FOXO inhibitor and pharmaceutical composition

Abstract

To provide a novel FOXO inhibitor that exhibits high medicinal efficacy even in vivo, and an agent for treating acute myeloid leukemia using the same.SOLUTION: A FOXO inhibitor comprises a complex of a pyrrole-imidazole polyamide that binds to the FOXO binding sequence and an alkylating agent. The FOXO inhibitor serves as a pharmaceutical composition for preventing or treating acute myeloid leukemia (AML).SELECTED DRAWING: Figure 9

Description

[Technical field]

[0001] The present invention relates to a FOXO inhibitor and a pharmaceutical composition using the same. [Background technology]

[0002] The incidence rate of acute myeloid leukemia (AML) in Japan is said to be about 2 to 3 people per 100,000 population, and the incidence rate increases with age, with the most common age being in the 60s. The long-term survival rate for acute myeloid leukemia is less than 50%.

[0003] AML is a malignant tumor arising from hematopoietic stem / progenitor cells and is characterized by a block in myeloid cell differentiation and the associated abnormal proliferation. Therefore, relieving the block in myeloid cell differentiation has attracted attention as an effective therapeutic strategy for AML.

[0004] As a key factor of differentiation block, the transcription factor FOXO protein has attracted attention. FOXO is composed of FOXO1, 3, and 6, and FOXO1 and 3 in particular are considered to be important for maintaining the undifferentiated state of myeloid cells in AML. In general, it is considered difficult to develop a direct inhibitor of a transcription factor, but AS1842856 (5-amino-7-(cyclohexylamino)-1-ethyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid) has been identified as a molecule that directly binds to FOXO and exerts an inhibitory effect (Non-Patent Document 1).

[0005] In fact, when the efficacy of AS1842856 was evaluated, it was found that AS1842856 increased the number of CD11b-positive cells, a differentiation marker, and induced differentiation. Therefore, AS1842856 was suggested to be a promising differentiation inducer. However, this FOXO inhibitor has the problem of low efficacy in vivo. Therefore, the development of a new FOXO inhibitor that can be used as a therapeutic agent for AML is desired. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] T. Nagashima, et al., Mol Pharmacol., 2010 Nov;7 8(5): 961-70 Summary of the Invention [Problem to be solved by the invention]

[0007] Therefore, an object of the present invention is to provide a novel FOXO inhibitor that exhibits high efficacy in vivo, and a therapeutic agent for acute myeloid leukemia using the same. [Means for solving the problem]

[0008] In order to solve the above problems, the present inventors focused on pyrrole-imidazole polyamide (PIP), a DNA-binding molecule, as a candidate molecule for FOXO inhibitors. PIP is a type of hairpin peptide in which pyrrole and imidazole are peptide-bonded, and PI recognizes CG, and PP recognizes AT or TA. Therefore, by adjusting the order of pyrrole and imidazole, PIP that binds to a specific DNA sequence can be produced. When PIP binds to an enhancer, it inhibits the binding of cis elements to transcription factors and suppresses gene expression. It is also known that when an alkylating agent is bound to PIP, the target sequence of PIP is alkylated, and PIP binds to the target sequence irreversibly, further strongly suppressing the expression of the target gene. Furthermore, PIP targeting the binding sequence of the transcription factor Runx1 has been shown to have anticancer effects in vivo, and PIP has been found to be a molecule that also exhibits pharmacological effects in vivo (J Clin Invest. 2017; 127(7): 2815-2828). Therefore, PIP, which targets the FOXO sequence, may be an effective FOXO inhibitor in vivo.

[0009] As a result of intensive research, the present inventors discovered that PIP, which targets the FOXO sequence, actually inhibits the function of FOXO in vivo and is useful as a therapeutic agent for AML, and thus completed the present invention. [1] A FOXO inhibitor comprising a polymer having a pyrrole-imidazole polyamide structure that binds to the FOXO binding sequence. [2] The FOXO inhibitor according to the above [1], wherein the polymer is a complex of a pyrrole-imidazole polyamide and an alkylating agent. [3] The FOXO inhibitor according to the above [2], wherein the alkylating agent is chlorambucil. [4] The FOXO inhibitor according to [3] above, wherein the polymer has the following structure: [ka] [5] The FOXO binding sequence (1) 5'-TGTTTAC-3' (2) 5'-TGTTTAG-3' (3) 5'-TGTTTTC-3' (4) 5'-TGTTTTG-3' (5) 5'-TATTTAC-3' (6) 5'-TATTTAG-3' (7) 5'-TATTTTC-3' or (8) 5'-TATTTTG-3' The FOXO inhibitor according to [1] above. [6] A FOXO inhibitor according to the above [1] that suppresses the expression of TRIB1. [7] A pharmaceutical composition for preventing or treating acute myeloid leukemia (AML), comprising the FOXO inhibitor described in [1] above. Effect of the Invention

