Compositions and methods for diagnosis and treatment of lymphatic system disorders

Abstract

To provide a method for diagnosing a lymphatic anomaly in a human patient.SOLUTION: The present invention provides a method comprising a) obtaining a biological sample comprising nucleic acid from the patient; b) assaying the nucleic acid to determine whether i) a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present or ii) an SNV in linkage disequilibrium with an SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present; and c) diagnosing the patient with a lymphatic anomaly if an SNV of i) or ii) is present.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 382,147, filed Aug. 31, 2016, the entire contents of which are incorporated herein by reference.

[0002] FIELD OF THEINVENTION The present invention relates to the fields of lymphatic genetics, personalized medicine, and malformations. More specifically, the present invention provides novel genetic targets and therapeutic treatment regimens for ameliorating symptoms associated with Lymphangiomatosis and other generalized lymphatic anomalies (GLA). [Background technology]

[0003] 2. Background of the Invention Several publications and patent documents are cited throughout this specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as if fully set forth.

[0004] The lymphatic system plays a vital role in maintaining fluid circulation, protecting the body from disease, and absorbing fats in the small intestine (1). Complex lymphatic disorders are characterized by abnormal formation of lymphatic vessels and abnormal proliferation of tissue. Patients often present with overlapping symptoms that can cause severe lung disease (2, 3). Examples of lymphatic disorders include lymphangiomatosis (GLA), lymphangiectasia, and chylous effusions (pericardial, pleural, or peritoneal). Due to significant challenges in diagnosis, the study of complex lymphatic disorders has been hampered by inconsistencies in classification and nomenclature (3-6). Although the molecular genetic pathogenesis of complex lymphatic disorders is poorly understood, congenital malformations of the lymphatic system appear to be linked to underlying genetic etiologies (7-9). Indeed, both germline and somatic mutations have been identified in genes that converge on the PI3K / mTOR and Ras / MAPK pathways (1, 8).

[0005] Disruption or abnormalities in the PI3K / mTOR and Ras / MAPK signaling pathways have been shown to impair normal expansion and remodeling during the establishment of mature lymphatic networks, and such disruptions are associated with lymphatic diseases. Gain-of-function mutations in AKT1 and PIK3CA, leading to increased activity of the mammalian target of rapamycin complex 1 (mTORC1), have been identified in patients with lymphatic malformations that are part of syndromes such as Proteus syndrome (OMIM 176920), CLOVES syndrome (OMIM 612918), and Klippel-Trenaunay-Weber syndrome (OMIM 149000) (9-11). Mutations in KRAS, HRAS, RAF1, PTPN11, SOS1, and RASA1 result in dysregulation of RAS pathway activity, causing lymphedema or lymphangiectasia in Noonan syndrome (OMIM 163950), Costello syndrome (OMIM 218040), cardio-facial-cutaneous syndrome (OMIM 115150), and capillary malformation-arteriovenous malformation (CM-AVM) syndrome (OMIM 608354) (12-17).

[0006] Despite this understanding, there is a lack of genetic biomarkers for use in identifying patients with lymphatic diseases and abnormalities, such as lymphangiomatosis / lymphangiectasia (LAM), lymphangiomatosis graftis (GLA), and chylous effusions, as well as therapeutic agents that target the genetic markers associated with these diseases. Summary of the Invention

[0007] Summary of the Invention Six members of a three-generation family were affected by lymphatic abnormalities, including GLA, and significant venous congestion, so family members were analyzed using exome sequencing (ES) to search for novel germline mutations. A heterozygous germline mutation in EPHB4 was identified. EPHB4 knockdown studies in zebrafish confirmed that EPHB4 plays a role in lymphatic development and branching, a process that includes mTOR signaling.

[0008] A cohort of 13 families diagnosed with GLA or lymphangiectasia, all of which had at least one family member with chylous effusion, were sequenced. Homozygous variants in PIK3R6, encoding a regulatory subunit of the PI3K complex, heterozygous mutations in MTOR, heterozygous mutations in PIK3R4, and recurrent novel gain-of-function mutations in ARAF, involved in the Ras / MAPK pathway and an interactor of the mTOR pathway, were identified.

[0009] Therefore, in one embodiment of the present invention, a method for diagnosing lymphatic abnormality in human patient is provided.An exemplary method includes: obtaining a biological sample comprising nucleic acid from patient; i) determining whether there is a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR and ARAF, or ii) determining whether there is an SNV in linkage disequilibrium with the SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR and ARAF; and diagnosing the patient as lymphatic abnormality if there is an SNV of i) or ii). In another aspect, a method for diagnosing a lymphatic abnormality in a human patient involves obtaining genotype sequence information from the human patient, assaying the nucleic acid to determine whether i) a single nucleotide variant (SNV) is present in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or ii) an SNV that is in linkage disequilibrium with the SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF is present; and diagnosing the patient with a lymphatic abnormality if the SNV of i) or ii) is present.

[0010] The present invention also provides a method for treating lymphatic abnormality in a human patient. An exemplary method includes obtaining a biological sample comprising nucleic acid from a patient; assaying the nucleic acid to determine whether i) there is a single nucleotide variant (SANV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or ii) there is an SNV in linkage disequilibrium with the SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF; and administering to the patient identified as having one or more SNVs in i) or ii) one or more agents suitable for treating said lymphatic abnormality, thereby treating the lymphatic abnormality. In an alternative embodiment of this method, genotype information is obtained from a patient and assayed to determine whether i) there is a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or ii) there is an SNV in linkage disequilibrium with the SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF; and administer one or more agents suitable for treating said lymphatic abnormality to the patient identified as having one or more SNVs in i) or ii), thereby treating the lymphatic abnormality.In an alternative embodiment of this method, genotype information is obtained from a patient.

[0011] In certain embodiments, the lymphatic abnormality is characterized by abnormal formation of lymphatic vessels and / or abnormal proliferation of tissue. In other embodiments, the lymphatic abnormality is lymphangiomatosis (LAM). In another embodiment, the lymphatic abnormality is lymphangiomatosis (GLA). The lymphatic abnormality can be characterized by chylous effusion, including pericardial effusion, pleural effusion, or peritoneal effusion.

[0012] The diagnostic method may further include generating a report identifying the SNVs after detection in the biological sample. The therapeutic method may further include generating a report discerning a proposed treatment(s) for the lymphatic abnormality based on the SNVs identified in the method.

[0013] In yet another embodiment, the diagnostic methods described herein may further comprise administering to the diagnosed patient an effective amount of one or more agents suitable for treating said lymphatic abnormality.

[0014] In certain embodiments of the method of treatment, the agent administered to the patient carrying one or more lymphoid abnormality-associated SNVs is selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and any one or more combinations of said inhibitors. In other embodiments, the agent or said inhibitor is listed in Tables 1 and 2. In some embodiments, when the agent is an mTor inhibitor, rapamycin and / or BEZ-235 (dactolisib) are administered. In certain embodiments, the one or more mTOR inhibitors, one or more PIK3K inhibitors, and / or one or more MEK / ERK inhibitors have an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0015] In another embodiment of the present invention, the agent that inhibits mTOR signal transduction also has additional biological activity. These include, but are not limited to, inhibition of PI3K, inhibition of FK506 binding protein, inhibition of DNA-PK, inhibition of p110, or inhibition of p70S6K. In some embodiments, the patient has one, two, three, four, or five SNVs in each of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF. In some embodiments, the patient does not have an SNV in EPHB4. In some embodiments, the patient does not have an SNV in PIK3R4. In some embodiments, the patient does not have an SNV in PIK3R6. In some embodiments, the patient does not have an SNV in mTOR. In some embodiments, the patient does not have an SNV in ARAF.

[0016] In some embodiments, the agents listed in Tables 1 and 2 are used in combination. These combinations include, but are not limited to, a) ridaforolimus and trametinib; b) ridaforolimus and selumetinib or cobimetinib; c) BEZ235 and selumetinib; d) omipalisib and selumetinib or trametinib; e) everolimus (E verolimus and trametinib or selumetinib; f) sirolimus, ridaforolimus and selumetinib; g) sirolimus, ridaforolimus and trametinib; h) torkinib and trametinib; i) BEZ235, torkinib and trametinib; and j) sirolimus and gedatolisib and trametinib. In other embodiments, the treatment further comprises administering systemic chemotherapy, interferon alpha, radiation therapy, and / or surgery.

[0017] In some embodiments, the SNV is selected from c.2334+1G>C in EPHB4; c.3481A>G:p.S1161G in PIK3R4; c.1393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; and c.640T>C:p.S214P in ARAF.

[0018] In some embodiments, the diagnostic method comprises detecting c.2334+1G>C in EPHB4. In some embodiments, the diagnostic method further comprises treating said patient with one or more agents selected from one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors. In other embodiments, the agent is selected from Table 1-2, thereby improving one or more of lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

[0019] In some embodiments, the diagnostic method comprises detecting c2334+1G>C in EPHB4 and administering at least one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, the agent is selected from Table 1-2, thereby improving one or more of lymphatic vasculature, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

[0020] In some embodiments, the diagnostic method comprises detecting c.3481A>G:p.S1161G in PIK3R4. In some embodiments, the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, the agent is selected from Table 1-2, thereby improving one or more of lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

[0021] In some embodiments, the diagnostic method comprises detecting c.3481A>G:p.S1161G in PIK3R4 and administering one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, at least one agent for administration is selected from Table 1-2, thereby improving one or more of lymphatic vasculature, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

[0022] In some embodiments, the diagnostic method comprises detecting c.1393-7C>T in PIK3R6. In some embodiments, the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, an agent from Table 1-2 is selected to improve one or more of lymphatic structures, reduce chylous pleural effusion, improve respiratory function, allow tapering of concomitant medications, or prolong survival.

[0023] In some embodiments, the diagnostic method includes detecting c.1393-7C>T in PIK3R6 and administering one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In some embodiments, at least one agent from Table 1-2 is administered to improve one or more of lymphatic vasculature, reduce chylous pleural effusion, improve respiratory function, allow tapering of concomitant medications, or prolong survival.

[0024] In some embodiments, the diagnostic method comprises detecting c.6818A>G:p.P2273L in mTOR. In some embodiments, the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, an agent from Table 1-2 is administered to improve one or more of lymphatic structures, reduce chylous pleural effusion, improve respiratory function, allow tapering of concomitant medications, or prolong survival.

[0025] In some embodiments, the diagnostic method comprises detecting c.6818A>G:p.P2273L in mTOR and administering an mTor inhibitor, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, at least one agent from Table 1-2 is administered to improve one or more of lymphatic vasculature, reduce chylous pleural effusion, improve respiratory function, allow tapering of concomitant medications, or prolong survival.

[0026] In some embodiments, the diagnostic method comprises detecting c.640T>C:p.S214P in ARAF. In some embodiments, the diagnostic method further comprises treating said patient with one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination. In some embodiments, an agent from Table 1-2 is administered to improve one or more of lymphatic structures, reduce chylous pleural effusion, improve respiratory function, allow tapering of concomitant medications, or prolong survival.

[0027] In some embodiments, the diagnostic method comprises detecting c.640T>C:p.S214P in ARAF and administering one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination.In some embodiments, at least one agent from Table 1-2 is administered, thereby improving one or more of lymphatic vasculature, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medication, or prolonging survival.In subjects with SNV in ARAF, the agent is an ERK / MEK inhibitor. ERK / MEK inhibitors suitable for treatment include, but are not limited to, Selumetinib (AZD6244), PD0325901, Trametinib (GSK1120212), PD184352 (CI-1040), Pimasertib (AS-703026), TAK-733, AZD8330, Binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, Refametinib (RDEA119, Bay 86-9766), and Cobimetinib (GDC-0973, RG7420).

[0028] In some embodiments, assaying the nucleic acid to determine whether a single nucleotide variant (SNV) is present in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF further comprises analyzing the polynucleotide sample to determine the presence of the SNV by performing a process selected from the group consisting of detection of specific hybridization, measurement of allele size, restriction fragment length polymorphism analysis, allele-specific hybridization analysis, single nucleotide primer extension reaction, and sequencing of the amplified polynucleotide.

[0029] In some embodiments, the biological sample comprises DNA.

[0030] In some embodiments, the biological sample comprises RNA.

[0031] In some embodiments, the nucleic acid comprising the SNV(s) is obtained from an isolated cell of a human patient.

[0032] In some embodiments, the isolated vector encodes a nucleic acid having an SNV, wherein the SNV is selected from c.2334+1G>C in EPHB4; c.3481A>G in PIK3R4: p.S1161G; c.1393-7C>T in PIK3R6; c.6818A>G in mTOR: p.P2273L; and c.640T>C in ARAF: p.S214P.

[0033] In some embodiments, the host cell comprises an isolated vector encoding a nucleic acid having an SNV. In some embodiments, a transgenic animal comprises the host cell. In some embodiments, the transgenic animal is a mouse or a zebrafish.

[0034] In some embodiments, the method of screening the effect of an agent comprises contacting a host cell or a transgenic animal with one or more mTor inhibitors, one or more PI3K inhibitors, and one or more MEK / ERK inhibitors, alone or in combination, or with an agent from Table 1-2. In some embodiments, the effect of the agent screened is caudal rescue or branching rescue in zebrafish. In some embodiments, the effect of the agent screened is phosphorylation of mTOR.

[0035] In some embodiments, a method for identifying an agent that alters cell signaling comprises providing a cell expressing at least one nucleic acid comprising at least one SNV as described above, providing a cell expressing a cognate wild-type sequence lacking the SNV; contacting both cell populations with a test agent; and analyzing whether the agent alters cell signaling in cells harboring the nucleic acid comprising the SNV compared to cells lacking the SNV. [Brief description of the drawings]

