoglobulin locus comprising feline immunoglobulin variable gene coding sequences and non-coding regulatory or scaffold sequences based on the rodent's endogenous immunoglobulin variable locus. In one embodiment, the heterologous partial feline immunoglobulin locus of the transgenic rodent is functional and expresses immunoglobulin chains comprising feline variable domain regions and rodent constant domains. In one embodiment, the heterologous partial feline immunoglobulin locus comprises a feline V H , D H , and J. H In one embodiment, the heterologous partial feline immunoglobulin locus comprises a feline V L and J. L In one embodiment, the heterologous partial feline immunoglobulin locus comprises a feline kappa (κ) V coding sequence. L and J. L In one embodiment, the heterologous partial feline immunoglobulin locus comprises a cat lambda (λ)V L and J. LIn one embodiment, a B lymphocyte lineage cell derived from a transgenic rodent is provided. In one embodiment, a portion or all of an immunoglobulin molecule is provided comprising a feline variable domain and a rodent constant domain sequence obtained from a B lymphocyte lineage cell. In one embodiment, a hybridoma cell derived from a B lymphocyte lineage cell is provided. In one embodiment, a portion or all of an immunoglobulin molecule is provided comprising a feline variable domain and a rodent constant domain from a hybridoma cell. In one embodiment, an immortalized cell derived from a B lymphocyte lineage cell is provided. In one embodiment, a portion or all of an immunoglobulin molecule is provided comprising a feline variable domain and a rodent constant domain from an immortalized cell. In one embodiment, a transgenic rodent is provided, wherein the heterologous partial feline immunoglobulin locus is a feline V L and J. L In one embodiment, a transgenic rodent is provided, wherein the heterologous partial feline immunoglobulin locus comprises a feline V H , D H , and J. H In one embodiment, the heterologous partial feline immunoglobulin locus comprises a feline kappa (κ) V coding sequence. L and J. L In one embodiment, the heterologous partial feline immunoglobulin locus comprises a cat lambda (λ)V L and J. L In one embodiment, the heterologous partial feline immunoglobulin locus further comprises one or more of the following sequences of the endogenous host: a promoter preceding each V gene segment, a splice site, and a recombination signal sequence for V(D)J gene rearrangement. In one embodiment, the heterologous partial feline immunoglobulin locus further comprises one or more of the following sequences of the endogenous host: an ADAM6 gene, a Pax-5-activating intergenic repeat (PAIR) element, and a CTCF binding site from the heavy chain intergenic control region 1 (IGCR1).
[0030] In one embodiment, the non-feline cell is a mammalian cell. In one embodiment, the non-feline mammalian cell is a mammalian embryonic stem (ES) cell.
[0031] In one embodiment, non-feline mammalian cells in which endogenous immunoglobulin variable region loci have been replaced with heterologous partial feline immunoglobulin variable region loci are selected and isolated. In one embodiment, the cells are non-feline mammalian ES cells, such as rodent ES cells. In one embodiment, at least one isolated non-feline mammalian cell is used to create a transgenic non-feline mammal that expresses the heterologous partial feline immunoglobulin variable region loci. In one embodiment, at least one isolated non-feline mammalian ES cell is used to create a transgenic non-feline mammal that expresses the heterologous partial feline immunoglobulin variable region loci.
[0032] In one embodiment, a method of generating a transgenic rodent is provided. In one embodiment, the method comprises: a) incorporating into the genome of a rodent cell at least one target site for a site-specific recombinase upstream of an endogenous immunoglobulin variable locus and at least one target site for a site-specific recombinase downstream of the endogenous immunoglobulin variable locus. In one embodiment, the endogenous immunoglobulin variable locus is a V H , D H , and J. HThe endogenous immunoglobulin variable locus comprises a Vκ and a Jκ gene segment. In one embodiment, the endogenous immunoglobulin variable locus comprises a Vλ and a Jλ gene segment. In one embodiment, the endogenous immunoglobulin variable locus comprises a Vλ, a Jλ gene segment, and a Cλ gene. In one embodiment, the method comprises: b) providing a vector comprising a heterologous partial feline immunoglobulin locus. In one embodiment, the heterologous partial feline immunoglobulin locus comprises chimeric feline immunoglobulin gene segments. In one embodiment, each of the partial feline immunoglobulin gene segments comprises a feline immunoglobulin variable gene coding sequence and a rodent non-coding regulatory sequence or scaffold sequence. In one embodiment, the partial feline immunoglobulin variable locus is flanked by target sites for a site-specific recombinase. In one embodiment, the target sites are capable of recombining with target sites introduced into a rodent cell. In one embodiment, the method includes: c) introducing into a rodent cell a vector and a site-specific recombinase capable of recognizing the target site. In one embodiment, the method includes: d) causing a recombination event to occur between the genome of the cell and the heterologous partial feline immunoglobulin locus, such that the endogenous immunoglobulin variable locus is replaced with the heterologous partial feline immunoglobulin locus. In one embodiment, the method includes: e) selecting cells comprising the heterologous partial feline immunoglobulin variable locus produced in step d); and using the cells to create a transgenic rodent comprising the heterologous partial feline immunoglobulin variable locus. In one embodiment, the cell is a rodent embryonic stem cell (ES cell). In one embodiment, the cell is a mouse embryonic stem (ES) cell.
[0033] In one embodiment, the method further comprises, after step a) and before step b), deleting the endogenous immunoglobulin variable locus by introducing a recombinase that recognizes a first set of target sites, wherein the deleting step leaves in place at least one set of target sites that cannot recombine with each other in the genome of the rodent cell. H , D H , and J. H In one embodiment, the vector comprises a coding sequence for L and J. L In one embodiment, the heterologous partial feline immunoglobulin locus comprises a feline kappa (κ) V coding sequence. L and J. L In one embodiment, the heterologous partial feline immunoglobulin locus comprises a lambda (λ)V L and J. L In one embodiment, the vector further comprises one or more of a promoter, splice sites, and recombination signal sequences.
[0034] In one embodiment, a method for generating a transgenic non-feline mammal comprising a heterologous partial feline immunoglobulin variable region locus is provided. In one embodiment, the method comprises: a) introducing into the genome of a non-feline mammalian host cell one or more sequence-specific recombination sites that flank the endogenous immunoglobulin variable region locus and are unable to recombine with each other. In one embodiment, the method comprises: b) providing a vector comprising a partial feline immunoglobulin locus, the vector comprising: i) a feline variable region gene coding sequence; and ii) a non-coding regulatory or scaffold sequence based on the endogenous host immunoglobulin variable region locus. In one embodiment, the coding sequence and the non-coding regulatory or scaffold sequence are flanked by the same sequence-specific recombination sites introduced into the genome of the host cell in a). In one embodiment, the method comprises: c) introducing into the cell the vector of step b) and a site-specific recombinase capable of recognizing the set of recombinase sites. In one embodiment, the method comprises: d) allowing a recombination event to occur between the genome of the cell of a) and the heterologous partial feline immunoglobulin variable region locus. In one embodiment, the endogenous immunoglobulin variable region loci are replaced with partial feline immunoglobulin loci. In one embodiment, the method comprises: e) selecting cells containing partial feline immunoglobulin loci; and f) using the cells to create a transgenic mammal containing the partial feline immunoglobulin loci.
[0035] In one embodiment, the transgenic non-feline mammal is a rodent, such as a mouse or a rat.
[0036] In one embodiment, at least 10 3 An immunoglobulin library (also called a repertoire) is provided that contains a diverse set of library members.
[0037] In one embodiment, an antibody repertoire is provided that includes the partial feline antibodies described herein. In one embodiment, the repertoire includes a variety of antibodies that each specifically recognize the same target antigen. Such a repertoire can be referred to as an antibody library of the same antibody type or structure, where the antibodies have different antigen-binding sites, e.g., to generate antibody variants of a parent antibody that recognizes the same epitope. In one embodiment, the antibody library includes antibody variants that have been affinity matured or otherwise optimized. In one embodiment, the antibody library includes antibodies that specifically recognize a target antigen but specifically recognize different epitopes of that antigen.
[0038] In one embodiment, an antibody repertoire is screened and individual library members are selected according to desired structural or functional properties, eg, to produce an antibody product.
[0039] In one embodiment, a repertoire of antibodies is provided that includes the partial feline antibodies described herein. In one embodiment, the repertoire includes a variety of antibodies that recognize different target antigens. In one embodiment, the repertoire is obtained by immunizing a non-feline mammal with a multi-component antigen, which can have many different target antigens, including but not limited to viruses and bacteria, and each antigen can include multiple epitopes.
[0040] In one embodiment, the repertoire is a naive library of antibodies, also referred to as a "pre-immune repertoire." In one embodiment, the pre-immune repertoire is expressed by mature, antigen-naive B cells that have recently emerged from the bone marrow.
[0041] In one embodiment, the antibody repertoire comprises at least about 10 antibodies, each characterized by a different antigen binding site. 3 antibodies, e.g., at least about 10 4 , about 10 5 , about 10 6 、 or about 107 It can be characterized by a diversity that encompasses:
[0042] In one embodiment, a non-feline mammalian cell is provided that expresses a heterologous immunoglobulin variable region locus having a feline variable region gene coding sequence and a non-coding regulatory or scaffold sequence based on an endogenous non-feline immunoglobulin locus of the host genome, hi one embodiment, the non-feline mammalian cell expresses a chimeric antibody comprising a complete feline heavy or light chain variable domain combined with a respective constant region endogenous to the non-feline mammalian cell or mammal.
[0043] In one embodiment, a non-feline transgenic mammal is provided that expresses a heterologous immunoglobulin variable region locus having feline variable region gene coding sequences and non-coding regulatory or scaffold sequences based on an endogenous non-feline immunoglobulin locus of the host genome. In one embodiment, the non-feline transgenic mammal expresses a chimeric antibody comprising a complete feline heavy or light chain variable domain combined with a respective constant region endogenous to the non-feline mammalian cell or mammal.
[0044] In one embodiment, B cells from a transgenic non-feline mammal are provided that are capable of expressing partial feline antibodies with complete feline variable sequences. In one embodiment, immortalized B cells are provided as a source of monoclonal antibodies specific for a particular antigen.
[0045] In one embodiment, feline immunoglobulin variable region gene sequences cloned from B cells are provided for use in the production or optimization of diagnostic, prophylactic, and therapeutic antibodies.
[0046] In one embodiment, non-feline hybridoma cells capable of producing partial feline monoclonal antibodies having complete feline immunoglobulin variable region sequences are provided.
[0047] In one embodiment, V encoding heavy and light chain immunoglobulin variable domains from a monoclonal antibody-producing hybridoma areH and V L Remove exon V H and V L The exons are modified to include feline constant regions, thereby providing a method for producing fully feline antibodies that are not immunogenic when injected into cats.
[0048] In one embodiment, a method for producing a therapeutic or diagnostic feline antibody is provided. In one embodiment, the method comprises: (i) The endogenous rodent immunoglobulin locus variable region is deleted, resulting in a chimeric V at the immunoglobulin heavy chain locus. H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V in the immunoglobulin light chain locus L and J. L expressing antibodies having cloned feline variable domains from antibody-producing cells of a transgenic rodent having its genome replaced with a heterologous immunoglobulin locus variable region comprising at least one of each of the variable gene segments, wherein each chimeric gene segment comprises a feline V, D, or J immunoglobulin variable region coding sequence and a rodent immunoglobulin variable region non-coding gene segment sequence; and (ii) Isolating antibodies with feline variable domains that are suitable for therapeutic or diagnostic use.
[0049] In one embodiment, the antibody is cloned from a B cell of a transgenic rodent. In one embodiment, the rodent is a mouse. In one embodiment, a therapeutic or diagnostic antibody produced by the methods described herein is provided.
[0050] In one embodiment, a method for producing a therapeutic or diagnostic antibody having a feline variable domain is provided. In one embodiment, the method comprises: (i) The endogenous rodent immunoglobulin locus variable region is deleted, resulting in a chimeric V at the immunoglobulin heavy chain locus.H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V in the immunoglobulin light chain locus L and J. L cloning the feline variable domains of antibodies expressed by antibody-producing cells from a transgenic rodent having its genome replaced with a heterologous immunoglobulin locus variable region comprising at least one of each of the variable region gene segments, wherein each chimeric gene segment comprises a feline V, D, or J immunoglobulin variable region coding sequence and a rodent immunoglobulin variable region non-coding gene segment sequence; and (ii) Producing therapeutic or diagnostic antibodies comprising the feline variable domains of the antibodies expressed by the transgenic rodent.
[0051] In one embodiment, the feline variable domain is cloned from an antibody expressed by a B cell of a transgenic rodent. In one embodiment, the rodent is a mouse. In one embodiment, a therapeutic or diagnostic antibody produced by the methods described herein is provided.
[0052] In one embodiment, a method for producing a monoclonal antibody comprising a feline variable domain is provided. In one embodiment, the method comprises: (i) The endogenous rodent immunoglobulin locus variable region is deleted, resulting in a chimeric V at the immunoglobulin heavy chain locus. H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V in the immunoglobulin light chain locus L and J. Lproviding B cells from a transgenic rodent having a genome replaced with a xenogeneic immunoglobulin locus variable region comprising at least one of each of the variable gene segments, wherein each chimeric gene segment comprises a feline V, D, or J immunoglobulin variable region coding sequence embedded in a rodent immunoglobulin variable region non-coding gene segment sequence; (ii) immortalizing B cells; and (iii) isolating a monoclonal antibody containing a feline variable domain expressed by the immortalized B cells, or a gene encoding the antibody.
[0053] In one embodiment, the method comprises the steps of: (iv) cloning the feline variable domains expressed by B cells; and (v) Producing therapeutic or diagnostic antibodies containing cloned feline variable domains from B cells of the transgenic rodent.
[0054] In one embodiment, a method for producing an antibody comprising a feline variable domain is provided, wherein the endogenous rodent immunoglobulin locus variable region is deleted and a chimeric V at the immunoglobulin heavy chain locus is generated. H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V in the immunoglobulin light chain locus L and J. L providing a transgenic rodent having its genome replaced with a xenogenous immunoglobulin locus variable region comprising at least one of each of the variable gene segments, wherein each chimeric gene segment comprises a feline V, D, or J immunoglobulin variable region coding sequence embedded in a rodent immunoglobulin variable region non-coding gene segment sequence, and wherein the xenogenous immunoglobulin locus of the transgenic rodent expresses antibodies comprising the feline variable domains.
[0055] In one embodiment, the method includes isolating an antibody having a feline variable region expressed by a transgenic rodent or a gene encoding the antibody. In one embodiment, the method includes: (i) obtaining B cells from the transgenic rodent that express an antibody specific to a target antigen; (ii) immortalizing the B cells; and (iii) isolating an antibody specific to the target antigen from the immortalized B cells.
[0056] In one embodiment, the method comprises cloning a feline variable region from a B cell specific for a particular antigen. In one embodiment, the rodent is a mouse. In one embodiment, the method comprises producing a therapeutic or diagnostic antibody using the feline variable region cloned from the B cell. In one embodiment, a therapeutic or diagnostic antibody produced by the method described herein is provided.
[0057] These and other aspects are described in more detail below. [Brief explanation of the drawings]
[0058] [Figure 1]Described herein are the mouse Igh locus (top) located at the telomeric end of chromosome 12 (containing the V (IghV), D (IghD), J (IghJ), and C (IghC) gene segments), the Igκ locus (middle) located on chromosome 6 (containing the V (IgkV), J (IgkJ), and C (IgkC) gene segments), and the Igλ locus (bottom) located on chromosome 16 (containing the Igl(V), IglJ(J), and IglC(C) gene segments). The Igh locus also contains 1 1) the PAIR element, a cis-regulatory sequence important for Igh loop formation to ensure the utilization of distal VH gene segments in VDJ rearrangement; 2) the Adam6a male fertility gene; 3) the intergenic control region 1 (IGCR1), which contains a region controlling ordered lineage-specific rearrangement of the Igh locus; 4) the heavy chain intronic enhancer Eμ; 5) the switch region Sμ; and 6) the 3' regulatory region (3'RR), a cis-acting element controlling isotype switching. Also shown are the 5' (E5') and 3' (E3') enhancers at the Igκ locus, and three enhancers at the Igλ locus: Eλ 2-4, Eλ, and Eλ 3-1.