[0010] The FOXO inhibitor of the present invention can suppress the expression of TRIB1, a factor for maintaining undifferentiated cells, by binding to the FOXO response element, and can induce differentiation in various AML cell lines. Furthermore, this FOXO inhibitor has a high antitumor effect and can be used as an effective therapeutic agent for AML. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 shows a diagram illustrating a PIP target sequence and a FOXO response element (FRE) in an example. [Diagram 2] 1 shows the results of a gel shift assay for FRE-chb. As probes, a wild-type FRE-chb DNA probe (wt probe) in which the PIP binding sequence is wild-type and a mutant FRE-chb DNA probe (mt probe) in which the binding sequence has been mutated were used. [Diagram 3] 1 shows the results of a chip assay in an example, in which FRE-chb significantly inhibited the association of FOXO3 with the TRIB1 promoter as compared to Chb-S (control). [Figure 4] 1 shows the results of a chip assay in an example, in which FRE-chb significantly inhibited the expression of TRIB1 compared to Chb-S (control). [Diagram 5] 1 shows the results of investigating the differentiation-inducing ability of HL-60 cells and MOLM-14 cells using the differentiation marker CD11b+ as an indicator. FRE-chb induced the differentiation of AML cell lines more effectively than Chb-S (control). [Figure 6] This figure shows the results of non-specific esterase (NSE) analysis of MOLM-14 cells, MV4-11 cells, THP-1 cells, SKM-1 cells, and U-937 cells. It was shown that FRE-chb can more effectively induce differentiation of various AML cell lines than Chb-S (control). [Figure 7]FIG. 1 shows the results of quantifying the viability of MOLM-14 cells, MV4-11 cells, THP-1 cells, HL-60 cells, SKM-1 cells, and U-937 cells in the presence of FRE-chb and Chb-S (control). [Figure 8] FIG. 1 shows the results of colony formation assays of AML cell lines (HL-60, SKM-1) and normal hematopoietic cells in the presence of FRE-chb and Chb-S (control). [Figure 9] FIG. 13 shows the change in tumor volume when FRE-chb and Chb-S (control) were administered to subcutaneous tumor-bearing mice. [Figure 10] FIG. 13 shows changes in body weight when FRE-chb and Chb-S (control) were administered to subcutaneous tumor-bearing mice. [Figure 11] FIG. 1 shows changes in blood components (white blood cell count WBC, red blood cell count RBC, platelet count PLT, and hemoglobin HGB) when FRE-chb and Chb-S (control) were administered to subcutaneous tumor-bearing mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention will be described in detail below based on the embodiments. The FOXO inhibitor of this embodiment includes a polymer having a pyrrole-imidazole polyamide structure that binds to a FOXO binding sequence. Pyrrole-imidazole polyamide (hereinafter referred to as "PI polyamide") is a synthetic ligand composed of N-methylpyrrole and N-methylimidazole linked by an amide bond, and is a compound that selectively binds to the minor groove of DNA in a base sequence. PI polyamide generally includes two chains oriented in antiparallel orientation, consisting of N-methylpyrrole (Py) residues and N-methylimidazole (Im) residues, and Py and Im are linked to each other by an amide bond "-C(=O)-NH-" (Trauger et al, Nature, 382, ​​559-61(1996); White et al, Chem.Biol., 4,569-78(1997); and Dervan, Bioorg. Med. Chem., 9, 2215-35(2001)). Here, "antiparallel" means that two polyamide chains of the PI polyamide are arranged in parallel, and the N- and C-termini of the two polyamide chains are oriented in opposite directions. PI polyamides can take several forms, and for example, hairpin, cyclic, H-pin, and U-pin PI polyamides are known. A hairpin PI polyamide contains a γ-aminobutyric acid moiety (hereinafter also referred to as a "γ-linker" or "γ-turn") in addition to the two polyamide chains described above, and takes a U-shaped conformation (hairpin type) in which the C-terminus of one chain and the N-terminus of the other chain are linked by a γ-linker. Py, Im, and the γ-aminobutyric acid moiety are linked to each other by an amide bond. A cyclic PI polyamide takes a cyclic conformation by closing the end of the hairpin structure with a second γ-turn. The H-pin type and U-pin type PI polyamides do not contain a γ-turn, and generally, the N-methyl group of the central Py of each of the two polyamide chains and the N-methyl groups of the terminal Py and Im are linked by an aliphatic linker. In the present embodiment, any form of PI polyamide may be used, for example, a hairpin type, a cyclic, an H-pin type, or a U-pin type PI polyamide is used, and preferably, a hairpin type PI polyamide is used.

[0013] PI polyamides bind with high affinity to specific base pairs in DNA when pairs of Py and / or Im facing each other between the two polyamide chains (hereinafter also referred to as "pyrrole-imidazole pairs") are in a specific combination (Py / Im pair, Im / Py pair, or Py / Py pair). For example, Py / Im pair can recognize and bind to C (cytosine)·G (guanine) base pairs, Im / Py pair can recognize and bind to G·C base pairs, and Py / Py pair can recognize and bind to both A (adenine)·T (thymine) base pairs and T·A base pairs. In addition to Py and Im, PI polyamides may also contain 3-hydroxypyrrole (Hp) and β-alanine residues (β), and Py can be replaced with Hp or β. Hp / Py pair can bind to T·A base pairs. Py / Hp pair can bind to A·T base pairs. The β / β pair can bind to both T·A and A·T base pairs. The β / Im pair can bind to C·G base pairs. The Im / β pair can bind to G·C base pairs. The β / Py pair and the Py / β pair can bind to both T·A and A·T base pairs. Furthermore, the γ-turn portion can bind to both T·A and A·T base pairs. Furthermore, the β-alanine residue added to the N-terminus of the PI polyamide can also bind to both T·A and A·T base pairs. By appropriately changing the structure, order, and combination of the pairs formed by Py, Im, Hp, and / or β, a PI polyamide that specifically recognizes and binds to a desired DNA sequence can be designed. For example, the N-terminus of the polyamide is designed to be at the 5'-side of the target DNA sequence.

[0014] In this embodiment, the methyl group on the nitrogen at the 1-position of Py and Im constituting the PI polyamide may be replaced with hydrogen or an alkyl group other than a methyl group. Examples of the alkyl group other than a methyl group include linear, branched or cyclic saturated or unsaturated alkyl groups having 2 to 10 carbon atoms, preferably linear, branched, branched or cyclic saturated or unsaturated alkyl groups having 2 to 5 carbon atoms, such as ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, etc. In addition, the alkyl group including the methyl group may be substituted, for example, the methylene in the alkyl group may be substituted with oxygen or the like. Furthermore, as described above, the 3-position of Py constituting the PI polyamide may be substituted with a hydroxy group. When used in this specification with respect to the PI polyamide, the terms "Py" or "pyrrole" and "Im" or "imidazole" include N-substituted or N-unsubstituted pyrrole, 3-hydroxypyrrole, and N-substituted or N-unsubstituted imidazole as described above.