[0036] [Figure 1] Pedigree of Family-1 and co-segregation pattern of EPHB4 mutations. Open circles indicate unaffected females, open boxes indicate unaffected males; solid shapes indicate affected subjects. EPHB4 genotype is shown below the symbol for each subject for whom DNA was available for testing. [Diagram 2] Schematic diagram of the role of EPHB4 in vascular development. [Figure 3A-3B] EPHB4 mutations lead to inactive EPHB4 kinase. In FIG. 3A, 293T cells were transiently transfected with wild-type EPHB4 alone, mutant EPHB4 alone, or a mixture of wild-type and mutant at the indicated ratios. Lysates were resolved by SDS-PAGE and blotted for phosphotyrosine (pTyr, top) or EPHB4 (bottom). In FIG. 3B, A375 cells were transfected with wild-type EPHB4, mutant EPHB4, or left untransfected. As a control, cells were stimulated with either plate-bound ephrinB2 Fc or human IgG1. Cells were lysed and transfected proteins were immunoprecipitated. Immunoprecipitates were blotted for phosphotyrosine (top) or EPHB4 (middle). To demonstrate equal expression, whole-cell lysates were blotted for EPHB4 (bottom). [Figure 4]Gel showing cDNA knockdown of EPHB4 in zebrafish using exon 13 morpholino at different loading concentrations at 2 dpf (days post-fertilization). Exon 13 has 216 base pairs. C=control (no morpholino). [Figure 5A-5D] Ephb4a knockdown induces mTOR signaling-dependent expansion of the caudal vascular plexus and misguided vessels in the intersegmental vasculature. Morpholino-mediated knockdown of ephb4a (Figure 5B) induces expansion and fusion of the caudal vasculature at 2.5 dpf compared to controls (Figure 5A) (arrowheads). Figure 5C shows that at 4 dpf, the zebrafish vasculature consists of intersegmental vessels (arrows) projecting dorsoventrally as well as thinner lymphatic vessels (arrowheads). The lymphatic parachordal line runs horizontally along the trunk (arrowheads pointing downwards), while intersegmental lymphatic vessels project downwards (arrowheads pointing upwards). Figure 5D shows that ephb4a knockdown induces misguided vessels resembling blood vessels (arrows) and lymphatic vessels (arrowheads). (Figures 5C and 5D are merged from two adjacent confocal scans). [Fig. 5E-5H] Figure 5E shows that caudal plexus defects were detected in 52% of ephb4a morpholino-injected larvae at 2.5 dpf, with mis-branching vasculature present in 46% at day 4. Rapamycin can significantly reduce the number of animals with defects at 2.5 dpf (Figure 5F) and 4 dpf (Figure 5G). Figure 5H shows that BEZ-235 similarly rescues the branching defects at day 4. [Figures 6A-6D]Pik3r6 knockdown induces mTOR signaling-dependent misbranching of intersomitic vessels. Figures 6A (control) and 6B (pik3r6 morpholino) show that morpholino-mediated knockdown of pik3r6 induces vascular misbranching resembling blood vessels (arrows) and lymphatic vessels (arrowheads) (panels are merged from two adjacent confocal scans). Trunk vascular defects can be induced by morpholinos targeting exon 4 (Figure 6C) and exon 13 (Figure 6D). [Figure 6E-6F] Both rapamycin (FIG. 6E) and BEZ-235 (FIG. 6F) significantly reduced the number of larvae with vascular defects. [Figure 7A-7D] Morpholino-mediated pik3r4 knockdown induces misdirected intersomitic vessels. Control-injected larvae exhibit normal vascular structures at 4 dpf (Figure 7A), whereas pik3r4 knockdown induces misbranching in vessels resembling blood vessels (arrowheads) or lymphatic vessels (arrows) (Figure 7B-7C). Figure 7D shows that defects were detected in only 5% of control-injected larvae but in 16% of pik3r4 morpholino-injected larvae. [Figure 8A-8B] Hyperactive mTORC1 contributes to the misbranching phenotype, and mTOR inhibitors rescue the phenotype. Figure 8A: Lysates from zebrafish larvae treated with either PIK3R6 morpholino or control morpholino and untreated or treated with rapamycin or BEZ235 were separated by SDS-PAGE and blotted for phospho-mTOR S2448 or phospho-p70S6K T389. Beta-actin blotting was used as a loading control. Figure 8B: Lysates from zebrafish larvae treated with either EPHB4 morpholino or control morpholino and untreated or treated with rapamycin were separated by SDS-PAGE and blotted for phospho-mTOR S2448 or phospho-p70S6K T389. Beta-actin blotting was used as a loading control. [Figure 9]Western blotting analysis of gene-edited wild-type HEK293T cells or EPHB4 mutant cells. Cells containing EPHB4 splice alteration mutations showed higher P-p70S6K levels than wild-type cells. Beta-actin blotting was used as a loading control. [Figure 10] The mTOR P2273L mutant shows increased protein kinase activity. Western blotting analysis of HeLa cells transfected with flag-tagged vector, wild-type mTOR and the P2273L-mTOR mutant. Activation is reflected by increased phosphorylation of p70S6K. ev = empty vector. Beta-actin blotting was used as a loading control. [Figure 11A] ARAF S214P mutation increased MAPK activity, and overexpression of human ARAF mutant in zebrafish led to vasculature defects. (FIG. 11A) Cell lysates from HEK293T cells were transfected with FLAG-tagged wild-type ARAF or S214P-ARAF mutant. Immunoprecipitation was performed using anti-FLAG (M2) antibody, followed by Western blotting using the indicated antibodies. Aliquots of cell lysates were analyzed by Western blot. Activation was reflected by increased phosphorylation of ERK due to impaired binding to 14-3-3 proteins. [Figure 11B] (FIG. 11B) The Tol2 Gateway kit was used to generate Tg(fli1:ARAF-V2a-mCherry) lines. Briefly, human S214P mutant or wild-type ARAF cDNA was injected with a transposon donor plasmid containing a Tol2 construct with the fil1 promoter. Transient mosaic expression was visualized by mCherry linked to ARAF by an autocatalytic V2a protein cleavage site. [Fig. 11C-11D] (FIGS. 11C and 11D) Expression of human ARAF induced enlarged tail blood vessels. [Fig. 11E-11J](Figure 11E) Defects in enlarged tail vasculature were detected in 21% of transgenic expressing human ARAF S214P but not in wild type at 2 dpf (***P<0.001). (Figure 11F and Figure 11G) The mTORC1 inhibitor rapamycin (Figure 11F) and BEZ235 targeting both PI3K and mTORC1 (Figure 11G) showed no therapeutic effect on transient transgenic zebrafish (ns, not significant). (Figure 11H, Figure 11I, and Figure 11J) The MEK inhibitors, U0126 (Figure 11H, **P<0.01), cobimetinib (Figure 11I, **P<0.01), and selumetinib (Figure 11J, ***P<0.001), significantly reduced the number of larvae with enlarged and fused tail vasculature at 2 dpf. [Fig. 11K-11L] (FIG. 11L and FIG. 11K) Transgenic expression of human ARAF S214P in zebrafish was found to profoundly affect normal dorsal / ventral vascular formation (FIG. 11L), whereas wild-type ARAF expression had no effect (FIG. 11K). [Figure 12] The LGA-associated mutation A-RafS214P impaired the migration properties of endothelial cells. Cell migration was measured using Millipore Transwell chambers. Hy926 cells expressing A-Raf wt or A-Raf-S214P (300 μl, 2 × 105 cells / ml) were seeded in the upper chamber of a Transwell plate, and 400 μl of DMEM containing 10% FBS was added to the lower chamber. The plate was then placed in an incubator containing 5% CO2 at 37 °C for 24 h. After incubation, the cells remaining in the upper chamber were carefully removed, and the Transwell membrane was fixed with 4% PFA and stained with 0.5% crystal violet. The amount of crystal violet was determined by optical density after treatment with 1% SDS solution. The data suggest that selumetinib may partially restore angiogenesis.

[0037] Overview of Arrays The following sequence listing provides information regarding the sequences used in this application. TIFF2025016454000001.tif223170TIFF2025016454000002.tif43170 DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] Whole exome sequencing of DNA samples from a three-generation family (three generations affected with lymphoid anomalies) was performed to identify the genetic basis of this previously undescribed rare disease. All missense, nonsense, splice alteration, and coding indel mutations consistent with an autosomal dominant genetic model in the family were examined. Results were filtered to exclude synonymous variants, variants with a minor allele frequency (MAF) of >0.5%, and variants previously identified in controls. Associated candidates were further analyzed. As a result, a single base pair substitution, c.2334+1G>C, resulting in a splice site mutation within the EPHB4 gene, was identified as the causative mutation. Samples from additional patients diagnosed with lymphoid anomalies were analyzed, and additional disease-causing SNVs - a missense mutation in PIK3R3, a splicing mutation in PIK3R6, a missense mutation in MTOR, and a conserved phosphorylation site mutation in ARAF, were identified.

[0039] These novel lymphatic abnormality-associated SNVs are c.2334+1G>C in EPHB4, c.3481A>G:p.S1161G in PIK3R4, c.1393-7C>T in PIK3R6, c.6818A>G:p.P2273L in mTOR, and c.640T>C:p.S214P in ARAF. The SNVs c.2334+1G>C in EPHB4, c.3481A>G:p.S1161G in PIK3R4, c.1393-7C>T in PIK3R6, c.6818A>G:p.P2273L in mTOR, and c.640T>C:p.S214P in ARAF may be referred to as "lymphatic abnormality-associated SNVs" or "lymphatic abnormality-associated mutations" in this application.

[0040] Thus, the present disclosure encompasses methods for diagnosing lymphatic abnormalities, where a patient is diagnosed with a lymphatic abnormality if the patient has at least one SNV in EPHB4, PIK3R3, PIK3R6, and mTOR, or has at least one SNV in linkage disequilibrium with at least one SNV in EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, compared to a negative control. The present disclosure also encompasses methods for treating lymphatic abnormalities in a patient with at least one SNV in EPHB4, PIK3R3, PIK3R6, and mTOR with at least one mTOR inhibitor, at least one PIK3K inhibitor, and / or at least one MEK inhibitor (e.g., at least one agent described in Tables 1-2).

[0041] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that it is not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents which may be included within the scope of the invention as defined by the appended claims.

[0042] Before describing the present teachings in detail, it is to be understood that the present disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a conjugate" includes a plurality of conjugates, reference to "a cell" includes a plurality of cells, and so forth.

[0043] It will be understood that there is an implicit "about" before temperatures, concentrations, times, etc. discussed in this disclosure so that minor and insubstantial deviations are within the scope of the present teachings herein. Also, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It is to be understood that both the foregoing general and detailed descriptions are exemplary and explanatory only and are not intended to limit the teachings.

[0044] Unless otherwise stated in the specification above, embodiments herein that are described as "comprising" various components are also considered to be "consisting of" or "consisting essentially of" the described components; embodiments herein that are described as "consisting of" various components are also considered to be "comprising" or "consisting essentially of" the described components; and embodiments herein that are described as "consisting essentially of" various components are also considered to be "consisting of" or "comprising" the described components (this interchangeability does not apply to the use of these terms in the claims).

[0045] The section headings used herein are for organizational purposes and should not be construed as limiting the desired subject matter in any manner. In the event that any document incorporated herein by reference conflicts with any term defined herein, the present specification shall control. Although the present teachings have been described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0046] Additionally, a compound "selected from the group consisting of" refers to one or more compounds in the list below, including mixtures (i.e., combinations) of two or more compounds. According to the present invention, an isolated or biologically pure molecule is a compound that has been removed from its natural environment. Thus, "isolated" and "biologically pure" do not necessarily reflect the extent to which a compound has been purified. An isolated compound of the present invention can be obtained from its natural source, can be produced using laboratory synthesis techniques, or can be produced by any such chemical synthesis route.

[0047] "Lymphatic abnormality" refers to a disease or disorder characterized by abnormal formation of lymphatic vessels and abnormal proliferation of tissue. Non-limiting examples of lymphatic abnormalities include "lymphangiomatosis" or "lymphangiectasia" (collectively referred to herein as LAM), lymphangiomas, generalized lymphatic anomaly (GLA), and chylous effusions, generalized lymphangioma, systemic cystic angiomatosis, multiple lymphangiectasias, generalized lymphatic malformation, diffuse lymphatic malformation, Kaposiform LAM, and Gorham-Stout disease (GSD), a rare vascular disorder of lymphatic origin characterized by progressive osteolysis.

[0048] Clinically, lymphangiomas are classified into several types. These include (1) simplex, which is composed of capillary-sized, thin-walled lymphatic vessels. This type usually affects the skin (localized lymphangiomas); (2) cystic lymphangiomas (or cysts), which can range in size from a few millimeters to a few centimeters, as commonly seen in the neck and armpits in early life; (3) cavernous: this type consists of dilated lymphatic vessels, often with a fibrous adventitia coat. This is the type that usually affects the organs of the chest, abdomen, and bones. Each of these lymphangiomas is encompassed by the present invention.

[0049] A "single nucleotide variant (SNV)" refers to a position in genomic DNA where there is a single base that differs from the normal base at that position. SNVs are similar to SNPs, except that SNPs generally refer to SNVs that occur with a certain frequency (e.g., occur above a certain percentage of a population), although SNVs do not provide frequency information. Millions of SNVs have been registered in the human genome. Some SNVs are disease-causing, while other SNVs are normal variations in the genome.

[0050] A "lymphatic abnormality associated SNV or specific marker" is an SNV that is associated with an increased risk of developing a lymphatic abnormality and is not found in patients who do not suffer from the disease. Such markers can include, but are not limited to, nucleic acids, proteins encoded thereby, or other small molecules.

[0051] The term "genetic modification" as used herein refers to a change from the wild type or reference sequence of one or more nucleic acid molecules. Genetic modifications include, but are not limited to, SNVs and SNPs, copy number variations (CNVs), base pair substitutions, additions, and deletions of at least one nucleotide from a nucleic acid molecule of known sequence.

[0052] "Linkage" refers to the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome, and is measured by the recombination rate (also called recombination fraction, or θ) between two genes, alleles, loci or genetic markers. The closer physically two loci are on a chromosome, the lower the recombination rate. Usually, when a polymorphic site within a disease-causing gene is tested for linkage to the disease, the recombination rate is zero, indicating that the disease and the disease-causing gene are always inherited together. In rare cases, when a gene spans a very large genomic segment, it may be possible to observe recombination between a polymorphic site at one end of the gene and a pathogenic mutation at the other end. However, if the pathogenic mutation is the polymorphism being tested for linkage to the disease, no recombination will be observed.

[0053] A "centimorgan" is a unit of genetic distance that represents linkage between two genetic markers, alleles, genes, or loci, and corresponds to a 1% probability of recombination between the two markers or loci for any given meiotic event.

[0054] "Linkage disequilibrium" or "allelic correlation" means that, for the frequency of any particular allele in a population, there is a preferential correlation between a particular allele, locus, gene, or genetic marker and a particular allele, locus, gene, or genetic marker at a nearby chromosomal location at a frequency higher than would be expected by chance.

[0055] The term "solid matrix" as used herein refers to any format, such as beads, microparticles, microarrays, the surface of a microtiter well or test tube, a dipstick, or a filter. The material of the matrix can be polystyrene, cellulose, latex, nitrocellulose, nylon, polyacrylamide, dextran, or agarose. The solid matrix can include nucleic acids immobilized thereon such that the nucleic acids cannot be removed from the matrix in solution.

[0056] As used herein, "target nucleic acid" refers to a predefined region of nucleic acid present in a complex nucleic acid mixture, where the predefined wild-type region contains at least one known nucleotide mutation, which may or may not be associated with lymphoid abnormality. Nucleic acid molecules can be isolated from natural sources by cDNA cloning or subtractive hybridization, or can be synthesized manually. Nucleic acid molecules can be synthesized manually by triester synthesis method, or can be synthesized using an automated DNA synthesizer.

[0057] With respect to nucleic acids as used in the present invention, the term "isolated nucleic acid", as applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous (in the 5' and 3' directions) in the naturally occurring genome of the organism from which it is derived. For example, an "isolated nucleic acid" can include a DNA molecule that is inserted into a vector, such as a plasmid or viral vector, or that is integrated into the genomic DNA of a prokaryote or eukaryote. An "isolated nucleic acid molecule" can also include a cDNA molecule. An isolated nucleic acid molecule that is inserted into a vector may also be referred to herein as a recombinant nucleic acid molecule.

[0058] With respect to RNA molecules, the term "isolated nucleic acid" refers primarily to an RNA molecule that is encoded by an isolated DNA molecule as defined above. Alternatively, the term can refer to an RNA molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues) and, as a result, is present in "substantially pure" form.

[0059] The use of the term "enriched" in reference to nucleic acids means that a particular DNA or RNA sequence represents a significantly higher proportion (2-5 fold) of the total DNA or RNA present in a cell or solution of interest than in normal cells or the cell from which the sequence was obtained. This can be caused by one preferentially reducing the amount of other DNA or RNA present, or by preferentially increasing the amount of a particular DNA or RNA sequence, or by a combination of the two. However, it should be noted that "enriched" does not indicate the absence of other DNA or RNA sequences, simply that the relative amount of the sequence of interest has been significantly increased.

[0060] For some purposes, it may also be advantageous for the nucleotide sequence to be in a purified form. The term "purified" in reference to nucleic acids does not require absolute purity (such as a homogeneous preparation), but rather represents an indication that the sequence is relatively purer than its natural environment.

[0061] The term "complementary" refers to two nucleotides that can form multiple favorable interactions with each other. For example, adenine is complementary to thymine because they can form two hydrogen bonds. Similarly, guanine and cytosine are complementary because they can form three hydrogen bonds. Thus, if a nucleic acid sequence contains the following base sequences: thymine, adenine, guanine, and cytosine, the "complement" of this nucleic acid molecule would be a molecule that contains an adenine in place of the thymine, a thymine in place of the adenine, a cytosine in place of the guanine, and a guanine in place of the cytosine. Because a complement contains a nucleic acid sequence that forms an optimal interaction with the parent nucleic acid molecule, such a complement can bind to the parent molecule with high affinity.

