Analytical method, kit and device for detection

Abstract

To provide analytical methods and kits that can simply determine the risk of developing each of breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colorectal cancer in a subject under analysis.SOLUTION: According to embodiments, provided are analytical methods and kits that determine the risk of developing each of breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colorectal cancer in a subject under analysis, including quantifying a target miRNA selected from a group of target miRNAs in a sample derived from the subject.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] Embodiments of the present invention relate to analytical methods, kits and detection devices. [Background technology]

[0002] In recent years, the relationship between microRNA (miRNA) and disease has been attracting attention. miRNA has the function of regulating gene expression, and it has been reported that the type and expression level of miRNA changes from the early stages of various diseases. That is, in patients with a certain disease, the amount of a specific miRNA increases or decreases compared to healthy individuals. Therefore, examining the amount of the miRNA in a sample collected from a subject is a means of knowing whether the patient is suffering from the disease. Summary of the Invention [Problem to be solved by the invention]

[0003] The problem to be solved by the present invention is to provide an analytical method, a kit, and a detection device that can simply determine whether or not an analytical subject is suffering from at least one of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer. [Means for solving the problem]

[0004] According to an embodiment, an analytical method is provided, which includes quantifying at least one of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-143-3p, hsa-miR-4770, hsa-miR-1296-5p, hsa-miR-125a-5p, hsa-miR-409-3p, hsa-miR-99a-5p, and hsa-miR-215-5p in a sample derived from a subject, and determining that the subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer. [Brief description of the drawings]

[0005] [Figure 1]FIG. 1 is a flowchart showing an example of an analytical method of the first embodiment, in which (a) is an example of an analytical method including a quantification step of any one of the first target miRNAs, (b) is an example of an analytical method including a determination step of determining that a subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer, (c) is an example of an analytical method including a determination step of determining the prognosis or the presence or absence of recurrence, and (d) is an example of an analytical method including a selection step of selecting a type of therapy or a type of drug to be applied to a subject. [Diagram 2] FIG. 2 is a flowchart showing an example of an analytical method of the second embodiment, in which (a) is an example of an analytical method including a quantification step of any one of the second target miRNAs, (b) is an example of an analytical method including a determination step of determining whether a subject is likely to be affected by all of breast cancer, pancreatic cancer, and colorectal cancer, (c) is an example of an analytical method including a determination step of determining the prognosis or the presence or absence of recurrence, and (d) is an example of an analytical method including a selection step of selecting a type of therapy or a type of drug to be applied to the subject. [Figure 3A] FIG. 3A is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-126-3p samples by cancer type. [Figure 3B] FIG. 3B is a box plot showing the experimental results of Example 1, showing the quantitative results of hsa-miR-326 samples by cancer type. [Figure 3C] FIG. 3C is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-28-3p samples by cancer type. [Figure 3D] FIG. 3D is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-425-3p samples by cancer type. [Figure 3E] FIG. 3E is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-93-3p samples by cancer type. [Figure 3F] FIG. 3F is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-24-3p samples by cancer type. [Figure 3G]FIG. 3G is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-222-3p samples by cancer type. [Figure 3H] FIG. 3H is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-361-5p samples by cancer type. [Figure 3I] FIG. 3I is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-342-3p samples by cancer type. [Figure 3J] FIG. 3J is a box plot showing the experimental results of Example 1, showing the quantification results of hsa-miR-10b-5p samples by cancer type. [Figure 4A] FIG. 4A is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-128-3p samples by cancer type. [Figure 4B] FIG. 4B is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-151a-3p samples by cancer type. [Figure 4C] FIG. 4C is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-143-3p samples by cancer type. [Figure 4D] FIG. 4D is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-4770 samples by cancer type. [Figure 4E] FIG. 4E is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-1296-5p samples by cancer type. [Figure 4F] FIG. 4F is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-125a-5p samples by cancer type. [Figure 4G] FIG. 4G is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-409-3p samples by cancer type. [Figure 4H] FIG. 4H is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-99a-5p samples by cancer type. [Figure 4I]FIG. 4I is a box plot showing the experimental results of Example 2, showing the quantification results of hsa-miR-215-5p samples by cancer type. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0006] Hereinafter, an analysis method, a kit, and a detection device according to embodiments will be described with reference to the drawings. First embodiment (Analysis method) The analytical method according to the first embodiment is an analytical method including quantifying at least one of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-143-3p, hsa-miR-4770, hsa-miR-1296-5p, hsa-miR-125a-5p, hsa-miR-409-3p, hsa-miR-99a-5p, and hsa-miR-215-5p in a sample derived from a subject, and determining that the subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer.

[0007] The nine types of miRNAs described above are also referred to as the "first target miRNA group" in the following description (or may be abbreviated to simply "target miRNA group"). Each miRNA constituting the target miRNA group is also referred to as the "first target miRNA" (or may be abbreviated to simply "target miRNA").

[0008] For example, the target miRNAs are represented by the base sequences shown in Table 1 below. In this specification, the notation "T" in the sequence table corresponding to each SEQ ID NO: means "U." The target miRNA to be quantified may be one type among the target miRNA group.

[0009] [Table 1]

[0010] The subject is an animal that is subjected to analysis in the present method, that is, an animal that provides a sample. The subject may be an animal with some disease, or may be a healthy animal. For example, the subject may be an animal that may be suffering from cancer, or an animal that has suffered from cancer in the past, and in particular, an animal that may be suffering from at least one of breast cancer, pancreatic cancer, lung cancer, stomach cancer, and colon cancer, or an animal that has suffered from at least one of breast cancer, pancreatic cancer, lung cancer, stomach cancer, and colon cancer in the past. The subject is preferably a human.

[0011] Alternatively, the subject may be another animal. The other animal may be, for example, a mammal, including, for example, a primate such as a monkey, a rodent such as a mouse, a rat or a guinea pig, a companion animal such as a dog, a cat or a rabbit, a livestock animal such as a horse, a cow or a pig, or an exhibition animal. In the case of an animal other than a human, the target miRNA is a miRNA that corresponds to the above-mentioned miRNA present in the animal.

[0012] Samples derived from a subject include samples collected from a subject or samples that have been appropriately treated therefrom. The sample is preferably serum or plasma. The sample may be other body fluids, such as blood, leukocyte interstitial fluid, urine, stool, sweat, saliva, oral mucosa, nasal mucosa, nasal discharge, pharyngeal mucosa, sputum, digestive fluid, gastric juice, lymphatic fluid, cerebrospinal fluid, tears, breast milk, amniotic fluid, semen, or vaginal fluid. Alternatively, the sample may be tissue or cells, etc., and may be tissue or cells collected from a subject and cultured, or the supernatant thereof.

[0013] In the present specification, the various types of "cancer" include any stage of the disease, for example, a state in which the cancer remains in the organ where it originated, a state in which the cancer has spread to surrounding tissues, a state in which the cancer has spread to lymph nodes, and a state in which the cancer has spread to more distant organs. For example, in the present specification, breast cancer refers to a malignant tumor (neoplasm) formed in mammary gland tissue. In addition, for example, breast cancer also includes those generally referred to as "breast cancer" or "breast cancer". In the present specification, the various types of cancer include, for example, epithelial tumors, non-epithelial tumors, or tumors consisting of both epithelial and non-epithelial tumors.

[0014] An example of the procedure of the method of the first embodiment will be described below with reference to (a), (b) and (c) of FIG.

[0015] As shown in FIG. 1(a), the analysis method is, e.g. Preparing a sample derived from a subject (preparation step (S11)); and quantifying one of the first target miRNA group in a sample derived from the subject (quantification step (S12)).

[0016] First, a sample derived from a subject is prepared (preparation step (S11)). The sample can be collected using a general method according to the type of sample. The sample may be used as is after collection, or may be treated so as to be in a state that does not inhibit the reaction for quantifying nucleic acid or to be in a state that is more suitable for the reaction. The treatment may be, for example, shredding, homogenization, centrifugation, precipitation, extraction and / or separation, and may be performed by any known means.