[0015] The γ-turn portion of the PI polyamide may be substituted, preferably at the α-position or β-position of the γ-turn portion, more preferably at the α-position of the γ-turn portion. Examples of the substituent include, but are not limited to, an amino group, an acetylamino group, a dimethylaminopropylamino group, a hydroxyl group, and a methoxy group. For example, the γ-turn portion may be an N-α-N-γ-diaminobutyric acid residue or an N-β-N-γ-diaminobutyric acid residue substituted with an amino group at the α-position or β-position.

[0016] Various functional groups or molecules may be added to the N-terminus and C-terminus of the PI polyamide. The functional groups or molecules to be added to the N-terminus and C-terminus of the PI polyamide can be appropriately determined by those skilled in the art. For example, various functional groups can be added via amide bonds. Examples of such functional groups include, but are not limited to, carboxy groups such as β-alanine residues and γ-aminobutyric acid residues, acetyl groups, chloroacetyl groups, and amino groups. For example, but not limited to, an acetyl group may be added to the N-terminus. For example, but not limited to, a dimethylaminopropylamino group may be added to the C-terminus.

[0017] The N-terminus, C-terminus, and γ-turn portion of the PI polyamide may also be modified with a molecule such as a fluorescent group, biotin, or isophthalic acid. As used herein, examples of the fluorescent group include, but are not limited to, fluorescein, rhodamine dyes, TAMRA (5-carboxytetramethylrhodamine), cyanine dyes, ATTO dyes, Alexa Fluor dyes, BODIPY, and the like. Fluorescein also includes fluorescein derivatives (e.g., fluorescein isothiocyanate, etc.).

[0018] A cyclic PI polyamide can be obtained by closing the end of a hairpin structure by a second γ-turn. Specifically, for example, a cyclic PI polyamide having a hairpin structure with cysteine ​​in the PI polyamide chain and a chloroacetyl group at the N-terminus can be obtained by reacting the chloroacetyl group at the N-terminus with a sulfhydryl group of the cysteine ​​to cyclize the PI polyamide (Roberts, KD; Lambert, JN; Ede, NJ; Bray, AM Tetrahedron Lett. 1998, 39 , 8357-8360. and Yu, L.; Lai, Y.; Wade, JV; Coutts, SM Tetrahedron Lett. 1998, 39 , 6633-6636.

[0019] Methods for designing and producing PI polyamides are known (see, for example, Japanese Patent No. 3045706, JP 2001-136974 A, WO 03 / 000683 A, JP 2013-234135 A, and JP 2014-173032 A). For example, they can be easily produced by automated synthesis using solid-phase synthesis (Fmoc solid-phase synthesis) using Fmoc (9-fluorenylmethoxycarbonyl). They can also be produced by liquid-phase synthesis.

[0020] In the present embodiment, the PI polyamide may be a modified PI polyamide modified to maintain or improve its ability to bind to DNA. Examples of such modified PI polyamides include modified PI polyamides in which an amino group is added to the α-position or β-position of a γ-turn, i.e., modified PI polyamides having a γ-turn consisting of N-α-N-γ-diaminobutyric acid residues or N-β-N-γ-diaminobutyric acid residues, modified PI polyamides in which the amino group is modified with a molecule such as a fluorescent group or biotin, modified PI polyamides in which the N-terminus is modified with a molecule such as a fluorescent group or biotin, and modified PI polyamides in which the C-terminus is modified with a molecule such as isophthalic acid.

[0021] The PI polyamide used in this embodiment is a PI polyamide that binds to a FOXO binding sequence, designed to recognize the consensus sequence of a FOXO binding site on the genome. Known consensus sequences include (1) 5'-TGTTTAC-3', (2) 5'-TGTTTAG-3', (3) 5'-TGTTTTC-3', (4) 5'-TGTTTTG-3', (5) 5'-TATTTAC-3', (6) 5'-TATTTAG-3', (7) 5'-TATTTTC-3', (8) 5'-TATTTTG-3', and the like. Therefore, based on the target FOXO binding sequence, the combination of pyrrole-imidazole pairs constituting the PI polyamide (the number, type, and order of pyrrole-imidazole pairs) may be determined. In addition, when used in this embodiment, the term "pyrrole-imidazole pair" includes any combination of Py, Im, Hp, and β.

[0022] Examples of PI polyamides that can be used in this embodiment include, but are not limited to, (1)βPyPyβPyPyIm-γ-PyPyImβPyPy (2)βPyPyPyβPyIm-γ-PyPyImβPyPy (3)βPyβPyPyPyIm-γ-PyPyImβPyPy (4) βPyPyβPyPyIm-γ-PyPyImPyβPy, or (5)βPyPyPyβPyIm-γ-PyPyImPyβPy In this case, γ represents a γ-turn, and adjacent Py, Im and the γ-turn are connected to each other via amide bonds.

[0023] As used herein with reference to the pyrrole-imidazole pair of the PI polyamide, "Py" has the formula: [ka] [In the formula, X represents CH or COH, and R' represents H or an organic group such as an alkyl group.] "Im" represents a pyrrole unit represented by the following formula: [ka] [In the formula, R″ represents H or an alkyl group.] represents an imidazole unit represented by the formula: [ka] The β-alanine residue shown is:

[0024] As used herein, a "complex" (or "conjugate") refers to two or more molecules that are linked together via a bond (e.g., a covalent bond) sufficient to form a stable larger construct to form the construct. In this embodiment, a complex is provided that includes the above-mentioned PI polyamide and an alkylating agent.

[0025] An alkylating agent is a compound having a functional group that forms a covalent bond with DNA, and can inhibit DNA synthesis by, for example, changing (alkylating) DNA into a molecule having an alkyl group. The alkylating agent used in this embodiment is not particularly limited, but is preferably one that has low or no cytotoxicity in consideration of its use in a pharmaceutical composition described later. Examples of such alkylating agents include chlorambucil, duocarmycin, seco-CBI (1-chloromethyl-5-hydroxy-1,2-dihydro-3H-benzo[e]indole), CBI (1,2,9,9a-tetrahydrocyclopropane[c]benzo[e]indol-4-one), pyrrolobenzodiazepine, nitrogen mustard, nitramine, cyclophosphamide, ifosfamide, melphalanthiotepa, carboquone, busulfan, and nimustine hydrochloride. When producing a complex of seco-CBI or CBI and a PI polyamide, indole or vinylpyrrole may be inserted between the PI polyamide and seco-CBI or CBI.

