Agent for the prevention and treatment of fish infectious diseases

Abstract

To provide a safe and simple agent for the prevention and treatment of fish infectious diseases without the dependency on antibiotics or the like.SOLUTION: An agent for the prevention and treatment of fish infectious diseases comprises sucrose and / or 1-kestose as an active ingredient.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to an agent for preventing or treating infectious diseases in fish. [Background technology]

[0002] In recent years, the demand for marine products has been expanding worldwide, but there is a limit to the amount of marine resources, and since an increase in production from fishing boats cannot be expected, a shift to aquaculture is being promoted. However, in aquaculture, the occurrence of fish diseases due to high-density farming is unavoidable, and commercial fish such as yellowtail, pufferfish, and eels are suffering great damage from fish diseases, with the greatest damage occurring to yellowtail, amounting to approximately 4 billion yen, and overall losses amounting to approximately 10 to 11 billion yen per year. Therefore, measures against fish diseases are considered to be an important issue for the sustainable development of aquaculture.

[0003] Diseases that cause great damage to farmed fish are mainly infectious diseases caused by viruses and bacteria, but most of them are bacterial infections. For example, Edwardsiellosis is an infectious disease caused by Edwardsiella bacteria, which infects marine fish such as flounder and red sea bream as well as eels, causing great economic losses. In eels, it is called paracolo disease, and affects everything from glass eels to adult eels. When it develops, redness and enlargement of the anus, redness and swelling of the anterior abdomen are observed, and numerous abscesses and ulcers are formed in the liver, kidneys, etc. In addition, cold water disease is a disease caused by Flavobacterium psychrophilum, which infects freshwater fish such as sweetfish, rainbow trout, and carp, and is characterized by lesions such as erosions and ulcers that appear on the caudal peduncle. In eels, a disease called columnaris disease caused by Flavobacterium columnare, which is caused by a similar Flavobacterium, has been reported.

[0004] Antibiotics are used to treat and prevent such bacterial infections. However, the use of antibiotics can lead to the emergence of drug-resistant bacteria, and safety issues due to antibiotic residues in fish bodies have been pointed out. Vaccines are also being developed, but the time and cost required for administration is significant, hindering their widespread use. Therefore, there is a demand for the establishment of safe and simple methods for preventing and treating infectious diseases that do not rely on antibiotics.

[0005] In response to this, a method for preventing and treating infectious diseases by administering lactose fructose oligosaccharides or soybean oligosaccharides to fish has been proposed (Patent Documents 1 and 2). However, there is no specific disclosure about the preventive and therapeutic effects against the above-mentioned bacterial infectious diseases. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Publication No. 10-45605 [Patent Document 2] JP 2022-120840 A [Non-patent literature]

[0007] [Non-Patent Document 1] Yaqiu Liu et al.,Front.Microbiol.,09 August 2022 Vol.13 [Non-Patent Document 2] Yibin Yang et al., Front.Immunol.,03 June 2022 Vol.13 [Non-Patent Document 3] Jiamin Li et al., Front.Nutr.19 October 2022 Vol9 [Non-Patent Document 4] Hao-Jun Zhu et al., MicrobiologyOpen Vol.9,Isuue 5 2020 [Non-Patent Document 5] Chunling Wang et al., Fish & Shellfish Immunology Vol.106,November 2020 [Non-Patent Document 6] Xiaolin Ye et al., Frontieres in Endocrinology, December 2021 vol.12 [Non-Patent Document 7] Sytze de Roock et al., Clinical Nutrition, December 2011 vol.30 [Non-Patent Document 8] Yi Liu et al., Multiple Sclerosis and Related Disorders Vol. 72, April 2023 [Non-Patent Document 9] Sage JB Dunham et al., mBio, 2022 Volume 13 Issue 6 [Non-Patent Document 10] Pagakrong Wanapaisan et al., Neurodegenerative Diseases, 2022;22(2):43-54. [Non-Patent Document 11] Honggang Yin et al., FEMS Microbiology Letters, Volume 370, 2023 Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide a safe and convenient agent for preventing and treating infectious diseases in fish. [Means for solving the problem]