[0062] With respect to single-stranded nucleic acids, particularly oligonucleotides, the term "specifically hybridize" refers to the binding between two single-stranded nucleotide molecules of sequences sufficiently complementary (sometimes referred to as "substantially complementary") to allow such hybridization under given conditions commonly used in the art. Specifically, the term refers to the hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the present invention, but substantially excludes hybridization of an oligonucleotide with a single-stranded nucleic acid of a non-complementary sequence. For example, specific hybridization can refer to a sequence hybridizing to any lymphoid abnormality specific marker nucleic acid, but not to other nucleotides. Such markers include, for example, lymphoid abnormality specific markers shown in the tables contained herein. Appropriate conditions that allow specific hybridization of single-stranded nucleic acid molecules of various complementarities are well known in the art.

[0063] For example, a general formula for calculating the stringency conditions necessary to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory (1989): T m =81.5 " C+16.6Log[Na+]+0.41(%G+C)-0.63(%formamide)-600 / number of bases in a double strand

[0064] As an example of the above formula, using [Na+]=[0.368], 50% formamide, GC content of 42%, and an average probe size of 200 bases, T m The T of the DNA double strand is 57°C. mThe T decreases by 1-1.5°C for every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C. The stringency of the hybridization and washes depends primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, hybridization is usually performed at a temperature near the calculated T of the hybrid. m Wash conditions are performed under salt and temperature conditions that are 20-25° C. lower than the T of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe to the target. In general, wash conditions are chosen based on the T of the hybrid. m For nucleic acids of the present invention, moderate stringency hybridization is defined as hybridization at 42° C. in 6×SSC, 5×Denhardt's solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA, and a wash at 55° C. for 15 minutes in 2×SSC and 0.5% SDS. High stringency hybridization is defined as hybridization at 42° C. in 6×SSC, 5×Denhardt's solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA, and a wash at 65° C. for 15 minutes in 1×SSC and 0.5% SDS. Very high stringency hybridization is defined as hybridization in 6x SSC, 5x Denhardt's solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA at 42°C, and a wash in 0.1x SSC and 0.5% SDS at 65°C for 15 minutes.

[0065] The term "oligonucleotide" as used herein is defined as a nucleic acid molecule that contains two or more, preferably more than three, ribonucleotides or deoxyribonucleotides. The exact size of an oligonucleotide will depend on various factors and will depend on the specific application and use of the oligonucleotide. Oligonucleotides, including probes and primers, can be any length from 3 nucleotides to the full length of the nucleic acid molecule, expressly including all possible numbers of consecutive nucleic acids from 3 to the full length of the polynucleotide. Preferably, oligonucleotides are at least about 10 nucleotides long, more preferably at least 15 nucleotides long, more preferably at least about 20 nucleotides long.

[0066] The term "probe" as used herein refers to a nucleic acid, either an oligonucleotide, polynucleotide, or RNA or DNA, whether naturally occurring, such as a purified restriction enzyme digest, or synthetically produced, that can anneal or specifically hybridize with a nucleic acid having a sequence complementary to the probe. The probe may be either single-stranded or double-stranded. The exact length of the probe will depend on a number of factors, including temperature, source of probe, and application of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, an oligonucleotide probe (in certain cases, a nucleic acid associated with a specific rs number associated with a single nucleotide polymorphism available in the dbSNP database) typically contains 15-25, 15-35, 20-50, or 100 or more nucleotides, although it may contain fewer nucleotides if the site of the SNV is included in the probe. The probes herein are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probe must be sufficiently complementary to be able to "specifically hybridize" or anneal to its respective target strand under a given set of conditions. Thus, the probe sequence does not necessarily reflect the exact complementary sequence of the target. For example, a non-complementary nucleotide fragment may be attached to the 5' or 3' end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences may be interspersed in the probe, provided that the probe sequence has sufficient complementarity to specifically anneal to the sequence of the target nucleic acid.

[0067] The term "primer" as used herein refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, derived from a biological system, generated by restriction enzyme digestion, or produced synthetically, that can functionally act as an initiator of template-dependent nucleic acid synthesis when placed in the appropriate environment. When presented with a suitable nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acid, a polymerase enzyme, suitable cofactors, and conditions, such as suitable temperature and pH, the primer can be extended at its 3' end by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. Primers can vary in length depending on the specific conditions and application requirements. For example, in diagnostic applications, oligonucleotide primers are typically 15-25, 15-35, 10-40, or more nucleotides in length. The primer must be sufficiently complementary to the desired template to be capable of annealing to the desired template strand in a manner sufficient to provide a 3' hydroxyl portion of the primer in a juxtaposed position suitable for use in initiating synthesis by a polymerase or similar enzyme to initiate the synthesis of the desired extension product. It is not essential that the primer sequence represent an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be added to the 5' end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of extension products.

[0068] Polymerase chain reaction (PCR) is described in US Pat. Nos. 4,683,195, 4,800,195, and 4,965,188, the entire disclosures of which are incorporated herein by reference.

[0069] "siRNA" refers to a molecule involved in the RNA interference process for sequence-specific post-transcriptional gene silencing or gene knockdown by providing a small interfering RNA (siRNA) with homology to the sequence of the targeted gene. Small interfering RNA (siRNA) can be synthesized in vitro or generated from longer dsRNA by RNase III cleavage, and is a mediator of sequence-specific mRNA degradation. Preferably, the siRNA of the present invention is chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesizer. siRNA can be synthesized as two separate complementary RNA molecules, or as a single RNA molecule with two complementary regions. Suppliers of synthetic RNA molecules or synthesis reagents include Applied Biosystems (Foster City, CA, USA), Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA), and Cruachem (Glasgow, UK). Specific siRNA constructs for inhibiting lymphangiomatosis mRNA can be, for example, 15-35 nucleotides in length, more typically about 21 nucleotides in length.

[0070] The term "vector" refers to a single-stranded or double-stranded circular nucleic acid molecule that can infect, transfect, or transform a cell and replicate independently or within the genome of a host cell. A circular double-stranded nucleic acid molecule can be cut and thereby linearized by treatment with a restriction enzyme. Information regarding various vectors, restriction enzymes, and nucleotide sequences targeted by the restriction enzymes is readily available to those skilled in the art, including any replicon, such as a plasmid, cosmid, bacmid, phage, or virus, to which another genetic sequence or element (either DNA or RNA) can be attached to result in a copy of the attached sequence or element. The nucleic acid molecule of the present invention can be inserted into a vector by cutting the vector with a restriction enzyme or by ligating the two parts together. When cloning a genetic region containing a duplication or deletion, those skilled in the art are well aware that flanking sequences of suitable length (e.g., 50-100 or more nucleotides) upstream and downstream of the affected region are utilized in the cloning process. Such vectors would have utility, for example, in cell lines for studying the effect that such modifications have on the encoded protein.

[0071] Numerous techniques are available to those skilled in the art to facilitate the transformation, transfection, or transduction of expression constructs into prokaryotic or eukaryotic organisms. The terms "transformation," "transfection," and "transduction" refer to methods for inserting nucleic acids and / or expression constructs into cells or host organisms. These methods include various techniques such as treating cells with high concentrations of salt, electric fields, or detergents to permeabilize the host cell outer membrane or cell wall with the nucleic acid molecule of interest, microinjection, PEG-fusion, and the like.

[0072] The term "promoter element" describes a nucleotide sequence incorporated into a vector that, once inside an appropriate cell, can facilitate transcription factor and / or polymerase binding and subsequent transcription of a portion of the vector DNA into mRNA. In one embodiment, a promoter element of the invention precedes the 5' end of a lymphoid abnormality specific marker nucleic acid molecule, resulting in the subsequent transcription into mRNA. The mRNA is then translated into a polypeptide by host cell machinery. The mRNA is then translated into a polypeptide by host cell machinery. The promoter element can drive constitutive or inducible expression of a coding region of interest.

[0073] Those skilled in the art will appreciate that a nucleic acid vector can contain nucleic acid elements other than a promoter element and a lymphoid abnormality-specific marker-encoding nucleic acid, including, but not limited to, origins of replication, ribosome binding sites, nucleic acid sequences encoding drug resistance enzymes or amino acid metabolizing enzymes, and nucleic acid sequences encoding secretion signals, localization signals, or signals useful for polypeptide purification.

[0074] A "replicon" is any genetic element, e.g., a plasmid, cosmid, bacmid, plastid, phage, or virus, that is capable of replication primarily under its own control. A replicon may be either RNA or DNA, and may be single- or double-stranded.

[0075] An "expression operon" refers to a nucleic acid fragment that may have transcriptional and translational control sequences, such as promoters, enhancers, translation initiation signals (e.g., ATG or AUG codons), polyadenylation signals, termination factors, and the like, that facilitate the expression of a polypeptide coding sequence in a host cell or organism.

[0076] As used herein, the terms "reporter", "reporter system", "reporter gene" or "reporter gene product" are intended to mean an operable genetic system in which the nucleic acid comprises a gene encoding a product that, when expressed, produces a reporter signal that can be readily measured, for example, by biological assay, immunoassay, radioimmunoassay, or colorimetric, fluorescent, chemiluminescent, or other methods. The nucleic acid can be RNA or DNA, linear or circular, single-stranded or double-stranded, antisense or sense polarity, and is operably linked to control elements required for expression of the reporter gene product. The control elements required will vary depending on the nature of the reporter system and whether the reporter gene is in DNA or RNA form, but can include elements such as, but not limited to, promoters, enhancers, translation control sequences, poly A addition signals, transcription termination signals, and the like.

[0077] The introduced nucleic acid may or may not be integrated (covalently linked) into the nucleic acid of the recipient cell or organism. For example, in bacterial cells, yeast cells, plant cells, and mammalian cells, the introduced nucleic acid may be maintained as an independent replicon, such as an episomal element or a plasmid. Alternatively, the introduced nucleic acid may be integrated into the nucleic acid of the recipient cell or organism, stably maintained in that cell or organism, and further passed on or inherited by progeny cells or organisms of the recipient cell or organism. Finally, the introduced nucleic acid may only be transiently present in the recipient cell or host organism.

[0078] The term "selectable marker gene" refers to a gene that, when expressed, confers a selectable phenotype, such as antibiotic resistance, on transformed cells.

[0079] The term "operably linked" means that regulatory sequences required for expression of a coding sequence are appropriately positioned relative to the coding sequence in the DNA molecule in order to achieve expression of the coding sequence. This same definition applies to the arrangement of transcription units and other transcription control elements (e.g. enhancers) in an expression vector.

[0080] The term "recombinant organism" or "transgenic organism" refers to an organism that has a new combination of genes or nucleic acid molecules. The new combination of genes or nucleic acid molecules can be introduced into the organism using a variety of nucleic acid manipulation techniques available to those skilled in the art. The term "organism" refers to any living organism that contains at least one cell. An organism can be as simple as a single eukaryotic cell or as complex as a mammal. Thus, the phrase "recombinant organism" encompasses recombinant cells as well as eukaryotic and prokaryotic organisms. Examples of transgenic organisms include zebrafish or mice.

[0081] The terms "isolated protein" or "isolated and purified protein" are sometimes used herein. This term primarily refers to a protein produced by expression of an isolated nucleic acid molecule of the present invention. Alternatively, this term may refer to a protein being sufficiently separated from other proteins with which it may be naturally associated, such that it exists in "substantially pure" form. "Isolated" does not mean to exclude artificial or synthetic mixtures with other compounds or substances, nor does it mean to exclude the presence of impurities that do not interfere with the basic activity, such as impurities that may be present due to incomplete purification, the addition of stabilizers, or formulation, for example, into an immunogenic or pharma- ceutically acceptable preparation.

[0082] A "specific binding pair" includes a specific binding member (sbm) and a binding partner (bp) that have a particular specificity for each other and bind to each other preferentially over other molecules under normal conditions. Examples of specific binding pairs include antigens and antibodies, ligands and receptors, and complementary nucleotide sequences. Many other examples will be known to those skilled in the art. Furthermore, the term "specific binding pair" is also applicable when one or both of the specific binding member and the binding partner are part of a larger molecule. In embodiments where the specific binding pair includes nucleic acid sequences, they will be of a length that hybridizes to each other under the conditions of the assay, preferably greater than 10 nucleotides in length, more preferably greater than 15 or 20 nucleotides in length.

[0083] A "sample" or "patient sample" or "biological sample" generally refers to a sample that can be tested for a particular molecule, preferably a lymphatic abnormality specific marker molecule, such as the markers set forth in the table provided below. Samples include, but are not limited to, cells, bodily fluids, such as blood, serum, plasma, urine, lymph, saliva, tears, pleural fluid, and the like.

[0084] "Genotypic sequence information" generally refers to any information regarding the sequence of a subject's DNA or RNA. Genotypic sequence information includes whole genome, whole exome sequencing, exome sequencing, or targeted sequencing of regions of interest in a subject's genome. Genotypic sequence information may also include the generation of data regarding the presence or absence of specific SNVs, such as those found herein to be associated with lymphatic abnormalities. Furthermore, genotypic sequence information would include the use of probes to detect the presence and / or expression of one or more lymphatic abnormality-associated SNVs. Examples of how probes can be used to obtain genotypic sequence information include, but are not limited to, various amplification reactions, such as (1) in situ hybridization; (2) Southern hybridization; (3) Northern hybridization; and (4) polymerase chain reaction (PCR).

[0085] The terms "agent" and "test compound" are used interchangeably herein and refer to a chemical compound, a mixture of chemical compounds, a biopolymer, or an extract made from biological material, such as bacteria, plants, fungi, or animal (especially mammalian) cells or tissues. Biopolymers include siRNAs, shRNAs, antisense oligonucleotides, peptides, peptide / DNA complexes, and any nucleic acid-based molecule that exhibits the ability to modulate the activity of nucleic acids containing SNVs described herein or proteins encoded thereby. Exemplary agents include at least one mTOR inhibitor, at least one PIK3K inhibitor, and / or at least one MEK inhibitor. Exemplary agents also include those listed in Tables 1-2. Agents are evaluated for potential biological activity, including screening assays described herein below.

[0086] As used herein, "treatment" includes the administration or application of a therapeutic agent for a disease in a mammal, including a human, including inhibiting the disease or progression of the disease, suppressing or slowing the disease or its progression, arresting its progression, partially or completely alleviating the disease, preventing the onset of the disease, or preventing the recurrence of symptoms of the disease. Examples of treatment include administering an effective amount of at least one mTOR inhibitor, at least one PIK3K inhibitor, and / or at least one MEK inhibitor (e.g., at least one agent listed in Tables 1-2).

[0087] The term "inhibition" or "inhibit" refers to the reduction or cessation of any event (such as protein ligand binding), or the reduction or cessation of a phenotypic characteristic, or the reduction or cessation of the incidence, extent, or likelihood of that characteristic. "Reduce" or "inhibit" refers to decrease, reduce, or arrest an activity, function, and / or amount compared to a reference. Inhibition or reduction need not be complete. For example, in certain embodiments, "reduce" or "inhibit" refers to the ability to cause an overall reduction of 20% or more. In another embodiment, "reduce" or "inhibit" refers to the ability to cause an overall reduction of 50% or more. In yet another embodiment, "reduce" or "inhibit" refers to the ability to cause an overall reduction of 75%, 85%, 90%, 95%, or more.

[0088] The term "inhibitor" refers to a substance that slows down or prevents a particular chemical reaction, signaling pathway or other process, or reduces the activity of a particular reactant, catalyst, or enzyme.

[0089] The terms "patient" and "subject" are used interchangeably to mean a mammal, including a human.

[0090] The term "mTOR" refers to the mammalian target of rapamycin protein encoded by mTOR. mTOR can form complexes with other proteins to enable important cellular functions. The term "mTORC" refers to mammalian target of rapamycin complex 1, also known as mechanistic target to rapamycin complex 1, which is a protein complex that functions to activate protein translation. For example, mTORC1 includes mTOR, regulatory associated protein of mTOR (Raptor), mammalian lethal with SEC13 protein 8 (MLST8), PRAS40, and DEPTOR. In another example, the mTORC2 complex includes mTOR, rapamycin-insensitive companion of mTOR (RICTOR), GβL, mammalian stress-activated protein kinase interacting protein 1 (mSIN1), Protor 1 / 2, DEPTOR, TTI1, and TEL2. Any protein complex that includes mTOR may be referred to as mTORC herein. The term "mTOR signaling" will refer to the activity of mTOR, mTORC1, and MTORC2, along with other proteins known to interact in complexes with these proteins.