[0026] Chlorambucil, given as an example of the alkylating agent above, is represented by the following chemical formula.

[0027] [ka]

[0028] The alkylating agent may be bound to any of the N-terminus, C-terminus, or γ-turn portion of the PI polyamide. It may also be bound to two or more positions selected from the N-terminus, C-terminus, and γ-turn portion. For example, the alkylating agent is bound to the N-terminus or C-terminus of the PI polyamide. When the alkylating agent is bound to two or more positions selected from the N-terminus, C-terminus, and γ-turn portion of the PI polyamide, the alkylating agents bound to each position may be the same or different.

[0029] The alkylating agent may be directly bound to the PI polyamide, for example, via an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond, or the like, or may be bound via a linker. The linker is not particularly limited as long as it does not interfere with the action of the alkylating agent and does not interfere with the target sequence recognition of the PI polyamide. Examples of the linker include, but are not limited to, a molecule containing a functional group that forms one or more types of bonds selected from the group consisting of an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond, and the like. Further examples of the linker include, but are not limited to, a β-alanine linker, a polyethylene glycol linker, a peptide linker, an alkyl linker, an aminoalkyl linker, a polyether linker, and the like. The ends of the linker are bound to the PI polyamide and the alkylating agent, for example, via an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, or an ether bond, and the like. The above linker can be appropriately determined by those skilled in the art.

[0030] Conjugation of the PI polyamide with an alkylating agent can be carried out according to known coupling or synthetic methods.

[0031] An example of a conjugate of a PI polyamide and an alkylating agent in this embodiment is a polymer having the following structure:

[0032] [ka]

[0033] The FOXO inhibitor of this embodiment includes a polymer having the pyrrole-imidazole polyamide structure that binds to a FOXO binding sequence, and inhibits the association between the promoter of the TRIB1 gene, which is a factor for maintaining undifferentiation, and FOXO by binding to the target sequence. As a result, the FOXO inhibitor of this embodiment can suppress the expression of TRIB1.

[0034] In one aspect of the present invention, a pharmaceutical composition for preventing or treating acute myeloid leukemia (AML) is provided. The pharmaceutical composition includes the FOXO inhibitor of this embodiment. As used herein, "acute myeloid leukemia (AML)" is a type of acute leukemia, a disease in which leukemia cells grow abnormally in the bone marrow. As a result of the abnormal growth of leukemia cells in the bone marrow, normal hematopoietic function is significantly inhibited, and various symptoms associated with leukopenia, anemia, and thrombocytopenia may be observed. For acute myeloid leukemia, the FAB classification (French-American-British classification) based on morphological / cytobiochemical classification and the WHO classification based on chromosomal abnormalities are known. In the FAB classification, acute myeloid leukemia can be classified into minimally differentiated acute myeloid leukemia (AML-M0), undifferentiated acute myeloid leukemia (AML-M1), differentiated acute myeloid leukemia (AML-M2), acute promyelocytic leukemia (AML-M3), acute myelomonocytic leukemia (AML-M4), acute monocytic leukemia (AML-M5), acute erythroleukemia (AML-M6), and acute megakaryoblastic leukemia (AML-M7) based on MPO staining, esterase staining, PAS staining, cell surface markers, etc. Conventional treatment methods for acute myeloid leukemia include anthracycline / cytarabine combination drugs, CD33 antibody drugs, azacitidine, and / or venetoclax drug therapy, allogeneic hematopoietic stem cell transplantation, and any combination thereof. Usually, a combination therapy of anthracycline and cytarabine can be performed as the initial treatment. For patients at high risk of relapse, combination therapy with anthracyclines and cytarabine may be used followed by allogeneic hematopoietic stem cell transplantation. In the treatment of acute myeloid leukemia, the proportion of leukemia cells in the bone marrow may not be sufficiently reduced after the initial treatment, leading to resistance to treatment or relapse.

[0035] The pharmaceutical composition of the present invention includes an active ingredient as an essential component, and a pharma- ceutical acceptable carrier or other drug as an optional component. The pharmaceutical composition of the present invention may be composed of only the active ingredient. However, in order to facilitate the formation of a dosage form and to maintain the pharmacological effect and / or dosage form of the active ingredient, it is preferable that the pharmaceutical composition is composed of a pharma- ceutical composition containing a pharma- ceutical acceptable carrier described below.

[0036] Each component constituting the pharmaceutical composition of the present invention will now be described in detail. The active ingredient in the pharmaceutical composition of the present invention is a FOXO inhibitor for preventing or treating acute myeloid leukemia. The composition has already been described in detail, so the specific description is omitted here. The number of FOXO inhibitors for treating acute myeloid leukemia contained in the pharmaceutical composition of the present invention is not limited, and may be one or more.

[0037] The term "pharmaceutical acceptable carrier" refers to a solvent and / or additive that can be commonly used in the technical field of pharmaceutical formulations and that is little or not harmful to living organisms.

[0038] Examples of pharma- ceutically acceptable solvents include water, castor oil, ethanol, propylene glycol, ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters, etc. These are desirably sterilized, and preferably adjusted to be isotonic with blood as necessary.

[0039] Furthermore, examples of pharma- ceutically acceptable additives include excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, and the like.

[0040] Excipients include, for example, sugars such as monosaccharides, disaccharides, cyclodextrins, and polysaccharides (more specifically, including, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, dextrins, maltodextrins, starch, and cellulose), metal salts (e.g., sodium chloride, sodium or calcium phosphate, calcium sulfate, magnesium sulfate, calcium carbonate), citric acid, tartaric acid, glycine, low, medium, or high molecular weight polyethylene glycols (PEGs), Pluronic®, kaolin, silicic acid, or combinations thereof.

