PCR method

Abstract

To provide a PCR method in which measurement of a fluorescence signal associated with PCR amplification can be preferably performed without performing a complicated purification work or the like of nucleic acid even in a case where blood is an analyte.SOLUTION: A PCR method comprises: a step (S10) of adding blood to a PCR reagent to prepare a sample; a step (S14) of repeatedly reciprocating the sample in a flow channel of a micro fluid chip to impart thermal cycle to the sample; and a step (S16) of detecting fluorescence from the sample in the flow channel in order to monitor progress of PCR in the sample.SELECTED DRAWING: Figure 7

Description

[Technical field]

[0001] The present invention relates to a method for the Polymerase Chain Reaction (PCR). [Background technology]

[0002] Genetic testing is widely used in various medical fields, identification of agricultural crops and pathogenic microorganisms, food safety evaluation, and even testing for pathogenic viruses and various infectious diseases. In order to detect minute amounts of DNA with high sensitivity, a method is known in which a portion of DNA is amplified and analyzed. Among these, the method using PCR is a notable technology that selectively amplifies a certain portion of a very small amount of DNA collected from a living organism.

[0003] PCR is a method of selectively amplifying a specific portion of DNA by subjecting a biological sample containing DNA to a mixture of PCR reagents consisting of primers, enzymes, etc., and subjecting the sample to a prescribed thermal cycle, repeatedly inducing denaturation, annealing, and extension reactions. PCR analysis can be performed in real time by measuring the fluorescent signal while the DNA is being amplified and performing quantitative analysis.

[0004] In PCR, a predetermined amount of the target sample is placed in a PCR tube or a chip such as a microplate (microwell) with multiple holes, and the temperature of the sample is generally changed using a device called a thermal cycler (see, for example, Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2020 / 065917 Summary of the Invention [Problem to be solved by the invention]

[0006] However, in the conventional PCR method using PCR tubes or microplates as described above, when PCR is performed on a sample in which blood has been directly added to the PCR reagent, the heat denaturation at the beginning of PCR causes the blood components to brown, and the fluorescence transmittance of the sample decreases, so that the fluorescent signal accompanying PCR amplification cannot be accurately measured, and there is a risk that real-time PCR analysis cannot be performed appropriately. Real-time PCR is possible with conventional PCR methods by performing nucleic acid extraction and purification work from the blood to remove pigments that inhibit the measurement of fluorescent signals before adding it to the PCR reagent, or by diluting the blood, for example, by 10 times or more, and then adding only a trace amount of blood to the PCR reagent, but performing such work is very complicated and time-consuming.

[0007] The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a PCR method that can suitably measure the fluorescent signal accompanying PCR amplification without requiring complicated nucleic acid purification procedures, even when blood is used as a sample. [Means for solving the problem]

[0008] In order to solve the above problems, a PCR method according to one embodiment of the present invention comprises the steps of preparing a sample by adding blood to a PCR reagent, subjecting the sample to a thermal cycle by repeatedly moving the sample back and forth within a flow channel of a microfluidic chip, and detecting fluorescence from the sample in the flow channel to monitor the progress of PCR of the sample. Effect of the Invention

[0009] According to the present invention, a PCR method can be provided that can suitably measure the fluorescent signal accompanying PCR amplification without requiring complicated nucleic acid purification procedures, even when blood is used as a sample. [Brief description of the drawings]

[0010] [Figure 1] 1 is a perspective view showing a first surface side of a microfluidic chip applicable to a PCR method according to an embodiment of the present invention. [Diagram 2] FIG. 2 is a perspective view showing a second surface side of the microfluidic chip. [Diagram 3] FIG. 2 is a plan view of a first surface of a substrate provided on the microfluidic chip. [Figure 4] FIG. 2 is a plan view of a second surface of a substrate provided in the microfluidic chip. [Diagram 5] FIG. 2 is a conceptual diagram for explaining a cross-sectional structure of a microfluidic chip. [Figure 6] FIG. 1 is a schematic diagram for explaining a thermal cycle that can utilize a microfluidic chip and a PCR device for performing PCR. [Figure 7] 1 is a flowchart illustrating a PCR method according to the present embodiment. [Figure 8] FIG. 2 is a diagram for explaining how a sample changes when the sample is moved within a channel of a microfluidic chip. [Figure 9] FIG. 2 is a diagram for explaining how a sample changes when the sample is moved within a channel of a microfluidic chip. [Figure 10] FIG. 2 is a diagram for explaining how a sample changes when the sample is moved within a channel of a microfluidic chip. [Figure 11] FIG. 2 is a diagram for explaining how a sample changes when the sample is moved within a channel of a microfluidic chip. [Figure 12] FIG. 2 is a diagram for explaining how a sample changes when the sample is moved within a channel of a microfluidic chip. [Figure 13] FIG. 2 is a diagram for explaining how a sample changes when the sample is moved within a channel of a microfluidic chip. [Figure 14] FIG. 2 is a plan view of a first surface of another microfluidic chip applicable to a PCR method according to an embodiment of the present invention. [Figure 15] 15(a) and 15(b) are diagrams showing amplification curves obtained when a reciprocal flow type real-time PCR device is used. [Figure 16]FIG. 1 shows an amplification curve when a general real-time PCR device is used. [Figure 17] 17(a) and 17(b) are diagrams showing amplification curves obtained when a reciprocal flow type real-time PCR device is used. [Figure 18] FIG. 1 shows an amplification curve when a general real-time PCR device is used. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Hereinafter, an embodiment of the present invention will be described. The same or equivalent components, parts, and processes shown in each drawing will be given the same reference numerals, and duplicated descriptions will be omitted as appropriate. In addition, the embodiment does not limit the invention but is merely an example, and all the features and combinations thereof described in the embodiment are not necessarily essential to the invention.

[0012] FIG. 1 is a perspective view showing a first surface side of a microfluidic chip 10 applicable to a PCR method according to an embodiment of the present invention. FIG. 2 is a perspective view showing a second surface side of the microfluidic chip 10. FIG. 3 is a plan view of a first surface 14a of a substrate 14 included in the microfluidic chip 10. FIG. 4 is a plan view of a second surface 14b of a substrate 14 included in the microfluidic chip 10. FIG. 5 is a conceptual diagram for explaining the cross-sectional structure of the microfluidic chip 10. It should be noted that FIG. 5 is a diagram for explaining the positional relationship between the channel, film, and filter and the substrate, and is different from the cross-sectional view of the microfluidic chip in the embodiment.

[0013] A microfluidic chip (also called a "fluid chip," "(micro)channel chip," "reaction processing chip," "reaction processing container," "nucleic acid amplification chip," "DNA chip," or "measurement chip") 10 includes a channel 12 through which a sample to be subjected to a thermal cycle or a reaction moves. The microfluidic chip 10 includes a resin substrate 14 having a groove-shaped channel 12 through which a sample moves formed on a first surface 14a, a first sealing film 16 and a second sealing film 18 attached to the first surface 14a of the substrate 14, and a third sealing film 20 attached to the second surface 14b of the substrate. In addition, the microfluidic chip 10 may include a first filter 28 and a second filter 30 near both ends of the channel 12 of the substrate 14 for the purpose of suppressing contamination of the channel 12.

[0014] 3, a first surface 14a of a substrate 14 of a microfluidic chip 10 is provided with at least a groove-shaped flow channel 12, air communication ports 24, 26 arranged at both ends of the flow channel 12 for connecting outputs from a pump that communicates with the flow channel 12 and pressurizes or blows air into the flow channel, room-shaped chambers 32, 34 provided above the flow channel 12, and filter spaces 36, 38 for mounting filters 28, 30 for preventing contamination of the flow channel 12. The groove-shaped flow channel 12 is intended to carry a sample to be subjected to PCR or thermal cycling.

[0015] 4, groove-shaped air ducts 40, 42 for communicating the air communication ports 24, 26 with the filter spaces 36, 38, and a sample introduction port (sample introduction hole) 44 for introducing a sample into the flow channel 12 are provided on the second surface 14b of the substrate 14. The groove-shaped air ducts 40, 42 may be intended as a flow channel through which air mainly passes for blowing or pressurizing from a pump or the like connected to the air communication ports 24, 26. Providing the flow channel 12 and the air ducts 40, 42 on the two opposing main surfaces (first surface 14a and second surface 14b) of the substrate 14 in this manner helps to make effective use of the main surfaces of the substrate 14.