[0059] [Figure 2] FIG. 1 is a schematic diagram showing a targeting strategy by homologous recombination for introducing a first set of sequence-specific recombination sites into the upstream region of the heavy chain variable region locus in the genome of a non-feline mammalian host cell.
[0060] [Figure 3] 1 is a schematic diagram showing the introduction of a second set of sequence-specific recombination sites downstream of the heavy chain variable region locus in the genome of a non-feline mammalian cell via a homology targeting vector, which also shows the deletion of a selectable marker and the endogenous immunoglobulin heavy chain variable region locus from the genome of the non-feline mammalian host cell.
[0061] [Figure 4]FIG. 1 is a schematic diagram showing the RMCE strategy for introducing a heterologous partial feline immunoglobulin heavy chain locus into a non-feline mammalian host cell genome that has previously been modified to delete the endogenous immunoglobulin heavy chain variable region locus.
[0062] [Figure 5] FIG. 1 is a schematic diagram showing the introduction of a heterologous partial feline immunoglobulin κ light chain variable region locus into the endogenous immunoglobulin κ light chain locus of the mouse genome.
[0063] [Figure 6] FIG. 1 is a schematic diagram showing the introduction of a heterologous partial feline immunoglobulin λ light chain variable region locus into the endogenous immunoglobulin λ light chain locus of the mouse genome.
[0064] definition Terms used herein are intended to have their plain and ordinary meanings as understood by those of ordinary skill in the art. The following definitions are intended to aid the reader in understanding the invention, but are not intended to alter or otherwise limit the meaning of such terms unless specifically indicated.
[0065] As used herein, the term "locus" refers to a chromosomal segment or nucleic acid sequence that is endogenously present in a genome or that has been (or is about to be) introduced into a genome, respectively. For example, an immunoglobulin locus may contain some or all of the genes (i.e., V and L) that direct the expression of immunoglobulin heavy or light chain polypeptides. H , D H , and J. H gene segment, or V L and J. L The term "locus" (e.g., immunoglobulin heavy chain variable region locus) can refer to a larger locus (e.g., a V H , D H, and J. H Similarly, an immunoglobulin light chain variable region locus can refer to a specific portion of a larger locus (e.g., a portion of an immunoglobulin heavy chain locus that includes a gene segment). L and J. L It can refer to a portion of the immunoglobulin light chain locus that includes a gene segment.
[0066] As used herein, the term "immunoglobulin variable region gene" refers to the variable (V), diverse (D), and joining (J) gene segments of an immunoglobulin heavy chain variable region, which encode a portion of an immunoglobulin heavy or light chain variable domain, respectively. H , D H , or J H Gene segment, or V of the immunoglobulin light chain variable region L or J L As used herein, the term "immunoglobulin variable region locus" refers to a V H , D H , or J H gene segment, or V L , or J L It refers to part or all of a chromosomal segment or nucleic acid strand, including gene segments and intervening non-coding sequences, including, for example, non-coding regulatory or scaffold sequences.
[0067] As used herein, the term "gene segment" refers to a nucleic acid sequence that encodes a portion of a heavy or light chain variable domain of an immunoglobulin molecule. A gene segment may include coding and non-coding sequences. The coding sequence of a gene segment is a nucleic acid sequence that can be translated into a polypeptide, such as a leader peptide or the N-terminal portion of a heavy or light chain variable domain. The non-coding sequences of a gene segment are sequences that flank the coding sequence and may include promoters, 5' untranslated sequences, introns flanking the coding sequence of the leader peptide, recombination signal sequences (RSSs), and splice sites. Gene segments of the immunoglobulin heavy chain (IGH) locus include V H , D H , and J.H The light chain variable region gene segments of the immunoglobulin kappa and lambda light loci are V L and J. L For kappa light chains, V L and J. L The gene segment is V κ and J. κ Similarly, for the λ light chain, V L and J. L The gene segment is V λ and J. λ They can be referred to as gene segments, or IGLV and IGLJ.
[0068] The heavy chain constant region is C H or IGHC. Feline C that encodes IgM, IgD, IgG1a, IgG2, IgE, or IgA. H The region exons are C, μ , C δ , C γ1a、 C γ2 , C ε , or C α Similarly, the immunoglobulin kappa or lambda constant regions may be referred to as C κ or C λ , IGKC or IGLC.
[0069] As used herein, "partly feline" refers to a nucleic acid, or its expressed protein and RNA product, that contains a sequence corresponding to a sequence found at a given locus in both a feline and a non-feline mammalian host. As used herein, "partly feline" also refers to an immunoglobulin locus that contains nucleic acid sequences derived from both a feline and a non-feline mammal. In one embodiment, "partly feline" refers to an immunoglobulin locus that contains nucleic acid sequences derived from, for example, a rodent, such as a mouse. In one embodiment, the partial feline nucleic acid has coding sequences for a feline immunoglobulin heavy or light chain variable region gene segment and sequences based on non-coding regulatory or scaffold sequences of an endogenous immunoglobulin locus of a non-feline mammal.
[0070] When used in reference to an endogenous non-coding regulatory sequence or scaffold sequence of a non-feline mammalian host cell genome, the term "based on" refers to the non-coding regulatory sequence or scaffold sequence present in the corresponding endogenous locus of the mammalian host cell genome. In one embodiment, the term "based on" means that the non-coding regulatory sequence or scaffold sequence present in the partial feline immunoglobulin locus shares a relatively high degree of homology with the non-coding regulatory sequence or scaffold sequence of the endogenous locus of the host mammal. In one embodiment, the non-coding sequence of the partial feline immunoglobulin locus shares at least about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homology with the corresponding non-coding sequence found in the endogenous locus of the host mammal. In one embodiment, the non-coding sequence of the partial feline immunoglobulin locus is the same as the corresponding non-coding sequence found in the endogenous locus of the host mammal. In one embodiment, the non-coding sequences of the partial feline immunoglobulin locus are retained from the immunoglobulin locus of the host mammal. In one embodiment, the non-coding sequences of the partial feline immunoglobulin locus are identical to the corresponding non-coding sequences present in the endogenous locus of the host mammal. In one embodiment, the feline coding sequences are embedded in non-regulatory or scaffold sequences of the immunoglobulin locus of the host mammal. In one embodiment, the non-feline host animal is a rodent, such as a rat or a mouse.
[0071] "Chimeric" refers to a nucleotide sequence comprising nucleotide sequences from more than one animal species, or a polypeptide, e.g., an antibody, encoded by a nucleotide sequence comprising nucleotide sequences from more than one animal species. A "chimeric" immunoglobulin locus refers to an immunoglobulin locus comprising nucleic acid sequences from more than one animal species. In one embodiment, a chimeric immunoglobulin locus comprises a feline nucleic acid sequence and a murine nucleic acid sequence. In one embodiment, a chimeric immunoglobulin comprises protein sequences from more than one animal species. In one embodiment, a chimeric immunoglobulin comprises a feline sequence and a murine sequence. In one embodiment, a chimeric immunoglobulin comprises a feline variable domain and a murine constant domain. In one embodiment, a chimeric immunoglobulin variable region locus comprises a feline V H , D H , and J. H Coding sequence, or cat V L and J. L In one embodiment, the chimeric immunoglobulin variable region locus comprises a feline V coding sequence as well as a non-feline non-coding sequence. H , D H , and J. H Coding sequence, or cat V L and J. L It contains coding sequences as well as mouse non-coding sequences.
[0072] As used herein, "flanking" refers to a sequence, such as a nucleotide sequence, that is upstream or downstream of a reference sequence. In one embodiment, the flanking sequence is adjacent to the reference sequence. In one embodiment, a pair of sequences flank the reference sequence, with the first sequence being upstream of the reference sequence and the second sequence being downstream of the reference sequence.
[0073] "Endogenous" means a nucleic acid sequence or polypeptide that is naturally present in an organism or cell.
[0074] "Heterologous" means a nucleic acid sequence or polypeptide that does not naturally occur in an organism or cell.
[0075] "Non-coding regulatory sequences" refers to sequences known to be essential for (i) V(D)J gene rearrangement, (ii) isotype switching, (iii) proper expression of full-length immunoglobulin heavy or light chains after V(D)J gene rearrangement, or (iv) alternative splicing, for example, to generate membrane and secreted forms of immunoglobulin heavy chains. "Non-coding regulatory sequences" can also include the following sequences: enhancers and locus control elements, such as CTCF and PAIR sequences (Proudhon et al., Adv. Immunol. 128:123-182 (2015)); promoters preceding each endogenous V gene segment; splice sites; introns; or recombination signal sequences flanking each V, D, and J gene segment. In one embodiment, the "non-coding regulatory sequences" of the partial feline immunoglobulin locus share at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, up to about 100% homology with the corresponding non-coding sequences found in the endogenous immunoglobulin locus of the non-feline mammalian host cell. In one embodiment, the "non-coding regulatory sequences" of the partial feline immunoglobulin locus have the same sequence as the corresponding non-coding sequences found in the endogenous immunoglobulin locus of the non-feline mammalian host cell.
[0076] "Scaffold sequence" refers to a sequence intervening a gene segment present in an endogenous immunoglobulin locus of a host cell genome. In some embodiments, the scaffold sequence is flanked by sequences essential for expression of a functional non-immunoglobulin gene, such as ADAM6A or ADAM6B. In one embodiment, the scaffold sequence can comprise a naturally occurring nucleic acid sequence from another species. In one embodiment, the scaffold sequence can be a heterologous sequence based on a naturally occurring nucleic acid sequence from another species. In one embodiment, the scaffold sequence can comprise an artificial sequence. In one embodiment, the scaffold sequence comprises a combination of sequences present in the immunoglobulin locus of the feline genome with other sequences, such as scaffold sequences from other species. The phrase "non-coding regulatory sequence or scaffold sequence" is inclusive and can refer to both non-coding regulatory sequences and scaffold sequences in an immunoglobulin locus.
[0077] "Specifically binds" refers to the ability of an antibody or immunoglobulin to bind to an epitope or antigenic determinant on a particular antigen with much greater affinity than it binds to other antigens.
[0078] The term "homologous targeting vector" refers to a nucleic acid sequence used to modify the endogenous genome of a mammalian host cell by homologous recombination. A homologous targeting vector may contain a targeting sequence that is homologous to the corresponding endogenous sequence flanking the locus to be modified, for example, present in the genome of a non-feline mammalian host. In one embodiment, a homologous targeting vector contains at least one sequence-specific recombination site. In one embodiment, a homologous targeting vector contains a non-coding regulatory sequence or scaffold sequence. In one embodiment, a homologous targeting vector contains one or more selectable marker genes. In one embodiment, a homologous targeting vector can be used to introduce a sequence-specific recombination site into a specific region of a host cell genome.
[0079] "Site-specific recombination" or "sequence-specific recombination" refers to the process of DNA rearrangement between two compatible recombination sequences (also called "sequence-specific recombination sites" or "site-specific recombination sequences"). Site-specific recombination can involve any of the following three events: a) deletion of preselected nucleic acids flanked by the recombination sites, b) inversion of nucleotide sequences of preselected nucleic acids flanked by the recombination sites, and c) reciprocal exchange of nucleic acid sequences adjacent to recombination sites located on different nucleic acid strands. It is understood that this reciprocal exchange of nucleic acid segments can be used as a targeting strategy to introduce heterologous nucleic acid sequences into the genome of a host cell.
[0080] The term "targeting sequence" refers to a sequence that is homologous to a DNA sequence in the genome of a cell and that flanks or flanks the region of the immunoglobulin locus to be modified. Flanking or flanking sequences may be located within the locus itself or upstream or downstream of the coding sequence in the genome of the host cell. Targeting sequences are inserted into a recombinant DNA vector that can be used to transfect host cells, e.g., ES cells, such that the sequence to be inserted into the host cell genome, such as a sequence at a recombination site, is flanked by the targeting sequences of the vector.
[0081] As used herein, the term "site-specific targeting vector" refers to a vector comprising a nucleic acid encoding a sequence-specific recombination site, a heterologous partial feline locus, and optionally a selectable marker gene. In one embodiment, a "site-specific targeting vector" is used to modify a host's endogenous immunoglobulin locus using recombinase-mediated site-specific recombination. The recombination sites of the targeting vector are adjacent to the immunoglobulin locus to be modified and are suitable for site-specific recombination with another corresponding recombination site inserted into the host cell's genomic sequence (e.g., via a homology targeting vector). Integration of the heterologous partial feline sequence into the recombination site of the immunoglobulin locus replaces the endogenous locus with the heterologous partial feline region.
[0082] As used herein, the term "transgene" is used to refer to genetic material that has been or is to be artificially inserted into the genome of a cell, particularly a cell of a mammalian host animal. As used herein, the term "transgene" refers to partial feline nucleic acid, for example in the form of a heterologous expression construct or targeting vector.
[0083] By "transgenic animal" is meant a non-feline animal, usually a mammal, that has a heterologous nucleic acid sequence present in some of its cells as an extrachromosomal element or stably integrated into the DNA of its germline (i.e., into the genomic sequence of most or all of its cells). In the present invention, partial feline nucleic acid is introduced into the germline of such a transgenic animal, for example, by genetically manipulating the embryos or embryonic stem cells of the host animal according to methods well known in the art.
[0084] "Vector" includes plasmids and viruses, as well as DNA and RNA molecules, whether autonomously replicating or not, that can be used to transform or transfect cells. DETAILED DESCRIPTION OF THE INVENTION
[0085] Unless otherwise specified, the implementation of the techniques described herein may employ conventional techniques and descriptions relating to organic chemistry, polymer technology, molecular biology (including recombinant technology), cell biology, biochemistry, and sequencing technology, which are within the skill of those skilled in the art. Such conventional techniques include polymer array synthesis, polynucleotide hybridization and ligation, and detection of hybridization using labels. Specific examples of suitable techniques can be found by reference to the examples herein. However, other equivalent conventional procedures may, of course, also be used.Such prior art techniques and descriptions are exemplified by Green et al., Eds. (1999), Genome Analysis: A Laboratory Manual Series (Vols. I-IV); Weiner, Gabriel, Stephens, Eds. (2007), Genetic Variation: A Laboratory Manual; Dieffenbach and Veksler, Eds. (2007), PCR Primer: A Laboratory Manual; Bowtell and Sambrook (2003), DNA Microarrays: A Molecular Cloning Manual; Mount (2004), Bioinformatics: Sequence and Genome Analysis; Sambrook and Russell (2006), Condensed Protocols from Molecular Cloning: A Laboratory Manual; and Green and Sambrook (2012), Molecular Cloning: A Laboratory Manual (all Cold Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry (4th Ed.) W.H. Freeman, New York NY; Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London; Nelson and Cox (2021), Lehninger, Principles of Biochemistry 8e, W.H. Freeman Pub., New York, NY; and Berg et al. (2019) Biochemistry, 93, Macmillan Pub., New York, NY, all of which are incorporated by reference in their entireties for all purposes.
[0086] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include the plural forms unless the context clearly dictates otherwise. Thus, for example, reference to a "locus" is a reference to one or more loci, reference to a "method" includes references to equivalent steps and methods known to those skilled in the art, and so forth.
[0087] As used herein, the term "or" may mean "and / or" unless expressly stated to refer to alternatives only or unless the alternatives are mutually exclusive. The terms "including," "includes," and "included" are not limiting.
[0088] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices, formulations, and methodologies that can be used in connection with the presently described invention.
[0089] When a range of values is stated, it is understood that each intervening value between the upper and lower limits of that range, as well as any other stated or intervening value within that range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where one or both of the limits is included in the stated range, ranges excluding either or both of those included limits are also included in the invention.
[0090] In the following description, numerous specific details are set forth to provide a thorough understanding of the present invention. However, it will be apparent to one skilled in the art that the present invention may be practiced without one or more of these specific details. In other instances, features or procedures well known to those skilled in the art are not described in order to avoid obscuring the present invention.
