METHOD FOR OPTIMIZING mRNA SEQUENCE BY USING PEPTIDE BAR CODE

Abstract

To acquire relationship between numberless candidate sequences of nucleic acid (e.g., mRNA medicine) and the expression level of target protein at high throughput.SOLUTION: A sequence optimization method of nucleic acid includes: a step of preparing a nucleic acid sequence which includes a candidate sequence including a sequence of an untranslated region and a sequence encoding target protein, and a sequence encoding a peptide bar code directly or indirectly connected to the target protein; a step of expressing protein from the nucleic acid sequence; a step of separating the peptide bar code from the protein; a step of analyzing the separated peptide bar code; and a step of acquiring relationship between the expression of the target protein and the candidate sequence on the basis of a result of the analysis, and selecting an optimum candidate sequence.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to methods and kits for sequence optimization of nucleic acids, such as mRNA pharmaceuticals. [Background technology]

[0002] Nucleic acid medicines such as mRNA medicines are a technology that has been expected for many years to be applied to infectious diseases and cancer treatment. Nucleic acid (e.g., mRNA) that codes for a protein to be expressed in the body is placed on a carrier such as lipid nanoparticles and introduced into the body. The nucleic acid (mRNA) taken up into the cell will express the encoded target protein according to the normal protein expression process. For example, if mRNA that codes for a part of a virus is introduced as a vaccine to prevent infectious diseases, the expressed protein can be recognized by the immune system. In addition, in the application as a cancer vaccine, mRNA that codes for a specific antigen expressed in cancer cells, that is, neoantigens, is introduced into the body. The immune system recognizes the expressed neoantigens, and the immune system attacks the cancer cells, thereby treating the cancer. If the base sequence of nucleic acid (e.g., mRNA) is designed, it can be used as a drug, and since the manufacturing method is simple, it is possible to quickly carry out everything from sequence design to manufacturing and shipping. Due to these advantages, the application of nucleic acid (mRNA) medicines has been expected. During the Covid-19 pandemic, mRNA vaccines were put into practical use for the first time, and their performance was demonstrated.

[0003] The performance of nucleic acid drugs, including mRNA, depends on their base sequence, so the sequence must be optimized for each target disease. For example, the base sequence of an mRNA drug generally consists of a 5' untranslated region (UTR), an open reading frame (ORF) that codes for a protein, and a 3' untranslated region (3'UTR). The 5'UTR is the site recognized by ribosomes and is involved in the control of expression. The ribosome translates the ORF into a protein based on the codons. The expression efficiency changes depending on the codon pattern. The 3'UTR is a site that is involved in the stability of mRNA. For example, it is known that the installation of Poly A, which is a series of adenines (A), improves the stability of mRNA, and is also used in Covid-19 vaccines.

[0004] When designing the base sequence of an mRNA drug, it is necessary to optimize the 5'UTR, ORF, and 3'UTR according to the purpose. Sequence optimization is important not only for mRNA drugs but also in systems involving protein expression using DNA, and several studies have been conducted. Non-Patent Document 1 discloses a method for optimizing the codons of ORF. Software named iCodon makes it possible to improve the expression level by adjusting the codons. In addition, Non-Patent Document 2 discloses a method for optimizing the 5'UTR. A base sequence encoding a random amino acid sequence is placed in the 5'UTR, and a polysome profiling technique makes it possible to find a 5'UTR that is easy for ribosomes to bind.

[0005] With technological developments in machine learning and deep learning, the accuracy of computational methods for sequence optimization is improving. On the other hand, it is not easy to obtain a large amount of molecular biological data to create a learning model. When trying to obtain data showing the relationship between the base sequence of an mRNA drug and the amount of protein expression by ELISA (Enzyme Linked Immunosorbent Assay), it is necessary to analyze one well for each sample with a changed base sequence. There are studies that use peptide barcodes as a method for analyzing countless candidate substances in parallel (Non-Patent Document 3, Patent Document 1). However, these are used for the purpose of screening substances that specifically bind to the target antigen, and are not used for designing the base sequence of an mRNA drug. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent No. 6781854 [Non-patent literature]

[0007] [Non-Patent Document 1] Diez, M., et al. iCodon customizes gene expression based on the codon composition, Sci Rep 12(1):12126 (2022) [Non-Patent Document 2] Sample, PJ, et al. Human 5′ UTR design and variant effect prediction from a massively parallel translation assay, Nat Biotechnol 37(7):803-809 (2019) [Non-Patent Document 3] Egloff, P., et al. Engineered peptide barcodes for in-depth analyzes of binding protein libraries, Nat Methods, 16(5):421-428 (2019) Summary of the Invention [Problem to be solved by the invention]

[0008] Previously, when trying to obtain the relationship between base sequence and protein expression level in order to optimize the base sequence of nucleic acid drugs such as mRNA drugs, it was necessary to prepare an infinite number of samples, one for each change in the base sequence, and analyze each of them.The longer the base sequence to be optimized, the more exponentially the number of candidate sequences increases, making it virtually impossible to obtain expression level data.

[0009] In view of this background, the present invention aims to provide a means and method for obtaining data showing the relationship between countless candidate sequences in nucleic acids (e.g., mRNA pharmaceuticals) and protein expression levels with high throughput, preferably in a single measurement. [Means for solving the problem]

[0010] The present inventors, in the course of investigating the optimization of the base sequence of nucleic acids (particularly mRNA pharmaceuticals) for expressing a target protein, discovered that when expressing a target protein from a candidate nucleic acid sequence, it is possible to select a candidate nucleic acid sequence suitable for expressing the target protein by linking the target protein to an identifiable peptide barcode and expressing it, and analyzing the peptide barcode, which led to the completion of the present invention.

[0011] In one aspect, the present invention provides a method for optimizing a nucleic acid sequence, comprising the steps of: preparing a nucleic acid sequence comprising a candidate sequence comprising a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode linked directly or indirectly to the protein of interest; expressing a protein from said nucleic acid sequence; separating the peptide barcode from the protein; Analyzing the separated peptide barcodes; A step of obtaining a relationship between the expression of the target protein and the candidate sequences based on the results of the analysis, and selecting an optimal candidate sequence. The present invention relates to a method comprising the steps of:

[0012] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: an insertion site for inserting a candidate sequence including a sequence encoding a target protein and a sequence of an untranslated region; A sequence encoding a peptide barcode containing two or more amino acids; A kit for sequence optimization of a nucleic acid comprising a plurality of expression cassettes comprising: each of the plurality of expression cassettes has a sequence encoding a different peptide barcode; The kit relates to a kit in which, when the expression cassette is expressed, the target protein inserted at the insertion site and the peptide barcode are linked and expressed.

[0013] In another aspect, the present invention provides a method for preparing a nucleic acid sequence comprising a candidate sequence comprising a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode linked directly or indirectly to the protein of interest, the method comprising the steps of: a step of combining one or more sequences of the 5'-untranslated region, one or more sequences encoding a protein of interest, one or more sequences of the 3'-untranslated region, and sequences encoding different peptide barcodes into a plasmid vector by a DNA assembly method using homologous sequences to prepare a plasmid vector containing a combination of multiple sequences; amplifying the plasmid vector; and performing the DNA assembly method under conditions in which the number of types of peptide barcodes is greater than the product of the number of types of sequences in the 5'-untranslated region, the number of types of sequences encoding the target protein, and the number of types of sequences in the 3'-untranslated region. Effect of the Invention

[0014] The present invention provides a method and kit for optimizing a nucleic acid sequence, and a method for preparing a nucleic acid sequence for use in the method. By using the method and kit of the present invention, the base sequence of a nucleic acid, for example, an mRNA drug, can be easily optimized with high throughput. [Brief description of the drawings]

[0015] [Figure 1] 1 shows an overview of a first embodiment of the present invention in which peptide barcodes are used to optimize the sequence of an mRNA drug. [Diagram 2] The figure shows images of eGFP fluorescence observed after mRNA designed using two types of UTRs and corresponding peptide barcodes for eGFP expression was expressed in cells. [Diagram 3] The figure shows a chromatogram of the peptide barcodes analyzed by liquid chromatography mass spectrometry (LCMS) after mRNA designed with two types of UTRs and the corresponding peptide barcodes for eGFP expression was expressed in cells. [Figure 4] 1 shows an outline of an example for preparing candidate nucleic acid sequences in sequence optimization of mRNA medicines. [Diagram 5] 1 shows examples of sequence constructs used in designing candidate nucleic acid sequences. [Figure 6] Another example is outlined for preparing candidate nucleic acid sequences in sequence optimization of mRNA medicines. [Figure 7] 1 shows an outline of plasmid vector construction for preparing candidate nucleic acid sequences in sequence optimization of mRNA medicines. [Figure 8]This shows an outline of a method for preparing plasmid DNA containing a candidate nucleic acid sequence by a DNA assembly method using homologous sequences. [Figure 9] 1 is a photograph showing colonies obtained on an agar medium plate in Example 2. [Figure 10] 1 shows a histogram of read length and frequency obtained by a nanopore sequencer in Example 2. [Figure 11] 1 is a graph showing the change in probability p of overlapping of peptide barcodes when m, which is the number of types of peptide barcodes, is changed. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] This application claims priority to Japanese Patent Application No. 2023-137652, filed on August 28, 2023, the entire disclosure of which is incorporated herein by reference.

