Electrode arrangement
Patent Information
- Application Number
- JP2024179259
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-10-02
- Filing Date
- 2024-10-11
- Publication Date
- 2025-06-02
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Existing methods for measuring biological markers in solid tissues face challenges such as invasiveness, discomfort, complexity, and high cost, as they often rely on blood samples or complex devices that are not suitable for general use.
An electrode arrangement with microstructures that penetrate the stratum corneum to access interstitial fluid, using microstructures with electrodes to measure and stimulate electrical signals, allowing for precise and continuous monitoring of biological markers without dermal penetration.
Enables accurate and continuous monitoring of biological markers within the epidermis, reducing discomfort and cost while avoiding dermal penetration issues, thus providing reliable health status indicators.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] The present invention relates to electrode arrangements for use with systems and methods for performing measurements on living subjects, and in one particular example, to electrode arrangements that include microstructures that penetrate functional barriers in the subject. [Background technology]
[0002] Reference in this specification to any prior publication (or information derived therefrom) or to any known matter is not, and should not be taken as, an acknowledgment or admission, or any form of suggestion, that the prior publication (or information derived therefrom) or known matter constitutes part of the common general knowledge in the field of endeavour to which this specification pertains.
[0003] Biological markers, such as proteins, antibodies, cells, small chemicals, hormones and nucleic acids, the presence of which in excess or insufficiency can indicate a disease state, are found in serum and their levels are routinely measured for research and clinical diagnosis. Standard tests include antibody assays to detect infections, allergic reactions, and blood-borne cancer markers (e.g., prostate-specific antigen assays to detect prostate cancer). Biological markers can originate from many organ systems in the body, but are extracted from one compartment: venous blood.
[0004] However, this is not suitable for all conditions as blood often does not contain important biological markers of diseases occurring in solid tissues, and although this problem has been partially overcome by performing tissue biopsies, which can be time-consuming, painful, risky, costly and require highly skilled personnel such as surgeons.
[0005] Another serum-rich fluid is the interstitial fluid (ISF), which fills the intercellular spaces of solid tissues and facilitates the passage of nutrients, biomarkers, and waste products via the bloodstream.
[0006] US Patent No. 5,999,943 describes a device for delivering bioactive materials and other stimuli to living cells, a method for making the device, and various uses of the device, including several medical applications. The device includes a plurality of structures that can penetrate a body surface to deliver the bioactive material or stimuli to a required site. The structures are typically solid, and the delivery end section of the structures is sized so that it can be inserted into a target cell to deliver the bioactive material or stimuli without causing significant damage to the target cell or a specific site therein.
[0007] The use of microneedle versions of such arrays in sampling fluids is also known, but these techniques focus on the use of microfluidic techniques such as capillary action or pumping action to extract fluids, as described, for example, in U.S. Pat. No. 6,293,336; U.S. Pat. No. 6,393,621; U.S. Pat. No. 6,491,663; U.S. Pat. No. 6,523,363; and U.S. Pat. No. 6,523,635; U.S. Pat. No. 6,523,625; and U.S. Pat. No. 6,523,635.
[0008] However, these systems have several drawbacks. First, the use of capillary or pumping action can only be achieved using relatively large structures, which usually pass through the dermis and may result in sampling blood rather than interstitial fluid. This may also cause discomfort or irritation to the subject being sampled. Second, the need for capillary or pumping action complicates the construction of the array and requires a power source, resulting in arrays that are difficult to manufacture, expensive and prone to infection, making them unsuitable for general use.
[0009] Other in vitro diagnostic devices are known, such as using arrays containing silicon nanowires to perform detection, or other complex detection mechanisms such as direct radio frequency detection of nucleotide hybridization, etc. The fabrication of such systems is also complex and expensive, making them unsuitable for practical applications.
[0010] Patent Document 10 describes that a device and system for measuring and / or monitoring an analyte present on the skin is provided. The system includes a skin-mountable device that can be attached to an external skin surface and a reader device. The skin-mountable device includes a substrate, a plurality of microneedles, and a nanosensor. The microneedles are attached to the substrate such that attachment of the substrate to the external skin surface causes the microneedles to penetrate the epidermis, interlayer skin, or dermis. The nanosensor includes a detectable label and is configured to interact with a target analyte present in interstitial fluid of the epidermis, interlayer skin, or dermis. The reader device is configured to detect the analyte in the interstitial fluid via interaction with the skin-mountable device.
[0011] US Patent No. 5,999,943 describes a system and method for revitalizing aged skin using electromagnetic energy delivered with multiple needles that can penetrate the skin to a desired depth. A particular aspect of this invention is the ability to protect zones of tissue from heat exposure. This tissue protection allows new tissue to be regenerated while heat treatment can shrink collagen and tighten the underlying structures. In addition, the system can deliver therapeutically beneficial substances either through the penetrating needles or through channels created by the needle penetration.
[0012] Patent Document 12 describes a method for delivering therapeutic or immunological treatment to a subject using an electric field by applying a non-invasive and easy-to-use electrode to the skin surface. Thus, therapeutic or immunological agents can be delivered to cells of the skin with optimal gene expression and minimal tissue damage for local and systemic treatment or immunization. In particular, therapeutic agents include naked or formulated nucleic acids, polypeptides and chemotherapeutic agents.
[0013] Patent document 13 describes a monitor apparatus including a sensor device and an I / O device in communication with the sensor device that uses data from the sensor device to generate derived data. The derived data cannot be directly detected by the associated sensor. Alternatively, an apparatus including a wearable sensor device and an I / O device in communication with the sensor device, including a means for displaying information and a dial for inputting information. Alternatively, an apparatus for tracking calorie intake and calorie expenditure data including a sensor device and an I / O device in communication with the sensor device. The sensor device includes a processor programmed to generate data regarding calorie expenditure from the sensor data. Alternatively, an apparatus for tracking calorie information of an individual utilizing a plurality of classification identifiers for classifying meals consumed by the individual, each of the classification identifiers having a corresponding calorie amount.
[0014] Patent Document 14 describes that a method, system and / or device is provided for enhancing the conductivity of an electrical signal through a subject's skin using one or more microneedle electrodes. The microneedle electrodes can be applied to the subject's skin by directly contacting the microneedle electrodes to the subject's skin. The microneedles of the microneedle electrodes can be inserted into the skin such that the microneedles penetrate the stratum corneum of the skin to or through the dermis of the skin. An electrical signal passes or is conducted through or across the microneedle electrodes and the subject's skin, and the impedance of the microneedle electrodes is very small and is significantly reduced compared to existing technologies.
[0015] US Patent No. 5,399,633 describes a device for use in detecting an analyte in a subject, the device comprising a number of structures provided on a patch such that at least some of the structures are inserted into the subject by applying the patch to the subject to target one or more analytes, and a reagent for detecting the presence or absence of the analyte.
[0016] Patent Document 16 describes that a device and system for measuring and / or monitoring an analyte present on the skin is provided. The system includes a skin-mountable device that can be attached to an external skin surface and a reader device. The skin-mountable device includes a substrate, a plurality of microneedles, and a nanosensor encapsulated in the microneedles. The microneedles are attached to the substrate such that attachment of the substrate to the external skin surface causes the microneedles to penetrate the skin and contact interstitial fluid. The microneedles can include a sacrificial agent and are configured to become porous upon contact with a solvent, such as interstitial fluid, whereby at least a portion of the sacrificial agent is dissolved. The nanosensor encapsulated in the microneedles includes a detectable label and is configured to interact with a target analyte present in the interstitial fluid. The reader device is configured to detect an analyte in the interstitial fluid via interaction with the skin-mountable device.
[0017] Patent Document 17 describes that a bioinformation measuring device is provided. The bioinformation measuring device includes a sensor portion and a needle portion including a plurality of needles protruding from a plurality of openings formed on the surface of the sensor portion. The plurality of needles is configured to penetrate tissue, and includes a biocompatible organic material including an enzyme member that reacts with an analytical material and a conductive polymer for transmitting an electrical signal generated as a result of the reaction of the enzyme member with the analytical material.
[0018] US Patent No. 5,999,366 describes at least one microneedle comprising a hydrogel material that includes a substance that fluoresces upon interaction with an analyte. The magnitude of the fluorescence varies as a function of the concentration of the analyte. During use, the hydrogel material is illuminated with illumination light of a first wavelength range while interfacing with the subject's dermal interstitial fluid layer, and a photosensor generates an output corresponding to the amount of light received in a second wavelength range.
[0019] Patent Document 19 describes that a biomedical monitor is disclosed. The biomedical monitor has an array of movable microneedles coated with a first chemical sensing medium. The biomedical monitor also has an actuator configured to move at least one microneedle in the array of microneedles from a retracted position to an engaged position, whereby the at least one microneedle enters the skin of a subject. The biomedical monitor further has an optical system configured to illuminate the at least one microneedle during or after entering the skin of the subject and monitor the first chemical sensing medium from the at least one microneedle, whereby at least one biomedical characteristic is determined based on at least one spectral characteristic of the monitored first chemical sensing medium. A method of monitoring at least one biomedical characteristic is also disclosed.
[0020] Patent Document 20 describes that a method, structure, and system for biosensing and drug delivery technology is disclosed. In one embodiment, a device for detecting analytes and / or releasing biochemicals into biological fluids may include an array of hollow needles, each needle including a protruding needle structure including an outer wall forming a hollow interior and an opening at the end of the protruding needle structure exposing the hollow interior, and a probe inside the outer wall that interacts with one or more chemical or biological substances that contact the probe through the opening to produce a probe detection signal, and an array of wires respectively connected to the probes of the array of hollow needles, each wire being electrically conductive to transmit the probe detection signal produced by the respective probe.
[0021] Patent Document 21 describes a transdermal microneedle continuous monitor system. This continuous system monitor includes a substrate, a microneedle unit, a signal processing unit, and a power supply unit. The microneedle unit includes at least a first microneedle set used as a working electrode and a second microneedle set used as a reference electrode, and the first and second microneedle sets are provided on the substrate. Each microneedle set includes at least a microneedle. The first microneedle set includes at least a sheet having a through hole at the edge of which the barbs are formed. One of the sheets provides a through hole through which the barbs at the edge of the other sheet pass, and the barbs are spaced apart.
[0022] Patent Document 22 describes that a biometric information measurement sensor is provided that includes a base including a plurality of biomarker measurement areas and a plurality of electrodes. Each of the plurality of electrodes is disposed on a respective one of the plurality of biomarker measurement areas, and each of the plurality of electrodes includes a working electrode and a counter electrode spaced apart from the working electrode. The biometric information measurement sensor also includes a plurality of needles. Each of the needles is disposed on a respective one of the plurality of electrodes. Two or more of the plurality of needles have different lengths.
[0023] US Patent No. 5,999,943 describes a microneedle device (200) comprising at least one microneedle (1) having one or more nanowires (203) on the surface of said at least one microneedle, which is typically used in sensors, such as sensors for monitoring glucose levels in the body, where the nanowires may have a membrane (207) covering at least a part of the nanowire.
[0024] US Pat. No. 5,399,433 describes a microneedle skin patch functionalized with carbon nanotubes coated with early diagnostic aptamers for various diseases.
[0025] Patent Document 25 describes a biomedical sensor device that includes a light source, a probe array, and a photodetector. The light source is configured to emit infrared light. The probe array is brought into contact with the skin of a user to detect radio signals transmitted from the skin through the probe array. The probe array includes a substrate and a plurality of probes mounted on the substrate, and the substrate and the probes are not opaque, so that infrared light can be transmitted through the probe array into the skin. The photodetector is configured to detect the infrared signal by measuring infrared absorption by the skin.
[0026] Patent Document 26 describes that a device is provided for enhancing the conduction of electrical signals through the skin of a subject using one or more microneedle electrodes. The microneedle electrodes can be applied to the skin of a subject by directly contacting the microneedle electrodes to the skin of the subject. The microneedles of the microneedle electrodes can be inserted into the skin such that the microneedles penetrate the stratum corneum of the skin to or through the dermis of the skin. Electrical signals pass or are conducted through or across the microneedle electrodes and the skin of the subject, and the impedance of the microneedle electrodes is very small and is significantly reduced compared to existing technologies.
[0027] US Patent Publication No. 2009 / 0133996 describes a skin conformal sensor device and a method of using the same. Consistent with one or more embodiments, the sensor device includes an upper portion and a lower portion. The upper portion includes a plurality of layers including at least one sensor. The lower portion includes a layer of microstructures configured and arranged to interface with the skin of a subject and engage the skin with the at least one sensor.
[0028] US Patent No. 5,999,943 describes a device for sampling at least one biological fluid component and measuring at least one target component in the biological fluid. The device has at least one microneedle with an open distal end that is used to penetrate the skin to a depth that minimizes pain and bleeding. The device further includes a hydrophilic gel in the microneedle for sampling the biological fluid component and an electrochemical cell for measuring the concentration of the target component in the sampled biological fluid component. In one embodiment, the electrochemical cell is integrated into the microneedle, such that the sampling and measuring steps are performed completely in situ. In another embodiment, the electrochemical cell is located outside the microneedle at the proximal end of the microneedle. Component sampling and measuring systems, methods, and kits are also provided.
[0029] Patent Document 29 describes a method for fabricating a diagnostic skin patch based on a microneedle coated with aptamers and the resulting patch. This patch has the advantage that a large number of aptamers, which are much smaller in size than antibodies, are attached to a relatively large number of microneedle tip surfaces. This patch can also detect various types of materials simultaneously (multiplexing) because aptamers for various types of biomarkers can be attached together. Therefore, the skin patch based on the microneedle tip can also be used as a protein chip using aptamers. [Prior art documents] [Patent documents]
[0030] [Patent Document 1] International Publication No. 2005 / 072630 [Patent Document 2] U.S. Patent No. 6,923,764 [Patent Document 3] U.S. Patent No. 6,052,652 [Patent Document 4] U.S. Patent No. 6,591,124 [Patent Document 5] U.S. Patent No. 6,558,361 [Patent Document 6] U.S. Patent No. 6,908,453 [Patent Document 7] US Patent Application Publication No. 2005 / 0261632 [Patent Document 8] US Patent Application Publication No. 2006 / 0264782 [Patent Document 9] U.S. Patent No. 6,589,202 [Patent Document 10] U.S. Patent No. 9,974,471 [Patent Document 11] U.S. Patent No. 20070142885 [Patent Document 12] U.S. Patent No. 6972013 [Patent Document 13] U.S. Patent No. 7,285,090 [Patent Document 14] U.S. Patent No. 20110295100 [Patent Document 15] International Publication No. 2009140735 [Patent Document 16] U.S. Patent No. 10,098,574 [Patent Document 17] US Patent Application Publication No. 2016 / 0256091 [Patent Document 18] US Patent Application Publication No. 2018 / 0177439 [Patent Document 19] US Patent Application Publication No. 2007 / 0276211 [Patent Document 20] International Publication No. 2013058879A2 [Patent Document 21] U.S. Patent Application Publication No. 20150208984 [Patent Document 22] US Patent Application Publication No. 2016 / 0302687 [Patent Document 23] US Patent Application Publication No. 2016 / 0166184 [Patent Document 24] Korean Patent No. 20170041375 [Patent Document 25] U.S. Patent No. 8,543,179 [Patent Document 26] U.S. Patent No. 8,588,884 [Patent Document 27] US Patent Application Publication No. 2016 / 0051195 [Patent Document 28] US Patent Application Publication No. 2005 / 0261606 [Patent Document 29] International Publication No. 2018 / 124327 Summary of the Invention [Means for solving the problem]
[0031] In one broad form, embodiments of the present invention seek to provide an electrode arrangement for use with a system for performing measurements on a biological subject, the electrode arrangement including at least one substrate and a plurality of plate microstructures extending from the substrate, the microstructures including electrodes configured to break through the stratum corneum of the subject and allowing signals to be applied to and / or received from the subject via the microstructures.
[0032] In one embodiment, the electrode is a surface electrode coated on at least a portion of the microstructure.
[0033] In one embodiment, the microstructure comprises a conductive material and an electrode is defined at least in part by an insulating coating extending over at least one of a portion of a surface of the microstructure, a proximal end of the microstructure, at least half the length of the microstructure, about 60 μm, 90 μm, or 150 μm of the proximal end of the microstructure, and at least a portion of a tip portion of the microstructure.
[0034] In one embodiment, the electrodes are configured for placement within at least one of the epidermis, the dermis, and the epidermis and the dermis.
[0035] In one embodiment, at least some of the microstructures are arranged in groups and at least one of an electrical response signal is measured between the microstructures in the group and an electrical stimulation signal is applied between the microstructures in the group.
[0036] In one embodiment, the group is a pair of microstructures including spaced apart plate microstructures having opposing substantially planar electrodes.
[0037] In one embodiment, at least some pairs of microstructures are angularly offset, at least some pairs of microstructures are orthogonally aligned, adjacent pairs of microstructures are orthogonally aligned, pairs of microstructures are aligned in rows and pairs of microstructures in one row are angularly offset relative to pairs of microstructures in another row, pairs of microstructures are aligned in rows and pairs of microstructures in one row are orthogonally aligned relative to pairs of microstructures in another row.
[0038] In one embodiment, the spacing between the electrodes within each group is at least one of less than 10 mm, less than 1 mm, about 0.1 mm, and greater than 10 μm, and the spacing between the groups of microstructures is at least one of less than 50 mm, greater than 20 mm, less than 20 mm, less than 10 mm, greater than 10 mm, less than 1 mm, greater than 1 mm, about 0.5 mm, and greater than 0.2 mm.
[0039] In one embodiment, the electrodes are configured to be operably connected to at least one of: at least one sensor operably configured to measure an electrical response signal from the at least one microstructure; and a signal generator configured to apply an electrical stimulation signal to the at least one microstructure.
[0040] In one embodiment, the microstructures include at least one of a response microstructure used to measure a response signal and a stimulus microstructure used to apply a stimulus signal to a subject.
[0041] In one embodiment, the substrate includes electrical connections that allow electrical signals to be applied to and / or received from each microstructure.
[0042] In one embodiment, the electrodes are configured to be connected to one or more switches for selectively connecting at least one of the at least one sensor and the at least one signal generator to the electrodes.
[0043] In one embodiment, the electrodes are configured to allow at least some of the electrodes to be used independently of at least some of the other electrodes.
[0044] In one embodiment, the system includes one or more processing devices configured to at least one of: control a signal generator to perform measurements, receive a measured response signal from the at least one sensor, analyze the measured response signal, and control the signal generator according to the measured response signal, control a switch to at least one of: enable at least one measurement to be performed, and control which microstructure is used to measure the response signal / apply the stimulus.
[0045] In one embodiment, the microstructures are applied to the skin of a subject, and at least some of the microstructures at least one of penetrate the stratum corneum, enter the viable epidermis but not the dermis, and enter the dermis.
[0046] In one embodiment, at least some of the microstructures have a length that is at least one of less than 2500 μm, less than 1000 μm, less than 750 μm, less than 450 μm, less than 300 μm, less than 250 μm, about 250 μm, about 150 μm, greater than 100 μm, greater than 50 μm, and greater than 10 μm; a maximum width that is at least one of less than 2500 μm, less than 1000 μm, less than 750 μm, less than 450 μm, less than 300 μm, less than 250 μm, an order of magnitude similar to the length, greater than the length, greater than the length, about the same as the length, about 250 μm, about 150 μm, and greater than 50 μm; and a maximum thickness that is at least one of less than the width, significantly less than the width, an order of magnitude less than the length, less than 300 μm, less than 200 μm, less than 50 μm, about 25 μm, and greater than 10 μm.
[0047] In one embodiment, at least some of the microstructures include at least one of a shoulder configured to abut the stratum corneum to control depth of penetration, and a shaft extending from the shoulder to a tip, the shaft configured to control a position of the tip within the subject.
[0048] In one embodiment, the microstructure has a density of 5000 / cm 2 Less than 100 / cm 2 More than and about 600 / cm 2 and at least one of a spacing that is at least one of less than 1 mm, about 0.5 mm, about 0.2 mm, about 0.1 mm, and greater than 10 μm.
[0049] In one embodiment, the microstructures have a spacing that is at least one of less than 1 mm, about 0.5 mm, about 0.2 mm, about 0.1 mm, and greater than 10 μm.
[0050] In one embodiment, at least some of the microstructures include at least a portion of an active sensor.
[0051] In one embodiment, the microstructure includes a plate having a substantially planar surface that includes at least one electrode.
[0052] In one embodiment, at least one electrode extends the length of a distal portion of the microstructure, extends the length of a portion of the microstructure spaced from the tip, is located proximate the distal end of the microstructure, is located proximate the tip of the microstructure, extends over at least 25% of the length of the microstructure, extends over less than 50% of the length of the microstructure, extends over approximately 60 μm, 90 μm, or 150 μm of the microstructure, is configured to be placed within the living epidermis of a subject in use, and is configured to be placed within the living epidermis of a subject in use. 2 Less than 22,500μm 2 , at least 2,000 μm 2 At least one of the above has a surface area of at least one of the above.
[0053] In one embodiment, the electrodes are at least 10 mm 2 , at least 1 mm 2 , at least 100,000 μm 2 , at least 10,000 μm 2 , at least 7,500 μm 2 , at least 5,000 μm 2 , at least 2,000 μm 2 , at least 1,000 μm 2 , at least 500 μm 2 , at least 100 μm 2 , and at least 10 μm 2 The surface area of the at least one of the above is
[0054] In one embodiment, at least one electrode has a width that is at least one of less than 50,000 μm, less than 40,000 μm, less than 30,000 μm, less than 20,000 μm, less than 10,000 μm, less than 1000 μm, at least 500 μm, at least 200 μm, at least 100 μm, at least 75 μm, at least 50 μm, at least 20 μm, at least 10 μm, and at least 1 μm.
[0055] In one embodiment, at least one electrode has a height that is at least one of: up to 2500 μm, at least 500 μm, at least 200 μm, at least 100 μm, at least 75 μm, at least 50 μm, at least 20 μm, at least 10 μm, and at least 1 μm.
[0056] In one embodiment, the one or more microstructure electrodes interact with one or more analytes of interest such that the response signal is dependent on the presence, absence, level or concentration of the analyte of interest.
[0057] In one embodiment, the analyte interacts with a coating on the microstructure and changes an electrical property of the coating, thereby allowing the analyte to be detected.
[0058] In one embodiment, the microstructure comprises materials including at least one of a bioactive material, a reagent for reacting with an analyte in a subject, a binder for binding to an analyte of interest, a material for binding one or more analytes of interest, a probe for selectively targeting an analyte of interest, an insulator, a material that reduces biofouling, a material that attracts at least one substance to the microstructure, a material that repels at least one substance from the microstructure, a material that attracts at least some of the analytes to the microstructure, and a material that repels at least some of the analytes from the microstructure.
[0059] In one embodiment, the substrate comprises a plurality of microstructures, where different microstructures are at least one of differentially responsive to the analytes, responsive to different analytes, responsive to different combinations of analytes, and responsive to different concentrations of analytes.
[0060] In one embodiment, at least some of the microstructures are at least one of attracting at least one substance to the microstructure, repelling at least one substance from the microstructure, attracting at least one analyte to the microstructure, and repelling at least one analyte from the microstructure.
[0061] In one embodiment, at least some of the microstructures are coated with a coating.
[0062] In one embodiment, at least some of the microstructures are uncoated, at least some of the microstructures are porous and include an internal coating, at least some of the microstructures are partially coated, different microstructures have different coatings, different portions of the microstructures include different coatings, and at least some of the microstructures include multiple coatings.
[0063] In one embodiment, at least some of the microstructures are coated with a selectively dissolvable coating.
[0064] In one embodiment, the selectively dissolvable coating dissolves after a determined period of time, in response to the presence of one or more reagents in a subject, in response to application of a stimulation signal, in response to the presence, absence, level or concentration of an analyte, and / or upon breaching or penetration of a functional barrier.
[0065] In one embodiment, the coating is at least one of: interacts with an analyte; changes properties upon exposure to an analyte; changes shape to selectively anchor the microstructure; modifies surface properties to at least one of increase hydrophilicity, increase hydrophobicity, and minimize biofouling; attracts at least one substance to the microstructure; repels at least one substance from the microstructure; provides a physical structure to at least one of facilitate penetration of a barrier, strengthen the microstructure, and anchor the microstructure in a subject; dissolves to at least one of expose the microstructure, expose further coating, and expose a material; provides a stimulus to the subject; contains a material; selectively releases a material; acts as a barrier to exclude at least one substance from the microstructure; and comprises at least one of polyethylene, polyethylene glycol, polyethylene oxide, zwitterion, peptide, hydrogel, and self-assembled monolayer.
[0066] In one embodiment, at least one of the substrate and the microstructure comprises at least one of a metal, a polymer, and silicon.
[0067] In one embodiment, the substrate is at least one of at least partially flexible, configured to conform to an exterior surface of the functional barrier, and configured to conform to a shape of at least a portion of the object.
[0068] In one embodiment, the plate microstructure is at least partially tapered and has a substantially rounded rectangular cross-sectional shape.
[0069] In one embodiment, the microstructures include anchor microstructures used to attach a substrate to a subject, the anchor microstructures at least one of: changing shape, changing shape in response to at least one of a substance in the subject and an applied stimulus, swelling, swelling in response to at least one of a substance in the subject and an applied stimulus, including anchoring structures, having a longer length than other microstructures, being rougher than other microstructures, having a higher surface friction than other microstructures, being duller than other microstructures, being thicker than other microstructures, and penetrating the dermis.
[0070] In one embodiment, the electrode arrangement is configured for use with a housing that includes at least one of the at least one electronic processing device, at least one sensor, and at least one signal generator.
[0071] In one embodiment, the substrate selectively couples to the housing.
[0072] In one embodiment, the substrate is coupled to the housing using at least one of an electromagnetic coupling, a mechanical coupling, an adhesive coupling, and a magnetic coupling.
[0073] In one embodiment, at least one of the housing and the substrate is at least one of fixed to the subject, fixed to the subject using an anchor microstructure, fixed to the subject using an adhesive patch, and fixed to the subject using a strap.
[0074] In one embodiment, the housing includes a housing connector that operably connects to a substrate connector on the substrate for communicating signals with the microstructure.
[0075] In one embodiment, the electrode mounting system is configured to be used to make repeated measurements over a period of time, and the microstructure is configured to remain within the subject during that period.
[0076] In one embodiment, the period of time is at least one of at least one minute, at least one hour, at least one day, and at least one week.
[0077] In one embodiment, the electrode arrangement is configured to perform repeated measurements substantially continuously, at a frequency that is at least one of every second, every minute, every 5-10 minutes, and every hour.
[0078] In one embodiment, the electrode fixture includes a substrate coil disposed on the substrate and operably coupled to one or more microstructure electrodes.
[0079] In one embodiment in use, the electrode arrangement is used in conjunction with excitation and receiving coils positioned in close proximity to the substrate coil such that changes in the drive signals applied to the excitation and receiving coils act as a response signal.
[0080] In one embodiment, the electrode arrangement includes a first substrate coil disposed on the substrate and operably coupled to one or more first microstructure electrodes, a second substrate coil disposed on the substrate and operably coupled to one or more second microstructure electrodes, the second microstructure electrodes configured to interact with an analyte of interest, and at least one excitation and receiving coil disposed proximate to at least one of the first and second substrate coils such that a change in a drive signal applied to the at least one excitation and receiving coil serves as a response signal, and the one or more electronic processing devices use the first and second response signals for the presence, absence, level or concentration of the analyte of interest.
[0081] In one embodiment, first and second excitation and receiving coils are positioned proximate to first and second substrate coils, respectively, such that a change in the drive signal applied to each excitation and receiving coil serves as a respective response signal.
[0082] In one embodiment, the system applies a stimulus to at least one of the microstructure and the object, the stimulus being at least one of a biochemical stimulus, a chemical stimulus, a mechanical stimulus, a magnetic stimulus, a thermal stimulus, an electrical stimulus, an electromagnetic stimulus, and an optical stimulus.
[0083] In one embodiment, the system measures a response signal from at least one of the microstructures, the response signal being indicative of at least one of visualization, mapping, mechanical properties, force, pressure, muscle movement, blood pulse waves, analyte concentrations, blood oxygen saturation, tissue inflammation status, bioimpedance, biocapacitance, bioconductance, and electrical signals within the body.
[0084] In one embodiment, the electrode equipment is at least partially wearable. It will be understood that the broad aspects of the invention and their respective features can be used together and / or independently, and reference to separate broad aspects is not intended to be limiting. Furthermore, it will be understood that method features can be performed using a system or device, and system or device features can be implemented using a method.