[0091] The term "mTORC inhibitors" refers to a class of drugs that inhibit the mechanistic target of rapamycin (mTOR), a serine / threonine-specific protein kinase that belongs to the family of phosphatidylinositol-3 kinase (PI3K)-related kinases (PIKKs). mTOR regulates cell metabolism, growth, and proliferation by forming and signaling through two protein complexes, mTORC1 and mTORC2. The most established mTOR inhibitors are the so-called rapalogs (rapamycin and its analogues). Several rapalogs are listed in Tables 1 and 2.

[0092] The term "PIK3K" or "PI3K" is used interchangeably herein to refer to phosphatidylinositol-4,5-bisphosphate 3-kinase (also called phosphatidylinositide 3-kinase, phosphatidylinositol-3-kinase, PI3-kinase, PI(3)K, PI-3K). PI3K is a family of enzymes involved in cellular functions such as cell growth, proliferation, differentiation, motility, survival and intracellular trafficking, which are further involved in cancer. PI3K is a signal transducer enzyme that regulates intracellular enzymes that can phosphorylate the 3-hydroxyl group of the inositol ring of phosphatidylinositol (PtdIns).

[0093] The term "PIK3K inhibitors" or "PI3K inhibitors" refers to a group of drugs that function by inhibiting one or more phosphoinositide 3-kinase enzymes that are part of the PI3K / AKT / mTOR pathway, a key signaling pathway for many cellular functions such as growth control, metabolism, and translation initiation. There are many components within this pathway, and their inhibition can result in tumor suppression. These anti-cancer drugs are examples of targeted therapies. There are many different classes and isoforms of PI3K. Class 1 PI3K has a catalytic subunit known as p110 and there are four types (isoforms) - p110 alpha, p110 beta, p110 gamma, and p110 delta.

[0094] The term "MEK" refers to the MAPK / ERK pathway (also known as the Ras-Raf-MEK-ERK pathway), which involves a chain of proteins inside the cell that transmit a signal from a receptor on the surface of the cell to the DNA in the cell's nucleus. A signal begins when a signaling molecule binds to a receptor on the cell surface and ends when the DNA in the nucleus expresses a protein that causes some change in the cell, such as cell division. This pathway includes many proteins, including MAPK (originally called ERK, a mitogen-activated protein kinase, called extracellular signal-regulated kinase), which communicate by adding phosphate groups to neighboring proteins that act as "on" or "off" switches.

[0095] The term "MEK inhibitor" or "MEK / ERK inhibitor" refers to agents that inhibit the mitogen-activated protein kinase enzymes MEK1, MEK2, and / or ERK. They can be used to affect the MAPK / ERK pathway, which is often overactive in some cancers. The term "intracellular signaling" would include mTOR signaling, as well as any other signaling pathway process that governs cellular homeostasis or activity.

[0096] Diagnosis of Patients with Lymphatic Abnormalities In some embodiments, the patient with lymphatic abnormality is diagnosed based on the presence of SNVs after obtaining genotype sequence information from the biological sample obtained from the patient.In some embodiments, the patient with lymphatic abnormality is diagnosed based on the detection of the presence of one or more SNVs in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or SNVs in linkage disequilibrium with the SNVs in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF associated with lymphatic abnormality, after obtaining genotype sequence information from the biological sample obtained from the patient. In some embodiments, the one or more SNVs in genes selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF are selected from c.2334+1G>C in EPHB4; c.3481A>G in PIK3R4: p.S1161G; c.1393-7C>T in PIK3R6; c.6818A>G in mTOR: p.P2273L; or c.640T>C in ARAF: p.S214P.

[0097] In some embodiments, a report identifying the SNVs present in a particular subject can be generated from experimental data. In some embodiments, a report identifying the proposed treatment(s) for lymphatic abnormalities can be generated based on data regarding the SNVs identified using genotype sequence information.

[0098] In some embodiments, after obtaining genotypic sequence information from a biological sample obtained from a patient, a diagnosis based on the detection of the presence of one or more SNVs in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or an SNV in linkage disequilibrium with an SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, guides the selection of a treatment for the patient. In some embodiments, after obtaining genotypic sequence information from a biological sample obtained from a patient, a diagnosis based on the detection of the presence of one or more SNVs in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or an SNV in linkage disequilibrium with an SNV in a gene selected from EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, does not guide or affect the selection of a treatment for the patient.

[0099] In some embodiments, the diagnosis of lymphatic abnormality is made based solely on clinical symptoms, scan results, and / or family history. In some embodiments, the diagnosis of lymphatic abnormality is made without examination of genetic sequence information. In some embodiments, the diagnosis of lymphatic abnormality is made based on clinical symptoms together with genetic sequence information.

[0100] The lymphatic abnormality-associated SNVs disclosed in the present invention can be used in a number of ways to diagnose lymphatic abnormalities.

[0101] For example, nucleic acids containing lymphatic abnormality-associated SNVs can be used as probes to detect the presence and / or expression of lymphatic abnormality-specific markers. Methods by which lymphatic abnormality-associated marker nucleic acids can be utilized as probes for such assays include, but are not limited to, (1) in situ hybridization; (2) Southern hybridization; (3) Northern hybridization; and (4) various amplification reactions such as polymerase chain reaction (PCR).

[0102] Furthermore, assays for detecting lymphoid abnormality-associated SNVs, or the proteins encoded thereby, can be performed on any type of biological sample, including, but not limited to, bodily fluids (including blood, urine, serum, gastric washings), any type of cell (brain cells, white blood cells, monocytes, etc.), or bodily tissue.

[0103] For the purpose of detecting and diagnosing lymphatic abnormalities, nucleic acids containing lymphatic abnormality-associated SNVs, vectors expressing the same, marker proteins containing lymphatic abnormality-associated SNVs, and anti-lymphatic abnormality-specific marker antibodies can be used to detect lymphatic abnormality-associated SNVs in body tissues, cells, or fluids and to alter the expression of marker proteins containing lymphatic abnormality-associated SNVs.

[0104] Based on lymphatic abnormality-associated SNVs, methods for detecting and / or diagnosing lymphatic abnormalities are included. The method may include detecting lymphatic abnormality-associated SNVs, and the nucleic acid containing lymphatic abnormality-associated SNVs in a sample will first be amplified, for example using PCR, to increase the amount of template compared to other sequences present in the sample. This allows the target sequence to be detected with high sensitivity if it is present in the sample. This initial step can be avoided by using highly sensitive array technology, which is becoming increasingly important in the art.

[0105] Alternatively, new detection techniques can overcome this limitation, allowing the analysis of small amounts of sample containing as little as 1 μg of total RNA. In contrast to traditional fluorescence techniques, resonant light scattering (RLS) techniques can be used to detect small amounts of mRNA using biotin-labeled hybridized targets and anti-biotin antibodies with multiple reads. Another alternative to PCR amplification includes planar waveguide technology (PWG) to increase the signal-to-noise ratio and reduce background interference. Both technologies are commercially available from Qiagen Inc. (USA).

[0106] Therefore, any of the aforementioned techniques can be used to detect or quantitate the expression of lymphatic abnormality-associated SNV markers and accordingly diagnose lymphatic abnormality or the risk of developing same.

[0107] Treatment of Patients with Lymphatic Abnormalities The elucidation of the role that the lymphatic abnormality-associated SNVs described herein play in modulating lymphatic abnormality phenotypes facilitates the repurposing of existing therapies and the development of new therapies useful for treating lymphatic abnormalities. In some embodiments, the invention includes administering one or more mTOR inhibitors, one or more PIK3K inhibitors, and / or one or more MEK inhibitors (e.g., one or more agents in Tables 1-2) to a patient with lymphatic abnormality.

[0108] In some embodiments, the patient with lymphatic abnormality to be treated is diagnosed based on symptoms of lymphatic abnormality and positive family history. In some embodiments, various scanning techniques, such as plain film radiography, bone scan, computed tomography, magnetic resonance imaging, and lymphoscintigraphy, are used along with clinical symptoms to diagnose lymphatic abnormality. In some embodiments, a biopsy is performed to diagnose lymphatic abnormality. In some embodiments, lymphatic abnormality is diagnosed based on abnormal proliferation of lymphatic vessels. In some embodiments, lymphatic abnormality is diagnosed based on abnormal formation of lymphatic vessels. In some embodiments, lymphatic abnormality is diagnosed based on chylous effusion, including pericardial effusion, pleural effusion, or peritoneal effusion.

[0109] In some embodiments, the patient having a lymphatic abnormality to be treated has been diagnosed according to the diagnostic methods described herein.

[0110] In some embodiments, one or more mTOR inhibitors, one or more PIK3K inhibitors, and / or one or more MEK inhibitors (e.g., one or more agents in Table 1-2) are useful for preparing a medicament for treating lymphatic dysfunction. One or more agents can be formulated with pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those skilled in the art. Such materials should be non-toxic and should not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other materials may depend on the route of administration, for example, oral, intravenous, cutaneous or subcutaneous, nasal, aerosolized, intramuscular, and intraperitoneal routes. In vitro systems or transgenic organisms containing lymphatic dysfunction-associated mutations can be used to select specific agents for human treatment.

[0111] Agents useful for treatment include, but are not limited to, those in Tables 1 and 2. Although some agents are listed in both Tables 1 and 2, the fact that an agent is not listed in both tables is not significant. JPEG2025016454000003.jpg216170JPEG2025016454000004.jpg216170JPEG2025016454000005.jpg211170JPEG2025016454000006.jpg51170

[0112] Table 2 provides agents that can be used alone or in combination with any of the agents of Table 1 or Table 2 to treat lymphatic disorders. TIFF2025016454000007.tif222170TIFF2025016454000008.tif176170

[0113] To treat individuals with lymphatic abnormalities or to alleviate the signs or symptoms of the disease, appropriate agents that target the genes disclosed herein can be administered in combination to provide a therapeutic benefit to the patient. Such agents should be administered in effective amounts.

[0114] Once the genetic alteration(s) are identified, then treatments are designed to regulate the biological and signaling pathways affected by the altered genes. For example, mTOR inhibitors can be used alone or in combination with additional mTOR inhibitors. Similarly, PIK3K inhibitors can be used alone or in combination with any of the above PIK3K inhibitors. If it is desired to inhibit the MAPK (MEK1 / MEK2) and ERK pathways, MEK inhibitors can be used alone or in combination with other MEK / ERK inhibitors. In certain embodiments, treatment requires administration of an mTOR inhibitor together with a PIK3K inhibitor. In other embodiments, mTOR and MEK / ERK inhibitors are combined to provide therapeutic benefits to patients. In another approach, PIK3K and MEK / ERK inhibitors are combined to improve disease symptoms. For certain ARAF gain-of-function mutations described herein, effective treatments include administration of MEK / ERK inhibitors. The above combination therapies can act in an additive manner. In other embodiments, the combined agents act synergistically to reduce symptoms.

[0115] First, biological samples and / or genotyping information can be obtained from the patient. Genetic information collected from the nucleic acids present in the sample will then be evaluated for the presence or absence of, for example, lymphatic abnormality-associated SNVs. The presence of these mutations, which indicate the risk of lymphatic abnormality or the presence of disease, along with the simultaneous identification of the affected genes, provides the clinician with guidance as to which therapeutic agent is appropriate. One or more total therapeutic doses (if more than one target is regulated) can be administered to the subject as a single dose, or can be administered using a split treatment protocol in which multiple / separate doses are administered over a longer period of time, for example, over a daily period to allow for administration of a daily dose, or over a longer period to administer doses over a desired period of time. Those skilled in the art will know that the amount of lymphatic abnormality drug required to obtain an effective amount in a subject will depend on many factors, including the age, weight, and general health of the subject, as well as the route of administration and the number of treatments administered. Taking these factors into account, those skilled in the art will adjust the specific dose to obtain an effective amount for treating an individual with lymphatic abnormality.

[0116] The effective amount of lymphatic disorder treating agent(s) will depend on the method of administration and the body weight of the individual being treated. The dosages described herein are generally for an average adult, but can be adjusted for treating children. Doses will generally range from about 0.001 mg to about 1000 mg.

[0117] In individuals suffering from lymphatic dysfunction, particularly more severe forms of the disease, administration of lymphatic dysfunction therapeutic agents may be particularly useful, for example, when administered in combination with conventional drugs for treating such diseases. Those skilled in the art will administer lymphatic dysfunction therapeutic agent(s) alone or in combination, and will monitor the effectiveness of such treatment using routine methods, such as assessment of lung, intestinal, thyroid, or inflammatory function, radiological or immunological assays, or histopathological methods, if indicated. Other drugs for the treatment of lymphatic dysfunction include systemic chemotherapy, interferon alpha therapy, radiation therapy, or surgery to alleviate the underlying symptoms of the disease.

[0118] Administration of a pharmaceutical preparation is preferably in an "effective amount," which is sufficient to show benefit to an individual. This amount prevents, alleviates, abates, or otherwise reduces the severity of symptoms of lymphatic abnormalities in a patient. Treatment of a patient with lymphatic abnormalities with an effective amount of an mTOR inhibitor, a PIK3K inhibitor, and / or a MEK inhibitor (e.g., an agent from Tables 1-2) may result in improved lymphatic structure, a decrease in chylous pleural effusion, improved respiratory function, tapering of concomitant medications, or increased survival.

[0119] Pharmaceutical preparations are formulated in dosage unit form for ease of administration and uniformity of dosage.Dosage unit form, as used herein, refers to a physically separate unit of pharmaceutical preparation suitable for the patient undergoing treatment.Each dosage should contain the amount of active ingredient calculated to produce the desired effect together with the selected pharmaceutical carrier.The procedure for determining the appropriate dosage unit is well known to those skilled in the art.

[0120] Dosage units can be proportionally increased or decreased based on the patient's body weight. Appropriate concentrations for the alleviation of a particular pathological condition can be determined by dose-concentration curve calculations, as is well known in the art.

[0121] Pharmaceutical compositions useful in the methods of the invention can be administered parenterally, in oral solid and liquid formulations, subcutaneously, intradermally, intramuscularly, sublingually, topically, OTIC, buccal, conjunctival, dermal, dental, via electroosmosis, intracervical, via the paranasal sinuses or trachea, intraintestinal, epidurally, via infiltration, intrainterstitially, intraperitoneally, intraarterially, intraarticularly, intrabiliary, intrabronchial, intrasynovial, intracardiac, intracartilaginous, intracavitary, intracavitary, intracerebral, intradermal, intralymphatic, intrapericardial, intraperitoneally, intranasal, transdermal, respiratory, ophthalmic, suppository, aerosol, topically, or systemically via other known routes of administration. In addition to the agent useful for treating lymphatic abnormalities, the pharmaceutical composition may contain a pharma- ceutically acceptable carrier, and other ingredients known to enhance and facilitate drug administration. Thus, such compositions may optionally include other components such as adjuvants, for example aqueous suspensions of aluminum hydroxide and magnesium hydroxide, and / or other pharma- ceutically acceptable carriers, such as saline. Other possible formulations, such as nanoparticles, liposomes, resealed red blood cells, and immunologically based systems, may also be used to deliver / administer the appropriate drug to the patient according to the methods of the present invention. The use of nanoparticles to deliver such drugs, as well as cell membrane-permeable peptide carriers that may be used, are described in Crombez et al., Biochemical Society Transactions v35:p44 (2007).

[0122] Administration of a drug(s) useful for treating lymphatic abnormality can be performed after successfully detecting or quantifying lymphatic abnormality-associated SNV marker expression and accordingly diagnosing lymphatic abnormality or the risk of developing it. Detecting or quantifying lymphatic abnormality-associated SNV marker expression can guide the selection of a particular drug to be used for treatment. Detecting or quantifying lymphatic abnormality-associated SNV marker expression can indicate that a particular treatment is not appropriate for a particular subject.

[0123] In other embodiments, treatment of lymphatic abnormalities may be based on a clinical diagnosis of the disease and treatment may be initiated without detection or quantification of gene sequence information. In other embodiments, treatment of lymphatic abnormalities may be based on a clinical diagnosis of the disease and treatment may be initiated without detection or quantification of lymphatic abnormality-associated SNV marker expression.