[0017] The present invention relates to a method and a kit for optimizing a nucleic acid sequence. In the present invention, a sequence encoding a target protein and a sequence affecting the expression (such as a sequence in a non-translated region) are linked to a sequence encoding an identifiable peptide barcode, and expressed, and the peptide barcode portion in the expressed protein is analyzed, so that a nucleic acid optimal for expression of the target protein can be selected based on the peptide barcode that shows the desired expression (high expression, long-term expression, etc.).

[0018] In one embodiment, there is provided a method for optimizing a sequence of a nucleic acid, comprising the steps of: preparing a nucleic acid sequence comprising a candidate sequence comprising a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode linked directly or indirectly to the protein of interest; expressing a protein from said nucleic acid sequence; separating the peptide barcode from the protein; Analyzing the separated peptide barcodes; A step of obtaining a relationship between the expression of the target protein and the candidate sequences based on the results of the analysis, and selecting an optimal candidate sequence. The present invention provides a method comprising:

[0019] Optimizing the sequence of a nucleic acid means optimizing the sequence of the nucleic acid to express the desired protein encoded by the nucleic acid. Protein expression may vary depending on the sequence of the protein coding sequence and the sequence of the untranslated region connected thereto. It is preferable to obtain a nucleic acid with an optimized sequence so as to achieve the desired protein expression.

[0020] The nucleic acid may be either RNA or DNA, so long as it is a nucleic acid whose sequence is desired to be optimized for protein expression. Preferably, the nucleic acid is RNA, for example, an mRNA drug. The target protein encoded by the nucleic acid is not particularly limited, so long as it is a protein whose expression is desired. In the case of a nucleic acid drug, for example, an mRNA drug, the target protein includes, for example, a protein that is an immunogen for a vaccine against infectious diseases (viruses, bacteria, fungi, etc.), a protein that is specifically expressed in cancer cells for a cancer vaccine, and the like. Alternatively, the target protein may be a protein to be expressed on a large scale in a cell or in a cell-free expression system. In this specification, the "nucleic acid sequence" may be either DNA or RNA, and for example, when referring to a "nucleic acid sequence containing a sequence encoding a target protein," it includes both a DNA sequence and an mRNA sequence obtained by further reverse transcription from the DNA sequence.

[0021] In the method of the present invention, a nucleic acid sequence is prepared that includes a candidate sequence including a sequence of an untranslated region and a sequence encoding a target protein, and a sequence encoding a peptide barcode directly or indirectly linked to the target protein.

[0022] The untranslated region (UTR) includes 5'UTR and 3'UTR. The untranslated region is a region that affects the expression of a protein. Therefore, it is preferable to optimize the sequence of the untranslated region for the desired protein expression. The optimization may be performed on only the 5'UTR or only the 3'UTR, or both the 5'UTR and the 3'UTR. As the candidate sequences for the 5'UTR and 3'UTR, a known UTR sequence or a mutant thereof, or a random sequence may be used.

[0023] In the method of the present invention, the sequences encoding the target protein may use the same nucleic acid sequence. Alternatively, because the same amino acid may be encoded by different codons due to genetic degeneracy, even if the same protein is encoded, the nucleic acid sequences may be different, and the expression of the protein may differ depending on the different sequences. Therefore, the sequences encoding the target protein may also be subject to optimization (codon optimization).

[0024] In the method of the present invention, a candidate sequence including at least a sequence of an untranslated region and a sequence encoding a target protein is linked to a sequence encoding a peptide barcode. A peptide barcode is a peptide consisting of two or more amino acids, and each peptide barcode is identifiable in the step of analyzing the peptide barcode. The peptide barcode includes a peptide consisting of, for example, 5 to 40 amino acids, preferably 10 to 30 amino acids. The peptide barcode is preferably of a length and composition that does not significantly affect the expression of the target protein.

[0025] In one embodiment, when a mass spectrometer is used in the step of analyzing peptide barcodes described below, the multiple peptide barcodes used include a sequence with high ionization efficiency. Here, the sequence with high ionization efficiency is preferably longer than the length of other sequences in the peptide barcode. For example, the multiple peptide barcodes used may include at least a portion of the same sequence, and the sequence may have high ionization efficiency. In other words, the multiple peptide barcodes may have a common sequence with high ionization efficiency in part.

[0026] The untranslated region sequence, the sequence encoding the protein of interest, and the sequence encoding the peptide barcode can be prepared by methods known in the art.

[0027] Methods for linking a candidate sequence to a sequence encoding a peptide barcode are also well known in the art. For example, a sequence encoding a target protein is directly or indirectly linked to a sequence encoding a peptide barcode so that the target protein and the peptide barcode are expressed as a fusion protein. Indirect linking can be performed, for example, via a sequence encoding an amino acid recognized by a protease, a spacer sequence, etc. Examples of amino acids recognized by a protease include, but are not limited to, the amino acid DDDDK (SEQ ID NO: 1) recognized by enterokinase, amino acids recognized by trypsin, amino acids recognized by thrombin, and amino acids recognized by factor Xa. In one embodiment, the sequence encoding the peptide barcode is linked to the sequence encoding the target protein via a sequence encoding an amino acid recognized by a protease.

[0028] The nucleic acid sequence including the candidate sequence including the sequence of the untranslated region and the sequence encoding the target protein, and the sequence encoding the peptide barcode directly or indirectly linked to the target protein may further include another sequence. In one embodiment, the sequence encoding the peptide barcode is linked to a sequence encoding a purification tag. The purification tag is not particularly limited as long as it is a tag commonly used in the art, and examples thereof include His tag, HQ tag, HN tag, etc. (purifiable by metal ions); FLAG tag, etc. (purifiable by affinity chromatography); Myc tag, etc. (purifiable by antibodies). By using the purification tag, it becomes possible to easily purify and recover the peptide barcode to which the purification tag is linked, or the peptide barcode and the target protein. The link between the sequence encoding the peptide barcode and the purification tag may be direct or indirect, and for example, the sequence encoding the peptide barcode is linked to the sequence encoding the purification tag via a sequence encoding an amino acid recognized by a protease. That is, in one embodiment, a sequence encoding an amino acid recognized by a protease is present between the sequence encoding the peptide barcode and the sequence encoding the purification tag, which allows the purification tag to be cleaved using a protease, thereby avoiding the influence of the purification tag on the peptide barcode analysis step.

[0029] Alternatively or additionally, the nucleic acid sequence comprising a candidate sequence including a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode directly or indirectly linked to the protein of interest may be capped and / or polyA may be added.

[0030] In one embodiment, in the preparation step of the method of the present invention, a candidate sequence or a sequence encoding a target protein is amplified using a primer to which a sequence encoding a peptide barcode is added, thereby preparing a nucleic acid sequence (including a candidate sequence including a sequence of an untranslated region and a sequence encoding a target protein, and a sequence encoding a peptide barcode directly or indirectly linked to the target protein).

[0031] In one embodiment, in the preparation step of the method of the present invention, a sequence encoding a target protein is amplified using a primer to which an untranslated region sequence is added, thereby preparing a nucleic acid sequence (including a candidate sequence including an untranslated region sequence and a sequence encoding a target protein, and a sequence encoding a peptide barcode directly or indirectly linked to the target protein).

[0032] In one embodiment, in the preparation step of the method of the present invention, the nucleic acid sequence is prepared by amplifying a plasmid vector containing the nucleic acid sequence (including a candidate sequence including a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode directly or indirectly linked to the protein of interest).

[0033] In one embodiment, the preparation step of the method of the present invention comprises: A plasmid vector including a sequence of the 5'UTR, which is an untranslated region, a plasmid vector including a sequence encoding a target protein, and a plasmid vector including a sequence encoding a peptide barcode are prepared. From these vectors, a plasmid vector is prepared that contains a nucleic acid sequence that includes a candidate sequence including a sequence of a non-translated region and a sequence encoding a target protein, and a sequence encoding a peptide barcode; The nucleic acid sequence is prepared by amplifying a plasmid vector containing the nucleic acid sequence.

[0034] In addition to the above-mentioned plasmid vector, a plasmid vector containing a 3'UTR sequence, which is a non-translated region, may be further used to prepare a plasmid vector containing the above-mentioned nucleic acid sequence. The 5'UTR sequence and / or the 3'UTR sequence may contain a specific candidate sequence or may be a random sequence.

[0035] In one embodiment, the preparation step of the method of the present invention comprises: one or more sequences of the non-translated region, one or more sequences encoding a target protein, and sequences encoding multiple different peptide barcodes are ligated to a plasmid vector by a DNA assembly method using homologous sequences to prepare a plasmid vector containing multiple combinations of sequences; By amplifying the plasmid vector, a nucleic acid sequence is prepared that includes a candidate sequence including a sequence of an untranslated region and a sequence encoding a target protein, and a sequence encoding a peptide barcode directly or indirectly linked to the target protein.

[0036] To prepare a plasmid vector containing the above-mentioned nucleic acid sequence, for example, the Gibson Assembly method using a homologous sequence or the ligation method using a blunt end can be used, both of which are known in the art. Preferably, the Gibson Assembly method is used to prepare a plasmid vector containing a nucleic acid sequence containing a candidate sequence including a sequence encoding a non-translated region and a sequence encoding a target protein, and a sequence encoding a peptide barcode, from each vector or DNA containing the sequence. The Gibson Assembly method is a method used to link multiple DNA fragments, and can link a DNA fragment having a homologous sequence of a specific length (about 15 to 20 bases) at its end. Therefore, when using the Gibson Assembly method, the plasmid vector or DNA containing each sequence is designed to contain a homologous sequence in the portion to be linked.