[0041] Binders include, for example, starch paste using corn, wheat, rice, or potato starch, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, shellac, and / or polyvinylpyrrolidone.

[0042] Disintegrants include, for example, the above-mentioned starches, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, sodium hydrogen carbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, or salts thereof.

[0043] Fillers include, for example, the sugars and / or calcium phosphate (eg, tricalcium phosphate or calcium hydrogen phosphate).

[0044] Examples of the emulsifier include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.

[0045] Flow regulators and lubricants include, for example, silicates, talc, stearates or polyethylene glycol.

[0046] In addition to the above additives, the composition may contain, as necessary, dissolution aids (solubilizers), suspending agents, diluents, surfactants, stabilizers, absorption promoters (e.g., quaternary ammonium salts, sodium lauryl sulfate), bulking agents, moisturizers (e.g., glycerin, starch), adsorbents (e.g., starch, lactose, kaolin, bentonite, colloidal silicic acid), coating agents, preservatives, antioxidants, buffers, etc.

[0047] The pharmaceutical composition of the present invention may contain other drugs within the range that does not lose the pharmacological effect of the above-mentioned active ingredient. Here, "other drugs" include drugs that have a therapeutic effect against acute myeloid leukemia similar to FOXO inhibitors. When the pharmaceutical composition of the present invention is a combination preparation containing other drugs, it is convenient because it can be expected to have a synergistic effect such as multifaceted suppression of acute myeloid leukemia.

[0048] The dosage form of the pharmaceutical composition of the present invention is not particularly limited as long as it does not or is unlikely to inactivate the active ingredient, the FOXO inhibitor, and can fully exert its pharmacological effect in vivo after administration.

[0049] Dosage forms can be classified into liquid dosage forms or solid dosage forms (including semi-solid dosage forms such as gels) depending on the form, and the pharmaceutical composition of the present invention may be either of them. Dosage forms can also be broadly classified into oral dosage forms and parenteral dosage forms depending on the administration method, and either of them may be used. Specific dosage forms include, for example, liquid dosage forms such as suspensions, emulsions, and syrups, and solid dosage forms such as powders (including powders, powders, and candy powders), granules, tablets, capsules, sublingual tablets, and lozenges, in the case of oral dosage forms. In addition, for example, liquid dosage forms such as injections, suspensions, and emulsions are included in the case of parenteral dosage forms.

[0050] The pharmaceutical composition of the present invention can be prepared by any method known in the art, so long as it is a method that can administer an effective amount of the active ingredient, a FOXO inhibitor, to a living body for the prevention or treatment of acute myeloid leukemia.

[0051] As used herein, the term "effective amount" refers to the amount of an active ingredient required to exert its function, i.e., the amount required to prevent or treat acute myeloid leukemia, and which causes little or no harmful side effects to the living body to which it is applied. This effective amount may vary depending on conditions such as information about the subject, the route of administration, and the number of administrations.

[0052] The term "subject" or "target" refers to an animal individual to which the FOXO inhibitor of the present invention or a pharmaceutical composition containing the same for preventing or treating acute myeloid leukemia is applied. Specifically, it is a mammal, including, for example, primates, pet animals, livestock, and sports animals, and humans are particularly preferred. "Subject information" refers to various individual information of the subject, including, for example, the subject's age, weight, sex, general health condition, drug sensitivity, and the presence or absence of medications being taken. The effective amount and the dosage calculated based thereon are determined by the judgment of a physician or veterinarian depending on the information of each individual subject. When it is necessary to administer a large amount of the pharmaceutical composition of the present invention to obtain a sufficient effect of preventing or treating acute myeloid leukemia, it can be administered in several divided doses to reduce the burden on the subject.

[0053] The pharmaceutical composition of the present invention may be administered either systemically or locally. Examples of systemic administration include intravascular injection such as intravenous injection and oral administration. Examples of local administration include intrabone marrow administration, intratumor administration, rectal administration, and intraperitoneal administration. Preferred administration methods are intravenous administration, subcutaneous administration, intrabone marrow administration, intratumor administration, and oral administration. In the case of oral administration, it is preferable to take appropriate measures, such as using a suitable DDS (drug delivery system) to protect the active ingredient from degradation by digestive enzymes.

[0054] When the pharmaceutical composition of the present invention is administered or ingested, the dosage or intake is appropriately selected depending on the age, body weight, symptoms, health condition, type of composition, etc. of the subject. For example, based on the radiation dose of the FOXO inhibitor labeled with an alpha-emitting nuclide, the dosage or intake may be 0.001 MBq / kg body weight to 1000 MBq / kg body weight, 0.01 MBq / kg body weight to 500 MBq / kg body weight, 0.1 MBq / kg body weight to 200 MBq / kg body weight, 1 MBq / kg body weight to 100 MBq / kg body weight, 2 MBq / kg body weight to 50 MBq / kg body weight, 5 MBq / kg body weight to 40 MBq / kg body weight, or 10 MBq / kg body weight to 30 MBq / kg body weight, for example, 4.4 MBq / kg body weight to 44 MBq / kg body weight. Alternatively, the dose may be 0.001 mg / kg / day to 1000 mg / kg / day, 0.01 mg / kg / day to 500 mg / kg / day, 0.1 mg / kg / day to 200 mg / kg / day, 1 mg / kg / day to 100 mg / kg / day, 5 mg / kg / day to 50 mg / kg / day, or 10 mg / kg / day, based on the weight of the FOXO inhibitor labeled with an alpha-emitting nuclide.

[0055] In one embodiment, the pharmaceutical composition of the present invention can be administered to a subject as a first-line treatment for acute myeloid leukemia. For example, the pharmaceutical composition of the present invention can be administered alone or in combination with an anthracycline / cytarabine combination drug, a CD33 antibody drug, azacitidine, and / or venetoclax.

[0056] In another embodiment, the pharmaceutical composition of the present invention may be administered to a subject after anthracycline / cytarabine combination therapy has been performed as an initial treatment for acute myeloid leukemia. For example, the pharmaceutical composition of the present invention may be administered to a subject who shows resistance to treatment after the initial treatment.