[0091] In the humoral immune system, a diverse antibody repertoire is produced through combinatorial and junctional diversity at the IGH and IGL chain loci through a process known as V(D)J gene rearrangement. In developing B cells, the first gene rearrangement event occurs between one D gene and one J gene in the heavy chain locus, resulting in the deletion of DNA between these two gene segments. Following this DJ gene rearrangement, one V gene segment joins from the upstream region of the newly formed DJ complex, forming a rearranged VDJ exon. All other sequences between the recombined V gene segment and the D gene segment of the newly generated VDJ exon are deleted from the genome of each B cell. This rearranged exon is ultimately expressed on the B cell surface as the variable region of the H chain polypeptide, which binds to the L chain polypeptide to form the B cell receptor (BCR). Mouse and feline Ig loci are highly complex in the number of features they contain and how the coding regions diversify through V(D)J rearrangement; however, this complexity does not extend to the fundamental details of the structure of each variable region gene segment. V, D, and J gene segments are uniform in their composition and organization. For example, V genes have the following characteristics, arranged in an essentially invariant order in the immunoglobulin locus: a short transcriptional promoter region (length 600 bp or less); exons encoding most of the antibody chain signal peptides; introns; exons encoding portions of the antibody chain signal peptides and most of the antibody variable domains; and a 3' recombination signal sequence required for V(D)J rearrangement. Similarly, D gene segments have the following characteristics: a 5' recombination signal sequence, a coding region, and a 3' recombination signal sequence. J gene segments have the following characteristics: a 5' recombination signal sequence, a coding region, and a 3' splice donor sequence.
[0092] In one embodiment, a non-feline mammalian cell is provided that comprises a heterologous partial feline nucleic acid sequence that comprises a feline variable region coding sequence and a non-coding regulatory or scaffold sequence present in an immunoglobulin locus of the mammalian host genome, e.g., a mouse genomic non-coding sequence when the host mammal is a mouse.
[0093] V of the cat genome H The area is approximately 24 V H Gene segment and five Js H Contains gene segments. D H Although the number of gene segments has not yet been precisely defined, all gene segments have been mapped to feline chromosome B3 in the Abyssinian cat breed. The kappa (κ) coding region is mapped to the feline A3 chromosome, spans approximately 200 kb, and contains approximately 12 functional Vκ, 5 Jκ, and 1 Cκ genes. The lambda (λ) coding region is mapped to the feline D3 chromosome, spans approximately 1000 kb, and contains approximately 32 functional Vλ, 10 functional Jλ, and 12 Cλ genes, of which only 5 are functional. The feline IGL locus contains a high frequency (approximately 62 / 94) of apparently non-functional Vλ gene segments. In one embodiment, in the partial feline H chain and κ and λ L chain loci, all Vλ gene segments are functional. H , D H , and J. H Segment, as well as all V L and J. L The segments are flanked by murine RSSs to facilitate rearrangement during B cell differentiation and contribution to the partial feline antibody repertoire of transgenic mice.
[0094] Like humans and mice, cats express two types of Ig light chains (κ and λ). However, the κ / λ ratio varies greatly between these animals. In mice, approximately 96% of the light chains in serum antibodies are κ, whereas in humans, κ accounts for only 66% of all Ig L chains. In contrast, the L chain repertoire in cats is dominated by λ (95%).
[0095] The partial feline nucleic acid sequence integrated into the Igh, Igκ, or Igλ locus enables the transgenic animal to produce antibodies comprising a feline heavy chain variable region paired with a feline κ or λ variable region. The partial feline immunoglobulin variable region locus retains, within the intervening sequences of the host genome (e.g., rodent), regulatory sequences and other elements that serve to promote efficient antibody production and antigen recognition in the host.
[0096] In one embodiment, the feline coding sequence and immunoglobulin V H Synthetic or recombinantly produced partial feline immunoglobulin loci are provided, comprising non-feline non-coding regulatory or scaffold sequences from the V, Vλ, or Vκ loci.
[0097] In one embodiment, the synthetic heavy chain DNA segment comprises one or more of the following elements: the ADAM6 gene required for male fertility; Pax-5-Activated Intergenic Repeats (PAIR) elements involved in contraction of the Igh locus; a CTCF binding site from heavy chain intergenic control region 1 involved in regulating normal VDJ rearrangement [(Proudhon et al. Adv. Immunol., 128:123-182 (2015)]; or a combination thereof. The location of these endogenous non-coding regulatory sequences and scaffold sequences in the mouse Igh locus is shown in Figure 1, which describes, from left to right: approximately 100 functional heavy chain variable region gene segments; PAIR, Pax-5-activated intergenic repeats involved in contraction of the Igh locus for VDJ gene rearrangement; Adam6a, a disintegrin and metallopeptidase domain 6A gene required for male reproductive function; pre-D region, the most distal D region. H A 21,609-bp fragment upstream of the gene segment Ighd-5;V H Intergenic control region 1 (IGCR1);D, which contains a CTCF insulator site that controls gene segment usage H , diversity gene segments (10–15 depending on mouse strain); four joining JH Gene segments: Eμ, an intronic enhancer involved in VDJ gene rearrangement; Sμ, a μ switch region for isotype switching; eight heavy chain constant region genes: Cμ, Cδ, Cγ3, Cγ1, Cγ2b, C2γa / c, Cε, and Cα; and a 3' regulatory region (3'RR) that controls isotype switching and somatic hypermutation. Figure 1 is adapted from Proudhon et al., Adv. Immunol., 128:123-182 (2015).
[0098] In one embodiment, the heterologous partial feline immunoglobulin locus integrated into the mammalian host cell is a known feline V H It contains all or a substantial number of gene segments. H It may be desirable to use a subset of gene segments. H Only one coding sequence may be contained in a partial feline immunoglobulin locus.
[0099] In one embodiment, the non-feline mammal or mammalian cell is a feline V H , D H , and J. H The heterologous partial feline immunoglobulin locus comprises a gene coding sequence. In one embodiment, the partial feline immunoglobulin locus comprises non-coding regulatory sequences and scaffold sequences, such as pre-D sequences, based on the endogenous Igh locus of the non-feline mammalian host. In one embodiment, the heterologous partial feline immunoglobulin locus comprises a fully recombined V(D)J exon.
[0100] In one embodiment, the transgenic non-feline mammal is a rodent, e.g., a mouse, and the feline V H , D H , and J. HThe transgenic rodent further comprises a heterologous partial feline immunoglobulin locus comprising a gene and an intervening sequence, such as a pre-D region, based on a rodent intervening (non-coding regulatory or scaffold) sequence, for example, a feline Vκ or Vλ coding sequence, and a feline Jκ or Jλ coding sequence, respectively, and an intervening sequence, such as a non-coding regulatory or scaffold sequence, present in the rodent Igl locus.
[0101] In one embodiment, the endogenous V H The entire immunoglobulin locus is deleted, resulting in 24 functional feline V H J558V in gene segments and the mouse genome H In one embodiment, the heterologous immunoglobulin locus is replaced with a non-coding sequence of the feline D H and 5J H In one embodiment, the heterologous immunoglobulin locus comprises a mouse pre-D region. In one embodiment, the heterologous immunoglobulin locus comprises a feline V H , D H , and J. H The coding sequence is embedded in rodent non-coding sequences.
[0102] In one embodiment, homologous recombination is combined with site-specific recombination to generate transgenic cells and animals. In one embodiment, a homology targeting vector is used to introduce a sequence-specific recombination site into the genome of a mammalian host cell at a desired location in the endogenous immunoglobulin locus. In one embodiment, the sequence-specific recombination site is inserted into the genome of the mammalian host cell by homologous recombination without affecting the expression or coding sequences of other genes in the mammalian host cell. In one embodiment, the ability of the immunoglobulin gene to be transcribed and translated to produce an antibody is maintained after the recombination site and, optionally, additional sequences such as a selectable marker gene are inserted. However, in some cases, other heterologous sequences can be inserted into the immunoglobulin locus sequence, and although the amino acid sequence of the resulting antibody molecule is altered by the insertion, the antibody retains sufficient functionality for the desired purpose. In one embodiment, one or more polymorphisms are introduced into the endogenous locus within a constant region exon, thereby providing a homotypic marker so that different Ig alleles can be distinguished.
[0103] In one embodiment, homology targeting vector is used to replace the sequence in endogenous immunoglobulin locus, as well as insert sequence-specific recombination site and one or more selection marker genes into host cell genome.It is understood by those skilled in the art that the selection marker gene as used herein can be used to identify and eliminate cells that have not undergone homologous recombination or have random integration of targeting vector.
[0104] Methods are known, as described in U.S. Patent Nos. 6,689,610; 6,204,061; 5,631,153; 5,627,059; 5,487,992; and 5,464,764, each of which is incorporated by reference in its entirety.
[0105] Site / Sequence-Specific Recombination Site- or sequence-specific recombination differs from homologous recombination in that a short, specific DNA sequence required for recognition by a recombinase is the only site at which recombination can occur. Depending on the orientation of these sites on a particular DNA strand or chromosome, specialized recombinases that recognize these specific sequences can catalyze either i) DNA excision or ii) DNA inversion or rotation. Site-specific recombination can also occur between two DNA strands when these sites are not present on the same chromosome. Many site-specific recombination systems from bacteriophages and yeast, each containing a recombinase and its recognition site, have been shown to function in eukaryotic cells. These include, but are not limited to, the bacteriophage P1 Cre / lox system, the yeast FLP-FRT system, and the Dre system of the tyrosine family of site-specific recombinases. For example, see U.S. Patent Nos. 7,422,889; 7,112,715; 6,956,146; 6,774,279; 5,677,177; 5,885,836; 5,654,182; and 4,959,317, each of which is incorporated herein by reference.
[0106] Other systems from the tyrosine family of site-specific recombinases can also be used, including, but not limited to, bacteriophage λ integrase, HK2022 integrase, and systems from the serine family of recombinases, e.g., bacteriophage ΦC31, R4Tp901 integrase.
[0107] Because site-specific recombination can occur between two different DNA strands, site-specific recombination can be used to introduce heterologous immunoglobulin loci into a host cell genome through a process called recombinase-mediated cassette exchange (RMCE). The RMCE process can be exploited by using wild-type and mutant sequence-specific recombination sites of a recombinase protein. For example, a target chromosomal site can be flanked on one end by wild-type LoxP sites and on the other end by mutant LoxP sites. Similarly, a vector can contain a heterologous sequence to be inserted into a host cell genome flanked on one end by wild-type LoxP sites and on the other end by mutant LoxP sites. When the vector is transfected into a host cell in the presence of Cre recombinase, the wild-type and mutant LoxP sites on each DNA strand are recombination incompatible with each other, so Cre recombinase catalyzes RMCE between the endogenous DNA strand and the vector DNA rather than catalyzing an excision reaction on the same DNA strand. In this way, a LoxP site on one DNA strand will only recombine with a LoxP site on the other DNA strand, and similarly, a mutated LoxP site on one DNA strand will only recombine with a mutated LoxP site on the other DNA strand.
[0108] In one embodiment, mutants of sequence-specific recombination sites recognized by the same recombinase are used for RMCE. Examples of such sequence-specific recombination site mutants include those containing combinations of inverted repeat sequences and those containing recombination sites with mutant spacer sequences. For example, two mutant recombinase sites are available for stable Cre-loxP integrative recombination. Both utilize sequence mutations of the Cre recognition sequence within the 8-bp spacer region or the 13-bp inverted repeat. Spacer mutants such as lox511 [Hoess et al., Nucleic Acids Res, 14:2287-2300 (1986)], lox5171, and lox2272 [Lee and Saito, Gene, 216:55-65 (1998)], m2, m3, m7, and m11 [Langer et al., Nucleic Acids Res, 30:3067-3077 (2002)] readily recombine with themselves but exhibit significantly reduced recombination rates with the wild-type site. This class of mutants has been utilized for DNA insertion by RMCE using non-interacting Cre-Lox and FLP recombination sites [Baer and Bode, Curr Opin Biotechnol, 12:473-480 (2001); Albert et al., Plant J, 7:649-659 (1995); Seibler and Bode, Biochemistry, 36:1740-1747 (1997); Schlake and Bode, Biochemistry, 33:12746-12751 (1994)].
[0109] Inverted repeat mutants are another type of mutant recombinase site. For example, LoxP sites can contain altered bases in the left inverted repeat (LE mutant) or the right inverted repeat (RE mutant). The LE mutant, lox71, has the 5'-end 5 bases of the left inverted repeat altered from the wild-type sequence to TACCG [Araki et al., Nucleic Acids Res, 25:868-872 (1997)]. Similarly, the RE mutant, lox66, has the 3'-end 5 bases altered to CGGTA. Inverted repeat mutants are used to integrate plasmid inserts into chromosomal DNA, and the LE mutant is designated as the "target" chromosomal loxP site into which the "donor" RE mutant recombines. After recombination, the loxP sites are positioned in cis, flanking the inserted segment. The mechanism of recombination is such that, after recombination, one loxP site becomes a double mutant (containing both LE and RE inverted repeat mutations) and the other becomes wild-type [Le and Sadowski, Prog Nucleic Acid Res Mol Biol, 80:1-42 (2005); Lee and Sadowski, J Mol Biol, 326:397-412 (2003)]. The double mutant is sufficiently different from the wild-type site that it is not recognized by Cre recombinase, and the inserted segment is not excised.
[0110] In one embodiment, the sequence-specific recombination sites are introduced into an intron, rather than into a coding or regulatory sequence, to avoid disruption of regulatory or coding sequences used for antibody expression.
[0111] Introduction of sequence-specific recombination sites can be achieved by conventional homologous recombination techniques, as described, for example, in Green and Sambrook (2012) (Molecular cloning: a laboratory manual, 4th ed. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press) and Nagy, A. (2003) (Manipulating the mouse embryo: a laboratory manual, 3rd ed. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press)).
[0112] Specific recombination into the genome can be easily achieved using vectors designed for positive or negative selection, as is known in the art. To facilitate identification of cells that have undergone the replacement reaction, appropriate genetic marker systems can be employed, and cells can be selected, for example, using selective tissue culture media. In one embodiment, nucleic acid sequences at or adjacent to the two ends of the heterologous sequence, such as marker systems or genes, can be removed after selection of cells containing the heterologous nucleic acid.
[0113] In one embodiment, cells lacking an endogenous immunoglobulin locus can be positively selected using a marker gene, which can optionally be removed from the cells after or as a result of a recombination event. A possible positive selection system relies on two non-functional portions of a marker gene, such as hypoxanthine-guanine phosphoribosyltransferase (HPRT), coming together via a recombination event. In one embodiment, successful replacement of the endogenous immunoglobulin locus with a heterologous immunoglobulin locus results in functionally linking the two non-functional portions. In one embodiment, the functionally rearranged marker gene is flanked by additional sequence-specific recombination sites (different from those used in the replacement reaction), allowing the marker gene to be excised from the genome using an appropriate site-specific recombinase. In another embodiment, cells are negatively selected upon exposure to a toxin or drug. For example, cells in which the targeting construct is not integrated by homologous recombination but rather randomly integrated into the genome retain expression of herpes simplex virus thymidine kinase (HSV-TK) if the HSV-TK gene is located outside the homologous region. Such cells can be selected with nucleoside analogs such as ganciclovir.
[0114] In one embodiment, the recombinase is provided as a purified protein. In one embodiment, the recombinase is provided as a protein expressed from a vector construct transiently transfected into a host cell or as a protein stably integrated into the host cell genome. Alternatively, transgenic animals containing heterologous immunoglobulin loci can be bred with animals expressing the recombinase.
[0115] In one embodiment, two or more sets of sequence-specific recombination sites are contained within the engineered genome, allowing multiple rounds of RMCE to insert a partial feline immunoglobulin variable region locus into the genome of a non-feline mammalian host cell.
[0116] In one embodiment, the partial feline immunoglobulin locus is introduced using CRISPR technology, for example, the CRISPR / Cas9 genome editing system can be used for targeted recombination [He et al. Nuc. Acids Res., 44:e85, (2016)].
[0117] Generation of transgenic animals In one embodiment, a method is provided for generating a transgenic animal, eg, a rodent, eg, a mouse, comprising a heterologous partial feline immunoglobulin locus.