[0017] For example, the extraction may be performed using a commercially available nucleic acid extraction kit. Examples of the nucleic acid extraction kit that can be used include NucleoSpin (registered trademark) miRNA Plasma (manufactured by Takara Bio), Quick-cfRNA Serum & Plasma Kit (manufactured by Zymo Research), miRNeasy Serum / Plasma Kit (manufactured by Qiagen), miRVana (registered trademark) PARIS isolation kit (manufactured by Thermo Fisher), PureLink (registered trademark) Total RNA Blood Kit (manufactured by Thermo Fisher), Plasma / Serum RNA Purification Kit (manufactured by Norgen Biotek), microRNA Extractor (registered trademark) SP Kit (manufactured by Wako Pure Chemical Industries, Ltd.), and High Pure miRNA Isolation Kit (manufactured by Sigma-Aldrich Co., Ltd.). Alternatively, the extraction may be performed without using a commercially available kit, for example, by diluting the sample with a buffer solution, heating the sample at 80 to 100°C, centrifuging the sample, and collecting the supernatant.

[0018] Next, one of the first target miRNA group contained in the subject-derived sample is quantified (quantification step (S12)). The quantification step (S12) can be performed using a general method for quantifying RNA, particularly short-chain RNA such as miRNA. A general method includes, for example, reverse transcribing the target miRNA to generate cDNA, amplifying the obtained cDNA, and detecting and quantifying the amplified product. When the RNA is short-chained, in order to facilitate amplification, it is generally practiced to extend the short-chain RNA so as to add an artificial sequence to the end thereof, and then reverse transcribe the RNA, or to extend the cDNA obtained by reverse transcription so as to add an artificial sequence to the end thereof. In addition, rolling circle amplification is known as a technique for directly amplifying RNA in a sample without reverse transcription, and detecting and quantifying the amplified product. Furthermore, when the concentration of the target miRNA in the sample is relatively high or when a device capable of high-sensitivity measurement is available, one general method is to directly detect the target miRNA (or its cDNA) without amplifying the target miRNA. An example of a device capable of direct detection is a microarray equipped with a nucleic acid probe that specifically binds to a target miRNA.

[0019] For example, PCR (including qPCR) or LAMP can be used for amplification. Detection and quantification can be performed after amplification or over time during amplification. For example, a measurement method using a signal based on turbidity or absorbance, a measurement method using an optical signal, or a measurement method using an electrochemical signal, or a combination thereof, can be used for detection and quantification. For example, the target miRNA can be quantified from the intensity or change in the signal obtained according to the amount of amplification product, or the time until the signal reaches a threshold (rise time), or the rise cycle number when using PCR. In addition, for example, the results of next-generation sequencing (NGS) can be used for detection and quantification. In that case, the target miRNA can be relatively quantified from the detection results such as the number of reads aligned to the target miRNA.

[0020] The quantitative value of the target miRNA may be determined using a calibration curve that represents the relationship between the detection result of the signal and the amount of the target miRNA present. The calibration curve can be created by detecting signals for a plurality of standard samples that contain the target miRNA at different known concentrations. The amount of the target miRNA present in the sample can be calculated by comparing the calibration curve with the detection result of the signal obtained for the sample derived from the subject. The amount of the target miRNA present in the sample may be calculated, for example, as the number of copies of the target miRNA per unit amount of the sample.

[0021] The quantification in the quantification step (S12) may be performed using, for example, a commercially available kit. Examples of commercially available kits include TaqMan (registered trademark) Advanced miRNA Assays (manufactured by Thermo Fisher Scientific, catalog No. A25576), miRCURY (registered trademark) LNA (registered trademark) miRNA PCR Assays (manufactured by Qiagen, catalog No. 339306, SYBR (registered trademark) Green qPCR microRNA Detection System (manufactured by Origin Technologies), etc., and may be used together with primers and probes that specifically amplify the target miRNA.

[0022] The data related to the detection of the first target miRNA obtained in the quantification step (S12) can be used to determine whether the subject may have breast cancer, pancreatic cancer, lung cancer, stomach cancer, or colorectal cancer. For example, as shown in (b) of FIG. 1, the analysis method of the first embodiment may further include a step (S13) of determining whether the subject may have breast cancer, pancreatic cancer, lung cancer, stomach cancer, or colorectal cancer, which is performed after the quantification step (S12).

[0023] In addition, "determining that the subject is likely to be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer" means that it is determined that the subject is likely to be affected by all of the five types of cancer, but that the type of cancer the subject has is not specific to any one of the five types of cancer, or that the subject is not affected by any of the five types of cancer.

[0024] An expression synonymous with "the subject may be affected by all five types of cancer, but the type of cancer the subject has is not specific to any one of the five types of cancer" is "determining whether or not the subject has at least one of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer."

[0025] In other words, by "determining that the subject may be affected with all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer," the possibility that the subject has breast cancer, the possibility that the subject has pancreatic cancer, the possibility that the subject has lung cancer, the possibility that the subject has gastric cancer, and the possibility that the subject has colorectal cancer are presented all at once, or the possibility that the subject does not have any of breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colorectal cancer is presented.

[0026] That is, the method of this embodiment is intended as a primary screening in cancer screening, and in view of the importance of early detection and early treatment of cancer, to present the possibility of as many types of cancer as possible without overlooking them.

[0027] The determination step (S13) can provide information that assists in determining whether the subject is likely to be affected with all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer.

[0028] For example, the determination step (S13) is performed based on the quantitative value of the first target miRNA in the control-derived sample, which is obtained by performing quantification on the control-derived sample in parallel with the quantification step (S12) on the subject-derived sample. That is, the method of the first embodiment includes quantifying the first target miRNA in the control-derived sample; and determining that the subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer by comparing the quantitative value of the first target miRNA in the subject with the quantitative value of the first target miRNA in the control.

[0029] The quantitative value of the first target miRNA in the control is a quantitative value of the target miRNA obtained in advance, for example, by using the same method as that used in the quantification step (S12) for a sample that is the same as or similar to the sample derived from the subject (for example, if the sample derived from the subject is serum, the sample derived from the control is serum or plasma). Note that multiple samples corresponding to the control may be prepared, and the determination may be made based on a numerical range consisting of values ​​obtained by quantifying each of the multiple samples.

[0030] The control may be, for example, a healthy individual. A healthy individual refers to an individual who is at least not affected by cancer. A healthy individual is preferably a healthy individual who does not have a disease or abnormality.

[0031] The individual selected as the control may be an individual different from the subject analyzed by the present method, but is preferably an individual belonging to the same species, i.e., if the subject is human, it is preferably a human. In addition, the physical conditions such as age, sex, height, weight, etc., or the number of the control are not particularly limited, but the physical conditions are preferably the same or similar to those of the subject to be examined by the present analysis method.

[0032] Alternatively, the determination step (S13) may be performed based on a preset threshold value or the like. The threshold value is, for example, the abundance of the first target miRNA that can distinguish between a quantitative value in a sample known to be affected with at least one of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer (hereinafter referred to as a "standard sample") and a quantitative value in a healthy subject. The standard sample is, for example, a sample from another site derived from the subject, a sample from an individual similar to the subject (for example, the same species), or a sample containing at least one of established cell lines of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer. The quantitative value in the standard sample is preferably obtained by applying the same method as in the quantitative determination step (S12) of the subject. The value that distinguishes between the quantitative value in the standard sample and the quantitative value in a healthy subject may be determined by a statistical criterion, or the maximum or minimum value of the quantitative value in the standard sample may be used as the threshold, or the maximum or minimum value of the quantitative value in the control may be used as the threshold. Furthermore, the threshold value may be determined according to the quantification method used, the type of sample, the measurement conditions, and the like.