[0085] Various examples and embodiments of the present invention will now be described with reference to the accompanying drawings. [Brief description of the drawings]
[0086] [Figure 1] 1 is a schematic diagram of an example of a system for performing measurements on a living subject; [Diagram 2] 1 is a flow chart of an example process for performing measurements on a living subject. [Figure 3A] 1 is a schematic side view of a further example of a system for performing measurements on a living subject; [Figure 3B] FIG. 3B is a schematic bottom view of an example patch for the system of FIG. 3A. [Figure 3C] FIG. 3C is a schematic plan view of the patch of FIG. 3B. [Figure 3D] FIG. 3B is a schematic bottom view of an alternative example of a patch for the system of FIG. 3A. [Figure 3E] FIG. 3E is a schematic side view of the patch of FIG. 3D. [Figure 3F] FIG. 3B is a schematic side view of an example of a housing arrangement for the system of FIG. 3A. [Figure 3G] FIG. 3F is a schematic plan view of the housing arrangement of FIG. 3F. [Figure 3H] 1 is a schematic side view of an example of a flexible segmented substrate fixture. FIG. [Figure 3I] 13 is a schematic side view of a further example of a flexible segmented substrate fixture. FIG. [Figure 3J] 13 is a schematic side view of a further example of a flexible segmented substrate fixture. FIG. [Figure 3K] 13 is a schematic side view of a further example of a flexible segmented substrate fixture. FIG. [Figure 3L] FIG. 2 is a schematic side view of an example of an actuator installation. [Figure 3M] FIG. 13 is a schematic side view of a further example of an actuator arrangement; [Figure 4A] FIG. 2 is a schematic side view of a first example of a microstructure configuration. [Figure 4B] FIG. 2 is a schematic side view of a second example of a microstructure configuration. [Figure 4C] 1 is a graph showing the electric field between closely spaced electrodes. [Figure 4D] 1 is a graph showing the electric field between widely spaced electrodes. [Figure 5A] 1 is a schematic side view of an example plate microstructure. [Figure 5B] FIG. 5B is a schematic front view of the microstructure of FIG. 5A. [Figure 5C] FIG. 5B is a schematic bottom view of an example patch including the microstructure of FIG. 5A. [Figure 5D] FIG. 5C is a schematic perspective top view of an example substrate including the pair of blade microstructures of FIGS. 5A and 5B. [Figure 5E] FIG. 2 is a schematic front view of an example blade microstructure. [Figure 5F] 1 is a schematic perspective top view of an example substrate including blade microstructures. FIG. [Figure 5G] FIG. 2 is a schematic plan view of an example hexagonal lattice microstructure array. [Figure 5H] 13A-13C are schematic plan views of alternative examples of grids of microstructure pairs; [Figure 5I] FIG. 5C is a schematic plan view of the grid of FIG. 5H showing examples of connections. [Figure 5J] 1 is a schematic perspective view of an example grid of microstructure pairs; [Figure 5K] 13 is an image of an example patch containing an array of angularly offset plate microstructure pairs. [Figure 5L] 1 is a schematic side view of an embodiment of a plate microstructure. [Figure 5M] FIG. 5I is a schematic perspective view of the plate microstructure of FIG. 5I. [Figure 5N] 1A-1C are schematic side views of an example pair of microstructures inserted into a subject for epidermal measurements. [Figure 5O] 1A-1C are schematic side views of an example pair of microstructures inserted into a subject for dermal measurements. [Figure 6A] FIG. 2 is a schematic side view of a second example of a microstructure. [Figure 6B] FIG. 6B is a schematic front view of the microstructure of FIG. 6A. [Figure 7A] FIG. 13 is a schematic diagram of a third example of a microstructure. [Figure 7B] FIG. 7B is a schematic diagram of a modified version of the microstructure of FIG. 7A. [Figure 8A] 1A-1D are schematic plan views of examples of microstructure substrates. [Figure 8B] 8B is a schematic side view of the microstructure substrate of FIG. 8A as the microstructures are formed. [Figure 8C] FIG. 8B is a schematic cross-sectional view taken along line AA' in FIG. 8A. [Figure 8D] FIG. 8B is a schematic front view of the microstructure substrate of FIG. 8A. [Figure 8E] FIG. 8B is a schematic side view showing an example of the construction of a multi-layer patch using the microstructure substrate of FIG. 8A. [Figure 8F] 1 is a schematic side view of an example multi-layer patch. [Figure 8G]FIG. 8F is a schematic cross-sectional view of the multilayer patch of FIG. [Figure 8H] FIG. 13 is a schematic cross-sectional view of an alternative arrangement of a multi-layer patch. [Figure 8I] 1A-1C are schematic plan views of alternative examples of microstructure substrates. [Figure 8J] FIG. 8J is a schematic side view of the configuration of the microstructures of the substrate of FIG. 8I. [Figure 8K] 1 is a schematic cross-sectional side view of an alternative microstructure configuration. [Figure 8L] FIG. 8K is a schematic cross-sectional side view of a coated version of the microstructure configuration of FIG. [Figure 8M] 1 is a schematic side view of an example of a first step in a microstructure construction technique. [Figure 8N] 1 is a schematic side view of an example of a second step of a microstructure construction technique. [Figure 8O] 13 is a schematic side view of an example of a third step of the microstructure construction technique. FIG. [Figure 8P] FIG. 8B is a schematic side view of a first example of a microstructure configuration made using the construction technique of FIGS. 8M-8O. [Figure 8Q] FIG. 8B is a schematic side view of a second example of a microstructure configuration made using the construction technique of FIGS. 8M-8O. [Figure 9] FIG. 1 is a schematic diagram of an example of a distributed computer architecture. [Figure 10] 1 is a schematic diagram of an example processing system. [Figure 11] 1 is a schematic diagram of an example of a client device. [Figure 12A] 1 is a flow chart of an example process for performing measurements on a living subject. [Figure 12B] 1 is a flow chart of an example process for performing measurements on a living subject. [Figure 13] 1 is a flow chart of an example process for creating a subject record. [Figure 14A] 1 is a flow chart of an embodiment of a process for performing measurements in a living subject. [Figure 14B]1 is a flow chart of an embodiment of a process for performing measurements in a living subject. [Figure 15A] FIG. 1 is a schematic perspective top view of an example patch including a substrate incorporating a microstructure electrode and a substrate coil. [Figure 15B] FIG. 15B is a schematic diagram of an equivalent circuit representing the electrical response of the patch of FIG. 15A. [Figure 15C] 15B is a graph showing the response of the patch of FIG. 15A to a drive signal. [Figure 15D] 15B is a graph showing the resonant response of the patch of FIG. 15A. [Figure 15E] FIG. 2 is a schematic perspective top view of an example of a dual patch arrangement. [Figure 15F] 15F is a graph showing an example of drive signal attenuation for the dual patch setup of FIG. 15E. [Figure 16A] 1 is an equivalent circuit for skin-based impedance measurements. [Figure 16B] 1 is an equivalent circuit for skin-based impedance measurement. [Figure 16C] FIG. 1 is a schematic diagram comparing skin and microstructure based impedance measurements. [Figure 17A] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17B] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17C] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17D] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17E] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17F] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17G] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17H] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 17I]It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17J] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17K] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17L] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17M] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17N] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17O] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 17P] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 18A] It is a microscopic photographic image of an example of a microstructure manufactured using the approach of FIGS. 17A to 17P. [Figure 18B] It is a microscopic photographic image of an example of a microstructure manufactured using the approach of FIGS. 17A to 17P. [Figure 18C] It is a microscopic photographic image of an example of a microstructure manufactured using the approach of FIGS. 17A to 17P. [Figure 18D] It is a microscopic photographic image of an example of a microstructure manufactured using the approach of FIGS. 17A to 17P. [Figure 19A] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 19B] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 19C] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 19D] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 19E] It is a schematic diagram showing the steps in an exemplary manufacturing process. [Figure 19F]1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 19G] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 19H] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 19I] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 19J] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 19K] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 19L] 1 is a schematic diagram illustrating steps in an exemplary manufacturing process. [Figure 20A] 19A-19L are micrograph images of example microstructures fabricated using the approach of FIGS. [Figure 20B] 19A-19L are micrograph images of example microstructures fabricated using the approach of FIGS. [Figure 20C] 19A-19L are micrograph images of further examples of microstructures fabricated using the approach of FIGS. 19A-19L. [Figure 20D] 19A-19L are micrograph images of further examples of microstructures fabricated using the approach of FIGS. 19A-19L. [Figure 21A] 1 is a photomicrograph image of an example of a partially coated microstructure. [Figure 21B] 1 is a photomicrograph image of an example of a partially coated microstructure. [Figure 22A] 1 is a graph showing an example of change in epidermal impedance with respect to change in water retention in pig skin. [Figure 22B] 1 is a graph showing an example of change in epidermal impedance and hematocrit in response to change in hydration. [Figure 22C] 1 is a graph showing an example of changes in epidermal and skin impedance in response to changes in hydration. [Figure 23A]1 is a graph showing the results of a first experiment to test the application of a negative electrical bias to prevent passive release of a surrogate drug (methylene blue). [Figure 23B] 13 is a graph showing further results of an experiment to test the application of a negative electrical bias to prevent passive release of a surrogate drug (methylene blue). [Figure 24A] 13 is a graph showing the results of an experiment to test tunable pulsatile release of a surrogate drug with electrical bias of alternating polarity. [Figure 24B] 13 is a graph showing further results of an experiment to test tunable pulsatile release of a surrogate drug with electrical bias of alternating polarity. [Figure 24C] 13 is a graph showing the results of further experiments to test tunable pulsatile release of a surrogate drug with electrical bias of alternating polarity. [Figure 24D] 13 is a graph showing further results of a further second experiment to test tunable pulsatile release of a surrogate drug with electrical bias of alternating polarity. [Diagram 25] 13 is a graph showing the results of a third experiment to test the suitability of methylcellulose / sucrose for therapeutic delivery. [Figure 26A] 13 is a graph showing the total amount of methylene blue retained on the patch in a fourth experiment to test the electrically tunable release of a surrogate drug into pig skin. [Figure 26B] 11 is a graph showing the amount of methylene blue delivered in a fourth experiment. [Figure 26C] 11 is a graph showing the percentage amount of methylene blue delivered in a fourth experiment. [Figure 27] 1 is a graph of the change in impedance of a molecularly imprinted polymer upon exposure to Troponin I. [Figure 28A] FIG. 1 is a schematic diagram of an example of an experimental setup for ex vivo detection of Troponin I in pig skin. [Figure 28B]1 is a graph showing the change in impedance at various concentrations of Troponin I for a molecularly imprinted conductive polypyrrole (MICP) coated patch. [Figure 28C] 1 is a graph showing the change in impedance with various concentrations of Troponin I for a patch coated with non-imprinted conductive polypyrrole (NICP). [Figure 28D] 1 is a graph showing a comparison of the change in impedance of a MICP patch and a NICP patch. [Figure 29A] FIG. 1 is a schematic diagram of an example of an experimental setup for ex vivo detection of Troponin I in pig skin. [Figure 29B] FIG. 29B is a graph showing an example of raw impedance values versus time during perfusion of the pig skin of FIG. 29A. [Figure 29C] FIG. 29B is a graph showing an example of change in impedance value over time during perfusion of the pig skin of FIG. 29A. [Figure 30A] FIG. 1 is a schematic diagram showing an example of an aptamer configuration. [Figure 30B] FIG. 1 is a schematic diagram showing an example of the configuration of an aptamer after reaction with an analyte. [Diagram 31] 1 is a graph showing the change in cyclic voltammetry readings after exposure of aptamer-functionalized microstructures to an analyte. [Figure 32A] 1 is a graph showing the change in cyclic voltammetry readings after exposure of aptamer-functionalized microstructures to an analyte. [Figure 32B] 1 is a graph showing the change in cyclic voltammetry readings after exposure of aptamer-functionalized microstructures to control solutions. [Figure 33A] FIG. 1 is a schematic showing the fabrication of antibody-functionalized electrodes for analyte sensing. [Figure 33B] FIG. 1 is a schematic diagram showing the fabrication of antibody-functionalized electrodes for analyte sensing. [Figure 33C] FIG. 1 is a schematic showing the fabrication of antibody-functionalized electrodes for analyte sensing. [Figure 34A] 1 is a graph showing the change in capacitance upon exposure to an analyte. [Figure 34B] 1 is a graph showing the change in impedance upon exposure to Troponin I. [Figure 35A] 1 is an image of a microstructure patch application site on human forearm skin immediately after removal. [Figure 35B] 1 is a scanning electron micrograph of the microstructures after application to human skin. [Figure 36A] 1 is a graph of an example of qualitative erythema scores at the site of microstructure patch application on human forearm skin from a first study. [Figure 36B] 13 is a graph of example qualitative erythema scores at microstructure patch application sites on human forearm skin from a second study. [Figure 37A] 1 is a scanning electron micrograph of the microstructures prior to application within human forearm skin. [Figure 37B] 37B is a scanning electron micrograph of the microstructure of FIG. 37A after application into the skin of a human forearm. [Figure 37C] 1 is a scanning electron micrograph of a microstructure patch after application into the skin of a human forearm. [Figure 37D] 1 is a scanning electron micrograph of the microstructures prior to application within human forearm skin. [Figure 37E] 37D is a scanning electron micrograph of the microstructure of FIG. 37D after application to human forearm skin. [Figure 37F] 1 is a scanning electron micrograph of a microstructure patch after application into the skin of a human forearm. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0087] definition Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.
[0088] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0089] The terms "about" and "approximately" are used herein to refer to conditions (e.g., amounts, levels, concentrations, time, etc.) that vary by up to 20% (i.e., ±20%) relative to a specified condition, particularly up to 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1%.
[0090] As used herein, the term "analyte" refers to a naturally occurring and / or synthetic compound that is a marker of a condition (e.g., drug abuse), disease state (e.g., infectious disease), disorder (e.g., neurological disorder), or normal or pathological process (e.g., drug metabolism) occurring in a subject, or a compound that can be used to monitor the level of an administered or ingested substance in a subject, such as a pharmaceutical (a substance that treats, prevents, and / or alleviates the symptoms of a disease, disorder, or condition, e.g., drugs, vaccines, etc.), an illicit substance (e.g., illegal drugs), a non-illicit abused substance (e.g., alcohol or prescription drugs taken for non-medical reasons), a poison or toxin (including environmental pollutants), a chemical weapon (e.g., nerve agents, etc.) or their metabolites. The term "analyte" can refer to any substance, including chemical and / or biological agents, that can be measured in an analytical procedure, including nucleic acids, proteins, illicit drugs, explosives, toxins, pharmaceuticals, carcinogens, poisons, allergens, and infectious agents that can be measured in an analytical procedure. The analyte may be a compound found directly in a sample, such as a biological tissue containing bodily fluid (e.g., interstitial fluid) from a subject, particularly in the dermis and / or epidermis. In certain embodiments, the analyte is a compound found in interstitial fluid. In some embodiments, the analyte is a compound with a molecular weight in the range of about 30 Da to about 100 kDa, particularly about 50 Da to about 40 kDa. Other suitable analytes are as described herein.
[0091] As used herein, the term "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted as alternatives (or).
[0092] As used herein, the term "aptamer" refers to a single-stranded oligonucleotide (e.g., DNA or RNA) that binds to a specific target molecule, such as an analyte. Aptamers can be of any size suitable for binding such a target molecule, such as from about 10 to about 200 nucleotides in length, particularly from about 30 to about 100 nucleotides in length.
[0093] The term "bind" and variations such as "bound" are used herein to refer to an interaction between two entities, such as an analyte and an aptamer, or an analyte and a molecularly imprinted polymer. The interaction can be a covalent or non-covalent interaction, particularly a non-covalent interaction.
[0094] Throughout this specification and the claims that follow, unless otherwise indicated by context, the word "comprise" and variations such as "comprise" and "comprising" are understood to mean the inclusion of a recited integer or step or group of integers or steps, but not the exclusion of other integers or steps or group of integers or steps. Thus, the use of terms such as "comprising" indicates that the recited integers are necessary or required, but other integers are optional and may or may not be present. "Consisting of" means including and limited to what precedes the phrase "consisting of". Thus, the phrase "consisting of" indicates that the recited elements are necessary or required, and that other elements may or may not be present depending on whether they affect the activity or action of the recited elements. "Consisting essentially of" means including any elements recited before the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in this disclosure for the recited elements. Thus, the phrase "consisting essentially of" indicates that the recited elements are necessary or required, but other elements are optional and may or may not be present depending on whether they affect the activity or action of the recited elements.
[0095] The term "multiple" as used herein means 2, 10, 100, 1000, 10000, 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , 1×10 152 to 1×10 etc. (and all integers in between) 15 (or any integer in between) and more, is used to refer to more than one.
[0096] As used herein, the term "predetermined threshold" refers to a value above or below which indicates the presence, absence or progression of a disease, disorder or condition, the presence or absence of an illegal or non-illegal abused substance, or the presence or absence of a chemical weapon, poison and / or toxin. For example, for purposes of the present invention, a predetermined threshold may represent a level or concentration of a particular analyte in a corresponding sample from an appropriate control subject, such as a healthy subject, or in a pooled sample from multiple control subjects, or the average or median value of multiple control subjects. Thus, a level or concentration above or below the threshold indicates the presence, absence or progression of a disease, disorder or condition, the presence or absence of an illegal or non-illegal abused substance, or the presence or absence of a chemical weapon, poison and / or toxin as taught herein. In other examples, the predetermined threshold may represent a value greater than or less than the level or ratio determined for the control subject, to incorporate an additional degree of confidence that a level or ratio above or below the predetermined threshold indicates the presence, absence or progression of a disease, disorder or condition, the presence or absence of an illicit or non-illicit abused substance, or the presence or absence of a chemical weapon, poison and / or toxin. One of skill in the art may readily determine an appropriate predetermined threshold based on analysis of samples from appropriate control subjects.
[0097] As used herein, the terms "selective" and "selectivity" refer to a molecular imprinted polymer or aptamer that binds an analyte of interest without exhibiting substantial binding of one or more other analytes. Thus, a molecular imprinted polymer or aptamer that is selective for an analyte, such as troponin or a subunit thereof, exhibits greater than about 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater than about 500-fold selectivity relative to the binding of one or more other analytes.
[0098] As used herein, the term "subject" refers to a vertebrate subject, particularly a mammalian subject, for which monitoring and / or diagnosis of a disease, disorder or condition is desired. Suitable subjects include, but are not limited to, primates, avians (birds), livestock animals such as sheep, cows, horses, deer, donkeys and pigs, laboratory animals such as rabbits, mice, rats, guinea pigs and hamsters, pets such as cats and dogs, bats and captive wild animals such as foxes, deer and dingoes. In particular, the subject is a human being.
[0099] System for taking measurements An example of a system for performing measurements on a living subject will now be described with reference to FIG.
[0100] In this example, the system includes at least one substrate 111 having one or more microstructures 112. In use, the microstructures are configured to breach a functional barrier associated with the subject. In the current example, the functional barrier is the stratum corneum SC, and the microstructures are configured to breach the stratum corneum SC by penetrating the stratum corneum SC and entering at least the viable epidermis VE. In one particular example, the microstructures are configured not to penetrate the boundary between the viable epidermis VE and the dermis D, although this is not required and structures that penetrate into the dermis could also be used, as described in more detail below.
[0101] Although this example is described with respect to breaking through the stratum corneum SC, it is understood that this is not necessary and that the technique can be applied to other functional barriers as well. In this regard, a functional barrier is understood to include any structure, boundary, or feature, physical or otherwise, that prevents the passage of an analyte, such as a signal and / or a biomarker. For example, a functional barrier can include one or more layers, a mechanical discontinuity, such as a discrete change in the mechanical properties of a tissue, a tissue discontinuity, a cellular discontinuity, a nerve barrier, a sensor barrier, a cell layer, a skin layer, a mucous layer, an internal or external barrier, an inner barrier in an organ, an outer barrier in an organ other than the skin, an epithelial or endothelial layer, etc. A functional barrier can also include other internal layers or boundaries, including a light barrier, such as a melanin layer, an electrical barrier, a molecular weight barrier that prevents the passage of a certain molecular weight biomarker, the basal layer boundary between the living epidermis and the dermis, etc.
[0102] The nature of the microstructures will vary depending on the preferred embodiment, in one example the microstructures may comprise needles, although this is not required and structures such as plates, blades, etc. are more commonly used, as described in more detail below.
[0103] The substrate and microstructures can be made from any suitable material, and the materials used can depend on the intended application, such as whether the structure needs to be optically and / or electrically conductive. In the present example, the microstructure includes electrodes that allow signals to be communicated to a subject, such as allowing electrical signals within the body to be detected or applied to a subject. The electrodes can be formed from the entire microstructure, if the microstructure is conductive, or can be surface electrodes formed from a conductive material applied to the surface of the microstructure, depending on the preferred embodiment.
[0104] The substrate can form part of a patch 110 that can be applied to a subject, although other arrangements can be used, for example, the substrate forms part of a housing that contains other components.
[0105] In one example, the electrode configuration is used in conjunction with a measurement device, which in one example includes at least one sensor 121 operably connected to at least one microstructure 112, whereby a response signal can be measured from each microstructure 112. In this regard, the term response signal will be understood to encompass signals that are intrinsic in the subject, such as ECG (electrocardiograph) signals, or signals that are induced as a result of application of a stimulus, such as bioimpedance signals.
[0106] The nature of the sensor will vary depending on the preferred embodiment and the nature of the sensing being performed. For example, sensing may include sensing of an electrical signal, in which case the sensor may be a voltage or current sensor, etc. Alternatively, other signals such as optical signals may also be sensed, in which case the sensor may also include an optical sensor such as a photodiode, CCD (Charge Coupled Device) array, while a temperature signal may be sensed using a thermistor, etc.
[0107] The manner in which the sensor 121 is connected to the microstructure electrode(s) 112 also varies depending on the preferred embodiment. In one example, this is accomplished using a connection between the microstructure electrode(s) 112 and the sensor, the nature of the connection varying depending on the signal to be sensed, so that the connection may include an electrically conductive element to conduct an electrical signal, a waveguide to conduct an electromagnetic signal, an optical fiber or other conductor, or a thermal conductor to conduct a thermal signal. The connection may also include a wireless connection, allowing the sensor to be located remotely. Furthermore, the connection may be provided as a separate element, while in other examples the substrate provides the connection, for example when the substrate is made of a conductive plate which is further electrically connected to all the microstructures. As a further alternative, the sensor may be embedded in or formed from part of the microstructure, and may not require a connection.
[0108] The sensors 121 may be operatively connected to all of the microstructures 112 by joint and / or independent connections. For example, one or more sensors may be connected to different microstructures to allow measuring different measurement response signals from different populations of microstructures 112. However, this is not required and any suitable arrangement may be used.
[0109] In addition to or instead of providing sensing, in some examples, the microstructure 112 may be configured to provide a stimulus. For example, the microstructure may be coupled to a signal generator that generates a stimulus signal, as described in more detail below. Such stimuli may also include electrical stimuli using a voltage or current source, optical stimuli using a visible or non-visible radiation source such as an LED or laser, thermal stimuli, etc., and may be delivered through the same or a different microstructure used to measure the response signal depending on the preferred embodiment. Additionally and / or alternatively, the stimulus may be achieved using other techniques, such as through exposure of the subject to the microstructure and materials thereon or therein. For example, a coating may be applied to the microstructure to allow a material to be delivered across a barrier to the subject, thereby stimulating a response in the subject.
[0110] These options allow for various types of sensing and or stimulation to be performed, including detection of electrical signals within the body such as ECG signals, plethysmographic signals, electromagnetic signals, or electrical potentials generated by muscle, nerve tissue, blood, etc., photoplethysmographic such as fluorescence, detection of electromagnetic effects, detection of mechanical properties such as stress or strain, etc. Sensing may include detection of the body's response to an applied electrical signal, for example to measure bioimpedance, bioconductance, or biocapacitance, detection of the presence, absence, level or concentration of an analyte, for example by detecting an electrical or optical property, etc.
[0111] In this regard, although the present implementation relates to an electrode configuration, it will be appreciated that other sensing / stimulation modalities may also be used in conjunction with electrical stimulation or detection, such as using an electrical signal to stimulate an optical response, etc. Thus, while electrodes are provided to enable electrical signals to be applied and / or measured, this does not preclude the use of additional stimulation or sensing modalities.
[0112] The system may further include one or more electronic processing devices 122 which may form part of a measurement device as described in more detail below, and / or may include an electronic processing device forming part of one or more processing systems such as a computer system, a server, a client device, etc. In use, the processing device 122 is adapted to control a signal generator and / or receive and analyze signals from the sensor 121 and store or process the signals. For ease of explanation, the remainder of the description will generally refer to a processing device, however it will be understood that multiple processing devices may be used with processing distributed between devices if desired, and that references to the singular encompass multiple equipment and vice versa.
[0113] An example of how this can be done will now be described with reference to FIG.
[0114] In particular, in this example, in step 200, a substrate is applied to a subject such that one or more microstructures breach, and in one example, penetrate, a functional barrier. For example, when applied to the skin, the microstructures may penetrate the stratum corneum and enter the viable epidermis, as shown in Figure 1. This may be accomplished manually and / or through the use of an actuator to help ensure good penetration.
[0115] At step 210, a stimulus signal is optionally applied to the subject, and at step 220 a response signal in the subject is measured and a signal indicative of the measured response signal is provided to the electronic processing device 112. This may occur after application of the stimulus, but this is not required and will vary depending on the nature of the sensing being performed.
[0116] The one or more processing devices may then analyze the resulting measurement data at step 230 and / or store data based on the measurement data for later analysis or provide an output based on the measured response signals. For example, the processing device may display an indicator indicative of the measured response signals and / or values derived therefrom. Alternatively, the processing device may generate intervention recommendations, trigger actions such as alerting a clinician, trainer, or parent, etc.
[0117] The analysis can be performed in any suitable manner, which varies depending on the nature of the measurements made. For example, this can include examining the values of the measured response signals and using them to calculate an index that indicates a health status, including the presence, absence, degree or prognosis of one or more medical conditions, prognosis related to a medical condition, the presence, absence, level or concentration of a biomarker, the presence, absence, level or concentration of an analyte, the presence, absence or grade of cancer, fluid levels in the subject, blood oxygenation, tissue inflammation state, bioelectrical activity such as nerve, brain, muscle or heart activity, or various other health conditions. This can also be achieved by monitoring the change in value over time, and can include a comparison with values measured for a reference subject with a known medical condition. Additionally and / or alternatively, the index can indicate a measured parameter associated with the subject, such as a measured level or concentration of an analyte or other biomarker.
[0118] For example, when measuring fluid levels, this may involve examining the values of the applied stimulation signal and the measured response signal and using these to calculate bioimpedance within the epidermis, which may further derive an index indicative of fluid levels. In this regard, fluids within the body, such as interstitial fluid, contain sodium (Na+), potassium (K+), calcium (Ca 2 +), chloride (Cl-), bicarbonate (HCO3-) and phosphate (HPO4 2It will be appreciated that the impedance measurement includes ions such as ions, such as ions, ions, and ions ...
[0119] The fluid level indicators may further be used in monitoring hydration levels and / or health status, such as the presence, absence, degree or prognosis of one or more medical conditions, prognosis associated with a medical condition, etc. This may include monitoring changes in values over time, for example to provide a longitudinal hydration measurement, and may include comparison to values measured for a reference subject of known hydration levels, thereby allowing an assessment of whether the subject is under- or over-hydrated.
[0120] In any event, it will be appreciated that the above-described systems operate by providing microstructures including electrodes configured to penetrate a barrier, such as the stratum corneum, and allowing these to be used to measure response signals within a subject, such as within the epidermis and / or dermis. These response signals can be further processed and then analyzed to derive specific measurements or various values that may be indicative of one or more aspects of the subject's health.
[0121] For example, the system may be configured to measure an analyte level or concentration, such as the level or concentration of a particular biomarker. The response signal may also be used to generate visualization, one-, two- or three-dimensional spatial mapping, mechanical properties, force, pressure, muscle movement, blood pulse wave details, analyte concentrations, such as the presence, absence, level or concentration of a particular biomarker, blood oxygen saturation, bioimpedance, biocapacitance, bioconductance, or electrical signals within the body, such as ECG (electrocardiogram) signals.
[0122] In one example, the system, and in particular the electrodes, may be configured to allow measurements to be taken at specific locations within a subject, such as only within the epidermis, only within the dermis, etc. This allows for high accuracy in detecting target analytes and provides higher quality data for more precise measurement of the analyte. Additionally, limiting the locations at which measurements are taken ensures that the measurements are reproducible, allowing for more accurate long-term monitoring.
[0123] In contrast to conventional approaches, breaking through and / or at least partially penetrating a functional barrier such as the stratum corneum allows measurements to be made from within or below the barrier, in particular from within the epidermis and / or dermis, resulting in a significant improvement in the quality and magnitude of the detected response signal. In particular, this ensures that the response signal accurately reflects conditions within the human body, in particular within the epidermis and / or dermis, such as the presence, absence, level or concentration of biomarkers, impedance of interstitial fluid, in contrast to conventional external measurements that are overly affected by the environment outside the barrier, such as the material properties of the skin, the presence or absence of hair, sweat, physical properties of the skin surface, such as the mechanical behavior of the applied sensor, etc. In addition, penetrating the stratum corneum but not the dermis allows the measurement to be limited to the epidermis only, thereby avoiding interference from changes in the fluid levels in the dermis.
[0124] For example, this allows accurate measurement of high molecular weight biomarkers that would otherwise barely pass through the skin. A good example is glucose, which is usually present in low concentrations when present externally, such as in sweat, and is often time-delayed, i.e., the concentration in sweat does not necessarily reflect the current glucose level in the body. In contrast, breaking through a barrier, in this case the stratum corneum, allows much more accurate measurements. It will be appreciated that similar considerations apply to a wide range of different biomarkers or signals and associated barriers that would otherwise prevent accurate measurement of the biomarker or signal.