[0118] In one embodiment, the genome of the transgenic animal is modified such that the B cells of the transgenic animal express two or more functional VH regions per cell, i.e., the cells produce bispecific antibodies, as described in "Enhanced Production of Immunoglobulins," WO20170 / 35252, filed August 24, 2016, the disclosure of which is incorporated herein by reference.
[0119] In one embodiment, the genome of the transgenic animal is modified so that its B cells are capable of expressing antibodies containing heavy chains and no light chains, ie, producing heavy chain-only antibodies.
[0120] In one embodiment, the host cells are embryonic stem (ES) cells, which can be used to create transgenic mammals. In one embodiment, the method includes isolating embryonic stem cells containing heterologous partial feline immunoglobulin loci and using the ES cells to generate transgenic animals containing the heterologous partial feline immunoglobulin loci. [Example]
[0121] The following examples are presented so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent or imply that the following experiments are all or the only experiments performed. One of ordinary skill in the art will recognize that numerous variations and modifications can be made without departing from the spirit or scope of the invention as described herein. Accordingly, these examples are illustrative and not limiting.
[0122] Efforts have been made to ensure accuracy with respect to terminology and numbers (e.g., vectors, quantities, temperature, etc.) used, but some experimental errors and deviations should be accounted for. Unless otherwise noted, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric.
[0123] The examples illustrate targeting by both 5' and 3' vectors flanking the recombination site and the introduction of synthetic DNA via RMCE. After reading this specification, it will be clear to those skilled in the art that targeting of the 5' vector can be performed first, followed by the 3' vector, or alternatively, targeting of the 3' vector can be performed first, followed by the 5' vector. In some cases, simultaneous targeting can be performed using a dual detection mechanism. While the examples use several different strategies to select cells that have properly integrated the 5' or 3' vector, it will also be clear that these strategies are compatible, with minor modifications, when targeting the Igh, Igκ, or Igλ loci.
[0124] Example 1: Introduction of a heterologous partial feline immunoglobulin variable region locus into the immunoglobulin heavy chain variable region locus of a non-feline mammalian host cell genome Exemplary methods for introducing a heterologous partial feline immunoglobulin locus into the genomic locus of a non-mammalian ES cell are shown in Figures 2 to 4. Figure 2 shows the introduction of an endogenous V HThis figure shows a method for introducing site-specific recombination sequences upstream (5') of a gene segment. A 5' homology targeting vector (201) is provided containing a puromycin phosphotransferase-thymidine kinase fusion protein (puro-TK) (203). This vector is flanked by two different recombinase recognition sites (e.g., FRT (207) and loxP (205) for Flp and Cre, respectively) and two different mutant sites (e.g., engineered mutant FRT (209) and mutant loxP (211)) that lack the ability to recombine with their respective wild-type counterparts (i.e., wild-type FRT (207) and wild-type loxP (205)). The targeting vector also contains a diphtheria toxin receptor (DTR) cDNA (217) for negative selection of cells. The targeting vector optionally also contains a visual marker, such as green fluorescent protein (GFP) (not shown). Regions 213 and 215 are located at the endogenous non-feline V locus. H The homology targeting vector (201) is homologous to the 5' and 3' portions, respectively, of a contiguous region (229) that is 5' of the genomic region containing the gene segment (219). H Gene segment (219), pre-D region (221), D H Gene segment (223), J H The site-specific recombination sequence and DTR cDNA from the homology targeting vector (201) are introduced into ES cells (202) carrying the immunoglobulin locus (231), which contains the gene segment (225) and the immunoglobulin constant gene region gene (227). H It integrates into the non-feline genome at a site 5′ of the locus ( 204 ), resulting in the genome structure shown in 233 .
[0125] Mouse embryonic stem (ES) cells (derived from C57B1 / 6NTac mice) are transfected with the 5' vector (201) by electroporation according to known procedures. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only the prokaryotic plasmid sequence or its associated polylinker. The transfected cells are plated, and after approximately 24 hours, cells that have integrated the 5' vector into their DNA are selected. ES cells that have not integrated the 5' vector (201) into their genome can be selected (killed) by adding puromycin to the culture medium; only ES cells that have stably integrated the 5' vector (201) into their genome and constitutively express the puroTK gene are resistant to puromycin.
[0126] Drug-resistant ES cell colonies become visible to the naked eye after approximately one week and are then physically removed from the plate. The colonies are disaggregated, replated into microwell plates, and cultured for several days. Each clone is then split, with some cells frozen for archival storage and others used for DNA isolation for analytical purposes. Primary screening for 5' vector integration can be performed by Southern blot or PCR with confirmation by a secondary screen, such as Southern blot.
[0127] The DNA of ES cell clones is screened by PCR using a commonly used gene targeting assay design, in which one PCR oligonucleotide primer sequence maps outside the region of identity shared between the 5' vector (201) and genomic DNA, and the other maps within the 5' vector, e.g., the Puro-TK gene (203). By standard design, these assays detect DNA present only in ES cell clones that have undergone homologous recombination between the 5' targeting vector and the endogenous mouse Igh locus.
[0128] Southern blot assays are performed according to a widely accepted procedure using genomic DNA digested with multiple restriction enzymes and three probes selected to identify the appropriate probe-treatment combination for the target locus in the clone, indicating that the structure has been appropriately modified by homologous recombination. One probe maps to the DNA sequence flanking the 5' side of the region of identity shared between the 5' targeting vector and the genomic DNA; a second probe maps 3' to but outside the region of identity; and a third probe maps within the novel DNA between the two arms of genomic identity within the vector, e.g., within the Puro-TK gene (203). In Southern blots, the presence of the expected restriction enzyme-generated DNA fragment corresponding to the modified sequence, i.e., the portion of the Igh locus modified by homologous recombination with the 5' targeting vector, is detected and identified by one of the external probes and the Puro-TK probe. The external probe detects the mutant fragment and also detects the wild-type fragment from the non-mutated copy of the immunoglobulin Igh locus on the homologous chromosome.
[0129] The karyotypes of PCR- and Southern blot-positive ES cell clones are analyzed using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones with such abnormalities are excluded from further use. ES cell clones with the genomic structure predicted by Southern blot data and no detectable chromosomal abnormalities by karyotype analysis are selected for further use.
[0130] As shown in Figure 3, a 3' homology targeting vector (301) is provided, which contains an optional hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene (335) that can be used for positive selection in HPRT-deficient ES cells; a neomycin resistance gene (337); and recombinase recognition sites FRT (307) and loxP (305) for Flp and Cre, respectively. Regions 329 and 339 are located within the endogenous J HThe homology targeting vector is homologous to the 5' and 3' portions, respectively, of the contiguous region (341) of the endogenous mouse locus downstream of the gene segment (325) and upstream of the constant region gene (327). H Gene segment (319), pre-D region (321), D H Gene segment (323), J H The gene segment (325) and the constant region gene (327) are introduced (302) into a modified mouse immunoglobulin locus (331). The site-specific recombination sequences (307, 305) of the homology targeting vector, the HPRT gene (335) and the neomycin resistance gene (337), are integrated (304) into the mouse genome upstream of the endogenous mouse constant region gene (327), resulting in the genome structure shown as 333.
[0131] Acceptable clones modified with the 3' vector (301) are identified using procedures and screening assays designed essentially identically to those used with the 5' vector (201), except that neomycin or HPRT selection is used instead of puromycin for selection. PCR assays, probes, and treatments are also tailored to the genomic region modified by the 3' vector. ES cell PCR and Southern blot-positive clones are analyzed for karyotype using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones with such abnormalities are excluded from further use.
[0132] Clones of ES cells mutated by both the 3' and 5' vectors, i.e., doubly targeted cells carrying both engineered mutations, are isolated after vector targeting and analysis. Clones must have undergone gene targeting on the same chromosome, as opposed to homologous chromosomes (i.e., the artificial mutations created by the targeting vectors must be in cis on the same DNA strand, not in trans on separate homologous DNA strands). Clones in cis and trans configurations are distinguished by analytical procedures such as fluorescent in situ hybridization of metaphase spreads with a probe that hybridizes to the novel DNA present between the genomic identity arms of the two gene targeting vectors (303 and 337). The two types of clones can also be distinguished from each other by transfecting them with a vector expressing Cre recombinase, which deletes the HPRT (335) and neomycin resistance (337) genes when the targeting vector is integrated in cis, and analyzing the clones' drug-resistance phenotype using a "sibling selection" screening procedure in which a portion of cells from each clone is tested for G418 / neomycin resistance. The majority of the resulting cis-derived clones will also be sensitive to G418 / neomycin; in contrast, the trans-derived clones should retain resistance to the drug. A double-targeted clone of cells carrying the engineered mutations in the cis configuration at the heavy chain locus is selected for further use.
[0133] Once the two recombination sites are integrated into the mammalian host cell genome, the endogenous immunoglobulin locus is then recombined by introducing a recombinase, such as Flp or Cre, that corresponds to the sequence-specific recombination site integrated into the genome. In the presence of Flp or Cre (306), all intervening sequences between the wild-type FRT or wild-type LoxP sites containing the DTR gene (317), the endogenous Igh variable region locus (319, 323, 325), the pre-D region (321), the HPRT (335), and the neomycin resistance (337) gene are deleted, resulting in the genome structure shown as 339. This procedure relies on the second targeting occurring on the same chromosome (i.e., in cis, not trans), rather than on its homolog. If targeting occurs in cis as intended, the DTR gene, which confers sensitivity to diphtheria toxin (317), should be deleted (deleted) from the host cell genome, making the cells insensitive to diphtheria toxin introduced into the culture medium. Similarly, ES cells carrying random integration of the first or second targeting vectors are sensitive to diphtheria toxin due to the presence of an intact DTR gene.
[0134] ES cell clones carrying a sequence deletion in one of the two homologous copies of the immunoglobulin heavy chain locus were transfected with a Cre recombinase expression vector and a feline V H , D H , and J. H A vector containing a partial feline immunoglobulin heavy chain locus with gene segment coding sequences embedded in mouse non-coding sequences is reintroduced. H Locus and J H This paper demonstrates the introduction of a heterologous partial feline immunoglobulin heavy chain locus into a mouse genome lacking a portion of the endogenous immunoglobulin heavy chain locus encoding the heavy chain variable region, including the intervening sequences between the loci. A site-specific targeting vector (441) containing the partial feline immunoglobulin locus to be inserted into a non-feline host genome is introduced (402) into the modified genome of a host cell (439) by RMCE. Hlocus (419), mouse pre-D region (421), partial feline D H Locus (423), partial cat J H The site-specific targeting vector (441) containing the gene locus (425), flanking mutant FRT (409), mutant LoxP (lox5171; 411), wild-type FRT (407), and wild-type LoxP (405) sites, was introduced into host cells by RMCE (402). Specifically, a partial cat V H Locus (419) contains 24 functional feline V H Contains gene segment coding sequences and the 3' non-feline RSS and intervening sequences present in the endogenous non-feline genome; pre-D region (421) contains 21.6 kb of non-feline genomic sequence present upstream in the endogenous non-feline genome; D H Region (423) is flanked by non-feline RSSs and contains endogenous non-feline D H Cat D embedded in the intervening sequence present in the region H containing the codons of the gene segment; and J H Locus (425) contains five cat J genes with a 5' non-cat RSS. H In one embodiment, the Igh locus of the host cell genome is modified to include the codons for the gene segment and the intervening sequence present in the endogenous non-feline genome. H , D H , and J. H The entire gene segment was deleted. This modification leaves the endogenous non-feline Igh locus (439) with a mutant FRT site (409) and a mutant LoxP site (lox5171;411) upstream and a puro-TK fusion gene (403) flanked by wild-type FRT (407) and wild-type LoxP (405) downstream. Upon introduction of the appropriate recombinase (404), the partial feline immunoglobulin locus is integrated into the genome between the lox5171 (411) and wild-type loxP (405) sites, upstream of the endogenous mouse constant region gene (427), creating the DNA region designated 443.
[0135] ES cells that do not undergo RMCE and do not integrate the partial feline Igh locus retain the puro-TK fusion gene ( 403 ) and are eliminated by inclusion of ganciclovir in the tissue culture medium.
[0136] Currently annotated functional cat V H , D H , and J. H The sequences of the gene segments are shown in SEQ ID NOs: 1 to 13. Because the feline IGH locus is not fully annotated, there are additional gene segments that can be used in the animals, cells, and methods described herein.
[0137] Integration of the heterologous partial feline immunoglobulin region can be detected by Southern blot or PCR with confirmation by a secondary screening method such as Southern blot. H , D H , or J H The assay is designed to detect the presence of gene loci and intervening sequences. ES cell PCR and Southern blot-positive clones are analyzed for karyotype using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones with such abnormalities are excluded from further use.
[0138] ES cell clones carrying a partial feline immunoglobulin heavy chain variable region (443) at the mouse heavy chain locus are microinjected into DBA / 2 mouse blastocysts according to standard procedures to generate ES cell-derived chimeric mice. Male chimeric mice with the highest ES cell-derived coat contribution are selected for mating with female mice. Offspring from these matings are analyzed for the presence of the partial feline immunoglobulin heavy chain locus. Mice carrying the partial feline immunoglobulin heavy chain locus are used to establish a mouse colony.
[0139] Example 2: Introduction of a heterologous partial feline immunoglobulin locus into the immunoglobulin kappa chain locus of the mouse genome A method for replacing a portion of the mouse Igκ locus with a partial feline Igκ locus is shown in Figure 5. This method involves introducing a first site-specific recombinase recognition sequence into the mouse genome, which site-specific recombinase recognition sequence is inserted into an endogenous V K (515) and J K (519) can be introduced either 5' or 3' to the cluster of constant region gene segments. A second site-specific recombinase recognition sequence is then introduced into the mouse genome, and this second site-specific recombinase recognition sequence, in combination with the first sequence-specific recombination site, is inserted into the V upstream of the constant region gene (521). K and J. K The entire locus containing the cluster of gene segments is flanked, and the flanked regions are deleted using a related site-specific recombinase and replaced with a partial feline immunoglobulin light chain variable region locus.
[0140] V K (515) and J K (519) The targeting vector used to introduce site-specific recombination sequences on either side of the gene segment also contains additional site-specific recombination sequences that are still efficiently recognized by the recombinase but are modified so that they do not recombine with the unmodified site. K and J. K Modified V gene locus via RMCE after deletion of gene segment clusters K The heterologous immunoglobulin light chain variable region locus is placed on a targeting vector so that it can be used for a second site-specific recombination event to insert the heterologous immunoglobulin light chain variable region locus into the targeting vector. In this example, the heterologous immunoglobulin light chain variable region locus is placed on a targeting vector so that it can be used for a second site-specific recombination event to insert the heterologous immunoglobulin light chain variable region locus into the targeting vector. K and J. K It is a synthetic nucleic acid comprising gene segments, and mouse Igκ variable region non-coding sequences.
[0141] To accomplish the process described above, two gene targeting vectors are constructed. One vector (503) targets the 5' end of the gene locus, i.e., the most distal V KThe other vector (505) contains mouse genomic DNA (525 and 541) obtained from upstream of gene segment (515). K It contains mouse genomic DNA (543 and 549) obtained from within the locus downstream (3') of gene segment (519) and upstream of the constant region gene (521).
[0142] The main features of the 5' vector (503) are: a gene encoding the diphtheria toxin A subunit (DTA) under the transcriptional control of the herpes simplex virus type I thymidine kinase gene promoter combined with two mutated transcriptional enhancers from polyomavirus (523); 6 kb of mouse genomic DNA mapped upstream of the distal variable region gene of the kappa chain locus (525); an FRT recognition sequence for Flp recombinase (527); a portion of genomic DNA containing the mouse Polr2a gene promoter (529); a translation initiation sequence (535) conforming to the "Kozak" consensus sequence embedded methionine codon); a mutated loxP recognition sequence for Cre recombinase (lox5171) (531); a transcription termination / polyadenylation sequence (533); a loxP recognition sequence for Cre recombinase (537); a gene encoding a fusion protein containing a protein conferring puromycin resistance fused to a truncated thymidine kinase (pu-TK) under the transcriptional control of a promoter derived from the mouse phosphoglycerate kinase 1 gene (539); and 2.5 kb of mouse genomic DNA (541) mapped near the 5' end of the 6 kb sequence in the vector and arranged in a native relative orientation.