[0016] The substrate 14 of the microfluidic chip 10 is preferably made of a material that is stable against temperature changes and is not easily affected by the sample solution used. Furthermore, the substrate 14 is preferably made of a material that has good moldability, good barrier properties, and low autofluorescence. Such materials include resins such as acrylic, polypropylene, and silicone, and among these, cyclic polyolefin resins are preferred. When the substrate is made of resin, it can be produced in large quantities and with high quality by injection molding using a mold.

[0017] The size of the substrate 14 of the microfluidic chip 10 is not particularly limited, and any size is acceptable as long as it satisfies the chemical and physical actions in the flow paths formed in the substrate. On the other hand, if there is a demand to miniaturize the device in which the microfluidic chip is mounted, the microfluidic chip and the substrate constituting it can also be made smaller or thinner. The substrate 14 of the microfluidic chip 10 may be a parallel plate that is easy to mold, portable, and handle.

[0018] The size of the substrate 14 of the microfluidic chip 10 is, for example, a thickness of 1 mm to 10 mm, preferably 2 mm to 6 mm, and a rectangular shape of W×L in plan view, where W is 10 mm to 60 mm, preferably 20 mm to 35 mm, and H is 45 mm to 100 mm, preferably 60 mm to 85 mm.

[0019] The microfluidic chip 10 may be made of a transparent resin. The microfluidic chip 10 is expected to be used for amplifying nucleic acids contained in a sample by real-time PCR. When a sample containing nucleic acids undergoes a reaction in the flow channel of the microfluidic chip 10, the progress and completion of the reaction can be known by detecting and monitoring the fluorescence emitted from the sample in real time. As a part used for optical measurements such as detecting the fluorescence from the sample in the flow channel and irradiating excitation light to cause fluorescence, the microfluidic chip 10 is preferably made of a transparent material.

[0020] A groove-shaped flow channel 12 is formed on the first surface 14a of the substrate 14. In the microfluidic chip 10, most of the flow channel 12 is formed in a groove shape exposed on the first surface 14a of the substrate. The groove-shaped air ducts 40, 42 are formed in a groove shape exposed on the second surface 14b of the substrate 14. By adopting such a form, the substrate 14 having the flow channel 12 and the like on two opposing main surfaces can be easily molded by injection molding using a mold. In order to seal the grooves formed in the substrate 14 and use them as the flow channel 12, a flow channel sealing film is attached on each surface of the substrate 14. The dimensions of the flow channel 12 are, for example, about 0.2 mm to 1.5 mm in width and 0.2 mm to 2 mm in depth, and the dimensions of the flow channel 12 may be 0.7 mm in width and 0.7 mm in depth. In order to produce the substrate 14 industrially more advantageously by the injection molding method, the structure of the flow channel 12 may include a side surface having a certain angle with respect to the first surface 14a and the second surface 14b of the substrate 14, which is called a "draft taper". The taper angle may be from 1° to 30°, or may be from 3° to 15°.

[0021] The sealing films 16, 18, 20 for sealing the flow channel 12, the sample introduction port 44, the air communication port 24, 26, the chambers 32, 34, and the filters 28, 30 may have one of their main surfaces with adhesiveness, or may have a functional layer formed on one of their main surfaces that exhibits adhesiveness or bonding properties by pressing, irradiating energy such as ultraviolet rays, heating, or the like, and have the function of being easily attached to and integrated with the first surface 14a and the second surface 14b of the substrate 14. The sealing films 16, 18, 20 are desirably formed from a material that has low, preferably almost zero, autofluorescence, including the adhesive. In this respect, a transparent film made of a resin such as cycloolefin polymer, polyester, polypropylene, polyethylene, or acrylic is suitable, but is not limited to these. The sealing films 16, 18, 20 may also be formed from plate-shaped glass or resin. In this case, rigidity can be expected, which helps prevent warping and deformation of the microfluidic chip 10.

[0022] A first filter 28 is provided near one end of the flow channel 12. A second filter 30 may be provided near the other end of the flow channel 12. The pair of first filter 28 and second filter 30 provided near both ends of the flow channel 12 are intended to prevent contamination of the flow channel and the sample so as not to interfere with the amplification and detection of the target DNA by PCR or to prevent deterioration of the quality of the target DNA. The first filter 28 and second filter 30 are formed to have dimensions such that they fit snugly into filter spaces 36, 38 formed on the first surface 14a of the substrate 14.

[0023] The substrate 14 is formed with a first air communication port 24 that communicates with one end of the flow path 12 via a first air duct 40 and a first filter 28. Similarly, the substrate 14 is formed with a second air communication port 26 that communicates with the other end of the flow path 12 via a second air duct 42 and a second filter 30. The pair of first air communication port 24 and second air communication port 26 are formed so as to be exposed on the first surface 14a of the substrate 14.

[0024] A part of the flow channel 12 includes a thermal cycle region between the pair of the first filter 28 and the second filter 30, in which the temperature can be controlled at multiple levels by a PCR device described later. By setting the microfluidic chip 10 in a PCR device having a temperature control system including a heater, etc., a part of the flow channel 12 of the microfluidic chip 10 is heated by the temperature control system and maintained at a desired temperature. The temperature is controlled so as to be maintained at multiple temperatures required for applying a thermal cycle to cause a reaction such as PCR. The reaction includes a reaction in which the nucleic acid contained in the sample is thermally denatured, an annealing reaction, and an extension reaction. The temperature controlled in the part of the flow channel 12 may be a temperature that causes these reactions. By moving the sample so as to continuously go back and forth through such a reaction region in which multiple levels of temperature are maintained, the sample can be subjected to a thermal cycle.

[0025] In this embodiment, the thermal cycle region includes a first temperature region 46 and a second temperature region 48. When the microfluidic chip 10 is mounted on a PCR device described later, the first temperature region 46 is maintained at a relatively high temperature (for example, about 95°C), and the second temperature region 48 is maintained at a lower temperature than the first temperature region 46 (for example, about 60°C). Nucleic acids contained in the sample may undergo a thermal denaturation reaction in a flow path included in the first temperature region 46, and an annealing reaction and an extension reaction may occur in a flow path included in the second temperature region 48. The first temperature region 46 and the second temperature region 48 may be referred to as a "high temperature region" and a "medium temperature region" from the viewpoint of the high and low temperatures. The first temperature region 46 and the second temperature region 48 may be referred to as a "denaturation region" and an "annealing and extension region" from the viewpoint of the attributes of the reaction.

[0026] One end of the first temperature region 46 communicates with the first chamber 32. Furthermore, the first chamber 32 communicates with the first air communication port 24 via the first filter 28 and the first air duct 40. The other end of the first temperature region 46 communicates with one end of the second temperature region 48 via the connecting flow path 50. The other end of the second temperature region 48 communicates with one end of the third serpentine flow path 52 through the connecting flow path 41. The other end of the third serpentine flow path 52 communicates with the second chamber 34. Furthermore, the second chamber 34 communicates with the second air communication port 26 via the second filter 30 and the second air duct 42.

[0027] In this embodiment, the third serpentine channel 52 is a channel that is not directly related to thermal cycling or PCR, and includes a straight channel and a curved channel. By configuring the sample inlet 44 for introducing a sample into the channel to be connected to the third serpentine channel 52, the third serpentine channel 52 may be used as a buffer channel for storing samples to be subjected to PCR.

[0028] The first temperature region 46 and the second temperature region 48 each include a first serpentine channel 54 and a second serpentine channel 56, which are a combination of a curved channel and a straight channel and which are continuously folded back. It can also be said that a plurality of curved channels are connected by straight channels. In the case of such a serpentine channel, the limited effective area of ​​a heater or the like constituting a temperature control system described later can be effectively used, which contributes to reducing the temperature variation in each temperature region, and the actual size of the microfluidic chip 10 can be reduced, which is advantageous in contributing to the miniaturization of a PCR device. In addition, by combining a curved channel and a straight channel, it is possible to promote stirring and mixing of the sample flowing through the channel, compared to, for example, a case in which the temperature region is composed of only a straight channel. This allows the sample to be effectively separated into a solid component and a transparent solution component, as described later. The radius of curvature R2 of the curved channel may be 0.3 mm to 10 mm, and preferably 0.5 mm to 6 mm.