[0033] Alternatively, the threshold value may be determined for each subject. For example, if the quantitative value of the first target miRNA is monitored in the subject's healthy state (e.g., during a regular health check, etc.), the threshold value may be used to issue an alarm for the subject's possible prevalence of breast cancer, pancreatic cancer, lung cancer, stomach cancer, and colorectal cancer when the quantitative value is higher or lower than the threshold value. The threshold value may vary from person to person. For example, typically, the quantitative value of the miRNA is about 10 3 At some point in time, the target A, which was being copied, 4 When the number of copies is 10, it can be determined that the subject may be affected by breast cancer, pancreatic cancer, lung cancer, stomach cancer, and colorectal cancer. 2 At some point, the target B, which was a copy, 3 If the result is a copy, it can be determined that the subject may be possibly infected with all of breast cancer, pancreatic cancer, lung cancer, stomach cancer, and colorectal cancer.

[0034] Here, the quantitative value or threshold value in the control that serves as the basis for the determination may be determined from past knowledge such as literature. The determination that a subject is afflicted includes a high possibility of the subject being afflicted. Conversely, the determination that a subject is not afflicted includes a low possibility of the subject being afflicted.

[0035] In subjects suffering from breast cancer, pancreatic cancer, lung cancer, gastric cancer or colon cancer, the target miRNA group includes those with high expression levels (highly expressed target miRNAs) and those with low expression levels (low expressed target miRNAs) compared to the control. When the low expression target miRNA has a low quantitative value compared to the control, it can be determined that the subject may be affected with all of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colon cancer. On the other hand, when the high expression target miRNA has a high quantitative value compared to the control, it can be determined that the subject may be affected with all of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colon cancer.

[0036] In this specification, "determining that a subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer" includes determining that a subject is affected by breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer, determining that a subject is affected by breast cancer, pancreatic cancer, lung cancer, or gastric cancer, determining that a subject is affected by breast cancer, pancreatic cancer, lung cancer, or colon cancer, determining that a subject is affected by breast cancer, pancreatic cancer, or gastric cancer, or determining that a subject is affected by breast cancer or pancreatic cancer.

[0037] Specifically, for each of hsa-miR-128-3p (SEQ ID NO: 1), hsa-miR-151a-3p (SEQ ID NO: 2), hsa-miR-4770 (SEQ ID NO: 4), hsa-miR-125a-5p (SEQ ID NO: 6), hsa-miR-409-3p (SEQ ID NO: 7) and hsa-miR-215-5p (SEQ ID NO: 9), the control is a healthy subject, and when the quantitative value of the subject is smaller than the quantitative value of the control, it can be determined that the subject is suffering from breast cancer, pancreatic cancer, lung cancer, stomach cancer or colon cancer. For hsa-miR-143-3p (SEQ ID NO: 3) or hsa-miR-1296-5p (SEQ ID NO: 5), the control is a healthy subject, and when the quantitative value of the subject is smaller than the quantitative value of the control, it can be determined that the subject is suffering from breast cancer, pancreatic cancer, lung cancer or stomach cancer. hsa-miR-99a-5p (sequence number 8) can be used to determine that a subject is suffering from breast cancer, pancreatic cancer, lung cancer, or colon cancer when the quantitative value of the subject is smaller than the quantitative value of the control, with the control being a healthy subject.

[0038] In addition, the difference between the quantitative value of each miRNA in the control and the quantitative value of each miRNA in the subject is preferably statistically significant.Whether or not it is statistically significant can be determined by preparing a plurality of samples known to be affected by various cancers, confirming the range of values ​​that each miRNA in the samples can have, and calculating the probability distribution in advance or calculating it from information such as known literature.

[0039] According to a further embodiment, for all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer, determining that the subject may be affected also includes determining the prognosis or recurrence of breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer in the subject. For example, as shown in (c) of FIG. 1, the analysis method includes a prognosis recurrence determination step (S14) of determining the prognosis or recurrence of breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer in the subject from the result of the quantification after the quantification step (S12). In the prognosis recurrence determination step (S14), for example, when the quantification value is high or low, it can be determined that the prognosis of breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer is poor, or that breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer has recurred, or that there is a high possibility of recurrence. The quantification value and threshold value in the above control can also be used to determine the prognosis and recurrence. In particular, there may be cases where it is preferable to use a threshold value determined for each subject.

[0040] In addition, after the judgment step (S13) and / or the prognosis recurrence judgment step (S14), it is also possible to select and assist in the selection of a type of therapy or a type of drug to be applied to the subject according to the judgment result. For example, as shown in (d) of FIG. 1, after the judgment step (S13) and / or the prognosis recurrence judgment step (S14), the analysis method includes a selection step (S15) of selecting a type of therapy or a type of drug to be applied to the subject from the judgment result. Here, the therapy or drug is for the treatment of breast cancer, pancreatic cancer, lung cancer, stomach cancer, or colon cancer. The type of therapy or drug includes the amount, timing, or duration of the therapy or drug.

[0041] According to the analysis method of the first embodiment described above, by quantifying one type of target miRNA from a first target miRNA group in a sample derived from a subject and comparing the quantitative value of the same miRNA in a sample derived from a control, it is possible to easily determine whether the subject is likely to be affected by any of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer.

[0042] The method of the present embodiment can use serum or plasma that can be easily collected during health checkups, etc., and therefore can detect breast cancer, pancreatic cancer, lung cancer, stomach cancer, or colon cancer at an early stage. By using serum or plasma, etc., the physical and economic burden on the subject can be greatly reduced compared to cytology, etc., and the procedure is simple, so the burden on the examiner is also small. In addition, serum or plasma has a stable concentration of miRNA contained therein, making it possible to perform more accurate testing.

[0043] According to a further embodiment, an analysis method for assisting in the determination of the possibility of a subject having breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer, including quantifying the first target miRNA in a sample derived from the subject (quantification step (S12)), is also provided. "Assisting in the determination" includes, for example, obtaining information regarding the possibility of a subject having breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer. "Information" is, for example, information regarding the analysis result of a sample, and may be, for example, a quantitative value. According to this method, it is possible to obtain more accurate information for determining the possibility of a subject having breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer, determining the prognosis, determining the presence or absence of recurrence, or selecting a treatment method or drug to be applied to the subject, for all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer in the subject.

[0044] According to a further embodiment, the control may be an individual confirmed by medical examination or the like to be afflicted with, for example, breast cancer, pancreatic cancer, lung cancer, stomach cancer, or colon cancer. That is, the control is an individual known to be afflicted with breast cancer, pancreatic cancer, lung cancer, stomach cancer, or colon cancer. That is, in the determination step (S13), the control is determined to be afflicted with the type of cancer with which the control is afflicted and whether the subject is afflicted with the type of cancer with which the control is afflicted. Specifically, the determination is made by quantifying the biomarker in the sample derived from the subject using the quantitative value of the biomarker indicating that the subject is afflicted with a specific cancer in the sample derived from the control as a standard, and comparing the same with the standard.

[0045] Specifically, the miRNAs hsa-miR-128-3p (SEQ ID NO: 1), hsa-miR-151a-3p (SEQ ID NO: 2), hsa-miR-143-3p (SEQ ID NO: 3) and hsa-miR-1296-5p (SEQ ID NO: 5) can be used to determine that a subject suffers from breast cancer, pancreatic cancer, lung cancer or gastric cancer when the control is a colon cancer patient and the quantitative value of the subject is smaller than that of the control. The miRNAs hsa-miR-4770 (SEQ ID NO: 4) can be used to determine that a subject suffers from breast cancer, pancreatic cancer or gastric cancer when the control is a colon cancer patient and the quantitative value of the subject is smaller than that of the control. The miRNAs hsa-miR-409-3p (SEQ ID NO: 7) can be used to determine that a subject suffers from breast cancer or pancreatic cancer when the control is a colon cancer patient and the quantitative value of the subject is smaller than that of the control.