[0124] In other embodiments, treatment of lymphatic abnormalities may be based on a clinical diagnosis of the disease, and treatment may be initiated if lymphatic abnormality-associated SNV marker expression is unchanged from controls.

[0125] In some embodiments, the treatment is administered to patients who do not have an SNV in EPHB4, PIK3R4, PIK3R6, mTOR, or ARAF.

[0126] In some embodiments, two or more agents from Table 1-2 are administered. In some embodiments, three or more agents from Table 1-2 are administered.

[0127] In some embodiments, the agent(s) administered have an inhibitory profile of mTOR, mTORC1, and mTORC2. The activity of mTOR, mTORC1, and mTORC2 can be referred to as "mTOR signaling". The inhibition of mTOR, mTORC1, and mTORC2 can be referred to as inhibition of mTOR signaling. In some embodiments, the agent(s) having an inhibitory profile of mTOR, mTORC1, or mTORC2 is not included in Table 1-2, but has an in vitro or cell-free profile of inhibition of mTOR, mTORC1, or mTORC2. In some embodiments, the inhibitor of mTOR signaling, mTOR inhibitor, mTORC1 inhibitor, or mTORC2 inhibitor has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0128] In some embodiments, the agent(s) are selective for inhibiting mTOR, mTORC1, and / or mTORC2 over other targets. In some embodiments, the agent(s) are not selective for inhibiting mTOR, mTORC1, and / or mTORC2 over other targets. In some embodiments, the agent(s) inhibit mTOR, mTORC1, and / or mTORC2 and have other measurable biological effects.

[0129] In some embodiments, the agent(s) is an ATP-competitive mTOR inhibitor. In some embodiments, the agent(s) is a non-ATP-competitive mTOR inhibitor. In some embodiments, the agent is a dual mTORC1 / C2 inhibitor.

[0130] In some embodiments, the agent(s) is an inhibitor of phosphoinositide 3-kinase (PI3K). In some embodiments, the agent(s) is an inhibitor of PI3K and mTOR, mTORC1, or mTORC2. In some embodiments, the agent(s) is an inhibitor of PI3K that does not inhibit mTOR, mTORC1, or mTORC2. In some embodiments, the PI3K inhibitor has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0131] In some embodiments, the agent(s) is an inhibitor of peptidyl-prolyl cis-trans isomerase, which is the gene product of FKB12. In some embodiments, the agent is an inhibitor of FK506 binding. In some embodiments, the agent(s) is an inhibitor of peptidyl-prolyl cis-trans isomerase or the gene product of FKB12, and mTOR, mTORC1, or mTORC2. In some embodiments, the agent(s) is an inhibitor of peptidyl-prolyl cis-trans isomerase or the gene product of FKB12 ​​that does not inhibit mTOR, mTORC1, or mTORC2. In some embodiments, the inhibitor of peptidyl-prolyl cis-trans isomerase or the gene product of FKB12 ​​has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0132] In some embodiments, the agent(s) is an inhibitor of DNA-activated protein kinase (DNA-PK). In some embodiments, the agent(s) is an inhibitor of DNA-PK and mTOR, mTORC1, or mTORC2. In some embodiments, the agent(s) is an inhibitor of DNA-PK that does not inhibit mTOR, mTORC1, or mTORC2. In some embodiments, the inhibitor of DNA-PK has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0133] In some embodiments, the agent(s) is an inhibitor of phosphatidylinositol-4,5-bisphosphate 3-kinase, also known as p110. In some embodiments, the agent(s) is an inhibitor of one or more subunits of p110 (alpha, beta, gamma, delta, etc.). In some embodiments, the agent(s) is an inhibitor of p110 and mTOR, mTORC1, or mTORC2. In some embodiments, the agent(s) is an inhibitor of p110 that does not inhibit mTOR, mTORC1, or mTORC2. In some embodiments, the inhibitor of p110 has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0134] In some embodiments, the agent(s) is an inhibitor of P70S6 kinase (P70S6K). In some embodiments, the agent(s) is an inhibitor of P70S6K and mTOR, mTORC1, or mTORC2. In some embodiments, the agent(s) is an inhibitor of P70S6K that does not inhibit mTOR, mTORC1, or mTORC2. In some embodiments, the inhibitor of P70S6K has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

[0135] In some embodiments, the inhibitors are MEK1 / 2 inhibitors, which inhibit the mitogen-activated protein kinase enzymes MEK1 and / or MEK2. They can be used to affect the MAPK / ERK pathway, which is often overactive in some cancers and other disorders.

[0136] In some embodiments, the agent(s) is rapamycin or BEZ-235 (dactolisib). Rapamycin, an mTOR inhibitor, is also known as sirolimus. BEZ-235, also known as dactolisib or NVP-BEZ235, is a compound with known activity against p110, PI3K, and mTOR.

[0137] In some embodiments, the agent administered in the treatment method is rapamycin (sirolimus), everolimus (RAD001), AZD8055, temsirolimus (CCI-779, NSC 683864), KU-0063794, MHY1485, BEZ235 (NVP-BEZ235, Dactolisib), PI-103, tolquinib (PP242), tacrolimus (FK506), ridaforolimus (deforolimus, MK-8669), INK 128 (MLN0128), voxtalisib (SAR245409, XL765), torin1, omipalisib (GSK2126458, GSK458), OSI-027, PF-04691502, apitolisib (GDC-0980, RG7422), GSK1059615, gedatolicib (PF-05212384, PKI-587), WYE-354, AZD20 14, Torin 2, WYE-125132 (WYE-132), PP121, WYE-687, CH5132799, WAY-600, ETP-46464, GDC-0349, XL388, zotarolimus (ABT-578), tacrolimus (FK506), BGT226 (NVP-BGT226), Palomid 529 (P529), and chrysophanic acid.

[0138] In some embodiments, the agent administered is a MEK inhibitor selected from selumetinib (AZD6244), PD0325901, trametinib (GSK1120212), PD184352 (CI-1040), pimasertib (AS-703026), TAK-733, AZD8330, binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, refametinib (RDEA119, Bay 86-9766), and cobimetinib (GDC-0973, RG7420).

[0139] The combination of the above drugs should have efficacy for the treatment of lymphatic abnormalities.The following combinations can act additively or synergistically to treat LAM.In certain embodiments, the combination for administration is selected from: 1) ridaforolimus and trametinib; 2) ridaforolimus and selumetinib or cobimetinib; 3) BEZ235 and selumetinib; 4) omipalisib and selumetinib or trametinib; 5) everolimus and trametinib or selumetinib; 6) sirolimus, ridaforolimus and selumetinib; 7) sirolimus, ridaforolimus and trametinib; 8) torquinib and trametinib; 9) BEZ235, torquinib and trametinib; and 10) sirolimus and gedatricib and trametinib.

[0140] In some embodiments, treatment with the agents described herein is used in combination with one or more of systemic chemotherapy, interferon alpha, radiation therapy, and / or surgery.

[0141] Methods for identifying useful therapeutic agents Because the SNVs identified herein are associated with the pathogenesis of lymphatic disorders, methods for identifying genes containing such SNVs and agents that modulate the activity of their encoded products should lead to the generation of effective therapeutic agents for the treatment of this condition.

[0142] The chromosomal regions described herein contain protein coding regions that provide suitable targets for the rational design of therapeutic agents that modulate their activity. Small peptide molecules corresponding to these regions can be advantageously used in the design of therapeutic agents that effectively modulate the activity of the encoded proteins.

[0143] Molecular modeling should facilitate the identification of specific organic molecules that have the ability to bind to the active site of the protein encoded by the nucleic acid containing SNV, based on the three-dimensional structure or important amino acid residues required for function. Combinatorial chemistry approaches can be used to identify molecules with the greatest activity, and then these molecules will be iterated and deployed for further cycles of screening. In certain embodiments, candidate drugs can be screened from large libraries of synthetic or natural compounds. One example is a library of compounds that are approved by the FDA and can be used by humans.In addition, compound libraries were provided by Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Microsource (New Milford, CT), Aldrich (Milwaukee, WI), AKos Consulting and Solutions GmbH (Basel, Switzerland), Ambinter (Paris, France), Asinex (Moscow, Russia), Aurora (Graz, Austria), BioFocus DPI, Switzerland, Bionet (Camelford, UK), ChemBridge, (San Diego, CA), ChemDiv, (San Diego, CA), Chemical Block Lt, (Moscow, Russia), ChemStar (Moscow, Russia), and Exclusive Chemistry, Ltd (Obninsk, Russia), Enamine (Kiev, Ukraine), Evotec (Hamburg, Germany), Indofine (Hillsborough, NJ), Interbioscreen (Moscow, Russia), Interchim (Montlucon, France), Life Chemicals, Inc. (Orange, CT), Microchemistry Ltd. (Moscow, Russia), Otava, (Toronto, ON), PharmEx Ltd. (Moscow, Russia), Princeton Biomolecular (Monmouth Junction, NJ), Scientific Exchange (Center Ossipee, NH), Specs (Delft, Netherlands), TimTec (Newark, DE), Toronto Research Corp. (North York It is commercially available from a number of companies, including, but not limited to, UkrOrgSynthesis (Kiev, Ukraine), Vitas-M, (Moscow, Russia), Zelinsky Institute, (Moscow, Russia), and Bicoll (Shanghai, China).

[0144] Libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are commercially available or can be easily prepared by methods well known in the art. It has been proposed that compounds isolated from natural sources such as animals, bacteria, fungi, plant sources including leaves and bark, and marine samples can be assayed as candidates for the presence of potentially useful pharmaceuticals. It will be understood that the pharmaceuticals to be screened may be derived from or synthesized from chemical compositions or man-made compounds. Several commercially available libraries can be used for screening.

[0145] The polypeptide or fragment used in the drug screening assay can be either free in solution or fixed on a solid support or in a cell. One method of drug screening utilizes eukaryotic or prokaryotic host cells stably transformed with recombinant polynucleotides expressing the polypeptide or fragment, preferably in competitive binding assays. Such cells can be used in standard binding assays, either in a live or fixed format. For example, the formation of a complex between the polypeptide or fragment and the agent being tested can be determined, or the extent to which the formation of a complex between the polypeptide or fragment and a known substrate is disrupted by the agent being tested can be examined.

[0146] Further techniques for drug screening involve the use of host eukaryotic cell lines, cells (such as endothelial cells) or whole animal models (e.g., transgenic mice or zebrafish) with non-functioning or altered lymphatic abnormality-related genes. In some embodiments, the transgenic organism comprises cells with the following mutations: c.2334+1G>C in EPHB4; c.3481A>G:p.S1161G in PIK3R4; c.1393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; or c.640T>C:p.S214P in ARAF. These host cell lines, cells or transgenic animals are defective at the polypeptide level. The host cell lines or cells are grown in the presence of drug compounds. For example, in zebrafish models, rescue of tail and / or D / V vasculature can be evaluated. In addition, induction of phosphorylation by mTOR in the host cell lines can be evaluated.

[0147] An exemplary method of drug screening would be a method for identifying agents that alter cell signaling, such as those listed in Tables 1-2. The method would include providing a cell expressing at least one nucleic acid that includes at least one lymphatic abnormality-associated SNV; providing a cell expressing a cognate wild-type sequence corresponding to the lymphatic abnormality-associated SNV; contacting the cell expressing at least one lymphatic abnormality-associated SNV and the cell expressing the cognate wild-type sequence with a test agent; and analyzing whether the agent alters cell signaling.

[0148] The host cell expressing the lymphatic abnormality-related SNV of the present invention or its functional fragment provides a system for screening potential compounds or drugs for their ability to regulate the development of lymphatic abnormality.Thus, in one embodiment, the nucleic acid molecule of the present invention can be used to generate recombinant cell lines for use in assays to identify drugs that regulate aspects of the abnormal mTOR signaling associated with lymphatic abnormality and abnormal angiogenesis.Also provided herein is a method for screening for compounds that can regulate the function of the protein encoded by the nucleic acid that comprises SNV.

[0149] Another approach involves the use of phage display libraries engineered to express on the phage surface fragments of polypeptides encoded by nucleic acids containing SNVs. Such libraries are then contacted with a combinatorial chemical library under conditions that allow for detection of binding affinity between the expressed peptides and components of the compound library. U.S. Patent Nos. 6,057,098 and 5,965,456 provide methods and devices for carrying out such assays.

[0150] In another embodiment, the availability of lymphatic abnormality-associated modified nucleic acids allows the generation of strains of laboratory mice carrying modified nucleic acids of the invention. These lymphatic abnormality-associated modified nucleic acids can be c.2334+1G>C in EPHB4; c.3481A>G:p.S1161G in PIK3R4; c.1393-7C>T in PIK3R6; c.6818A>G:p.P2273L in mTOR; and / or c.640T>C:p.S214P in ARAF. Transgenic mice expressing lymphatic abnormality-associated mutations of the invention provide a model system for investigating the role of proteins encoded by mutant nucleic acids in the development and progression to lymphatic abnormalities. Methods for introducing transgenes into laboratory mice are known to those skilled in the art. Three common methods include: 1. Incorporation of a retroviral vector encoding a foreign gene of interest into early embryos; 2. Injection of DNA into the pronuclei of newly fertilized eggs; and 3. Incorporation of genetically engineered embryonic stem cells into early embryos. The production of the above transgenic mice will facilitate the molecular elucidation of the role that target proteins play in various processes related to lymphoid abnormality phenotypes. Such mice provide an in vivo screening tool for studying putative therapeutic agents in a whole animal model and are encompassed by the present invention.

[0151] The term "animal" is used herein to include all vertebrate animals, except humans. It also includes individual animals at all stages of development, including embryonic and fetal stages. A "transgenic animal" is any animal that contains one or more cells that have been modified or received genetic information, either directly or indirectly, by deliberate genetic manipulation at the subcellular level, for example, by targeted recombination or microinjection, or infection with a recombinant virus. The term "transgenic animal" is not meant to encompass classical crossbreeding or in vitro fertilization, but rather to encompass animals in which one or more cells have been modified by or received a recombinant DNA molecule. The molecule may be specifically targeted to a defined locus, may be randomly integrated within a chromosome, or may replicate DNA extrachromosomally. The term "germline transgenic animal" refers to a transgenic animal in which a genetic modification or genetic information has been introduced into the germline, thereby conferring the ability to transmit the genetic information to offspring. If such offspring in fact possess some or all of the modification or genetic information, they are also transgenic animals.

[0152] The altered genetic information may be foreign to the species to which the recipient belongs, or may be foreign only to a particular individual recipient, or may be genetic information that the recipient already possesses. In the latter case, the altered or introduced gene may be expressed differently than the original gene. Such altered or foreign genetic information would include the introduction of an altered lymphoid abnormality-associated nucleotide sequence.

[0153] The DNA used to modify the target gene can be obtained by a variety of techniques, including, but not limited to, isolation from genomic sources, preparation of cDNA from an isolated mRNA template, direct synthesis, or a combination thereof.

[0154] One type of target cell for introducing transgenes is the embryonic stem cell (ES). ES cells can be obtained from preimplantation embryos cultured in vitro (Evans et al., (1981) Nature 292:154-156; Bradley et al., (1984) Nature 309:255-258; Gossler et al., (1986) Proc. Natl. Acad. Sci. 83:9065-9069). Transgenes can be efficiently introduced into ES cells by standard techniques such as DNA transfection or retrovirus-mediated transduction. The resulting transformed ES cells can then be combined with a blastocyst derived from a non-human animal. The introduced ES cells then colonize the embryo and contribute to the germ line of the resulting chimeric animal.

[0155] One approach to the problem of determining the contribution of individual genes and their expression products is to use isolated, mutation-containing lymphoid abnormality-associated genes as insertion cassettes to selectively inactivate wild-type genes in totipotent ES cells (such as those described above) and then generate transgenic mice. The use of gene-targeted ES cells in the generation of gene-targeted transgenic mice has been described and discussed elsewhere (Frohman et al., (1989) Cell 56:145-147; Bradley et al., (1992) Bio / Technology 10:534-539).