[0037] In one embodiment, the homologous sequence between the 5'-untranslated region and the plasmid vector comprises a T7 promoter sequence. In one embodiment, the homologous sequence between the 5'-untranslated region and the sequence encoding the target protein comprises a start codon. In one embodiment, the homologous sequence between the sequence encoding the target protein and the sequence encoding the peptide barcode comprises a protease recognition sequence (a sequence encoding an amino acid recognized by a protease), for example, a sequence encoding an amino acid recognized by enterokinase. In one embodiment, the homologous sequence between the sequence encoding the peptide barcode and the 3'-untranslated region comprises a stop codon. In one embodiment, the homologous sequence between the 3'-untranslated region and the plasmid vector comprises a partial sequence of the plasmid vector (for example, about 15 to 20 bases).

[0038] When multiple types of sequences are randomly linked to a plasmid vector, it is preferable to perform the DNA assembly method under conditions in which the number of types of peptide barcodes is greater than the product of the number of types of sequences in the 5'-untranslated region, the number of types of sequences encoding the target protein, and the number of types of sequences in the 3'-untranslated region.

[0039] When the nucleic acid to be optimized is an RNA such as an mRNA, the amplified nucleic acid sequence (DNA) can be reverse transcribed (e.g., in vitro transcription (IVT)) to prepare an RNA (mRNA) containing the candidate sequence.

[0040] In one embodiment, in the preparation step of the method of the present invention, a plurality of nucleic acid sequences including different untranslated region sequences and sequences encoding different peptide barcodes are prepared. The plurality of untranslated region sequences to be optimized correspond to sequences encoding different peptide barcodes.

[0041] In one embodiment, in the preparation step of the method of the present invention, a plurality of nucleic acid sequences are prepared, the plurality of sequences encoding the target protein and the sequences encoding different peptide barcodes, and the plurality of sequences encoding the target protein to be optimized correspond to sequences encoding different peptide barcodes.

[0042] Subsequently, a protein is expressed from the prepared nucleic acid sequence. In one embodiment, the expression step of the method of the present invention is carried out in a cell. The cell is not particularly limited, and may be a prokaryotic cell, such as a bacterial cell (such as E. coli), or a eukaryotic cell, such as a fungal cell (such as yeast), an insect cell, or a mammalian cell (such as a human cell). Preferably, the cell is one in which the target protein is to be expressed, and it becomes possible to select an optimal sequence for expression in the cell. For example, in the case of a nucleic acid drug for administration to humans, it is preferable to optimize the expression in human cells.

[0043] In another embodiment, the expression step of the method of the present invention is carried out in a cell-free expression system. The cell-free expression system is also not particularly limited, and can be any suitable one among the expression systems derived from E. coli, wheat germ, rabbit reticulocytes, and insect cells known in the art. Preferably, a cell-free expression system that mimics the cell in which the target protein is ultimately to be expressed is used. For example, when the target protein is to be expressed in E. coli, the sequence of the nucleic acid can be easily and quickly optimized by using an expression system derived from E. coli.

[0044] The peptide barcode is then separated from the expressed protein, for example, by using a protease to separate the peptide barcode if the expressed protein contains an amino acid that the protease recognizes.

[0045] The expressed protein and / or the separated peptide barcode may be purified at an appropriate stage, for example, before analysis of the peptide barcode. The purification step can be carried out using a method used for purifying proteins, for example, a method of purifying using an antibody that binds to the target protein. When a sequence encoding a purification tag is linked to the above-mentioned nucleic acid sequence, the expressed protein and / or the separated peptide barcode can be conveniently purified using the purification tag.

[0046] The separated peptide barcodes are then analyzed. In one embodiment, the peptide barcodes are analyzed by a mass spectrometer. In another embodiment, the peptide barcodes are analyzed by a known protein analysis method (e.g., immunoassays such as ELISA and immunoblot). Apparatuses and methods for analyzing peptide barcodes are well known in the art, and a person skilled in the art can appropriately select an apparatus and method to be used depending on the composition and properties of the peptide barcode to be used.

[0047] In one embodiment, in the analysis step of the method of the present invention, the ion intensity for each peptide barcode obtained by a mass spectrometer is normalized by the ionization efficiency for each peptide barcode obtained in advance, and the abundance of each peptide barcode is estimated from the normalized ion intensity.

[0048] In one embodiment, a list of m / z peaks detected by a mass spectrometer is prepared in advance based on the amino acid sequence length of the peptide barcode, and in the analysis step of the method of the present invention, the amount of peptide barcode present is estimated using the ion intensities of the m / z values ​​in the m / z peak list.

[0049] In one embodiment, the method of the present invention comprises the steps of: Sequencing the nucleic acid sequences contained in the plasmid vector and analyzing the abundance ratio of each sequence; and A process of normalizing the results of peptide barcode analysis by their abundance ratio to obtain the relationship between the expression of the target protein and the candidate sequence. After preparing the nucleic acid sequences using the plasmid vectors, the nucleic acid sequences contained in each plasmid vector are sequenced, and the abundance ratio of each sequence is analyzed. The abundance ratio is used to normalize the abundance of the peptide barcodes, thereby taking into account the difference due to the amount of the nucleic acid sequence used.

[0050] In the method of the present invention, the relationship between the expression of a target protein and a candidate sequence is obtained based on the results of the analysis of the peptide barcode, and an optimal candidate sequence is selected. That is, since the peptide barcode corresponds to the candidate sequence, the relationship between the expression of a target protein and a candidate sequence can be obtained by analyzing the peptide barcode. For example, information on a candidate sequence corresponding to a target protein with a high or low expression level, or a target protein with a long or short expression period can be obtained. An optimal candidate sequence is selected according to the expression of a desired target protein. In one embodiment, a candidate sequence with a high expression level of a target protein is selected based on the results of the analysis of the peptide barcode. In one embodiment, a candidate sequence with a long expression period of a target protein is selected based on the results of the analysis of the peptide barcode.

[0051] The method of the present invention may further include a step of identifying the selected candidate sequence by designing a primer based on the amino acid sequence of the peptide barcode corresponding to the selected candidate sequence, amplifying or reverse transcribing at least a portion of the nucleic acid sequence, and sequencing the obtained sequence. When a random sequence is used as the candidate sequence (e.g., 5'UTR and / or 3'UTR), the sequence of the selected candidate sequence may not be known by analysis of the peptide barcode. Therefore, the sequence of the selected candidate sequence can be known by sequencing the sequence obtained by amplifying or reverse transcribing using a primer designed based on the amino acid sequence of the peptide barcode.

[0052] According to the method of the present invention, an identifiable peptide barcode is provided to the expressed protein, so that even if multiple nucleic acids containing candidate sequences for optimization are expressed simultaneously, the expression products can be distinguished. By collectively analyzing the separated peptide barcodes, it becomes possible to examine (screen) multiple candidate sequences simultaneously. Therefore, the method of the present invention can easily optimize the sequence of a nucleic acid with high throughput.

[0053] In another aspect, the present invention provides a kit for sequence optimization of a nucleic acid. an insertion site for inserting a candidate sequence including a sequence encoding a target protein and a sequence of an untranslated region; A sequence encoding a peptide barcode containing two or more amino acids; A kit for sequence optimization of a nucleic acid comprising a plurality of expression cassettes comprising: each of the plurality of expression cassettes has a sequence encoding a different peptide barcode; The kit provides a kit in which, when the expression cassette is expressed, the target protein inserted at the insertion site and the peptide barcode are linked and expressed.

[0054] The expression cassette may be in a form suitable for a cell or a cell-free expression system in which the target protein is expressed, for example, in the form of a linear nucleic acid or a vector. The expression cassette may be either DNA or RNA, and is preferably DNA from the viewpoint of ease of operation. When optimizing the RNA sequence, RNA can be obtained by performing a reverse transcription reaction from the DNA expression cassette. Such operations are well known in the art. The insertion site may be a site for inserting a sequence into the expression cassette, such as a restriction site, a multicloning site, or a homologous sequence.

[0055] By using the kit of the present invention, it is possible to simply link a nucleic acid whose sequence is to be optimized to the insertion site of an expression cassette, thereby linking the target protein to a peptide barcode and expressing it, and then easily examine the expression of the target protein based on the peptide barcode.

[0056] The kit of the present invention is preferably a kit for carrying out the above-mentioned method of the present invention (method for optimizing a nucleic acid sequence). By using such a kit, the method of the present invention can be carried out simply and efficiently.

[0057] In another aspect, the present invention provides a method for preparing a nucleic acid sequence comprising a candidate sequence comprising a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode linked directly or indirectly to the protein of interest, the method comprising the steps of: a step of combining one or more sequences of the 5'-untranslated region, one or more sequences encoding a protein of interest, one or more sequences of the 3'-untranslated region, and sequences encoding different peptide barcodes into a plasmid vector by a DNA assembly method using homologous sequences to prepare a plasmid vector containing a combination of multiple sequences; amplifying the plasmid vector; and performing the DNA assembly method under conditions in which the number of types of peptide barcodes is greater than the product of the number of types of sequences in the 5'-untranslated region, the number of types of sequences encoding the target protein, and the number of types of sequences in the 3'-untranslated region.

[0058] The method for preparing a nucleic acid sequence according to the present invention can be used, for example, to prepare a nucleic acid sequence for use in the method for optimizing a nucleic acid sequence according to the present invention as described above. As a DNA assembly method using a homologous sequence, for example, the Gibson Assembly method known in the art can be used. Preferably, a plasmid vector containing a nucleic acid sequence containing a candidate sequence containing a sequence encoding a non-translated region and a sequence encoding a target protein and a sequence encoding a peptide barcode is prepared from DNA or a vector containing each sequence using the Gibson Assembly method. The Gibson Assembly method is a method used to link multiple DNA fragments, and can link a DNA fragment having a homologous sequence of a specific length (about 15 to 20 bases) at its end. Therefore, when using the Gibson Assembly method, the vector or DNA containing each sequence is designed to contain a homologous sequence in the portion to be linked.