[0046] In addition, some miRNAs in the first target miRNA group can be used as a marker to identify one cancer type by setting a specific cancer type as a control. That is, some miRNAs in the first miRNA group can be used for purposes other than determining that "the subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer." For example, it can be determined that the subject is affected by breast cancer.

[0047] Specifically, some miRNAs in the first target miRNA group are hsa-miR-128-3p (SEQ ID NO: 1), hsa-miR-151a-3p (SEQ ID NO: 2), hsa-miR-143-3p (SEQ ID NO: 3), hsa-miR-4770 (SEQ ID NO: 4), hsa-miR-125a-5p (SEQ ID NO: 6), and hsa-miR-99a-5p (SEQ ID NO: 8). For hsa-miR-128-3p (SEQ ID NO: 1), a subject can be determined to be suffering from breast cancer when the subject's quantitative value is smaller than the quantitative value of the control, using a lung cancer or stomach cancer patient as the control. For each of hsa-miR-151a-3p (SEQ ID NO: 2), hsa-miR-143-3p (SEQ ID NO: 3) and hsa-miR-4770 (SEQ ID NO: 4), a subject can be determined to be suffering from breast cancer when the quantitative value of the subject is smaller than that of the control, using a lung cancer patient as the control. For hsa-miR-125a-5p (SEQ ID NO: 6), a subject can be determined to be suffering from breast cancer when the quantitative value of the subject is smaller than that of the control, using a colon cancer, lung cancer or stomach cancer patient as the control. For hsa-miR-99a-5p (SEQ ID NO: 8), a subject can be determined to be suffering from breast cancer when the quantitative value of the subject is smaller than that of the control, using a stomach cancer patient as the control.

[0048] According to a further embodiment, the present analysis method can be used for detecting breast cancer cells, pancreatic cancer cells, or colon cancer cells in a sample not derived from a subject, etc. For example, when breast cancer cells, pancreatic cancer cells, or colon cancer cells are artificially produced, the method can be used for confirming whether or not the cells are present in a produced cell-containing solution.

[0049] (marker) According to a first embodiment, there is provided a marker for detecting at least one of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer in a subject, the marker comprising one type of target miRNA.

[0050] Here, the term "marker" refers to a substance whose presence or absence or concentration in a sample can be detected to determine whether or not the sample and / or the subject from which it is derived is in a particular state.

[0051] For all of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colon cancer in the first embodiment, the marker for detecting the possibility of a subject having the cancer can be used, for example, by measuring the amount (quantitative value) present in a sample derived from the subject, to determine the possibility of the subject having the cancer, determine the prognosis or the presence or absence of recurrence, or select a treatment method or drug to be applied to the subject, for all of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colon cancer in the subject, as described above.

[0052] (kit) According to a first embodiment, a kit is provided for detecting the possibility of a subject suffering from any of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colon cancer.

[0053] The kit includes reagents that can be used in a general method for quantifying RNA, particularly short-stranded RNA such as miRNA, and a nucleic acid capable of specifically binding to a target miRNA (i.e., hybridizing to the target miRNA). When the qPCR method is used to detect the target miRNA, the nucleic acid capable of specifically binding to the target miRNA may be a reverse transcription (RT) primer for reverse transcribing the target miRNA, an extension (EL) primer for extending the target miRNA, or an amplification primer set for amplifying the target miRNA.

[0054] The RT primer is a primer for obtaining the cDNA of the target miRNA. The RT primer comprises a sequence complementary to at least a part of the sequence of the target miRNA. The RT primer may further comprise an artificial sequence added to the cDNA to facilitate the amplification of the cDNA of the target miRNA.

[0055] The EL primer is a primer for adding an artificial sequence to a cDNA to facilitate amplification of the cDNA of the target miRNA. The EL primer may include a sequence complementary to at least a portion of the sequence of the cDNA of the target miRNA and a sequence to be added for elongation of each cDNA.

[0056] For example, the amplification primer set for PCR includes at least a forward primer and a reverse primer. Alternatively, the amplification primer set may be for the LAMP method, and may include primers having a sequence corresponding to the base sequence of the target miRNA, which are used in the general LAMP method. Alternatively, the amplification primer set may be for the NGS method, and may include a forward primer including an artificial adapter sequence and a reverse primer including a complementary sequence thereof. The amplification primer set for the NGS method may include multiple combinations of forward primers and reverse primers including different barcode sequences in order to simultaneously analyze multiple samples. When the amplification primer set is used for the rolling cycle amplification method, the kit further includes a circular single-stranded DNA to which the amplification primer hybridizes to serve as a template for amplification.

[0057] Each primer included in the amplification primer set may be designed to bind to the cDNA of the target miRNA or its complementary sequence, or may be designed to bind to an artificial sequence added by the RT primer and / or the EL primer.

[0058] Amplified cDNA may be detected using a nucleic acid probe designed to bind to the target cDNA or its complementary sequence.

[0059] Furthermore, when the target miRNA in the sample is directly detected by a microarray, the nucleic acid capable of specifically binding to the target miRNA is a nucleic acid probe provided on the microarray. The nucleic acid probe may have at least a part of the sequence of the target miRNA, its cDNA, or its amplification product, or a complementary sequence thereof.

[0060] The above-mentioned nucleic acids included in the kit may be provided individually or in any combination in a container together with a suitable carrier. The suitable carrier is, for example, water, a physiological solution, a buffer solution, etc. The container is, for example, a tube or a microtiter plate, etc. Alternatively, these nucleic acids may be provided immobilized on a solid phase such as a microfluidic chip.

[0061] In addition to the nucleic acid, the kit may contain reagents used for reverse transcription, extension or amplification, such as enzymes, substrates and / or labeling substances that generate optical or electrical chemical signals used for detection, etc. Labeling substances are, for example, fluorescent dyes such as SYBR Green, EvaGreen (registered trademark) and SYTO (registered trademark) 82, or indicators such as metal complexes such as ruthenium hexaamine in the case of current detection.

[0062] The kit can be used, for example, for determining the possibility of a subject being afflicted with breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colon cancer, as described above, to determine the prognosis, determine the presence or absence of recurrence, select the type of treatment or type of drug, etc.

[0063] According to a further embodiment, a kit for detecting the possibility of a subject having all of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colorectal cancer is provided as a composition or diagnostic agent for diagnosing the possibility of a subject having all of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colorectal cancer. Also provided according to the embodiment is the use of at least one of the above nucleic acids in the manufacture of the above diagnostic composition or diagnostic agent.

[0064] Second embodiment (Analysis method) The analytical method according to the second embodiment is an analytical method comprising quantifying at least one of hsa-miR-126-3p, hsa-miR-326, hsa-miR-28-3p, hsa-miR-425-3p, hsa-miR-93-3p, hsa-miR-24-3p, hsa-miR-222-3p, hsa-miR-361-5p and hsa-miR-342-3p in a sample derived from a subject, and determining that the subject may be affected by all of breast cancer, pancreatic cancer and colorectal cancer.

[0065] The target miRNAs of the second embodiment (hereinafter referred to as "second target miRNAs") are represented by the base sequences shown in the following Table 2. That is, the target miRNA to be quantified in the second embodiment may be one type among the second target miRNA group shown in Table 2.

[0066] [Table 2]

[0067] As shown in FIG. 2(a), the method of the second embodiment includes: Preparing a sample derived from a subject (preparation step (S21)); Quantifying one of the second target miRNA group in a sample derived from the subject (quantification step (S22)); Includes.

[0068] The data related to the detection of the second target miRNA obtained in the quantification step (S22) can be used to determine whether the subject may have breast cancer, pancreatic cancer, or colorectal cancer. For example, the analysis method of the second embodiment may further include a step (S23) performed after the quantification step (S22) of determining whether the subject may have breast cancer, pancreatic cancer, or colorectal cancer.