[0156] Techniques are available to inactivate or modify any gene region with a desired mutation by inserting a specific change into a chromosomal allele using targeted homologous recombination. However, compared to homologous extrachromosomal recombination, which occurs with a frequency of nearly 100%, homologous plasmid-chromosomal recombination was initially achieved in 10 -6 From 10 -3 It has been reported that nonhomologous plasmid-chromosome interactions are detected at frequencies of 10 times higher than equivalent homologous insertions. 5Double to 10 2 occurs more frequently at twice the levels.

[0157] To address this low rate of targeted recombination in mouse ES cells, various strategies have been developed to detect or select rare homologous recombinants. One approach to detect homologous modification events uses polymerase chain reaction (PCR) to screen a pool of transformant cells for homologous insertions, followed by screening individual clones. Alternatively, positive gene selection approaches have been developed that construct marker genes that are active only when homologous insertion occurs, and these recombinants can be directly selected. The positive-negative selection (PNS) method, developed for genes for which there is no direct selection of modifications, is one of the most powerful approaches developed to select homologous recombinants. The PNS method is more efficient for targeting genes that are not expressed at high levels, since the marker gene has its own promoter. Heterologous recombinants are selected for by using the herpes simplex virus thymidine kinase (HSV-TK) gene and selecting against non-homologous insertions with effective herpes drugs such as ganciclovir (GANC) or (1-(2-deoxy-2-fluoro-BD arabinofluranosyl)-5-iodouracil (FIAU). This counter-selection can increase the number of homologous recombinants among the surviving transformants. The use of a mutant lymphoid abnormality associated nucleic acid as a targeted insertion cassette provides a means to detect successful insertion, as visualized, for example, by acquisition of immunoreactivity to antibodies immunologically specific for a polypeptide encoded by the EPHB4 nucleic acid, facilitating screening / selection of ES cells with the desired genotype.

[0158] As used herein, a knock-in animal is one in which the endogenous mouse gene has been replaced with, for example, a human lymphatic disorder-associated gene of the present invention. Such knock-in animals provide an ideal model system for studying the development of lymphatic disorders.

[0159] As used herein, expression of a mutant lymphoid abnormality-associated nucleic acid, a fragment thereof, or a lymphoid abnormality-associated fusion protein can be targeted in a "tissue-specific manner" or a "cell type-specific manner" using a vector in which a nucleic acid sequence encoding all or a portion of a lymphoid abnormality-associated nucleic acid is operably linked to a control sequence (e.g., a promoter and / or enhancer) that induces expression of the encoded protein in a particular tissue or cell type. Such control elements can be advantageously used for both in vitro and in vivo applications. Promoters for inducing tissue-specific proteins are well known in the art and described herein. Alternatively, the transgene can be under the control of an inducible promoter that can function in a tissue-specific or "systemic" manner.

[0160] The nucleic acid sequences encoding lymphoid abnormality-associated mutants of the present invention can be operably linked to a variety of different promoter sequences for expression in transgenic animals, including, but not limited to, prion gene promoters such as the hamster or mouse Thy-1 promoter, the PGK promoter, or the CMV promoter for expression of the transgene in the desired cell type.

[0161] Methods of using the transgenic mice of the invention are also provided herein. Transgenic mice into which a nucleic acid comprising a mutant lymphatic disorder-associated nucleic acid or its encoded protein has been introduced are useful, for example, for developing screening methods to screen therapeutic agents to identify those capable of modulating the development of lymphatic disorders.

[0162] Detection Products and Kits Compositions or products useful for detecting lymphatic abnormality SNVs are included. For example, nucleic acids containing lymphatic abnormality-associated SNVs, vectors expressing the same, marker proteins containing lymphatic abnormality-associated SNVs, and anti-lymphatic abnormality specific marker antibodies are products that can detect SNVs such as c.2334+1G>C in EPHB4, c.3481A>G:p.S1161G in PIK3R4, c.1393-7C>T in PIK3R6, c.6818A>G:p.P2273L in mTOR, or c.640T>C:p.S214P in ARAF. Also encompassed are nucleic acid probes of sufficient length and characteristics to detect the SNVs c.2334+1G in EPHB4>c.3481A>G in PIK3R4:p.S1161G, c.1393-7C>T in PIK3R6, c.6818A>G in mTOR:p.P2273L, or c.640T>C in ARAF:p.S214P. Detection products may be labeled so that they can be detected.

[0163] Any product useful for detecting lymphatic abnormality-associated SNVs can be incorporated into the kit. Any product useful for treating lymphatic abnormalities can be incorporated into the kit. Kits containing such detection products and treatment products are included. The kit may include one or more lymphatic abnormality-associated SNV-specific marker polynucleotides or one or a collection of such markers immobilized on a solid support, a gene chip, an oligonucleotide, a polypeptide, a peptide, an antibody, a label, a marker, a reporter, a pharma- ceutically acceptable carrier, a physiologically acceptable carrier, instructions for use, a container, a container for administration, an assay substrate, or any combination thereof.

[0164] The following examples are provided to illustrate certain embodiments of the invention, but are not intended to limit the invention in any way. EXAMPLES

[0165] Example I To identify the genetic basis of LAM / GLA, whole-exome sequencing (ES) was performed on DNA samples obtained from family members from a three-generation family containing six individuals affected with atypical lymphatic abnormalities. Affected family members exhibited a variety of lymphatic abnormalities, including marked venous congestion in combination with lymphatic vascular disease. As shown in Figure 1, the pedigree demonstrated an autosomal dominant inheritance model.

[0166] The proband in Family 1 was a 24-year-old man with a lifelong history of complex lymphatic disease manifesting as a predominantly right-sided chylous effusion. The diagnosis of pulmonary lymphangiomatosis had been previously confirmed by histopathologic evidence in an open lung biopsy performed at 4 months of age. Lymphangiogram showed no normal lymphatic valves. Reflux of lymph was found, which was suspected to flow to (rather than from) the lungs. There was lymphatic proliferation in the retroperitoneum around the spinal cord and in the lungs. The lymphatics were dysfunctional, and flow after gadolinium injection into the lymph nodes was abnormal. There was swelling and lymphatics around the airways, and T2-weighted bilateral peribronchial trees suggestive of peribronchial lymphatics. Evidence of fibrosis in the right lung base, where there had previously been chylothorax, was also found. His family history was notable for lymphatic defects in his mother, maternal uncles and aunts, as well as his maternal grandfather. All affected family members have venous changes, but some family members have varying degrees of lymphatic involvement.

[0167] Exome sequencing was performed on the proband (i.e., affected individual) and healthy sisters, parents, an unaffected maternal aunt, and the affected maternal grandfather, who provided the most useful baseline data. All missense, nonsense, splice variant, and coding indel mutations consistent with an autosomal dominant inheritance model in the family were examined. Results were filtered by an in-house exome variant database to exclude synonymous variants, variants with a minor allele frequency (MAF) >0.5%, and variants previously identified in controls. Relevant candidates were subjected to manual curation.

[0168] As a result, a single base pair substitution, c.2334+1G>C, resulting in a splice site mutation within the EPHB4 gene, was identified as the causative mutation. Cosegregation of the mutation with the phenotype was confirmed by Sanger sequencing, which demonstrated the presence of the heterozygous splicing variant in six affected individuals and the absence of the mutation in seven unaffected family members. Single asterisks in Figure 1 indicate individuals who tested positive for this causative mutation, while double asterisks indicate individuals who tested negative for the mutation.

[0169] EPHB4 is expressed in the valves of lymphatic collecting ducts, and affected individuals in the proband have lymphangiograms showing reflux suggesting valve defects or dysfunction. The c.2334+1G>C mutation was not present in the 1000 Genomes Project, COSMIC, ESP6500SI, and ExAC 61,000 exome v0.3 releases. RNA-seq using skin biopsies obtained from the lead proband showed that the EPHB4 splice altering mutation causes retention of the intervening 12 bp of an intron, creating a cryptic splice donor resulting in a non-frameshift 4 amino acid insertion in the highly conserved catalytic loop of the protein kinase domain, which was also confirmed by standard Sanger sequencing (data not shown). RT-PCR identified two bands in EBV-transformed lymphoblastoid cell lines (LCLs) generated from the proband and mother, and skin from unaffected controls showed high levels of wild-type EPHB4 expression (data not shown). Protein immunoblots of EPHB4 in LCLs from healthy family members and patients showed a band of the expected size (120 kD) in all samples, with a more prominent band in controls (data not shown).

[0170] EPHB4 encodes ephrin type B receptor 4, a receptor tyrosine kinase that recognizes ephrin B2 (EFNB2) as a specific ligand. The EFNB2 / EPHB4 pathway has previously been shown to influence venous and lymphatic cell fate decisions. Figure 2 provides a schematic of the signaling pathways that give rise to the arterial, venous, and lymphatic phenotypes, highlighting the role of EPHB4 in the development of the venous phenotype.

[0171] Example II Ten additional family members were sequenced to identify three additional disease-causing genes. The first was a missense mutation in phosphoinositide-3-kinase regulatory subunit 4 (PIK3R4), the second was a homozygous splicing mutation in phosphoinositide-3-kinase regulatory subunit 6 (PIK3R6), and the third was a missense mutation in mTOR. PIK3R4, PIK3R6, MTOR, and EPHB4a are related in that they converge on the same physiological PI3K / AKT / mTOR pathway. This pathway therefore provides an ideal target for therapeutic agents that may have efficacy in treating lymphatic abnormalities.

[0172] Table 3 provides a summary of these data. The family with the above mutation at c.2334+1G>C in EPHB4 was named Family-1. For Family 2, exon sequencing revealed a homozygous variant, c.1393-7C>T, in PIK3R6 in the proband, whose parents were heterozygous. PIK3R6 encodes a regulatory subunit (p84) that pairs with the catalytic subunit p110 to form the class IB PI3K complex. For Families 3 and 4, a very rare missense mutation, c.6818A>G:p.P2273L, in MTOR and a novel missense mutation, c.3481A>G:p.S1161G, in PIR3R4 were identified, respectively. In families 5 and 6, a recurrent ARAF mutation, c.640T>C:p.S214P, was identified at a conserved phosphorylation site, which putatively results in a gain of function, as phosphorylation of residue S214 is involved in the regulation of the A-RAF proto-oncogene (ARAF). The inheritance pattern was characterized as autosomal dominant (AD) or autosomal recessive (AR), as described in Table 3. TIFF2025016454000009.tif79170

[0173] Example III In vivo zebrafish studies of the four identified human mutations confirmed their association with lymphatic abnormalities.

[0174] To determine whether the c.2334+1G>C mutation in EPHB4 affects the catalytic activity of the gene product, expression constructs containing wild-type and mutant forms of EPHB4 were generated. A plasmid containing the EPHB4 coding sequence was obtained from GE Dharmacon (catalog number MHS6278-202833446, Lafayette, CO). The 12 base pair insertion discovered was performed using the Quikchange II mutagenesis kit (Agilent, Santa Clara, CA) using primers SEQ ID NO:1 and SEQ ID NO:2. The coding sequence was amplified by PCR using forward primer SEQ ID NO:3 and reverse primer SEQ ID NO:4 and ligated into the EcoRI and NotI sites of pBabe+CMV Puro. A FLAG tag was inserted into the coding sequence followed by the signal peptide using the Q5 mutagenesis kit (NEB, Ipswich, MA) using forward primer SEQ ID NO:5 and reverse primer SEQ ID NO:6. All sequences were confirmed by Sanger sequencing.

[0175] HEK239T cells and A375 melanoma cell lines were obtained from ATCC (Manassas, Virginia). Transfections were performed using Fugene HD (Promega, Madison, WI) with 3 μg of DNA and 9 μl of transfection reagent according to the manufacturer's protocol. To stimulate cells transfected with ephrin-B2-Fc, 6-well plates (not tissue culture treated, Thermo Scientific) were coated overnight at 37° C. with either ephrin-B2-Fc (catalog no. 7397-EB, R&D Systems) or IgG1, kappa from human myeloma plasma (catalog no. I5154, Sigma) at 5 μg / mL in 50 mM sodium carbonate solution (pH 9.6). Plates were washed with PBS, blocked with 1% BSA in PBS for 30 min at 4° C., and washed again with PBS. Transfected cells were removed from their plates using 10 mM EDTA in DMEM, washed, resuspended in serum-free DMEM, and added to the coated plates. Plates were placed at 4°C for 15 min and transferred to 37°C for 20 min before cells were lysed. Where indicated, FLAG immunoprecipitation (IP) was performed using Anti-FLAG M2 Affinity Gel (Cat. No. A2220, Sigma, St. Louis, MO). IPs and lysates were run on NuPAGE 4-12% Bis-Tris gels and blotted with anti-phosphotyrosine-4G10-biotin (Cat. No. 16-103, EMD Millipore, Billerica Ma) and anti-EPHB4 (Cat. No. AF3038, R&D Systems, Minneapolis, MN).

[0176] Transfection of wild-type EPHB4 into 293T cells resulted in constitutive tyrosine phosphorylation of the protein (Figure 3A, phosphorylated Tyr (pTyr) in the top panel and total EPHB4 in the bottom panel). In contrast, dramatically less tyrosine phosphorylation was detected upon transfection of the mutants. As previously described for different mutations of EPHB4 in hydrops fetalis, transfection of a mixture of wild-type and mutant proteins resulted in a reduction in phosphorylation, approximately proportional to the amount of mutant protein transfected. See Martin-Almedina S, et al. J Clin Invest 126:3080-3088 (2016). Transfection of mutant EPHB4 into the A375 melanoma cell line (Figure 3B) resulted in much less constitutive phosphorylation compared to transfection of wild-type EPHB4 (compare signals by pTyr blot for EPHB4 after FLAG immunoprecipitation or total cell lysates). Stimulation of transfected cells with ephrinB2, a ligand for EPHB4, led to the induction of phosphorylation of wild-type EPHB4 but not of mutant EPHB4 (data not shown). These results suggest that the four amino acid insertion caused by the splice-altering mutation has a significant effect on the kinase activity of mutant EPHB4 and that the presence of the mutant may affect the phosphorylation of the wild-type protein.

[0177] To evaluate the functional impact of EPHB4 variants, we performed an mRNA knockdown approach using morpholino antisense oligonucleotides in zebrafish that inhibit the same splice junction of exon 13 identified in the patient by using the tg(fli1:GFP) strain. The morpholino sequence targeting exon 13 was CGAGAGCAGTATTTACCAGTGAGCT (SEQ ID NO: 15) and was used at a concentration of 0.8 mM. For pik3r6 ex4 del, the concentration used was 0.25 mM and for pik3r6 ex13 del, the concentration was 0.5 mM. RT-PCR analysis showed an efficient knockdown of ~66% (Figure 4).

[0178] Fusion of blood vessels and general enlargement of the caudal vascular plexus at 2.5 days post fertilization (dpf) (compare control in Fig. 5A with morpholino treatment in Fig. 5B) is quantified in Fig. 5E (labeled as "tail defects") and was observed in approximately 52% of morpholino-injected larvae (four experiments with 225 animals, P<0.0006). Furthermore, lateral abnormalities and hyperbranching of intersomitic vessels were observed in approximately 46% of injected larvae at 4 days post fertilization (dpf) (Fig. 5C [control] and Fig. 5D [morpholino treatment]). Fig. 5E shows the quantification (labeled as "misbranching", six experiments, 259 animals, P<3.9E-08). Morphology and lateral branching indicate that these abnormal branches have lymphatic characteristics. Amplification of ephb4a cDNA from morphants (MO) revealed that specific targeting of exon 13 resulted in aberrant splicing with either a small or a larger insertion. Sanger sequencing showed that the smaller band was a 30 bp in-frame insertion (encoding VNTALVLSIL), while the larger band was due to retention of an intron between exons 13 and 14, likely resulting in a premature stop codon.