[0029] Meanwhile, the first temperature region 46 and the second temperature region 48 are connected by a linear connecting flow path 50. The connecting flow path 50 may be provided with a region (referred to as a "fluorescence detection region" or simply as a "detection region") 58 that is irradiated with excitation light in order to detect fluorescence from a sample flowing through the flow path when the microfluidic chip 10 is mounted on a PCR device described below. The flow path included in this fluorescence detection region 58 is referred to as a detection flow path 59.

[0030] The connection flow channel 50 corresponds to a portion where a part of a fluorescence detection device for detecting the fluorescence of a sample is disposed. Therefore, the interval between the first temperature region 46 and the second temperature region 48 may be relatively long, and for example, the interval between the first temperature region 46 and the second temperature region 48 may be longer than the linear flow channel included in the first temperature region 46 and / or the second temperature region 48. Since the part of the fluorescence detection device disposed in the connection flow channel 50 has a predetermined volume, it is advantageous to set the interval to a certain distance or more in order to dispose some parts of the fluorescence detection device. In addition, the longer the interval between the first temperature region 46 and the second temperature region 48, the smaller the thermal interference between both temperature regions can be. When the thermal interference between the temperature regions is small, the heat provided from the device through a temperature control means such as a heater can be effectively utilized, which contributes to power saving of the device.

[0031] On the other hand, since there are advantages (portability, weight, etc.) in reducing the size of the PCR device and the microfluidic chip 10, the distance between the first temperature region 46 and the second temperature region 48 may be shorter than, for example, 1 / 2 the length L of the long side in a plan view of the microfluidic chip 10. In this case, the degree of freedom in designing the microfluidic chip, such as mounting other elements and arranging margins and blank spaces, can be improved, and it is easy to ensure the size and portability required for a PCR device.

[0032] The first chamber 32 is disposed between the thermal cycle area and the first air communication port 24. More specifically, the first chamber 32 is disposed between the first temperature area 46 of the thermal cycle area and the first filter 28. The sample in the flow path moves toward the first temperature area 46, for example, by being pressurized or blown from the second air communication port 26. The first chamber 32 has a role of preventing the sample from being pushed excessively or overrunning the first temperature area 46 and reaching the first filter 28. By providing the first chamber 32 having a certain volume in the flow path, even if the sample passes a predetermined stop position in the thermal cycle area, the sample can be retained and stopped in the first chamber 32, and the flow of the sample toward the first air communication port 24 can be suppressed.

[0033] 3, the first chamber 32 includes a first connection part 32a which is a connection part (or an opening) with a flow path end of a flow path extending from the first temperature region 46 of the thermal cycle region, and a second connection part 32b which is a connection part with a flow path end of the flow path toward the first filter 28. The first chamber 32 has a first structure 32c in the vicinity of the first connection part 32a. This first structure 32c prevents the liquid sample that has entered the first chamber 32 from the first connection part 32a from moving directly toward the second connection part 32b, and contributes to preventing the sample from entering in the direction of the first filter 28.

[0034] The second chamber 34 is disposed between the thermal cycle region and the second air communication port 26. More specifically, the second chamber 34 is disposed between the third serpentine flow path 52 and the second filter 30. The sample in the flow path is, for example, pressurized or blown from the first air communication port 24, causing the sample to move toward the second temperature region 48. The second chamber 34 serves to prevent the sample from being pushed excessively or from overrunning the second temperature region 48 or the third serpentine flow path 52 and reaching the second filter 30.

[0035] 3, the second chamber 34 includes a third connection part 34a which is a connection part with a flow path end of the flow path extending from the third serpentine flow path 52, and a fourth connection part 34b which is a connection part with a flow path end of the flow path toward the second filter 30. The second chamber 34 has a second structure 34c in the vicinity of the third connection part 34a. This second structure 34c prevents the liquid sample that has entered the second chamber 34 from the third connection part 34a from moving directly toward the fourth connection part 34b, and contributes to preventing the sample from entering in the direction of the second filter 30.

[0036] The first chamber 32 and the second chamber 34 may have a function other than preventing sample overrun. For example, the first chamber 32 and the second chamber 34 may be used as reaction chambers. Specifically, a PCR reagent may be held in the first chamber 32 and the second chamber 34 in advance, and a sample may be added to the PCR reagent in the first chamber 32 and the second chamber 34, and then PCR may be performed.

[0037] 3, a first widening flow channel 60 may be provided between the first serpentine flow channel 54 and the first chamber 32. The first widening flow channel 60 is adjacent to the flow channel belonging to the first temperature region 46 and is provided on the inner side of the first serpentine flow channel 54 as viewed from the connecting flow channel 50. In addition, a second widening flow channel 62 may be provided between the second serpentine flow channel 56 and the third serpentine flow channel 52. The second widening flow channel 62 is adjacent to the flow channel belonging to the second temperature region 48 and is formed on the inner side of the flow channel belonging to the second temperature region 48 as viewed from the connecting flow channel 50.

[0038] The first widening channel 60 is provided so that its cross-sectional area is larger than that of the first serpentine channel 54. Similarly, the second widening channel 62 is provided so that its cross-sectional area is larger than that of the second serpentine channel 56. The first widening channel 60 and the second widening channel 62 each have a role of exerting a braking effect on the sample flowing through the first serpentine channel 54 and the second serpentine channel 56. This is based on Bernoulli's law, which states that the speed of a fluid passing through a flow tube is inversely proportional to the cross-sectional area of ​​the flow tube. When the sample flows through the first temperature region 46 and the second temperature region 48, a brake is applied to the sample, and a function is added to stop the sample within the first temperature region 46 and the second temperature region 48. In addition, by providing a region in which the cross-sectional area changes in a part of the channel 12 in this way, it is possible to promote stirring and mixing of the sample in that region. This allows the sample to be effectively separated into a solid component and a transparent solution component, as described below.

[0039] The microfluidic chip 10 may have at least one sample inlet for introducing a sample into the flow channel. The sample inlet is, for example, an inlet for introducing a sample containing a nucleic acid to be amplified into the flow channel. The sample inlet may have any shape, size, or arrangement as long as it has a perforated structure that communicates with any of the flow channels from the main surface of the substrate 14. In Figs. 3 and 4, as an example, a sample inlet 44 is provided so as to communicate with the third serpentine flow channel 52. In Figs. 3 and 4, the flow channel 12 is provided on the surface 14a, and the sample inlet 44 is provided on the surface 14b, and they are formed on opposing surfaces of the substrate 14, but they may be provided on the same surface of the substrate 14. A microfluidic chip according to another embodiment may have two sample inlets (a first sample inlet and a second sample inlet).

[0040] As shown in FIG. 1, a first sealing film 16 for sealing at least the flow path is attached to the first surface 14a of the substrate 14. The first sealing film 16 may be large enough to cover substantially the entire surface of the first surface 14a of the substrate 14. The first sealing film 16 may have holes pre-opened at positions corresponding to the air communication ports 24, 26 so that the air communication ports 24, 26 are not sealed in order to connect a nozzle leading from the discharge port of a pump of a liquid delivery system. The first sealing film 16 may be in a form in which the air communication ports 24, 26 are sealed. In this case, a nozzle leading from the discharge port of a pump used in a liquid delivery system for pressurizing or blowing air in the flow path is attached to the air communication ports 24, 26 when the microfluidic chip 10 is used. Therefore, if a hollow needle or the like is provided at the nozzle end, the film can be pierced with the tip of the needle to communicate with the output port of the pump and the air communication ports 24, 26.

[0041] On the first surface 14a of the substrate 14, in addition to using the first sealing film 16 for sealing the flow path 12, the filter spaces 36, 38, and the chambers 32, 34 except for the air communication ports 24, 26, an adhesive second sealing film 18 may be attached so that only the second air communication port 26 is sealed. In this case, a sealing film for sealing may not be attached to the first air communication port 24. When a sample is introduced into the microfluidic chip 10 from the sample introduction port 44, the first air communication port 24 serves as an exhaust port for air corresponding to the volume of the sample introduced into the flow path. Then, the output end of the pump of the liquid delivery system may be connected to the air communication ports 24, 26 of the microfluidic chip 10 in which the sample has been introduced into the flow path. At this time, the second sealing film may be peeled off. During distribution, the first air communication port 24 is open, but the second air communication port 26 and other ports are sealed with a sealing film, making it difficult for dust, dirt, and other particles to enter through the first air communication port 24, making it possible to suppress contamination.