[0143] The main features of the 3' vector (505) are as follows: κ Locus (519) and C κa 6-kb stretch of mouse genomic DNA (543) mapped within an intron between loci (521); a gene encoding human hypoxanthine-guanine phosphoribosyltransferase (HPRT) (545) under the transcriptional control of the mouse Polr2a gene promoter; a neomycin resistance gene (547) under the control of the mouse phosphoglycerate kinase 1 gene promoter; a loxP recognition sequence for Cre recombinase (537); 3.6-kb stretch of mouse genomic DNA (549) mapped immediately downstream of a 6-kb DNA fragment contained at the 5' end of the vector, these two fragments being in the same relative orientation within the mouse genome; and a gene encoding diphtheria toxin A subunit (DTA) under the transcriptional control of the herpes simplex virus type 1 thymidine kinase gene promoter combined with two mutated transcriptional enhancers from polyomavirus (523).
[0144] Mouse embryonic stem cells (ES cells) derived from C57B1 / 6NTac mice are transfected with the 3' vector (505) by electroporation according to known procedures. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only within the prokaryotic plasmid sequence or its associated polylinker. The transfected cells are plated, and after approximately 24 hours, cells that have integrated the 3' vector into their DNA are placed under positive selection using the neomycin-like drug G418. Negative selection is also performed for cells that have integrated the vector into their DNA but not via homologous recombination. Non-homologous recombination results in retention of the DTA gene, and expression of this gene results in cell death. However, because the DTA gene is located outside the vector's homology region with the mouse Igκ locus, it is deleted by homologous recombination. Drug-resistant ES cell colonies become visible to the naked eye after approximately one week and are then physically removed from the plate. Picked colonies are disaggregated, replated onto microwell plates, and cultured for several days. Each clone is then split so that some cells are cryopreserved as an archive and the rest are used to isolate DNA for analytical purposes.
[0145] The DNA of ES cell clones is screened by PCR using gene targeting assays. In these assays, one PCR oligonucleotide primer sequence maps outside the region of identity shared between the 3' vector (505) and genomic DNA (501), while the other maps within the novel DNA between the two arms of genomic identity within the vector, e.g., within the HPRT (545) or neomycin resistance (547) gene. These assays detect DNA fragments present only in ES cell clones derived from transfected cells that have undergone homologous recombination between the 3' vector (505) and the endogenous mouse Igκ locus. PCR-positive clones are selected for expansion and then further analyzed using Southern blot assays.
[0146] Southern blot assays are performed according to known procedures using three probes and genomic DNA digested with multiple restriction enzymes. The probe and treatment combinations are selected so that conclusions can be drawn about the structure of the target locus in the clone and whether it has been properly modified by homologous recombination. One probe maps to the DNA sequence adjacent to the 5' side of the region of identity shared between the 3' kappa targeting vector (505) and the genomic DNA; the second probe also maps outside the region of identity but 3' to it; and the third probe maps within the novel DNA between the two arms of genomic identity within the vector, for example, within the HPRT (545) or neomycin resistance (547) gene. In Southern blots, the presence of the predicted restriction enzyme-generated DNA fragments corresponding to the correctly mutated portion of the kappa locus, i.e., the portion mutated by homologous recombination with the 3' kappa targeting vector (505), is detected and identified by one of the external probes and the neomycin resistance or HPRT gene probe. The outer probe detects the mutant fragment and also detects the wild-type fragment from the non-mutated copy of the immunoglobulin kappa locus on the homologous chromosome.
[0147] The karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones with such abnormalities are excluded from further use. Karyotypically normal clones that are determined to have the correct expected genomic structure based on the Southern blot data are selected for further use.
[0148] Acceptable clones are then modified with the 5' vector (503) using essentially the same procedure and screening assay design as used for the 3' vector (505). However, puromycin selection is used instead of G418 / neomycin selection, and the protocol is adjusted to accommodate the genomic region modified by the 5' vector (503). The goal of the 5' vector (503) transfection experiment is to isolate double-targeted ES cell clones that are mutated in the expected manner by both the 3' vector (505) and the 5' vector (503), i.e., harboring both engineered mutations. In these clones, Cre recombinase induces recombination (502) between the loxP sites introduced into the kappa locus by the two vectors, resulting in the genomic DNA configuration shown in 507.
[0149] Furthermore, clones must be gene-targeted on the same chromosome, not on homologous chromosomes; i.e., the engineered mutations created by the targeting vectors must be in cis on the same DNA strand, not in trans on separate homologous DNA strands. Clones in cis and trans configurations are distinguished by analytical procedures such as fluorescent in situ hybridization of metaphase spreads with a probe that hybridizes to the novel DNA present between the genomic identity arms of the two gene-targeting vectors (503 and 505). The two types of clones can also be distinguished by transfecting them with a vector expressing Cre recombinase, which deletes the pu-Tk (539), HPRT (545), and neomycin resistance (547) genes when the targeting vector is integrated in cis, comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene (503) introduced by the 5' vector, and analyzing the drug-resistance phenotype of the surviving clones by a "sibling selection" screening procedure in which a portion of cells from the clones are tested for resistance to puromycin or G418 / neomycin. Cells with the mutation in the cis configuration are approximately 10 times more likely to survive than cells with the mutation in the trans configuration. 3 This is expected to produce many ganciclovir-resistant clones. The majority of the resulting cis-derived ganciclovir-resistant clones should be sensitive to both puromycin and G418 / neomycin; in contrast, the trans-derived ganciclovir-resistant clones should retain resistance to both drugs. Clones of cells carrying the engineered mutations in the cis configuration at the kappa chain locus are selected for further use.
[0150] The doubly targeted clonal cells are transiently transfected with a vector expressing Cre recombinase (502), and the transfected cells are then placed under ganciclovir selection, as in the analytical experiments summarized above. Ganciclovir-resistant clones of cells are isolated and analyzed by PCR and Southern blot for the presence of the predicted deletion (507) between the two artificial mutations created by the 5' vector (503) and the 3' vector (505). In these clones, Cre recombinase induces recombination between the loxP sites (537) introduced into the kappa chain locus by the two vectors. Because the loxP sites are oriented in the same relative orientation in the two vectors, recombination excises a DNA circle encompassing the entire genomic interval between the two loxP sites. Because this circle lacks an origin of replication, it is not replicated during mitosis and is therefore lost from the clonal cells during clonal expansion. The resulting clones lack the DNA originally located between the two loxP sites. The karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using a fluorescent in situ hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones with such abnormalities are excluded from further use. Karyotypically normal clones that are determined to have the correct predicted genomic structure based on the Southern blot data are selected for further use.
[0151] ES cell clones carrying a sequence deletion in one of the two homologous copies of the immunoglobulin kappa chain locus are retransfected with a Cre recombinase expression vector and a vector containing a partial feline immunoglobulin kappa chain locus (509) including the Vκ(551) and Jκ(555) gene segments (504). The main features of this vector are: a lox5171 site (531); an open reading frame for the neomycin resistance gene (547), which lacks an initiating methionine codon but is contiguous in frame with the uninterrupted open reading frame of the lox5171 site (531) downstream of the methionine initiation codon (535); an FRT site (527); an array of 12 feline Vκ gene segments (551), each containing a feline coding sequence flanked at the 3' end by mouse RSSs and embedded in mouse non-coding sequences; optionally, a 13.5 Kb genomic DNA fragment (not shown) from just upstream of the cluster of Jκ region gene segments of the mouse κ chain locus; DNA (555) containing five feline Jκ region gene segments flanked at the 5' end by mouse RSSs and embedded in mouse non-coding DNA; and a loxP site (537) in the opposite orientation relative to the lox5171 site (531).
[0152] The sequences of the functional feline Vκ and Jκ gene coding regions are shown in SEQ ID NOs: 14 to 30.
[0153] The transfected ES clones were placed under G418 selection to enrich for clones of cells that had undergone RMCE. During RMCE, the entire donor DNA (509), containing a partial feline immunoglobulin κ-chain locus, was integrated into the deleted endogenous immunoglobulin κ-chain locus between the lox5171 site (531) and the loxP site (537) placed there by the 5' vector (503) and the 3' vector (505), respectively. Only cells that have undergone proper RMCE are capable of expressing the neomycin resistance gene (547), because the promoter (529) and initiation methionine codon (535) required for its expression are absent from the vector (509) and are already present in the Igκ locus (507) of the engineered host cells. The DNA region created using the sequence of 509 is shown in 511. The remaining elements from the 5' vector (503), located between the FRT sites (527), are removed in vitro or in vivo via Flp-mediated recombination (506), as described below, resulting in a partial feline immunoglobulin light chain locus, as shown in 513.
[0154] G418-resistant ES cell clones are analyzed by PCR and Southern blotting to determine whether they have undergone the expected RMCE process without unwanted rearrangements or deletions. The karyotypes of ES cell PCR- and Southern blot-positive clones are analyzed using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones with such abnormalities are excluded from further use. Karyotypically normal clones, determined to have the correct expected genomic structure based on Southern blot data, are selected for further use.
[0155] ES cell clones carrying a partial feline immunoglobulin κ-chain locus at the endogenous mouse immunoglobulin κ-chain locus (513) are microinjected into DBA / 2 strain mouse blastocysts according to standard procedures to generate partial ES cell-derived chimeric mice. Male chimeric mice with the highest ES cell-derived coat contribution are selected for mating with female mice. Female mice used for mating are of the C57B1 / 6NTac strain and carry a transgene encoding Flp recombinase expressed in the germline, with the FRT-flanked neomycin resistance gene (520) and other elements deleted from the 5' vector. Offspring resulting from these matings are analyzed for the presence of the partial feline immunoglobulin κ-chain locus and the loss of the neomycin resistance gene. Mice carrying the partial feline immunoglobulin κ-chain locus are used to establish mouse colonies.
[0156] Mice with partial feline immunoglobulin heavy chain loci generated as described in Example 1 can be bred with mice with partial feline immunoglobulin κ chain loci. The offspring are bred to ultimately generate mice homozygous for both partial feline Igh and partial feline Igκ. These mice produce partial feline heavy chains containing feline variable domains and mouse constant domains. They also produce partial feline kappa proteins containing feline kappa variable domains and mouse kappa constant domains. Monoclonal antibodies recovered from these mice contain feline heavy chain variable domains paired with feline kappa variable domains.
[0157] In one embodiment, mice homozygous for both partial feline Igh and partial feline Igκ are bred with mice homozygous for the partial cat lamda locus generated in Example 3 to create mice homozygous for all three loci.
[0158] Those skilled in the art will recognize that the 5' vector (503) and subsequent strategy used herein to target the Igκ locus can also be used in place of the 5' vector (201) in Figure 2 as an alternative strategy to target the Igh locus, in which case the 5' vector (503) is modified to replace the genomic DNA regions homologous to the Igκ locus (525 and 541) with genomic DNA regions homologous to the Igh locus (213 and 215 in Figure 2).
[0159] Example 3: Introduction of a heterologous partial feline immunoglobulin locus into the immunoglobulin lambda chain locus of the mouse genome A method for replacing a portion of the mouse Igλ locus with a partial feline Igλ locus is shown in Figure 6. This method involves deleting approximately 200 Kb of DNA from the wild-type mouse immunoglobulin lambda locus (601 and Figure 1, bottom) by a homologous recombination process involving a targeting vector (603) that shares identity with the Vλ2 / Vλ3 gene segment (613) upstream and the Cλ1 gene segment (box at the right end of 617) downstream of the Cλ1 gene segment, as well as with the Eλ enhancer (623) upstream or downstream of the Vλ2 / Vλ3 gene segment (613) and the Cλ1 gene segment (box at the right end of 617) upstream or downstream of the Eλ enhancer (623) of the endogenous mouse immunoglobulin lambda locus. This vector replaces approximately 200 Kb of endogenous mouse genomic DNA with elements designed to allow subsequent site-specific recombination in which the heterologous immunoglobulin lambda locus replaces the engineered Vλ locus via RMCE. (604) In this example, the heterologous immunoglobulin lambda locus is a synthetic nucleic acid containing feline Igλ coding sequences and mouse Igλ non-coding sequences.
[0160] The main features of the gene targeting vector (603) for achieving approximately 200 Kb of deletion and inserting site-specific recombination sites are as follows: a negative selection gene, such as the gene encoding the A subunit of diphtheria toxin (DTA, 659) or the thymidine kinase gene of herpes simplex virus (not shown); 4 Kb of genomic DNA 5' to the mouse Vλ2 / Vλ3 variable region gene segment in the immunoglobulin lambda locus (625); an FRT site (627); genomic DNA containing the mouse Polr2a gene promoter (629); a translation initiation sequence (a methionine codon embedded in a "Kozak" consensus sequence) (635); a mutant loxP recognition sequence for Cre recombinase (lox5171) (631); a transcription termination / polyadenylation sequence (633); and an open reading frame encoding a protein conferring resistance to puromycin (637), although this open reading frame is confined to the Polr2a promoter and its adjacent and its own transcription termination / polyadenylation sequence (633); a loxP recognition sequence for Cre recombinase (639); a translation initiation sequence on the antisense strand identical to that of the open reading frame of the puromycin resistance gene (a methionine codon embedded in a "Kozak" consensus sequence) (635); a chicken beta-actin promoter and cytomegalovirus early enhancer element (641) oriented to direct transcription of the puromycin resistance open reading frame, where translation initiates at the start codon downstream of the loxP site (635) and continues backward through the loxP site to the puromycin resistance open reading frame, all on the antisense strand relative to the Polr2a promoter and its adjacent translation initiation sequence; a mutated recognition site for Flp recombinase (643); and genomic DNA containing the Eλ enhancer element (623) (645).
[0161] Mouse embryonic stem (ES) cells derived from C57B1 / 6NTac mice are transfected (602) by electroporation with the targeting vector (603) according to known procedures. Homologous recombination replaces the endogenous mouse immunoglobulin lambda locus in a region of approximately 200 Kb with the site-specific recombination site from the targeting vector (603), resulting in the genomic DNA configuration depicted in 605.
[0162] Prior to electroporation, vector DNA is linearized with a rare-cutting restriction enzyme that cuts only within the prokaryotic plasmid sequence or its associated polylinker. Transfected cells are plated and, after approximately 24 hours, placed under positive drug selection with puromycin. Cells that have integrated the vector into their DNA but not via homologous recombination are also negatively selected. Non-homologous recombination results in the retention of the DTA gene (659), which, when expressed, will kill the cell. However, because the DTA gene is located outside the vector's homology region with the mouse Ig λ locus, it is deleted by homologous recombination. Drug-resistant ES cell colonies become visible after more than a week and are then physically removed from the plate. These colonies are disaggregated and replated at limiting dilution onto microwell plates and cultured for several days. Each clonal cell line is then split; some are cryopreserved for archival purposes, while the remainder are used for DNA isolation for analytical purposes.
[0163] The DNA of the ES cell clones is screened by PCR using known gene targeting assays. In these assays, one PCR oligonucleotide primer sequence maps outside the region of identity shared between the targeting vector and genomic DNA, while the other maps within the novel DNA between the two arms of genomic identity within the vector, e.g., within the puro gene (637). These assays detect DNA fragments present only in clones derived from transfected cells that have undergone homologous recombination between the targeting vector (603) and endogenous DNA (601).
[0164] PCR-positive clones obtained from transfection are selected and further analyzed using Southern blot assays containing three probes and genomic DNA from the clones digested with multiple restriction enzymes, selected to identify whether the ES cell DNA was properly modified by homologous recombination using the combination of probes and treatments.
[0165] The karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones showing evidence of abnormalities are excluded from further use. Karyotypically normal clones determined to have the correct expected genomic structure based on Southern blot data are selected for further use.