[0009] As a result of extensive research aimed at solving the above-mentioned problems, the inventors have discovered that feeding sucrose or 1-kestose to fish promotes the proliferation of Romboutsia bacteria, which are beneficial intestinal bacteria, while suppressing the proliferation of pathogenic bacteria such as Edwardsiella bacteria and Flavobacterium bacteria, and thereby making it possible to treat and prevent infectious diseases caused by these pathogenic bacteria, thereby completing the present invention.

[0010] That is, the present invention is a preventive or therapeutic agent for infectious diseases in fish, which contains sucrose and / or 1-kestose as active ingredients.

[0011] The present invention also relates to an agent for regulating the intestinal function of fish, which contains sucrose and / or 1-kestose as active ingredients.

[0012] The present invention also relates to an agent for inhibiting the proliferation of Romboutsia bacteria and Edwardsiella and / or Flavobacterium bacteria in the intestines of fish, which comprises sucrose and / or 1-kestose as active ingredients.

[0013] The present invention also relates to a feed efficiency improver containing sucrose and / or 1-kestose as active ingredients.

[0014] The present invention also relates to a method for preventing or treating an infectious disease, which comprises administering sucrose and / or 1-kestose to fish.

[0015] The present invention also relates to a method for improving the intestinal environment of fish, which comprises administering sucrose and / or 1-kestose to fish. Effect of the Invention

[0016] According to the present invention, it is possible to proliferate Romboutsia bacteria, which are useful intestinal bacteria, while suppressing the proliferation of pathogenic bacteria such as Edwardsiella bacteria and Flavobacterium bacteria, thereby treating or preventing infectious diseases caused by these bacteria. [Brief description of the drawings]

[0017] [Figure 1] 1 is a graph showing the relative occupancy rates of Romboutsia bacteria, Edwardsiella bacteria, and Flavobacterium bacteria in the eel intestinal bacterial flora in the test group and the control group in Example 1. [Diagram 2] 1 is a graph showing the concentrations of lactic acid and acetic acid in the intestines of eels in the test group and the control group in Example 1. [Diagram 3] 1 is a graph showing the growth rates of Edwardsiella bacteria in a test group and a control group in Example 4. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] The target fish for the infection preventive or therapeutic agent of the present invention (hereinafter referred to as "infection preventive and therapeutic agent") are not particularly limited, but examples include freshwater fish such as eel, rainbow trout, sweetfish, tilapia, carp, crucian carp, catfish, etc., and saltwater fish such as flounder, red sea bream, yellowtail, striped jack, coho salmon, etc., and among these, it is preferably used for eel, rainbow trout, sweetfish, tilapia, carp, flounder, red sea bream, etc.

[0019] The active ingredient of the infection preventive and therapeutic agent of the present invention is sucrose and / or 1-kestose. Among these, 1-kestose is preferred because of its superior effect on the proliferation of bacteria of the genus Romboutsia and its superior effect on the proliferation of pathogenic bacteria such as bacteria of the genus Edwardsiella and Flavobacterium.

[0020] Infectious diseases that are targets of the infection preventive and therapeutic agent of the present invention are not particularly limited, and include bacterial infections such as Edwardsiellosis, eel paracoccosis and columnaris disease, cold water disease, furunculosis, α-hemolytic streptococcosis, vibriosis, nocardiosis, bacterial gill disease, gliding bacteriosis, and β-hemolytic streptococcosis, and among these, the agent is preferably used for infections caused by Edwardsiella bacteria and / or Flavobacterium bacteria. Infectious diseases caused by Edwardsiella bacteria include Edwardsiellosis and eel paracoccosis, and infectious diseases caused by Flavobacterium bacteria include cold water disease and eel columnaris disease.