[0042] As shown in FIG. 2, the second surface 14b of the substrate 14 is provided with groove-shaped air ducts 40, 42 that communicate between the air communication ports 24, 26 and the filter spaces 36, 38, and a sample introduction port 44 for introducing a sample into the flow path. A third sealing film 20 for sealing the groove-shaped air ducts 40, 42 may be attached to the second surface 14b of the substrate 14. Furthermore, a fourth sealing film for sealing the sample introduction port 44 may be attached to the second surface 14b of the substrate 14. If the air ducts 40, 42 and the sample introduction port 44 are close to each other, the air ducts 40, 42 and the sample introduction port 44 may be simultaneously sealed by the third sealing film 20. In this case, the fourth sealing film is not necessary.

[0043] 1 and 2 show an example in which the substrate 14 and each of these sealing films 16, 18, and 20 are attached and integrated together. Fig. 2 shows an example of the embodiment of the third sealing film 20 that simultaneously seals the air ducts 40, 42 and the sample introduction port 44.

[0044] An example will be described in which a sample is introduced into a flow channel through the sample introduction port 44. First, an operator peels off the third sealing film 20 to open the sample introduction port 44. At this time, the third sealing film 20 is peeled off to an extent that the sample introduction port 44 is opened, and the groove-shaped air ducts 40, 42 are left sealed.

[0045] Next, a measured amount of sample is introduced into the flow channel 12 through the sample introduction port 44 using a pipette, dropper, syringe, or the like. The pipette, dropper, syringe, or the like may be further operated to push the sample until it reaches the first temperature region 46 or the second temperature region 48 of the thermal cycle region. In this case, the position where the sample reaches can be set as the initial position of the sample during PCR or thermal cycling. The introduced sample pushes air of approximately the same volume as the sample in the flow channel, and is released from the first air communication port 24, which is open. At this time, the first air communication port 24 serves as an exhaust port when the sample is introduced.

[0046] Next, the third sealing film 20 is attached back to its original state. The third sealing film 20 preferably has a property that can withstand multiple cycles of attachment and removal. This is preferable from the viewpoints of maintaining the cleanliness of the microfluidic chip 10 during distribution and convenience of the sample introduction operation.

[0047] In addition, the second sealing film 18 and the third sealing film 20 may be provided with tabs 18a, 20a having non-adhesive front and back sides at the ends of the film so that they can be easily peeled off (and possibly reattached) when used from the state in which they are initially attached to the main surface of the substrate 14. This helps to improve the convenience of the operator in opening the sample introduction port 44 and the air communication ports 24, 26 of the microfluidic chip 10.

[0048] 2, the third sealing film 20 may have a corner portion 20b between the sample introduction port 44 and the air duct 42. This corner portion 20b serves as a guide for the limit of peeling off the third sealing film 20 when an operator opens only the sample introduction port 44. Also, a substantially circular cut may be provided in the corner portion to emphasize the guide, or the film may be peeled off partway to make it difficult for the film to tear.

[0049] FIG. 6 is a schematic diagram illustrating a PCR device (also called a "thermal cycle device," "thermal cycler," or "reaction processing device") 100 for performing thermal cycling and PCR that can utilize the microfluidic chip 10.

[0050] The PCR device 100 includes a mounting section 101 on which the microfluidic chip 10 is mounted, a first heater 102 for heating the first temperature region 46 of the flow channel 12, which is controlled to a relatively high temperature, a second heater 104 for heating the second temperature region 48 of the flow channel, and a temperature control system including a temperature sensor (not shown), such as a thermocouple, for measuring the actual temperature of each reaction region. Each heater may be, for example, a resistive heating element or a Peltier element. By using these heaters, an appropriate heater driver, and a control device 110 consisting of a microcomputer, a microprocessor, an electronic circuit, etc., the first temperature region 46 in the flow channel 12 of the microfluidic chip 10 is maintained at about 95°C, and the second temperature region 48 is maintained at about 60°C, and the temperature of each reaction region in the thermal cycle region required for carrying out PCR is set. Furthermore, the PCR device 100 includes a battery built into the device and a power supply unit (neither of which is shown) for receiving power from an external source in order to operate each of these parts appropriately. Explanations and descriptions of drivers for driving each part are omitted.

[0051] The PCR device 100 further includes a fluorescence detection device 106. A predetermined fluorescent probe is added to the sample S. As the amplification of DNA progresses, the intensity of the fluorescent signal emitted from the sample S increases, and the intensity value of the fluorescent signal can be used as an index for determining the progress and completion of PCR.

[0052] The fluorescence detection device 106 may be an optical fiber fluorescence detector FLE-510 manufactured by Nippon Sheet Glass Co., Ltd., which has a very compact optical system, can perform rapid measurements, and can detect fluorescence regardless of whether the location is bright or dark. This optical fiber fluorescence detector can be tuned so that the wavelength characteristics of its excitation light / fluorescence are suitable for the fluorescence characteristics emitted by the sample S, making it possible to provide an optimal optical / detection system for samples with various characteristics. Furthermore, due to the small diameter of the light beam provided by the optical fiber fluorescence detector, it is suitable for detecting fluorescence from samples present in small or narrow areas such as flow channels, and has excellent response speed.

[0053] The optical fiber type fluorescence detection device 106 includes an optical head 108, a fluorescence detection device main body (including a driver) 112, and an optical fiber 114 that connects the optical head 108 and the fluorescence detection device main body 112. The fluorescence detection device main body 112 includes a light source for excitation light (LED, laser, or other light source adjusted to emit a specific wavelength), an optical fiber type multiplexer / demultiplexer, and a photoelectric conversion element (photodetector such as PD, APD, or photomultiplier) (none of which are shown), and is made up of a driver, a microcomputer, and the like for controlling these. The optical head 108 is made up of an optical system such as a lens, and is responsible for the functions of directional irradiation of the excitation light to the sample and collecting the fluorescence emitted from the sample. The collected fluorescence is separated from the excitation light by the optical fiber type multiplexer / demultiplexer in the fluorescence detector driver through the optical fiber 114, and is converted into an electric signal by the photoelectric conversion element. As the optical fiber type fluorescence detector, one described in JP 2010-271060 A can be used. The optical fiber type fluorescence detector 106 can be further modified to enable coaxial detection of multiple wavelengths using a single or multiple optical heads. The invention described in International Publication No. 2014 / 003714 can be utilized for a fluorescence detector for multiple wavelengths and its signal processing.

[0054] In the PCR device 100, an optical head 108 is disposed so as to be able to detect the fluorescence from the sample S in the detection flow path 59. The sample S is repeatedly moved back and forth within the thermal cycle region in the flow path, whereby the reaction proceeds and a specific DNA contained in the sample S is amplified, so that the progress of DNA amplification can be known in real time by monitoring the fluctuation in the amount of detected fluorescence (real-time PCR). In addition, in the PCR device 100, the output value from the fluorescence detection device 106 is utilized to control the movement of the sample S. For example, the output value from the fluorescence detection device 106 may be transmitted to the control device 110 and used as a parameter for controlling the liquid delivery system 120 described below. The fluorescence detection device 106 is not limited to an optical fiber type fluorescence detection device, so long as it exhibits the function of detecting fluorescence from the sample.

[0055] Furthermore, the fluorescence detection device 106 can be provided with a plurality of sets of excitation light / fluorescence. For example, the first fluorescence detection device may be set to irradiate the sample with blue excitation light and detect green fluorescence emitted from the sample, and the second fluorescence detection device may be set to irradiate the sample with green excitation light and detect red fluorescence. Alternatively, fluorescence detection devices may be arranged that are preset with combinations of excitation light / fluorescence wavelength characteristics according to combinations of nucleic acids and fluorescent probes to be detected.

[0056] In the PCR device 100, the optical head 108 of the fluorescence detection device 106 is disposed so as to detect fluorescence from the sample in a connecting flow path 50 in the thermal cycle region. The connecting flow path 50 is a flow path that connects the first temperature region 46 and the second temperature region 48. As described above, the region in which fluorescence from the sample is expected to be detected is referred to as the fluorescence detection region 58. In addition, the flow path belonging to the fluorescence detection region 58 is referred to as the detection flow path 59. The detection flow path 59 is provided on the first surface 14a of the substrate 14 on which the flow paths are formed.