[0057] In a further embodiment, the pharmaceutical composition of the present invention may be administered to a subject after anthracycline / cytarabine combination therapy as an initial treatment for acute myeloid leukemia, followed by allogeneic hematopoietic stem cell transplantation. By administering the pharmaceutical composition of the present invention between anthracycline / cytarabine combination therapy and allogeneic hematopoietic stem cell transplantation, the relapse rate can be reduced in patients who do not achieve remission with conventional treatment.

[0058] The type of acute myeloid leukemia targeted by the pharmaceutical composition of the present invention is not particularly limited.Specific examples of acute myeloid leukemia include minimally differentiated acute myeloid leukemia (AML-M0), undifferentiated acute myeloid leukemia (AML-M1), differentiated acute myeloid leukemia (AML-M2), acute promyelocytic leukemia (AML-M3), acute myelomonocytic leukemia (AML-M4), acute monocytic leukemia (AML-M5), acute erythroleukemia (AML-M6), and acute megakaryoblastic leukemia (AML-M7).

[0059] In one embodiment, acute myeloid leukemia is resistant to therapy and / or recurrent. Refractory acute myeloid leukemia refers to a pathological condition in which the proportion of leukemia cells in bone marrow does not decrease sufficiently after initial therapy. For example, in acute myeloid leukemia, the proportion of leukemia cells in bone marrow does not decrease to less than 5% even after standard chemotherapy using anthracycline drugs and cytarabine in combination is exemplified. On the other hand, complete remission (CR) refers to recovery of normal hematopoiesis and the proportion of leukemia cells in bone marrow is less than 5%. Recurrent acute myeloid leukemia refers to recurrence of leukemia after complete remission (CR), and in acute myeloid leukemia, refers to a state in which blast cells in bone marrow increase or tumors consisting of leukemia cells are formed in multiple organs after complete remission. EXAMPLES

[0060] The present invention will now be described in further detail with reference to examples. 1. General description of the synthesis of PI polyamides Reagents and solvents were obtained from standard suppliers and used without further purification. Automated polyamide synthesis was performed using a PSSM-8 system (Shimadzu). High-performance liquid chromatography (HPLC) analysis was performed with a JASCO PU-2080 Plus pump, a JSCO UV-2075 Plus UV / vis detector, and a Chemcobond5-ODS-H 4.6 mm × 150 mm column (Chemo Plus Scientific). The mobile phase was acetonitrile-TFA (0.1%, v / v in water) at a flow rate of 1.0 mL / min. Matrix-assisted laser desorption / ionization mass spectrometry (MALDI-TOFMS) was obtained on a Microflex-KSII (Bruker Daltonics). Saturated HCCA (α-cyano-4-hydroxycinnamic acid) in TA30 (0.1% TFA / MeCN=7 / 3) was used as the matrix with peptide calibration standards. The synthesis of PI polyamides was carried out by the Fmoc solid-phase synthesis method reported previously. Oxime resin was used in all syntheses.

[0061] 2. Gel Shift Assay To develop a new FOXO inhibitor using PIP, we searched for FOXO binding sequences that contribute to the differentiation block. Gene expression analysis and CRISPR screening identified TRIB1, a component of the ubiquitin ligase complex, as a downstream factor for maintaining undifferentiation downstream of FOXO. We also found that FOXO induces TRIB1 expression via a typical FOXO response element (FRE), contributing to the differentiation block. Therefore, we developed a PIP that targets the FRE in the TRIB1 promoter. To efficiently suppress TRIB1 expression, chlorambucil (chb) was bound to PIP. The structure of the synthesized PIP-chlorambucil complex is shown below.

[0062] [ka]

[0063] The target sequence of PIP in the above complex is underlined in Figure 1. In contrast, 5'-TGTTTAC-3' in Figure 1 is the consensus sequence of FOXO. Since the synthesized complex targets the FOXO response element (FRE), this complex was named FRE-chb.

[0064] The synthesis of FRE-chb was carried out using FmocHN-Py-CO2H, FmocHN-Im-CO2H, FmocHN-β-alanine-CO2H, and FmocHN-γ-aminobutyric acid. Each starting material was added in turn to 86 mg of FmocHN-Py-oxime resin (0.44 mmol / g). The reaction was then cleaved with 1000 μL of N,N-dimethyl-1,3-propanediamine at 55 °C for 3 h, filtered, and 52.2 mg of Et2O precipitate was obtained. The precipitate was dissolved in 522 μL of dimethylformamide and mixed with chlorambucil (Chb, 19 mg, 2 equiv.), benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate (PyBOP, 67 mg, 4 equiv.), and N,N-diisopropylethylamine (DIEA, 65 μL, 12 equiv.) and stirred at room temperature for 2 h. After Et2O precipitation, FRE-chb was obtained. The crude product was dissolved in DMF and purified by HPLC to obtain pure FRE-chb (24.1 mg) as an off-white powder. For purification by HPLC, the retention time was 21.6 min (detected at 254 nm with 0.1% TFA containing 0-100% acetonitrile in a 40 min linear gradient at a flow rate of 1.0 mL / min). MALDI-TOFMS: m / z calcd for C 90 H 112 Cl2N 29 O 15 + [M+H] + Theoretical value: 1908.82, Actual value: 1910.41.