[0021] The dosage of the infectious disease preventive and therapeutic agent of the present invention is not particularly limited and can be appropriately set depending on the type of fish to be treated, the type of infectious disease, symptoms, etc., but the addition rate of each oligosaccharide is 0.1% to 10% of the fish body weight, and can be appropriately adjusted depending on the fish type and size. For example, the dosage may be about 1,280 mg / kg of fish body weight per day.

[0022] The method of application of the infectious disease preventive and therapeutic agent of the present invention is not particularly limited, but oral administration is preferred, and the active ingredient can be formulated as an oral preparation or added to fish feed and fed. The dosage form of the preparation is not particularly limited, and any dosage form such as granules, tablets, etc. can be used, and the preparation can be prepared according to a known preparation method. The feed to which the infectious disease preventive and therapeutic agent of the present invention is added can also be prepared according to a conventional method, and sucrose and / or 1-kestose can be mixed into raw feed such as fish meal, wheat flour, starch, calcium phosphate, etc. so that the amount of sucrose and / or 1-kestose is about 3.5 to 4.0% by mass in the total feed, and the feed can be made into any form such as moist pellets or dry pellets.

[0023] By administering the infectious disease preventive and therapeutic agent of the present invention to fish, the intestinal bacterial environment of the fish is improved, and preventive and therapeutic effects against infectious diseases are obtained. That is, many pathogenic bacteria of bacterial infectious diseases, such as Edwardsiella bacteria, which are causative bacteria of Edwardsiella disease, and Flavobacterium bacteria, which are causative bacteria of cold water disease, are facultative pathogenic bacteria that are normally present in environmental water and intestines, but by administering the infectious disease preventive and therapeutic agent of the present invention, useful bacteria of the Romboutsia genus are proliferated in the intestines of fish (Non-Patent Documents 6-7), while the proliferation of pathogenic bacteria such as Edwardsiella bacteria and Flavobacterium bacteria is inhibited, thereby making it possible to prevent or treat infectious diseases caused by these bacteria. Useful bacteria of the Romboutsia genus are widely known to exist as normal bacteria in the intestines of fish, and it has been reported that they exist as normal bacteria in eels, tilapia, herring, crucian carp, catfish, mint crab, etc. (Non-Patent Documents 1-5). Furthermore, the administration of sucrose and / or 1-kestose promotes the growth of fish, thereby improving feed efficiency. Therefore, the present invention encompasses not only an infectious disease preventive and therapeutic agent for fish containing sucrose and / or 1-kestose as an active ingredient, but also an agent for regulating the intestines of fish, an agent for inhibiting the proliferation of bacteria of the genus Romboutsia, bacteria of the genus Edwardsiella, and bacteria of the genus Flavobacterium in the intestines of fish, an agent for improving feed efficiency, and methods thereof.

[0024] The infectious disease preventive / treatment agent etc. of the present invention may be in a form in which it is labeled to be used for purposes such as preventive treatment of bacterial infectious diseases such as Edwardsiellosis, paracolocasia, cold water disease etc., intestinal regulation, improvement of intestinal environment, proliferation of Romboutsia bacteria in the intestines, and inhibition of proliferation of Edwardsiella bacteria and / or Flavobacterium bacteria, and this includes, for example, forms in which these uses are indicated on the main body, container, packaging, instruction manual, attached document, etc. of the product, or are indicated in advertisements such as pamphlets and posters, promotional materials, webinar and SNS screens, etc.