[0125] For example, in the case of impedance measurements, microstructured electrodes tend to measure a different impedance compared to standard surface electrodes, which indicates that microstructured electrodes do not measure the impedance of the skin, i.e. the impedance measured is more indicative of conditions inside the body. Because the impedance contribution of the skin surface is large, this can lead to changes in the impedance inside the covered body, i.e. skin-based measurements are less likely to detect meaningful changes.
[0126] A further problem with skin-based impedance measurements is that the fields generated tend to pass through the stratum corneum and dermis and are not restricted to the epidermis. An example of this is shown in Figure 16C.
[0127] In this example, skin-based electrode 1601 generates an electric field 1602 that extends into the stratum corneum SC, the viable epidermis VEPiD, and the dermis D. In contrast, microstructure patch 1603 generates an electric field 1604 that is confined to the viable epidermis VEPiD.
[0128] Examples of equivalent circuits resulting from skin-based and epidermal measurements are shown in Figures 16A and 16B, respectively. In this regard, each equivalent circuit includes three circuits representing the contribution of current flowing through the tissue in orthogonal directions for each layer. Thus, in the skin-based measurement shown in Figure 16A, the impedance of the stratum corneum is represented by circuit C SC1 , R SC1 , CSC2 , R SC2 , C SC3 , R SC3 The epidermis is represented by the circuit C VE1 , R VE1 , C VE2 , R VE2 , C VE3 , R VE3 The dermis is represented by circuit C D1 , R D1 , C D2 , R D2 , C D3 , R D3 In this example, R SC1 >>R VE1 , R SC2 >>R VE2 and R SC3 >>R VE3 i.e., the impedance contribution of the epidermis layer is very small compared to the impedance contribution of the stratum corneum, so that skin-based measurements are more reflective of the impedance of the stratum corneum.
[0129] In contrast, in the case of epidermal sensing only shown in FIG. 16B, the impedance is VE1 , R VE1 , C VE2 , R VE2 , C VE3 , R VE3 only, and thus epidermal measurements are more reflective of epidermal fluid levels.
[0130] In addition, in some cases, the microstructure penetrates the barrier far enough to allow measurements to be made. For example, in the case of skin, the microstructure is usually configured to enter the viable epidermis and not enter the dermis layer. This results in several improvements over other invasive techniques, including avoiding problems associated with penetrating the dermis, such as pain, erythema, and pinpoint bleeding caused by nerve exposure. Avoiding the penetration of the dermal boundary also greatly reduces the risk of infection, allowing the microstructure to remain embedded for extended periods of time, such as several days, which can further be used for long-term longitudinal monitoring. However, in some cases, such as when detecting troponin or its subunits, penetration of the dermal barrier may be necessary.
[0131] It will be appreciated that being able to keep the microstructures in situ is particularly beneficial as it ensures that measurements are taken at the same location within the subject, reducing inherent variability resulting from imprecision in repositioning the measurement device that can occur with conventional techniques. Nevertheless, it will be appreciated that the system may be used in other manners, such as to provide single point in time monitoring.
[0132] In one example, this allows the equipment to be provided as part of a wearable device, which can perform measurements significantly better than existing surface-based measurement techniques, for example by providing access to signals or biomarkers that would not otherwise be able to pass through a barrier, but still allowing measurements to be taken while the subject is performing normal activities and / or over an extended period of time. This further allows measurements to be obtained that more accurately reflect the subject's health or other status. For example, this allows the fluctuations in the subject's condition over the course of a day to be measured, avoiding measurements being taken in artificial conditions, such as in a clinic, that do not represent the subject's actual situation. This also allows monitoring to be performed substantially continuously, which allows conditions, for example in the case of myocardial infarction, cardiovascular disease, vomiting, diarrhea, etc., to be detected as soon as they arise, so that more rapid intervention can be sought.
[0133] The above-mentioned system can be applied to any part of the body and therefore can be used with a wide range of different functional barriers. For example, the functional barrier can be an internal or external barrier, a skin layer, a mucous layer, an inner barrier in an organ, an outer barrier of an organ, an epithelial layer, an endothelial layer, a melanin layer, a light barrier, an electrical barrier, a molecular barrier, a basal layer or a stratum corneum. Thus, the microstructures can be applied to the buccal mucosa, the eye, or another epithelial layer, an endothelial layer, etc. The following examples focus specifically on application to the skin, and the functional barrier includes some or all of the stratum corneum, but it will be understood that this is intended to be illustrative and not limiting.
[0134] Further variations will become apparent from the following description.
[0135] In one example, the system includes a signal generator operably connected to at least one microstructure to apply a stimulus, typically by applying a stimulus signal to the microstructure. Again, the manner in which the signal generator is connected varies depending on the preferred embodiment, and this may be accomplished via connections, such as wired or wireless connections, and / or by integrating the signal generator into the substrate and / or the microstructure. Examples of types of connections include mechanical connections, magnetic connections, thermal connections, electrical connections, electromagnetic connections, optical connections, etc.
[0136] The nature of the stimulation signal and the manner in which it is applied will vary depending on the preferred embodiment and may include any one or more of biochemical, chemical, mechanical, magnetic, electromagnetic, electrical, optical, thermal, or other signals. The stimulation signal may be used to allow measurement of a response signal and / or to trigger a biological response, which may then be measured. For example, the stimulation signal may be used to cause electroporation to induce local inflammatory mediators, which may further release biomarkers and allow their levels or concentrations to be measured. In this regard, electroporation or electroporation involves applying an electric field to cells to increase the permeability of cell membranes to allow chemicals, drugs, or DNA to be introduced into the cells. In another example, the stimulation may be used to break down boundaries within a subject, for example, to break down the dermal boundary, allowing biomarkers in the dermal layer to be detected in the living epidermis without the need for penetration of the dermal layer by microstructures. In a further example, the stimulation may be used to trigger additional effects. Thus, for example, an electrical or mechanical signal can be used to disrupt a coating on the microstructure to release material, which can then be stimulated by a chemical or other stimulus.
[0137] Stimulation signals can also be applied to the microstructures to alter their form or function: for example, polymeric microstructures can be induced to expand or contract along their length or width by an applied electric field or temperature, while microstructures can be configured to move between a retracted flat position and an extended upright position for penetrating and then retracting the skin or other barrier.
[0138] In one example, the operation of the signal generator is controlled by a processing device, which can control the signal generator to perform measurements, for example by applying an electrical signal to enable impedance measurements to be performed. Additionally and / or alternatively, the processing device can also control the signal generator according to the measured response signal, for example to apply a stimulus to the subject and / or the microstructure when certain criteria are met. For example, in a theranostic application, the signal applied to the microstructure can be used to release therapeutic materials. In this example, the processing device can monitor the response signals and use these to assess when intervention is required, and further control the signal generator to trigger the release. In one example, such control can be according to a dosing regimen, specifying, for example, the dose and the timing of dose delivery, after it has been determined that a therapy is required. In this example, the dosing regimen can be predetermined and stored on-board, or can be manually entered by a clinician or other individual as needed.
[0139] As mentioned above, the signal generator and / or sensor can be connected to the microstructure via a connection. The nature of the connection varies depending on the preferred embodiment and the nature of the signal. For example, if the signal is an optical or other electromagnetic signal, a waveguide, fiber optic cable, or other electromagnetic conductor can be used. In the case of an electrical signal, the connection can be a conductive connection such as a wire, or a conductive track on a substrate, or can be formed by a conductive substrate. The connection can also include a wireless connection such as a short-range radio frequency wireless connection, an inductive connection, etc. The connection can also be a mechanical connection, a magnetic connection, a thermal connection, etc.
[0140] In one example, inductive connections can be used to transmit signals and power, such that, for example, inductive coupling can be used to power electronic circuitry mounted on the substrate. This can also be used to allow basic processing such as amplification and processing of impedance changes to be done on the substrate using simple integrated circuits or the like, without the need for an on-board power source on the substrate.
[0141] In one example, the system may include a response microstructure used to measure a response signal and / or a stimulus microstructure used to apply a stimulus signal to the subject. Thus, the stimulus and response may also be measured through different microstructures, in which case the substrate typically incorporates a response connection that allows the response signal to be measured and a stimulus connection that allows the stimulus signal to be applied. In some examples, multiple stimulus and response connections are provided to allow different measurements to be made through different connections. For example, to allow multimodal sensing, different types of measurements may be made through different microstructures or different parts of a given microstructure. Additionally and / or alternatively, the same types of measurements may be made at different locations and / or depths, for example to identify localized problems such as the presence of skin cancer, etc. In other cases, the stimulus and measurement may be made through the same connection, for example when making bipolar impedance measurements.
[0142] Signals can also be applied to or measured from individual microstructures and / or different portions of the microstructures, which can be useful for distinguishing features at different locations and / or depths within the body. This can be used, for example, for mapping or tomography to produce images where, for example, the contrast or color of the image is proportional to changes in a physical property such as the level or concentration of one or more analytes or bioimpedance. Additionally and / or alternatively, signals can be applied to or measured from multiple microstructures collectively, which can be used to improve signal quality or to perform measurements such as bipolar, quadripolar or other multipolar impedance measurements. Additionally and / or alternatively, microstructures can be used for both measurement and stimulation, for example, by applying a signal to the microstructures and then measuring the response therefrom.
[0143] In one particular example, the sensors and / or signal generators may be connected to the microstructures via one or more switching devices, such as multiplexers, to allow signals to be selectively communicated between the sensors or signal generators and different microstructures. The processing device is typically configured to control the switches to allow a variety of different sensing and stimulating to be accomplished under the control of the processing device. In one example, this allows at least some electrodes to be used independently of at least some other electrodes. The ability to selectively interrogate different electrodes in this manner may provide advantages.
[0144] For example, this allows different electrodes to have different functionality, e.g., by functionalizing different electrodes with different coatings and further interrogating or stimulating them as needed, so that different measurements can be made as needed. Additionally and / or alternatively, this allows different measurements to be made via different microstructures, e.g., for spatial discrimination and therefore mapping. For example, by interrogating electrodes at different locations on the patch, a measurement map at different locations can be constructed, which can be further used to locate effects such as the presence of an analyte or a particular target, such as a lesion or cancer. Furthermore, this allows stimuli to be delivered to different microstructures. For example, in theranostic embodiments, different therapeutic materials or doses can be associated with different microstructures, so that different interventions can be made by selectively stimulating different microstructures. In some examples, different microstructures can be used for different purposes, so that some microstructures are used for sensing and other microstructures are used for delivering stimulation and / or therapy.
[0145] In another example, when electrodes are provided in pairs, it allows some electrode pairs to be used independently of other pairs, as described in more detail below. In one particular example, electrodes and / or electrode pairs may be provided in columns, allowing measurements to be made row by row, although this is not required and other groupings may be used.
[0146] The nature of the substrate and / or microstructure varies depending on the preferred embodiment. For example, the substrate and / or microstructure can be made of or contain fabric, woven fabric, electronic fabric, natural fiber, silk, organic material, natural composite material, artificial composite material, ceramic, stainless steel, ceramic, stainless steel, metal such as titanium or platinum, polymer such as rigid or semi-rigid plastic including doped polymer, silicon or other semiconductor including doped semiconductor, organosilicate, gold, silver, carbon, carbon nanomaterial, etc. The substrate and microstructure can be made of similar and / or dissimilar materials and can be integrally formed or made separately and bonded together. The microstructure can also be provided on one or more substrates, so that, for example, signals can be measured or applied between microstructures on different substrates.
[0147] It will be understood that the specific materials used will depend on the intended application, thus different materials will be used, for example, if the microstructure needs to be conductive as opposed to insulating. Insulating materials such as polymers and plastics can also be doped to provide the necessary conductivity, for example by doping with micro- or nano-sized metal particles, or conductive composite polymers such as PEDOT:PSS (poly(3,4-ethylenedioxythiophene)polystyrene) can be used. When doping is used, it can involve the use of graphite or graphite derivatives, including 2D materials such as graphene and carbon nanotubes, which can also be used as stand-alone materials or blended with polymers or plastics and as dopants.
[0148] The substrate and microstructures can be fabricated using any suitable technique. For example, in the case of silicon-based structures, this can be done using etching techniques. Polymer or plastic structures can also be fabricated using additive manufacturing such as 3D printing or molding. In one particular example, a mold is filled with a suitable filler material, such as a solution containing materials such as active compounds and / or sugar-based excipients such as carboxymethylcellulose (CMC), or one or more polymers, which is then cured and removed. It will also be understood that the filler material can include any necessary probes, reagents, etc. to be contained within the structure, as discussed in more detail below. Photosensitive polymers such as photoresists or polyimides, including SU8, may be used to directly pattern electrodes on the substrate or to create the microstructures. Successive layers of photosensitive resists, polymers, metals, etc. can be deposited and / or selectively removed to yield the shape of a custom 3D microstructure.
[0149] In one example, the substrate may be at least partially flexible to allow it to conform to the shape of the subject, thereby ensuring penetration of the microstructures into the living epidermis and / or dermis or other functional barrier. In this example, the substrate could be a textile or fabric with electrodes and circuitry woven into it, or multiple substrates could be attached to a flexible backing to provide a segmented substrate fitment. Alternatively, the substrate could be molded to conform to the shape of the subject, so as to be rigid yet ensure penetration of the microstructures.
[0150] In a preferred example, the substrate and the microstructure are formed from one or more of a metal, a polymer, or silicon.
[0151] The microstructures may have a variety of shapes, including ridges, needles, plates, blades, and the like. In this regard, the terms plate and blade are used interchangeably to refer to microstructures whose width is of a similar order of magnitude to their length, but are rather thin. The microstructures may be tapered to facilitate insertion into a subject, and may have different cross-sectional shapes, for example, depending on the intended use. The microstructures typically have a rounded rectangular shape, and may include shape variations along the length of the microstructure. For example, the microstructures may also include a shoulder configured to abut the stratum corneum to control the depth of penetration, and / or a shaft extending to a tip configured to control the position of the tip within the subject and / or provide a surface for an electrode.
[0152] Examples of other shapes include circles, rectangles, cross shapes, squares, rounded squares, rounded rectangles, ovals, etc., which can allow for increased surface area, which is useful in coating the microstructures to maximize the volume of coverage and therefore the amount of payload delivered per microstructure, although it will be appreciated that various other shapes can also be used. The microstructures can have rough or smooth surfaces, or can include surface features such as pores, ridges, serrations, etc., that can increase the surface area and / or help penetrate or engage tissue, thereby anchoring the microstructure within the subject. This can also help reduce biofouling, for example, by preventing the attachment and therefore accumulation of biofilms. The microstructures can also be hollow or porous, and can include internal structures such as holes, in which case the cross-sectional shape can also be at least partially hollow. In certain embodiments, the microstructures can be porous, which can increase the effective surface area of the microstructures. The pores may be of any suitable size that allows an analyte of interest to enter the pore while excluding one or more other analytes or substances, and thus depends on the size of the analyte of interest, hi some embodiments, the pores may be less than about 10 μm in diameter, preferably less than about 1 μm in diameter.
[0153] In one example, the microstructure has a rounded rectangular shape when viewed in cross section through a plane extending laterally through the microstructure and parallel to but offset from the substrate. The microstructure may include shape variations along the length of the microstructure. For example, the microstructure may include a shoulder configured to abut the stratum corneum to control the depth of penetration, and / or a shaft extending to a tip configured to control the position of the tip within the subject and / or provide a surface for an electrode.
[0154] Different microstructures can be provided on a common substrate, e.g., different shaped microstructures can be provided to achieve different functions. In one example, this can include performing different types of measurements. In another example, microstructures can be provided on different substrates, e.g., sensing can be performed via microstructures on one patch and therapeutic delivery can be performed via microstructures on a different patch. In this example, this allows therapeutic patches to be replaced when exhausted, while the sensing patch can remain in situ. Additionally, measurements can be performed between patches, e.g., whole body impedance measurements can be performed between patches provided at different locations on a subject.
[0155] Additionally and / or alternatively, anchor microstructures may be provided that can be used to anchor the substrate to a subject. In this regard, the anchor microstructures will typically be longer in length than the microstructures, which may help hold the substrate in place on the subject and ensure that the substrate does not move or is not inadvertently removed during measurement. The anchor microstructures may include anchoring structures such as raised portions that can aid in tissue engagement, which may be formed by the shape of the microstructure and / or the shape of the coating. Additionally, the coating may include a hydrogel or other similar material that expands upon exposure to moisture in the subject or upon application of a stimulus, thereby further facilitating engagement with the subject. Similarly, the microstructures may undergo a shape change, such as swelling, in response to exposure to a substance such as water or moisture in the subject or in response to an applied stimulus. It will be appreciated that the anchor microstructures can enter the dermis when applied to the skin, and thus are longer than the other microstructures, helping to hold the substrate in place, although this is not required and is in accordance with the preferred embodiment. In other examples, the anchor microstructures are rougher than other microstructures, have more surface friction than other microstructures, are duller than other microstructures, or are thicker than other microstructures.
[0156] In a further example, at least a portion of the substrate can be coated with an adhesive coating to enable the substrate, and thus the patch, to adhere to a subject.
[0157] As mentioned above, when applied to the skin, the microstructures will usually enter the living epidermis, in one example they will not enter the dermis, but in other examples they may enter the dermis. However, this is not required, and in some applications it may be necessary for the microstructures to enter the dermis, for example protruding briefly through the living epidermis / dermis boundary, or to enter the dermis a significant distance, depending on the nature of the detection primarily being performed. In one example, for skin, the microstructures have a length that is at least one of less than 2500 μm, less than 1000 μm, less than 750 μm, less than 600 μm, less than 500 μm, less than 400 μm, less than 300 μm, less than 250 μm, more than 100 μm, more than 50 μm, and more than 10 μm, although it will be understood that other lengths may also be used. More generally, when applied to a functional barrier, the microstructures typically have a length greater than the thickness of the functional barrier, at least 10% greater than the thickness of the functional barrier, at least 20% greater than the thickness of the functional barrier, at least 50% greater than the thickness of the functional barrier, at least 75% greater than the thickness of the functional barrier, and at least 100% greater than the thickness of the functional barrier.
[0158] In another example, the microstructure has a length that is 2000% greater than the thickness of the functional barrier, 1000% greater than the thickness of the functional barrier, 500% greater than the thickness of the functional barrier, 100% greater than the thickness of the functional barrier, 75% greater than the thickness of the functional barrier, or 50% greater than the thickness of the functional barrier. This avoids deep penetration of underlying layers within the body that may be undesirable, it being understood that the length of the microstructure used will vary depending on the intended use and in particular the nature of the barrier to be breached and / or the signal to be applied or measured. The length of the microstructure may also be non-uniform, for example the blade may be higher at one end than the other, which may facilitate penetration of the target or functional barrier.
[0159] Similarly, the microstructures can have different widths depending on the preferred embodiment. Typically, the width is at least one of less than 25% of the length, less than 20% of the length, less than 15% of the length, less than 10% of the length, or less than 5% of the length. Thus, for example, the microstructures can have a width of less than 50 μm, less than 40 μm, less than 30 μm, less than 20 μm, or less than 10 μm when applied to the skin. However, instead, the microstructures can include blades and can be wider than the length of the microstructures. In some examples, the microstructures can have a width of less than 50,000 μm, less than 40,000 μm, less than 30,000 μm, less than 20,000 μm, less than 10,000 μm, less than 5000 μm, less than 2500 μm, less than 1000 μm, less than 500 μm, or less than 100 μm. In the example of a blade, it is also possible to use a microstructure with a width substantially up to the width of the substrate.
[0160] Generally, the thickness of the microstructure is fairly small to facilitate penetration, typically less than 1000 μm, less than 500 μm, less than 200 μm, less than 100 μm, less than 50 μm, less than 20 μm, less than 10 μm, at least 1 μm, at least 0.5 μm, or at least 0.1 μm. Generally, the thickness of the microstructure is dictated by mechanical requirements, in particular the need to ensure that the microstructure does not break, fracture, or deform upon penetration. However, this problem can be mitigated by the use of coatings that add additional mechanical strength to the microstructure.
[0161] In one embodiment, for epidermal detection, the microstructure has a length of less than 300 μm, more than 50 μm, more than 100 μm and about 150 μm, and a width that is greater than or about equal to the length of the microstructure, usually less than 300 μm, more than 50 μm and about 150 μm. In another example, for dermal detection, the microstructure has a length of less than 450 μm, more than 100 μm and about 250 μm, and a width that is greater than or about equal to the length of the microstructure, at least a similar order of magnitude to the length, usually less than 450 μm, more than 100 μm and about 250 μm. In other examples, longer microstructures can be used, so that for example, for hyperdermal detection, the length of the microstructure will be longer. The microstructure usually has a thickness that is less than, much less than, or a smaller order of magnitude than the width. In one example, the thickness is less than 50 μm, more than 10 μm, and about 25 μm, but the microstructures typically include an extended base for additional strength, and thus a base thickness adjacent to the substrate that is about three times the thickness, typically less than 150 μm, more than 30 μm, and about 75 μm. The microstructures typically have a tip that is less than 50% of the length of the microstructure, at least 10% of the length of the microstructure, and more typically about 30% of the length of the microstructure. The tip further has a sharpness of at least 0.1 μm, less than 5 μm, and typically about 1 μm.
[0162] In one example, the microstructure has a resolution of 1000 / cm 2 Less than 500 / cm 2 Less than 100 / cm 2 Less than 10 / cm 2 Less than or even 5 / cm 2 Less than 10000 / cm 2 The use of a relatively low density facilitates penetration of the microstructures through the stratum corneum and avoids problems associated with penetration of the skin with high density arrays, which may require more high power actuators to properly apply the array. However, this is not required and may be less than 50,000 / cm. 2 Microstructures less than 30,000 / cm 2Higher density microstructure arrangements can also be used, including microstructures of less than 10 mm. As a result, the microstructures will typically have spacings of less than 20 mm, less than 10 mm, less than 1 mm, less than 0.1 mm, or less than 10 μm. It should be noted that in some circumstances the microstructures are provided in pairs, with the microstructures in each pair having small spacings, such as less than 10 μm, while the pairs have larger spacings, such as greater than 1 mm, to ensure that a low overall density is maintained. However, it will be appreciated that this is not required and that higher densities may be used in some circumstances.
[0163] In one embodiment, the microstructure has a density of 5000 / cm 2 Less than 100 / cm 2 More than and about 600 / cm 2 densities resulting in spacings of less than 1 mm, greater than 10 μm, and about 0.5 mm, 0.2 mm, or 0.1 mm.
[0164] In one example, when optical sensing is performed, the substrate connections include waveguides or other electromagnetically conductive pathways, such as optical fibers, that extend through the microstructure to one or more ports in the microstructure, allowing electromagnetic radiation to be emitted from or received through the ports. In one example, this is accomplished by having the microstructure made from or contain a polymer or other similar material that is at least partially transparent to the frequencies of the applied or received electromagnetic radiation, which may include visible light, ultraviolet light, infrared light, etc., depending on the preferred application.
[0165] In one example, the at least partially electromagnetically transparent core may be surrounded by an outer electromagnetically opaque layer, with ports extending through the opaque layer to allow electromagnetic radiation to be emitted or received through the ports. In this example, it will be appreciated that appropriate placement of the ports may allow radiation to be delivered or received in a targeted manner, for example, directing it to a particular depth within the living epidermis or elsewhere. In one example, the transparent core may be made from a waveguide, such as a fiber optic cable, or a portion thereof. For example, the outer layer and / or the reflective layer may be removed, allowing the microstructure's transparent core to be made from an optical fiber core. In a further example, the microstructure includes an electromagnetic reflective layer that allows electromagnetic radiation to be conducted to and from a designated port.
[0166] Similar provisions are provided for electrical signal transmission, where the microstructure optionally includes an electrically insulating layer comprising an electrically conductive material and including ports to allow electrical signals to be emitted from or received by the ports, again optionally at different depths so that electrical signals can be measured at different locations and / or depths.
[0167] Thus, the microstructure may comprise an electrically conductive material at least partially covered by a non-conductive (insulating) layer, with an opening providing access to the core to allow conduction of an electrical signal therethrough, thereby defining an electrode. In one example, the insulating layer extends over a portion of the surface of the microstructure, including the proximal end of the microstructure adjacent the substrate. The insulating layer may extend over at least half the length of the microstructure, and / or about 60 μm, 90 μm, or 150 μm of the proximal end of the microstructure, and optionally over at least a portion of the distal portion of the microstructure. In one embodiment, this is done so that the non-insulating portion is provided within the epidermis and / or dermis to apply a stimulating signal to the epidermis and / or dermis and / or receive a response signal from the epidermis and / or dermis. The insulating layer may also extend over a portion or all of the surface of the substrate. In this regard, in some examples, connections are formed on the surface of the substrate, in which case a coating may be used to insulate them from the subject. For example, electrical connections to the electrodes may be provided using electrical tracks on the surface of the substrate, with an insulating layer provided over the connections to ensure that the connections do not make electrical contact with the subject's skin which may further adversely affect the measured response signal.
[0168] The microstructure may be made from a metal or other conductive material such that the entire microstructure constitutes an electrode, or an electrode may be coated or deposited on the microstructure, for example by depositing a layer of gold to form the electrode. In a further example, the microstructure may include an electrically conductive core covered with a non-conductive layer, with openings providing access to the core to allow conduction of an electrical signal therethrough. The electrode material may include any one or more of gold, silver, colloidal silver, colloidal gold, colloidal carbon, carbon nanomaterials, platinum, titanium, stainless steel, or other metals, or any other biocompatible conductive material.
[0169] The electrodes may be used to apply an electrical signal to a subject and measure an intrinsic or exogenous response electrical signal, e.g., measuring an ECG or impedance, etc. In another example, one or more microstructure electrodes interact with one or more analytes of interest such that the response signal is dependent on the presence, absence, level or concentration of the one or more analytes of interest, thereby allowing the level or concentration of the one or more analytes to be quantified.
[0170] In one example, the microstructure comprises a plate having a substantially planar surface with an electrode thereon. The use of a plate shape maximizes the surface area of the electrode while minimizing the cross-sectional area of the microstructure, thereby aiding in the penetration of the microstructure into a target. This also allows the electrode to act as a capacitive plate, allowing for capacitive sensing. In one example, the electrode is at least 10 mm 2 , at least 1 mm 2 , at least 100,000 μm 2 , 10,000μm 2 , at least 7,500 μm 2 , at least 5,000 μm 2 , at least 2,000 μm 2 , at least 1,000 μm 2 , at least 500 μm 2 , at least 100 μm 2 , or at least 10 μm 2 In one example, the electrodes have a width or height of up to 2500 μm, at least 500 μm, at least 200 μm, at least 100 μm, at least 75 μm, at least 50 μm, at least 20 μm, at least 10 μm, or at least 1 μm. In the case of electrodes provided on a blade, the width of the electrodes may be less than 50000 μm, less than 40000 μm, less than 30000 μm, less than 20000 μm, less than 10000 μm, or less than 1000 μm, including the widths outlined above. In this regard, it should be noted that these dimensions apply to individual electrodes, and that in some examples each microstructure may include multiple electrodes.
[0171] In one embodiment, the electrodes are 200,000 μm 2 Less than 2000μm 2 and approximately 22,500 μm 2 and the electrode extends the length of the distal portion of the microstructure, optionally spaced from the tip, and optionally positioned proximate the distal end of the microstructure as well as proximate the tip of the microstructure. The electrode may extend over at least 25% and less than 50% of the length of the microstructure, so that the electrode typically extends over about 60 μm, 90 μm or 150 μm of the microstructure and thus is positioned within the living epidermis and / or dermis of the subject in use.
[0172] In one example, at least some of the microstructures are arranged in groups, such as pairs, and a response signal or stimulus is measured from or applied to the microstructures in the group. The microstructures in the group can have a particular configuration that allows a particular measurement to be made. For example, when arranged in pairs, the separation distance can be used to affect the nature of the measurement made. For example, when making a bioimpedance measurement, if the separation between the microstructures is greater than a few millimeters, this tends to measure the properties of the interstitial fluid located between the electrodes, while decreasing the distance between the microstructures makes the measurement more influenced by surface properties, such as the presence of material bound to the surface of the microstructures. The measurement is also influenced by the nature of the stimulus applied, so that, for example, low frequency currents tend to flow through extracellular fluid, while higher frequency currents are more influenced by intracellular fluid.
[0173] In one particular example, the plate microstructures are provided in pairs, each pair including spaced apart plate microstructures having opposing substantially planar electrodes. This can be used to generate a highly uniform field in the subject in the region between the electrodes and / or to perform capacitive or conductive sensing of materials between the electrodes. However, this is not required and other configurations such as spacing multiple electrodes circumferentially around a central electrode can be used. Typically, the spacing between the electrodes in each group is typically less than 50 mm, less than 20 mm, less than 10 mm, less than 1 mm, less than 0.1 mm or less than 10 μm, although it will be appreciated that larger spacings can also be used, including spacings up to and / or beyond the dimensions of the substrates, when the microstructures are distributed across multiple substrates.
[0174] Thus, in one embodiment, at least some of the microstructures are arranged in pairs and response signals are measured between the microstructures in the pair and / or stimuli are applied between the microstructures in the pair. Each microstructure pair typically includes spaced apart plate microstructures having opposing substantially planar electrodes and / or spaced apart substantially parallel plate microstructures.