[0179] To validate the morpholino data, the point mutation ephb4a, originally discovered by the Sanger Institute using a tilling approach, sa11431We obtained mutant strains carrying ephb4a (see Kettleborough RN, et al., Nature 496:494-497 (2013)). However, inbred intercrosses of mutation carriers with a tg(fli1:GFP) background did not show defects in the caudal plexus or misbranching of intersomitic vessels. Potentially, the second ephb4 gene in zebrafish, ephb4b, could compensate for the complete absence of ephb4a. Indeed, injection of ephb4b morpholinos targeting the exon 13 splice junction led to fusion and expansion of the caudal plexus at 54 hours post fertilization (hpf). At higher concentrations, approximately 70% of these larvae also developed misbranching at 4 dpf (data not shown). Importantly, these phenotypes were not induced when morpholinos targeted only to ephb4b in wild-type larvae (data not shown).

[0180] It has been suggested that mTORC1 is a key signaling pathway for lymphatic development (see Sun et al., Nature 496:494-497 (2015)). Therefore, to inhibit the same splice junction in exon 13 of EPHB4, zebrafish exposed to morpholino antisense oligonucleotides were treated with the mTORC1 inhibitors rapamycin (1 μM) and BEZ-235 (100 nM). Treatment with rapamycin from 24 hpf to 56 hpf showed a significant rescue of the defects in the caudal vascular plexus from 44% (control, no treatment) to 29% (6 experiments, 321 animals, P < 0.01), as shown in Figure 5F. Rapamycin also rescued misbranching of intersomitic vessels when treated from 2.5 dpf to 4 dpf (47% [control, no treatment] vs. 20%) (Figure 5G, 6 experiments, 136 animals, P<0.00007). BEZ-235 also rescued misbranching from 45% (control) to 15% (Figure 5H, 2 experiments, 41 animals, P<0.037).

[0181] Thus, data from zebrafish confirm a role for EPHB4 in proper development of the lymphatic system. These data support that EPHB4 mutations, such as c.2334+1G>C, predict the lymphatic phenotype seen in human patient pedigrees.

[0182] We then developed two morpholino lines against pik3r6, both targeting splice donor sites, one in exon 4 and the other in exon 13, covering the same orthologous region identified in the patient. Neither of these morpholinos induced a phenotype in the caudal vascular plexus, but both caused severe misbranching of intersomitic vessels. Deletion of exon 4 (Figure 6B) caused a more severe phenotype than deletion of exon 13 (Figure 6A-D, ex4: 55% of injected morpholinos, 7 experiments, 210 animals, P<1.13E-07; ex13: 47%, 3 experiments, 70 animals, P<0.0016).

[0183] Furthermore, we investigated whether rapamycin and BEZ-235 could also inhibit the misbranching phenotype induced by the pik3r6 exon 4 morpholino. Indeed, both drugs showed that they could reverse the functional process that leads to vascular normalization. Rapamycin reduced the number of animals with aberrant branches from 47% to 21% (Figure 6E, 4 experiments, 190 animals, P<0.003), and BEZ-235 reduced the misbranching animals from 56% to 23% (Figure 6F, 4 experiments, 103 animals, P<0.008).

[0184] To examine whether pik3r4 affects lymphatic development in zebrafish, morpholinos were designed against the splice junction site of exon 3. Compared to controls with 5% misbranching, morpholinos induced misbranching in 16% of injected larvae, which affected intersomitic or lymphatic vessels (as assessed by morphology and vessel location) (Figures 7A-7D; 2 experiments; 198 animals; P<0.05).

[0185] To determine the biochemical effects caused by PIK3R6 and EPHB4 morpholinos, multiple zebrafish larvae were lysed between 4.5 and 5 dpf, and lysates were analyzed for mTORC1 signaling by Western blot. Trunk sections of 4.5-5 dpf zebrafish larvae were lysed in radioimmunoprecipitation assay (RIPA) buffer supplemented with protease inhibitors (Complete protease inhibitor cocktail tablets, Roche, Mannheim, Germany). Approximately 5 micrograms of protein were separated on NuPAGE 4-12% Bis-Tris gels run with MOPS SDS running buffer (Life Technologies, Carlsbad, CA). Western blotting was performed using the following antibodies: p-p70 S6 kinase T389 (catalog no. 9205S, Cell Signaling, Danvers, MA), phospho-mTOR Ser2448 (catalog no. 5536P, Cell Signaling), HIF1 (catalog no. LS-C287203, LSBio, Seattle, WA), and beta-actin (catalog no. AC-15, Santa Cruz Biotechnology, Santa Cruz, CA).

[0186] Both PIK3R6 (Figure 8A) and EPHB4 MO (Figure 8B) showed activated mTORC1 signaling, as detected by phosphorylation of both mTOR and its downstream target p70S6K. Activation of mTORC1 by either morpholino was inhibited by treatment of developing larvae with rapamycin. Activation by PIK3R6 morpholino was also inhibited by BEZ235, a dual PI-3-kinase and mTOR inhibitor. Additionally, a cellular model of EPHB4 mutation was developed using CRISPR. The exon 12 to 14 region of EPHB4 cDNA was amplified by PCR and directly sequenced to confirm knock-in. The pSpCas9(BB)-2A-Puro vector containing a specific target sequence for the EPHB4 locus (gRNA-EPHB4) was transfected with single-stranded donor oligonucleotide (ssODN) into 293T cells using Lipofectamine 2000 transfection reagent according to the manufacturer's instructions. The ssODNs contain single-base mismatches to the genomic sequence to recapitulate the EPHB4 mutation and 4 or 3 synonymous or non-coding changes, respectively. pSpCas9(BB)-2A-Puro(PX459)V2.0 was purchased from Addgene (plasmid ID number 62988). The guide RNAs (gRNAs) used in this study (SEQ ID NO: 7 for EPHB4) are located immediately upstream of the protospacer adjacent motif (PAM) and were designed using the gRNA designer from MIT (http: / / crispr.mit.edu / ). For gRNA assembly, a pair of synthetic oligos for each target site with the following sequences (hEPHB4-F=SEQ ID NO: 8, hEPHB4-R=SEQ ID NO: 9, hPIK3R6-F=SEQ ID NO: 10, hPIK3R6-R=SEQ ID NO: 11) were annealed and pasted into pSpCas9(BB)-2A-Puro using the BbsI (NEB, Ipswich, MA) restriction enzyme site. Synthetic ssODN (180 bases, SEQ ID NO: 12) was purchased from IDT.

[0187] After transfection with CRISPR reagents, Western blot analysis of gene-edited cells harboring EPHB4 splice alteration mutations showed higher levels of phosphorylation of p70S6K (P-p70S6K) compared to wild-type cells (Figure 9).

[0188] It was also found that expression of mTOR was significantly increased in HeLa cells transfected with wild-type or mutant mTOR cDNA. A mammalian expression vector (pcDNA3-FLAG mTOR wt) containing human wild-type mTOR cDNA with an N-terminal FLAG tag (ID number 26603) was obtained from Addgene. This expression vector carrying wild-type mTOR cDNA was used to generate the P2273L mTOR mutant using the Q5 Site-Directed Mutagenesis Kit (NEB, Ipswich, MA) according to the manufacturer's instructions. Primers were designed using a template-directed mutagenic primer design program. The primer sequences were SEQ ID NO:13 and SEQ ID NO:14.

[0189] HeLa cells were obtained from the American Type Culture Collection (ATCC) and grown at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). HeLa cells were transiently transfected with empty vector (ev), wild-type (wt) or P2273L mutant mTOR expression vectors according to the manufacturer's instructions (Invitrogen Life Technologies, CA). Medium was changed 24 hours after transfection. 36-48 hours after transfection, cells were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed on ice using freshly prepared ice-cold cell lysis buffer containing 50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 50 mM β-glycerophosphate, 10% glycerol (w / v), 1% NP-40 (w / v), 1 mM EDTA, 2 mM NaVO4, and 20 μl of EDTA-free protein inhibitor cocktail (Roche Applied Science, Mannheim Germany) per mL of lysis buffer. Cell lysates were collected in 1.5 mL microcentrifuge tubes, disrupted by vortexing, and incubated on ice for 5 min. Cell lysates were then centrifuged at 12,000 rpm for 5 min at 4°C. Supernatants were collected and protein concentrations were measured using a Bradford protein assay kit (Bio-Rad Laboratories, Hercules CA). This cell lysate was used for Western blotting. Western blotting was performed using 10-30 μg of cell lysates separated on SDS / PAGE and transferred to PVDF membranes (Millipore Co., Bedford, MA). The membranes were blocked with 5% skim milk / TBS containing 0.1% Tween 20 (TBST) for 1 h at room temperature, and then the membranes were sliced ​​based on molecular weight.The membranes were incubated with primary antibodies including anti-EPHB4, anti-phospho-p70S6K (catalog no. 9234, Cell Signaling Technology, Danvers, MA), anti-FLAG (catalog no. 2972, Cell Signaling Technology, Danvers MA), or anti-β-actin (catalog no. sc-1616R, Santa Cruz Biotechnology) antibodies for 1 h at room temperature (RT) or overnight at 4°C. After washing four times with TBST, the blots were incubated with the respective HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (catalog nos. sc-2004 and c-2005, Santa Cruz Biotechnology) for 1 h at room temperature. After washing with TBST, the protein bands on the membranes were detected using enhanced chemiluminescence (ECL) reaction reagents (Thermo Scientific, Waltham, MA) and exposed to X-ray film.

[0190] The mTOR mutant, P2273L, resulted in increased phosphorylation of p70S6K (P-p70S6K) compared to wild-type mTOR or empty vector (ev) (FIG. 10), indicating enhanced signaling, consistent with a gain-of-function mutation.

[0191] Experiments to evaluate the ARAF c.640T>C:p.S214P mutation were performed as described in Example II. Endothelial cells expressing human ARAF wild type or S214P mutant were generated and incubated with increasing doses of ERK inhibitors (1-100 nM) in 5% FBS medium. Using these cell lines, it was determined that the ARAF S214P mutation impairs angiogenesis and reduces the migration ability of endothelial cells (see Figures 11A and 12).

[0192] Transgenic mosaic expression of human ARAF wild-type or S214P mutant in zebrafish was examined (11B-L). Expression of human ARAF induced enlarged tail vessels, and defects in the enlarged tail vessels were detected in 21% of transgenic mice expressing human ARAF S214P but not in wild-type mice at 2 dpf ( *** P<0.001) (FIGS. 11C-E). Partial rescue is detected in tube formation and migration after treatment with MEK inhibitors (e.g., U0126, cobimetinib at 1-10 μM in physiological seawater, and selumetinib at 50-100 μM in physiological seawater). See FIG. 11F-L and FIG. 12. Endothelial cells expressing EPHB4 wild type, EPHB4-Dex13 mutant, or EPHB4-12bp insertion mutant were also generated. Ephb4 mutation did not appear to impair tube formation in these cell lines (data not shown).

[0193] Example IV Treatment of patients with ARAF mutations with ERK inhibitors: A 12-year-old male with severe GLA who required multiple surgeries to drain and cauterize his chest was found to have the ARAF mutation mentioned above. He had previously been treated with rapamycin for 6 months without any success and continued to have progressive chyle requiring surgery. He subsequently required multiple chest surgeries and had run out of options when the ARAF mutation was confirmed and treatment with ERK inhibitors was approved. He was then started on trametinib (the only MEK inhibitor approved in children, with efficacy comparable to that of selumetinib and cobimetinib) at 1 mg daily and continued for 1 month for response. His pulmonary function tests, which previously showed severe restrictive lung disease, improved overall by 45% (FVC, FEV1) after starting 1 month of treatment with trametinib. Except for some dry skin around his wrists, he had no side effects from trametinib treatment. He also felt better after trametinib treatment, was less short of breath, and was eating better. After treatment, he was able to climb stairs without stopping and play basketball outdoors, both of which had been impossible before. After treatment, his oxygen pulse was normal, with nadirs recorded in the morning (95%), and he spent time without oxygen. His CT chest scan was essentially unchanged after 2 months of treatment, suggesting that his disease had not progressed (pulmonary function tests are much more sensitive in measuring response to treatment than radiographic measurements). Taken together, this is evidence that trametinib halted GLA disease progression (e.g., improved lung function and oxygen saturation, and reduced requirement for supplemental oxygen), and suggests that ERK inhibitor treatment may be beneficial for patients with GLA and ARAF mutations, and potentially for those with mutations that affect ERK function.

[0194] Thus, the data presented in this application identify a novel splice-altering mutation in EPHB4, identified for the first time in six patients with complex lymphatic abnormalities including GLA and venous congestion, that resulted in increased mTORC1 activity. This c.2334+1G>C mutation in EPHB4 results in a non-frameshift insertion in the protein kinase domain involved in phosphorylation in forward signaling.

[0195] Both functional data validate the pathogenicity of c.2334+1G>C in mutant EPHB4 and show that the insertion reduces the phosphorylation state of the EPHB4 protein. Modeling of the splice-altered EPHB4 mutation in zebrafish results in vascular misbranching and deformation in developing lymphatic vessels, indicating possible differentiation defects of both blood vessels and lymphatic vessels, mimicking the symptoms of patients in Family-1. Remarkably, drugs that inhibit mTOR signaling were able to rescue this misbranching phenotype.

[0196] Furthermore, multiple germline mutations and functional data in PIK3R6, MTOR, and PIK3R4 that converge on the PI3K / mTOR pathway support the ability of these mutations to cause tail defects and misbranching in zebrafish. Thus, the supporting evidence presented herein strongly suggests that mutations in PIK3R6, MTOR, and PIK3R4 also play nonredundant roles in the lymphangiogenesis process.

[0197] Recurrent ARAF mutations were also found at conserved phosphorylation sites with putative gain-of-function effects. ARAF activation then upregulates E3 ubiquitin protein ligase containing RING finger and FY3-like domains (RFFL), resulting in polyubiquitination and destabilization of proline-rich 5-like (PRR5L), a component of mTORC2 and a suppressor of protein kinase C (PKC) phosphorylation, to achieve sustained PKC activation leading to enhanced cell proliferation and migration. Thus, there is also a fundamental mechanism for mutations in ARAF to have a causative role in the development of lymphatic abnormalities. Notably, treatment of patients with mutations in ARAF with ERK inhibitors successfully ameliorated disease symptoms.