[0059] In one embodiment, the sequence homologous to the 5' untranslated region sequence and the plasmid vector comprises a T7 promoter sequence.

[0060] In one embodiment, the homologous sequence between the 5' untranslated region sequence and the sequence encoding the protein of interest includes the start codon.

[0061] In one embodiment, the homologous sequence between the sequence encoding the protein of interest and the sequence encoding the peptide barcode comprises a protease recognition sequence (a sequence encoding an amino acid recognized by a protease), e.g., a sequence encoding an amino acid recognized by enterokinase.

[0062] In one embodiment, the homologous sequence between the sequence encoding the peptide barcode and the sequence in the 3' untranslated region includes a stop codon.

[0063] In one embodiment, the sequence homologous to the sequence of the 3' untranslated region and the plasmid vector includes a portion of the sequence of the plasmid vector (for example, about 15 to 20 bases).

[0064] Hereinafter, a mode for carrying out the present invention (referred to as an "embodiment") will be described with reference to the attached drawings. In the present embodiment, specific examples based on the principles of the present invention are shown, but these are for the purpose of understanding the present invention and are in no way used to interpret the present invention in a restrictive manner. Modifications resulting from combinations and substitutions of the following embodiments with known technologies are also included in the scope of the present invention. In all drawings for explaining the embodiments, parts having the same functions are given the same reference numerals and repeated explanations thereof will be omitted.

[0065] [First embodiment] A first embodiment of the present invention will be described with reference to Figure 1. In the first embodiment, a sequence encoding a target protein, a sequence of a non-translated region, and a sequence encoding a peptide barcode are amplified as DNA, then transcribed to prepare mRNA, the mRNA is introduced into a cell to express the protein, and the sequence of the mRNA is optimized for expression of the target protein based on analysis of the peptide barcode in the expressed protein.

[0066] In FIG. 1, three patterns of untranslated region (UTR) sequences are prepared as an example, and three types of plasmid DNA are prepared for the purpose of selecting the optimal sequence for mRNA medicine. In the three plasmids, the gene (target DNA) 1 encoding the target protein to be expressed is the same. The DNA is designed so that a peptide barcode is fused to the C-terminus of the target protein. The peptide barcode is composed of about 10 to 30 amino acids and is designed to correspond to three patterns of UTR (5'UTR and 3'UTR) (Barcode gene 1, Barcode gene 2, and Barcode gene 3). In other words, the peptide sequence acts as a barcode, and the correspondence with the UTR can be understood based on the barcode. A gene encoding an amino acid sequence recognized by a protease is inserted between the gene encoding the peptide barcode and the gene encoding the target protein. For example, when enterokinase is used as the protease, enterokinase recognizes the amino acid sequence represented by DDDDK (SEQ ID NO: 1) in single-letter amino acid notation, and cleaves the protein after K. Therefore, design the DNA (mRNA) to insert at least the DDDDK sequence between the protein of interest and the peptide barcode.

[0067] To synthesize mRNA, linear DNA is amplified by polymerase chain reaction (PCR) from the three types of plasmid DNA in Figure 1. The linear DNA should contain a promoter, for example, a T7 promoter. The prepared linear DNA is transcribed into mRNA 5 by in vitro transcription (IVT). During this PCR and IVT, a step of capping the mRNA or adding Poly A may be included. Poly A may be included in the plasmid DNA as 3'UTR.

[0068] The transcribed mRNA 5 is introduced into cells. The mRNA can be introduced into cells using a gene introduction reagent such as lipids. It may also be introduced using electroporation. The mRNA introduced into cells is translated according to the normal protein expression process to synthesize protein 6. The amino acid sequence of the synthesized protein 6 varies depending on the sequence of the gene (target DNA) 1 that codes for it. On the other hand, even if the UTR sequences such as 5'UTR and 3'UTR are different, the amino acid sequence of the synthesized protein 6 does not change. Therefore, the amino acid sequences of the target protein 6 body derived from the three types of plasmid DNA are identical. Although the target protein 6 body does not change, the peptide barcode 7 is connected to the C-terminus, and the amino acid sequence of the peptide barcode 7 differs for each UTR.

[0069] After expressing protein 6 in cells, the cells are harvested and the target protein 6 is recovered. If the protein is expressed in the cytoplasm, the cells can be lysed in a normal lysis buffer and centrifuged to recover the supernatant. The recovered protein solution is purified by acetone precipitation or the like to exchange the solvent, and the peptide barcode 7 is dissociated using a protease. Enterokinase recognizes the DDDDK sequence (sequence number 1), cleaves the peptide bond after K, and the peptide barcode 7 connected to the latter stage is separated from the main protein 6. The peptide barcode 7 is expressed in a fused state with the target protein 6, and the amount of peptide barcode 7 indicates the expression amount of the target protein 6. If the expression amount of the target protein 6 differs for each candidate UTR sequence, the difference can be evaluated as the amount of peptide barcode 7.

[0070] To evaluate the abundance of peptide barcode 7, the sample solution is analyzed by a mass spectrometer. When evaluating the abundance of countless peptide barcodes, it is desirable to use a high-resolution mass spectrometer because the difference in molecular weight for each peptide barcode is small. On the other hand, when measuring three types of peptide barcodes as in the example of Figure 1, a device with high quantitative performance, although not high resolution such as a triple quadrupole mass spectrometer, can be selected. In addition, when the peptide barcode portion is separately synthesized and the collision-induced dissociation conditions are examined in advance, the ion intensity can be evaluated by multiple reaction monitoring (MRM). Since the amount of peptide barcodes correlates with the ion intensity obtained by the mass spectrometer, it can be seen that the UTR sequence corresponding to the peptide barcode with a strong ion intensity has a high expression of the target protein. For example, such a UTR sequence is an efficient UTR sequence for enhancing the expression of the target protein, so it can be selected as the optimal sequence for enhancing the expression of the target protein.

[0071] [Example 1] In this example, the results of verifying the principle of the first embodiment of the present invention are shown. eGFP (enhanced green fluorescent protein) was used as the target protein. Two patterns of UTR were tested. The UTR of ATP5PF was used as the first UTR (UTR1), and the UTR of α-globin was used as the second UTR (UTR2). The sequences of UTR1 and UTR2 are shown below:

[0072] UTR1 3′UTR AGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGC (SEQ ID NO: 2) 5'UTR AGAAATAAAGTAAAATTAATCTGGTAATTTGTCACGGATTAGTTGTACAACTAGTTAGAAGTTTCAGAATAAACATGCATTTCATAACTGTCAAATGTTCTTTTAATTCTGAGTCCAAATAAATTATTTGGTGATGTTGA (SEQ ID NO: 3)

[0073] UTR2 3′UTR ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC (SEQ ID NO: 4) 5'UTR GCTGGAGCCTCGGTAGCCGTTCCTCCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGCACCGGCCCTTCCTGGTCTTTGAATAAAGTCTGAGTGGGCAGC (SEQ ID NO: 5)

[0074] The plasmid DNA was designed so that the peptide barcode corresponding to UTR1 was FVGARLDYKDDDDK (sequence number 6), and the peptide barcode corresponding to UTR2 was WLFPVGDYKDDDDK (sequence number 8).

[0075] DNA sequence of a portion containing a peptide barcode corresponding to UTR1 (encoding 6 amino acids as a spacer, the enterokinase recognition sequence DDDDK (underlined), and the peptide barcode): GCGGTAGTGACTACAAA GATGACGACGATAAA TTTGTCGGTGCCCGTCTAGACTACAAGGATGATGATGACAAG (SEQ ID NO: 7) DNA sequence of a portion containing a peptide barcode corresponding to UTR2 (encoding 6 amino acids as a spacer, the enterokinase recognition sequence DDDDK (underlined), and the peptide barcode): GGAGCAGTGACTACAAA GATGACGACGATAAA TGGCTGTTCCCTGTCGGAGACTATAAGGATGATGATGATAAG (SEQ ID NO: 9)

[0076] A plasmid DNA was prepared by introducing DNA linked in the order of T7 promoter, 3'UTR, eGFP gene, barcode gene, and 5'UTR into the multicloning site. A DNA fragment containing the T7 promoter to 3'UTR was amplified by PCR to obtain linear DNA. After purifying the DNA using a DNA purification column, mRNA was synthesized by in vitro transcription (IVT) using T7 RNA polymerase. After purifying the mRNA using an RNA purification column, a cap structure was added to the mRNA. The mRNA was purified again using an RNA purification column, and Poly A was added to the mRNA. The mRNA was then purified again using an RNA purification column.

[0077] Purified mRNA was introduced into A431 cells (human epithelial cell-like) using an mRNA introduction reagent. The green fluorescence of eGFP was observed under a fluorescent microscope. Figure 2 shows an image of eGFP fluorescence. When eGFP is expressed using UTR1 and UTR2, the amino acid sequence of the eGFP portion is identical, but it can be seen that there is a large difference in fluorescence brightness. Since fluorescence brightness correlates with the expression level of eGFP, this difference in brightness indicates a difference in the expression level. It can be seen that the expression level of eGFP is higher when UTR1 is used than when UTR2 is used.