[0057] The PCR device 100 further includes a liquid delivery system 120 for moving and stopping the sample S in the flow path of the microfluidic chip 10. Although not limited to this, the liquid delivery system 120 can move the sample S in one direction in the flow path by feeding (blowing) air from either the first air communication port 24 or the second air communication port 26. Furthermore, the liquid delivery system 120 can stop the sample S at a predetermined position by stopping the blowing of air to the flow path or equalizing the pressure on both sides of the sample S in the flow path.

[0058] 6, the liquid delivery system 120 in this embodiment includes a liquid delivery pump 128, a first three-way valve 122, a second three-way valve 124, and a pressurized chamber 126. Furthermore, the liquid delivery system 120 may include a tube and a nozzle that connect the discharge port of the liquid delivery pump 128 and the air communication port.

[0059] The pressurized chamber 126 forms a space having a certain volume therein. The pressurized chamber 126 is configured to be able to change the pressure in the internal space. The pressure in the pressurized chamber 126 is maintained at a pressure (for example, 1.05 to 1.3 atm) higher than the atmospheric pressure in the surrounding environment of the PCR device 100 during PCR. The PCR device 100 may include, but is not limited to, a pressurized pump, an air pump, a blower, a micropump, a syringe pump, or the like (not shown) whose output port is connected to the pressurized chamber 126 in order to increase the pressure in the pressurized chamber 126. The atmospheric pressure in the surrounding environment of the PCR device 100 refers to the pressure (or atmospheric pressure) in the place where the PCR device 100 is installed, the place where PCR is performed by the PCR device 100, or, if the PCR device 100 is installed in a place partitioned from the surroundings, in the partitioned place. The pressure in the pressurized chamber 126 may be increased to a level that can prevent significant evaporation of the sample or generation of bubbles, which may affect the PCR reaction process, even if the sample is repeatedly exposed to high temperatures (about 95°C). The higher the pressure in the pressurized chamber 126, the more the effects of sample evaporation and the like can be suppressed. On the other hand, however, the liquid delivery system 120, including its handling, becomes more complex and larger. Therefore, a person skilled in the art can comprehensively assess the use, purpose, cost, effectiveness, etc. of the device and design the entire system.

[0060] The pressurized chamber 126 is provided with an atmospheric pressure release valve (leak valve) 127. The atmospheric pressure release valve 127 is controlled so that the pressure in the liquid delivery system 120 and the flow channel 12 of the microfluidic chip 10 becomes equal to the atmospheric pressure when the microfluidic chip 10 is attached or detached. This makes it possible to prevent the sample S from suddenly moving or jumping out.

[0061] The liquid sending pump 128 is disposed in the pressurized chamber 126. The liquid sending pump 128 may be an air blower or a micro-blower in which the pressure on the primary side (air intake side) and secondary side (air discharge side) are equal when the pump is stopped. It should be noted that the liquid sending pump 128 has the role of sending air into the flow path, and the liquid sample moves in response to the air blown or increased pressure, and is not a pump that actually sends the liquid itself.

[0062] A first port A of the first three-way valve 122 is connected to an output port (discharge port) 128a of the liquid-sending pump 128. A second port B of the first three-way valve 122 is connected to the internal space of the pressurized chamber 126. A third port C of the first three-way valve 122 is connected to one end of a first tube 130, and the other end of the first tube 130 is connected to the first air communication port 24 of the microfluidic chip 10 as a first output port 131 of the liquid-sending system 120. The first three-way valve 122 is switchable between a state in which the first air communication port 24 of the microfluidic chip 10 is connected to the output port 128a of the liquid-sending pump 128 and a state in which the first air communication port 24 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126. When the first air communication port 24 of the microfluidic chip 10 and the output port 128a of the liquid-feeding pump 128 are communicated with each other, the first three-way valve 122 is controlled to a state in which port A and port C are communicated with each other. On the other hand, when the first air communication port 24 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126, the first three-way valve 122 is controlled to a state in which port B and port C are communicated with each other.

[0063] The first port A of the second three-way valve 124 is connected to the output port 128a of the liquid-sending pump 128. The second port B of the second three-way valve 124 is connected to the internal space of the pressurized chamber 126. The third port C of the second three-way valve 124 is connected to the second air communication port 26 of the microfluidic chip 10. The third port C of the second three-way valve 124 is connected to one end of a second tube 132, and the other end of the second tube 132 is connected to the second air communication port 26 of the microfluidic chip 10 as a second output port 133 of the liquid-sending system 120. The second three-way valve 124 can switch between a state in which the second air communication port 26 of the microfluidic chip 10 is connected to the output port 128a of the liquid-sending pump 128 and a state in which the second air communication port 26 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126. When the second air communication port 26 of the microfluidic chip 10 and the output port 128a of the liquid-feeding pump 128 are communicated with each other, the second three-way valve 124 is controlled to a state in which port A and port C are communicated with each other. On the other hand, when the second air communication port 26 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126, the second three-way valve 124 is controlled to a state in which port B and port C are communicated with each other.

[0064] The liquid delivery pump 128, the first three-way valve 122 and the second three-way valve 124 can be operated by the control device 110 through appropriate drivers. In particular, the optical head 108 arranged as described above transmits an output value based on the obtained fluorescent signal to the control device 110, and the control device 110 recognizes the position of the sample S in the flow path and its passage, thereby controlling the liquid delivery system 120.

[0065] A case where the sample S is moved from the first temperature region 46 to the second temperature region 48 using the liquid sending system 120 will be described. The liquid sending pump 128 is controlled to an operating state (ON). The first three-way valve 122 is controlled to a state where the first port A and the third port C are communicated, and the second three-way valve 124 is controlled to a state where the second port B and the third port C are communicated. As a result, the first air communication port 24 of the microfluidic chip 10 is communicated with the output port 128a of the liquid sending pump 128, and the second air communication port 26 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126. In this embodiment, since the liquid sending pump 128 is disposed in the pressurized chamber 126, when air is discharged from the liquid sending pump 128, the pressure of the first air communication port 24 of the microfluidic chip 10 becomes higher than the second air communication port 26, and the sample S moves from the first temperature region 46 to the second temperature region 48. When the sample S reaches the second temperature region 48, the first three-way valve 122 is controlled to a state in which the second port B and the third port C are in communication, and the second three-way valve 124 is controlled to a state in which the second port B and the third port C are in communication. As a result, the first air communication port 24 and the second air communication port 26 are both in a state in which they are open to the internal space of the pressurized chamber 126, so that the sample S stops in the second temperature region 48. Conversely, when moving the sample S from the second temperature region 48 to the first temperature region 46, the first three-way valve 122 and the second three-way valve 124 can be operated in the reverse order to that described above.

[0066] In this manner, by sequentially and continuously operating the first three-way valve 122 and the second three-way valve 124 connected to both sides of the flow path 12, the sample S can be continuously moved back and forth within the flow path between the first temperature region 46 and the second temperature region 48, thereby providing the sample S with an appropriate thermal cycle.

[0067] In the PCR device 100, a liquid delivery pump 128 is disposed in the internal space of a pressurized chamber 126 set at a pressure (for example, 1.3 atm) higher than the atmospheric pressure of the surrounding environment, and the second port B of the first three-way valve 122 and the second three-way valve 124 is configured to be open to the internal space of the pressurized chamber 126. Therefore, during the reaction process, the entire flow channel 12 of the microfluidic chip 10 is maintained at a pressure higher than the atmospheric pressure of the surrounding environment. This is particularly advantageous when the PCR device 100 is used, for example, at high altitudes such as Mexico City or inside an airplane during flight. The first temperature of the first temperature region 46 is 95°C or close to it. Since the pressure at high altitudes and inside an airplane is lower than 1 atm, there is a possibility that a part of the sample S will boil even at 95°C. However, by employing the liquid delivery system 120 including the pressurized chamber 126 of the PCR device 100, it is possible to suppress undesirable boiling of the sample in such a low atmospheric pressure environment. In addition, the PCR device 100 can be used without problems even in environments other than low atmospheric pressure.

[0068] The liquid delivery system may adopt a form other than that shown in FIG. 6. As the pump, a syringe pump, a diaphragm pump, a micro-blower, a blower, or the like may be used. Since two pumps are used, it may be necessary to adjust the individual differences of the pumps in order to stop them accurately at the target temperature range. In this case, an air-blowing pump consisting of a blower or a micro-blower that equalizes the pressure on the primary side (air intake side) and the secondary side (air discharge side) when stopped can be used for the two pumps. When moving the sample, only the pump corresponding to that direction is operated. When stopping the sample, both pumps are stopped. This balances the pressure on both sides of the sample, so the sample can be stopped.