[0025] In addition, since Romboutsia bacteria are also present in the intestines of various animals, animals can also be the subjects of administration, including mammals such as humans, dogs, cats, monkeys, chimpanzees, cows, horses, and sheep. In humans, Romboutsia bacteria are known to be involved in various diseases and physiological functions, and for example, the relationship between Romboutsia bacteria and diabetes, demyelinating optic neuritis, Alzheimer's, improvement of vascular endothelial function, and the like has been reported (Non-Patent Documents 8 to 11). Therefore, the Romboutsia bacteria proliferation agent of the present invention containing sucrose and / or 1-kestose as an active ingredient can prevent or improve diseases such as diabetes, demyelinating optic neuritis, Alzheimer's, and hypertension, dyslipidemia, obesity, metabolic syndrome, and arteriosclerosis associated with decreased vascular endothelial function.

[0026] The Romboutsia bacteria proliferation agent of the present invention can be formulated by combining the above-mentioned active ingredient with a pharma- ceutically acceptable carrier as necessary. Examples of pharma-ceutically acceptable carriers include glucose, lactose, starch, mannitol, dextrin, fatty acid glycerides, polyethylene glycol, hydroxyethyl starch, ethylene glycol, polyoxyethylene sorbitan fatty acid esters, amino acids, gelatin, albumin, water, and physiological saline. Furthermore, conventional additives such as stabilizers, wetting agents, emulsifiers, binders, isotonicity agents, and excipients can be added as necessary. The dosage form is not particularly limited, and examples include liquids, powders, granules, capsules, and tablets, and can be prepared according to conventional methods. The dosage of the Romboutsia bacteria proliferation agent of the present invention is not particularly limited, and is, for example, about 0.1 to 5 g per kg of body weight, and preferably about 0.5 to 1 g, per day for adults.

[0027] The Romboutsia genus bacteria proliferation agent of the present invention can also be in the form of food or drink, and is prepared by blending the above-mentioned active ingredient with known food additives and / or food materials in a conventional manner, and the form is not particularly limited, and examples thereof include starch-based foods such as bread, biscuits, pancakes, noodles, tablet candy, and other confectioneries; gum, candy, Japanese sweets, and other confectioneries; meat foods such as ham and sausage; fish foods such as chikuwa (chikuwa stewed fish paste) and kamaboko (fish paste paste), seafood foods, seasonings such as dressing, soy sauce, jam, furikake (rice toppings), and beverages such as tea, juice, soft drinks, and alcoholic beverages. EXAMPLES

[0028] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0029] Example 1 Effect of 1-kestose administration on the intestinal flora of eels Eels were orally administered iKes fiber (1-kestose content of 45.0% or more, manufactured by Itochu Sugar Co., Ltd.) to examine the effects on the intestinal flora, as well as the total length and body weight of the eels. Tanks housing 200 eels each were used as the control and test groups. Eel feed was compound feed for eels (mash, manufactured by Nosan Corporation), with the feeding rate being 0.5-1.5% by mass of the total fish body weight housed. The eels were fed a mixture of compound feed: cod liver oil: water = 1:0.1:1.3, which was kneaded and made into a soft mochi shape. The feed for the test group consisted of 10% by mass of iKes fiber and 2 x 10 lactic acid bacteria (Lactobacillus plantarum FM8, Nosan Corporation) in water. 11 The fish were suspended at 0.3% by mass at 1.5g / g and then mixed with formulated feed and cod liver oil. The fish were fed once a day at 9am on weekdays. After one month of rearing, all fish were taken from each of the control and test groups and their total length and weight were measured. From these, 20 fish from each group (10 fish close to the average size and 10 fish larger than the average size) were dissected, and the intestinal contents were collected and stored at -80℃. Frozen intestinal contents were thawed on ice, and each sample was suspended in 4 M guanidium thiocyanate, 100 mM Tris-HCl (pH 9.0), 40 mM EDTA, and ground with zirconia beads using a FastPrep FP100A instrument (MP Biomedicals, USA). DNA was extracted from the bead-treated suspension using a QIA QUBE. The V3-V4 region of bacterial and archaeal 16S rDNA sequences was amplified using universal PCR primers (F:3V4f_MIX:ACACTCTTTCCCTACACGACGCTCTTCCGATCT-NNNNN-CCTACGGGNGGCWGCAG, R:V3V4r_MIX:GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-NNNNN-GACTACHVGGGTATCTAATCC) using ExTag HS (TaKaRa). The amplified PCR products were sequenced using MiSeq, and the results were analyzed using QIIME2 (version 2022.2) to calculate the relative occupancy of each bacterium at the genus level. For the measurement of short-chain fatty acids, 1 mL of ice-cold PBS was added to the collected intestinal content sample, which was then thoroughly stirred using a vortex mixer and centrifuged to collect the supernatant as an analytical sample. The collected supernatant was pretreated with YMC's long-chain and short-chain fatty acid analysis labeling reagent (product number XARFAR02) and analyzed by HPLC. The analytical column used was a Waters ACQUITY UPLC BEH C18 1.7 μm × 150 mm, and the solvent was adjusted to a ratio of acetonitrile:methanol:water = 24:12:64, with the pH adjusted to 4-5 with dilute hydrochloric acid. The relative occupancy and short-chain fatty acid concentration of each bacterium in the control and test groups were compared using the Mann-Whitney test, with p < 0.1 considered significant. The results are shown in Figure 1 (relative occupancy rate of bacteria) and Figure 2 (short-chain fatty acid concentration). Table 1 shows the feed efficiency calculated based on the weight gain in the control and test groups.