[0069] For example, the determination step (S23) is performed based on the quantitative value of the second target miRNA in the control-derived sample, which is obtained by performing quantification on the control-derived sample in parallel with the quantification step (S22) on the subject-derived sample. That is, the method of the second embodiment includes, as in the first embodiment, quantifying the miRNA in the control-derived sample; and determining that the subject may be affected by all of breast cancer, pancreatic cancer, and colorectal cancer by comparing the quantitative value of the miRNA in the subject with the quantitative value of the miRNA in the control.

[0070] The control may be, for example, a healthy individual, or an individual confirmed to be afflicted with breast cancer, pancreatic cancer, or colon cancer by medical examination, etc. In other words, the control is a healthy individual, or an individual known to be afflicted with breast cancer, pancreatic cancer, or colon cancer.

[0071] In the case where the control is breast cancer, pancreatic cancer or colon cancer, in the determination step (S23), it is determined whether or not the subject is afflicted with the cancer type that the control is afflicted with. Specifically, the quantitative value of a biomarker in a sample derived from the control that indicates afflicting a specific cancer is used as a standard, and the biomarker in a sample derived from the subject is quantified and compared with the standard to make a determination.

[0072] In addition, "determining that the subject is likely to be affected by all of breast cancer, pancreatic cancer, and colorectal cancer" means that it is determined that the subject is likely to be affected by all three types of cancer, but that the type of cancer the subject has is not specific to any one of the three types of cancer, or that the subject is not affected by any of the three types of cancer.

[0073] An expression synonymous with "the subject may be affected by all three types of cancer, but the type of cancer the subject has is not specific to any one of the three types of cancer" is "determining whether or not the subject has at least one of breast cancer, pancreatic cancer, and colorectal cancer."

[0074] In other words, by "determining that the subject is likely to be affected with all of breast cancer, pancreatic cancer, and colorectal cancer," the possibility that the subject is affected with breast cancer, the possibility that the subject is affected with pancreatic cancer, and the possibility that the subject is affected with colorectal cancer are presented all at once, or the possibility that the subject is not affected with any of breast cancer, pancreatic cancer, and colorectal cancer is presented.

[0075] That is, the method of this embodiment is intended to be used as a primary screening method in cancer screening, and to present the possibility of as many types of cancer as possible without overlooking them, in consideration of the importance of early detection and early treatment of cancer.

[0076] In this specification, "determining that the subject may be affected by all of breast cancer, pancreatic cancer, and colon cancer" includes determining that the subject is affected by breast cancer, pancreatic cancer, or colon cancer, or determining that the subject is affected by pancreatic cancer or colon cancer.

[0077] Specifically, for each of hsa-miR-126-3p (SEQ ID NO: 10), hsa-miR-326 (SEQ ID NO: 11), hsa-miR-28-3p (SEQ ID NO: 12), hsa-miR-425-3p (SEQ ID NO: 13), hsa-miR-93-3p (SEQ ID NO: 14), hsa-miR-24-3p (SEQ ID NO: 15), hsa-miR-222-3p (SEQ ID NO: 16) and hsa-miR-361-5p (SEQ ID NO: 17), the control is a healthy subject, and when the quantitative value of the subject is smaller than the quantitative value of the control, it can be determined that the subject is suffering from breast cancer, pancreatic cancer or colon cancer. For hsa-miR-342-3p (SEQ ID NO: 18), the control is a healthy subject or a breast cancer patient, and when the quantitative value of the subject is smaller than the quantitative value of the control, it can be determined that the subject is suffering from pancreatic cancer or colon cancer.

[0078] Furthermore, some miRNAs in the second target miRNA group can be used as markers to identify one cancer type by using a specific sample group as a control. That is, some miRNAs in the second target miRNA group can be used to determine other than "the subject may be affected by all of breast cancer, pancreatic cancer, and colon cancer." For example, it can be determined that the subject is affected by colon cancer.

[0079] Specifically, some miRNAs in the second target miRNA group are hsa-miR-126-3p (SEQ ID NO: 10), hsa-miR-326 (SEQ ID NO: 11), hsa-miR-28-3p (SEQ ID NO: 12), hsa-miR-425-3p (SEQ ID NO: 13), hsa-miR-93-3p (SEQ ID NO: 14), hsa-miR-24-3p (SEQ ID NO: 15), hsa-miR-222-3p (SEQ ID NO: 16), hsa-miR-361-5p (SEQ ID NO: 17) and hsa-miR-342-3p (SEQ ID NO: 18). In addition, hsa-miR-10b-5p (SEQ ID NO: 19: UACCCUGUAGAACCGAAUUUGUG) can also be used as a marker to identify one type of cancer.

[0080] For each of the miRNAs hsa-miR-126-3p (SEQ ID NO: 10), hsa-miR-326 (SEQ ID NO: 11), hsa-miR-28-3p (SEQ ID NO: 12), hsa-miR-425-3p (SEQ ID NO: 13), hsa-miR-93-3p (SEQ ID NO: 14), hsa-miR-24-3p (SEQ ID NO: 15), hsa-miR-222-3p (SEQ ID NO: 16), and hsa-miR-361-5p (SEQ ID NO: 17), the subject can be determined to be suffering from colorectal cancer when the subject's quantitative value is smaller than the quantitative value of the control, with breast cancer or pancreatic cancer as the control. For hsa-miR-342-3p (SEQ ID NO: 18), the subject can be determined to be suffering from colorectal cancer when the subject's quantitative value is smaller than the quantitative value of the control, with the subject being a pancreatic cancer patient as the control. hsa-miR-10b-5p (sequence number 19) can be used to determine that a subject is suffering from colorectal cancer when the quantitative value of the subject is smaller than the quantitative value of the control, with the control being a healthy subject, a breast cancer patient, or a pancreatic cancer patient.

[0081] According to a further embodiment, for all of breast cancer, pancreatic cancer, and colon cancer, determining that the subject may be affected also includes determining the prognosis or recurrence of breast cancer, pancreatic cancer, or colon cancer in the subject. For example, as shown in (c) of FIG. 2, the analysis method includes a prognosis recurrence determination step (S24) of determining the prognosis or recurrence of breast cancer, pancreatic cancer, or colon cancer in the subject from the results of the quantification after the quantification step (S22). In the prognosis recurrence determination step (S24), for example, when the quantification value is high or low, it can be determined that the prognosis of breast cancer, pancreatic cancer, or colon cancer is poor, or that breast cancer, pancreatic cancer, or colon cancer has recurred, or that there is a high possibility of recurrence. The quantification value and threshold value in the control can also be used to determine the prognosis and recurrence. In particular, there may be cases where it is preferable to use a threshold value determined for each subject.

[0082] In addition, after the determination step (S23) and / or the prognosis recurrence determination step (S24), it is also possible to select and assist in the selection of a type of therapy or a type of drug to be applied to the subject according to the determination result. For example, as shown in (d) of FIG. 2, after the determination step (S23) and / or the prognosis recurrence determination step (S24), the analysis method includes a selection step (S25) of selecting a type of therapy or a type of drug to be applied to the subject from the determination result. Here, the therapy or drug is for the treatment of breast cancer, pancreatic cancer, or colon cancer. The type of therapy or drug includes the amount, timing, or duration of the therapy or drug.

[0083] According to the analysis method of the second embodiment described above, by quantifying one type of target miRNA from the second target miRNA group in a sample derived from a subject and comparing the quantitative value of the same miRNA in a sample derived from a control, it is possible to easily determine whether the subject is likely to be affected by all of breast cancer, pancreatic cancer, and colorectal cancer.

[0084] According to a further embodiment, the analysis method according to the second embodiment can also be used for detecting breast cancer cells, pancreatic cancer cells, or colon cancer cells in a sample not derived from a subject. For example, when artificially producing breast cancer cells, pancreatic cancer cells, or colon cancer cells, the method can also be used to confirm whether or not the cells are present in a produced cell-containing solution.