[0078] The cells were then collected, lysed in lysis buffer, and centrifuged. The supernatant was collected, and proteins were precipitated by acetone precipitation. The precipitate was treated with enterokinase, a protease, to release the peptide barcodes. The peptide barcodes were analyzed by measuring them with a liquid chromatography mass spectrometry (LCMS). The results are shown in Figure 3. Because they are separated by an LC column, chromatogram peaks are seen at different retention times corresponding to the peptide barcodes corresponding to UTR1 and UTR2. As is clear from the results, the peptide barcode released from eGFP in UTR1 has a higher intensity, which correlates with the fluorescence intensity shown in Figure 2. In other words, even without observing the fluorescence intensity (expression of the target protein itself), it is possible to determine which UTR-derived eGFP has a higher expression level, that is, which UTR is effective for high expression, by measuring the peptide barcodes with a mass spectrometer.

[0079] In this example, two types of mRNA were introduced into different cell samples, so that the difference in expression level could be grasped by the fluorescence of eGFP (Figure 2). When mRNAs are introduced simultaneously into one cell sample, even if the fluorescence is observed, it is not possible to determine which mRNA eGFP is derived from. When peptide barcodes are used, such a problem does not occur. In other words, by simultaneously introducing multiple mRNAs into one cell sample, isolating the peptide barcodes from them and measuring them with a mass spectrometer, it is possible to determine which mRNA has a higher expression level of the protein (Figure 3). The more candidate sequences of mRNA there are, the more advantageous the method of the present invention using peptide barcodes becomes compared to the method of preparing cell samples for each and observing the expression.

[0080] [Modification of the first embodiment] In Figures 1 to 3, mRNA was introduced into cells to evaluate the expression level of the protein. It is not necessary to use cultured cells to confirm the expression. The target protein may be expressed by introducing mRNA into a cell-free expression system. It is considered that the use of a cell-free expression system is easier to develop into automation than the use of cultured cells.

[0081] FIG. 4 shows an example of the process of preparing plasmid DNA for optimizing 5'UTR. A plasmid vector containing a gene (target DNA) 1 encoding a target protein to be expressed in vivo as an mRNA drug is prepared. The target DNA 1 is amplified from the plasmid vector by PCR. In this case, the 5' primer 2 used contains a 5'UTR candidate sequence in addition to a portion complementary to a part of the target DNA. This is because the 5'UTR candidate sequence is added when the target DNA is amplified by PCR. There is no limit to the length of the 5'UTR candidate sequence, and the sequence may be designed randomly. It may be combined with a known promoter sequence such as a T7 promoter. For example, a 5'UTR candidate sequence may be one in which a T7 promoter and a random base sequence of about 20 bases are connected. During the PCR reaction, it is desirable to mix the plasmid vector with multiple types of primers. When using a 5' primer containing a sequence in which a T7 promoter and a random base sequence of about 20 bases are connected, a primer mix in which the 20 bases are random is prepared, and the PCR reaction is performed in one tube. As a result, multiple types of linear DNA 4 containing the candidate sequence are amplified.

[0082] On the other hand, the 3' primer 3 includes a sequence complementary to the target DNA 1, a protease recognition sequence, a sequence encoding a peptide barcode, and a 3'UTR. The protease recognition sequence is a sequence recognized by a protease that cleaves a protein, such as trypsin or enterokinase. For example, enterokinase recognizes an amino acid sequence represented by DDDDK (SEQ ID NO: 1) in single-letter amino acid notation, and cleaves the protein after K (3' side). The peptide barcode 7 is a peptide consisting of two or more amino acids, and is a substance used to link the relationship between a candidate sequence and the expression level when measuring with a mass spectrometer as described above. For example, Poly A is arranged in the 3'UTR. As with the 5' primer 2, it is preferable to prepare and use a primer mix in which multiple types of primers containing sequences encoding various types of peptide barcodes are mixed for the 3' primer 3. In this way, the amplified PCR product will contain DNA encoding various peptide barcodes. When designing the 3' primer, the sequence encoding the peptide barcode may be a random base sequence. If the base sequence is random, it may not necessarily be a codon that codes for an amino acid, but may be a nonsense codon. In this case, the length of the peptide barcode will be shorter than originally expected. For example, if the length of the peptide barcode is specified as 5 amino acids or more, if the length of the peptide barcode becomes 2 or 3 amino acids due to the presence of a nonsense codon, the molecular weight will be smaller than the molecular weight of 5 amino acids or more that was initially specified. Therefore, it is possible to set a threshold value at a specified molecular weight during analysis by mass spectrometry to identify short peptide barcodes and delete them from the data.

[0083] The synthesis of linear DNA 4 does not necessarily have to be performed in one PCR. If the UTR sequence of the primers used is much longer than the sequence portion complementary to the gene sequence of the target protein, it may not be possible to stably amplify it. Therefore, for example, the 5'UTR and target DNA 1 portions may be amplified in the first PCR, and then a second PCR may be performed to add the peptide barcode side. In addition, after the first PCR, the amplified linear DNA 4 may be purified by electrophoresis or the like before the next PCR.

[0084] FIG. 5A shows an example of linear DNA 4 amplified by PCR. The circles, triangles, and squares in the figure indicate the positions of bases, and their numbers are not significant. From the left, there is a candidate sequence for 5'UTR such as a promoter or random sequence (small white circle), followed by the start codon ATG. Next, there is target DNA 1 (small black circle) that codes for the target protein, followed by a protease recognition sequence. In FIG. 5, the DDDDK sequence (SEQ ID NO: 1) recognized by enterokinase is inserted. After that, there is a sequence (white circle) that codes for peptide barcode 7, followed by the termination codon TAA. Finally, 3'UTR (inverted triangle) is placed. The sequence pattern is not limited to that shown in FIG. 5A. In FIG. 5B, a base sequence (triangle) that codes for several amino acids is inserted as a spacer between target DNA 1 (small black circle) and the protease recognition site. Depending on the protein, the function or expression may change depending on the C-terminal sequence. In the case of proteins with important functions at the C-terminus, steric hindrance with the amino acid sequence added to the C-terminus may occur, resulting in reduced function. In such cases, it is effective to insert several amino acids (triangles) as spacers between the target DNA 1 (small black circle) and the protease recognition site. In Figure 5C, a tag sequence (square) is inserted after the peptide barcode 7 (white circle). This is a tag sequence for purification, such as a His tag or FLAG tag. When performing mass spectrometry (described later), if there are many impurities in the sample that interfere with the measurement, it is desirable to purify the target protein using the tag before measuring it.

[0085] As shown in Figure 4, in a state where multiple types of PCR products are mixed, DNA 4 is transcribed into mRNA 5 by in vitro transcription (IVT). The rest is the same as in Figures 1 to 3, and the peptide barcode 7 connected to the target protein 6 is measured by a mass spectrometer. Since countless types of peptide barcodes 7 are contained in the sample solution, it is preferable to use a high-resolution mass spectrometer. Peaks are classified by slight differences in molecular weight using a time-of-flight mass spectrometer or a Fourier transform mass spectrometer, and peak intensity is obtained for each mass-to-charge ratio m / z. The higher the concentration in the sample solution, the greater the peak intensity in the mass spectrum. For this reason, peaks with high intensity are extracted. Of these peaks, it is necessary to extract those originating from peptide barcodes 7. Peptide barcodes are fixed in length or have a fixed range of sequence length in the experiment. For example, 10 amino acids. Also, assuming that there are 20 types of amino acids and that 10 of them are randomly connected, it is possible to list the m / z that can be detected by the mass spectrometer. Peaks that match the list are extracted. If multiple peaks with high intensity originating from peptide barcode 7 are detected, it is a good idea to re-measure the same sample with a quantitative mass spectrometer to investigate a more accurate quantitative ratio. A typical example of a quantitative mass spectrometer is a triple quadrupole mass spectrometer. A high-resolution mass spectrometer can analyze a large number of molecules at once, but the quantitative accuracy is not high. On the other hand, a quantitative mass spectrometer can analyze only a limited number of molecules in one measurement, but has high quantitative accuracy. Therefore, it is reasonable to re-analyze some candidates picked up by the high-resolution mass spectrometer with a quantitative mass spectrometer to compare their abundance.

[0086] In addition to the peptide barcode 7, various kinds of molecules are present in the sample solution. Therefore, depending on the state, it may be difficult to determine which peak in the mass spectrum represents the peptide barcode 7. In such a situation, it is desirable to purify the target protein 6 before treating it with a protease. For example, an antibody that recognizes the target protein 6 can be used. The antibody is bound to magnetic beads and mixed with a solution containing the target protein 6, so that the antibody binds to the target protein 6. It is possible to purify the target protein 6 by recovering only the magnetic beads and then dissociating the target protein 6 from the antibody. In addition, if a tag sequence is bound to the target protein 6 as shown in C of FIG. 5, an antibody that recognizes the tag can be used. If a His tag is used, it can be used to purify the protein because it binds to the immobilized metal. The peptide barcode 7 is dissociated from the purified protein, and the amount of peptide barcode 7 present is confirmed with a mass spectrometer as described above. If a protease recognition sequence is inserted between the purification tag and the peptide barcode 7, the purification tag and the peptide barcode 7 can be separated by the protease. When measuring with a mass spectrometer, if the molecular weight of the target molecule is large, the ionization efficiency decreases and it may not be possible to detect it. In such a case, it is desirable to separate the purification tag and the peptide barcode 7 to reduce the molecular weight and analyze only the peptide barcode 7.