[0030] [Table 1]

[0031] As shown in Figure 1, Romboutsia bacteria increased significantly in the test group compared to the control group. Meanwhile, Edwardsiella and Flavobacterium bacteria decreased significantly. Furthermore, Figure 2 confirms that the concentrations of lactic acid and acetic acid in the intestine increased significantly in the test group. From these results, it was found that administering 1-kestose to eels increased the beneficial bacteria Romboutsia in the intestine of the eels, and increased short-chain fatty acids such as acetic acid and lactic acid. Meanwhile, Edwardsiella bacteria, which cause paracolo disease, and Flavobacterium bacteria, which cause columnaris disease, were decreased.

[0032] Example 2 Growth effects of various carbohydrates on Romboutsia and Edwardsiella bacteria The assimilation of various carbohydrates by Romboutsia and Edwardsiella bacteria was investigated. The basal medium was prepared by dissolving 4.0 g of hypopeptone (Nissui Pharmaceutical), 4.0 g of yeast extract (BD), 0.2 g of sodium chloride (Fujifilm Wako Pure Chemical Industries), 0.08 g of dipotassium hydrogen phosphate (Fujifilm Wako Pure Chemical Industries), 0.08 g of potassium dihydrogen phosphate (Fujifilm Wako Pure Chemical Industries), 0.02 g of magnesium sulfate heptahydrate (Fujifilm Wako Pure Chemical Industries), 0.02 g of calcium chloride dihydrate (Fujifilm Wako Pure Chemical Industries), 4.0 g of sodium bicarbonate (Wako Pure Chemical Industries), 1.0 g of bile powder (Fujifilm Wako Pure Chemical Industries), 4.0 g of Tween (Tokyo Chemical Industry Co., Ltd.), 20 uL of vitamin K (Tokyo Chemical Industry Co., Ltd.), 0.01 g of hemin (Fujifilm Wako Pure Chemical Industries), 1 mg of resarrin sodium salt (Tokyo Chemical Industry Co., Ltd.), and 1.0 g of cysteine ​​hydrochloride (Tokyo Chemical Industry Co., Ltd.) in 1 L of water. As carbohydrates serving as carbon sources, sucrose (Suc, Fujifilm Wako Pure Chemical Industries), kestose (Kes, Itochu Sugar), galactooligosaccharides (Gos, Fujifilm Wako Pure Chemical Industries), inulin (Sigma-Aldrich), fiberixa (FRX, Hayashibara), raffinose (Tokyo Chemical Industry), and CI-dextrin (CI-dex, Nissin Sugar) were adjusted to a concentration of 50 mg / mL. 500 μL of the basal medium was mixed with 500 μL of the adjusted carbohydrate solution to be used as the culture medium. The bacteria used for the culture were Romboutsia lituseburenisis (JCM1404 strain) and Edwardsiella tarda (NBRC 105688 strain). These were pre-cultured in GAM medium (Nissui Pharmaceutical), and 20 uL was inoculated into the culture medium. The turbidity at 660 nm absorbance of the medium before inoculation was taken as the turbidity at the start of the culture, and the turbidity was measured 24 hours after inoculation. The turbidity was measured using a plate reader (TECAN). The pH of the medium was also measured 24 hours after inoculation. The results are shown in Table 2.