[0175] In one example, at least some pairs of microstructures are angularly offset, and in one particular example, orthogonal. Thus, in the case of plate microstructures, at least some pairs of microstructures extend in different, optionally orthogonal, directions. This also serves to reduce lateral slippage of the patch by distributing stresses associated with insertion of the patch in different directions and ensuring that the plate faces at least partially the direction of any lateral force. Reducing slippage during or after insertion can help reduce discomfort, erythema, etc., and aid in making the patch more comfortable to wear for extended periods of time. Additionally, this can help account for any electrical anisotropy in the tissue, for example as a result of fibrin structures in the skin, cellular anisotropy, etc.
[0176] In one embodiment, pairs of adjacent microstructures are angularly offset and / or orthogonal; in addition and / or alternatively, pairs of microstructures can be arranged in rows, with pairs of microstructures in one row being orthogonal or angularly offset relative to pairs of microstructures in another row.
[0177] In one embodiment, when pairs of microstructures are used, the spacing between the microstructures within each pair is typically less than 0.25 mm, greater than 10 μm, and about 0.1 mm, while the spacing between groups of microstructures is typically less than 1 mm, greater than 0.2 mm, and about 0.5 mm. Such arrangements help ensure that electrical signals are applied and measured primarily within pairs, reducing crosstalk between pairs and allowing independent measurements to be recorded for each microstructure / electrode pair.
[0178] To create an array of electrode pairs, this can be done by fabricating a first substrate having first microstructures and corresponding first apertures. An insulating layer is then provided on the side of the first substrate opposite the first microstructures, after which a second substrate is provided on the insulating layer. In this example, the second substrate has second microstructures that extend through the insulating layer and the first apertures to form pairs of first and second microstructures, an example of which is described in more detail below. In one example, the first and second apertures are offset to reduce capacitive coupling between the first and second substrates. Alternatively, other mechanisms for capacitive coupling between the substrates can be used.
[0179] The microstructures can be configured to interact with, and in particular bind to, one or more analytes of interest to allow their detection. In particular, in one example, the binding of one or more analytes to the microstructure can alter the charge transport capability, leading to a change in the capacitance of the electrode pair, which can be further monitored to derive the level or concentration of the analyte. Binding of the analyte can be achieved using a variety of techniques, including mechanical properties of the microstructure, such as the presence of pores or other physical structures, the selection of the material from which the microstructure is fabricated, the use of coatings, or otherwise affecting the properties of the microstructure, such as using magnetic microstructures.
[0180] Additionally, the microstructures and / or substrates may incorporate one or more materials or other additives, either within the body of the microstructure or through the addition of a coating containing the additive. The nature of the material or additive will vary depending on the preferred embodiment and may include bioactive materials, reagents for reacting with analytes in a subject, binders for binding to analytes of interest, materials for binding one or more analytes of interest, probes for selectively targeting analytes of interest, materials for reducing biofouling, materials for attracting at least one substance to the microstructure, materials for repelling or excluding at least one substance from the microstructure, materials for attracting at least some analytes to the microstructure, or materials for repelling or excluding analytes. In this regard, materials may include any one or more of cells, fluids, analytes, and the like. Examples of materials include polyethylene, polyethylene glycol, polyethylene oxide, zwitterions, peptides, hydrogels, and self-assembled monolayers.
[0181] The material can be contained within the microstructure itself, for example by impregnating the microstructure during manufacture, can be the material from which the microstructure is formed, or can be provided in a coating. Thus, it will be appreciated that at least some of the microstructures can be coated with a coating, such as a material for binding one or more analytes of interest, which can be used to target specific analytes of interest, allowing these analytes to bind or otherwise attach to the microstructure, so that these analytes can then be detected in situ using an appropriate detection mechanism, such as by detecting a change in an optical or electrical property.
[0182] In some embodiments, the material or additive is a material for binding one or more analytes of interest.
[0183] In certain embodiments, the material is an aptamer, particularly a plurality of aptamers, hi certain embodiments, the aptamer is a coating on the microstructure.
[0184] The identity of the aptamer depends on the specific analyte of interest and the detection method.Those skilled in the art can easily identify and use the aptamer suitable for each analyte of interest and the detection method.The aptamer interacts or binds with the analyte of interest, and changes conformation when the analyte binds.For example, in some embodiments, the aptamer has a first conformation in the absence of analyte binding, and a second conformation when the analyte binds.
[0185] In some embodiments, the second conformation results in a portion of the aptamer (e.g., a first end of the aptamer, such as the 3' or 5' end) being closer to the microstructure (and electrode) than in the first conformation (i.e., the spacing between the portion of the aptamer and the microstructure is decreased in the second conformation). In alternative embodiments, the second conformation results in a portion of the aptamer being farther from the microstructure (and electrode) than in the first conformation (i.e., the spacing between the portion of the aptamer and the microstructure is increased in the second confirmation). Such a change in proximity between the portion of the aptamer and the microstructure can be further detected using a label moiety, such as, for example, a redox moiety or a fluorescent label, attached to or in proximity to the relevant portion of the aptamer, such as the first end. In certain embodiments, the portion of the aptamer is preferably the first end of the aptamer (e.g., the 5' end) when the second end of the aptamer (e.g., the 3' end) is conjugated or otherwise attached directly or indirectly to the microstructure. Thus, in some embodiments, the second conformation results in a first end of the aptamer being closer to the microstructure than the first conformation, or alternatively, the first end of the aptamer being farther from the microstructure than the first conformation, such that, for example, a first signal is generated when the aptamer is in the first conformation and a second signal is generated when the aptamer is in the second conformation, where the first signal is other than the second signal (i.e., the first signal and the second signal are different).
[0186] Although aptamers of any structure are contemplated, in certain embodiments, the aptamer comprises or consists of a stem-loop hairpin structure.
[0187] Suitable aptamers are known in the art or can be identified using a variety of methods known in the art of aptamer selection.
[0188] For example, suitable aptamers are described in Negahdary et al. (2018) J Biomed Phys Eng, 8(2):167-178, Jo et al. (2015) Anal Chem, 87:9869-9875, U.S. Patent Application Publication No. 2012 / 0316326(A1), Chinese Patent No. 102703455(A), Korean Patent No. 20160021488(A), U.S. Patent Application Publication No. 2019 / 0219595(A1), Pfefiffer and Mayer (2016) Frontiers in Chemistry ... Chem), 4:25, International Publication No. 2017 / 210683(A1), Chinese Patent No. 102660547(A), International Publication No. 2017 / 210683(A1), Chinese Patent No. 105136754(A), International Publication No. 2012 / 130948(A1), U.S. Patent No. 5582981, U.S. Patent No. 5595877, U.S. Patent Application Publication No. 2018 / 0327746 (A1), European Patent No. 2532749(B1), U.S. Patent Application Publication No. 2012 / 0135540(A1), Chinese Patent No. 105349545(A), U.S. Patent Application Publication No. 2011 / 0318846(A1), Chinese Patent No. 104745585(A), Stojanovic et al. (2000) J Am Chem Soc, 122:11547-11548, WO 2015 / 197706(A1), WO 2019 / 094315(A1), or U.S. Patent Application Publication No. 2017 / 0233738(A1), the entire contents of which are incorporated herein by reference.
[0189] In some embodiments, the aptamer is a troponin-selective aptamer, representative examples of which include those described in Negahdary et al. (2018) J Biomed Phys Eng, 8(2):167-178, Jo et al. (2015) Anal Chem, 87:9869-9875, U.S. Patent Application Publication No. 2012 / 0316326(A1), Chinese Patent No. 102703455(A), Korean Patent No. 20160021488(A), and U.S. Patent Application Publication No. 2019 / 0219595(A1), the entire contents of which are incorporated herein by reference.
[0190] In some embodiments, the aptamer is selected from the group consisting of AGTCTCCGCTGTCTCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 1], CGTGCAGTACGCC ACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 2], AGTCTCCGCCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 3], CGTGCAGTACGCC ACC TTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 4], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 5], TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 6], CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 7], ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 8], CGTGCAGTACGCAACCTTTCTCATGC GCTGCCCCTCTTA [SEQ ID NO: 9], CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 10], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 11], and AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 12], TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 13] No. 13], CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 14], ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 15], CGTGCAGTACGCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 16], CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 17], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 18],TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 19], CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 20], ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 21], CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 22], CGTGCAGTACGCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 23], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 24], GGGATGGGGTGGGTGGCCAGCGATT [SEQ ID NO: 25], and TTAGGGGTGGTGGTTGGCAATTC [SEQ ID NO: 26], in particular comprising, consisting of, or consisting essentially of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1.
[0191] The present invention also contemplates variants of the sequences provided herein.Thus, in some embodiments, the aptamer comprises, consists of, or consists essentially of a nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs:1-26, particularly SEQ ID NO:1.
[0192] To determine the percentage of sequence identity between two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second nucleic acid sequences for optimal alignment, and non-homologous sequences can be ignored for comparison purposes). In some embodiments, the length of the reference sequence aligned for comparison purposes is at least 40%, more usually at least 50% or 60%, and even more usually at least 70%, 80%, 90% or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. If a position of the first sequence is occupied by the same nucleotide as the corresponding position of the second sequence, the molecules are identical at that position.
[0193] Comparison of sequences and determination of percent identity between sequences can be accomplished using mathematical algorithms. In one embodiment, percent identity between nucleic acid sequences is determined using the Needleman and Wuensch (1970, J. Mol. Biol., 48:444-453) algorithm incorporated in the GAP program of the GCG software package (Devereaux et al. (1984) Nucleic Acids Research, 12:387-395), using either Blosum62 matrix or PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6. In some embodiments, percent identity between nucleic acid sequences may be determined using the algorithm of Meyers and Miller (1989, Cabios, 4:11-17) as incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.
[0194] Alternatively, suitable aptamers can be identified and prepared using various methods known in the art of aptamer selection, including Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology (e.g., as described in U.S. Pat. Nos. 5,475,096 and 5,270,163) and methods described in WO 2019 / 067383(A1), U.S. Pat. No. 5,582,981, U.S. Pat. No. 5,595,877, and U.S. Pat. No. 5,637,459, the entire contents of which are incorporated herein by reference. In certain embodiments, aptamers can be identified and prepared using SELEX technology. Briefly, this method can involve systematically subjecting a large random pool of oligonucleotides to negative and positive selection rounds against a target, e.g., an analyte such as a protein, to remove low affinity or non-specific binders. The remaining aptamers can be collected and expanded, e.g., PCR amplified, and used in subsequent selection rounds.
[0195] In some embodiments, it may be desirable to improve the stability of the aptamer. Several approaches are known in the art, including capping the ends of the aptamer, substituting naturally occurring nucleotides with non-natural nucleotides (e.g., 2'-F, 2'-OCH3, 2'-H, 2'-OH or 2'-NH2 modified nucleotides, such as 2'-fluorine substituted pyrimidines, 2'-aminopyrimidines, and 2'-O-methylribose purines and pyrimidines), using non-natural internucleotide linkages, such as phosphorothioate, methylphosphonate or triazole linkages, using modified sugar moieties, conjugating molecules such as biotin to the 3' end, capping the 3' end with inverted thymidine (dT), conjugating protein-like side chains to nucleotides such as the 5-position of deoxyuridine (dU) (e.g., 5-(N-benzylcarboxamido)-2-deoxyuridine), developing "spiegelmers" composed entirely of non-natural L-ribonucleic acid backbones, etc. Further approaches are described, for example, in Shuaijian et al. (2017) Int J Mol Sci, 18(8):1683, the contents of which are incorporated herein by reference in their entirety.
[0196] Aptamers may be modified to increase the sensitivity and binding kinetics of the aptamer to the analyte of interest. It should be noted that one or more of the approaches to improve the stability of the aptamer, particularly conjugating a protein-like side chain to a nucleotide such as the 5-position of deoxyuridine (dU) (e.g., 5-(N-benzylcarboxamido)-2-deoxyuridine), may result in this outcome. Further modifications to increase the sensitivity and binding kinetics of the aptamer to the analyte of interest may be achieved using the methods described in Ricci et al. (2016) Acc Chem Res, 49(9):1884-1892, including population shift, allostery, matched receptor set, intracellular invagination, and cooperativity. Further approaches contemplated by the present invention may include retaining structures that retain the aptamer in the second configuration to extend the recovery time of the aptamer, such as complementary primers attached to the ends of the aptamer that bind together upon analyte binding to hold the aptamer in the second configuration beyond the recovery interval, and at least one blocker attached to the aptamer that prevents the primers from binding together prior to analyte binding, or attaching functional groups that interact with each other upon analyte binding to hold the aptamer in the second configuration beyond the recovery interval. Such approaches are described in WO 2018 / 031559 A1, the entire contents of which are incorporated herein by reference.
[0197] In some embodiments, the aptamer comprises a moiety, such as a functional group or compound, for attaching or immobilizing the aptamer onto the surface of the microstructure, preferably via a covalent bond. Suitable moieties for attaching or immobilizing the aptamer onto the surface of the microstructure include, but are not limited to, thiols, amines, carboxylic acids, alcohols, carbodiimides, Nafion, avidin, biotin, azides, and the like, particularly thiols. The moiety may be attached directly to the aptamer, but in some embodiments the moiety may be a C1-C 20 Alkyl, especially C6 or C 11The aptamer is attached via a linker such as an alkyl chain, particularly including a C6 alkyl linker (i.e., a (CH2)6 linker), a polymer such as polyethylene glycol (PEG), or a nucleic acid sequence, including DNA and RNA sequences. In certain embodiments, the linker is a C1-C 20 Alkyl, especially C6 or C 11 Alkyl, particularly alkyl chains such as C6 alkyl linkers (i.e., (CH2)6 linkers). Suitable linkers and synthetic routes to produce such linkers are known in the art, such as Lai et al. (2006) Langmuir, 22:10796-10800, the entire contents of which are incorporated herein by reference.
[0198] Aptamers can be prepared using oligonucleotide synthesis techniques standard in the art, such as chemical synthesis (see, e.g., Itakura et al. (1984) Ann Rev Biochem 53:323-356). Aptamers can also be prepared by amplification (e.g., PCR) of aptamers prepared using SELEX technology as described in U.S. Pat. Nos. 5,475,096 and 5,270,163, as well as the methods described in WO 2019 / 067383(A1), U.S. Pat. No. 5,582,981, U.S. Pat. No. 5,595,877, and U.S. Pat. No. 5,637,459. Aptamers are also commercially available from several sources, including Bioneer Pacific, Bio-synthesis Inc., and TriLink Biotechnologies.
[0199] Aptamers are selective for binding one or more analytes of interest. Preferably, aptamers are selective for binding one or more analytes of interest, such as troponin or a subunit thereof, particularly troponin I, relative to at least one other substance present in the sample, and preferably a majority of other substances present in the sample.
[0200] In some embodiments, the aptamer comprises a label or labeling moiety, such as a redox moiety, a fluorescent label, etc. Such moieties are useful for detecting conformational changes in the aptamer upon binding of an analyte as discussed herein.
[0201] In some embodiments, the aptamer comprises a redox moiety.Suitable redox moieties include any chemical moiety capable of redox that can be conjugated or otherwise attached to the aptamer.For example, suitable redox moieties include, but are not limited to, methylene blue, ferrocene, vinylferrocene, anthraquinone, Nile blue, thionine, anthraquinone-C5, dabcyl, 2,6-dichlorophenal-indophenol, gallocyanine, ROX, pentamethylferrocene, ferrocene-C5, neutral red and horseradish peroxidase, particularly methylene blue, ferrocene, anthraquinone or Nile blue, especially methylene blue.
[0202] The redox moiety may be attached at any suitable point on the aptamer, so long as the conformational change that occurs upon binding of an analyte to the aptamer results in a detectable change in the spacing between the redox moiety and the electrode of the microstructure on which the aptamer is immobilized. In some embodiments, the redox moiety is closer to the electrode of the microstructure on which the aptamer is immobilized in the second conformation (i.e., upon binding of the analyte) compared to the first conformation (i.e., the spacing is decreased in the second conformation). In alternative embodiments, the redox moiety is further from the electrode of the microstructure on which the aptamer is immobilized in the second conformation (i.e., upon binding of the analyte) compared to the first conformation (i.e., the spacing is increased in the second conformation). For example, in some embodiments, the redox moiety is attached to the 3'-end or 5'-end of the aptamer, particularly the 3'-end of the aptamer, and the aptamer is attached to the microstructure through the opposite end, such as the 5'-end and vice versa, preferably the 5'-end. Without wishing to be bound by theory, it is proposed that decreasing the spacing between the redox moiety and the electrode increases electron transfer from the redox moiety to the electrode of the microstructure on which the aptamer is immobilized, and vice versa, thereby producing a detectable change that can be correlated with the presence, absence, level or concentration of the analyte.
[0203] In some embodiments, the aptamer comprises a fluorescent label. Suitable fluorescent labels include fluorescein, 6-carboxyfluorescein (FAM), coumarin, rhodamine, 5-TMRIA (tetramethylrhodamine-5-iodoacetamide), (9-(2(or 4)-(N-(2-maleimdylethyl)-sulfonamidyl)-4(or 2)-sulfophenyl)-2,3,6,7,12,13,16,17-octahydro-(1-H,5H,11H,15H-xanthenol(2,-3,4-ij:5,6,7-i'j')diquinolizine-18-ium salt) (Texas Red), 2-(5-(1-(6 -(N-(2-maleimdylethyl)-amino))-6-oxohexyl)-1,3-dihydro-3,3-dimethyl-5-sulfo-2H-indol-2-ylidene)-1,3-propyldienyl)-1-ethyl-3,3-dimethyl-5-sulfo-3H-indolium salt (Cy3), N,N'-dimethyl-N-(iodoacetyl)-N'-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine (IANBDamide), N-((2-(iodoacetoxy)ethyl)-N-methyl)amino-7-nitrobenz-2 -oxa-1,3-diazole (IANBD ester), 6-acryloyl-2-dimethylaminonaphthalene (acrylodan), pyrene, 6-amino-2,3-dihydro-2-(2-((iodoacetyl)amino)ethyl)-1,3-dioxo-1H-benz(de)isoquinoline-5,8-disulfonate (Lucifer Yellow), 2-(5-(1-(6-(N-(2-maleimidoethyl)-amino)-6-oxohexyl)-1,3-dihydro-3,3-dimethyl-5-sulfo-2H-indol-2-ylidene)-1,3-pentadiazole enyl)-1-ethyl-3,3-dimethyl-5-sulfo-3H-indolium salt (Cy5), 4-(5-(4-dimethylaminophenyl)oxazol-2-yl)phenyl-N-(2-bromoacetamidoethyl)sulfonamide (Dapoxyl® (2-bromoacetamidoethyl)sulfonamide)), (N-(4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacen-2-yl)iodoacetamide (BODIPY507 / 545IA), N-(4,4-difluoro-5,Examples of fluorescent proteins include, but are not limited to, 7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl)-N'-iodoacetylethylenediamine (BODIPY530 / 550IA), 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS), carboxy-X-rhodamine, 5 / 6-iodoacetamide (XRIA5,6), BODIPY-FL-hydrazide, 6-carboxytetramethylrhodamine (TAMRA), cyan fluorescent protein, green fluorescent protein, and yellow fluorescent protein. Fluorescent quantum dots are also contemplated. Other suitable fluorescent labels include those described in ThermoFisher Scientific (2019) The Molecular Probes Handbook-A Guide to Fluorescent Probes and Labeling Technologies, accessed September 29, 2019;<https: / / www.thermofisher.com / au / en / home / references / molecular‐probes‐the‐handbook.html> These include those described in
[0204] The fluorescent label may be attached at any suitable point on the aptamer, for example, in some embodiments, the fluorescent label is attached at the 3' or 5' end of the aptamer, particularly at the 3' end of the aptamer.
[0205] Those skilled in the art will be familiar with suitable methods for attaching labeling moieties to aptamers, including chemical means such as reduction, oxidation, conjugation and condensation reactions.For example, a thiol reactive group can be used to attach a labeling moiety, such as a fluorescent label or a redox moiety, to the natural or engineered thiol group present in an aptamer.In a further example, a reactive group present in an aptamer can be labeled using a succinimide ester derivative of a fluorescent label.For example, an amine can be introduced at the desired position of the aptamer for attachment of a labeling moiety, and an NHS-labeled redox moiety (e.g., NHS-labeled methylene blue) can be conjugated to the aptamer, for example, using succinimide ester coupling. Suitable methods are known in the art, such as Liu et al. (2010) Anal Chem, 82(19):8131-8136, Xiao et al. (2005) Angew Chem Int Ed, 44:5456-5459, and U.S. Patent Application Publication No. 2016 / 0278638(A1), the entire contents of which are incorporated herein by reference.
[0206] The labeling moiety may be an autofluorescent or luminescent label.
[0207] While the label moiety can be attached directly to the aptamer, in some embodiments, the label moiety is attached to the aptamer via a linker. For example, in some embodiments, the moiety is 20 Alkyl, especially C6 or C 11 The aptamer is attached via a linker such as an alkyl chain, particularly including a C6 alkyl linker (ie, a (CH2)6 linker), a polymer such as polyethylene glycol (PEG), or a nucleic acid sequence, including DNA and RNA sequences.
[0208] In some embodiments, the fluorescent label may be the only label moiety attached to the aptamer. Without wishing to be bound by theory, it is proposed that in such embodiments, the binding of the analyte results in a conformational change of the aptamer, which causes a detectable change in the fluorescence of the fluorescent label, such as an increase in fluorescence, a wavelength shift, and / or an increase in fluorescence lifetime (e.g., due to a change in the conjugation of the fluorescent label). Alternatively, the fluorescent label may interact with the bound analyte, which results in a decrease in the fluorescence of the fluorescent label.
[0209] In alternative embodiments, the aptamer includes two label moieties, such as two fluorescent labels. Such embodiments are particularly suited to generating light output, such as Förster resonance energy transfer (FRET). Such embodiments may utilize a pair of label moieties (e.g., a pair of fluorescent labels) attached at different points on the aptamer, where one label acts as a donor molecule (first label moiety) and the other acts as an acceptor molecule (i.e., a quencher) (second label moiety), with the absorption spectrum of the acceptor molecule overlapping with the fluorescence emission spectrum of the donor molecule. Without wishing to be bound by theory, it is proposed that binding of the analyte results in a conformational change in the aptamer, which changes the proximity of the first and second label moieties, and thus the fluorescence intensity of the first label moiety and the emission intensity of the second label moiety. In some embodiments, the first and second label moieties may be closer to each other (i.e., have a reduced spacing in the second conformation) in the second conformation (i.e., upon binding of the analyte) compared to the first conformation. In such embodiments, the fluorescence intensity of the first labeling moiety is decreased and the emission intensity of the second labeling moiety is increased in the second conformation compared to the first conformation. In alternative embodiments, the first and second labeling moieties can be farther apart (i.e., are spaced apart more in the second conformation) in the second conformation (i.e., upon binding of the analyte) compared to the first conformation. In such embodiments, the fluorescence intensity of the first labeling moiety is increased and the emission intensity of the second labeling moiety is decreased in the second conformation compared to the first conformation.
[0210] In certain embodiments, it is preferred that both label moieties are fluorescent labels, suitable examples of which are described above. Exemplary combinations include cyan fluorescent protein and yellow fluorescent protein, Cy3 and Cy5, FAM and TAMRA, etc. In alternative embodiments, the first label moiety (i.e., the donor molecule) is a fluorescent label and the second label moiety (i.e., the acceptor molecule) is a non-fluorescent moiety. Non-limiting examples of suitable non-fluorescent moieties include 4-([4-(dimethylamino)phenyl]-azo)-benzoic acid (DABCYL), Iowa Black RQ, 4-(4-dimethylaminophenylazo)benzenesulfonic acid (DABSYL), Iowa Black FQ, IRDye QC-1, QXL quenchers, black hole quenchers including BHQ-1, BHQ-2 and BHQ-3, and the like, including those moieties described in Le Reste et al. (2012) Biophysical Journal, 11(6):2658-2668, and Crisalli and Kool (2011) Bioconj Chem, 22(11):2345-2354, the entire contents of which are incorporated herein by reference.
[0211] The first and second label moieties can be attached at any point on the aptamer, and the spacing between the first and second label moieties is different in the first and second aptamer conformations. In some embodiments, the spacing between the first and second label moieties is 10 nm or less in the first conformation and greater than 10 nm in the second conformation. In other embodiments, the spacing between the first and second label moieties is greater than 10 nm in the first conformation and less than 10 nm in the second conformation. For example, the first and second label moieties can be attached at or near each end of the aptamer, such as at or near the 3' and 5' ends. In some embodiments, the first label moiety is attached at the 3' end and the second label moiety is attached at the 5' end, or the first label moiety is attached at the 5' end and the second label moiety is attached at the 3' end.
[0212] The present invention also contemplates embodiments in which the receptor molecule is a material that forms the microstructure, or a coating on the microstructure, such as graphene, graphene oxide, or the like.
[0213] In a preferred embodiment, the aptamers are a coating on the microstructure (also referred to herein as an aptamer coating). The number of aptamers in the coating and / or the aptamer density will depend on the analyte of interest (including the size of the analyte and the level or concentration expected to be detected), the application of the system of the invention, and the detection method. The aptamer density in the coating should be a density that produces a measurable response, such as a change in impedance or fluorescence, upon binding of the analyte, particularly upon binding of the analyte at the analyte concentration or level of interest. In some embodiments, the aptamer density in the coating is about 1×10 10 ~Approx. 1×10 14 Aptamer molecules / cm 2 , about 5×10 10 ~Approx. 5×10 13 Aptamer molecules / cm 2 , about 1×10 11 ~Approx. 1×10 13 Aptamer molecules / cm 2 , about 5×10 11 ~Approx. 5×10 12 Aptamer molecules / cm 2 (and all integers in between).
[0214] When applied as a coating on a microstructure, the aptamer can be coated using any suitable technique conventional in the art, such as chemical adsorption or chemical crosslinking. For example, this technique can include contacting the surface of the microstructure with the aptamer for a period of time sufficient for a moiety for attaching or immobilizing the aptamer on the surface of the microstructure to be attached, such as via a covalent bond, to the surface of the microstructure. Suitable non-limiting methods can include chemical adsorption of thiolated aptamers on gold microstructures, attachment of biotinylated aptamers to avidin-modified microstructures, immobilization of azide-terminated aptamers to alkyne-modified microstructures, covalent immobilization of amine-terminated aptamers by amine coupling to carboxyl groups of functionalized microstructures, covalent immobilization of amine-terminated aptamers to functionalized microstructures containing amine groups using glutaraldehyde, and the like. Exemplary methods are described in Xiao et al. (2007) Nat Protocols, 2(11):2875-2880, Negahdary et al. (2018) J Biomed Phys Eng, 8(2):167-178, and Mishra et al. (2018) Biosensors, 8(2):28. The aptamer may be attached to the microstructure through any suitable point on the aptamer, particularly the 3' or 5' end of the aptamer, especially the 5' end.
[0215] In other embodiments, the material is a molecularly imprinted polymer.
[0216] The identity of the molecular imprinted polymer depends on the specific analyte of interest and the detection method. Those skilled in the art will be able to easily identify and use the molecular imprinted polymer suitable for each analyte of interest. For example, suitable molecular imprinted polymers include those formed from monomers that contain one or more functional groups for binding or interacting with the analyte of interest, such as amine, sulfide, sulfhydryl, amide, carbonyl or carboxyl groups. In some embodiments, the molecular imprinted polymer is formed from one or more monomers that contain one or more amine and / or carboxyl groups.
[0217] For example, suitable monomers include, but are not limited to, aminothiophenols (including p-aminothiophenol and o-aminothiophenol), methacrylic acid, vinylpyridine, acrylamide, aminophenols (including o-aminophenol and p-aminophenol), 1,2-dimethylimidazole, dimetridazole, o-phenylenediamine, 4-amino-5-hydroxy-2,7-naphthalenedisulfonic acid, pyrrole, aminobenzenethiol-co-p-aminobenzoic acid, vinylpyrrolidone, vinylferrocene, bis(2,2'-bithien-5-yl)methane, pyridine, chitosan, 3,4-ethylenedioxythiophene, 1-mercapto-1-undecanol, dopamine, methacrylates such as methyl methacrylate and dimethyl methacrylate, carboxylated pyrrole, aniline, thiopheneacetic acid (e.g., 3-thiopheneacetic acid), and thiophene.
[0218] Molecularly imprinted polymers can be conducting polymers (eg, polymers with conjugated pi bonds along the polymer backbone) or insulating polymers.
[0219] When the molecularly imprinted polymer is an insulating polymer, the polymer is a coating on the microstructure. Suitable insulating polymers include, but are not limited to, poly-o-phenylenediamine, poly-o-aminophenol, polymethacrylates such as polymethylmethacrylate and polydimethylmethacrylate, polyacrylamide, non-conductive polypyrrole, polypyridine, polyvinylpyrrolidone, poly-p-aminothiophenol, and polydopamine, especially non-conductive polypyrrole.
[0220] In some embodiments, the insulating polymer may be a copolymer. Thus, the polymer may be a polymer or copolymer formed from one or more monomers selected from the group consisting of pyrrole, dopamine, methacrylates such as methyl methacrylate and dimethyl methacrylate, methacrylic acid, acrylamide, carboxylated pyrrole, o-aminophenol, phenol, p-aminothiophenol (including p-aminothiophenol and o-aminothiophenol), pyridine, vinylpyrrolidone, and o-phenylenediamine. In some embodiments, the insulating polymer is a copolymer formed from methacrylates such as methyl methacrylate or dimethyl methacrylate, and acrylamide, particularly methyl methacrylate and acrylamide, or pyrrole and carboxylated pyrrole.