[0087] Each peptide barcode 7 contains different amino acids, and the ionization efficiency may also differ. If the difference in abundance is about 100 times, even if the ionization efficiency differs for each peptide barcode 7, it is possible to distinguish the difference in abundance by ion intensity, but if the difference is only a few times, the difference may be canceled out by the difference in ionization efficiency. Therefore, it is desirable to perform a process that cancels the difference in ionization efficiency. One method is to create a library containing countless peptide barcodes 7 and measure the library in advance with a high-resolution mass spectrometer. The ion intensity for each m / z of the detected peak can be used as a correction term for the ionization efficiency. By normalizing the peak value of the mass spectrum with this correction term, it becomes possible to compare the abundance of peptide barcodes 7 while taking into account the difference in ionization efficiency. Another method is to align the ionization efficiency of peptide barcodes 7. The sequence of the peptide barcode 7 does not need to be a completely random sequence, and may have a part of the sequence in common as long as it can be separated by m / z value when analyzed by mass spectrum or spectrum using collision induced dissociation. By attaching a peptide sequence with high ionization efficiency as a common sequence, the influence of other parts in the peptide barcode 7 can be reduced. For example, the ionization efficiency of the peptide barcode 7 can be made uniform by using a common sequence using molecules with high ionization efficiency such as arginine and lysine. Furthermore, if the common sequence of the part with high ionization efficiency is longer than the randomized sequence in the peptide barcode 7, the effect of making the ionization efficiency constant is high.

[0088] If the purpose of sequence optimization is to maximize the expression level, the UTR sequence corresponding to the most abundant peptide barcode 7 is selected. If the purpose of sequence optimization is long-term expression, the UTR sequence corresponding to the peptide barcode 7 that was detectable when cells into which mRNA was introduced were cultured for a long period of time and then analyzed with a mass spectrometer is selected. Next, the amino acid sequence of the peptide barcode 7 is calculated from the m / z value of the peptide barcode 7. When identifying the amino acid sequence, if necessary, adding cleavage information using collision induced dissociation or electron transfer dissociation can improve the accuracy of identification. Based on the determined amino acid sequence, the DNA sequence that codes for it is estimated, and a primer complementary to it is designed. The base sequence of the linear DNA 4 or mRNA 5 containing the target DNA 1 is analyzed using the primer to identify the sequence of the 5'UTR corresponding to the selected peptide barcode.

[0089] In the synthesis example of plasmid DNA in FIG. 4, a method of optimizing a nucleic acid sequence using multiple patterns of 5'UTR sequences is shown as an example. The sequence to be optimized in the present invention is not limited to 5'UTR. In the PCR process shown in FIG. 4, the 3'UTR sequence portion of the 3' primer 3 can be prepared in multiple patterns, similar to the 5' primer 2, to synthesize linear DNA 4 having various 3'UTR sequences. In addition, multiple patterns of linear DNA 4 with altered codons may be synthesized without changing the amino acid sequence of the ORF portion of the target protein. The subsequent process is as described above, and the abundance of peptide barcode 7 is evaluated to search for candidate sequences effective for high expression and long-term expression.

[0090] The method of the present invention is a technique for identifying the characteristics of a candidate sequence by matching peptide barcodes with candidate sequences of nucleic acids such as mRNA and evaluating the abundance of the peptide barcodes, and the subject of examination is the entire nucleic acid (e.g., mRNA) sequence and is not limited to a particular portion.

[0091] [Second embodiment] A second embodiment of the present invention will be described with reference to Figure 6. In the second embodiment, similarly to the first embodiment, when amplifying DNA to prepare mRNA for the purpose of optimizing the sequence of an mRNA drug, a plasmid vector is used to prevent bias in DNA amplification efficiency.

[0092] FIG. 6 is an example of a plasmid DNA preparation process showing the second embodiment. The process of preparing linear DNA 4 containing a candidate sequence of 5'UTR and a sequence encoding peptide barcode 7 at both ends by PCR is the same as in the first embodiment. However, linear DNA 4 does not necessarily have to contain a 3'UTR sequence. In the first embodiment, as a process after linear DNA 4 synthesis, the mixture of linear DNA 4 was directly transcribed into mRNA 5 by IVT reaction. If the amplification efficiency of PCR differs depending on the sequence, the amount of mRNA 5 for each candidate sequence may not be uniform at the stage of transcription into mRNA 5. If the variation in the amount of mRNA 5 is sufficiently smaller than the variation in the expression amount, there is no problem, but if it is larger than that, it becomes unclear whether the analysis result is looking at the effect of the expression amount or the difference in the efficiency of the synthesis process of mRNA 5.

[0093] Therefore, in the second embodiment, a plasmid vector 8 containing a linear DNA 4 (a gene encoding a target protein, a candidate sequence for 5'UTR, and a sequence encoding a peptide barcode) is prepared. The position in this plasmid vector 8 where the linear DNA 4 is inserted contains a 3'UTR, and when the linear DNA 4 is inserted, the 3'UTR is bound to the end of the stop codon of the linear DNA 4. Therefore, it is not necessary to bind the 3'UTR to the linear DNA when synthesizing the linear DNA 4 as in the first embodiment. The prepared plasmid vector 8 is introduced into E. coli 9 by transformation and amplified. Since the efficiency of transformation is not high, it is unlikely that multiple plasmid vectors 8 containing the same candidate sequence among the plasmid vectors 8 containing a huge number of candidate sequences are taken up by E. coli. In other words, it can be assumed that each type of plasmid vector containing a candidate sequence is taken up by E. coli 9 one by one, and the E. coli 9 is amplified from that state to extract the plasmid vector 8, so that the variation in the amount of each candidate sequence is reduced compared to the first embodiment. Furthermore, when an antibiotic resistance gene such as ampicillin resistance is inserted into a plasmid vector 8 and introduced into E. coli 9, and the vector is cultured on a plate medium containing an antibiotic, the E. coli 9 into which the plasmid vector 8 has been introduced forms colonies. From the number of colonies formed, the number of types of plasmid vectors 8 incorporated into the E. coli 9, i.e., the number of types of candidate sequences, can be determined. Linear DNA 4 containing the candidate sequence is extracted from the plasmid vector 8 extracted from the E. coli 9 using a restriction enzyme. The extracted linear DNA 4 is transcribed into mRNA 5 by an IVT reaction. The subsequent steps are the same as those in the first embodiment.

[0094] As in the first embodiment, the present embodiment has been described by taking 5'UTR as an example of a target for sequence optimization. However, the target is not limited to 5'UTR. Primers for PCR amplification may be designed to synthesize multiple candidate sequences for 3'UTR.

[0095] [Third embodiment] The third embodiment of the present invention will be described with reference to FIG. 7. FIG. 7 is a part of the analysis flow showing the third embodiment. In this embodiment, as in the second embodiment, the 5'UTR candidate sequence 10, the target DNA 1, and the base sequence 11 encoding the peptide barcode are inserted into a plasmid vector, amplified in E. coli, and then transcribed into mRNA. FIG. 7 shows a flow for constructing a plasmid vector. A plasmid vector into which a base sequence 11 encoding countless types of peptide barcodes is inserted and a plasmid vector into which a 5'UTR candidate sequence 10 is inserted are prepared in advance. For example, they are prepared by generating linear DNA of a base sequence encoding a peptide barcode or a 5'UTR candidate sequence by DNA synthesis, and inserting it into a plasmid vector by ligation using blunt ends or a method using a homologous sequence such as the Gibson Assembly system. As shown in FIG. 4, when inserting the linear DNA into both ends of the target DNA 1, it is preferable to use a restriction enzyme that blunts the ends. After generating a plasmid vector into which the 5'UTR candidate sequence 10, the target DNA 1, and the base sequence 11 encoding the peptide barcode are inserted, the subsequent process is the same as in the second embodiment.

[0096] As in the first embodiment, the present embodiment has been described with the 5'UTR as an example of a target for sequence optimization. However, the target is not limited to the 5'UTR. Instead of the 5'UTR candidate sequence 10, the 3'UTR candidate sequence may be inserted into a plasmid vector by ligation using blunt ends or a method using a homologous sequence such as the Gibson Assembly system. In addition, a plurality of candidate sequences for the 5'UTR and 3'UTR may be prepared and inserted into both ends of the target DNA 1.

[0097] [Fourth embodiment] In the fourth embodiment, one or more types of 5'UTR candidate sequence 10, target DNA 1, base sequence 11 encoding a peptide barcode, and 3'UTR candidate sequence 12 are prepared, and a plasmid DNA is synthesized by randomly combining them. As in the first to third embodiments, the multiple types of candidate sequences of target DNA 1 have different sequences, but encode the same amino acids and proteins. For synthesis, a DNA assembly method using homologous sequences such as Gibson Assembly is used.