[0065] First, we confirmed whether this FRE-chb binds to the target sequence by gel shift assay. As probes, we used FRE-chb wild-type DNA probe with wild-type PIP binding sequence and FRE-chb mutant DNA probe with mutated binding sequence. FRE-chb wild-type DNA probe and FRE-T mutant DNA probe were prepared by annealing the following oligonucleotides. FRE-chb wtFw ACCCGGCTTCCCAACTGTTTACACA (SEQ ID NO: 1) FRE-chb wtRv TGTGTAAACAGTTGGGAAGCCGGGT (SEQ ID NO: 2) FRE-chb mtFw ACCCGGCTTCCCACAGAGGGACACA (SEQ ID NO: 3) FRE-chb mtRv TGTGTCCCTCTGTGGGAAGCCGGGT (SEQ ID NO: 4)

[0066] FRE-chb was reacted with the DNA probe (12 μM) in a reaction solution (13.3 mM NaCl, 13.3 mM KCl) for 1 hour. After adding Loading Dye, the sample was electrophoresed on a 20% polyacrylamide gel. The DNA probe was stained with ethidium bromide, and the signal was detected using a FUSION FX7 EDGE Imaging System (Witec AG). The results of the electrophoresis are shown in Figure 2.

[0067] As shown in Figure 2, FRE-chb bound specifically to the wt. Therefore, it was confirmed that FRE-chb binds to the target sequence of PIP.

[0068] 3. ChIP Assay Next, we performed a ChIP assay to confirm whether FRE-chb inhibits the association of FOXO with the TRIB1 promoter. First, HL-60 cells were cultured for 2 days in the presence of Chb-S and FRE-chb (400 nM). Here, Chb-S has the following structure:

[0069] [ka]

[0070] The synthesis of Chb-S was carried out according to the procedure described in the literature (Genetic regulation of the RUNX transcription factor family has antitumor effects. J Clin Invest 2017, 127(7): 2815-2828.). The crude product was purified by HPLC with a retention time of 21.8 min (0.1% TFA containing 0-75% acetonitrile with a linear gradient of 30 min at a flow rate of 1.0 mL / min, detected at 254 nm). MALDI-TOFMS: m / z calculation for C 70 H 87 Cl2N 25 O 11 + [M+H] + Theoretical value: 1524.647, measured value: 1525.620. 1H NMR (600 MHz, DMSO-d6): d = 10.34 (s, 2H), 10.33 (s, 1H), 10.32 (s, 1H), 9.93 (s, 2H), 9.33 (s, 1H), 9.31 (s, 1H), 8.15 (t, J = 5.5 Hz, 1H), 8.04 (t, J = 5.2 Hz, 1H), 7.89 (t, J = 5.5 Hz, 1H), 7.58 (s, 2H), 7.55 (s, 1H), 7.52 (s, 1H), 7.26 (s, 2H), 7.17 (s, 4H), 6.97 (d, J = 7.6 Hz, 2H), 6.95 (s, 1H), 6.91 (s, 1H), 6.61 (d, J = 7.6 Hz, 2H), 4.01 (s, 6H), 3.99 (s, 3H), 3.98 (s, 3H), 3.85 (s, 6H), 3.813 (s, 3H), 3.807 (s, 3H), 3.66 (m, 8H), 3.32 (q, J = 6.2 Hz, 2H), 3.23 (m, 4H), 3.06 (m, 2H), 2.79 (d, J = 3.4 Hz, 6H), 2.52 (m, 2H), 2.38 (m, 4H), 2.04 (t, J = 7.5 Hz, 2H), 1.82 (m, 4H), 1.70 (m, 2H).

[0071] Cells were cross-linked with 0.5% formalin for 10 min and the reaction was stopped with 0.125 M glycine. Cells were washed with PBS and disrupted in NP-40 buffer (10 mM Tris-HCl (pH 8.0), 10 mM NaCl, 0.5% NP-40). After centrifugation, the pellet was resuspended in 100 μL of lysis solution (50 mM Tris-HCl (pH 8.0), 176 mM NaCl, 1.1% sodium deoxycholate) and 400 μL of ChIP diluent (10 mM Tris-HCl (pH 8.0), 1% SDS, and 10 mM EDTA (pH 8.0)). After DNA shearing and centrifugation, soluble chromatin was immunoprecipitated with FOXO3 antibody (ab12162; Abcam) complexed with magnetic beads. The mixture was washed once with 150 mM RIPA buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA (pH 8.0), 0.1% SDS, 1% Triton X-100, and 0.1% sodium deoxycholate), once with 500 mM RIPA buffer (50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 1 mM EDTA (pH 8.0), 0.1% SDS, 1% Triton X-100, and 0.1% sodium deoxycholate), and twice with TE buffer. Bound DNA was eluted with 200 μL of elution solution (10 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5 mM EDTA (pH 8.0), 0.5% SDS) and decrosslinked at 65°C. The samples were then reacted with 1 μg of RNase (37°C, 30 min) and 100 μg of proteinase K (55°C, 1 h) and purified with phenol / chloroform. ChIP-qPCR was performed using the Mx3000P qPCR system (Agilent). The primer sequences for ChIP-qPCR are shown below. FRE-TFw CATTGCACAACCCGGCTTCC (SEQ ID NO: 5) FRE-TRv GACTCACGCTGTATACACACACA (SEQ ID NO: 6)

[0072] As a result, as shown in Figure 3, it was found that FOXO3 associates with the TRIB1 promoter and that FRE-chb inhibits the association of FOXO3 with the TRIB1 promoter.

[0073] Next, the effect of FRE-chb on the expression of TRIB1 was examined. HL-60 cells were cultured for 4 days in the presence of Chb-S and FRE-chb (400 nM), and then RNA was extracted using RNeasy Mini Kit (QIAGEN). cDNA was prepared using Advantage® RT-for-PCR kit (Clontech Laboratories, Inc.). Quantitative real-time PCR (qRT-PCR) was performed using Mx3000P qPCR System (Agilent). Gene expression was normalized with GAPDH. The primer sequences for qRT-PCR are shown below. GAPDHFw ATGGTTGCCACTGGGGATCT (SEQ ID NO: 7) GAPDHRv TGCCAAAGCCTAGGGGAAGA (SEQ ID NO: 8) TRIB1Fw TTCAAGCAGATTGTCTCCGC (SEQ ID NO: 9) TRIB1Rv AGTGGTGTTGAGGATCTCAG (SEQ ID NO: 10)

[0074] Consistent with the above results showing that FRE-chb inhibits the association of FOXO3 with the TRIB1 promoter, FRE-chb also suppresses the expression of TRIB1, as shown in Figure 4. Therefore, it was found that FRE-chb can inhibit the FOXO3-TRIB1 axis. Next, we performed a pharmacological evaluation.