[0221] In the case where the molecularly imprinted polymer is a conductive polymer, the polymer may be a coating on the microstructure or may be a material that forms the microstructure. Without wishing to be bound by theory, in some embodiments, it is believed that the conductive polymer undergoes a conformational change upon binding of the analyte, causing the polymer to become more conformationally distorted. The conformational change results in a decrease in the conductivity of the polymer, which can be quantified and correlated with the presence, absence, level or concentration of the analyte. In other embodiments, it is proposed that the binding of the analyte to the conductive polymer causes a change in impedance, which can be quantified and correlated with the presence, absence, level or concentration of the analyte.
[0222] In some embodiments, the molecularly imprinted polymer is a conductive polymer and is the material from which the microstructure is formed. In such embodiments, the microstructure is preferably porous.
[0223] Suitable conductive polymers include, but are not limited to, polypyrrole, polyaniline, poly(3,4-ethylenedioxythiophene) and polythiophenes, especially polypyrrole.
[0224] In some embodiments, the conductive polymer may be a copolymer. Thus, the polymer may be a polymer or copolymer formed from one or more monomers selected from the group consisting of pyrrole, carboxylated pyrrole, aniline, 3,4-ethylenedioxythiophene, thiophene acetic acid (e.g., 3-thiophene acetic acid), and thiophene. In some embodiments, the conductive polymer is a copolymer formed from 3,4-ethylenedioxythiophene and thiophene acetic acid, or pyrrole and carboxylated pyrrole.
[0225] Although the molecularly imprinted polymer may be the only component of the coating or forming the microstructure, in some embodiments the polymer includes a dopant, for example to increase the conductivity of the polymer. Suitable dopants include, but are not limited to, sodium nitrate (NaNO3), lithium perchlorate (LiClO4), p-toluenesulfonate, chondroitin sulfate, dodecylbenzenesulfonate and tetrabutylammonium hexafluorophosphate (TBAPF6), preferably lithium perchlorate and dodecylbenzenesulfonate.
[0226] In some embodiments, the conductivity of the polymer can be increased by varying the solvent of the polymerization solution (i.e., varying the solvent during polymerization). Suitable solvents include, but are not limited to, water, phosphate buffered saline, acetate buffer, acetonitrile, and dichloromethane, particularly acetonitrile or dichloromethane.
[0227] In a particular embodiment, the polymer is a conductive polypyrrole molecularly imprinted polymer doped with LiClO4 that is selective for troponin I binding.
[0228] The molecular imprinted polymer is formed using one or more analytes of interest or fragments or subunits thereof as templates as discussed herein and is therefore selective for binding of one or more analytes of interest. Preferably, the molecular imprinted polymer is selective for binding of one or more analytes of interest, such as troponin or a subunit thereof, particularly troponin I, relative to at least one other substance present in the sample, preferably a majority of other substances present in the sample.
[0229] In some embodiments, the polymer further comprises a redox moiety, especially when the molecular imprinted polymer is an insulating polymer.Suitable redox moieties include, but are not limited to, methylene blue, vinyl ferrocene, and horseradish peroxidase.Those skilled in the art will be familiar with suitable methods for incorporating redox moieties into polymers.For example, the redox moiety may be attached to a monomer before polymerization or may be copolymerized with the monomer.
[0230] The analyte can be any compound that can be detected in the epidermis and / or dermis. In certain embodiments, the analyte is a marker of a condition, disease, disorder, or normal or pathological process occurring in a subject, or a compound that can be used to monitor the level of an administered substance in a subject, such as a drug (e.g., a medication, a vaccine), an illicit substance (e.g., an illegal drug), a non-illicit abused substance (e.g., alcohol or a prescription drug taken for non-medical reasons), a poison or toxin, a chemical weapon (e.g., a nerve agent, etc.) or a metabolite thereof. Suitable analytes include: Nucleic acids, including DNA and RNA, including short RNA species, including microRNA, siRNA, snRNA, shRNA, etc. an antibody, or an antigen-binding fragment thereof, an allergen, an antigen or an adjuvant, Chemokines or cytokines, ·hormone, Parasites, bacteria, viruses, or virus-like particles, or compounds therefrom, such as surface proteins, endotoxins, etc. Epigenetic markers, such as DNA methylation status or chromatin modifications of specific genes / regions, ·peptide, Polysaccharides (glycans), Polypeptides, Proteins, and ·Small molecules These include, but are not limited to:
[0231] In certain embodiments, the analyte of interest is selected from the group consisting of nucleic acids, antibodies, peptides, polypeptides, proteins and small molecules, particularly polypeptides and proteins, especially proteins.
[0232] The analyte can be a biomarker, which is a biochemical characteristic or feature that can be used to measure the progression of a disease, disorder or condition, or the effectiveness of a treatment for a disease, disorder or condition. A biomarker can be, for example, a virus or a compound from a virus, a bacterium or a compound from a bacterium, a parasite or a compound from a parasite, a cancer antigen, an indicator of heart disease, an indicator of stroke, an indicator of Alzheimer's disease, an antibody, an indicator of mental health, etc.
[0233] Alternatively, the analyte can be a compound that can be used to monitor the level of an administered or ingested substance in a subject, such as a pharmaceutical (e.g., a drug, a vaccine), an illicit substance (e.g., an illegal substance), a non-illicit substance of abuse (e.g., alcohol or prescription drugs taken for non-medical reasons), a poison or toxin, a chemical weapon (e.g., a nerve agent, etc.), or a metabolite thereof.
[0234] In some embodiments, the analyte is a troponin or a subunit thereof, an enzyme (e.g., amylase, creatine kinase, lactate dehydrogenase, angiotensin II converting enzyme), a hormone (e.g., follicle stimulating hormone or luteinizing hormone), cystatin C, C-reactive protein, TNFα, IL-6, ICAM1, TLR2, TLR4, presepsin, D-dimer, a viral protein (e.g., nonstructural protein 1 (NS1)), a bacterial protein, a parasitic protein (e.g., histone-rich protein 2 (HRP2)), an antibody (e.g., influenza In a particular embodiment, the analyte is a protein selected from the group consisting of a troponin or a subunit thereof, in particular a troponin I, a troponin C, a troponin T, a troponin C, a troponin T, a troponin C, a troponin T, a troponin C, a troponin T, a troponin I ...botulinum toxin or a metabolite or subunit thereof, in particular a troponin I, a botulinum toxin or a metabolite or subunit thereof, in particular a troponin I, a troponin C, a troponin T, a botulinum toxin or a metabolite or subunit thereof, in particular a troponin I, a troponin C, a troponin T, a botulinum toxin or a metabolite or subunit thereof, in particular a troponin I, a troponin C,
[0235] The analyte may be a small molecule, non-limiting examples of which include hormones (e.g., cortisol or testosterone), neurotransmitters (e.g., dopamine), amino acids, creatinine, aminoglycosides (e.g., kanamycin, gentamicin, and streptomycin), anticonvulsants (e.g., carbamazepine and clonazepam), illicit substances (e.g., methamphetamine, amphetamine, 3,4-methylenedioxymethamphetamine (MDMA), N-ethyl-3,4-methylenedioxyamphetamine (MDEA), 3,4-methylenedioxypropanediol (DMPA), N-methyl-3,4-methyl ... Cyanphetamine (MDA), cannabinoids (e.g. delta-9-tetrahydrocannabinol, 11-hydroxy-delta-9-tetrahydrocannabinol, 11-nor-9-carboxydelta-9-tetrahydrocannabinol), cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, and opiates (e.g. heroin, 6-monoacetylmorphine, morphine, codeine, methadone, and dihydrocodeine), anticoagulants (e.g. warfarin), blister agents (e.g. cantharidin, furanocoumarins, sulfur Mustards (e.g. 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethyl chloromethyl sulfide, bis(2-chloroethyl) sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl) ether, bis(2-chloroethylthioethyl) ether), nitrogen mustards (e.g. bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)ethylamine, (tris(2-chloroethyl)methylamine and tris(2-chloroethyl)amine) and phosgene oxime), arsenicals (e.g. ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine and 2-chlorovinyldichloroarsine) and nettle agents (e.g. phosgene oxime), blood agents (e.g. cyanogen chloride, hydrogen cyanide and arsine), asphyxiants (e.g. chlorine, chloropicrin, diphosgene and phosgene), nerve agents (e.g. tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethyl phosphoramidofluoridate (GV), (S)-(ethyl {[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethyl methylphosphonothioate (VM), ethyl ({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin and saxitoxin, These include chemical weapons, poisons or toxins such as animal venom components (e.g., tetrodotoxin and saxitoxin), cyanide, arsenic, tropane alkaloids (e.g., atropine, scopolamine and hyoscyamine), piperidine alkaloids (e.g., coniine, N-methylconiine, conhydrine, pseudoconhydrine and gammaconiceine), curare alkaloids (e.g., tubocurarine), nicotine, caffeine, quinine, strychnine, brucine, aflatoxins), or their metabolites. In some embodiments, the small molecule is selected from the group consisting of cortisol, testosterone, creatinine, dopamine, kanamycin, gentamicin, streptomycin, carbamazepine, clonazepam, methamphetamine, amphetamine, MDMA, MDEA, MDA, delta-9-tetrahydrocannabinol, 11-hydroxy-delta-9-tetrahydrocannabinol, 11-nor-9-carboxydelta-9-tetrahydrocannabinol, cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, heroin, 6-monoacetylmorphine, morphine, codeine, methadone, dihydrocodeine, warfarin, cantharidin, furanocoumarin, 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-Bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethylsulfide, bis(2-chloroethyl)sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl)ether, bis(2-chloroethylthioethyl)ether, bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine and tris(2-chloroethyl)amine, phosgene oxime, ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, 2-chlorovinyldichloroarsine, phosgene oxime, cyanogen chloride, hydrogen cyanide, arsine, chlorine, chloropicrin, diphosgene, phosgene, tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramid dofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin, cyanide, arsenic, atropine, scopolamine, hyoscyamine, coniine, N-methylconiine, conhydrin, pseudoconhydrin, gammaconiceine, tubocurarine, nicotine, caffeine, quinine, strychnine, brucine, aflatoxin and metabolites thereof.
[0236] In some embodiments, the analyte is a peptide, non-limiting examples of which include hormones (e.g., oxytocin, gonadotropin releasing hormone and adrenocorticotropic hormone), B-type natriuretic peptide, N-terminal pro-B-type natriuretic peptide (NT-proBNP) and animal venom components (e.g., peptidic components of spider, snake, scorpion, bee, wasp, ant, tick, cone snail, octopus, fish (e.g., stonefish) and jellyfish venoms) or metabolites thereof. In certain embodiments, the peptide is oxytocin, gonadotropin releasing hormone, adrenocorticotropic hormone, B-type natriuretic peptide or NT-proBNP.
[0237] In some embodiments, the analyte is a polysaccharide (glycan), suitable non-limiting examples of which include inulin, endotoxin (lipopolysaccharide), anticoagulants (e.g., heparin) and their metabolites.
[0238] In some embodiments, the analyte is an illegal or non-illegal abused substance or a metabolite thereof. Suitable illegal substances include, but are not limited to, methamphetamine, amphetamine, 3,4-methylenedioxymethamphetamine (MDMA), N-ethyl-3,4-methylenedioxyamphetamine (MDEA), 3,4-methylenedioxyamphetamine (MDA), cannabinoids (e.g., delta-9-tetrahydrocannabinol, 11-hydroxy-delta-9-tetrahydrocannabinol, 11-nor-9-carboxydelta-9-tetrahydrocannabinol), cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, and opiates (e.g., heroin, 6-monoacetylmorphine, morphine, codeine, methadone, and dihydrocodeine), or a metabolite thereof. Non-limiting examples of non-illicit substances of abuse include alcohol, nicotine, prescription or over-the-counter drugs taken for non-medical reasons, and substances taken for a medical effect but taken in excess or inappropriately (e.g., painkillers such as opiates, sleep aids, anti-anxiety drugs, methylphenidate, erectile dysfunction drugs), or their metabolites.
[0239] In some embodiments, the analyte is a drug or a component or metabolite thereof. A wide variety of drugs and their metabolites are suitable analytes, including, but not limited to, cancer therapeutics, vaccines, analgesics, antipsychotics, antibiotics, anticoagulants, antidepressants, antivirals, sedatives, antidiabetics, contraceptives, immunosuppressants, antifungals, anthelmintics, stimulants, biological response modifiers, nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids, disease-modifying antirheumatic drugs (DMARDs), anabolic steroids, antacids, antiarrhythmics, thrombolytics, anticonvulsants, antidiarrheals, antiemetics, antihistamines, antihypertensives, anti-inflammatory agents, antitumor agents, antipyretics, barbiturates, beta-blockers, bronchodilators, antitussives, cytotoxic agents, decongestants, diuretics, expectorants, hormones, laxatives, muscle relaxants, vasodilators, sedatives, and vitamins. Various examples of these agents are described herein and are well known in the art.
[0240] In some embodiments, the analyte is a poison, toxin, chemical weapon, or a metabolite thereof. Suitable poisons, toxins, and chemical weapons include blister agents (e.g., cantharidin, furanocoumarins, sulfur mustards (e.g., 1,2-bis(2)-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethylsulfide, bis(2-chloroethyl)sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl)ether, bis(2-chloroethylthioethyl)ether), nitrogen mustards (e.g., bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine), and tris(2-chloroethyl)amine) and phosgene oxime), arsenicals (e.g. ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, and 2-chlorovinyldichloroarsine) and nettle agents (e.g. phosgene oxime), blood agents (e.g. cyanogen chloride, hydrogen cyanide, and arsine), asphyxiants (e.g. chlorine, chloropicrin, diphosgene, and phosgene), nerve agents (e.g. tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,Atropa such as O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethyl methylphosphonothioate (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin and botulinum toxins, animal venom components (e.g. tetrodotoxin, saxitoxin and other components of spider, snake, scorpion, bee, wasp, ant, tick, cone shell, octopus, fish (e.g. stonefish) and jellyfish venoms), cyanide, arsenic, tropane alkaloids (e.g. atropine, scopolamine and hyoscyamine). In some embodiments, the analyte may be a blister agent, such as, but not limited to, Belladonna components, Hemlock components such as piperidine alkaloids (e.g., coniine, N-methylconiine, conhydrin, pseudoconhydrin, and gammaconicein), curare alkaloids (e.g., tubocurarine), nicotine, caffeine, alcohol, quinine, atropine, strychnine, brucine, aflatoxin, and their metabolites. In some embodiments, the analyte may be a blister agent, such as cantharidin, furanocoumarins, sulfur mustards (e.g., 1,2-bis(2)-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethylsulfide, bis(2-chloroethyl)sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl)ether or bis(2-chloroethylthioethyl)ether), nitrogen mustards (e.g. bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine or tris(2-chloroethyl)amine or phosgene oxime), arsenicals (e.g. ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine or 2-chlorovinyldichloroarsine) or nettle agents such as phosgene oxime), blood agents (e.g. cyanogen chloride, hydrogen cyanide or arsine), asphyxiants (e.g. These include chemical weapons or their metabolites, such as chlorine, chloropicrin, diphosgene or phosgene, nerve agents (e.g. tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin and saxitoxin or botulinum toxins).
[0241] Suitable analytes, diseases, disorders or conditions, or their associated uses, and the lowest known clinically relevant serum concentration ranges are provided in Tables 1-3.
[0242] [Table 1]
[0243] [Table 2]
[0244] [Table 3]
[0245] In some embodiments, the analyte is a metabolite of any one of the above exemplary analytes.
[0246] Although it is preferred that the analyte binds directly to the binding agent, the present invention also contemplates detecting a substance that is indicative of the analyte of interest, such as a specific binding pair member complementary to the analyte of interest, the presence of which is detected only if the particular analyte of interest is present in the sample. Thus, the substance that is indicative of the analyte becomes the analyte that is detected.
[0247] In some embodiments, the microstructures are coated with a material that reduces the absorption of non-target analytes. Examples of materials include alkyl groups coated with BSA (bovine serum albumin), bifunctional polyethylene glycol (PEG) polymers, etc. Such materials have the effect of reducing the adsorption of non-specific analytes, effectively repelling them from the microstructures.
[0248] For example, it will be appreciated that multiple coatings can be used in combination to repel or exclude non-specific analytes and bind analytes of interest, thereby allowing specific analytes of interest to be selectively captured while non-specific analytes remain uncaptured.
[0249] Polymer coatings, including molecularly imprinted polymer coatings, can be applied using a variety of techniques commonly used in the art. For example, microstructures can be coated with polymers using a variety of techniques, including dip coating, spray coating, deposition coating, electropolymerization, drop casting, electrospinning, inkjet coating, spin coating, and the like, in particular electropolymerization. In one example, a coating solution is applied to the microstructures and optionally dried in situ using a gas jet. When the coating is a polymer coating, the polymer can be synthesized prior to coating, in some embodiments, for example, using bulk polymerization. In alternative embodiments, the polymer is synthesized and coated simultaneously, such as when synthesized and coated using electropolymerization. Those skilled in the art will be familiar with suitable techniques.
[0250] Molecularly imprinted polymers can be prepared using a variety of techniques, non-limiting examples of which include bulk polymerization and electropolymerization, particularly electropolymerization, in the presence of a template (i.e., one or more analytes of interest or fragments or subunits thereof).
[0251] For example, a molecularly imprinted polymer may be prepared by (a) preparing a polymerization solution including one or more monomers of interest and a solvent (e.g., phosphate buffered saline), (b) adding one or more template compounds (e.g., one or more analytes of interest or fragments or subunits thereof) to the prepared polymerization solution, (c) polymerizing the template / polymerization solution, optionally in the presence of one or more additives (e.g., dopants, redox moieties, etc.), to form a molecularly imprinted polymer, and (d) isolating the molecularly imprinted polymer from the one or more template compounds. The properties of the molecularly imprinted polymer may be optimized using techniques common in the art, such as varying the concentrations of one or more monomers and / or template compounds.
[0252] The polymer may be coated in any form suitable for detecting one or more analytes of interest, such as a film, particle, fiber or nanotube, particularly a film.
[0253] The coating may be of a thickness suitable for determining the presence, absence, level or concentration of an analyte, such as, but not limited to, 1 nm to 100 nm, particularly 10 nm to 20 nm, and especially about 15 nm.
[0254] Although the polymer coating may be the only coating applied to the electrode, in some embodiments it may be desirable to enhance the bonding (adhesion) of the polymer coating to the electrode. Thus, in such embodiments, an agent that enhances the bonding of the polymer coating to the electrode may be applied prior to applying the coating. Suitable agents include, but are not limited to, organosilanes, silicones, siloxanes, amide and amine containing compounds, organophosphorus compounds, self-assembled monolayers or other coupling agents.
[0255] To optimize the coating, the properties of the coating can be controlled by the addition of one or more other agents, such as thickeners, detergents or other surfactants, and adjuvants. These components can be provided in a variety of concentrations. For example, a thickener or surfactant can form between 0% and 90% of the coating solution.
[0256] A variety of viscosity-increasing agents can be used, examples include methylcellulose, carboxymethylcellulose (CMC), gelatin, agar, and agarose, as well as any other viscosity-adjusting agent. The viscosity of the solution is usually within the range of 10 -3 Pa s~10 -1 In one example, a coating solution containing 1-2% methylcellulose provides a suitable uniform coating, resulting in a viscosity in the range of 0.011 (1%) to 0.055 (2%) Pa s.
[0257] Similarly, the surface tension of the coating solution can be adjusted using various surfactants, such as any detergent or any suitable agent that reduces surface tension and is biocompatible at low concentrations. The properties of the solution are typically similarly controlled by the addition of one or more other agents, such as thickeners, detergents, other surfactants, or any other suitable materials. These components can be provided in a variety of concentrations. For example, a thickener or surfactant can form between 0% and 90% of the coating solution.
[0258] Instead of using coating techniques, the reagents can also be embedded within the microstructures. Thus, for example, in the case of a molded patch manufactured using a polymeric material, the reagents can be introduced into the mold along with the polymeric material such that the reagents are distributed throughout the structure. In this example, the polymer can be provided such that pores are formed within the structure during the curing process.
[0259] The use of affinity surface coatings on each structure also allows for reduced non-specific adsorption of ISF and / or blood components while facilitating specific extraction of molecular targets of interest.
[0260] Thus, in one example, the one or more microstructures interact with one or more analytes of interest such that the response signal is dependent on the presence, absence, level or concentration of the analyte of interest. In one particular example, the analyte interacts with a coating on the microstructures to change the electrical and / or optical properties of the coating, thereby allowing the analyte to be detected.
[0261] For example, measurements can be made by passing a current between the electrodes and measurement of the resulting signal between the electrodes is used to detect a change in an electrical property and thus the presence, absence, level or concentration of an analyte. In this regard, the electrical output signal may be indicative of any one or more of voltage, current, resistance, capacitance, conductance, or impedance, or a change in any of these variables. Thus, the signal may be potentiometric, amperometric, voltammetric, impedimetric, etc.
[0262] Impedance measurements, such as, for example, in electrochemical impedance spectroscopy (EIS), probe the dynamics of bound analytes or charge transfer in the bulk or interfacial regions of MIPs and / or aptamers. In this regard, when a MIP (especially a conductive MIP) captures a target analyte, the cavities of the MIP are filled, preventing the diffusion of ions in the bulk polymer. In addition, the captured analyte may distort the structure of the conductive MIP, causing an increase in charge transfer in the polymer. Similarly, when an aptamer captures a target analyte, the captured analyte may change the structure of the aptamer, changing its electrical properties. Measurements require only ions in the sample and can be performed without the use of redox moieties.
[0263] In this example, the electrodes may be provided in pairs, although the system may alternatively measure the impedance between different groups of electrodes, for example with one group acting as working electrodes and the other group acting as counter electrodes.
[0264] In further examples, voltammetric / amperometric techniques can be used, including cyclic voltammetry (CV), linear sweep voltammetry (LSV), differential pulse voltammetry (DPV), square wave voltammetry (SWV), and chronoamperometry (CA).
[0265] In this example, a current output is generated from a redox reaction of an electroactive species (redox moiety) occurring on a conductive material (e.g., a gold microstructure). When an analyte of interest is captured by a MIP (particularly an insulating MIP coating), the cavities of the MIP are filled, thereby blocking / preventing diffusion of the redox moiety to the gold surface. Reduced analyte permeation results in a reduced current output. Similarly, when an analyte of interest is captured by an aptamer, the conformation of the aptamer changes, resulting in the redox moiety moving relative to the microstructure surface, thereby altering the current output.
[0266] Because this type of transformation requires a redox reaction, some researchers have incorporated redox moieties into the polymer matrix.
[0267] In this example, it is also conceivable that a reference electrode is also provided, in which case the electrodes may be arranged in triplicate groups including a working electrode, a counter electrode, and a reference electrode. The reference electrode need only be close to the working and counter electrodes, so for example, an electrode may be provided in a pair of working and counter electrodes, and a row of electrode pairs may be used as the reference electrode.
[0268] In a further example, potentiometric measurements can be made, generating an electrical output in response to binding of a target analyte at the MIP and / or aptamer, where a change in voltage is measured that corresponds to the amount of analyte bound to the MIP and / or aptamer. Potentiometric technology is found in sensors such as ion selective electrodes (ISE) and field-effect transistors (FET).
[0269] Other measurement techniques include mass-sensing acoustic transducers such as surface acoustic wave (SAW) oscillators, Love wave oscillators, or quartz crystal microbalances (QCMs). Binding of analyte can be quantified via a change in vibration frequency caused by a change in mass at the oscillator surface.
[0270] In a further example, one or more of the microstructures contain a treatment material and at least one treatment delivery mechanism is provided that controls the release of the treatment material, hi one preferred example, the release of the treatment material is controlled by applying a stimulus to the microstructure(s), for example, by applying light, heat, or an electrical stimulus to release the treatment material.
[0271] In one preferred example, the treatment material is contained in a coating on at least one microstructure, and a stimulus is used to dissolve the coating on the microstructure, thereby delivering the treatment material. It will be appreciated that this technique is applicable to any treatment material that can be incorporated into a coating and selectively released using a stimulus, such as a mechanical, magnetic, thermal, electrical, electromagnetic, or optical stimulus.
[0272] The nature of the treatment material will vary depending on the preferred embodiment and / or the nature of the treatment being performed, including whether the treatment is cosmetic or therapeutic. Examples of treatment materials include, but are not limited to, nanoparticles, nucleic acids, antigens or allergens, parasites, bacteria, viruses, or virus-like particles, metals or metal compounds, molecules, elements or compounds, DNA, proteins, RNA, siRNA, sfRNA, iRNA, synthetic biomaterials, polymers, drugs, and the like.
[0273] However, it will be appreciated that the use of a coating is not required and that the treatment material may additionally and / or alternatively be incorporated into the microstructure itself.
[0274] Regardless of how the treatment material is provided, the substrate may include a plurality of microstructures, where the different microstructures have different treatment materials and / or different treatment doses. In this case, a processing device may control a therapeutic delivery mechanism to release the treatment material from selected microstructures, thereby allowing different treatments to be administered and / or differential dosing depending on the results of measurements made on the subject. In particular, as described in more detail below, the processing device typically performs an analysis at least in part using the measured response signal and uses the results of the analysis to control at least one therapeutic delivery mechanism, thereby allowing individualized treatments to be performed substantially in real time.
[0275] It will be appreciated that the microstructures may be differentially coated, for example by coating different microstructures with different coatings and / or by coating different parts of the microstructures with different coatings. This may also be used to allow different analytes to be detected at different depths, such that, for example, different coatings are used for parts of the microstructures that enter the dermis compared to the living epidermis. This may also be used to allow the detection of different analytes, or different levels or concentrations of the same analyte. In addition, at least some of the microstructures may be left uncoated, for example so that they can be used as controls, some may be partially coated, or may include a porous structure with an internal coating. It will be appreciated that multiple coatings may also be provided. For example, an outer coating may be provided that provides mechanical strength during insertion and dissolves once in situ, allowing, for example, an underlying functional coating to be exposed so that an analyte can be detected.
[0276] The nature of the coating and the manner in which it is applied will vary depending on the preferred embodiment, and techniques such as dip coating, spray coating, jet coating, etc., may be used as described above. The thickness of the coating will also vary depending on the situation and the intended functionality provided by the coating. For example, thicker coatings may be used when the coating is used to provide mechanical strength or contain payload materials to be delivered to the target, while thinner coatings may be required when the coating is used to sense other applications.
[0277] In one example, a stimulus such as a chemical, biochemical, electrical, optical or mechanical stimulus can be used to release material from, disrupt, dissolve or otherwise delaminate a coating on a microstructure.
[0278] In another example, the microstructures can be coated with a selectively dissolvable coating. The coating can also be adapted to dissolve after a defined period of time, such as after the microstructure has been present in the subject for a set length of time, in response to the presence, absence, level or concentration of one or more analytes in the subject, upon breaching or penetration of a functional barrier, or in response to application of a stimulus signal, such as an electrical signal, an optical signal, etc. Dissolution of the coating can be used to trigger the measurement process, for example by exposing a binding agent or other functional feature, such that the analyte is detected only after the coating has dissolved.
[0279] In a further example, dissolution of the coating can be detected, for example, through a change in an optical or electrical property, and a measurement can be taken after the coating has dissolved, and thus dissolution of the coating can be detected based on a change in the response signal.
[0280] In one example, the coating can be used to provide mechanical properties. For example, the coating can provide a physical structure that can be used to facilitate penetration of a barrier, for example, by providing the microstructure with a smoothly tapered outer profile. The coating can reinforce the microstructure to prevent it from breaking, crushing, buckling, or otherwise being damaged during insertion, or can be used to help anchor the microstructure within a subject. For example, the coating can include a hydrogel, which expands when exposed to moisture, thereby causing the microstructure and coating to increase in size upon insertion into a subject, thereby making the microstructure more difficult to remove.
[0281] The coating can also be used to modify the surface properties of the microstructure, for example to increase or decrease hydrophilicity, increase or decrease hydrophobicity, and / or minimize biofouling. The coating can also be used to attract, repel, or repel at least one substance, such as an analyte, a cell, a fluid, etc. The coating can also dissolve to expose the microstructure, further coatings, or materials, which can be used to control the detection process. For example, a time-release coating can be used to allow measurements to be taken at a set time after the patch is applied. It can also be used to provide a stimulus to the subject, for example by releasing a treatment or therapeutic material.
[0282] Thus, in one example, a system includes a plurality of microstructures, where different microstructures respond differentially to an analyte, e.g., different microstructures may respond to different analytes, different combinations of analytes, different levels or concentrations of analytes, etc.
[0283] In one example, at least some of the microstructures attract at least one substance to the microstructure and / or repel or exclude at least one substance from the microstructure. The nature of the substance varies depending on the preferred embodiment and may include one or more analytes or may include other substances that contain analytes, such as ISF, blood, etc. This can be used to attract, repel or exclude analytes, for example to attract analytes of interest so that they can be concentrated and / or detected, or to repel or exclude analytes other than those of interest.