[0098] FIG. 8 shows a method for synthesizing plasmid DNA in this embodiment. A plasmid DNA 13 linearized with a restriction enzyme, a 5'UTR candidate sequence 10 including a T7 promoter, a target DNA 1, a base sequence 11 encoding a peptide barcode, and a 3'UTR candidate sequence 12 are each prepared as linear DNA. In the DNA assembly method, each sequence is bound at a homologous sequence portion of about 15 bases. Therefore, the binding portion between the beginning of the 5'UTR candidate sequence 10 and the linearized plasmid DNA 13, the end of the 5'UTR candidate sequence 10 and the beginning of the target DNA 1, the end of the target DNA 1 and the beginning of the base sequence 11 encoding a peptide barcode, the end of the base sequence 11 encoding a peptide barcode and the beginning of the 3'UTR candidate sequence 12, and the binding portion between the end of the 3'UTR candidate sequence 12 and the linearized plasmid DNA 13 are each designed to contain the same sequence (homologous sequence). Although the homologous sequence portion is fixed, one or more types of 5'UTR candidate sequence 10 including a T7 promoter, target DNA 1, base sequence 11 encoding a peptide barcode, and 3'UTR candidate sequence 12 are prepared, mixed, and bound to linearized plasmid DNA 13 as an insert DNA. Which sequences bind is random, and multiple types of plasmid DNA including multiple combinations of sequences are synthesized. For example, when three types each of 5'UTR candidate sequence 10 including a T7 promoter, target DNA 1, base sequence 11 encoding a peptide barcode, and 3'UTR candidate sequence 12 are mixed, 3^4 types of plasmid DNA are synthesized.

[0099] After insert DNA is bound to the linearized plasmid DNA, it is transformed into E. coli. The plasmid DNA contains a gene resistant to antibiotics such as kanamycin, and only E. coli containing the plasmid DNA survive when cultured in the presence of the antibiotic. When E. coli is cultured on an agar plate, colonies are formed. One colony can be considered to be created by introducing one type of plasmid DNA into E. coli. Therefore, the number of colonies indicates the number of types of plasmid DNA contained in the sample. Even if 1000 types of plasmid DNA are theoretically synthesized from the combination of insert DNA, if there are 100 colonies, then 100 types of plasmid DNA out of the 1000 types are contained in the sample. After the E. coli is sufficiently amplified, the plasmid DNA is extracted from the E. coli. At this point, the sequence of the plasmid DNA may be confirmed using a DNA sequencer such as a next-generation sequencer (NGS).

[0100] Next, the portion of the plasmid DNA required for mRNA synthesis is amplified by PCR. Alternatively, the plasmid DNA is linearized using a restriction enzyme. Next, mRNA is synthesized by IVT using T7 polymerase. Once the mRNA is synthesized, it is desirable to determine the sequence and the number of mRNAs for each sequence using a sequencer. The number of mRNAs may vary for each sequence, and the amount of mRNA affects the amount of protein expressed after introduction into cells. If the number of mRNAs for each sequence is known before gene introduction into cells, it is possible to correct the amount of protein expression based on that ratio.

[0101] After mRNA is introduced into cells and the target protein is expressed, the cells are recovered. After extracting proteins from the cells, the peptide barcodes are released by a protease such as enterokinase. The peptide barcodes are measured by mass spectrometry. If the sequence is confirmed at the mRNA stage, the sequence of the peptide barcodes to be detected is known in advance. By creating a list of m / z to be detected based on that, mass spectrometry data can be analyzed efficiently. If necessary, collision induced dissociation is used. Since the amount of peptide barcodes correlates with the amount of bound protein, the relationship between the mRNA sequence and the protein expression level can be estimated based on the ion intensity of the peptide barcode. In this embodiment, multiple types of mRNAs are generated with different peptide barcodes bound to one type of mRNA sequence. By averaging and comparing the ion intensities of the corresponding peptide barcodes from the results of mass spectrometry, the influence of differences in the characteristics of the peptide barcodes themselves on the results can be mitigated. The influence on the results referred to here includes the influence on the protein expression level due to the binding of the peptide barcode and the difference in ionization efficiency for each peptide barcode. In addition, as mentioned above, the amount of mRNA introduced into the cells may differ significantly for each combination pattern. In this case, the influence of different amounts of mRNA can be mitigated by normalizing the ion intensity of each detected peptide barcode by the abundance ratio of the combination pattern of mRNA.

[0102] In this embodiment, the optimal combination of the 5'UTR candidate sequence 10, the target DNA 1, and the 3'UTR candidate sequence 12 is selected using a peptide barcode. Therefore, a specific peptide barcode without overlaps must correspond to the combination of the 5'UTR candidate sequence 10, the target DNA 1, and the 3'UTR candidate sequence 12, each including a T7 promoter. For this reason, when synthesizing plasmid DNA, the number of types of peptide barcodes must be sufficiently larger than the number of combinations, which is the product of the number of types of the 5'UTR candidate sequence 10, the target DNA 1, and the 3'UTR candidate sequence 12, each including a T7 promoter.

[0103] In the DNA assembly method of this embodiment, a homologous sequence is provided at the beginning and end of each combination sequence to serve as a margin. This also becomes a restriction that reduces the degree of freedom of the sequence. For this reason, it is desirable to design the homologous sequence to be the minimum necessary. In addition, in the present invention using a peptide barcode, it is preferable to minimize the reduction in the degree of freedom by incorporating a sequence that is necessarily required into the homologous sequence. For example, for the homologous sequence at the junction of the candidate sequence 10 of the 5'UTR containing the plasmid DNA and the T7 promoter, it is desirable to incorporate the T7 promoter sequence into the homologous sequence. The T7 promoter is a sequence required when synthesizing mRNA from DNA. The homologous sequence at the junction of the candidate sequence 10 of the 5'UTR containing the T7 promoter and the target DNA 1 desirably contains the start codon ATG. This is because it is necessarily required because proteins are translated from the start codon ATG. For the homologous sequence at the junction of the target DNA 1 and the base sequence 11 encoding the peptide barcode, it is desirable to use a DNA sequence encoding a protease recognition sequence (amino acid recognized by protease). The protease recognition sequence can be used to release the peptide barcode after protein expression. For example, enterokinase recognizes the DDDDK sequence (SEQ ID NO: 1) and cleaves the protein after K. Therefore, if a peptide barcode is connected after K, the peptide barcode will be released from the protein body when treated with enterokinase. It is desirable to insert a stop codon in the homologous sequence at the junction of the base sequence 11 encoding the peptide barcode and the candidate sequence 12 of the 3'UTR. For example, TAA. In order to design a gene so that the peptide barcode is connected to the C-terminus of the protein, it is preferable that the end of the sequence encoding the peptide barcode is a stop codon. In order to stop translation at the stop codon, two codons may be stacked to make TAATAA, or they may be combined with another stop codon. As for the homologous sequence at the junction of the candidate sequence 12 of the 3'UTR and the plasmid DNA 13, it is preferable to incorporate a sequence originally present in the plasmid DNA 13 (a part of the sequence of the plasmid DNA) into the candidate sequence 12 of the 3'UTR and use it as a homologous sequence.In this case, the design freedom of the 3'UTR candidate sequence is not hindered by the homologous sequence. A poly A sequence may be incorporated into the 3'UTR candidate sequence 12. The poly A sequence contributes to the stability of the mRNA. If the poly A sequence is not introduced into the 3'UTR candidate sequence 12, the primers can be designed so that poly A is added during PCR in the mRNA synthesis process. If the poly A sequence is included in the 3'UTR candidate sequence 12, linear DNA may be generated from the plasmid DNA using a restriction enzyme other than the PCR method. A restriction enzyme site such as BspQI may be placed behind the poly A. BspQI cleaves a sequence at a certain distance from the restriction enzyme recognition sequence. This has the advantage that the plasmid DNA can be linearized without extra bases being connected to the poly A.

[0104] [Example 2] As an example of the fourth embodiment, 10 candidate sequences of 5'UTR including three types of T7 promoters, 1 type of target DNA (eGFP gene), and approximately 2 × 10 6 This shows an example in which a base sequence 11 encoding a peptide barcode of one type was ligated to a plasmid DNA 13 into which a candidate 3'UTR sequence 12 had been inserted in advance, using a DNA assembly method that utilizes homologous sequences.

[0105] In this example, three combinations of candidate 5'UTR sequences including T7 promoters and three types of target DNA are evaluated, that is, nine combinations are evaluated. 6The peptide barcodes are designed to bind to eGFP. During DNA assembly, the plasmid DNA is linearized in advance with a restriction enzyme. The sample reacted with the enzyme for DNA assembly was introduced into E. coli and then plated on an agar medium plate containing kanamycin. Figure 9 shows the colonies obtained. More than 200 colonies were obtained, and it is assumed that each contains one type of plasmid DNA. As described above, the purpose of this example is to evaluate nine types of combinations. More than 200 colonies were obtained, and it is expected that the nine types of combinations are included.

[0106] Approximately 200 colonies were collected and cultured in liquid medium, after which plasmid DNA was collected from E. coli. The plasmid DNA was linearized with a restriction enzyme and sequenced with a nanopore sequencer. Figure 10 shows a histogram of the read length and frequency detected by the nanopore sequencer. As shown in Figure 10, two peaks appear, one for plasmid DNA with an insert DNA inserted and one for plasmid DNA without an insert DNA inserted. When insert DNA is inserted into plasmid DNA by the DNA assembly method, the insert DNA is not necessarily inserted into all of the plasmid DNA, and the plasmid DNA may self-ligate. It is thought that some plasmid DNA that was not cut by the restriction enzyme treatment before the DNA assembly process remains. Such plasmid DNA is introduced directly into E. coli and is also detected during analysis by the nanopore sequencer.

[0107] Table 1 below shows the combination patterns of insert DNA based on the analysis results of the nanopore sequencer. The candidate sequences 10 of 5'UTR including three types of T7 promoters are shown as U1, U2, and U3, and the three types of target DNA are shown as C1, C2, and C3. As shown in Table 1, all nine expected combinations were detected. It was also confirmed that multiple types of peptide barcodes were assigned to each combination pattern. It is preferable to normalize the expression amount of nucleic acids including each combination according to the abundance ratio shown in the number of detections.