[0166] ES cell clones carrying a sequence deletion in one of the two homologous copies of the immunoglobulin lambda chain locus are retransfected with a Cre recombinase expression vector (604) along with a vector containing a partial feline immunoglobulin lambda chain locus (607) that includes feline Vλ and Jλ region gene segment coding sequences. The main features of this vector (607) are: a lox5171 site (631); an open reading frame for the neomycin resistance gene (647), which lacks an initiating methionine codon but is contiguous in frame with the uninterrupted open reading frame of the lox5171 site (631 in diagram 605); an FRT site (627); an array of 32 functional feline lambda variable region gene segments, each flanked on the 3' side by a mouse RSS and containing a feline lambda coding sequence embedded in mouse lambda noncoding sequence (651); and an array of JC units, each containing a feline Jλ gene segment and a mouse lambda constant domain gene segment embedded in noncoding sequence from the mouse lambda locus (655), including the Eλ2-4 enhancer element (Figure 1). The feline Jλ gene segments encode Jλ1, Jλ2, and Jλ4-11. The other Jλ gene segments, Jλ3 and Jλ12, are nonfunctional ORFs (open reading frames), while the mouse lambda constant domain gene segments are Cλ1, Cλ2, or Cλ3, or a combination thereof; a mutated recognition site for Flp recombinase (643); an open reading frame conferring hygromycin resistance (657) located on the antisense strand relative to the information encoding the immunoglobulin gene segments in the construct; and a loxP site (639) in the opposite orientation relative to the lox5171 site.
[0167] RCME inserts a partial feline immunoglobulin lambda chain locus from the RCME vector (607) into the modified endogenous mouse Igλ locus, resulting in the genomic DNA configuration depicted in 609.
[0168] The sequences of the functional feline Vλ and Jλ gene coding regions are shown in SEQ ID NOs: 31-73.
[0169] The transfected clones are placed under G418 or hygromycin selection to enrich for clones of cells that have undergone the RMCE process, in which a partial feline immunoglobulin lambda chain variable is integrated into the deleted endogenous mouse immunoglobulin lambda chain locus between the lox5171 and loxP sites placed there by the gene targeting vector. The remaining elements from the targeting vector (603) are removed in vitro or in vivo via FLP-mediated recombination (606) (see below), ultimately resulting in a partial feline immunoglobulin lambda chain locus, as shown at 611.
[0170] A more detailed view of one arrangement of the partial feline immunoglobulin lambda chain locus of 611 is shown at 613 and is provided by way of example only. Other arrangements and numbers of feline Vλ and Jλ gene segments and mouse Cλ gene segments, as well as other locations and numbers of enhancer elements, are possible.
[0171] G418 / hygromycin-resistant ES cell clones are analyzed by PCR and Southern blotting to determine whether they have undergone the expected recombinase-mediated cassette exchange process without unwanted rearrangements or deletions. ES cell PCR- and Southern blot-positive clones are analyzed for karyotype using an in situ fluorescent hybridization method designed to distinguish the most common chromosomal abnormalities that occur in mouse ES cells. Clones that show evidence of abnormalities are excluded from further use. Karyotypically normal clones, determined to have the correct expected genomic structure based on the Southern blot data, are selected for further use.
[0172] ES cell clones carrying a partial feline immunoglobulin lambda chain locus (611) at the mouse immunoglobulin lambda chain locus are microinjected into DBA / 2 strain mouse blastocysts according to known procedures to generate partial ES cell-derived chimeric mice. Male chimeric mice with the highest ES cell-derived coat contribution are selected for mating with female mice. These selected female mice are of the C57B1 / 6NTac strain and carry a transgene encoding Flp recombinase expressed in the germline, resulting in a deletion of the FRT-flanked selectable marker. Offspring resulting from these matings are analyzed for the presence of the partial feline immunoglobulin lambda chain locus and the loss of the FRT-flanked neomycin resistance gene and mFRT-flanked hygromycin resistance gene created in the RMCE step. Mice carrying the partial feline immunoglobulin lambda chain locus are used to establish a mouse colony.
[0173] In one embodiment, mice homozygous for a partial feline immunoglobulin heavy chain locus and a partial feline immunoglobulin kappa light chain locus (described in Examples 1 and 2) are bred with mice carrying a partial feline immunoglobulin lambda light chain locus. Mice resulting from this type of mating are homozygous for a partial feline Igh locus and homozygous for partial feline Igκ and Igλ loci. Monoclonal antibodies recovered from these mice contain, in some cases, a feline kappa variable domain and, in other cases, a feline heavy chain variable domain paired with a feline lambda variable domain.
[0174] Sequence information IGHV Sequence number 1: > LOC101082137 Atggagtttgtgctgggctgggttctcctggttgctcttttaaaaggtgtccagtgtgacgtgcagctggtggagtctggggagacctggtgaagcctgggggtccctgagactcacctgtgtagcctctggattcaccttcagtagttccagcatgaactgggtccgccaggctccagggaaaggggctgcagtgggtcgcatatatttatgatgatggaagtagcacatactacgcagactccgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgt atctgcagatgaacaacctgaagaccgaggacacggccacatattactgtgcaagagacacggtgaggggacctcactgggagccagacacaaaacctccctgcaggaggggatcagcaccaccagggggcgcacactatgcacaac tctggtttgtgttcccaggagcaggtgcagatggaggttacaggcaggtttcctgtcagggtctggggcttctctctccacacagcagtttccccagggagcctctctggacacaggattctgtactttcctgttcattccttgactta
[0175] அக்கிய்குத்து2: > LOC101093781 Atggagtttgtgctgggctgggttttcctggttgctcttttaaaaggtgtccagtgtgacgtgcagctggtggagtctggggagacctggtgaagcctgggggtccctgagactcacctgtgtggcctctggattcaccttcagt agctatggaatgagctgggtccgccaggctccagggaaggggctgcagtgggtcgcatatattagatatgatggaagtagcacatactacgcagactccgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgt atctgcagatgaacagcctgaagaccgaggacacggccacatattactgtgcaagagacacgctgagggacctcactgggagcccacacacaaacctccctgcaggaggggatcagcaccaccaggggcgcacactatgcacaattctggtttgtgttcccaggagcaggtgcagatggaggttacaggcaggtttcctgtcagggtctggggcttcctctccacacagcagtttctccagggagcctctctggtcacaggattctgtgtttatctattaactctctgaattag
[0176] அக்க்கிய்க்குக்கு3: > LOC111559009 atggagtttgtgctgggctgggttttcctggttgctcttttaaaaggtgtccagtgtgacgtgcagctggtggagtctggggagacctggtgaagcctggggggtccctgagactcacctgtgtggcctctggattcaccttcagt agctactacatgaactgggtccgccaggctccagggaaggggctgcagtgggtctcatggattaatactgatggaagtagcacaagctacgcagactccgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgt atctgcagatgaacagcctcaagaccgaggacacggccacatattactgtgcgagagacacagtgaggggacctcactgggagcccagacacaacctccctgcaggaggggatcagcaccaccagggggcgcacactatgcacaatt ctcctttgtgttcccaggcgcaggtgcagatggaggttacaggcaggtttcctgtcagggtctggggcttctctctccacacagcagtttccccagggagcctccctggttatatgattctgtgtttacctattaactctctgaattag
[0177] அக்க்குக்க்கள் 4: > LOC111560938 atgcagatgctgtggtccctcctctgcctgctggcagctcccctgggtgtcctatctcaacttacacttcgggagtccggcccaggactggtgaagccttcacaatccctctctctcacctgcgttgtctccggaggctctgttaccagcagttactactggaactggatccgccagcgccctgggagagggttggagtggctggggtactggtcaggtagcaccagctacaacccggctttccagggccgcatctccatcactgctgacacagcccagaaccagttctccctgcagctgagctccatgaccaccgaggacacggccgtgtattactgtgcaagaagcacagtgagggaaagtcagtgtgagctcagtcacaaaccttggtgcagggacctggaggggctgggctgcaggggcgctcaggatccacaagagggcacacaggacctaccaggggaactagggcatcagggggtgcttagggccccttaccacagggaccagcccagaaacaggggcagagcaggagtgaggtccccactgtcagtatctggagctttctcttcctggcactctgatcctatggggacctccctttctttcttgcttgcgttcccttttgtttcagtcccagtgtg
[0178] IGHD SEQ ID NO: 5: >DH206 GCATAGCGGAAGCTGGTCC
[0179] [[ID=eleven]] SEQ ID NO: 6: >DH447 GGTAGTAGCGGGTGGGCT
[0180] [[ID=eighteen]]SEQ ID NO: 7: >DH1151 TTACTACGATAGCGACTATGCC
[0181] SEQ ID NO: 8: >DH2663 TCTATAACTACGGGTGGTAC
[0182] IGHJ SEQ ID NO: 9: JH1 Cctatgattacttccagttttggggccagggcaccctggtcaccgtctcctcag
[0183] SEQ ID NO: 10: JH2 caatacttttggtatctggggccaaggtacccaggtcaccgtctcccaag
[0184] SEQ ID NO: 11: JH3 actactttgactactggggccaaggagccctggtgacggtgtcctcag
[0185] SEQ ID NO: 12: JH4 Actactttgactactggggccaaggagccctggtgacggtgtcctcag
[0186] SEQ ID NO: 13: JH5 attactacggtatcgatctctggggccatggaaccatagtcacagtgtcctcag
[0187] IGKV SEQ ID NO: 14: >IMGT000050|IGKV1-10*01 atgaaggccccccgctcagctcctgggcctcctgctgctctggctcccaggagccagctgc gaaatccagatgacccagtctccatcctcgctgtctgcatctccaggagacagagtcacc atcacctgccgggcgagtcagaacgttaacacgtggttagcctggtatcagcagaaaccg gggaaagttcctaagcttctgatctatcgtgcatccacgttgcaaactggggtcccctcg cggttcagcggcagtgggtctgggacagatttcaccctcaccatcagcagcctggagcct gaagacgctgccacttactactgtcagcagcataacagcggcatc
[0188] அக்குக்க்குத்து15: >IMGT000050|IGKV1-17*01 atgaaggcccccgctcagctcctgggcctcctgctgctctggctcccaggagccagctgt gaaatccagatgacccagtctccatcctcgctgtctgcatctccagggagacagagtcacc atcacctgccgggcgagtcagaatgttaacacgtggttagcctggtatcagcagaaaccg gggaaagttcctaagcttctgatctatcgtgcatccacgttgcaaactggggtcccctcg cggttcagcggcagtgggtctgggacagatttcaccctcaccatcagcagcctggagcct gaagacgctgccacttactactgccagcaaagtagcaatctccctcc
[0189] அக்குக்க்குத்தி16: >IMGT000050|IGKV2-4*01 atgaggttccctgctcagctgctggggctgctgatgctctggatcccaggatccagtggg gatgtcgtgatgacgcagacccctctgtccctgcccgtcacccctggagagccggcctca atctcctgcagggccagtcagagcctcctgcacagtaatggaaatacttatctgaattgg tacctgcagaagccaggccagtctccacggcgactgatctataaggtttccaaccgggac tctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagggtggaggctgacgacgtcggagtttattactgccagcaaggtacacatgctcct cg
[0190] Accession number: >IMGT000050|IGKV2-5*01 atgaggttccctgctcagctgctggggctgctgatgctctggatcccaggatccagtggg gatgtcgtgatgacgcagacccctctgtccctgcccgtcacccctggagagccggcctca atctcctgcagggccagtcagagcctcctgcacagtaatggaaatacttatctgaattgg tacctgcagaagccaggccagtctccacggcgactgatctataaggtttccaaccgggac tctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagggtggaggctgacgacgtcggagtttattactgccagcaaggtacacatgctcct cg
[0191] Accession number: >IMGT000050|IGKV2-9*01 atgaggttccctgctcagctgctggggctgctgatgctctggatcccaggatccagtggg gatgtcgtgatgacgcagacccctctgtccctgcccgtcacccctggagagccggcctca atctcctgcagggccagtcagagcctcctgcacagtaatggaaacacctatttacattgg tacctgcagaagccaggccagtctccacggcgactgatctatagggtttccaaccgggac tctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagggtggaggctgacgacgtcggagtttattactgcctgcaaggtacacacagacct cc
[0192] Accession No. 19: >IMGT000050|IGKV2-12*01 atgaggttccctgctcagctcctgggactcatcatgctctggatcccaggatccagtggg gatattgtgatgacgcagacccctctgtccctgtccgtcacccctggagagccagcctca atctcctgcagggccagtcagagcctcctgcacagtgatggaaatacttatctgaattgg tacctgcagaagccaggccagtctccacggcgcttgatctatcttgtttccaaccgggac tctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagggtggaggctgacgacgtcggtgtttattactgcggtcaagctttacagtatcct cc
[0193] Accession No. 20: >IMGT000050|IGKV2-13*01 atgaggttccctgctcagctcctggggctgctagtgctttggttccctggatccggtgcg gatgtcgtgatgacacagacccctctgtccctgcctgtcacccctggagagccggcctca atctcctgcagggccagtcagagcctcctgcacagtgatggaaatacttatctgaattgg tacctgcagaagccaggccagtctccacggcgactgatctataaggtttccaaccgggac tctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagggtagaggctgacgacgtcggagtttattactgcctgcaaggtacaaagtatcct ac
[0194] SEQ ID NO: 21: >IMGT000050|IGKV2-14*01 atgaggttccctgctcagctcctggggctgctagtgctttggttccctggatccagtggg gatgtcatgatgacccagacccttctgtccctgcccgtcgcccctggacagccgggctca atctcctgcagggccagtcagagcctcctgcccagcaatggatactcctatttaagttgg tacctgcagaagacaggccagtctccacagcgcccgatctatcaggtttccaaccgggcc tctggggtcccagacaggttcagtggcagcgggtcagggacagatttcacactcaaaatc aacagagtggaggctgaggatgtgggagtttattgctgcttgcaagatatacaacttcct ct
[0195] SEQ ID NO: 22: >IMGT000050|IGKV4-1*01 atggtgacccagaggcaggtcctcctatccttgttgctgtgggtctcaggtgcctgtggg gcgatcacgatgacgcagtctccaggctcccctggctgggtctccaggtcagcaggtcacc atgaactgcagggccagtcagagtgttagcagctacttagcctggtaccagcagaaacca gggcagcatcctaagctgctcatctactcagcttccaccccgggcatctggagtccccgac cgattcagtggcagtgggtccgggacggatttcaccctcaccatcagcaacctccaggct gaagacgtggcgagttactactgtcagcagtattacagctctcctcc
[0196] அக்குக்க்குத்துக்கு23: >IMGT000050|IGKV6-6*01 atggtgtctccatcacagcttcttgggcttctgctcctctgggttccagcctccagtggt gaggttgtgctgacccagtcctcagccttcctgtccaggactctaaaaagaaaaagccacc atcacctgccgagccaatcagggcatcagcaccatcttgcactggtatcagcagaaacca aatcaggctccgaagctccttgtgaagtatgcttcccagtccgtctcgggagcgccgtcg cggttcagcggcagtgggtctgggacagatttcaccctcaccatcagcagcccggagcct gaagacgctgccacttactactgccagcaaagtaacaatctccctcg
[0197] அக்கிய்குக்குக்கு24: >IMGT000050|IGKV8-3*01 atggggtcctgacccagctcctctgccttctgctggcctgcctcccagctgccggcggg accactgagttgacccagtctcccacccatctctctgtgtccctgacagacagcgtgtcc gtcatctgcagggccagtgagagcattagtgatcacttaagctggtatcagcagaaacca ggccagcctcccaagcttatcatctatgatgccgataaacctagagtctggcgtctcagac cgcttctctgggattcagtctggcacagaattcatcctcaaaatcagcacagtcgaggct gatgacgccgccgctttattactgccagcagggttatgcgcttctccc
[0198] அக்கிய்குக்குக்கு25: >IMGT000050|IGKV8-16*01 atggggtcctgacccagctcctctgccttctgctggcctgcctcccagctgccagcggg accgctgagttgacccagtctcccacccatctctctgtgtccctgacagacagcgtgtcc ctcatctgcagggccaatgagagcgttagtgattacttaagctggtatcagcagaaacca ggccagcctcccaagcttatcatctatgatgccgataatctagagtctggcgtctcagac cgcttctctgggattcagtctgacacagaattcatcctcaaaatcagcacagtcgaggct gatgacgccgccatttattactgccagcaggattatgcgcttctcc