[0284] The ability to repel or exclude substances can also help prevent biofouling. For example, the microstructure can contain or include a coating of a material such as polyethylene glycol (PEG) that generally repels substances from the surface of the microstructure. The reduction of biofouling can also be achieved based on the selection of the material of the microstructure or the structure of the microstructure, for example, a coating of a binder within the pores of a porous microstructure, a surface coating that peels off to expose the sensing surface when sensing is to be performed, a permeable coating such as a porous polymer, for example, a hydrogel coating such as a nylon membrane, a polyvinylidene fluoride coating, a polyphenylenediamine coating, a polyethersulfone coating, or a poly(hydroxyethyl methacrylate) or PEG coating, an isoporous silica micelle membrane, a protein membrane such as a fibroin membrane, a polysaccharide membrane such as a cellulose membrane or a chitosan membrane, or a diol or silane membrane, a peelable coating that interferes with biofouling substances, and / or a porous coating. In certain embodiments, the microstructure is porous and a binder is coated within the pores of the microstructure.
[0285] In another example, a control can be used to account for biofouling. For example, a patch can include non-functionalized microstructures that act as controls in addition to functionalized microstructures for analyte detection. Assuming that both sets of microstructures are exposed to similar levels of biofouling, the change in the response signal measured through the non-functionalized microstructures can be used to quantify the degree of biofouling that has occurred. This can be further accounted for when processing the signal from the functionalized microstructures, for example by removing any change in the response signal that results from biofouling.
[0286] In one example, the system includes an actuator configured to apply a force to the substrate, which in one example is used to assist the microstructure in breaking through the barrier. The actuator can also and / or alternatively be used for other purposes.
[0287] For example, the movement of the microstructure can be used to sense mechanical properties of tissue. In this example, the response of the actuator, such as the amount of current required to cause movement of the microstructure, can be used to sense mechanical properties such as elastic modulus, which may further indicate a health problem such as disease. This can also be used in combination with the mechanical response signal to allow the transmission of actuator movement to be monitored, for example by measuring stress or strain on the microstructure using an appropriate sensing modality. Other external mechanical stimuli can also be used, such as providing a ring or other structure around the patch that creates pressure waves in the tissue so that the response can be measured.
[0288] The actuators can be used to provide mechanical stimuli, for example to trigger a biological response such as inflammation, or to attract, repel, or expel substances. Additionally, physical motion can be used to release material from a coating on at least some of the microstructures, or can be used to break, dissolve, remove, or otherwise peel off a coating on at least some of the microstructures. This can be used to trigger a measurement process, for example to peel off a coating or material to trigger a reaction with an analyte to allow detection of the analyte.
[0289] The actuators can also be used to cause the microstructure to penetrate a barrier or retract the microstructure from a barrier and / or a subject. In one example, this allows the microstructure to be inserted and removed from a subject as needed, so that the microstructure can be removed when measurements are not being taken. This can be used to reduce pain, reduce the chance of infection, reduce biofouling, etc.
[0290] Since the microstructures are provided in a low density configuration, the force required is usually very small, in which case it can be achieved using actuators providing small forces, such as piezoelectric actuators or mechanical actuators such as offset motors, vibration motors, etc. However, other actuators can also be used, including any one or more of electric actuators, magnetic actuators, polymer actuators, cloth or textile actuators, pneumatic actuators, thermal actuators, hydraulic actuators, chemical actuators, etc. For example, chemical or biochemical reactions involving exposure to air, light, water or other substances can trigger an exothermic release of energy, which can be used to provide a mechanical impulse to press the substrate and thus the microstructures into the subject. It will be appreciated that actuation can also be achieved manually by applying force to the patch or by pressing the patch into the subject using a strap or the like.
[0291] In one embodiment, this is accomplished by using a biasing force, such as provided by a spring or electromagnetic actuator, together with an oscillatory, cyclic or repetitive force, which can aid penetration, for example by perturbing microstructures to overcome the elasticity of the stratum corneum and / or reduce friction to penetrate the epidermis and / or dermis, and by reducing the force required to penetrate the barrier. This reduces the overall force required to penetrate the stratum corneum. However, this is not required, and a single continuous or instantaneous force can also be used.
[0292] The frequency of vibration used varies depending on the preferred embodiment and possibly on the type of skin to which the microstructures are applied, and may include any one or more of at least 0.01 Hz, 0.1 Hz, 1 Hz, at least 10 Hz, at least 50 Hz, at least 100 Hz, at least 1 kHz, at least 1 kHz, or at least 100 kHz and possibly up to several MHz. In one example, a varying frequency may be used. The frequency may vary depending on various factors such as the time applied and in particular the length of time the application process is taking place, the depth or extent of penetration, the degree of resistance to insertion, etc. In one example, the system uses a response signal measured through the microstructure to detect when a barrier is breached, such as when the microstructure penetrates the stratum corneum. Thus, the frequency may be continuously varied, either increasing or decreasing, until good penetration is achieved or depending on the depth of penetration, which can be detected using the response signal, at which point the actuator may be stopped. In another example, the frequency starts at a high frequency and gradually decreases as the microstructure penetrates the barrier, particularly the stratum corneum.
[0293] In another example, the amount of force applied can also be controlled. The force used varies depending on various factors such as the structure of the patch, the manner in which the patch is applied, the location of application, the depth of penetration, etc. For example, a patch with a large number of microstructures will usually require a higher overall force to ensure penetration, while a very small number of microstructures, such as 10 or so, may require a higher force to account for attenuation or loss by the substrate / skin. Similarly, the force required to penetrate the stratum corneum will usually be greater than the force required to penetrate the buccal mucosa. In one example, the force applied can be any one or more of at least 0.1 μN, at least 1 μN, at least 5 μN, at least 10 μN, at least 20 μN, at least 50 μN, at least 100 μN, at least 500 μN, at least 1000 μN, at least 10 mN, or at least 100 mN per microstructure and / or collectively. For example, if there are 1000 microstructures, the force can be 100 mN in total, or 100 mN per protrusion, resulting in an overall force of 100 N.
[0294] Again, the force may be varied, either increasing or decreasing, depending on the time it is applied, the depth or extent of penetration which may be determined based on the response signal to look at the change in measured impedance, or the insertion resistance, etc. In one embodiment, the force is gradually increased up to the point of penetration, at which point the force is decreased.
[0295] As mentioned above, the force can be applied as a continuous or instantaneous force. More commonly, however, the force is periodic. In this case, the nature of the periodic motion can vary and it can have any waveform, including, for example, square waves, sine waves, triangular waves, variable waveforms, etc. In this case, the force can be an absolute magnitude, or it can be a peak-to-peak or root mean square (RMS) force.
[0296] Similarly, the magnitude of the microstructure movement can be controlled. The magnitude depends on factors such as the length of the microstructure and the degree of penetration required. The magnitude can include any one or more of: greater than 0.001 times the length of the microstructure, greater than 0.01 times the length of the microstructure, greater than 0.1 times the length of the microstructure, greater than the length of the microstructure, greater than 10 times the length of the microstructure, greater than 100 times the length of the microstructure, or greater than 1000 times the length of the microstructure. The magnitude can also vary, either increasing or decreasing, depending on the applied time, depth of penetration, degree of penetration, or insertion resistance. Again, the magnitude can increase up to the point of penetration and then decrease after the point of penetration.
[0297] In the above examples, the system can be configured to detect aspects of the insertion process. In one example, this can be achieved by monitoring the actuator, for example the current required by the actuator to achieve a particular movement, which can be further used to detect depth of penetration, degree of penetration, insertion resistance, etc., which can be further used to control the actuator.
[0298] The actuators can also be used to apply mechanical stimuli that can be used for a variety of purposes, for example, the actuators can be configured to physically break or remove a coating on the microstructure, physically stimulate an object, cause the microstructure to penetrate a barrier, cause the microstructure to retract from a barrier, or cause the microstructure to retract from an object.
[0299] The actuator is typically operably coupled to the substrate, which may be accomplished using any suitable mechanism, such as a mechanical mechanism, an electromechanical mechanism, or the like.
[0300] In one embodiment, the actuator includes a spring or electromagnetic actuator or an electromagnetic actuator for providing a constant bias and at least one of a piezoelectric actuator and a vibration motor for applying a vibration force. The vibration force is applied at a frequency of at least 10 Hz, less than 1 kHz, and about 100-200 Hz. The continuous force is typically greater than 1 N, less than 10 N, and about 5 N, while the vibration force is at least 1 mN, less than 1000 mN, and about 200 mN. The actuator is typically configured to induce a movement of the microstructure of at least 10 μm, less than 300 μm, and about 50 μm to 100 μm.
[0301] In one example, the system includes a housing that contains at least the sensor and one or more electronic processing devices, and optionally other components such as a signal generator, actuator, power source, wireless transceiver, etc. In one particular example, the housing provides a reader functionality that can be used to interrogate the microstructure, which can be provided within the integrated device or can be provided remotely of the substrate and engaged when a reading is to be performed or provided in close proximity to the substrate.
[0302] In an integrated configuration, the reader is typically mechanically connected / integrated with the patch during normal use, allowing measurements to be taken automatically. For example, continuous monitoring may be performed, with readings taken from every second to every day or week, typically every 2-60 minutes, more typically every 5-10 minutes. The timing of readings may vary depending on the nature of the measurements being taken and the specific circumstances. Thus, for example, an athlete may wish to be monitored more frequently while competing in an event, and less frequently while recovering after the event. Similarly, for a person undergoing medical monitoring, the frequency of monitoring may vary depending on the nature and / or severity of the condition. In one example, the frequency of monitoring may be selected based on user input, and / or may be based on a defined user profile, etc.
[0303] In an integrated setup, the reader can be connected to the patch using a conventional resistive bridge circuit and measurements can be made using analog-to-digital conversion.
[0304] Alternatively, the reader can be separate, which allows it to be removed when not in use and allows the user to wear the patch without the integrated electronics, making it less intrusive. This is particularly useful for applications such as sports, geriatrics and pediatrics, where the presence of a bulkier device may affect activity. In this situation, the reader is typically brought into contact or proximity with the patch and a read can be taken as required. It will be appreciated that this requires the user / person to initiate interrogation. However, the reader can also include an alert feature to prompt interrogation.
[0305] Readings can be performed wirelessly, optionally using inductive coupling to power the patch and take the reading as described in more detail below, but instead direct physical contact can alternatively be used. In this example, the microstructure and tissue form part of a resonant circuit with respective inductance or capacitance, and the frequency can be used to determine the impedance and therefore the fluid level, or the level or concentration of an analyte. Additionally and / or alternatively, ohmic contacts can be used, where the reader makes electrical contact with a connector on the patch.
[0306] In either case, some analysis and interpretation of the hydration signal or analyte level or concentration can be performed in the reader, and the reader can optionally display the indication using an output such as an LED indicator, LCD screen, etc. Additionally and / or alternatively, an audible alarm may be provided to provide an indication, for example, if the subject is under- or over-hydrated or if the analyte level or concentration is outside of an acceptable range. The reader can also incorporate wireless connectivity, such as Bluetooth, Wi-Fi, etc., to allow a reading event to be triggered remotely and / or to allow data, such as impedance values, indications of hydration or analyte level or concentration, to be transmitted to a remote device, such as a client device, computer system, or cloud-based computing equipment.
[0307] In use, the housing is generally coupled to the substrate, allowing the housing and substrate to be attached and detached as required. In one example, this can be achieved utilizing any suitable mechanism, such as electromagnetic coupling, mechanical coupling, adhesive coupling, magnetic coupling, etc. This allows the housing, and in particular the sensing device, to be connected to the substrate only when required. Thus, the substrate can be applied to the subject and secured, and the sensing system can be attached to the substrate only when a measurement is to be made. However, it will be appreciated that this is not required, and instead the housing and substrate can be secured together to the subject, for example, using an adhesive patch, an adhesive coating on the patch / substrate, straps, anchor microstructures, etc. In a further example, the substrate can form part of the housing, such that the substrate and microstructures are integrated into the housing.
[0308] When the housing is configured to be attached to a substrate, the housing typically includes a connector that operably connects to a substrate connector on the substrate, thereby communicating signals between the signal generator and / or sensor and the microstructure. The nature of the connector and connection will vary depending on the preferred embodiment and the nature of the signal, and may include conductive contact surfaces that engage corresponding surfaces on the substrate, or may include wireless connections such as tuned inductive coils, wireless communication antennas, and the like.
[0309] In one example, the system is configured to take repeated measurements over a period of hours, days, weeks, etc. To achieve this, the microstructures can be configured to remain in the subject during that period, or can be removed when measurements are not being taken. In one example, the actuator can be configured to trigger the insertion of the microstructures into the skin and also to allow removal of the microstructures after measurements are taken. In that case, the microstructures can be inserted and retracted as needed to take measurements over an extended period of time without continuing to penetrate the skin. However, this is not required and short-term measurements can instead be taken, in which case the period can be less than 0.01 seconds, less than 0.1 seconds, less than 1 second, or less than 10 seconds. It will be appreciated that other intermediate time frames can also be used.
[0310] In one example, once measurements have been taken, one or more electronic processing devices analyze the measured response signals to determine indicators indicative of the subject's health and / or physiological status.
[0311] In one example, this is accomplished by deriving at least one metric that can be further used to determine the indicator. For example, the system may be configured to perform impedance measurements and the metric corresponds to impedance parameters such as impedance at a particular frequency, phase angle, etc. The metric can be further used to derive an indicator, such as an indication of a fluid level, such as an extracellular or intracellular fluid level.
[0312] The manner in which this is done varies depending on the preferred embodiment. For example, the electronic processing device may fit the metric to at least one computational model to determine the index, the computational model embodying a relationship between the health status and one or more metrics. In this case, the computational model may be obtained by applying machine learning to reference metrics derived from subject data measured on one or more reference subjects with known health status. In this case, the health status may indicate organ function, tissue function, or cell function, may include the presence, absence, degree, or severity of a medical condition, or may include one or more measures otherwise related to the health status, such as measurements of the presence, absence, level, or concentration of one or more analytes or measurements of other biomarkers.
[0313] The nature of the model and training performed can be of any suitable form and can include any one or more of decision tree learning, random forests, logistic regression, association rule learning, artificial neural networks, deep learning, inductive logic programming, support vector machines, clustering, Bayesian networks, reinforcement learning, representation learning, similarity and metric learning, genetic algorithms, rule-based machine learning, learning classifier systems, etc. These techniques are known and will not be described in further detail. In one example, this can include training a single model to determine the index using metrics from reference subjects with a combination of different health conditions, but this is not required and other approaches can be used.
[0314] The measured signals can also be used in other ways. For example, changes in a metric over time can be used to track changes in a subject's health or medical condition. The measured signals can also be analyzed to generate images or to perform mapping. For example, tomography can be used to establish 2D or 3D images of a region of interest based on impedance measurements, etc. The signals can also be used for contrast imaging, etc.
[0315] In one example, the system may include a transmitter that transmits measured object data, metrics or measurement data, such as response signals or values derived from measured response signals, allowing these to be analyzed remotely.
[0316] In one particular example, the system includes a wearable patch that includes a substrate and a microstructure, and a monitoring device (also called a "reader") that performs the measurement. The monitoring device can be attached to or integrally formed with the patch, for example with the necessary electronics mounted on the back side of the substrate. Alternatively, the reader can be brought into contact with the patch when a reading is to be taken. In either case, the connection between the monitoring devices can be a conductive (ohmic) contact, but can alternatively be an indicating connection, allowing the reader to wirelessly interrogate and / or power the patch.
[0317] The monitoring device can be configured to cause measurements to be taken and / or at least partially process and / or analyze the measurements. The monitoring device can control the stimulation applied to at least one microstructure, for example by controlling a signal generator and / or a switch as required. This allows the monitoring device to selectively interrogate different microstructures, thereby allowing different measurements to be taken and / or measurements to be taken at different locations. This also allows the microstructures to be selectively stimulated, for example allowing different therapies to be administered to a subject. Thus, this can also be used to provide dosage control or to deliver different therapeutic materials by selectively stimulating the microstructures, thereby selectively releasing therapeutic materials.
[0318] The monitoring device may also be used to generate an output, such as an output indicative of the indicator or a recommendation based on the indicator, and / or to cause an action to be taken. Thus, the monitoring device may be configured to generate an output including a notification or warning. This may be used to trigger an intervention, e.g., to indicate to the user that action is required. This may be simply an indication of a problem, such as telling the user that they are dehydrated or that their troponin levels are high, and / or may include a recommendation, such as telling the user to hydrate or seek medical attention, etc. The output may additionally and / or instead include an indication of an indicator, such as a measurement, or information derived from the indicator. Thus, hydration levels or analyte levels or concentrations may be presented to the user.
[0319] The monitor device may also be configured to trigger other actions.
[0320] The output may also be used to alert a caregiver that an intervention is needed, e.g., forward a notification to the caregiver's client device and / or computer. In another example, it may also be used to control remote equipment. For example, it may be used to trigger a drug delivery system, such as an electronically controlled syringe infusion pump, allowing an intervention to be triggered automatically. In a further example, a semi-automated system may be used, e.g., a notification including the indication and the recommended intervention may be provided to a clinician, who may approve the intervention, after which the intervention may be performed automatically.
[0321] In one example, the monitor device is configured to interface with a separate processing system, such as a client device and / or a computer system. In this example, this allows for the distribution of processing and analysis tasks between the monitor device and the client device and / or computer system. For example, the monitor device may also perform partial processing, such as filtering and / or digitizing the measured response signal, and provide an indication of the processed signal to a remote process system for analysis. In one example, this is accomplished by generating subject data including the processed response signal and forwarding this to the client device and / or computer system for analysis. This thus allows the monitor device to communicate with a computer system that generates, analyzes or stores subject data derived from the measurement data. This may further be used to generate an indicator at least partially indicative of a health status associated with the subject.
[0322] It will be appreciated that this allows additional functionality to be implemented, including forwarding notifications to a clinician or other caregiver, and also allows for remote storage of data and / or metrics. In one example, this allows recorded measurements and other information, such as derived metrics, details of applied stimulation or therapy, and / or details of other resultant actions, to be incorporated directly into an electronic record, such as an electronic medical record.
[0323] In one example, this allows the system to augment telemedicine systems with high fidelity accurate clinical data, providing data to support the growing telemedicine sector so that remote clinicians can get the information they need, which will be highly valued in both centralized hospitals and in rural areas far from centralized laboratories and regional hospitals. Time to treatment is a strong predictor of improved clinical outcomes for heart attack patients, so a distributed population cannot rely solely on access to traditional large hospitals. Thus, the system can provide a low-cost, robust and accurate monitoring system that can diagnose, for example, a heart attack, and be provided at any local medical facility and as simple as applying a patch device. In this example, resources can be quickly sent to cardiac troponin clinical blood testing without delay for patients who test positive for troponin I. Similarly, patients who are determined to be low risk can be released with earlier, less invasive testing, or can be placed on other streams, such as via a family physician.
[0324] In a further example, a client device such as a smartphone, tablet, etc. is used to receive measurement data from the wearable monitor device, generate object data, and forward it to a processing system, which returns indicators that may be further displayed on the client device and / or monitor device depending on the preferred implementation.
[0325] However, it will be appreciated that this is not required and that some or all of the steps of analyzing the measurements, generating the indicators, and / or displaying a representation of the indicators may be performed on the monitor device.
[0326] Again, it will be appreciated that similar outputs can also be provided to or by a remote processing system or client device, for example, alerting a clinician or trainer that a subject or athlete needs attention and that intervention should be performed, controlling equipment such as a drug delivery device, etc.
[0327] The reader may be configured to automatically take measurements when integrated into the patch or permanently / semi-permanently attached, or if the reader is separate it may take measurements when brought into contact with the patch, in this latter example the reader may be inductively coupled to the patch.
[0328] Thus, functionality such as processing measured response signals, analyzing results, generating output, controlling measurement procedures, and / or delivering therapy may be performed by an on-board monitor device and / or by a remote computer system, it being understood that the specific distribution of tasks and resulting functionality may vary depending on the preferred embodiment.
[0329] In one example, the system includes a substrate coil disposed on the substrate and operably coupled to one or more microstructure electrodes, which may include microstructures that are electrodes or that include electrodes thereon. Excitation and receiving coils are provided, typically within the housing of the measurement device, and the excitation and receiving coils are disposed in close proximity to the substrate coil in use. This is done to inductively couple the excitation and receiving coils to the substrate coil, such that when an excitation signal is applied to the drive coil, this induces a signal in the substrate coil, which may form a resonant circuit in conjunction with the electrodes and other reactive components on the substrate. As a result, the signal frequency, amplitude and attenuation (Q) of the resonant circuit on the substrate is reflected in the signal observed at the excitation and receiving coils, which in turn allows the drive signal applied to the excitation and receiving coils to be modified, for example by changing the frequency, phase or magnitude of the signal, which acts as a response signal, for example bioimpedance or biocapacitance to be measured.
[0330] While this can be used in a variety of ways, in one example, one or more microstructure electrodes are configured to bind one or more analytes of interest such that the response signal is dependent on the presence, absence, level or concentration of the analytes of interest. This can be achieved in a variety of ways as described above, such as coating the microstructure with a binding agent or forming the microstructure from a material that includes the binding agent, such that the analytes interact with the microstructure electrodes and change their electrical properties, thereby changing the properties of the response signal. For example, this can include coating or binding the analyte to the material that forms the microstructure, such as a molecularly imprinted polymer.
[0331] Detection of the analyte can be done in any manner, including, for example, by examining the change in response signal over time as the level or concentration of the analyte near the microstructure electrodes changes. Alternatively, in another example, two sets of microstructure electrodes are used that are independently driven, one acting as a control and the other selectively responsive to one or more analytes, such that differences in the measured signals indicate changes in the analyte level or concentration.
[0332] In this example, the system typically includes a first substrate coil disposed on a substrate and operably coupled to one or more first microstructure electrodes, and a second substrate coil disposed on the substrate and operably coupled to one or more second microstructure electrodes, the second microstructure electrodes configured to interact with an analyte of interest. At least one drive coil is positioned in proximity to at least one of the first and second substrate coils such that a modification, such as attenuation or a phase or frequency change, of an applied drive signal serves as a response signal. In this case, one or more electronic processing devices use the first and second response signals, particularly the difference between the first and second response signals, to determine the presence, absence, level or concentration of the analyte of interest.
[0333] Where multiple substrate coil and electrode combinations form resonant circuits, each may be purposefully designed to have a different resonant frequency by selection of fixed reactive components, either inductive or capacitive, thereby allowing a means of frequency-based multiplexing of the entire array using a single excitation and receiving coil.
[0334] A further example of a system for performing measurements on a living subject will now be described with reference to Figures 3A to 3K.
[0335] In this example, the system includes a monitor device 320 that includes a sensor 321 and one or more electronic processing devices 322. The system further includes a signal generator 323, a memory 324, an external interface 325 such as a wireless transceiver, an actuator 326, and an input / output device 327 such as a touch screen or display and input buttons connected to the electronic processing device 322. The components are typically provided within a housing 330, which is described below.
[0336] The nature of the signal generator 323 and sensor 321 depends on the measurements to be made and may also include current and voltage sensors, other electromagnetic radiation sources such as lasers or LEDs, and photodiode or CCD sensors, etc. The actuator 326 is typically a spring or electromagnetic actuator combined with a piezoelectric actuator or vibration motor coupled to the housing, which urges the substrate to vibrate against the underside of the housing, thereby pressing the microstructure into the skin, while the transceiver is typically a short-range wireless transceiver such as a Bluetooth system on a chip (SoC).
[0337] The processing device 322 executes software instructions stored in memory 324 to enable various processes to take place, including controlling the signal generator 323, receiving and interpreting signals from the sensor 321, generating and transmitting measurement data to a client device or other processing system via the transceiver 325. Thus, an electronic processing device is typically a microprocessor, a microcontroller, a microchip processor, logic gate configurations, firmware optionally associated with logic implementations such as FPGAs (Field Programmable Gate Arrays), or any other electronic device, system or equipment.
[0338] In use, the monitoring device 320 is coupled to a patch 310 comprising a substrate 311 and a microstructure 312 coupled to a sensor 321 and / or signal generator 323 via a connection 313. The connection may comprise a physical conductive connection such as a conductive track, although this is not required and instead an inductive connection or a wireless connection such as a radio frequency wireless connection may be provided. In this example, the patch further comprises an anchor microstructure 314 configured to penetrate into the dermis, thereby helping to anchor the patch to the subject.
[0339] An example of a patch 310 is shown in more detail in Figures 3B and 3C. Notably, in this example, the substrate 311 is generally rectangular with rounded corners to avoid discomfort when the substrate is applied to a subject's skin. The substrate 311 includes anchor microstructures 314, which are provided proximate corners of the substrate 311 to help anchor the substrate, while the measurement microstructures 312 are provided in an array on the substrate. In this example, the array has a regular grid organization, with the microstructures 312 provided in equally spaced rows and columns, although this is not required and alternative spacing configurations can be used, as described in more detail below.
[0340] 3D and 3E, three anchor microstructures 314.1, 314.2, 314.3 are provided, surrounded by respective circumferentially spaced apart microstructures 312.1, 312.2, 312.3. This can be useful to maximize the effectiveness of the anchor, providing the microstructures 312 particularly close to the anchor microstructures 314 to avoid the microstructures 312 moving within the subject. Additionally, in this example, the anchor microstructures 314 can also be used in measuring or applying signals, such as by acting as a ground connection.
[0341] In this example, the substrate is also formed from multiple substrate layers 311.1, 311.2, which may be useful for making internal structures such as connections to microstructures, coils, etc., as described in more detail below. In a similar manner as described below with respect to the backing, the substrate may also include different regions or layers having different material properties, etc.
[0342] In this example, the anchor microstructure 314.1 is circular and includes one peripheral group of circumferentially spaced microstructures 312.1. However, it will be appreciated that this is not required and in the case of the anchor microstructure 314.2, the anchor microstructure 314.2 is surrounded by two or more concentric groups of microstructures 312.2, with the outer groups including more microstructures. This allows measurements to be taken over a wider range. It will be appreciated that other arrangements are possible, such as providing additional concentric groups, providing different numbers of microstructures in each group, etc. Additionally, while a circular group is shown, this is not intended to be limiting and other shapes or distributions may be used, including elliptical shapes, square shapes, etc.
[0343] In the case of the anchor microstructure 314.3, which is hexagonal, there are six plate microstructures 312.3, each positioned radially outward from a respective face of the hexagonal anchor microstructure 314.3. In this manner, measurements can be made between each face of the anchor microstructure 314.23 and each microstructure 312.3, which can be useful to maximize the surface area of the electrodes on each face and plate while maintaining an equidistance separation between the anchor microstructures and the surrounding microstructures.
[0344] Although the above configuration is described with respect to an anchor microstructure, it will be appreciated that this is not required and a similar arrangement may be used with any drive or sense microstructure. Thus, in one example, one drive microstructure may be used with multiple peripheral sense microstructures, or one sense microstructure may be used with multiple peripheral drive microstructures. This provides an effective master-slave arrangement in which one master drive / sense microstructure is used with multiple sense / drive microstructures.
[0345] Such a master / slave relationship can be used in a wide range of applications, for example to induce responses in multiple sense microstructures with one drive signal. In this example, it can also be used for mapping, for example to identify different responses at different locations and thereby pinpoint effects such as the presence of an analyte or a particular target such as a lesion or cancer. Alternatively, it can be used with sense microstructures used to detect different analytes, for example using different coatings, allowing one stimulation signal to trigger the detection of different analytes.
[0346] 3B and 3C, four connectors 315 are provided that connect to respective microstructures 312 via connections 313 so that stimulus and response signals can be applied to and measured from the two sets of respective microstructures. This can be used to allow symmetric or differential application and detection of signals as opposed to asymmetric or single-ended application or detection that is typically done relative to a ground reference and which is typically noisier. However, it will be appreciated that for some detection modalities, such as optical detection, this is not important and a single connection 315 can be provided.
[0347] The substrate also includes a coupling member 316 , such as a magnet, that can be used to attach the substrate to a housing 330 .
[0348] In the example of Figures 3F and 3G, the housing 330 is a generally rectangular housing. The measurement device can optionally have a form factor similar to a watch or other wearable device, in which case a strap 331 is included that allows the housing to be secured to the user. However, this is not required and other fastening mechanisms can be used. Alternatively, the housing can simply engage with the patch and hold it in place each time a measurement is taken. In this example, the housing includes a coupling member 332, such as a magnet, which can engage with a corresponding coupling member 316 on the substrate to allow the substrate to be secured to the housing. While any form of coupling member can be used, the use of a magnet is particularly advantageous as the magnet can be contained within the housing 330, thereby sealing the housing, and can also act to ensure correct alignment of the substrate 310, for example by allowing the polarity of the magnet to guide the relative orientation of the substrate 310 and the housing 330.
[0349] However, it will be appreciated that this configuration is for illustrative purposes only and other arrangements can be used. For example, the substrate can form part of an adhesive patch that is applied to a subject and held in place. Alternatively, an adhesive can be provided on a surface of the substrate for directly adhering the substrate to the subject. The housing 330 can then be selectively attached to the patch, for example using a magnetic coupling, thereby allowing measurements to be taken as required.