[0085] According to a second embodiment, there is provided a marker for detecting at least one of breast cancer, pancreatic cancer, and colorectal cancer in a subject, comprising one type of second target miRNA.

[0086] In the second embodiment, for all of breast cancer, pancreatic cancer, and colon cancer, the marker for detecting the possibility of a subject having the disease can be used, for example, by measuring the amount (quantitative value) present in a sample derived from the subject, to determine the possibility of the subject having the disease, determine the prognosis or the presence or absence of recurrence, or select a treatment method or drug to be applied to the subject, for all of breast cancer, pancreatic cancer, and colon cancer in the subject, as described above.

[0087] According to a second embodiment, a kit for detecting the possibility of a subject suffering from all of breast cancer, pancreatic cancer, and colorectal cancer is provided.

[0088] The kit according to the second embodiment, like that of the first embodiment, includes reagents that can be used in general methods for quantifying RNA, particularly short-stranded RNA such as miRNA, and a nucleic acid capable of specifically binding to a target miRNA.

[0089] The kit of the second embodiment can also be used, for example, to determine the possibility of a subject being afflicted with breast cancer, pancreatic cancer, and colorectal cancer, to determine the prognosis, to determine the presence or absence of recurrence, to select the type of treatment or type of drug, and the like.

[0090] According to a further embodiment, a kit for detecting the possibility of a subject having all of breast cancer, pancreatic cancer, and colorectal cancer is provided as a composition or diagnostic agent for diagnosing the possibility of a subject having all of breast cancer, pancreatic cancer, and colorectal cancer. Also provided according to the embodiment is the use of at least one of the above nucleic acids in the manufacture of the above diagnostic composition or diagnostic agent.

[0091] [example] The experiments carried out to obtain the marker of this embodiment are described below.

[0092] Example 1. Search and selection of miRNA markers to distinguish between patients with various cancers and healthy subjects We searched for miRNA markers that can distinguish breast cancer patients, pancreatic cancer patients, and colorectal cancer patients from healthy subjects, as described below.

[0093] Sample preparation A total of 96 samples were prepared as samples: 24 serum samples from breast cancer patients, 24 serum samples from pancreatic cancer patients, 24 serum samples from colon cancer patients, and 24 serum samples from healthy subjects.

[0094] Sample processing and miRNA quantification miRNA was extracted from 300 μL of all serum samples using Nucleospin (registered trademark) miRNA Plasma (Takara Bio Inc.).

[0095] For cDNA synthesis, TaqMan miRNA cDNA Synthesis Kit (Applied Biosystems, Cat. A28007) was used. The TaqMan miRNA cDNA Synthesis Kit is a kit that performs general reverse transcription of all mature RNA present in a sample, not target-specific, by adding a poly(A) tail to the 3' end of the mature RNA and ligating an adapter sequence to the 5' end. Thus, cDNA corresponding to all mature RNAs, including miRNAs, in each sample was obtained.

[0096] The miRNA in the obtained cDNA was quantified by performing RT-qPCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) and TaqMan Advanced miRNA Assays (Applied Biosystems) according to the included protocol. The TaqMan PCR method, which is one of the 5' nuclease assays, is an amplification method characterized by excellent detection accuracy by using a primer for amplifying the target and a TaqMan probe in which fluorescence resonance energy transfer (FRET) occurs within the molecule and which specifically binds to the target. The quantitative value of cDNA obtained by applying this TaqMan PCR method is, for example, the number of cycles (Ct value) until the cDNA corresponding to each probe and primer reaches the detection standard.

[0097] In addition, the quantitative values ​​were corrected using the quantitative values ​​of miRNAs (standard miRNAs) commonly present in serum samples from healthy subjects and patients with various cancers, taking into consideration that the overall activity level of miRNAs may differ for each individual, and that the yield of extraction and amplification reactions in sample processing may differ for each type of cell or sample. Specifically, the quantitative value of hsa-miR-486-5p (SEQ ID NO: 133), which is known to be highly expressed in both samples from healthy subjects and patients with various cancers, was used. Normalization was performed by subtracting the Ct value of hsa-miR-486-5p from the Ct value of each miRNA, and correction was performed so that the difference (△Ct value) was an index of expression level.

[0098] The quantitative value of each miRNA corrected as described above is a value obtained for each individual specimen (i.e., for each individual) of a healthy person, a breast cancer patient, a pancreatic cancer patient, or a colon cancer patient. Therefore, when handling quantitative results for each group consisting of a plurality of specimens of the same type (for example, a group of specimens of healthy people), a set of multiple quantitative values ​​is obtained. Such a set of multiple quantitative values ​​is a numerical distribution with a certain degree of variance because there are individual differences even in a group of specimens of the same type.

[0099] In this example, it was assumed that the numerical distribution of the quantitative values ​​of each miRNA observed in the same type of sample group follows a normal distribution. Since it is preferable to exclude quantitative values ​​that are outliers in the normal distribution from the analysis target, the quantitative values ​​that are outliers were excluded, and the average value of the quantitative values ​​of each miRNA in each sample group was calculated. The average value can also be interpreted as a quantitative value that represents each sample group.

[0100] Quantitative results The average quantitative values ​​of each miRNA in patients with each type of cancer, calculated as described above, were relativized to the average quantitative values ​​of each miRNA in healthy subjects (i.e., converted into expression ratios relative to healthy subjects) and are shown in Tables 3-1 to 3-7.

[0101] As shown in Tables 3-1 to 3-7, a total of 94 types of miRNAs were detectable. In Tables 3-1 to 3-7, "-" indicates data in which amplification by TaqMan PCR was insufficient in healthy subjects, breast cancer patients, pancreatic cancer patients, and colon cancer patients, and did not reach the detection standard value.

[0102] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]

[0103] Marker selection From the above-mentioned 94 types of miRNAs, miRNAs characteristic of breast cancer patients, pancreatic cancer patients, and colorectal cancer patients, i.e., markers for each type of cancer, were selected.

[0104] Whether each miRNA is characteristic of a cancer type can be determined based on whether the difference between the log2 fold value of a quantitative value (e.g., average value) representative of a sample group of a certain cancer type (hereinafter referred to as sample group A) and the log2 fold value of a quantitative value (e.g., average value) representative of a sample group of other cancer types or healthy subjects (hereinafter referred to as sample group B) is 2 or more. In other words, if the average quantitative value of a certain miRNA in sample group A is more than twice or less than half the average quantitative value in sample group B, the miRNA may be determined to be characteristic of sample group A and to be a marker indicating the presence or absence of the cancer type in sample group A.

[0105] However, as mentioned above, the quantitative values ​​of each miRNA in each sample group are numerical distributions with a certain degree of variance. Depending on the degree of overlap of the numerical distributions, it may be impossible to distinguish between sample group A and sample group B. Therefore, by verifying whether sample group A and sample group B can be statistically distinguished, it is possible to select marker candidates with higher accuracy.

[0106] In this embodiment, as candidates for pancreatic cancer markers, miRNAs were selected whose average quantitative values ​​of the sample groups of pancreatic cancer patients were measured to be more than twice or less than half the average quantitative values ​​of the sample groups of at least one of healthy subjects, breast cancer patients, and colon cancer patients.Furthermore, it was verified whether the selected pancreatic cancer markers were statistically significant.

[0107] Similarly, as candidates for colon cancer markers, miRNAs measured from the average quantitative values ​​of specimens from colon cancer patients that were more than twice or less than half the average quantitative values ​​of specimens from healthy subjects, breast cancer patients, or pancreatic cancer patients were selected and their statistical significance was verified.

[0108] Marker selection results The miRNAs selected as markers are shown in Table 4.