[0199] IGKJ அக்குக்க்குத்து26: >IMGT000050|IGKJ1*01 gtggacgtttggccaaggaaccaagctggaagtcaaac
[0200] அக்கிய்குக்க்கு27: >IMGT000050|IGKJ2*01 tgtacaatttcggccaggggacgaagctggagataaaac
[0201] அக்கிய்குக்குக்கு28: >IMGT000050|IGKJ3*01 gttcactttcggccagggggaccaaactggagatgaaac
[0202] அக்கிய்குக்க்கு29: >IMGT000050|IGKJ4*01 gctcactttcggcccaggtaccaagctggagatcaaac
[0203] அக்க்கிய்க்குக்கு30: >IMGT000050|IGKJ5*01 gaccacctttggccaagggacacatctggagattaaac
[0204] IGLV அக்க்குக்க்குக்கு31: >IMGT000038|IGLV1-32*01 atggcttggtctccggtccttctcaccctctcgctcactgcacagggtcctgggcccagtctgtactggctcagccatcctcggtgtcaggctccttgggccagagggtcaccatctcctgctctggaagcagttccaacacatcggtagcaattatgtgagctggtaccaacaact cccaggcacaacccccaaaaccataatctattgggataatagcagaccctcgggggtctctgaacgattctctggctccaagtctggcagcacaggcaccctgaccatcactgggctccagggctgaggacgagggctgattattactgctcagcatgggatggtagtctgagagctca
[0205] அக்க்குக்க்குக்கு32: >IMGT000038|IGLV1-36*01 atggcctggtctcctctcctcctcatcctctcgctcactgcacagtgtcctgggcccag tctaggctgactcagccgccctcagtgtctggttctctgggccagagggtcaccatctcc tgcgctggaagcagctctaaattggtggttatggtgtgaactggcaccaacaattccca ggaatggcccccaaaaccatcatctatggtaatagcaatcgaccctctggggtcccagat cgattctccggctccaagtctggcaacacaggcaccctgaccatcactgggctccaggct gaggacgagggctgattatactgctcatcgtgggacagcagtagcagtgctcg
[0206] அக்க்கிய்க்குக்கு33: >IMGT000038|IGLV1-36*01 atggcctggtctcctctcctcctcatcctctcgctcactgcacagtgtcctgggcccag tctaggctgactcagccgccctcagtgtctggttctctgggccagagggtcaccatctcc tgcgctggaagcagctctaaattggtggttatggtgtgaactggcaccaacaattccca ggaatggcccccaaaaccatcatctatggtaatagcaatcgaccctctggggtcccagat cgattctccggctccaagtctggcaacacaggcaccctgaccatcactgggctccaggct gaggacgagggctgattatactgctcatcgtgggacagcagtagcagtgctcg
[0207] Accession number 34: >IMGT000038|IGLV1-37*01 atggcctggtcccctctcctcctcaccctcctcattcactgcacagggtcctgggcccag tctgtgttgagtcagccaccctcagtgtctggggccctgggccagacggtcaccatcccc tgcgctggaggtgccaacaacatcggtattgctggtgggaactggtaccaacagcttcca ggaaaggcccctaaactcctcatctatgatagtagcgatcgaccctcaggggtccctgaa cgattctctggctccaagtctggcaacacaggctccttgaccatcactgggctccaggct gaggacgaggctgattattactgccagtctcttgactttactcaaggtgctga
[0208] Accession number 35: >IMGT000038|IGLV1-40*01 atggcctggacccctcttctcctcaccctacttgctcactgtacagggtcctgggcccag tctgtgctgactcagccaccatcagtgtctgggaccctaggccagaggatcaccatctcc tgcaccggaagcagctccaacatcgggggtggtaatgctgtgagctggtaccaacaagtc ccaggaatgggccccaaaaccgtcatctattggaataacagcaaaccctcgggggtccca gatagattctccggctcaaagtctggcagttcaggcaccctgaccatcactgggctgcag gctgaggacgaggctgattattactgctcagcgtgggatgatagtctcagtgctca
[0209] அக்க்குக்க்குக்கு36: >IMGT000038|IGLV1-42*01 atggcctggtctcctttccttctcactctctcgctcactgcacagggtcctgggcccag tctgtgctgactcagccgccctcagtgtcggggtccctgggccagagggtcaccatctcc tgcactggaagcagctccaacatcgggggtggtaattatgtgagctggtaccaacaagtc ccaggaacggcccccaggctcctgatttatgagaataacaaacgaccctccggggtcccc gatcgattctctggctccaagtctggcagctcaggctccctgaccatcactgggctgcag gctgacgacgagggctgattatttgtgcatcatgggacaatagtctcagtgctca
[0210] அக்க்குக்க்குக்கு37: >IMGT000038|IGLV1-51*01 atggcctggttcctcttctcctgacccttctcatccactgcacagggtcctgggcccag tctgtgctgactcagccgccctcagtgtctggggccctggggcagacggtcaccatctcc tgcgctggaagtaggagcaacatcggtattgctggtgtgaactggtaccaacagcttcca ggaaaggcccctaaactcctctctatgctaatagacagaaacaaccctcatgggttccct gaacgaatccgcgaatctcctggctccaagtctggcaacacaggctccttgaccatcact gggctccagggctgaggacgaggctgattatactgctcagcatgggatgctattctgaaa gctca
[0211] அக்க்குக்க்குக்கு38: >IMGT000038|IGLV1-56*01 atggcctggtcctttctcctcctcaccctctcgctcactgcacagggtcctgggctcag tctgtgctgactcagccgccctcagtgtctggggccctgggccagagggtcaccatctcc tgcactggaagcagctccaacatcgggcgtggtaattatgtgagctggtaccaacaactc tcaggaacagctcccaaactcctcatctatggtaatagcaatcgaccctcggggggtccca gatcgattttctggctccaagtctggcagcacaggctccttgaccatcactgggctgcag gctgaggacgagggctgattatactgtgcagcgtgggacagcagtctcaatgctca
[0212] அக்கிய்குக்க்கு39: >IMGT000038|IGLV1-61*01 atgtcctggtctcctgtccttctcgccctcttcactcactgcacagggtcctgggcccag tctgtactgactcagccaccctcggtgtcaggctccttgggccagagggtcaccatctcc tgcactggaagcagctcccacatcagtaacaattttgtgaactggtaccaacaactccca ggcacaacccccaaaaaccataatcctttgggatgatagcagaccctcgggggtctctgaa cgattctctggctccaagtctggcagcacaggcaccctgaccatcactgggctccaggct gaggacgagggctgattatactgctcagcatgggatgatagtctgagagctca
[0213] அக்கிய்குத்துக்கு40: >IMGT000038|IGLV1-63*01 atggcctggttccctcttctcctcaccctcctcatctactgcacagggtcctgggcccag tctgagctgactcagccgccctcagtgtctggggcctgggccagacggtcaccatctcc tgcgctggaagtaggagcaacattggtattgctggtgtgaactggtaccaacagcatcca ggaaaggcccctaaactcctcatctatggtagtagcaatcgaccctcaggggtccctgac agattttctggctccaagtctggcaacacaggctccttgaccatcactgggctccaggcc gaggacgagggctgattatttgcctgtctgttgacgttacgcgaggtgctga
[0214] அக்க்கிய்க்குக்கு41: >IMGT000038|IGLV1-70*01 atggcctggttccctcttctcctcaccctcctcatctactgcacaggttcctgggcccag tctgagctgactcaaccgccctcagtgtctggggcctgggccagacggtcaccatctcc tgcgctggaagtgccaacaacatcggtagaattggtgtgaactggtaccaacagtttcca ggaaaagcccctaaactcctcatctccgcttatagcaatcaaccctcacgggtttctggt cgattttctggctccacgtctggcaacacaggctccttgaccatcactgggctccaggcc gaggacgagggctgattatactgcacgtctgctgaccctattcaaagtgctca
[0215] அக்க்குக்க்கள் 42: >IMGT000038|IGLV2-24*01 atggcctgggctctggtcctcctcagtctcctcactcaggacacagggtcctgggcccag tctgccctgaatcagcctccctcactgtccggggatctgggacgcacagtcaccatctcc tgtgctggcagcagcaatgacattgggagatatagtgacgtctcctggtaccaacagctc gaaggcacatcccccaaactcctgattcataatgtaaattcccggccttcagggatccct gatcgcttctctggctccaagtctggcaacacggcctccttgaccatctctgggctccag gctgaagatgagggctgattatactgttgctcatatgctagtagtaatactctc
[0216] அக்க்கியுக்க்குக்கு43: >IMGT000038|IGLV3-2*01 atggcctggaccctcttctccctcagtatcctggctcactgcacaggttccatggcctcc tacgtgctgaccagccccgtcggtgtcagtgaacctgggacagacagccagaatcacc tgtgggggaaacaacattggaagtaaacatgcttactggtaccagcagaagccaggccag gcccccatgctggtcatttactagtagcagcaaccggccctcagggatccctgaccgattc tctggcaccaactcgggggaacacggccaccctgaccatcagcggggcccaggctgaggac gaggctgactattactgtcaggtgtgggataacagtggtaatgct
[0217] அக்க்கிய்க்குக்கு44: >IMGT000038|IGLV3-5*01 atggcctggacccctctcctcctcagtgtcctggcatactacacaggctccgtgacctca aacagggtgactcagcccccttccatttcagtggccctgggagagatggcaaggatcacc tgtgagggaaacaacatcggaaatacatatgtttcctggtaccagcagaagccgaaccag gtgcccctgatgattatttatcaggatagcaaccggccttcagggatccctgaccgattc tctggctctaactctgggaacacggccaccctgactgtcagcggggcccgggctgaggat gaggctgactattactgtctgtctgctcacagcagtagtaacgtt
[0218] அக்குக்க்குக்குக்கு45: >IMGT000038|IGLV3-6*01 atggcctggacccctctcctcctcggcctcctcgctcactgcacaggttctgtggcttcc tatgagctgactcagcccccatcagtgtcagtgaacctgggacagacggccaggatcaca tgtggaggaaaacaacattggaaataagatgcttactggtaccagcagaagtcaggccag gcccccatgctgattatctatgaggacagcaaacggccctcagggatccctgaccgattc tctggcaccaactcagggaacatggccaccttgaccatcagcggggcccgggccgaagat gaggctgactattactgccaggtgtgggacagcagtagtgatgct
[0219] அக்க்கியுக்குக்கு46: >IMGT000038|IGLV3-7*01 atggcctggacccctctcatcctcagcctcctcacttactgcacaggttccatagcctcc tatgtgctgactcagcccccctcagtgtcggtgagcctgggacagacggccaggaccacc tgtggaggaaaacaacattgaaagcaaaagtgttcactggtaccagcagaagtcaggccaa acccctgtgctgattatctagatgatagcaaccggccctcaggaatccccgaccgattc tcaggcaccaactcgggggaacacggccaccctgaccatcagcggggcccgggccgaggac gaggctgactattactgtcaggtgtgggacagtagtagtgatgct
[0220] அக்க்குக்க்குக்கு47: >IMGT000038|IGLV3-11*01 atggcctggacccctctcctgctccccctccttactctttgcacaggattcgtggcctcc agtgaggtgactcagccgccctcagtgtcagtggccctgggacagacggctagaatcacc tgctctggagatatgatggagaaaaaatataccaattggcaccagcagaagccaggtcaa gcccccatacagatcatttaataaggatagtgagcggccctcagggatccctgaccgattc tctagctccagttcagggaaaacagtcaccctgaccatcagcggggcccgggccgaagac gaggctgactactactgtcagtcttatgacatcagtagtaatgct
[0221] அக்க்குக்க்குத்து48: >IMGT000038|IGLV3-13*01 atggcctggacccctctcctctcggcctcctcgctcactgcacaggctccgtggcctcc tatgtgctgactcagcccccatcagtggcagtgaacctgggacagacggccaggatcaca tgtggaggaaaacaacattggaagtagttatgcttactggtaccagcagaagtcaggccag gcccctgtgctgattatctataaggatagcaaccggccctcagggatccctgaccgattc tcaggcaccaactcgggggaacacggccaccctgaccatcagcggggcccgggccgaggac gaggctgactattactgtcagtcatatgacagcaactatgatcct
[0222] அக்க்குக்க்குக்கு49: >IMGT000038|IGLV3-17*01 atggcctggactcctctcctgctccccctccttattctctgcacaggttctgtgacagct tctgaactgactcagccacctgcggtgtctgtggccttgggacagacggccacgattaca tgcgagggagacagcttcgaaagcagtatgattaactggtatcagcagaaatcaggccaa gccccccgtgctggtcatttatgagtagagtgagcagcccacagggattcctgacagattc tctggctccaactcggggatgcagccactctgaccatcaccggggcccaggctgaggac gaggctgactattactgtcagtcctatgataacagtggtgatgct
[0223] அக்குக்க்குத்துக்கு50: >IMGT000038|IGLV3-20*01 atggcctggacccctctcctccttggcctcctcgctcactgcacaggctccgtggcctcc tatgtgctgactcagcccccatcagtggcagtgaacctgggacagacagccaggatcaca tgtggaggaaaacaacattggaagtagttatgcttactggtaccagcagaagtcaggccag gcccctgtgctgattatctatgaggacagcaaacggccctcagggatccctgaccgattc tcaggcaccaactcgggggaacacggccaccctgaccatcagcggggcccgggccgaggac gaggctgactattactgtcaggtgtgggataacagtggtaatgct
[0224] அக்குக்க்குக்குக்கு51: >IMGT000038|IGLV3-23*01 atggcctggacccctctcctctcggcctcctcgcttactgcacaggctccatggcctcc tacgtgctgactcagccccccgtcagtgtcaatgaacctgggaaagacggccaggatcacg tgtggaggaaaacaacattggaagtaaaatatgcttactggtaccagcagaagccaggccgg gccccgatgatgattatctatgatgatagcaaaggtcctcaaggacccctgaccgattc tcaggcaccaactcgggggaacacggccaccctgaccatcagcggggcccaggccgaggac gaggccaactattactgtcaggtgtggggtggcaatagtgatcct
[0225] அக்குக்க்குக்குக்கு52: >IMGT000038|IGLV4-15*01 atggactgggctcccttctacctctgcccttcattttctctacaggtttctgtgctctg cctgtgctgacccaggctccatctgcatctgcctcacttggagcctcagtcaagctcacc tgcaccctgagcagtgaacacagcaattactttgtttggtggtatcaacagagaccagag aaggcccctcggtatttgatgaaggttaacagtgatggaagccacatcaaaggagacgga atccccagtcgcttctcaggctcaagctctggggctgatcgctactttaaccatctccaac atccagcctgaggatgaggctgactattactgtggtgagaagcatacaattgatggtcaa accggttaagc
[0226] அக்குக்க்குக்குக்கு53: >IMGT000038|IGLV5-30*01 atggcctggattcctcccctcctagtgctcctctgtcactgcacatgttccatctcccaa tttgtggtgacccagccaccttccctctctgcatctctgggaacaacagccagactcacc tgcaccctcaacagtgaaaggactgatatttaccccatattctggtaccagcaaaagcca gggagccttctcgttacctccttacctatgtaacagactcaaataagcatcaaggctct ggggtccccagccgcttctctggatccaaagatacctctgccaatgcagggattttgctc atttccgggattcaatcagaggatgaggcagactattactgtcagtcatttgatgttggt gaccga
[0227] அக்குக்க்குக்குக்கு54: >IMGT000038|IGLV5-34*01 atggcctggatccccatcctcctcgtgttcctctgtcactgcacaggttccctgtcccag cctgtcgtgactcagccagcctccctctctgcatctctgggagccacagccagactcacc tgcaccctgagcagggacatcaatgctggaggctactacatatactggtaccaacagaag ccagggagccctccccggtatctcctgtactactactcagattcaaataagcaccagggc cccggggtccccagccgcttctccgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggctgcagcctgaggacgaggctgactattactgtgcaacttggcacagt agtgctggt
[0228] அக்குக்க்குக்குக்கு55: >IMGT000038|IGLV5-46*01 atggcctggacccatgctctcctcgtgctcttctgccactgcacaggttccctgtcccag cctgtcgtgactcagccaccctccctctctgcatctctgggagcaacagccagactcacc tgcaccctcagcagggaagtgagcgttggtagtaaaagcatatactggtaccaacagaag ccagggagccctcctcggtatttcctgtactactactcagactccagcaatgagctggga cccggggtccccagtcgagtgtctgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggctgcagcctgaggacgaggctgactattactgtgctatagcacatggc agtggaagcagctttggtact
[0229] அக்குக்க்குக்குக்கு56: >IMGT000038|IGLV5-48*01 atggcttggactcttctagtcctcatgcttgtgtctcaatggacaggttccctgtcccag cctgtgctgacccagccgtcctccctgtctgcatctcctggaacaacagccagactcacc tgcaccctgagcagcgggttcagtgttggaggctactacataaattggttccagcagaag ccagggagccctccccggtatctcctgtactactactcagattcaaataagcaccagggc cctggggtccccagccgcttctccgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggccgcagcctgaggacgaggctgactattactgtgctatagcacatggc agtggaagcagctaccgttact
[0230] அக்க்குக்க்குக்குக்கு57: >IMGT000038|IGLV5-49*01 atggcctggatccccgtcctcctcgtgctcctctgtcactgcgcaggttccctgtcccag cctgtcgtgactcagccaccctccctctctgcatctctgggagcaacagccagactcacc tgcaccctcagcagggaagtgagcgttggtagtaaaagcatatactggtaccaacagaag ccagggagccctcctcggtatttcctgtactactactcagactccagcaatgagctggga cccggggtccccagtcgagtgtctgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggctgcagcctgaggacgaggctgactattactgtgctatagcacatggc agtggaagcagctaccgttact
[0231] அக்குக்க்குக்குக்கு58: >IMGT000038|IGLV5-55*01 atggcctggactcctgtcctcctcatgctcctctcccattgtgcaggttccctgtcccag cctgtgctgacccagccgtcctccctgtctgcatctccgggaacaacagccagactcacc tgcaccctgagcagcggcttcaatgttggaggctactacataagttggttccagcagaag ccagggagccctccccggtatctcctgtactactactcagactcagataagcaccagggc cccggggtccccagccgcttctccgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggccgcagcctgaggacgaggctgactattactgtgctacagatcatggc agtggtact
[0232] அக்குக்க்குக்குக்கு59: >IMGT000038|IGLV5-66*01 atggcttggcctcttctcgtcctcatactcctgtctcactgcacaggttccctgtcccag cctgtgctgaccagccgccctccctgtctgcatctccgggaacaacagccagactcacc tgcaccctgagcagcggcttcaatgttggaggctactacataagttggttccagcagaag ccagggagccctccccggtatctcctgtactactactcagactcagataagcaccagggc cccggggtccccagccgcttctccgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggccgcagcctgaggacgaggctgactattactgtgctacaggttatggc agtgggagcagctaccgttact
[0233] அக்கிய்குக்குக்கு60: >IMGT000038|IGLV5-68*01 atggcctggatctccgtcctctcgtgctcctctgtcactgcgcaggttccctgtctcag cctgtcgtgactcagccagcctccctctctgcatctctgggagcaacagccagactcacc tgcacgctgagcagggacatcaatgttggaggctactacatatactggtaccaacagaat ccagggagccctccccggtatctcctgtactactactcagactccagtacacagttggga cctggggtccccagccgcttctccggatccaaagatgcctcggccaatgcagggcttctg ctcatctctgggctgcagcctgaggacgaggctgactattactgtgcaatcgggcacagt agtgctggt