[0033] [Table 2]

[0034] As shown in Table 2, it was confirmed that Romboutsia bacteria grow by assimilating sucrose and 1-kestose and reduce the pH of the medium. On the other hand, it was confirmed that Edwardsiella bacteria grow in this medium composition when glucose is used as a carbon source (see Example 3), but growth was not confirmed with any of the oligosaccharides shown in Table 2, and no decrease in the pH of the medium was confirmed. From these results, it was revealed that Romboutsia bacteria efficiently assimilate sucrose and 1-kestose and reduce the pH of the medium, but Edwardsiella cannot utilize any of the carbohydrates.

[0035] Example 3 Comparison of growth of Romboutsia and Edwardsiella bacteria depending on medium pH The effect of the pH of the medium, which decreases by culturing Romboutsia bacteria, on the growth of Edwardsiella bacteria was evaluated. Glucose was used as a carbon source that Edwardsiella bacteria can use. A basal medium with the same composition as in Example 2 and a 50 mg / mL glucose solution were mixed in an amount of 500 uL each to prepare a medium. Acetic acid was added to the medium so that the final concentrations were 0 mM, 5 mM, 10 mM, and 20 mM, respectively. Romboutsia lituseburensis (JCM1404 strain) and Edwardsiella tarda (NBRC 105688 strain) were pre-cultured in GAM medium (Nissui Pharmaceutical), and 20 uL was inoculated into the culture solution. The turbidity at an absorbance of 660 nm of the medium before inoculation was defined as the turbidity at the start of the culture, and the turbidity was measured 24 hours after inoculation. The pH of the medium was also measured at the start of the culture (0 h) and 24 hours after inoculation (24 h).

[0036] [Table 3]

[0037] As shown in Table 3, the growth of Romboutsia bacteria was slightly slowed at an acetic acid concentration of 20 mM, but growth was confirmed at all acetic acid concentrations. Compared to the pH at the beginning of the culture (immediately after inoculation), it was found that at a pH of about 7.5 to 6.3, acetic acid was produced as the growth of Romboutsia progressed, decreasing the pH of the medium to around 5.5. In contrast, Edwardsiella bacteria grow without being affected by acetic acid at acetic acid concentrations of 0 to 10 mM, but their growth slows at 20 mM. In other words, it was suggested that the growth of Edwardsiella bacteria is suppressed when the pH is below 5.5 in the early stages of culture. From the above, it was presumed that the acetic acid produced by the proliferation of Romboutsia bacteria in the living body of fish lowers the surrounding pH, which in turn suppresses the growth of Edwardsiella bacteria. That is, from Examples 2 and 3, it was revealed that the efficient utilization of sucrose and 1-kestose by Romboutsia bacteria promotes the production of acetic acid in the intestines of fish, lowering the pH, and relatively suppressing the growth of Edwardsiella.