[0069] The PCR device 100 to which the microfluidic chip 10 having the flow channel 12 can be applied is also called a reciprocal flow type real-time PCR device.

[0070] As described above, in conventional PCR methods using PCR tubes or microplates, when performing real-time PCR using blood as a sample, it was necessary to extract and purify nucleic acids from the blood to remove pigments that inhibit the measurement of fluorescent signals before adding them to the PCR reagent, or to dilute the blood, for example, 10 times or more, and then add only a small amount of blood to the PCR reagent. This is because, in conventional PCR methods, when PCR is performed on a sample in which blood has been directly added to the PCR reagent, the blood components brown due to heat denaturation at the beginning of PCR, reducing the fluorescent transmittance of the sample, making it impossible to accurately measure the intensity of the fluorescent signal accompanying PCR amplification. In other words, in conventional PCR methods, the color of the blood components in the sample prevented fluorescent detection.

[0071] While conducting real-time PCR experiments on various samples, the inventors discovered that by using a microfluidic chip 10 having a fine flow path 12 through which the above-mentioned samples flow and a PCR device 100 that provides thermal recycling to the microfluidic chip 10, it is possible to effectively measure the fluorescent signal associated with PCR amplification even for samples in which blood has been directly added to the PCR reagent.

[0072] 7 is a flow chart for explaining the PCR method according to this embodiment. The PCR method according to this embodiment is a real-time PCR method using blood as a sample.

[0073] In the PCR method according to this embodiment, first, blood is added to a PCR reagent to prepare a sample (S10). Here, "blood" means "whole blood". In this specification, "adding blood to a PCR reagent" means adding whole blood directly to the PCR reagent as it is, and adding nucleic acid purified from blood to a PCR reagent or adding crude blood that has been simply purified to a PCR reagent is not called the act of adding blood to a PCR reagent. Please note that in conventional technical documents, adding such blood to a PCR reagent is sometimes expressed as "adding blood to a PCR reagent".

[0074] The PCR reagents include primers and a probe, which may be a TaqMan probe (TaqMan is a registered trademark of Roche Diagnostics Gesellschaft mit Beschlenkter Haftung).

[0075] A sample is prepared by adding a predetermined amount of blood to a predetermined amount of PCR reagent. The blood content in the sample may be 0.01% to 20%, preferably 0.1% to 10%, and more preferably 1% to 5%. For example, 20 μL of sample with a blood content of 5% can be prepared by adding 1 μL of whole blood to 19 μL of PCR reagent.

[0076] Next, the microfluidic chip 10 is prepared, and the prepared sample is introduced into the flow channel 12 in the microfluidic chip 10 (S12). The sample is introduced into the flow channel 12 from the sample introduction port 44 of the microfluidic chip 10 using a pipette, a dropper, a syringe, or the like.

[0077] In S10 and S12, the sample is prepared and then introduced into the microfluidic chip 10, but the sample may be prepared within the microfluidic chip 10. For example, as described above, PCR reagents may be held in advance within the first chamber 32 and the second chamber 34, and blood may be added to the PCR reagents within the first chamber 32 and the second chamber 34.

[0078] Next, the sample is repeatedly moved back and forth between the first temperature region 46 and the second temperature region 48 of the microfluidic chip 10 to apply thermal cycling to the sample (S14). By applying several tens of thermal cycles to the sample, the target nucleic acid is amplified.

[0079] During the thermal cycle of S14, a fluorescent signal emitted from the sample in the flow channel 12 is detected (S16) in order to monitor the progress of PCR of the sample. Then, based on the detected fluorescent signal, real-time PCR analysis is performed (S18). In real-time PCR analysis, an amplification curve is created with the cycle number (C) on the horizontal axis and the fluorescent signal intensity on the vertical axis. When the sample is subjected to thermal cycles and the target nucleic acid in the sample is amplified, the intensity of the fluorescent signal increases. The cycle number at which the fluorescent signal intensity rises exponentially is called the Ct value (threshold cycle number), and the Ct value decreases as the initial sample concentration increases. In real-time PCR analysis, it is extremely important to accurately measure the fluorescent signal intensity in order to determine the Ct value.

[0080] 8 to 13 are diagrams for explaining how the sample S changes when the sample S is moved within the flow channel 12 of the microfluidic chip 10. Fig. 8 to Fig. 13 show a schematic diagram of the flow channel 12 formed on the first surface 14a of the microfluidic chip 10. The sample S is prepared by directly adding blood to a PCR reagent.

[0081] Fig. 8 shows the state immediately after the sample S is introduced into the flow channel 12 from the sample introduction port 44. The sample S immediately after introduction is located in the third serpentine flow channel 52 as shown in Fig. 8. The sample S immediately after introduction is red and transparent.

[0082] 9 shows the state in which the sample S has been moved from the third serpentine flow channel 52 through the second temperature region 48 and the connecting flow channel 50 to the first temperature region 46. As described above, the sample can be moved within the flow channel 12 by pressurizing or blowing air through the air communication ports 24, 26. In the first temperature region 46, the sample is heated to about 95° C. for 15 seconds. This causes the sample S to change from a transparent red color to an opaque light brown color.

[0083] 10 shows the state in which the sample S has been transferred from the first temperature region 46 to the second temperature region 48 through the connecting flow path 50. In the second temperature region 48, the sample S is heated at about 60° C. for 15 seconds. As a result, the sample S gradually begins to separate into a solid component (precipitate) and a transparent solution component. The solid component of the sample S is light brown and opaque, and the transparent solution component is light brown and transparent.

[0084] 11 shows the state in which the sample S has been transferred from the second temperature region 48 to the first temperature region 46 through the connecting flow path 50. In the first temperature region 46, the sample S is heated to about 95° C. for 15 seconds. This promotes aggregation of the solid components of the sample S, and further promotes separation of the colored solid components from the transparent solution components.

[0085] FIG. 12 shows the state in which the sample S has been moved from the first temperature region 46 through the connecting flow channel 50 to the second temperature region 48. In the second temperature region 48, it is heated to about 60° C. for 15 seconds. This causes further aggregation of the solid components of the sample S, and as shown in FIG. 12, the separation of the colored solid components and the transparent solution component becomes clear. The solid components of the sample S change from a light brown opaque color to a dark brown opaque color. The transparent solution component is light brown and transparent.

[0086] 13 shows the state in which the sample S has been moved from the second temperature region 48 to the first temperature region 46 through the connecting flow path 50. In the first temperature region 46, the sample S is heated to about 95° C. for 15 seconds. This causes further aggregation of the solid components of the sample S, and further separation of the colored solid components (dark brown) from the transparent solution components (light brown, transparent) proceeds.

[0087] Thereafter, PCR proceeds and the target nucleic acid is amplified by repeatedly (several dozen cycles) moving the sample S back and forth between the first temperature region 46 and the second temperature region 48 in the same manner. During this time, the sample S remains separated into a colored solid component (dark brown) and a transparent solution component (light brown, transparent).

[0088] The inventors have found that, as described above, the blood specimen S is separated into an opaque colored solid component and a transparent solution component by several reciprocating movements between the first temperature region 46 and the second temperature region 48 at the beginning of PCR. In typical PCR in which reagents do not move, blood components are not separated in this manner after the blood is denatured by heating, making it difficult to accurately measure the intensity of the fluorescent signal due to PCR amplification. However, in the present invention, the sample S is separated into a colored solid component and a transparent solution component, making it possible to accurately measure the intensity of the fluorescent signal emitted from the transparent solution component, and therefore real-time PCR analysis can be suitably performed.

[0089] In the PCR method according to this embodiment, the phenomenon in which the sample separates into a solid component and a transparent solution component in the channel 12 is presumably due to the sample being stirred and mixed as it moves through the channel 12. In the microfluidic chip 10, the first temperature region 46 and the second temperature region 48 include a first serpentine channel 54 and a second serpentine channel 56 that combine a straight channel and a curved channel. By flowing the sample through the curved channel, the sample is stirred and mixed more than when it is simply flowed through a straight channel, accelerating the separation of the fixed component and the transparent solution component of the sample.