[0198] References 1. Alitalo K, Tammela T, Petrova TV 2005 Lymphangiogenesis in development and human disease.Nature 438:946-953 2. Trenor CC, 3rd, Chaudry G 2014 Complex lymphatic anomalies.Semin Pediatr Surg 23:186-190 3. Levine C 1989 Primary disorders of the lymphatic vessels--a unified concept.J Pediatr Surg 24:233-240 4. Wassef M, Blei F, Adams D, Alomari A, Baselga E, Berenstein A, Burrows P, Frieden IJ, Garzon MC, Lopez-Gutierrez JC, Lord DJ, Mitchel S, Powell J, Prendiville J, Vikkula M 2015 Vascular Anomalies Classification: Recommendations From the International Society for the Study of Vascular Anomalies.Pediatrics 136:e203-214 5. Hilliard RI, McKendry JB, Phillips MJ 1990 Congenital abnormalities of the lymphatic system: a new clinical classification.Pediatrics 86:988-994 6. Smeltzer DM, Stickler GB, Fleming RE 1986 Primary lymphatic dysplasia in children: chylothorax, chylous ascites, and generalized lymphatic dysplasia.Eur J Pediatr 145:286-292 7. Faul JL, Berry GJ, Colby TV, Ruoss SJ, Walter MB, Rosen GD, Raffin TA 2000 Thoracic lymphangiomas, lymphangiectasis, lymphangiomatosis, and lymphatic dysplasia syndrome.Am J Respir Crit Care Med 161:1037-1046 8. Brouillard P, Boon L, Vikkula M. 2014 Genetics of lymphatic anomalies.J Clin Invest 124:898–904 9. Luks VL, Kamitaki N, Nursery MP, Uller W, Rab R, Bovee JV, Rialon KL, Guevara CJ, Alomari AI, Greene AK, Fishman SJ, Kozakewich HP, Maclellan RA, Mulliken JB, Rahbar R, Spencer SA, Trenor CC, 3rd, Upton J, Zurakowski D, Perkins JA, Kirsh A, Bennett JT, Dobyns WB, Kurek KC, Warman ML, McCarroll SA, Murillo R 2015 Somatic mutations in PIK3CA.J Pediatr 166:1048–1054 e1041–1045 10. Kurek KC, Luks VL, Ayturk UM, Alomari AI, Fishman SJ, Spencer SA, Mulliken JB, Bowen ME, Yamamoto GL, Kozakewich HP, Warman ML 11. Lindhurst MJ, Sapp JC, Teer JK, Johnston JJ, Finn EM, Peters K, Turner J, Cannons JL, Bick D, Blakemore L, Blumhorst C, Brockmann K, Calder P, Cherman N, Deardorff MA, Everman DB, Golas G, Greenstein RM, Kato BM, Keppler-Noreuil KM, Kuznetsov SA, Miyamoto RT, Newman K, Ng D, O'Brien K, Rothenberg S, Schwartzentruber DJ, Singhal V, Tirabosco R, Upton J, Wientroub S, Zackai EH, Hoag K, Whitewood-Neal T, Robey PG, Schwartzberg PL, Darling TN, Tosi LL, Mullikin JC, Biesecker LG 2011 A mosaic activating Mutation in AKT1 is associated with Proteus syndrome.N Engl J Med 365:611-619 12. Revencu N, Boon LM, Mendola A, Cordisco MR, Dubois J, Clapuyt P, Hammer F, Amor DJ, Irvine AD, Baselga E, Dompmartin A, Syed S, Martin-Santiago A, Ades L, Collins F, Smith J, Sandaradura S, Barrio VR, Burrows PE, Blei F, Cozzolino M, Brunetti-Pierri N, Vicente A, Abramowicz M, Desir J, Vilain C, Chung WK, Wilson A, Gardiner CA, Dwight Y, Lord DJ, Fishman L, Cytrynbaum C, Chamlin S, Ghali F, Gilaberte Y, Joss S, Boente Mdel C, Leaute-Labreze C, Delrue MA, Bayliss S, Martorell L, Gonzalez-Ensenat MA, Mazereeuw-Hautier J, O'Donnell B, Bessis D, Pyeritz RE, Salhi A, Tan OT, Wargon O, Mulliken JB, Vikkula M 2013 RASA1 mutations and associated phenotypes in 68 families with capillary malformation-arteriovenous malformation.Hum Mutat 34:1632-1641 [ PubMed ] 13. Burrows PE, Gonzalez-Garay ML, Rasmussen JC, Aldrich MB, Guilliod R, Maus EA, Fife CE, Kwon S, Lapinski PE, King PD, Sevick-Muraca EM 110:8621–8 14. Lo IF, Brewer C, Shannon N, Shorto J, Tang B, Black G, Soo MT, Ng DK, Lam ST, Kerr B 2008 Severe neonatal manifestations of Costello syndrome.J Med Genet 45:167–171 15. Fabretto A, Kutsche K, Harmsen MB, Demarini S, Gasparini P, Fertz MC, Zenker M 2010 Two cases of Noonan syndrome with severe respiratory and gastroenteral involvement and the SOS1 mutation F623I.Eur J Med Genet 53:322–324 [ PubMed ] 16. Joyce S, Gordon K, Brice G, Ostergaard P, Nagaraja R, Short J, Moore S, Mortimer P, Mansour S. Eur J Hum Genet 24:690–696 17. Morcaldi G, Bellini T, Rossi C, Maghnie M, Boccardo F, Bonioli E, Bellini C 2015 Lymphodysplasia and Kras Mutation: A Case Report and Literature Review.Lymphology 48:121-127 18. Makinen T, Adams RH, Bailey J, Lu Q, Ziemiecki A, Alitalo K, Klein R, Wilkinson GA 2005 PDZ interaction site in ephrinB2 is required for the remodeling of lymphatic vasculature.Genes Dev 19:397-410 19. Kume T 2010 Specification of arterial, venous, and lymphatic endothelial cells during embryonic development.Histol Histopathol 25:637-646 20. Hashimoto T, Tsuneki M, Foster TR, Santana JM, Bai H, Wang M, Hu H, Hanisch JJ, Dardik A 2016 Membrane-mediated regulation of vascular identity.Birth Defects Res C Embryo Today 108:65-84 21. Martin-Almedina S, Martinez-Corral I, Holdhus R, Vicente A, Fotiou E, Lin S, Petersen K, Simpson MA, Hoischen A, Gilissen C, Jeffery H, Atton G, Karapouliou C, Brice G, Gordon K, Wiseman JW, Wedin M, Rockson SG, Jeffery S, Morti S, Berny PS, Berny MP. Mansour S, Makinen T, Ostergaard P 2016 EPHB4 kinase-inactivating mutations cause autosomal dominant lymphatic-related hydrops fetalis.J Clin Invest 126:3080-3088 22. Kettleborough RN, Busch-Nentwich EM, Harvey SA, Dooley CM, de Bruijn E, van Eeden F, Sealy I, White RJ, Herd C, Nijman IJ, Fenyes F, Mehroke S, Scahill C, Gibbons R, Wali N, Carruthers S, Hall A, Yen J, Stemple ADL, 2013 systematic genome-wide analysis of zebrafish protein-coding gene function.Nature 496:494-497 23. Sun S, Chen S, Liu F, Wu H, McHugh J, Bergin IL, Gupta A, Adams D, Guan JL 2015 Constitutive Activation of mTORC1 in Endothelial Cells Leads to the Development and Progression of Lymphangiosarcoma through VEGF Autocrine Signaling.Cancer Cell 28:758-772.

[0199] Although some preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the present invention be limited to such embodiments. Various modifications may be made without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

1. 1. A method for diagnosing a lymphatic abnormality in a human patient, comprising: a) obtaining a biological sample containing nucleic acid from a patient; b) i) the presence of a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF; or ii) Are there any SNVs in linkage disequilibrium with the SNVs in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF? assaying the nucleic acid to determine whether c) if the SNV in i) or ii) is present, diagnosing the patient as having a lymphatic abnormality; A method comprising:

2. 1. A method for diagnosing a lymphatic abnormality in a human patient, comprising: a) obtaining genotype sequence information from a human patient; b) i) the presence of a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF; or ii) Are there any SNVs in linkage disequilibrium with the SNVs in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF? assaying the nucleic acid to determine whether c) if the SNV in i) or ii) is present, diagnosing the patient as having a lymphatic abnormality; A method comprising:

3. 1. A method for treating a lymphatic disorder in a human patient, comprising: a) obtaining a biological sample containing nucleic acid from a patient; b) i) the presence of a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF; or ii) Are there any SNVs in linkage disequilibrium with the SNVs in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF? assaying the nucleic acid to determine whether c) administering to a patient identified as having one or more SNVs of i) or ii) one or more agents suitable for treating said lymphatic abnormality, thereby treating the lymphatic abnormality. A method comprising:

4. 1. A method for treating a lymphatic disorder in a human patient, comprising: a) obtaining genotype sequence information from a human patient; b) i) the presence of a single nucleotide variant (SNV) in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF; or ii) Are there any SNVs in linkage disequilibrium with the SNVs in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF? assaying the nucleic acid to determine whether c) administering to a patient identified as having one or more SNVs of i) or ii) one or more drugs suitable for treating a lymphatic disorder, either alone or in combination, thereby treating the lymphatic disorder. A method comprising:

5. 5. The method of claim 3 or 4, wherein the agent suitable for treating the lymphatic abnormality is selected from the group of one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of the foregoing inhibitors.

6. 6. The method of any one of claims 3 to 5, wherein the drug(s) or inhibitor(s) are listed in Tables 1 and / or 2.

7. S.N.V. a) c.2334+1G>C in EPHB4; b) c.3481A>G in PIK3R4: p.S1161G; c) c.1393-7C>T in PIK3R6; d) c.6818A>G in mTOR: p.P2273L; e) c.640T>C: p.S214P in ARAF, and f) an SNV that is in linkage disequilibrium with one or more of the SNVs of a), b), c), d), or e); The method according to any one of claims 1 to 6, wherein the compound is selected from the group consisting of

8. A method for treating a lymphatic abnormality in a human patient, comprising administering an effective amount of an agent selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of the foregoing inhibitors, thereby treating the lymphatic abnormality.

9. 9. The method of any one of claims 1 to 8, wherein the lymphatic abnormality is characterized by abnormal formation of lymphatic vessels and / or abnormal proliferation of tissue.

10. 10. The method of any one of claims 1 to 9, wherein the lymphatic disorder is lymphangiomatosis (LAM).

11. 11. The method of any one of claims 1 to 10, wherein the lymphatic disorder is lymphangiomatosis (GLA).

12. 12. The method of any one of claims 1 to 11, wherein the lymphatic abnormality is characterized by a chylous effusion, including a pericardial effusion, a pleural effusion, or a peritoneal effusion.

13. 4. The method of claim 1 or claim 3, further comprising generating a report identifying the SNV after detection in the biological sample.

14. 14. The method of any one of claims 1 to 13, further comprising generating a report discerning a proposed treatment(s) for the lymphatic abnormality based on the SNVs identified in the method.

15. 3. The method of claim 1 or claim 2, further comprising administering to the diagnosed patient an effective amount of one or more drugs suitable for treating the lymphatic abnormality.

16. 16. The method of claim 15, wherein the agent is selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of the foregoing inhibitors.

17. 17. The method of claim 15 or claim 16, wherein the drug or inhibitor is listed in Tables 1 and 2.

18. 18. The method of any one of claims 1 to 17, wherein at least one agent that inhibits PI3K signaling is administered.

19. 19. The method of any one of claims 1 to 18, wherein at least one agent that inhibits MEK / ERK signaling is administered.

20. 20. The method of any one of claims 1 to 19, wherein at least one agent that inhibits mTOR signaling is administered.

21. 21. The method of any one of claims 1 to 20, wherein rapamycin is administered.

22. 22. The method of any one of claims 1 to 21, wherein BEZ-235 (dactolisib) is administered.

23. 23. The method of any one of claims 1 to 22, wherein the agent has an IC50 of less than 100 μM, less than 10 μM, less than 1 μM, less than 100 nM, less than 10 nM, or less than 1 nM.

24. 21. The method of claim 20, wherein the agent inhibits mTOR signaling and has an additional biological activity.

25. 25. The method of claim 24, wherein the additional biological activity is inhibition of PI3K, inhibition of FK506 binding protein, inhibition of DNA-PK, inhibition of p110, or inhibition of p70S6K.

26. 26. The method of any one of claims 1 to 25, wherein the patient does not have a SNV in EPHB4.

27. 27. The method of any one of claims 1 to 26, wherein the patient does not have a SNV in PIK3R4.

28. 28. The method of any one of claims 1 to 27, wherein the patient does not have a SNV in PIK3R6.

29. 29. The method of any one of claims 1 to 28, wherein the patient does not have a SNV in mTOR.

30. 30. The method of any one of claims 1 to 29, wherein the patient does not have a SNV in ARAF.

31. If the patient has the following SNVs: a) c.2334+1G>C in EPHB4; b) c.3481A>G in PIK3R4: p.S1161G; c) c.1393-7C>T in PIK3R6; d) c.6818A>G in mTOR: p.P2273L; and e) c.640T>C in ARAF: p.S214P 31. The method of any one of claims 1 to 30, having one, two, three, four or five of the following in any combination:

32. 32. The method of claim 31, wherein the patient has a SNV in linkage disequilibrium with the SNV in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF.

33. 33. The method of any one of claims 1 to 32, wherein the treatment further comprises administering systemic chemotherapy, interferon alpha, radiation therapy, and / or surgery.

34. A method for treating lymphatic abnormalities in a patient with SNV c.2334+1G>C in EPHB4 or a SNV in linkage disequilibrium with said SNV, comprising administering one or more agents selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of said inhibitors, thereby improving lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

35. 35. The method of claim 34, wherein the agent is listed in Tables 1 and 2.

36. A method for treating lymphatic abnormalities in a patient with SNV c.3481A>G:p.S1161G in PIK3R4 or an SNV in linkage disequilibrium with said SNV, comprising administering one or more agents selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of said inhibitors, thereby improving lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

37. 37. The method of claim 36, wherein the agent is listed in Tables 1 and 2.

38. 1393-7C>T in PIK3R6 or a SNV in linkage disequilibrium with said SNV, comprising administering one or more agents selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of said inhibitors, thereby improving lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

39. 39. The method of claim 38, wherein the agent is listed in Tables 1 and 2.

40. A method for treating lymphatic abnormalities in a patient carrying SNV c.6818A>G:p.P2273L in mTOR or an SNV in linkage disequilibrium with said SNV, comprising administering one or more agents selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of said inhibitors, thereby improving lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

41. 41. The method of claim 40, wherein the agent is listed in Tables 1 and 2.

42. A method for treating lymphatic abnormalities in a patient with SNV c.640T>C:p.S214P in ARAF or a SNV in linkage disequilibrium with said SNV, comprising administering one or more agents selected from one or more mTOR inhibitors, one or more PIK3K inhibitors, one or more MEK / ERK inhibitors, and one or more combinations of any of said inhibitors, thereby improving lymphatic structure, reducing chylous pleural effusion, improving respiratory function, allowing tapering of concomitant medications, or prolonging survival.

43. 43. The method of claim 42, wherein the agent is listed in Tables 1 and 2.

44. 4. The method of claim 1 or 3, wherein the step of assaying nucleic acid to determine whether a single nucleotide variant (SNV) is present in one or more of EPHB4, PIK3R4, PIK3R6, mTOR, and ARAF, or an SNV in linkage disequilibrium with the SNV, further comprises the step of analyzing a polynucleotide sample to determine the presence of the SNV by performing a method selected from the group consisting of detection of specific hybridization, measurement of allele size, restriction fragment length polymorphism analysis, allele-specific hybridization analysis, single-nucleotide primer extension reaction, and sequencing of amplified polynucleotides.

45. 45. The method of any one of claims 1 to 44, wherein the biological sample comprises DNA.

46. 46. ​​The method of any one of claims 1 to 45, wherein the biological sample comprises RNA.

47. 47. The method of any one of claims 1 to 46, wherein the nucleic acid comprising the SNV(s) is obtained from an isolated cell of a human patient.

48. a) c.2334+1G>C in EPHB4; b) c.3481A>G in PIK3R4: p.S1161G; c) c.1393-7C>T in PIK3R6; d) c.6818A>G in mTOR: p.P2273L; and e) c.640T>C in ARAF: p.S214P An isolated vector encoding a nucleic acid having a SNV selected from:

49. A host cell comprising the vector of claim 48.

50. 50. A transgenic animal comprising the cell of claim 49.

51. 51. The transgenic animal of claim 50, which is a mouse or a zebrafish.

52. a) providing a cell expressing at least one nucleic acid comprising at least one SNV as claimed in any one of claims 1 to 51 or a SNV in linkage disequilibrium with said SNV; b) providing a cell expressing a cognate wild-type sequence corresponding to the SNV of a); c) contacting the cells of a) and b) with a test agent; and d) analyzing whether said agent alters the cell signaling of the cells of step a) compared to those of step b). A method for identifying an agent that alters cell signaling comprising:

53. 43. The method of claim 42, wherein the agent is a MEK / ERK inhibitor.

54. 54. The method of claim 53, wherein the MEK / ERK inhibitor is selected from selumetinib (AZD6244), PD0325901, trametinib (GSK1120212), PD184352 (CI-1040), pimasertib (AS-703026), TAK-733, AZD8330, binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, refametinib (RDEA119, Bay 86-9766), and cobimetinib (GDC-0973, RG7420).

55. 55. The method of claim 54, wherein the inhibitor is selumetinib.

56. 20. The method of claim 18, further comprising administration of an agent selected from the group consisting of a PI3K inhibitor and a MEK / ERK inhibitor.

57. A combination of drugs is administered, the combination comprising: a) ridaforolimus and trametinib; b) ridaforolimus with selumetinib or cobimetinib; c) BEZ235 and selumetinib; d) omipalisib and selumetinib or trametinib; e) everolimus with trametinib or selumetinib; f) sirolimus and ridaforolimus and selumetinib; g) sirolimus plus ridaforolimus plus trametinib; h) torquinib and trametinib; i) BEZ235, torquinib and trametinib; and j) Sirolimus, gedatolisib and trametinib The method of claim 3 or claim 4, wherein the compound is selected from the group consisting of:

Images