[0075] 4. Evaluation of differentiation-inducing ability of FRE-chb The differentiation-inducing ability of FRE-chb was examined using the differentiation marker CD11b and nonspecific esterase (NSE) activity as indicators.

[0076] (1) Quantification of cell surface marker CD11b HL-60 and MOML-14 cells were treated with drugs for 4 days, and then reacted with APC-labeled anti-human CD11b antibody (BD Biosciences (Cat#550019)) on ice for 30 minutes. The cells were washed with 2% FBS-added PBS (F-PBS) and resuspended in F-PBS containing 7-AAD. The CD11b-positive cell population was quantified using FACS Lyric™ (BD Biosciences). The results are shown in Figure 5.

[0077] (2) Quantification of NSE activity THP-1 cells were treated with 200 nM for 3 days, SKM-1 cells with 100 nM for 5 days, U-937 cells with 400 nM for 4 days, and MOLM-14 and MV4-11 cells with 20 nM for 4 days, and then nonspecific esterase (NSE) analysis was performed. Cells were attached to glass slides using a cytospin, and NSE activity was quantified using an α-NA esterase staining kit (Muto Chemical Co., Ltd.). ImageJ software was used to quantify the intensity of NSE activity. The results are shown in Figure 6.

[0078] From the results of Figures 5 and 6, it was found that FRE-chb enhances CD11b or NSE activity in the six types of AML cell lines used in the experiment, and therefore, it was found that FRE-chb can induce differentiation in various AML cell lines.

[0079] 5. Evaluation of the anti-proliferative activity of FRE-chb The IC50 was then calculated to quantify the anti-proliferative potential of FRE-chb. Specifically, AML cell lines were cultured in the presence of AS1842856, control PIP Chb-S, and FRE-chb for 6 and 3 days, respectively, and viability was quantified using Cell Counting Kit 8 (Dojindo). Absorbance was measured using an Infinite Pro 200 Reader (Tecan). The results are shown in Figure 7 and Table 1.

[0080] As shown in Figure 7, FRE-chb had a stronger antiproliferative effect than the control PIP, with IC50 values ​​at the nM level in all cell lines. In addition, when compared with AS1842856, an existing FOXO inhibitor, FRE-chb showed lower IC50 values ​​in the four boxed cell types out of six, as shown in Table 1. In particular, the IC50 value was less than 1 / 10 in MV4-11, and less than 1 / 100 in MOLM-14 and SKM-1, demonstrating the superiority of the new FOXO inhibitor in vitro.

[0081] [Table 1]

[0082] 6. Colony Formation Assay Next, we compared the effects of FRE-chb on normal hematopoietic cells and AML cells in colony formation assays. + Lin - Cells were isolated from human umbilical cord blood using the Diamond CD34 Isolation Kit human (Miltenyi Biotec). + Lin - The cells were cultured in MethoCult H4034 Optimum (StemCell Technologies) supplemented with 100 ng / ml FLT3 ligand and 100 ng / ml human recombinant TPO. After 12 days of culture, the number of colonies was quantified using an All-in-One Fluorescence Microscope BZ-X800 (KEYENCE). SKM-1 and HL-60 cells were cultured in 1.5% methylcellulose medium supplemented with 20% FBS and penicillin / streptomycin. After 12 days of culture, the number of colonies was quantified. The results are shown in Figure 8.

[0083] The two on the left in Figure 8 are AML, and the cord blood on the right is a normal hematopoietic cell. FRE-chb specifically inhibits colony formation in AML, and has been shown to be promising for the treatment of AML.

[0084] 7.Therapeutic effect of FRE-chb The therapeutic effect of FRE-chb was examined in a subcutaneous tumor mouse model. NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ (NSG) mice were purchased from Ninox Lab Supply Co., Ltd. (Ishikawa, Japan). SKM-1 cells were administered at a concentration of 5 × 10 per mouse. 6 The mice were subcutaneously transplanted into NSG mice to create tumor mouse models. Three days after NSG transplantation, the mice were randomly divided into vehicle, Chb-S, or FRE-chb groups, and 1.28 mg / kg of FRE-chb was administered every two days via tail vein injection. The tumor volume was calculated as {(long diameter) × (short diameter) 2} / 2. Blood components were measured using a fully automated blood cell counter, Celltac α (Nihon Kohden). The measurement results are shown in Figures 9 to 11.

[0085] As shown in Figure 9, FRE-chb inhibited the expansion of tumor volume and was found to have an antitumor effect. On the other hand, as shown in Figures 10 and 11, no significant effects were observed on body weight and blood components. Therefore, it was suggested that FRE-chb may be an effective therapeutic drug that exhibits antitumor effects while avoiding side effects.

Claims

1. A FOXO inhibitor comprising a polymer having a pyrrole-imidazole polyamide structure that binds to a FOXO binding sequence.

2. The FOXO inhibitor of claim 1, wherein the polymer is a conjugate of a pyrrole-imidazole polyamide and an alkylating agent.

3. The FOXO inhibitor of claim 2, wherein the alkylating agent is chlorambucil.

4. The FOXO inhibitor of claim 3 , wherein the polymer has the following structure: 【Chemistry 1】

5. The FOXO binding sequence is (1) 5'-TGTTTAC-3' (2) 5'-TGTTTAG-3' (3) 5'-TGTTTTC-3' (4) 5'-TGTTTTG-3' (5) 5'-TATTTAC-3' (6) 5'-TATTTAG-3' (7) 5'-TATTTTC-3' or (8) 5'-TATTTTG-3' The FOXO inhibitor of claim 1 .

6. The FOXO inhibitor according to claim 1, which suppresses the expression of TRIB1.

7. A pharmaceutical composition for preventing or treating acute myeloid leukemia (AML), comprising the FOXO inhibitor of claim 1.

Images