[0109] [Table 4]

[0110] As shown in Table 4, a total of 19 cancer markers for each cancer type were identified. That is, hsa-miR-128-3p (SEQ ID NO: 1), hsa-miR-151a-3p (SEQ ID NO: 2), hsa-miR-143-3p (SEQ ID NO: 3), hsa-miR-4770 (SEQ ID NO: 4), hsa-miR-1296-5p (SEQ ID NO: 5), hsa-miR-125a-5p (SEQ ID NO: 6), hsa-miR-409-3p (SEQ ID NO: 7), hsa-miR-99a-5p (SEQ ID NO: 8), hsa-miR-215-5p (SEQ ID NO: 9), hsa-miR-126-3p (SEQ ID NO: 10), hsa-miR-326 (SEQ ID NO: 11), hsa-miR-28- miR-3p (SEQ ID NO: 12), hsa-miR-425-3p (SEQ ID NO: 13), hsa-miR-93-3p (SEQ ID NO: 14), hsa-miR-24-3p (SEQ ID NO: 15), hsa-miR-222-3p (SEQ ID NO: 16), hsa-miR-361-5p (SEQ ID NO: 17), hsa-miR-342-3p (SEQ ID NO: 18) and hsa-miR-10b-5p (SEQ ID NO: 19) were found to be markers of low-expressed target miRNAs indicating that the subject is affected with breast cancer, pancreatic cancer, or colorectal cancer, since their abundance in the subject is less than its abundance in healthy subjects.

[0111] Among the above, the ratios of each miRNA of SEQ ID NOs: 10 to 19 to healthy subjects are shown in Figures 3A to 3J, respectively (box and whisker plots of SEQ ID NOs: 1 to 9 are omitted because similar results will be shown in Example 2 described later). Figures 3A to 3J are box and whisker plots, with the horizontal axis indicating the type of cancer each specimen suffered from and the vertical axis indicating the expression ratio (log2 fold value) of each miRNA measured in each specimen to healthy subjects.

[0112] We verified whether each miRNA marker showing the distribution of quantitative values ​​shown in Figures 3A to 3J can be distinguished from healthy subjects or other cancer types. Specifically, for example, we used healthy subjects as controls and subjects with breast cancer, pancreatic cancer, or colon cancer to verify whether the range of the quantitative values ​​of each miRNA between the two is significantly different. Similarly, we verified whether each marker can be statistically significantly distinguished when the control is a colon cancer patient and the subject is a breast cancer or pancreatic cancer patient, or when the control is a breast cancer patient and the subject is a pancreatic cancer patient.

[0113] The results of the statistical analysis are shown in Tables 5 and 6. In Table 5, "*" indicates significance when the significance level (p value) is set to a value smaller than 0.05, "**" indicates significance when the significance level (p value) is set to a value smaller than 0.01, "***" indicates significance when the significance level (p value) is set to a value smaller than 0.001, and "ns" indicates no significant difference. In Table 6, "decrease" indicates that the quantitative value of the subject is smaller than that of the control, "increase" indicates that the quantitative value of the subject is larger than that of the control, and "ns" indicates no significant difference. Each miRNA is shown by its abbreviation (for example, hsa-miR-126-3p is described as "126-3p").

[0114] [Table 5]

[0115] [Table 6]

[0116] As shown in Tables 5 and 6, it is possible to statistically significantly distinguish between the control and the subject by measuring and comparing the abundance of each miRNA of SEQ ID NO: 10 to 19. Therefore, it was shown that each miRNA of SEQ ID NO: 10 to 19 is a marker capable of determining whether a subject may be affected by all of breast cancer, pancreatic cancer, and colorectal cancer.

[0117] Example 2. Extensive marker search and selection The search for miRNA markers was carried out again using the same method as in Example 1, but with an increased number and type of samples.

[0118] Sample preparation A total of 576 samples were prepared, including serum from breast cancer patients, pancreatic cancer patients, lung cancer patients, gastric cancer patients, colon cancer patients, and healthy subjects. As shown in Table 4, the number of samples was 100 for breast cancer patients, 99 for pancreatic cancer patients, 99 for lung cancer patients, 99 for gastric cancer patients, 98 for colon cancer patients, and 81 for healthy subjects.

[0119] Sample processing and miRNA quantification From the above samples, miRNA was extracted and various miRNAs were quantified in the same manner as in Example 1. Each quantitative value was corrected with the quantitative value of the standard miRNA hsa-miR-486-5p, and the expression level ratios were calculated between the healthy subjects, breast cancer, lung cancer, pancreatic cancer, gastric cancer, and colon cancer groups.

[0120] Quantitative results and statistical validation Quantitative values ​​of nine miRNA markers identified in Example 2 are shown in Figures 4A to 4I. Figures 4A to 4I are box plots, with the horizontal axis indicating the type of cancer each specimen suffered from and the vertical axis indicating the relative ratio of the quantitative values ​​measured in each specimen.

[0121] It was verified whether each miRNA marker showing the distribution of quantitative values ​​shown in Figures 4A to 4I can be distinguished from healthy subjects or other cancer types. Specifically, for example, a healthy subject was used as the control, and a subject was used as a patient with breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer, and it was verified whether the range of the quantitative value of each miRNA between the two was significantly different. Similarly, it was verified whether each marker can be statistically significantly distinguished when the control is a patient with colon cancer and the subject is a patient with breast cancer, pancreatic cancer, lung cancer, or gastric cancer, when the control is a patient with breast cancer and the subject is a patient with pancreatic cancer, lung cancer, or gastric cancer, and when the control is a patient with lung cancer and the subject is a patient with pancreatic cancer or gastric cancer.

[0122] The results of the statistical analysis are shown in Tables 7 and 8. In Table 7, "*" indicates significance when the significance level (p value) is set to a value smaller than 0.05, "**" indicates significance when the significance level (p value) is set to a value smaller than 0.01, "***" indicates significance when the significance level (p value) is set to a value smaller than 0.001, and "ns" indicates no significant difference. In Table 8, "decrease" indicates that the quantitative value of the subject is smaller than that of the control, "increase" indicates that the quantitative value of the subject is larger than that of the control, and "ns" indicates no significant difference. Each miRNA is shown by its abbreviation (for example, hsa-miR-190a-5p is described as "190a-5p").

[0123] [Table 7]

[0124] [Table 8]

[0125] As described above, it is found that a control and a subject can be statistically significantly distinguished by measuring and comparing the presence of each miRNA of SEQ ID NO: 1 to 9. Therefore, it was shown that each miRNA of SEQ ID NO: 1 to 9 is a marker capable of determining whether a subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer.

[0126] Although several embodiments of the present invention have been described, these embodiments are presented as examples and are not intended to limit the scope of the invention. These novel embodiments can be implemented in various other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their modifications are included in the scope and spirit of the invention, and are included in the scope of the invention and its equivalents described in the claims.

Claims

1. Quantifying a miRNA selected from the group of miRNAs consisting of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-143-3p, hsa-miR-4770, hsa-miR-1296-5p, hsa-miR-125a-5p, hsa-miR-409-3p, hsa-miR-99a-5p, and hsa-miR-215-5p in a sample derived from a subject; determining that the subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer; , an analytical method.

2. quantitating said miRNA in a sample from a control; The method according to claim 1, wherein the determination is made by comparing the quantitative value of the miRNA in the subject with the quantitative value of the miRNA in the control, thereby determining that the subject may be affected by all of breast cancer, pancreatic cancer, lung cancer, gastric cancer, and colorectal cancer.

3. The method according to claim 2 , wherein the control is a healthy subject or a specimen known to have at least one of breast cancer, pancreatic cancer, lung cancer, gastric cancer and colon cancer.

4. The control is a healthy individual, The method according to claim 3, wherein the subject is determined to be suffering from breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colon cancer when a quantitative value of any one miRNA selected from the group of miRNAs consisting of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-4770, hsa-miR-125a-5p, hsa-miR-409-3p, and hsa-miR-215-5p in the subject is smaller than a quantitative value of the miRNA in the control.