[0234] அக்குக்க்குத்தி61: >IMGT000038|IGLV5-71*01 atggcctggatccccatcctcctcgtgctcctctgtcactgcacaggttccctgtcccag cctgtcttgactcagccagcctccctctctgcatctctgggagcaacagccagactcacc tgcaccctgagcagggacatcaacgttggaagctataacatactggtaccaacagaag ccagggagccctccccggtatctcctgtactactactcagactcagataagcaccagggc cctggcgtccccagccgcttctctgggtccaaagatgcctcggccaatgcagggcttctg ctcatctctgggctgcagcctgaggacgaggctgactattactgtgcaatctggcacagt agtgctggt
[0235] அக்க்குக்க்குக்குக்கு62: >IMGT000038|IGLV5-79*01 atggcttggaccccttttttccttgtgttcctggctcactgcacaggttccctgtctcag ccggtgctgacccagccaccctccctctctgcatctctgggaacttctgtgagacttacc tgtaccctgagcagtggcttcagagttggtgatttctggataaactggtaccagcagaat ccagggaaccctccccggtatctcctgtactaccactcagactcagataaacaccagggc tccggggtccccagccgcttctctggatccagtgatgcctcggccaatgcagggcttctg ctcatctctgggctgcagcctgaggatgaggctgactattactgtagcacatggcatggc aactctaagtctta
[0236] Accession number 63: >IMGT000038|IGLV12-26*01 atggcctgggctcttctcctgttcacacttctgtctcactgcacaggggccacttcccag gaagtagtgactcaggaaacttcactctcaacaactcctggaggaacagtcacactcacc tgtggctccagtactggggctgtcaccaccagtaattatgccagctgggtccaacagaag ccctaccagagattccagggtctgataggtgggaccagctaccggaacccaggggtccct gcccgattctctggctccctggttggacagaaggccgtcctcaccatcacgggggcgcag tcagaggatgaagctgagtattactgtgttctgtggttcagcaaccattac
[0237] IGLJ Accession number 64: >IMGT000038|IGLJ1*01 ttgggtgttcggcggaggtacccatctgagcgtcctag
[0238] Accession number 65: >IMGT000038|IGLJ2*01 tcatattttcggtggagggacccatctgactgtcctcg
[0239] Accession number 66: >IMGT000038|IGLJ4*01 ttatgttttcggcggagggaccaaggtgaccgtcctcg
[0240] Accession number 67: >IMGT000038|IGLJ5*01 tcctattttcggcggagggacccgtctgaccgtcctcg
[0241] SEQ ID NO: 68: >IMGT000038|IGLJ6*01 ttttgtttttggcagagggacctggctgacggtcctag
[0242] SEQ ID NO: 69: >IMGT000038|IGLJ7*01 tgctttgttcggcggagggacccatctgaccgtcctcg
[0243] SEQ ID NO: 70: >IMGT000038|IGLJ8*01 ttgggtgtttggcgatggaacccagctgactgtattag
[0244] SEQ ID NO: 71: >IMGT000038|IGLJ9*01 tattgtgttcggcggagggacccatctgaccgtcctcg
[0245] SEQ ID NO: 72: >IMGT000038|IGLJ10*01 ttgggtgtttggcgatggaacccagctgactgtattag
[0246] SEQ ID NO: 73: >IMGT000038|IGLJ11*01 tattgtgttcggcggagggacccatctgaccgtcctcg
[0247] Pre-D This is a 21609 bp fragment upstream of the Ighd-5DH gene. The pre-D sequence is found on chromosome 12 of the mouse strain C57BL / 6J, assembly: GRCm38.p4, annotation release 106, sequence ID: NC_000078.6 The entire sequence is located between two 100 bp sequences shown below: Upstream of the Ighd-5DH gene segment corresponding to positions 113526905-113527004 of NC_000078.6: SEQ ID NO:74: ATTTCTGTACCTGATCTATGTCAATATCTGTACCATGGCTCTAGCAGAGATGAAATATGAGACAGTCTGATGTCATGTGGCCATGCCTGGTCCAGACTTG
[0248] 2 kb upstream of the Adam6a gene, corresponding to positions 113526905-113527004 of NC_000078.6: SEQ ID NO: 75: GTCAATCAGCAGAAATCCATCATACATGAGACAAAGTTATAATCAAGAAATGTTGCCCATAGGAAACAGAGGATATCTCTAGCACTCAGAGACTGAGCAC
[0249] Adam6a Adam6a (a disintegrin and metallopeptidase domain 6A) is a gene involved in male reproductive function. The Adam6a sequence is found on chromosome 12 of the mouse strain C57BL / 6J, at positions 113543908-113546414 in assembly GRCm38.p4, annotation release 106, sequence ID NC_000078.6. Adam6a sequence ID: OTMUSG00000051592 (VEGA)
Claims
1. 1. A transgenic rodent having a genome in which an endogenous rodent immunoglobulin variable locus has been deleted and replaced with a partial feline immunoglobulin locus comprising a feline immunoglobulin variable gene coding sequence and non-coding regulatory sequences based on the endogenous rodent immunoglobulin variable locus, A transgenic rodent, wherein the partial feline immunoglobulin locus of the transgenic rodent is functional and expresses immunoglobulin chains comprising a feline variable domain region and a rodent constant domain.
2. A partial feline immunoglobulin locus is identified in cat V. H , D H , and J. H 2. The transgenic rodent of claim 1, comprising a feline kappa VL and JL coding sequence, a feline kappa VL and JL coding sequence, a feline lambda VL and JL coding sequence, or a combination thereof.
3. A transgenic rodent as described in claim 1, wherein a feline immunoglobulin variable gene coding sequence is embedded in an endogenous rodent immunoglobulin variable region gene non-coding sequence.
4. 2. The transgenic rodent of claim 1, wherein the non-coding regulatory sequences include a promoter preceding each V gene segment, splice sites, and a recombination signal sequence for V(D)J gene rearrangement.
5. A partial feline immunoglobulin locus (i) ADAM6 gene; (ii) Pax-5 activating intergenic repeat (PAIR) element; (iii) a CTCF binding site from heavy chain intergenic control region 1; or (iv) Any combination of (i) to (iii) The transgenic rodent of claim 1 further comprising:
6. A B lymphocyte lineage cell derived from the transgenic rodent of claim 1.
7. A hybridoma or immortalized cell derived from a B lymphocyte lineage cell according to claim 6.
8. 8. Part or all of an immunoglobulin molecule comprising a feline variable domain and a rodent constant domain derived from a B lymphocyte lineage cell according to claim 6 or a hybridoma or immortalized cell according to claim 7.
9. 10. A method for generating the transgenic rodent of claim 1, comprising: a) integrating in the genome of a rodent cell at least one target site for a site-specific recombinase upstream of an endogenous immunoglobulin variable locus and at least one target site for a site-specific recombinase downstream of the endogenous immunoglobulin variable locus, wherein the endogenous immunoglobulin variable locus is (i) a V H , D H , and J. H gene segments, (ii) Vκ and Jκ gene segments, (iii) Vλ and Jλ gene segments, or (iv) Vλ and Jλ gene segments and Cλ genes; b) providing a vector comprising a partial feline immunoglobulin locus comprising partial feline immunoglobulin variable region gene segments, wherein each of the partial feline immunoglobulin variable region gene segments comprises a feline immunoglobulin variable region gene coding sequence and a rodent non-coding regulatory sequence, and wherein the partial feline immunoglobulin variable region locus is flanked by target sites for a site-specific recombinase, the target sites being capable of recombination with the target sites introduced into the rodent cell in step a); c) introducing the vector of step b) and a site-specific recombinase capable of recognizing the target site into said cells; d) causing a recombination event to occur between the genome of said cell and the partial feline immunoglobulin locus, resulting in replacement of the endogenous immunoglobulin variable locus with the partial feline immunoglobulin locus; e) selecting cells containing the partial feline immunoglobulin variable loci generated in step d); and f) using said cells to create a transgenic rodent containing a partial feline immunoglobulin variable locus; A method comprising:
10. 10. The method of claim 9, further comprising, prior to the introducing step and after the providing step, deleting the endogenous immunoglobulin variable loci by introducing a recombinase that recognizes a first set of target sites, wherein the deleting step leaves in place at least two target sites that cannot recombine with each other in the genome of the rodent cell.
11. Vector is (i) Cat V H , D H , and J. H coding sequence; (ii) either kappa or lambda V L and J L coding sequences; (iii) V gene promoters, splice sites, and recombination signal sequences of endogenous host origin; (iv) ADAM6 gene; (v) Pax-5 activating intergenic repeat elements; (vi) a CTCF binding site from heavy chain intergenic control region 1; or (vii) Any combination of (i) to (vi) 10. The method of claim 9, comprising:
12. 1. A method for producing an antibody for therapeutic or diagnostic use, comprising: (i) expressing antibodies with cloned feline variable domains from antibody-producing cells of a transgenic rodent, wherein the genome of the transgenic rodent has been deleted and contains a chimeric V domain at the immunoglobulin heavy chain locus; H , D., and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V at the immunoglobulin light chain locus. L and J. L an endogenous rodent immunoglobulin locus variable region replaced with an immunoglobulin locus variable region comprising at least one of each of the variable gene segments, each chimeric gene segment comprising a feline V, D, or J immunoglobulin variable region coding sequence and a rodent immunoglobulin variable region non-coding gene segment sequence; and (ii) isolating antibodies with feline variable domains that are suitable for therapeutic or diagnostic use; A method comprising:
13. The method of claim 12, wherein the antibody is cloned from a B cell of a transgenic rodent.
14. A therapeutic or diagnostic antibody produced by the method of claim 12 or 13.
15. 1. A method for producing a therapeutic or diagnostic antibody having a feline variable domain, comprising: (i) cloning the feline variable domains of antibodies expressed by antibody-producing cells from a transgenic rodent, wherein the genome of the transgenic rodent is deleted and contains a chimeric V domain at the immunoglobulin heavy chain locus; H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V at the immunoglobulin light chain locus. L and J. L an endogenous rodent immunoglobulin locus variable region replaced with an immunoglobulin locus variable region comprising at least one of each of the variable gene segments, each chimeric gene segment comprising a feline V, D, or J immunoglobulin variable region coding sequence and a rodent immunoglobulin variable region non-coding gene segment sequence; and (ii) producing a therapeutic or diagnostic antibody comprising the feline variable domain of the antibody expressed by the transgenic rodent; A method comprising:
16. 16. The method of claim 15, wherein the feline variable domain is cloned from an antibody expressed by a B cell derived from a transgenic rodent.
17. A therapeutic or diagnostic antibody produced by the method of claim 15 or 16.
18. 1. A method for producing a monoclonal antibody comprising a feline variable domain, comprising: (i) The endogenous rodent immunoglobulin locus variable region is deleted, resulting in a chimeric V at the immunoglobulin heavy chain locus. H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V at the immunoglobulin light chain locus. L and J. L providing B cells from a transgenic rodent having a genome replaced with an immunoglobulin locus variable region comprising at least one of each of the variable gene segments, wherein each chimeric gene segment comprises a feline V, D, or J immunoglobulin variable region coding sequence embedded in a rodent immunoglobulin variable region non-coding gene segment sequence; (ii) immortalizing B cells; and (iii) isolating a monoclonal antibody containing a feline variable domain expressed by the immortalized B cells or a gene encoding the antibody; A method comprising:
19. (iv) cloning the feline variable domains expressed by B cells; and (v) producing therapeutic or diagnostic antibodies comprising the cloned feline variable domains from B cells of the transgenic rodent; 20. The method of claim 18, further comprising:
20. A method for producing an antibody comprising a feline variable domain, wherein the endogenous rodent immunoglobulin locus variable region is deleted and a chimeric V at the immunoglobulin heavy chain locus is generated. H , D H , and J. H At least one of each of the immunoglobulin variable region gene segments and / or a chimeric V at the immunoglobulin light chain locus. L and J. L providing a transgenic rodent having a genome replaced with an immunoglobulin locus variable region comprising at least one of each of the variable gene segments, wherein each chimeric gene segment comprises a feline V, D, or J immunoglobulin variable region coding sequence embedded in a rodent immunoglobulin variable region non-coding gene segment sequence, and wherein the immunoglobulin locus of the transgenic rodent expresses antibodies comprising the feline variable domains.
21. 21. The method of claim 20, further comprising isolating an antibody comprising a feline variable region expressed by the transgenic rodent or a gene encoding the antibody.
22. (i) obtaining B cells from the transgenic rodent that express an antibody that is specific for the target antigen; (ii) immortalizing B cells; and (iii) isolating antibodies specific for the target antigen from the immortalized B cells; 21. The method of claim 20, further comprising:
23. 23. The method of claim 22, further comprising cloning the feline variable region from a B cell that is specific for a particular antigen.
24. 24. The method of claim 23, further comprising producing therapeutic or diagnostic antibodies using the feline variable regions cloned from said B cells.
25. A therapeutic or diagnostic antibody produced by the method of any one of claims 20 to 24.