[0038] Example 4 Cultivation test of Edwardsiella bacteria using culture supernatant of Romboutsia bacteria The following test was carried out to verify whether organic acids, including acetic acid, produced by culturing Romboutsia bacteria directly inhibit the growth of Edwardsiella bacteria. First, a medium was prepared by adding 2 mL of glucose adjusted to 50 mg / mL and 2 mL of sterile water to 10 mL of the same basal medium as in Example 2. Then, 1800 μL was dispensed into three tubes, two of which were inoculated with live Romboutsia lituseburensis (JCM1404 strain), and one was inoculated with killed Romboutsia lituseburensis as a control. The killed bacteria were adjusted by heating the culture solution of Romboutsia lituseburensis in a heat block at 100° C. for 15 minutes. The amount of bacteria inoculated was 36 μL, and the culture was carried out at 37° C. under anaerobic conditions. The culture medium was collected immediately after inoculation of the live bacteria (day 0 of culture) and one day after culture, and also collected immediately after inoculation of the dead bacteria. The culture medium was centrifuged at 15,000 rpm for 3 minutes to precipitate the bacterial cells, and the supernatant was filtered through a 0.45 μm membrane filter to collect the culture supernatant, and the pH was measured. The culture supernatants of these Romboutsia lituseburensis strains were used to culture Edwardsiella bacteria. Specifically, 50 μL of distilled water was added to 950 μL of culture supernatant from day 0 of live and dead bacteria culture to make the volume 1 mL, and 50 μL of 50 mg / mL glucose was added to 950 μL of culture supernatant from day 1 of live bacteria culture to make the volume 1 mL, and 20 μL of Edwardsiella tarda (NBRC 105688 strain) was inoculated and cultured at 37°C under anaerobic conditions. The results are shown in Figure 3.

[0039] The growth rate of Edwardsiella bacteria in the culture supernatant using killed Romboutsia bacteria as a control was set to 100%, and the growth rate of Edwardsiella for the other two groups was also expressed. When the culture supernatant of Romboutsia bacteria was used after 1 day of cultivation, the growth rate of Edwardsiella bacteria was significantly reduced after 24 and 48 hours of cultivation. The growth of Edwardsiella bacteria was suppressed due to the large drop in pH of the medium supernatant after culturing Romboutsia bacteria for 1 day. In other words, it is presumed that the culture products of Romboutsia bacteria (short-chain fatty acids) are involved in the inhibition of Edwardsiella growth.

[0040] Example 5 DNA was extracted from the intestinal contents of farmed fish (carp and tilapia) in the same manner as in Example 1. On the other hand, a primer set (5'- TAAGCT TGACATCCTTTTGACCTCTC-3',5'- CWe designed a primer set (5'-GCCTCACGACTTGGCTG-3') for detecting Edwardsiella genus bacteria by PCR. This primer set was designed by adding the underlined bases of the corresponding sequence of the 16S rRNA gene of Romboutsia lituseburensis to the 3' end of the primer set described in the paper (chrome-extension: / / efaidnbmnnnibpcajpcglclefindmkaj / https: / / www.jstage.jst.go.jp / article / bmfh / 38 / 2 / 38_18-023 / _pdf). GGAAGGTGTGCGTGTTAATAGCA -3',5'- GAGACTCTAGCTTGCCAGTCTTGGA -3') was designed by aligning the top three 16S rRNA gene sequences derived from Edwardsiella bacteria frequently detected in the eel intestine. Using these primer sets, PCR reactions were performed on DNA extracted from the intestinal contents of each farmed fish, and on genomic DNA obtained by disrupting the culture fluid of Romboutsia lituseburensis (JCM1404 strain) and Edwardsiella tarda (NBRC 105688 strain) in the same manner as in Example 1. The PCR reaction solution was prepared according to the specifications of Quick Taq HS DyeMix (TOYOBO), and the reaction conditions were 40 cycles of 94°C for 15 seconds, 60°C for 15 seconds, and 72°C for 20 seconds. Then, electrophoresis was performed using a 2% agarose gel to confirm the amplified fragments. As a result, amplified DNA fragments were observed in koi carp and tilapia both when using the primer set for detecting Romboutsia bacteria by PCR and when using the primer set for detecting Edwardsiella bacteria by PCR, confirming the presence of Romboutsia or Edwardsiella bacteria.