[0108] [Table 1]

[0109] Table 2 shows an overview of the peptide barcode sequences detected for each of the nine combinations. The combination numbers 1 to 9 in Table 2 correspond to those in Table 1. PB represents each peptide barcode (a random sequence of six amino acids), and PBs with the same number represent the same peptide barcode.

[0110] [Table 2] TIFF2025032965000004.tif144131

[0111] As shown in Table 2, sequences that are approximately specific to the peptide barcode sequence were detected in each combination. However, overlapping of peptide barcode sequences was observed in combination #7 and combination #9 (PB109). In this example, peptide barcodes consisting of various combinations of amino acids are randomly inserted into plasmid DNA, and some of them are introduced into E. coli to form colonies. Therefore, overlapping of peptide barcodes occurs with a certain probability. In order to reduce the overlapping occurrence rate, it is preferable to increase the number of types of sequences that code for peptide barcodes when performing the DNA assembly method. Furthermore, if overlapping peptide barcodes are not used in mass spectrometry analysis, the overlapping does not affect the purpose of the present invention (analyzing the expression level of a candidate nucleic acid sequence in correspondence with a peptide barcode). Therefore, even if several peptide barcodes overlap, they can be omitted from the analysis and do not pose a problem.

[0112] Here, let us consider the probability p of peptide barcode duplication. If the number of peptide barcode types is m, the number of plasmid DNA combination patterns is n, and the number of peptide barcode types assigned to each plasmid DNA combination pattern is k, then p is 1 minus the probability that all peptide barcodes are different, and is expressed by the following formula.

number

[0113] For example, under the conditions described in this embodiment, m=2×10 6For a total of 9 species, n=9, and k=15, p=0.45% can be calculated. This calculation assumes that the probability of insertion into plasmid DNA is constant for all peptide barcode sequences. When performing DNA assembly, the synthesis probability may differ for each sequence, and the probability of introduction into E. coli and the growth rate of E. coli may vary depending on the sequence, which can cause errors in the above calculation. Figure 11 shows how the duplication probability p changes when m, the number of peptide barcode types, is changed. It can be seen that p decreases as the number of peptide barcode types m increases. However, at the current rate of 2×10 6 It can be seen that even if the number of samples is increased from the seed, the decrease in p is not so large. In addition, considering that there was only one overlap under the condition of p=0.45% in this embodiment, it is believed that the object of the present invention can be achieved by performing the experiment under the condition of p<0.5%.

[0114] The present invention is not limited to the above-described embodiment, and includes various modified examples. For example, the above-described embodiment has been described in detail to clearly explain the present invention, and is not necessarily limited to all of the configurations described. In addition, it is possible to replace a part of the configuration of one embodiment with the configuration of another embodiment, and it is also possible to add the configuration of another embodiment to the configuration of one embodiment. In addition, it is possible to add, delete, or replace a part of the configuration of each embodiment with another configuration. [Explanation of symbols]

[0115] 1. Gene encoding the target protein (target DNA) 2 5' primer containing the candidate sequence of 5'UTR 3. 3' primer containing a base sequence encoding a peptide barcode 4. Linear DNA 5. mRNA 6. Target Protein 7. Peptide Barcoding 8. A plasmid vector containing a gene encoding a target protein, a candidate 5'UTR sequence, and a sequence encoding a peptide barcode 9. Escherichia coli 10 Candidate sequences for 5'UTR 11. Peptide barcode coding sequence 12 Candidate sequences for 3'UTR 13 Linearized plasmid DNA

Claims

1. A method for optimizing a nucleic acid sequence, comprising: preparing a nucleic acid sequence comprising a candidate sequence comprising a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode linked directly or indirectly to the protein of interest; expressing a protein from said nucleic acid sequence; separating the peptide barcode from the protein; Analyzing the separated peptide barcodes; A step of obtaining a relationship between the expression of the target protein and the candidate sequences based on the results of the analysis, and selecting an optimal candidate sequence. The method includes:

2. The method of claim 1 , wherein in the preparation step, a plurality of nucleic acid sequences are prepared, the nucleic acid sequences comprising different untranslated region sequences and sequences encoding different peptide barcodes.

3. The method of claim 1, wherein in the preparation step, a plurality of nucleic acid sequences are prepared, the plurality of nucleic acid sequences comprising different sequences encoding a target protein and sequences encoding different peptide barcodes.

4. The method of claim 1 , wherein the nucleic acid is an mRNA drug.

5. The method of claim 1 , wherein the expression step is carried out in a cell or in a cell-free expression system.

6. 2. The method according to claim 1, wherein in the preparation step, the nucleic acid sequence is prepared by amplifying the candidate sequence or the sequence encoding the target protein using a primer to which a sequence encoding the peptide barcode is added.

7. The method according to claim 1, wherein in the preparation step, the nucleic acid sequence is prepared by amplifying a sequence encoding the target protein using a primer to which a sequence of the untranslated region is added.

8. The method according to claim 1 , wherein in the preparing step, the nucleic acid sequence is prepared by amplifying a plasmid vector containing the nucleic acid sequence.

9. In the preparation step, preparing a plasmid vector comprising a sequence of the 5'UTR, which is the untranslated region, a plasmid vector comprising a sequence encoding the target protein, and a plasmid vector comprising a sequence encoding the peptide barcode; From these vectors, a plasmid vector is prepared that contains the nucleic acid sequence that includes a candidate sequence that includes a sequence of the untranslated region and a sequence that encodes the target protein, and a sequence that encodes the peptide barcode; The method of claim 1 , wherein the nucleic acid sequence is prepared by amplifying a plasmid vector containing the nucleic acid sequence.

10. 2. The method of claim 1, wherein the sequence encoding the peptide barcode is linked to a sequence encoding a purification tag.

11. The method of claim 10, wherein a sequence encoding an amino acid recognized by a protease is present between the sequence encoding the peptide barcode and the sequence encoding the purification tag.

12. In the preparation step, one or more sequences of the non-translated region, one or more sequences encoding a target protein, and sequences encoding multiple different peptide barcodes are ligated to a plasmid vector by a DNA assembly method using homologous sequences to prepare a plasmid vector containing multiple combinations of sequences; 2. The method of claim 1, wherein the plasmid vector is amplified to prepare a nucleic acid sequence comprising a candidate sequence including a sequence of an untranslated region and a sequence encoding a target protein, and a sequence encoding a peptide barcode directly or indirectly linked to the target protein.

13. Sequencing the nucleic acid sequences contained in the plasmid vector and analyzing the abundance ratio of each sequence; and A step of normalizing the results of the peptide barcode analysis by the abundance ratio and obtaining a relationship between the expression of the target protein and the candidate sequence. The method of claim 12 further comprising:

14. 2. The method of claim 1, wherein the sequence encoding the peptide barcode is linked to the sequence encoding the protein of interest via a sequence encoding an amino acid recognized by a protease.

15. The method of claim 1 , wherein the peptide barcodes are analyzed by a mass spectrometer.

16. The method according to claim 1 , further comprising selecting the candidate sequence having a high expression level of the target protein based on the results of the analysis.

17. The method according to claim 1 , further comprising selecting the candidate sequences having a long expression period for the target protein based on the results of the analysis.

18. 2. The method of claim 1, further comprising the step of identifying the selected candidate sequence by designing a primer based on the amino acid sequence of a peptide barcode corresponding to the selected candidate sequence, amplifying or reverse transcribing at least a portion of the nucleic acid sequence, and sequencing the resulting sequence.

19. an insertion site for inserting a candidate sequence including a sequence encoding a target protein and a sequence of an untranslated region; A sequence encoding a peptide barcode containing two or more amino acids; A kit for sequence optimization of a nucleic acid comprising a plurality of expression cassettes comprising: each of the plurality of expression cassettes has a sequence encoding a different peptide barcode; A kit, wherein when the expression cassette is expressed, the target protein inserted at the insertion site and the peptide barcode are linked and expressed.

20. 20. A kit according to claim 19 for carrying out the method according to claim 1.

21. A method for preparing a nucleic acid sequence comprising a candidate sequence including a sequence of an untranslated region and a sequence encoding a protein of interest, and a sequence encoding a peptide barcode linked directly or indirectly to the protein of interest, comprising: a step of combining one or more sequences of the 5'-untranslated region, one or more sequences encoding a protein of interest, one or more sequences of the 3'-untranslated region, and sequences encoding different peptide barcodes into a plasmid vector by a DNA assembly method using homologous sequences to prepare a plasmid vector containing a combination of multiple sequences; amplifying the plasmid vector; wherein the DNA assembly method is performed under conditions in which the number of types of peptide barcodes is greater than the product of the number of types of sequences in the 5' untranslated region, the number of types of sequences encoding the target protein, and the number of types of sequences in the 3' untranslated region.

22. The method of claim 21 , wherein the homologous sequence between the 5′ untranslated region sequence and the plasmid vector comprises a T7 promoter sequence.

23. The method according to claim 21 , wherein the homologous sequence between the 5′ untranslated region sequence and the sequence encoding the target protein comprises an initiation codon.

24. 22. The method of claim 21 , wherein a homologous sequence between the sequence encoding the protein of interest and the sequence encoding the peptide barcode comprises a sequence encoding an amino acid recognized by a protease.

25. 22. The method of claim 21, wherein the homologous sequence between the sequence encoding the peptide barcode and the sequence of the 3' untranslated region comprises a stop codon.

26. The method according to claim 21 , wherein the sequence homologous to the 3' untranslated region sequence and the plasmid vector comprises a portion of the sequence of the plasmid vector.

Images