[0090] The microfluidic chip may be configured so that the cross-sectional area of ​​a portion of the flow channel 12 is different from that of the other portions. In this case, the unevenness of the portion where the cross-sectional area changes will further agitate and mix the sample, facilitating the separation of the fixed component of the sample from the transparent solution component. An example of this is shown below.

[0091] Fig. 14 is a plan view of a first surface 14a of another microfluidic chip 70 applicable to a PCR method according to an embodiment of the present invention. As shown in Fig. 14, in the microfluidic chip 70, the cross-sectional area of ​​the detection channel 59 in the connection channel 50 is larger than the cross-sectional areas of the first serpentine channel 54 and the second serpentine channel 56. The unevenness of the portion where the cross-sectional area of ​​the channel changes causes the sample to be stirred and mixed more effectively, accelerating the separation of the fixed component and the transparent solution component of the sample.

[0092] The PCR reagent may contain a surfactant. When a surfactant is added to the PCR reagent, the sample can be mixed appropriately while flowing through the flow path 12. The surfactant may be any of cationic surfactants, anionic surfactants, zwitterionic surfactants, and nonionic surfactants, and may be either a high molecular weight or low molecular weight surfactant. Examples of surfactants include pure soap, alpha sulfo fatty acid ester salts, linear alkylbenzene sulfonates, alkyl sulfate ester salts, alkyl ether sulfate ester salts, alpha olefin sulfonates, alkyl sulfonates, sucrose fatty acid esters, sorbitan fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene fatty acid esters, fatty acid alkanolamides, alkyl glucosides, polyoxyethylene alkyl ethers, polyoxyethylene alkyl phenyl ethers, alkyl amino fatty acid salts, alkyl betaines, alkyl amine oxides, alkyl trimethyl ammonium salts, and dialkyl dimethyl ammonium salts. Specifically, N,N-Bis(3-D-gluconamidopropyl)cholamide [BIGCHAP], N,N-Bis(3-D-gluconamidopropyl)deoxycholamide[Deoxy-BIGCHAP]、NIKKOL BL-9EX [Polyoxyethylene(9)Lauryl Ether]、Octanoyl-N-methylglucamide [MEGA-8]、Nonanoyl-N-methylglucamide [MEGA-9]、Decanoyl-N-methylglucamide [MEGA-10]、Polyoxyethylene(8)Octylphenyl Ether [Triton X-114]、Polyoxyethylene(9)Octylphenyl Ether [NP-40]、Polyoxyethylene(10)Octylphenyl Ether [Triton X-100]、Polyoxyethylene(20)Sorbitan Monolaurate [Tween 20]、Polyoxyethylene(20)Sorbitan Monopalmitate [Tween 40]、Polyoxyethylene(20)Sorbitan Monostearate [Tween 60]、Polyoxyethylene(20)Sorbitan Monooleate [Tween 80]、Polyoxyethylene(20)Sorbitan Trioleate、Polyoxyethylene(23)Lauryl Ether [Brij35]、Polyoxyethylene(20)Cethyl Ether [Brij58]、n-Dodecyl-β-D-maltopyranoside、n-Heptyl-β-D-thioglucopyranoside、n-Octyl-β-D-glucopyranoside、n-Octyl-β-D-thioglucopyranoside、n-Nonyl-β-D-thiomaltoside、IGEPAL CA-630、Digitonin、Saponin,from Soybeans, 3-[(3-Cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonate [CHAPSO], 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate [CHAPS], Sodium Dodecylsulfate [SDS], Lithium Dodecyl Sulfate [LDS], Lithium 3,5-Diiodosalicylate, Tris(hydroxymethyl)aminomethane Dodecyl Sulfate[Tris DS], Sodium Cholate, N-Lauroylsarcosine, Sodium N-Dodecanoylsalcosinate, Cetyldimethylethylammonium Bromide, Cetyltrimethylammonium Bromide[CTAB], Cetyltrimethylammonium Chloride, Guanidine Thiocyanate, etc. are used.,

[0093] The PCR reagent may contain an additive. When an additive is added to the PCR reagent, the sample can be mixed appropriately while flowing through the flow channel 12. This is because the proteins in the blood are denatured and do not interfere with PCR. In order to increase the efficiency and specificity of the amplification reaction of the present invention, it is effective to add an appropriate amount of additives such as ammonium sulfate, bovine serum albumin, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), betaine, formamide, gelatin, glycerol, PEG6000, SDS, spermidine, Triton, Triton X-100, urea, etc. In addition to adding the above substances, the amplification reaction can be efficiently carried out by mixing an alkaline solution with the sample. Examples of the alkaline solution include, but are not limited to, solutions of alkali metal hydroxides, such as sodium hydroxide solution and potassium hydroxide solution. The alkaline concentration (OH-1 concentration) can be 0.1 mM or more, or 1 mM or more, preferably 10 mM or more, and more preferably 30 mM or more. Alternatively, the pH can be at least 7, preferably at least 8, more preferably at least 9. The alkaline concentration and pH can be any concentration and pH (e.g., 10 M or less) as long as they do not inhibit the subsequent detection or amplification step.

[0094] Examples will now be described.

[0095] (First Example) In the first embodiment, a reciprocal flow real-time PCR device and a general real-time PCR device using PCR tubes were used to prepare samples by directly adding blood to a PCR reagent, and real-time PCR measurements were performed.

[0096] A sample was prepared under the following conditions. Primers (each 0.9 μM) shown in SEQ ID NO: 1 and 2 for amplifying horse mackerel genes, a probe (0.4 μM) shown in SEQ ID NO: 3, and 10 μM of template DNA shown in SEQ ID NO: 4 were used so that the 2×PCR reagent of GoTaq (registered trademark) Enviro qPCR Systems (manufactured by Promega) was diluted 2-fold. 5A PCR reagent containing 19 μL of PCR product was prepared. 1 μL of whole blood or ddH 2 O was added to prepare 20 μL of a sample, which was used as a sample for one reaction in each device. The sequences are shown below. Primer: 5'-CAGATATCGCAACCGCCTTT-3' (SEQ ID NO: 1) Primer: 5'-CCGATGTGAAGGTAAATGCAAA-3' (SEQ ID NO: 2) Probe: 5'-[FAM]-TATGCACGCCAACGGCGCCT-[BHQ1]-3' (SEQ ID NO: 3) Template DNA: 5'CAGATATCGCAACCGCCTTTACATCCGTAGCACACATCTGCCGGGACGTAAACTACGGCTGACTTATTCGCAATGCACGCCAACGGCGCCTCCTTCTTTTTCATTTGCATTTACCTTCACATCGG-3' (SEQ ID NO: 4)

[0097] The real-time PCR device and PCR conditions are shown below. The reciprocal flow type measurement chip and real-time PCR device correspond to the microfluidic chip 10 and PCR device 100 described above. (Reciprocal flow real-time PCR device and PCR conditions) Measurement equipment: PicoGene PCR1100 (GoPhoton) Measurement chip: MCP2000 (GoPhoton) Measurement conditions: PCR1100 set value Hot Start 95℃, 15sec. Denaturation 95℃, 3.5sec. Annealing & Extension 60℃,15sec. Cycle 50 (General real-time PCR equipment and PCR conditions) Measurement equipment: CFX96 Touch Deep Well (manufactured by Bio-Rad) Measurement tube: 8 tubes Measurement conditions: Actual measured values ​​of CFX96 Touch Deep Well (same as PCR1100) Hot Start 95℃, 15sec. Denaturation 95℃, 3.5sec. Annealing & Extension 60℃,15sec. Cycle 50

[0098] When using a reciprocal flow real-time PCR device, a sample consisting of blood added to PCR reagent is alternately sent through the flow path 12 to a first temperature region 46 of 95°C and a second temperature region 48 of 60°C, whereby the sample is stirred and mixed while the blood coagulates, separating the solid component from the clear solution component, making it possible to measure the fluorescent signal of the clear solution component.

[0099] Figures 15(a) and 15(b) show amplification curves obtained when using a reciprocal flow real-time PCR device. Figure 15(a) is a real-time amplification curve for a sample with added blood, and Figure 15(b) is a real-time amplification curve for a sample without added blood. As shown in Figures 15(a) and 15(b), similar amplification curves can be obtained for samples with and without added blood, making it very easy to determine the PCR amplification.