[0041] Example 6 Effect of sucrose feeding on feed efficiency in eels Eels were orally administered sucrose (manufactured by Itochu Sugar Co., Ltd.) to study the effects on feed efficiency, total length, and body weight. Aquariums containing 58 eels each were used as the control and test groups. Eel feed (mash, manufactured by Nippon Nosan Kogyo Co., Ltd.) was used as feed, and the feeding rate was 1.0-1.5% by mass of the total fish body weight. The eels were mixed in a ratio of 1:0.1:1.3, and the mixture was kneaded into a soft mochi shape. The feed for the test group was prepared by dissolving sucrose in water at a rate of 10% by mass relative to the feed, and then mixing it with the feed and cod liver oil. Feeding was carried out once a day at 9:00 a.m. on weekdays. After 41 days of rearing, all individuals from each control and test group were taken and their total length and body weight were measured. Table 4 shows the feed efficiency calculated based on the weight gain in the control and test groups.

[0042] [Table 4]

[0043] As shown in Table 4, it was confirmed that the administration of sucrose improved feed efficiency. [Industrial Applicability]

[0044] The infectious disease preventive agent of the present invention uses a highly safe active ingredient, and can effectively prevent or treat bacterial infectious diseases by oral administration. Therefore, it is extremely useful in aquaculture as a safe and simple preventive and therapeutic agent for infectious diseases that does not rely on antibiotics.

Claims

1. A preventive or therapeutic agent for infectious diseases in fish, comprising sucrose and / or 1-kestose as active ingredients.

2. 2. The agent for preventing or treating an infectious disease in fish according to claim 1, wherein the infectious disease is caused by infection with bacteria of the genus Edwardsiella and / or Flavobacterium.

3. 3. The preventive or therapeutic agent for infectious diseases in fish according to claim 1 or 2, wherein the fish is a freshwater fish.

4. A fish intestinal regulator containing sucrose and / or 1-kestose as active ingredients.

5. 5. The intestinal regulator for fish according to claim 4, which is based on the proliferation of bacteria of the genus Romboutsia in the intestines of fish.

6. 5. The intestinal regulator for fish according to claim 4, which is based on the effect of reducing Edwardsiella bacteria and / or Flavobacterium bacteria in the intestines of fish.

7. 7. The intestinal regulator for fish according to any one of claims 4 to 6, wherein the fish is a freshwater fish.

8. An agent for promoting the proliferation of bacteria of the genus Romboutsia in the intestines of fish, comprising sucrose and / or 1-kestose as active ingredients.

9. An inhibitor of the proliferation of Edwardsiella and / or Flavobacterium bacteria in the intestines of fish, comprising sucrose and / or 1-kestose as active ingredients.

10. A feed efficiency improver comprising sucrose and / or 1-kestose as active ingredients.

11. A growth agent for Romboutsia bacteria, comprising sucrose and / or 1-kestose as active ingredients.

12. A method for preventing or treating an infectious disease, comprising administering sucrose and / or 1-kestose to fish.

13. 13. The method for preventing or treating an infectious disease in fish according to claim 12, wherein the infectious disease is caused by infection with bacteria of the genus Edwardsiella and / or Flavobacterium.

14. The method for preventing or treating an infectious disease in fish according to claim 12 or 13, wherein the fish is a freshwater fish.

15. A method for improving the intestinal environment of fish, comprising administering sucrose and / or 1-kestose to fish.

16. The method for improving the intestinal environment of fish according to claim 15, which comprises multiplying Romboutsia bacteria in the intestines of fish.

17. 17. The method for improving the intestinal environment of fish according to claim 15 or 16, which reduces Edwardsiella bacteria and / or Flavobacterium bacteria in the intestines of fish.

Images