5. The control is a healthy individual, The method according to claim 3, wherein the subject is determined to be suffering from breast cancer, pancreatic cancer, lung cancer, or gastric cancer when the quantitative value of hsa-miR-143-3p or hsa-miR-1296-5p in the subject is smaller than the quantitative value of the miRNA in the control.

6. The control is a healthy individual, The method according to claim 3, wherein the determination is made that the subject is suffering from breast cancer, pancreatic cancer, lung cancer, or colorectal cancer when the quantitative value of hsa-miR-99a-5p in the subject is smaller than the quantitative value of the miRNA in the control.

7. The control is a patient with colorectal cancer, The method according to claim 3, wherein the subject is determined to be suffering from breast cancer, pancreatic cancer, lung cancer or gastric cancer when the quantitative values ​​of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-143-3p and hsa-miR-1296-5p in the subject are smaller than the quantitative values ​​of the miRNAs in the control.

8. The control is a patient with colorectal cancer, The method according to claim 3, wherein the subject is determined to be suffering from breast cancer, pancreatic cancer, or gastric cancer when the quantitative value of hsa-miR-4770 in the subject is smaller than the quantitative value of the miRNA in the control.

9. The control is a patient with colorectal cancer, The method according to claim 3, wherein the subject is diagnosed as suffering from breast cancer or pancreatic cancer when the quantitative value of hsa-miR-409-3p in the subject is smaller than the quantitative value of the miRNA in the control.

10. Quantifying a miRNA selected from the group of miRNAs consisting of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-143-3p, hsa-miR-4770, hsa-miR-125a-5p, and hsa-miR-99a-5p in a sample derived from a subject; and determining that the subject is likely to be suffering from breast cancer.

11. quantitating said miRNA in a sample from a control; The method according to claim 10, wherein the determination is made as to whether the subject is likely to be affected by breast cancer by comparing the quantitative value of the miRNA in the subject with the quantitative value of the miRNA in the control.

12. The method of claim 11 , wherein the control is a specimen known to have at least one of pancreatic cancer, lung cancer, gastric cancer, and colon cancer.

13. The control is a lung cancer or gastric cancer patient, The method according to claim 11, wherein the determination is made that the subject is affected with breast cancer when the quantitative value of hsa-miR-128-3p in the subject is smaller than the quantitative value of the miRNA in the control.

14. The control is a lung cancer patient, The method according to claim 11, wherein the subject is determined to be suffering from breast cancer when the quantitative values ​​of hsa-miR-151a-3p, hsa-miR-143-3p and hsa-miR-4770 in the subject are smaller than the quantitative values ​​of the miRNAs in the control.

15. The control is a patient with colorectal cancer, lung cancer, or gastric cancer, The method according to claim 11, wherein the subject is determined to be affected with breast cancer if the quantitative value of hsa-miR-125a-5p in the subject is smaller than the quantitative value of the miRNA in the control.

16. The control is a gastric cancer patient, The method according to claim 11, wherein the determination is made that the subject is affected with breast cancer if the quantitative value of hsa-miR-99a-5p in the subject is smaller than the quantitative value of the miRNA in the control.

17. An analytical method comprising: quantifying a miRNA selected from the group of miRNAs consisting of hsa-miR-126-3p, hsa-miR-326, hsa-miR-28-3p, hsa-miR-425-3p, hsa-miR-93-3p, hsa-miR-24-3p, hsa-miR-222-3p, hsa-miR-361-5p and hsa-miR-342-3p in a sample derived from a subject; and determining that the subject may be affected by all of breast cancer, pancreatic cancer and colorectal cancer.

18. quantitating said miRNA in a sample from a control; The method according to claim 17, wherein the determination is made by comparing the quantitative value of the miRNA in the subject with the quantitative value of the miRNA in the control, thereby determining that the subject may be affected by all of breast cancer, pancreatic cancer, and colorectal cancer.

19. The method of claim 18, wherein the control is a healthy subject or a subject known to have at least one of breast cancer, pancreatic cancer, and colon cancer.

20. The control is a healthy individual, The method according to claim 19, wherein the subject is determined to be suffering from breast cancer, pancreatic cancer or colorectal cancer when the quantitative values ​​of hsa-miR-126-3p, hsa-miR-326, hsa-miR-28-3p, hsa-miR-425-3p, hsa-miR-93-3p, hsa-miR-24-3p, hsa-miR-222-3p and hsa-miR-361-5p in the subject are smaller than the quantitative values ​​of the miRNAs in the control.

21. The control is a healthy subject or a breast cancer patient, The method according to claim 19, wherein the subject is determined to be suffering from pancreatic cancer or colon cancer when the quantitative value of hsa-miR-342-3p in the subject is smaller than the quantitative value of the miRNA in the control.

22. Quantifying a miRNA selected from the group of miRNAs consisting of hsa-miR-126-3p, hsa-miR-326, hsa-miR-28-3p, hsa-miR-425-3p, hsa-miR-93-3p, hsa-miR-24-3p, hsa-miR-222-3p, hsa-miR-361-5p, hsa-miR-342-3p and hsa-miR-10b-5p in a sample derived from a subject; and determining that the subject is likely to be suffering from colorectal cancer.

23. quantitating said miRNA in a sample from a control; The method according to claim 22, wherein the determination is made by comparing the quantitative value of the miRNA in the subject with the quantitative value of the miRNA in the control, thereby determining that the subject may be affected by colorectal cancer.

24. The method of claim 23, wherein the control is a specimen known to have at least one of the following: a healthy subject, breast cancer, and pancreatic cancer.

25. The control is a patient with breast cancer or pancreatic cancer; The method according to claim 24, wherein the subject is judged to be suffering from colorectal cancer when the quantitative values ​​of hsa-miR-126-3p, hsa-miR-326, hsa-miR-28-3p, hsa-miR-425-3p, hsa-miR-93-3p, hsa-miR-24-3p, hsa-miR-222-3p, and hsa-miR-361-5p in the subject are smaller than the quantitative values ​​of the miRNA in the control.

26. The control is a pancreatic cancer patient, The method according to claim 24, wherein the subject is determined to be affected by colorectal cancer when the quantitative value of hsa-miR-342-3p in the subject is smaller than the quantitative value of the miRNA in the control.

27. The control is a healthy subject, a breast cancer patient, or a pancreatic cancer patient; The method of claim 24, wherein the determination comprises determining that the subject is suffering from colorectal cancer when the quantitative value of hsa-miR-10b-5p in the subject is smaller than the quantitative value of the miRNA in the control.

28. The method according to any one of claims 1 to 27, wherein the quantification is carried out using a PCR method, a LAMP method, or a microarray method.

29. The method according to any one of claims 1 to 28, wherein the sample is serum or plasma.

30. The method according to any one of claims 2 to 9, 11 to 16, 18 to 21 and 23 to 27, wherein the quantitative value of the miRNA in the sample derived from the subject and the quantitative value of the miRNA in the sample derived from the control are corrected by a standard miRNA contained in common in the sample derived from the subject and the sample derived from the control.

31. The method of claim 30, wherein the standard miRNA is hsa-miR-486-5p.

32. A kit for detecting the possibility of a subject having breast cancer, pancreatic cancer, lung cancer, gastric cancer, or colorectal cancer, comprising a nucleic acid capable of specifically binding to at least one miRNA selected from the group of miRNAs consisting of hsa-miR-128-3p, hsa-miR-151a-3p, hsa-miR-143-3p, hsa-miR-4770, hsa-miR-1296-5p, hsa-miR-125a-5p, hsa-miR-409-3p, hsa-miR-99a-5p, and hsa-miR-215-5p.

33. The kit according to claim 32, wherein the nucleic acid capable of specifically binding to the miRNA is a reverse transcription primer for reverse transcribing the miRNA, an extension primer for extending the miRNA, an amplification primer set for amplifying the miRNA, or a nucleic acid probe for detecting the miRNA.

Images