[0100] Measurements were performed using a PCR tube with a general real-time PCR device. In a general real-time PCR device, the PCR reaction proceeds while the sample remains stationary in the PCR tube. For samples without added blood, the sample was transparent both before and during PCR, and the fluorescent signal accompanying PCR amplification could be adequately measured. On the other hand, for samples with added blood, the sample was red and transparent before PCR, but during PCR, the blood components browned due to heat denaturation at the beginning of PCR, and the fluorescent transmittance of the sample decreased. As a result, it became impossible to adequately measure the fluorescent signal accompanying PCR amplification.

[0101] Figure 16 shows the amplification curves obtained using a typical real-time PCR device. As shown in Figure 16, the amplification curve for the sample to which no blood was added has a clear rise in the curve, making it possible to clearly determine PCR amplification. On the other hand, the amplification curve for the sample to which blood was added has an unclear rise in the curve, making it very difficult to determine PCR amplification.

[0102] (Second Example) In the second example, a reciprocal flow real-time PCR device and a general real-time PCR device using PCR tubes were used to prepare samples by directly adding blood to an RT-PCR reagent, and real-time RT-PCR measurements were performed.

[0103] A sample was prepared under the following conditions. A predetermined amount of reverse transcriptase included with GoTaq (registered trademark) Enviro RT-qPCR Systems (manufactured by Promega Corp.) was added, and the 2xPCR reagent was diluted 2-fold to amplify the SFTS gene. The primers (0.9 μM each) shown in SEQ ID NO: 5 and 6, the probe (0.3 μM) shown in SEQ ID NO: 7, and the template RNA 10 shown in SEQ ID NO: 8 were used. 5 19 μL of RT-PCR reagent containing 1 copy was prepared. 1 μL of whole blood or ddH 2 O was added to prepare 20 μL of a sample, which was used as a sample for one reaction in each device. The sequences are shown below. Primer: 5'-ACCTGTCTCCTTCAGCTTCT-3' (SEQ ID NO: 5) Primer: 5'-TGTCAGAGTGGTCCAGGATT-3' (SEQ ID NO: 6) Probe: 5'-FAM-TGGAGTTTGGTGAGCAGCAGC-BHQ1-3' (SEQ ID NO: 7) Template RNA: 5'ACCTGTCTCCTTCAGCTTCTTGATGATCAATGCAGGATCAAGGCCTTCATAGGCCAGCTCTCGCAAAATCTTCAAGCTCAGTCAAATTGAGCTGCTGCTCACCAAACTCCACTGCAATCCTGGACCACTCTGACA-3' (SEQ ID NO: 8)

[0104] The real-time PCR device and PCR conditions are shown below. The reciprocal flow type measurement chip and real-time PCR device correspond to the microfluidic chip 10 and PCR device 100 described above. (Reciprocal flow real-time PCR device and PCR conditions) Measurement equipment: PicoGene PCR1100 (GoPhoton) Measurement chip: MCP2000 (GoPhoton) Measurement conditions: PCR1100 set value RT 50℃,5min. Hot Start 95℃, 15sec. Denaturation 95℃, 3.5sec. Annealing & Extension 60℃,20sec. Cycle 45 (General real-time PCR equipment and PCR conditions) Measurement equipment: CFX96 Touch Deep Well (manufactured by Bio-Rad) Measurement tube: 8 tubes Measurement conditions: Actual measured values ​​of CFX96 Touch Deep Well (same as PCR1100) RT 50℃,5min. Hot Start 95℃, 15sec. Denaturation 95℃, 3.5sec. Annealing & Extension 60℃,20sec. Cycle 45

[0105] When using a reciprocal flow real-time PCR device, just as when the template is DNA, the sample prepared by adding blood to the RT-PCR reagent is subjected to a reverse transcription reaction at 50°C for 5 minutes in the flow path 12, and then alternately sent to a first temperature region 46 at 95°C and a second temperature region 48 at 60°C. As the sample is stirred and mixed, blood coagulation progresses, and the solid component is separated from the clear solution component, making it possible to measure the fluorescent signal of the clear solution component.

[0106] Figures 17(a) and 17(b) show amplification curves obtained when using a reciprocal flow real-time PCR device. Figure 17(a) is a real-time amplification curve for a sample with added blood, and Figure 17(b) is a real-time amplification curve for a sample without added blood. As shown in Figures 17(a) and 17(b), similar amplification curves can be obtained for samples with and without added blood, making it very easy to determine the PCR amplification.

[0107] On the other hand, in a typical real-time PCR device, the RT-PCR reaction proceeds while the sample remains stationary within the PCR probe. For samples without added blood, the sample was transparent both before and during PCR, and the fluorescent signal accompanying PCR amplification could be adequately measured. For samples with added blood, the sample was red and transparent before PCR, but during PCR, the blood components browned due to heat denaturation at the beginning of PCR, decreasing the fluorescent transmittance of the sample. As a result, it became impossible to adequately measure the fluorescent signal accompanying RT-PCR amplification.

[0108] Figure 18 shows the amplification curves obtained using a typical real-time PCR device. As shown in Figure 18, the amplification curve for the sample to which no blood was added has a clear rise in the curve, making it possible to clearly determine PCR amplification. On the other hand, the amplification curve for the sample to which blood was added has an unclear rise in the curve, making it very difficult to determine PCR amplification.

[0109] From the PCR results of the first and second examples, it can be seen that the PCR method according to this embodiment can suitably measure the fluorescent signal accompanying PCR amplification for a sample in which blood is directly added to the PCR reagent, and can appropriately perform real-time PCR analysis. Since the PCR method according to this embodiment uses a sample in which blood is directly added to the PCR reagent, there is no need for complicated nucleic acid purification work, etc. Therefore, rapid real-time PCR is possible without any hassle.

[0110] The present invention has been described above based on the embodiment. This embodiment is merely an example, and it will be understood by those skilled in the art that various modifications are possible in the combination of each component and each treatment process, and that such modifications are also within the scope of the present invention. [Explanation of symbols]

[0111] 10, 70 microfluidic chip, 12 flow path, 14 substrate, 16 first sealing film, 18 second sealing film, 20 third sealing film, 24 first air communication port, 26 second air communication port, 28 first filter, 30 second filter, 32 first chamber, 34 second chamber, 40 first air duct, 42 second air duct, 46 first temperature area, 48 second temperature area, 54 first serpentine flow path, 56 second serpentine flow path, 58 fluorescence detection area, 59 detection flow path, 60 first widening flow path, 62 second widening flow path, 100 PCR device, 101 installation unit, 102 first heater, 104 second heater, 106 fluorescence detection device, 108 optical head, 110 control device, 120 A liquid delivery system, 122 a first three-way valve, 124 a second three-way valve, 126 a pressure chamber, and 128 a liquid delivery pump.

[0112] SEQ ID NO: 1: Primer SEQ ID NO:2: Primer SEQ ID NO:3: Probe SEQ ID NO: 4: Template DNA SEQ ID NO: 5: Primer SEQ ID NO: 6: Primer SEQ ID NO: 7: Probe SEQ ID NO: 8: template RNA

Claims

1. preparing a sample by adding blood to PCR reagents; a step of repeatedly moving the sample back and forth in a flow channel of a microfluidic chip to subject the sample to a thermal cycle; detecting fluorescence from the sample in the flow path to monitor progress of PCR on the sample; A PCR method comprising:

2. In the step of applying the thermal cycle, the sample is repeatedly moved back and forth within the flow channel, whereby the sample is separated into a colored solid component and a transparent solution component within the flow channel; 2. The PCR method according to claim 1, wherein in the step of detecting fluorescence, the fluorescence emitted from the transparent solution component is detected.

3. 3. The PCR method according to claim 1, wherein the blood content in the sample is 0.01% to 20%, preferably 0.1% to 10%, and more preferably 1% to 5%.

4. 3. The PCR method according to claim 1, wherein the PCR reagent contains a surfactant.

5. 3. The PCR method according to claim 1, wherein the PCR reagent contains an additive.

6. 3. The PCR method according to claim 1, wherein the flow channel includes a serpentine flow channel that is a combination of a straight flow channel and a curved flow channel.

7. the flow path includes a first temperature region maintained at a first temperature, a second temperature region maintained at a second temperature different from the first temperature, and a connection flow path connecting the first temperature region and the second temperature region; 3. The PCR method according to claim 1, wherein a cross-sectional area of ​​the connecting flow channel is larger than cross-sectional areas of the flow channels included in the first temperature region and the second temperature region.

Images