[0350] In this example, the substrate may be a flexible substrate, which may be achieved using a woven or nonwoven fabric or other suitable material to which the microstructures are directly attached. More commonly, however, flexibility is achieved by forming a segmented substrate using several individual substrates 311 attached to a flexible backing 319, as shown in Figure 3H. It will be appreciated that such an arrangement may be used in a wide variety of contexts, including attachment to straps or the like for attaching the substrate to a subject.
[0351] Some further variations are shown in Figures 3I-3K.
[0352] In particular, in the example of Figure 3I, the backing 319 is formed from multiple backing layers 319.1, 319.2, two of which are shown in the example for illustrative purposes only. The use of multiple layers may be beneficial in achieving desired properties, for example to provide an adhesive or waterproof layer, etc.
[0353] In the example of Figure 3J, the backing layer has a number of interspersed regions 319.3 that can be used for specific purposes such as to allow easier attachment of the substrate 311, to provide connectivity to a measurement device 320, to increase flexibility between the substrates 311, etc. In this example, the interspersed regions are substantially aligned with the substrate, although it will be appreciated that this is not required and may be provided in other locations.
[0354] A further example is shown in Figure 3K, which includes several geometric modifications including thinner regions 319.4 located between the substrates which may be used to enhance flexibility, or thicker regions 319.5 between the substrates which may enhance strength. Similarly, thinner or thicker regions 319.5, 319.6 may also be provided along the substrate to enhance, for example, strength, flexibility, connection to a measurement device, etc.
[0355] Although these features are described with respect to the backing layer, it will be understood that a similar approach can also be used for the substrate itself.
[0356] An example of an actuator configuration to aid in patch application will now be described with reference to FIG. 3L.
[0357] In this example, the housing 330 includes a mount 333 to which an actuator 326, such as a piezoelectric actuator or vibration motor, is attached. The actuator 326 is aligned with an opening 334 in the underside of the housing 330, through which an arm 326.1 connected to the actuator 326 extends, and the opening 334 may be sealed using an O-ring 334.1 or other similar equipment.
[0358] The patch substrate 311 is positioned adjacent the underside of the housing 330 and magnets 316, 332 are provided to urge the substrate 311 towards the housing 330. The arm 326.1 engages the substrate, thereby transferring force from the actuator 326 to the substrate 311, allowing the substrate and therefore the microstructures 312, 314 to be vibrated to aid in the insertion of the microstructures into a target. In particular, this arrangement transfers force directly to the substrate 311, allowing the force at the substrate to be maximised while vibration of the housing 330 is minimised.
[0359] A further example of an actuator arrangement will now be described with reference to FIG. 3M.
[0360] In this example, the actuator fixture includes an actuator housing 335 having a base 335.1 with an opening 335.2. The housing includes a spring 336 and a mount 337, which supports the patch 310 (and any integrated reader) in use. The mount also optionally includes a piezoelectric actuator or offset motor 338.
[0361] In use, the actuator housing 335 is positioned such that the base 335.1 of the housing 335 abuts the skin of the subject, with the patch protruding at least partially through the opening 335.2. In one example, this is achieved by having an operator hold the actuator housing. However, this is not required and the actuator housing may additionally and / or alternatively be integrated into and / or form part of the monitoring device as described above.
[0362] In use, the spring 336 is configured to apply a continuous biasing force to the attachment 337, thereby pressing the patch 310 against the skin of the subject. Additionally, a piezoelectric actuator or offset motor 338 can vibrate the attachment 337 and thus the patch 310, thereby facilitating the microstructures to pierce and / or penetrate the stratum corneum.
[0363] Next, an example of the microstructure device will be described in more detail with reference to FIGS.
[0364] In the example of Figure 4A, microstructures of different lengths are shown, with a first microstructure 412.1 penetrating the stratum corneum and viable epidermis but not breaking through the dermis, a second microstructure 412.2 entering the dermis but only just passing the dermal boundary, while a third microstructure 412.3 penetrating the dermal layer a greater distance. It will be appreciated that the length of the structures used will vary depending on the intended use of the device, and in particular the nature of the barrier to be breached.
[0365] In the example of FIG. 4B, pairs of microstructures are provided, with a first pair of microstructures 412.4 having a closer spacing and a second pair of microstructures 412.5 having a relatively larger spacing, which can be used to detect different properties or provide different forms of stimulation.
[0366] For example, larger electrode spacing can be used to make impedance measurements of interstitial fluid and other tissues and fluids between the electrodes, while more closely spaced electrodes are better suited to performing capacitive sensing to detect different analytes present on the surface of the electrodes.
[0367] In addition, the electric field strength generated by applying a signal to the first and second microstructure pairs is shown in Figures 4C and 4D, highlighting that as the spacing increases, the field strength between the electrodes decreases, which further impacts the ability to stimulate. For example, by providing an array of closely spaced microstructures, this can be used to generate a very uniform field within a subject without the need for large applied fields. This can be used to enable the field to be used for stimulation, such as to perform electroporation.
[0368] An example of a plate microstructure is shown in Figures 5A-5C.
[0369] In this example, the microstructure is a plate having a body 512.1 and a tip 512.2, tapered to facilitate the penetration of the microstructure 512 into the stratum corneum. In this example, electrode plates 517 are provided on both sides of the microstructure, which are linked to a connector 515 via one connection 513 for further connection to the sensor 321 and / or signal generator 323. This allows signals to be collectively measured from or applied to the electrode plates. However, it will be appreciated that this is not required and separate connections can be provided to allow each electrode to be independently driven or sensed. Additionally, each electrode 517 can be subdivided into multiple separate segments 517.1, 517.2, 517.3, 517.4 such that each side includes multiple electrodes.
[0370] As shown in Figures 5C and 5D, different setups can be used, but typically pairs of microstructures are formed such that they face each other to apply signals between the microstructures or measure signals between the microstructures. Again, different separations between the electrodes in an electrode pair can be used to make different measurements and / or to allow for altering the profile of stimulation of the tissue between the electrodes.
[0371] Further examples of blade microstructures are shown in Figures 5E and 5F.
[0372] In this example, the microstructure is an elongated body 512.1 and a tip 512.2 that is tapered to facilitate penetration of the microstructure 512. This is generally a similar profile to the plate provision described above, but in this example is much wider, and in one particular example may extend substantially the entire distance across the substrate. In this example, the microstructure includes multiple electrode plates 517 on either side of the microstructure. In this case, the substrate may include multiple spaced parallel blades, allowing signals to be applied across or measured between electrodes on different blades. However, it will be appreciated that other configurations may be used, such as providing a single electrode, providing segmented electrodes, or having the entire microstructure act as an electrode.
[0373] In the illustrated example, the blade tip is parallel to the substrate, however this is not required and other configurations can be used such as having a beveled tip so that as the blade is inserted it penetrates gradually along its length, thereby facilitating further penetration. The tip may also include serrations or the like to further enhance penetration.
[0374] As mentioned above, in one example, the microstructures are provided in a regular lattice arrangement. However, in another example, the microstructures are provided in a hexagonal lattice arrangement, as shown in Figure 5G. This is particularly advantageous because each microstructure is equally spaced relative to all of its nearest neighboring microstructures, as indicated by the arrows, meaning that measurements can be made without having to modify the response or stimulus signal to account for the different spacing of any neighboring microstructures.
[0375] A further example of the arrangement is shown in Figures 5H and 5I, where the microstructures 512 are arranged in pairs 512.3, and the pairs are arranged in offset rows 512.4, 512.5. In this example, the pairs in different rows are arranged orthogonally, so that the microstructures extend in different directions. This avoids that all the microstructures are aligned, which may further make the patch vulnerable to lateral slippage in the direction aligned with the microstructures. Additionally, the orthogonal arrangement of the pairs reduces interference such as crosstalk between different electrode pairs, improving measurement accuracy, especially when performing measurements via multiple microstructure pairs simultaneously, and taking tissue anisotropy into account.
[0376] In one example, the microstructure pairs in each row can be provided with respective connections 513.41, 513.42; 513.51, 513.52 to allow an entire row of microstructure pairs to be interrogated and / or stimulated simultaneously while allowing different rows to be interrogated and / or stimulated independently.
[0377] A Scanning Electron Microscopy (SEM) image showing an array of offset plate microstructure pairs is shown in FIG. 5K.
[0378] Examples of microstructures for making measurements in the epidermis are shown in Figures 5L and 5M.
[0379] In this example, the microstructure is a plate or blade having a body 512.1 with a flared base 512.11 where it joins with a substrate to enhance the strength of the microstructure. The body narrows at a waist 512.12 to define a shoulder 512.13, which in this example extends via a non-tapered shaft 512.14 to a tapered tip 512.2. Typical dimensions are shown in Table 4 below.
[0380] [Table 4]
[0381] An example pair of the microstructures of Figures 5L and 5M upon insertion into a subject is shown in Figure 5N.
[0382] In this example, the microstructure is configured such that the tip 512.2 penetrates the stratum corneum SC and enters the living epidermis VE. The waist 512.12, and particularly the shoulder 512.13, abuts the stratum corneum SC, preventing the microstructure from penetrating further into the subject and preventing the tip from entering the dermis. This helps to avoid contact with nerves that could lead to pain.
[0383] In this configuration, the body 512.1 of the microstructure can be covered with a layer of insulating material (not shown) with only the tip exposed. As a result, a current signal applied across the microstructure generates an electric field E within the subject, and in particular within the living epidermis VE, such that the measurements reflect the fluid level within the living epidermis VE.
[0384] However, it will be appreciated that other configurations can be used, for example in the setup of Figure 5O, the shaft 512.14 is extended so that the tip 512.2 enters the dermis, allowing measurements to be taken of the dermis (and optionally the epidermis).
[0385] In this example, typical dimensions are shown in Table 5 below.
[0386] [Table 5]
[0387] Examples of inter-pair and intra-pair spacing for these configurations are shown in Table 6 below.
[0388] [Table 6]
[0389] A further example of the arrangement is shown in Figures 6A and 6B, where the microstructure again comprises a generally similar plate-like arrangement, the microstructure including spaced apart prongs 612.2 each having an electrode 617 thereon such that the electrode is on a plane between the prongs 612.2, again allowing for a very uniform field to be applied or for capacitive sensing to take place.
[0390] A further example of a microstructure is shown in Figures 7A and 7B, which includes a body 512.1 including a conductive core 513 covered by an insulating layer 512.1, which in one example can be a polymer or other material. In this case, the core 513 terminates in an opening 513.2, allowing an electrical signal to be conducted via an outlet. Additionally and / or alternatively, a port 513.3 extending through the insulating layer may also be provided to allow an electrical signal to be conducted partway along the structure, as shown in Figure 7B, allowing measurements to be made at a target depth within the living epidermis and / or dermis.
[0391] It will also be appreciated that when pairs of microstructures are used, electrodes may be provided only on the inner surfaces of the pairs, for example by insulating the outer surfaces of the pairs, thereby reducing electrical interference between different pairs of microstructures.
[0392] Next, construction of a further patch arrangement will be described with reference to Figures 8A-8L.
[0393] In this example, the substrate 810 is formed from a metal, particularly stainless steel, plate 811 into which a U-shaped cutout 815 is made and an internal section can be bent downward as indicated by arrow 812.1 to form structures 812 adjacent to respective apertures 816. This process is repeated to form identical first and second substrates 810.1, 810.2, which are further combined with an intervening insulating layer 810.3. In one example, the insulating layer 810.3 is made of plastic or other similar material and is attached to the backside of the first substrate 810.1, after which the microstructures 812 of the second substrate are punched through the insulating layer and apertures 811.2 of the first substrate 810.1 to form a patch including a pair of electrically isolated microstructures. As a result, a signal can be measured across or applied between the substrates 810.1, 810.3 and thus the pair of microstructures.
[0394] It will thus be appreciated that this provides a mechanism for quickly and inexpensively constructing arrays of spaced apart microstructure pairs which can be used in applying and / or measuring signals.
[0395] Providing a pair of substrates 811 separated by an insulating layer can result in large capacitive coupling, which can further affect the readings. In one example, this can be addressed by creating additional apertures in the first and second substrates 811.1, 811.2, thereby reducing the amount of overlapping substrate material. In an alternative example shown in Figure 8H, the second substrate is rotated 180° such that apertures 816.1, 816.2 are offset, thereby creating a similar effect.
[0396] A further alternative configuration is shown in Figures 8I and 8J, where a single substrate 811.3 has back-to-back cutouts 815.3 to allow for pairs of microstructures 812.3 to be created.
[0397] Further example configurations are shown in Figures 8K and 8L. In this example, two substrates 811.4, 811.5 are provided, with the first substrate 811.4 including individual first microstructures 812.4 that can be placed between pairs of second microstructures 812.5 on the second substrate 811.5. The first and second substrates 811.4, 811.5 and the first and second microstructures 812.4, 812.5 are typically held apart by insulating spacers 817. This configuration allows the first microstructures to act to interrogate the conditions between the second microstructures 812.5. For example, a field can be applied between the second microstructures 812.5 and the first microstructures can be used to measure similar field strength. In one example, a coating 818 can also be applied to the microstructures 812.4, 812.5 to strengthen the microstructures during insertion through a barrier.
[0398] An alternative technique for manufacturing microstructures will now be described with reference to Figures 8M-8Q.
[0399] In this example, a carrier wafer 891 is provided and spin-coated with a photopolymer layer 892. The photopolymer layer 892 is selectively exposed to UV radiation and cross-linked to create structural regions 892.1, which in this example form the substrate. A second photopolymer layer 893 is spin-coated over the first layer 891 and exposed to UV radiation and cross-linked to create second structural regions 893.1, which in this example form the microstructures extending from the substrate. The carrier wafer and uncross-linked polymer are removed to create the microstructures shown in Figure 8P.
[0400] It will be appreciated that a wide range of different microstructure configurations can be made using this layering technique, and an alternative design is shown in FIG. 8Q.
[0401] In one example, the monitor device operates as part of a distributed architecture, an example of which will now be described with reference to FIG.
[0402] In this example, one or more processing systems 910 are coupled to a number of client devices 930 and monitor devices 920 via a communications network 940 and / or one or more local area networks (LANs). The monitor devices 920 may be directly connected to the network or may be configured to connect to the client devices 930, which in turn provide further connectivity to the network 940. It will be appreciated that the configuration of the network 940 is for example purposes only, and in practice the processing systems 910, client devices 930 and monitor devices 930 may communicate via any suitable mechanism, such as via wired or wireless connections, including but not limited to mobile networks, private networks such as 802.11 networks, the Internet, LANs, WANs, and the like, as well as via direct connections or point-to-point connections such as Bluetooth.
[0403] In one example, each processing system 910 is configured to receive subject data from a monitoring device 920 or a client device 930 and analyze the subject data to generate one or more health status indicators, which can be further provided to the client device 930 or the monitoring device 920 for display. Although the processing system 910 is shown as a single entity, it will be appreciated that the processing system 910 may be distributed across several geographically separated locations, for example, by using a processing system 910 and / or database provided as part of a cloud-based environment. However, the above arrangement is not required and other suitable configurations may be used.
[0404] An example of a suitable processing system 910 is shown in FIG.
[0405] In this example, the processing system 910 includes at least one microprocessor 1000, memory 1001, optional input / output devices 1002, such as a keyboard and / or display, and an external interface 1003, interconnected via a bus 1004 as shown. In this example, the external interface 1003 may be utilized to connect the processing system 910 to peripheral devices such as a communications network 940, a database 1011, other storage devices, etc. Although one external interface 1003 is shown, this is for purposes of example only, and in practice multiple interfaces using various methods (e.g., Ethernet, serial, USB, wireless, etc.) may be provided.
[0406] In use, the microprocessor 1000 executes instructions in the form of application software stored in memory 1001 to perform necessary processes. The application software may include one or more software modules and may be executed in a suitable execution environment, such as an operating system environment.
[0407] It will therefore be appreciated that the processing system 910 may be formed from any suitable processing system, such as a suitably programmed client device, a PC, a web server, a network server, etc. In one particular example, the processing system 910 is a standard processing system, such as, but not required to be, an Intel™ architecture-based processing system that executes software applications stored in non-volatile (e.g., hard disk) storage. However, it will also be appreciated that the processing system may be any electronic processing device, such as a microprocessor, a microchip processor, logic gate configurations, firmware optionally associated with logic implementations such as an FPGA (Field Programmable Gate Array), or any other electronic device, system, or equipment.
[0408] An example of a suitable client device 930 is shown in FIG.
[0409] In one example, client device 930 includes at least one microprocessor 1100, memory 1101, input / output devices 1102 such as a keyboard and / or display, and an external interface 1103 interconnected via a bus 1104 as shown. In this example, external interface 1103 can be utilized to connect client device 930 to peripheral devices such as a communications network 940, databases, other storage devices, etc. Although one external interface 1103 is shown, this is for purposes of example only and in practice multiple interfaces using various methods (e.g., Ethernet, serial, USB, wireless, etc.) may be provided.
[0410] In use, the microprocessor 1100 executes instructions in the form of application software stored in the memory 1101 to enable communication with the processing system 910 and / or the monitor device 920 .
[0411] It will therefore be appreciated that the client device 1130 may be formed from any suitable processing system, such as a suitably programmed PC, Internet terminal, laptop or handheld PC, and in one preferred example is a tablet, smartphone, etc. Thus, in one example, the client device 1130 is a standard processing system, such as an Intel™ architecture-based processing system, which executes software applications stored in non-volatile (e.g. hard disk) storage, although this is not required. However, it will also be appreciated that the client device 1130 may be any electronic processing device, such as a microprocessor, a microchip processor, logic gate configurations, firmware optionally associated with logic implementations such as an FPGA (Field Programmable Gate Array), or any other electronic device, system or equipment.
[0412] Examples of processes for making measurements and generating indicators will now be described in more detail. For the purposes of these examples, it is assumed that one or more processing systems 910 are operative to analyze received object data and generate resulting indicators. Measurements are made by monitor devices 920, and object data is transferred to the processing system 910 via client devices 230. In one example, to provide this in a platform-agnostic manner and make it easily accessible using client devices 930 with different processing capabilities using different operating systems, input data and commands are received from the client devices 930 using a web page, and the resulting visualization is rendered locally by a browser application or other similar application executed by the client devices 930. Thus, the processing system 910 is typically a server (hereinafter referred to as a server) that communicates with the client devices 930 and / or the monitor devices 920 via a communication network 940 or the like depending on the particular network infrastructure available.
[0413] To accomplish this, the server 910 typically executes application software for hosting web pages and performing other necessary tasks including storing, retrieving and processing data, and actions performed by the processing system 910 are performed by the processor 1000 according to instructions stored as application software in the memory 1001 and / or input commands received from a user via the I / O device 1002 or commands received from the client device 1030.
[0414] It is also envisioned that a user interacts with the server 910, such as through a GUI (Graphical User Interface) presented on the client device 930, such as through a browser application that displays web pages hosted by the server 910 or an app that displays data provided by the server 910, in one particular example. Actions performed by the client device 930 are performed by the processor 1100 according to instructions stored as application software in the memory 1101 and / or input commands received from a user via the I / O device 1102.
[0415] However, it will be understood that the above configuration assumed for purposes of the following examples is not required and that numerous other configurations may be used. It will also be understood that the division of functionality between the monitor device 920, the client device 930, and the server 910 may vary depending on the particular implementation.
[0416] An example of a process for taking measurements on a subject will now be described in more detail with reference to Figures 12A and 12B.
[0417] In this example, the process for applying a patch including a substrate and microstructures is shown in steps 1200-1230, while the measurement process is shown in steps 1235-1260. In this regard, it will be appreciated that for a patch that is used to make multiple measurements over a period of time, steps 1200-1230 are performed only once and steps 1235-1260 are repeated as necessary.
[0418] Additionally, for purposes of this example, the system is assumed to include a reader formed by the housing 330 and associated signal generator, sensor and processing electronics. The reader may be integral with the patch 310 and / or may be separate from the patch 310 depending on the preferred embodiment.
[0419] In step 1200, a substrate is provided at a desired location with the substrate and microstructure in place relative to a subject. In step 1205, assuming a reader is not integrated into the patch 310, a housing 330 is attached to the substrate 311, for example, by magnetically or otherwise coupling the housing to the substrate, or by holding the housing in contact with the patch 310.
[0420] At step 1210, the processing device 322 selects the frequency / magnitude of the actuator. This may be a standard value and / or may be dependent on the barrier being breached, and therefore different values may be selected for different sites on the object and / or for different objects.
[0421] In step 1215, the actuator 326 is controlled to initiate vibration of the microstructure, thereby facilitating movement of the microstructure within the object.
[0422] A stimulus is optionally applied at step 1220 and a response signal is measured at step 1225 so that the processing device 322 can monitor the depth of breaching and / or penetration of the functional barrier. The mechanism for accomplishing this depends on the nature of the response signal and any stimulus. For example, impedance can also be derived using the stimulus and response, as impedance values change as the microstructures penetrate the stratum corneum and into the living epidermis.
[0423] At step 1230, the processing device 322 optionally determines whether the breach or penetration is complete, and if not, the process returns to step 1210 to select a different frequency and / or magnitude. This process thus allows for the frequency and / or magnitude of the force applied to be continuously adjusted as the substrate and microstructure are applied, and in particular as the microstructure breaches and optionally penetrates the functional barrier. In one example, this can be used to gradually increase the force during insertion until the barrier is breached, while decreasing the frequency, at which point the force is reduced. In this regard, it has been found that this can facilitate the penetration of the barrier.
[0424] Once the patch is applied, measurements can begin. In this regard, if a reader is integrated into the patch, measurements can be taken as needed. Alternatively, if the reader is separate, it may be necessary to bring the reader into proximity and / or contact with the patch so that measurements can be taken.
[0425] In this example, the monitor device 920 applies one or more stimulus signals to the subject in step 1235 and then measures a response signal in step 1240. The response signal is measured by the sensor 321, which generates measurement data, which is provided to the processing device 322 in step 1245. In this example, the monitor device 920 then forwards the measurement data to the client device 930 for further processing. In particular, the client device 930 could also perform preliminary pre-processing of the data, for example adding additional information derived from on-board sensors such as GPS, thereby adding time or location information, etc. This information could be useful in situations such as tracking the spread of infectious diseases.
[0426] The resulting data may be collated, for example by creating target data, and then transferred to the server 910 for further analysis in step 1250. However, it will be appreciated that the analysis may also be performed on the reader and that indicators derived from performing the analysis may also be displayed on the reader.
[0427] The nature of the analysis will vary depending on the preferred embodiment, and a wide range of options is anticipated.
[0428] When making a fluid level measurement, an alternating current signal is applied to the subject via the pair of microstructures and the resulting voltage signal is measured via the same microstructures. The magnitude and phase of the applied current and the resulting voltage can be further used to calculate an impedance value that depends on the fluid level in the subject. Thus, the measured impedance value can be correlated with the fluid level, allowing for a determination of hydration of the subject, an example of which is described in more detail below.
[0429] It will be further appreciated that different information can be derived depending on the frequency at which the measurements are taken. For example, the system can use Bioimpedance Analysis (BIA) where a single low frequency signal is injected into the subject S and the measured impedance is used directly to determine a biological parameter. In one example, the applied signal has a relatively low frequency, such as less than 100 kHz, more typically less than 50 kHz, and more preferably less than 10 kHz. In this case, such a low frequency signal can be used as an estimate of the impedance at zero applied frequency, which is indicative of the extracellular fluid level.
[0430] Alternatively, the applied signal can have a relatively high frequency, such as greater than 200 kHz, more typically greater than 500 kHz, or even 1000 kHz, in which case such a high frequency signal can be used as an estimate of the impedance at infinite applied frequency, which is further indicative of the combined extracellular and intracellular fluid levels.
[0431] Additionally and / or alternatively, the system may use Bioimpedance Spectroscopy (BIS), in which impedance measurements are made at multiple frequencies, which may be further used to derive information about both intracellular and extracellular fluid levels, for example by fitting the measured impedance values to a Cole model.
[0432] When measuring the level or concentration of an analyte, an alternating electrical stimulation signal is applied to the subject through the pair of microstructures, and the resulting electrical response signal is measured through the same microstructures. The magnitude and / or phase of the applied signal, and the voltage of the resulting response signal can be further used to calculate an impedance or capacitance value that depends on the level or concentration of the analyte in the subject. Thus, the measured impedance value can be correlated with the level or concentration of the analyte, thereby making it possible to monitor the progression of a disease, disorder or condition, or to diagnose a disease, disorder or condition, or to determine the presence, absence, level or concentration of a drug, an illegal or non-illegal substance of abuse, or a chemical weapon, poison or toxin.
[0433] For example, the subject data may be used in conjunction with previously collected subject data to perform longitudinal analysis to examine changes in measurements over time. Additionally and / or alternatively, the subject data may be analyzed using machine learning models, etc. One or more indices are generated in step 1255, the nature of the indices and the manner in which they are generated will vary depending on the preferred embodiment and the nature of the analysis being performed.
[0434] At step 1260, data such as object data, metrics, or measurement data is recorded so that it can be accessed later as needed. Metrics may be provided to the client device 930 and / or the monitor device 920 for display.
[0435] In one example, a monitoring device is assigned to each user and this assignment is used to track the measurements of the subjects. An example of a process for assigning monitoring devices 920 to subjects will now be described with reference to FIG.
[0436] In this example, the subject first undergoes an assessment in step 1300, a process performed by a clinician. The clinician uses the assessment to guide the type of monitoring that needs to be performed and to identify specific biomarkers to be measured, which may further depend, for example, on any symptoms or medical diseases, disorders or conditions from which the subject suffers. As part of this process, the clinician will typically obtain subject attributes, such as weight, height measurements, age, sex, details of medical interventions, etc., in step 1310. This may be done using any combination or technique of querying medical records, asking questions, taking measurements, etc.
[0437] Once the evaluation is complete, a type of monitor device can be selected at 1320, based on the measurements required. In this regard, it will be appreciated that various combinations of microstructure features and sensing modalities can be used to enable various measurements to be made, and thus it is important to make the correct selection to enable measurements to be collected. A particular monitor device 920 is then assigned to the subject at step 1330. In this regard, each device typically includes a unique identifier, such as a MAC (Media Access Control) address or other identifier, which can be used to uniquely associate the monitor device with the subject.
[0438] At step 1340, the monitoring device 920 can optionally be configured to, for example, update firmware or instruction sets required to perform the respective measurements. At step 1350, a subject record is created that is used to store details relating to the subject, including subject attributes, subject data, metrics, or any other relevant information. In addition, the subject record will typically also include an indication of the monitoring device identifier, thereby associating the monitoring device with the subject.
[0439] An example of a process for taking a measurement using the device will now be described with reference to Figures 14A and 14B.
[0440] In this example, at step 1400, one or more measurements are taken. The measurements are taken, for example, by having the monitor device apply a stimulus signal and measure a response signal, by utilizing the process described above. Measurement data based on the response signal is recorded, which is uploaded to the client device 930 at step 1405, enabling the client device 930 to generate subject data at step 1410. The subject data may simply be the measurement data, but may also include additional information provided by the client device 930. This allows for user input to be provided via the client device 930, for example providing details of symptoms, changes in attributes, etc. The subject data is then uploaded to the server 910 at step 1415. The server 910 then retrieves another subject attribute, for example, from the subject record, at step 1420, after which the server 910 calculates one or more metrics at step 1425.
[0441] At step 1430, the server 910 analyzes the metrics. The manner in which this is done varies depending on the preferred embodiment. For example, this can be accomplished by fitting the metrics to a computational model that embodies a relationship between the relevant health status and one or more metrics. Alternatively, the metrics can be established from a population of reference subjects and compared to defined thresholds that are used to represent a disease, disorder, or condition, such as the presence or absence of a medical condition. As a further option, the metrics can be compared to previous metrics of the subject, for example to see changes in the metrics that may further represent a change in health status. The results of the analysis can be used to generate one or more indices at step 1435. In one example, the indices can be in the form of a score that represents a health status, or can indicate the presence, absence, or degree of a disease, disorder, or condition.
[0442] At step 1440 the indication may be stored, at step 1445 an indication of the indication may be forwarded to the client device 930 , and at step 1450 the indication may be displayed by either the client device 930 or the monitor device 920 .
[0443] Additionally and / or alternatively, the indicator can be used to determine whether action is needed, e.g., whether an intervention should be performed, in step 1455. The assessment of whether action is needed can be done in any of a number of ways, but typically involves comparing the indicator to a predefined threshold or criteria that defines an acceptable range of index values, e.g., comparing a water retention indicator to a range indicative of normal water retention, or comparing an analyte indicator indicative of a normal level or concentration of the analyte.
[0444] The evaluation criteria may also specify the action required if the indicator is outside of an acceptable range, and any steps required to take the action, allowing the action to be taken in step 1460. For example, if an analyte is detected, this may indicate a medical condition, in which case the processing system or monitoring device may generate a notification that is provided to a clinician or other designated person or system to alert them. The notification may also include any determined indicator and / or measured response signal, allowing the clinician to quickly identify the required intervention. In theranostic applications, the action may also include causing the application monitoring device to apply a stimulation signal to the electrodes, thereby releasing one or more therapeutic agents. This may be done according to a dosing regimen that may be specified as part of the evaluation criteria or may be manually defined by the clinician in response to a notification provided, for example, as described above. Alternatively, the action may include notifying the user, thus, for example, if the subject is dehydrated, the action may include causing the monitoring device to provide a hydration recommendation to the user.
[0445] It will therefore be appreciated that this allows actions to be triggered as required.
[0446] The above process describes the transfer of data to a remote system for analysis, which can have several advantages. For example, this allows more complex analysis to be performed with existing processing power. It also allows remote supervision, for example allowing clinicians to access records related to multiple patients in real time, allowing them to respond quickly if necessary. It can also allow clinicians to be alerted or notified, for example if the measurement data indicates an adverse health condition, allowing intervention to be triggered. In addition, collective monitoring provides a public health benefit, allowing for example the tracking of infectious diseases. Furthermore, centralized analysis allows data mining to be used to refine the analysis process, making it more accurate as more data is collected.
[0447] However, it will be appreciated that a distributed implementation is not required and that in addition or instead, the analysis can be performed in situ, for example by having the monitor device 920 and / or the client device 930 perform steps 1425-1460, and the resulting information can be displayed locally, for example using the client device 930 or an integrated display.
[0448] Further examples of microstructure tooling and analysis techniques will now be described with reference to Figures 15A-15F.
[0449] In this example, a patch 1510 is provided that includes a substrate 1511 having several microstructures 512 thereon. It will be understood that the form and configuration of the microstructures is not important for purposes of this example, and various configurations may be used, as discussed above.
[0450] In this example, the substrate 1511 includes a substrate coil 1515 disposed on the substrate 1511, typically on the back surface. The coil is operatively coupled to one or more microstructure electrodes, which may be electrodes provided on the microstructure or the conductive microstructure itself. Typically, the substrate coil includes two ends, each end coupled to a different microstructure electrode as shown by the dotted lines, such that the substrate coil 1511 signal is applied between the microstructure electrodes. Excitation and receiving coils (not shown) are typically provided within the housing of the measurement device, such that the excitation and receiving coils are aligned and placed in close proximity to the substrate coil when a measurement is to be made, e.g., when the housing is attached to the substrate. This is done to inductively couple the excitation and receiving coils to the substrate coil, such that when an excitation signal is applied to the excitation and receiving coils by the signal generator, this induces a corresponding signal in the substrate coil 1515, which is then applied across the microstructure electrodes.
[0451] As shown, the microstructure electrode and the tissue and / or fluid surrounding the electrode act as a capacitor. As a result, the excitation and receiving coils and the substrate coil act as a tuned circuit, an example of the circuit configuration is shown in FIG. 15B. It includes a fixed inductance 1561 and a capacitance 1562 and a resistance 1563, which represent the inherent response of the excitation coil and substrate coil. The circuit also includes a variable capacitance and a variable resistance 1565, 1564, which represent the response of the microstructure electrode and the tissue or other material between the electrodes. It will therefore be appreciated that the frequency response and attenuation (Q) of the tuned circuit will vary depending on the values of the variable capacitance and resistance, which in turn depend on the environment in which the microstructure electrode resides.
[0452] In general, when a signal is applied to the excitation and receiving coils, the overall response will be a constant amplitude signal in the excitation and receiving coils as shown in FIG. 15C. When the drive signal is stopped, the circuit continues to resonate and the resulting signal decays over time as shown to the right of the dotted line. The rate and / or frequency of decay will depend on the values of the variable capacitance and resistance, resulting in different responses 1581, 1582 depending on the conditions within the subject, which may further allow information to be derived about the conditions within the subject. For example, this may be affected by binding of analyte to the microstructure electrodes, fluid levels, etc., so examining the change in decay rate and frequency can be used to derive information about the presence of analyte, fluid levels, etc.
[0453] However, because the attenuated signal is transient, in another example, the response of the circuit at different frequencies is analyzed and used to determine the resonant frequency and Q of the tuned circuit, which further indicate resistance and capacitance values. In this regard, changes in electrical conditions within the subject result in changes in the frequency response as shown in Figure 15D. For example, the response in the absence of analyte may be as shown by the solid line, while the presence of analyte may result in an increase or decrease in the resonant frequency and / or Q, as shown by the dotted line.
[0454] In one particular example, it is preferable to provide a control reference to allow for more accurate interpretation of the response. This example is shown in Figure 15E, where two patches 1510.1, 1510.2 are provided, each having a respective substrate 1511, microstructure 1512, and substrate coil 1515. In this example, patch 1510.2 is coated with a binding agent to attract the analyte, while patch 1510.1 is not coated and serves as a control.
[0455] In this case, each substrate coil is driven and the modification is measured, including the attenuation and / or frequency or phase change of the signal, which depends on the resonant frequency and the Q value. An example of a modified drive signal is shown in FIG. 15F, where signal 1571 represents the control obtained for patch 1510.2, and signals 1571.11, 1571.12 and 1571.21, 1571.22 respectively represent the different responses obtained for patch 1510.2. In this regard, signals 1571.11, 1571.21 represent the signal applied without analyte, emphasizing that different patches may have different tuning frequency responses, and signals 1571.12, 1571.22 show a change in frequency δ1, δ2, emphasizing that different responses may be measured, which may further be used to derive information regarding the level or concentration of an analyte near the microstructure of the second patch 1510.2.
[0456] Measurement of the change in frequency that occurs in response to different analyte levels or concentrations may be performed in the frequency domain by use of a return loss bridge circuit in the excitation coil. In this manner, absorption of the rf electromagnetic signal while being swept across various frequencies indicates a signal loss in decibels (dB) at the resonant frequency of the substrate coil. The frequency and depth of this absorption indicates the analyte level or concentration.
[0457] It will be appreciated that this technology allows measurements to be made regarding conditions within a subject, such as the presence, absence, level or concentration of an analyte, to be readily determined using a patch that does not include an electronically active sensing element. It will also be appreciated that by appropriately adapting the coating, it is possible to sense a variety of analytes, and that it can be adapted to make other suitable measurements.
[0458] Further exemplary details of the above mentioned equipment will now be described.
[0459] manufacturing Next, an example process for manufacturing a substrate containing microstructures will be described in more detail.
[0460] In a first example shown in Figures 17A-17P, the microstructures are fabricated from an insulating polymer that is applied to a substrate, and electrodes are patterned on the substrate through selective etching to act as electrical connections for the polymer microstructures. It will also be appreciated that conductive polymers can also be used, for example through appropriate doping of the insulating polymer.
[0461] In this example, the first step shown in Figures 17A-17G is to selectively pattern an electrode architecture on a flexible polyethylene terephthalate (PET) substrate 1701. An electrode design to define microstructures on the PET was patterned, in this case an indium tin oxide (ITO) 1702 layer was deposited on the flexible PET substrate and the electrode pattern was selectively etched from the ITO layer. The substrate was prepared (Figure 17A), after which a positive photoresist AZ1518 (MicroChemicals) was patterned on top of the ITO via photolithography (Figure 17B) and soft baked (Figure 17C). The photoresist was selectively exposed to UV light (Figure 17D) to define the electrode pattern, after which the photoresist was baked and developed using developer AZ726MIF (MicroChemicals) (Figure 17E), and the exposed ITO areas were wet acid etched (Figure 17F). The photoresist was removed to reveal the final etched ITO pattern that provides the conductive electrodes for the device (Figure 17G).
[0462] In the second step shown in Figures 17H-17P, 3D microstructures were fabricated on the ITO electrodes from photopolymer. The patterned PET substrate with ITO electrodes was treated with oxygen plasma (Figure 17H) to improve wetting and resist adhesion, and a seed adhesion layer 1704 of SU-8 3005 (MicroChemicals) was spin-coated onto the ITO-PET substrate (Figure 17I). After baking the seed SU-8 layer stack (Figure 17J), a SUEX SU-8 film resist 1705 (DJ MicroLaminates) was bonded to the substrate through thermal lamination (Figure 17K). After alignment through a mask aligner and exposure to UV (Figure 17L), the exposed SU-8 regions crosslinked to form an array of rectangular microstructures 1706 with vertical wall profile along the conductive ITO fingers 1702 (Figure 17M). The structure is baked with SU-8 1704 and SUEX 1705, then developed with PGMEA (propylene glycol monomethyl ether acetate) (Sigma Aldrich) and then hard baked (Figure 17N). A shadow mask 1708 is applied to the substrate 1701 and the microstructures 1706 are coated with gold 1707 through selective deposition (Figure 17O), after which the mask is removed (Figure 17P), leaving behind the selectively metallized microstructures that act as electrodes.
[0463] In this example, the microstructures have flat tips, however it will be appreciated that other UV lithography techniques such as grayscale lithography, backside diffraction lithography, and two-photon lithography can also be used to define tapered microstructures.
[0464] The resulting microstructure is shown in Figures 18A to 18D.
[0465] In a second example shown in Figures 19A-19L, a microstructure is produced by molding.
[0466] In this example, a 90 nm layer 1902 of nitride was deposited on a silicon wafer 1901 (Figure 19A). Next, AZ1505 (MicroChemicals) positive resist 1903 was spun at 4000 rpm (Figure 19B). Using a mask writer 1904, a rectangular pattern was directly written that defines the blade outline (Figure 19C). The written pattern was developed using AZ726MIF (MicroChemicals) for 30 seconds (Figure 19D). The nitride layer 1902 was removed using reactive ion etching (Figure 19F), after which the photoresist 1913 was removed (Figure 19E). The silicon wafer was then etched along its crystallographic axis by holding the wafer vertically in a potassium hydroxide bath at 80°C for 40 minutes (Figure 19G). Etching stops at axis 111 to define the desired sharp tip, which will act as a mold for the device to be further fabricated.
[0467] Omni-coat is used as a lift-off resist and is coated onto the wafer to a thickness of approximately 20 nm using a spin recipe at 3000 RPM for 1 minute, then baked at 200°C for 1 minute. Following this, a 5 micron layer 1905 of SU8 3005 is spun onto the wafer at 3000 RPM, then baked at 65°C for 1 minute, then 95°C for 20 seconds, then again at 65°C for 1 minute (Figure 19H). The thinner formulation of SU8 3005 will allow it to flow more easily into the sharp triangular gaps etched into the silicon wafer mold. A layer 2016 of SU8 1900 is then spun onto this layer to a thickness of 200 microns using a spin recipe at 2000 RPM for 60 seconds (Figure 19I). Following this, the wafer was baked at 65°C for 5 minutes, then 95°C for 35 minutes, then again at 65°C for 5 minutes. This layer of SU8 1900 is believed to allow for sharp tips to stand on a solid layer.
[0468] Finally, the wafer was subjected to 15mW / cm 2The wafer is flood exposed for 40 seconds using an ultraviolet light source 1907 delivering a power of 1000 nm (FIG. 19J). The structure is released by soaking the wafer in AZ726 developer overnight (FIG. 19K) and exposing the wafer to a heat shock of 120° C. for 15 seconds. The structure is removed from the inverted mold and dried using nitrogen gas (FIG. 19L).
[0469] The resulting microstructures are shown in 20A and 20B.
[0470] Figures 21A and 21B show silicon blades fabricated by etching. Figure 21A shows a blade coated with a nearly 1 micron thick layer of SU8 3005 diluted 3:2 using SU8 thinner and spun at 5000 RPM for 40 seconds. Figure 21B shows a blade whose base has been selectively coated with a polymer coating. The tip of the blade is bare and only this area is usable for sensing purposes. This selective coating is achieved by pressing and removing the coated blade of Figure 21A against a thin layer of aluminum foil which mechanically removes the resist from the tip of the blade. This allows the blade to be partially covered with an insulating coating so that only the tip portion acts as an electrode, thereby allowing measurements to be made in the epidermis and / or dermis as described above with respect to Figures 5L and 5M.
[0471] water retention An example of the use of microstructures in measuring water retention will now be described.
[0472] In this regard, research suggests that there is a strong correlation between level of performance and dehydration measured as a %Δ of body weight, with significant dehydration occurring when body weight loss exceeds 2%. Evidence suggests that dehydration adversely affects high intensity muscular endurance, strength and power. Furthermore, there is a relationship between reduced strength and power and the likelihood of injury, suggesting that being able to accurately measure hydration could be beneficial for athletes, especially in high-risk sports.
[0473] Experiments were performed to measure water retention in porcine skin using a microstructure impedance-based approach. In this example, the tissue was measured at a nominal "fresh" water retention point and then dehydrated by application to a warming plate at a set point of 38°C. The volume of the tissue block was measured by the displacement method at the beginning and end of the experiment. It was assumed that all mass changes were due to evaporative water loss from the excised tissue.
[0474] Time series data for impedance measured at 200 Hz is shown in Figure 22A, where the secondary axis represents the contemporaneous estimate of water content derived from the measured mass and volume measurements. The inverse correlation between impedance and water content is as expected, with the primary rate of water loss being reflected in the change in measured impedance.
[0475] This indicates that the microstructure patch can be well engaged and measure the water loss of the sample with a sufficient level of accuracy. Therefore, this architecture is a solid foundation for the development of electrically interfaced microstructure patches as demonstrated in water retention sensing.
[0476] Human water loss and hydration experiments were performed to investigate the ability of the above described equipment to assess body water loss (and gain) through interstitial fluid probing in the living epidermal layer of the human anterior forearm. A 4x4mm gold coated patch was applied and multi-frequency impedance measurements were performed using a bench instrument (Keysight E4990A). The 4x4mm device was electrically divided into two 2x4mm regions with 15 blade microstructure electrodes of 150μm depth and 260μm width, which are expected to penetrate to a depth of 80μm into human tissue in in vivo experiments.
[0477] Dehydration was controlled over a three-hour period, and a reference or "ground truth" measurement of plasma water loss was obtained by serial hematocrit (Hct) measurements. Normal red blood cell mass comprises approximately 43% of plasma volume at normal hydration levels in adult males. Thus, an increase in Hct in the absence of blood loss is due to water loss.
[0478] 22B is a graph showing the results of impedance (Z) and hematocrit (Hct) measured versus time as total body water loss approaches 1.7%. The impedance trend tracks dehydration as measured by Hct and tracks recovery, with response times in minutes.
[0479] Recordings of viable epidermal Hct and impedance over time show good correlation with dehydration. At rehydration points, measurements also track restoration of total body water levels. Body weight and urine analysis were used to quantify total body water loss and gain over the study period.
[0480] Notably, the electrical correlation was detectable with less than 1.7% total body water loss, a level below the threshold for detection of dehydration by a trained clinician that would traditionally require blood sampling and measurement of plasma osmolality by laboratory assay. Restoration of body water was rapid, and the sensor was able to detect this change in ISF in less than 15 minutes.
[0481] The range of two-electrode measurements and impedance changes seen with bench instruments is easily miniaturized into a wearable device, and the minimally invasive nature of the sensor resulted in only very mild local erythema following removal of the device.
[0482] It is also noteworthy that total body water loss induces physiological responses that can be classified according to the resulting plasma osmolality. For example, water loss due to sweat and oral fluid restriction results in primarily hypertonic hypovolemia, i.e. disproportionately high salt (Na + , Cl - , K +) concentrations result in a decrease in plasma volume. In contrast, fluid loss induced by diuretics, vomiting, cold, and altitude induces isotonic or hypotonic hypovolemia. The disproportionate loss of salt relative to water reduces plasma osmolality. The conductivity of interstitial fluid (ISF) is closely related to the concentration of conductive ions, and therefore these different modes of fluid retention can be distinguished based on impedance changes.
[0483] An example of this is shown in Figure 22C, which shows the change in impedance as a result of exercise-induced water loss, which elicits a hypertonic response thereby increasing conductivity (decreasing impedance), in contrast to the results of diuretic-induced hypovolemia in Figure 22B, which shows an increase in impedance consistent with a disproportionate loss of ions relative to the water excreted by the kidney.
[0484] It will therefore be appreciated that not only may a change in impedance indicate a change in hydration, but further monitoring the direction of the impedance change can be used to indicate the nature of the fluid loss, particularly whether it is hypertonic or isotonic, with the magnitude of any change reflecting the amount of fluid lost. Similarly, if hydration levels are maintained or approximately constant, then a change in impedance will indicate a change in ion concentration.
[0485] Theranostics In one example, the above-described device can be used to deliver a therapeutic agent to a subject, as outlined above, In one preferred example, delivery of the therapeutic agent is achieved by selectively releasing the therapeutic agent into the skin from one or more microstructures.
[0486] In one preferred example, the system is designed to provide controlled release of a therapeutic into the skin in response to a stimulus, such as an electrical stimulus, although other stimuli may be used as discussed above. In any event, this allows the system to operate as a "closed loop" theranostic, where detection of a biochemical parameter / diagnostic biomarker initiates and dictates the rate of therapeutic release.
[0487] To achieve this, an electrically responsive material is required that can encapsulate the drug, swell upon hydration (i.e., when inserted into the dermal interstitial fluid environment), and deswell upon application of a positive bias, thereby actively releasing the therapeutic molecules from the hydrogel "lattice" down a concentration gradient into the aqueous environment. A number of hydrogel compounds have been described for tunable electrically responsive drug delivery, such as xanthan gum and sodium alginate. Methylcellulose and sucrose have also been used for bulk delivery of therapeutics into the skin when coated into microstructures.
[0488] Therefore, hydrogel formulations containing xanthan gum and methylcellulose / sucrose were evaluated to confirm their ability to direct the delivery of the surrogate drug methylene blue (300 Da) from 2D gold-coated electrodes (area 1 × 1 cm) into solution. Methylene blue is an ionic blue dye that absorbs light at a wavelength of 665 nm and can therefore be detected and quantified by UV-visible spectroscopy. It can be used therapeutically to treat rare blood disorders at clinical doses in the range of 1 mg / kg (1%).
[0489] For the in vitro experiments, the following steps were performed: A plate electrode was prepared using polyamide insulating tape such that an area of 1 × 1 cm was exposed. The electrodes were cleaned by sonication for 5 min in acetone and then isopropanol, and then dried using N2. · 2% xanthan gum was prepared by mixing in deionized water, to which 0.8 mg / mL methylene blue was added and the formulation was magnetically stirred overnight. · The electrodes were treated with 200uL of 0.01% w / v poly-l-lysine for 30min at RT, which was then removed and the electrodes were dried with N2. The electrodes were dipped into the formulation multiple times to cover an area of 1 × 1 cm with a film thickness of 1–2 mm and then dried in a desiccator under vacuum overnight. · The experimental setup consisted of a plastic tube containing 5 mL of phosphate-buffered saline (PBS) into which a dip-coated working electrode was inserted along with a Ag / AgCl reference electrode. During the period, the tubes were replaced with new ones every 2 to 5 minutes, and the concentration of methylene blue released into the solution was confirmed by reading the absorbance at 665 nm. The cumulative release over time (ng) and release rate (ng / hr) were calculated.
[0490] The first experiment tested the application of a negative bias to prevent passive release of a surrogate drug (methylene blue).
[0491] The literature suggests that passive release of encapsulated drugs occurs during the hydrogel swelling phase, and that this can be prevented by application of a negative voltage. Figure 23A shows that application of -0.6 V upon immersion in PBS reduces this passive release to zero within 15-20 minutes. The data compilation shown in Figure 23B illustrates this effect in five experiments (no voltage) and two experiments (-0.6 V, -3.5 V). Both voltages tested were effective in preventing passive release of the surrogate drug over time, although -3.5 V was found to detach the hydrogel from the electrode. This was mitigated by 1) reducing the magnitude of the voltage, and 2) pre-coating the electrode with 0.01% poly-l-lysine to anchor the hydrogel to the electrode.
[0492] The second experiment examined tunable pulsed release of a surrogate drug by alternating polarity.
[0493] In this example, two experiments were performed using a plate electrode coated with methylene blue encapsulated in xanthan gum. Application of a negative voltage (-0.6V) reduced the passive release during hydrogel swelling to zero within 20 minutes. Application of +0.6V resulted in an increase in the release rate as shown in Figures 24A and 24C, and a corresponding increase in cumulative release in Figures 24B and 24D. A return to -0.6V dramatically reduced the release rate back to zero. A second pulse of +0.6V increased the rate again (although not as much as the first pulse). This data demonstrates electrically tunable release of methylene blue from a xanthan gum hydrogel coated on an electrode.
[0494] A second experiment tested the suitability of methylcellulose / sucrose for bulk delivery of therapeutics, and the results are shown in FIG.
[0495] The methylcellulose / sucrose formulation was tested for its ability to release methylene blue. Within the first 10 minutes of immersion in PBS, there was a rapid release of the dye. This decreased to zero by 15 minutes (probably due to the ionic nature of methylene blue rather than the controllable properties of hydrogel swelling as seen with xanthan gum). No pulsed release was observed, and no change in either rate or amount released occurred after 20 minutes, suggesting that the coating was dissolving from the electrode at a constant rate. This indicates that this formulation is suitable for bulk delivery of therapeutics that do not require controlled delivery.
[0496] After this, xanthan gum was selected for ex vivo pig skin experiments, which were carried out using the following steps: · Gold-coated microstructure patches were fabricated and connected to electrical connections. The patches were washed with acetone, then isopropanol, and dried with N2. · Patches were treated with 20uL of 0.01% w / v poly-l-lysine for 30 minutes, removed and dried under N2. The patches were dip-coated in 2% w / v xanthan gum and 0.8 mg / mL methylene blue and dried upside down in a desiccator under vacuum overnight. Pig skin was obtained and stored at -20°C until use. The hair was clipped, shaved, and the ears were removed. A silver / silver chloride reference electrode was inserted just below the surface of the skin. The patch (either unconnected, uncontrolled, or a wired patch connected to a DC power source) was applied to the skin with a force of 40 N for 10 seconds. · Inverted forceps / metal pegs insulated with polyacrylamide tape were used to keep the patch in place throughout the experiment. The skin was kept hydrated by applying paper towels soaked in Krebs Heinseleit perfusate between experiments and by adding two drops of perfusate onto each patch at the start of each experiment to aid in swelling of the ex vivo tissue. The monitoring period was 60 minutes in total during which -0.6V or +0.6V was applied, or ...
Claims
1. 1. A system for performing fluid level measurements on a living subject, comprising: a) a wearable patch having a substrate including a plurality of microstructures configured to penetrate a stratum corneum of the subject, the microstructures being arranged in groups, each microstructure in a group including a corresponding electrode; b) a signal generator operatively connected to at least some of the microstructures in each group to apply an electrical stimulation signal between at least some of the microstructures in each group; c) at least one sensor operatively connected to at least some of the microstructures in each group to measure electrical response signals between the microstructures in each group; d) i) identifying said response signal, which is indicative, at least in part, of a measured bioimpedance; ii) performing an analysis using, at least in part, the measured response signal to identify at least one indicator at least in part indicative of a fluid level in the subject; a plurality of electronic processing devices; A system including:
2. The groups of microstructures each include a) a spaced apart plate microstructure having opposing substantially planar electrodes; b) spaced apart substantially parallel plate microstructures; The system of claim 1 , comprising at least one of:
3. a) the spacing between the microstructures within each group is i) less than 0.25 mm; ii) Approximately 0.1mm, iii) more than 10 μm, At least one of b) the spacing between the groups of microstructures is i) less than 1 mm; ii) about 0.5 mm; iii) more than 0.2mm, At least one of 3. An electrode arrangement according to claim 1 or 2.
4. some of the microstructures are plate microstructures, the plate microstructures being at least partially tapered and having a substantially rounded rectangular cross-sectional shape; A system according to any one of claims 1 to 3.
5. At least some of the microstructures are a) i) 1) less than 300 μm, 2) Approximately 150 μm, 3) greater than 100 μm; and 4) More than 50 μm, At least one length of ii) 1) of a similar magnitude to the length; 2) greater than the length; 3) Approximately the same length as the above; 4) Less than 300 μm; 5) about 150 μm, and 6) More than 50 μm, A maximum width that is at least one of iii) 1) smaller than the width; 2) significantly smaller than said width; 3) a size smaller than said length; 4) less than 50 μm; 5) about 25 μm, and 6) More than 10μm At least one of the thicknesses having at least one of b) i) 1) less than 50% of the length of the microstructure; 2) at least 10% of the length of the microstructure; and 3) a length that is approximately 30% of the length of the microstructure; and ii) 1) at least 0.1 μm; 2) less than 5 μm; and 3) Approximately 1μm and having at least one of the sharpnesses of and having a tip that is at least one of c) i) a shoulder configured to abut the stratum corneum to control the depth of penetration; and ii) a shaft extending from a shoulder to a tip, the shaft being configured to control a position of the tip within the object; and d) i) 5000 / cm 2 less than, ii) 100 / cm 2 Ultra, and iii) About 600 / cm 2 At least one density of At least one of A system according to any one of claims 1 to 4.
6. 6. The system of claim 1, wherein: a) the substrate comprises electrical connections that enable an electrical signal to be applied to and / or received from each of the microstructures; and b) the system comprises one or more switches for selectively connecting at least one of at least one sensor and at least one signal generator to at least one or more of the microstructures, the one or more electronic processing devices being configured to control the switches and the signal generator to enable at least one measurement to be taken.
7. The system comprises: a) a substrate coil disposed on the substrate and operatively coupled to one or more microstructure electrodes; b) excitation and receiving coils positioned adjacent to the substrate coil such that a change in an applied drive signal acts as a response signal; The system according to any one of claims 1 to 6, comprising:
8. The system of any one of claims 1 to 7, wherein the electrode comprises a coating on a surface of the microstructure.
9. The microstructure comprises: a) a portion of the surface of the microstructure; b) a proximal end of the microstructure; c) at least half the length of the microstructure; d) about 90 μm of the proximal end of the microstructure; and e) at least a part of the tip portion of the microstructure, an insulating layer extending across at least one of the A system according to any one of claims 1 to 8.
10. The at least one electrode is a) i) 200,000μm 2 less than, ii) About 22,500 μm 2 , iii) at least 2,000 μm 2 , having a surface area that is at least one of b) extending the length of the distal portion of the microstructure; c) extending the length of a portion of the microstructure spaced from the tip; d) disposed proximate the distal end of the microstructure; e) positioned adjacent to the tip of the microstructure; f) extending over at least 25% of the length of the microstructure; g) extending over less than 50% of the length of the microstructure; h) extending across about 60 μm of said microstructure; and i) configured to be placed, in use, within the living epidermis of the subject; The system according to any one of claims 1 to 9, wherein the system is at least one of the following:
11. At least some of the microstructures are coated with a coating, the coating comprising: a) i) To increase hydrophilicity, ii) to increase hydrophobicity, and iii) To minimize biofouling modifying the surface properties due to at least one of b) attracting at least one substance to said microstructure; c) repelling at least one substance from said microstructure; d) acting as a barrier to exclude at least one substance from said microstructure; and e) i) polyethylene, ii) polyethylene glycol, iii) polyethylene oxide, iv) zwitterions, v) peptides, vi) a hydrogel, and vii) Self-assembled monolayer At least one of The system according to any one of claims 1 to 10, characterized in that it is at least one of the following:
12. The system of any one of claims 1 to 11, wherein the system comprises a housing containing the at least one sensor, the at least one signal generator, and at least one electronic processing device.
13. The system of any one of claims 1 to 12, wherein the system is configured to perform repeated measurements over a period of time, the microstructure being configured to remain within the subject during said period.
14. The system comprises: a) object data derived from the measured response signals; and b) Measured response signal A system according to any one of claims 1 to 13, comprising a transmitter for transmitting at least one of the following:
15. The system comprises: a) performing said measurements; and b) i) providing an output indicative of said indicator; and ii) Providing recommendations based on said metrics. a monitor device configured to perform at least one of The system according to any one of claims 1 to 14, comprising:
16. The monitor device includes: a) causing a measurement to be taken; b) at least partially analyzing the measurements; c) controlling a stimulus applied to at least one of said microstructures; d) generating an output; e) providing an output indicative of a good faith indicator; f) providing recommendations based on said metrics; and g) causing an action to be taken; The system of claim 15 , configured to perform at least one of the following:
17. The system comprises: a) a wearable monitor device for performing said measurements; and b) i) receiving target data derived from said measured response signals; ii) analyzing the subject data to generate at least one index at least partially indicative of a health status associated with the subject; Processing System The system according to any one of claims 1 to 16, comprising:
18. The system comprises: a) interstitial fluid levels; b) changes in interstitial fluid levels; c) ion concentrations in interstitial fluid; d) changes in ion concentrations in interstitial fluid; e) ion concentration; f) changes in ion concentration; g) total body water, h) intracellular fluid levels; i) extracellular fluid levels; j) plasma hydration level; k) fluid volume; l) maintaining hydration in said subject; and m) Water retention level 18. The system of claim 1 , configured to perform impedance measurements within the living epidermis to determine an indication of at least one of:
19. 1. A method for performing a fluid level measurement on a living subject, the method comprising: a) penetrating a stratum corneum of the biological subject with at least one substrate comprising a plurality of microstructures, the microstructures being arranged in groups, each of the microstructures in the group including a corresponding electrode; b) applying an electrical stimulation signal between at least some of the microstructures in each of said groups using a signal generator operatively connected to at least some of the microstructures in each of said groups; c) measuring electrical response signals between at least some of the microstructures in each of said groups with at least one sensor operatively connected to at least some of the microstructures in each of said groups; d) using one or more electrical processing devices i) identifying a measured response signal at least in part indicative of bioimpedance; ii) performing an analysis at least in part using the measured response signal to identify at least one indicator at least in part indicative of a fluid level within the living subject. Steps and The method includes: