Autophagy promoter

Abstract

To provide an autophagy promoter, a waste product production inhibitor, and a waste product-induced collagen production decrease inhibitor.SOLUTION: A juniper berry extract of the present invention has excellent autophagy promoting effects, waste product production inhibitory effects, and waste product-induced collagen production decrease inhibitory effects. Therefore, the juniper berry extract can be applied to an autophagy promoter, a waste product production inhibitor, or a waste product-induced collagen production decrease inhibitor which contain the juniper berry extract, as well as cosmetics, foods, quasi-drugs, and pharmaceuticals that contain the same.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to an autophagy promoter, an inhibitor of waste product production, and an inhibitor of reduced collagen production due to waste products, each of which is characterized by containing an extract of juniper berries. [Background technology]

[0002] Autophagy is a mechanism in which an isolation membrane that appears in the cytoplasm surrounds cytoplasmic components to form an autophagosome, which then fuses with a lysosome to degrade the cytoplasmic components. Autophagy is an adaptive response to starvation, and is transiently induced in conditions of low amino acid or insulin, where it supplies nutrients by degrading cytoplasmic components. On the other hand, it also plays a role in removing unnecessary substances from within the cell, such as damaged organelles that accumulate under stress, and contributes to maintaining intracellular homeostasis (Patent Document 1). Furthermore, pathogens such as bacteria that have invaded the cell are also directly eliminated by autophagosomes (Non-Patent Document 1).

[0003] Autophagy is not the only system that breaks down unnecessary substances in cells; proteasomes are also involved. While proteasomes selectively target and break down only ubiquitinated proteins, autophagy is a completely different degradation system that can break down cytoplasmic components such as mitochondria and organelles, as well as pathogens such as bacteria that have invaded cells.

[0004] In autophagy failure, abnormal proteins accumulate in cells. It is believed that one of the causes of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Huntington's disease is the accumulation of abnormal proteins in cells (Non-Patent Document 2). In addition, autophagy failure causes the overexpression of inflammatory cytokines, which leads to inflammation. This causes inflammatory diseases such as Crohn's disease, asthma, cystic fibrosis, Parkinson's disease, amyotrophic lateral sclerosis, systemic lupus erythematosus, and cancer (Non-Patent Document 1). Furthermore, it is known that autophagy decreases with aging, and that the decrease in autophagy causes the aging phenomenon (Non-Patent Document 3). Promoting autophagy is very important in preventing and improving such diseases and preventing and improving aging.

[0005] Waste is a general term for unnecessary substances produced by cellular metabolism, etc. Waste is known to cause tissue dysfunction by leading proliferating cells to aging and chronic inflammation (Non-Patent Documents 4, 5). In addition, one of the aging hypotheses is the waste accumulation hypothesis, which is the idea that the aging phenomenon occurs when waste gradually accumulates in the body because the production rate of metabolic products is faster than the excretion rate (Non-Patent Document 6). Therefore, suppressing the production of waste is very important in preventing and improving aging and tissue dysfunction.

[0006] Collagen is the major structural protein that accounts for approximately one-third of mammalian tissues, and is an essential component of many matrix tissues, such as skin, bone, cartilage, tendons, ligaments, etc. Therefore, it is known that a decrease in collagen production can cause various diseases.

[0007] The skin is exposed to various physical and chemical stresses such as ultraviolet rays, dryness, cold, heat, and drugs every day. As a result, the skin's functions are reduced, and various skin aging phenomena become apparent. Skin aging phenomena include wrinkle formation, sagging skin, loss of elasticity, loss of barrier function, and loss of moisture retention in the stratum corneum. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are wrinkles that occur when the skin dries and the moisture content in the epidermal stratum corneum decreases due to a decrease in ceramide and NMF. On the other hand, dermal wrinkles are wrinkles that occur due to a decrease in collagen production ability in dermal fibroblasts. In addition, a decrease in collagen production also causes sagging and loss of elasticity in the skin. Therefore, it is important to suppress the decrease in collagen production to prevent and improve dermal wrinkles, sagging skin, and loss of elasticity.

[0008] Bones are made up of collagen-based protein components called bone matrix and calcium and phosphorus-based mineral components called bone salts. Collagen, which is the bone matrix, creates bone structure and plays a role in strengthening bones. Furthermore, without sufficient collagen, calcium will not be deposited in bones even if a large amount of calcium is ingested, resulting in weak bones (Non-Patent Document 7). Therefore, inhibiting the decline in collagen production is important for strengthening bones and preventing and improving osteoporosis.

[0009] The eyeball is surrounded by orbital connective tissue, mainly made of collagen, called the orbital pulley, and exists stably. It is known that the orbital pulley can become thin or break with age. This can cause the eyeball to shift position, resulting in sagging eye syndrome (age-related strabismus) (Non-Patent Document 8). Therefore, suppressing the decrease in collagen production is important for preventing and improving sagging eye syndrome.

[0010] In addition, it is known that a decrease in collagen causes arthritis, tendonitis, gingival recession, etc. It is also known that collagen production is increased during the wound healing process, and wound healing is promoted. Therefore, suppressing the decrease in collagen production is also effective in preventing and improving arthritis, tendonitis, and gingival recession, and in wound healing of the skin.

[0011] Dry heat treatment refers to a processing method in which heat is applied to ingredients without adding water, using fire, air, oil, metal plates, etc. It is generally believed that dry heat treatment causes changes in chemical components such as proteins, making it possible to change the color, taste, aroma, etc. The changes in chemical components also vary depending on the heating temperature and time.

[0012] Juniper berries, whose scientific name is Juniperus communis, are coniferous trees belonging to the Juniperaceae family. They are drought-resistant and grow naturally in cold regions, and can be found in Hokkaido and other areas of Japan. The fruits are black-purple berries and the leaves are evergreen needles. They are known to exhibit MMP inhibitory activity (Patent Document 2), preadipocyte differentiation inhibitory activity (Patent Document 3), trypsin inhibitory activity (Patent Document 4), and proteasome activation activity (Patent Document 5).

[0013] However, no autophagy promoters, waste product production inhibitors, or inhibitors of reduced collagen production due to waste products are known that are characterized by containing an extract of juniper berries. [Prior art documents] [Patent documents]

[0014] [Patent Document 1] Patent Publication No. 2021-70670 [Patent Document 2] JP 2023-007747 A [Patent Document 3] JP 2004-075640 A [Patent Document 4] JP 2006-182732 A [Patent Document 5] Patent Publication No. 2021-134215 [Non-patent literature]

[0015] [Non-Patent Document 1] Chemistry and Biology Vol.53 No.7 468-472(2015) [Non-Patent Document 2] Nature Vol.441 No.15 885-889(2006) [Non-Patent Document 3] Gifu Dental Society Journal Vol.45 No.1 1-7(2018) [Non-Patent Document 4] Yokohama City University Journal of Natural Sciences Vol.63 No.1·2·3 29-42(2013) [Non-Patent Document 5] Audiology Japan Vol.62 No.5 365(2019) [Non-Patent Document 6] Polymer Vol.24 No.1 44-49(1975) [Non-Patent Document 7] Sapporo Medical University Bulletin of the Faculty of Health and Medical Sciences Vol.6 1-8(2003) [Non-Patent Document 8] Neuro-Ophthalmology Vol.32 No.3 291-295(2015) Summary of the Invention [Problem to be solved by the invention]

[0016] In view of the above-mentioned circumstances, an object of the present invention is to provide an excellent autophagy promoter, an agent for suppressing the production of waste products, and an agent for suppressing the decrease in collagen production caused by waste products. [Means for solving the problem]

[0017] As a result of intensive research aimed at solving the above-mentioned problems, the inventors discovered that juniper berry extract has excellent effects of promoting autophagy, inhibiting the production of waste products, and inhibiting the decline in collagen production caused by waste products, and thus completed the present invention.

[0018] That is, the present invention includes the following inventions. (1) An autophagy promoter characterized by containing an extract of juniper berries. (2) A waste product production inhibitor characterized by containing an extract of juniper berries. (3) An agent for inhibiting the decline in collagen production caused by waste products, characterized by containing an extract of juniper berries. (4) The agent according to any one of (1) to (3), characterized in that the juniper berry extract is an extract of juniper berry that has been subjected to a dry heating treatment in which the extract is heated to 100°C or higher. Effect of the Invention

[0019] According to the present invention, there are provided an autophagy promoter, an inhibitor of waste product production, and an inhibitor of decreased collagen production due to waste products, each of which contains an extract of juniper berries as an active ingredient. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] Collagen in the collagen production decrease inhibitor of the present invention is one of the proteins constituting skin, bone, cartilage, tendon, ligament, etc., and is the main component of the extracellular matrix. Collagen is classified by type according to function and structure, and the type of collagen in the present invention is not particularly limited, but may be type I, type III, or type V collagen, preferably type I collagen, and more preferably type I collagen present in the skin.

[0021] The juniper berry used in the present invention may be juniper berry (scientific name: Juniperus communis), a plant of the genus Juniperus in the Cupressaceae family, also known as common juniper, juniperus communis, or rat stinger. In the present invention, juniper berry refers to the whole plant (whole plant), or parts of the plant such as fruit, leaves, stems, flowers, buds, seeds, and roots, or a mixture thereof, but the fruit is preferred, and these plant bodies may be used as they are, or may be treated by drying, crushing, shredding, or the like. Furthermore, it is preferable to perform a dry heat treatment before extraction in order to enhance the effect.

[0022] As mentioned above, dry heat treatment refers to a processing method in which heat is applied to materials through fire, air, oil, metal plates, etc., without adding water. It is generally believed that dry heat treatment causes changes in chemical components such as proteins, making it possible to change the color, taste, aroma, etc. The changes in chemical components also vary depending on the heating temperature and time.

[0023] The temperature of the dry heat treatment of juniper berries is preferably 100°C or higher, more preferably 120 to 300°C. Furthermore, 150 to 250°C is particularly preferred. At 300°C or higher, the plant is likely to be carbonized, making it unsuitable for extraction. The time of the dry heat treatment varies depending on the temperature, but is preferably 5 minutes or more, more preferably 5 to 30 minutes. Heating for 60 minutes or more often leads to carbonization of the plant, making it unsuitable for extraction. These treatments may be carried out in separate steps, such as 2 to 5 times. The total time in this case is preferably the time mentioned above.

[0024] For the dry heat treatment, a dryer, roaster, metal tray, frying pan, metal pot, pressure cooker, stone pot, iron plate, roasting pan, hot plate, hot stone, aluminum foil, toaster oven, grill, etc. can be used, and stirring, etc. can also be performed if necessary.

[0025] The extraction method is not particularly limited, but can be carried out by stirring or column extraction using water or hot water, or a mixed solvent of water and an organic solvent. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are good, and more preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are good. These solvents may be used alone or in combination of two or more. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, relative to the weight of the juniper berry (dry weight), but is preferably 100 times or less for the convenience of operations such as concentration and isolation after extraction. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0026] The extract may be used as it is in the form of an extracted solution, or may be used after subjecting it to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc., as long as the effects of the present invention are achieved. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0027] In the present invention, the above-mentioned extract may be used as it is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, acidulants, and other ingredients used in cosmetics, quasi-drugs, medicines, foods, and the like, within the scope of not impairing the effects of the extract.

[0028] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of the dosage forms thereof include lotions, creams, milky lotions, gels, aerosols, essences, packs, cleansers, bath agents, foundations, dusting powders, lipsticks, ointments, poultices, tablet confections, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0029] In the case of external use, the content of the above extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as a solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to see an increase in the effect, which is uneconomical.

[0030] In the case of internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. In general, the daily dosage for an adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0031] In the following, in order to explain the present invention in detail, examples of production, formulation and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. Unless otherwise specified, % in the examples refers to % by weight. EXAMPLES

[0032] Juniper berry extracts were produced as follows. In Production Examples 1 to 4, dried juniper berry fruit (dried at 60°C or less) was used which was dry-heated for 10 minutes at 180°C under airflow. In Production Examples 5 to 8, dried juniper berry fruit (dried at 60°C or less) was used without dry-heating.

[0033] (Production Example 1) Preparation of hot water extract of dry-heat-treated juniper berries 200 g of water was added to 10 g of dried juniper berries that had been subjected to dry heat treatment, and extraction was performed for 2 hours at 95 to 100° C. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 3.1 g of hot water extract of juniper berries that had been subjected to dry heat treatment.

[0034] (Production Example 2) Preparation of 50% ethanol extract of dry-heat-treated juniper berries 200g of 50% ethanol aqueous solution was added to 10g of dried juniper berries that had been subjected to dry heat treatment, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered, and the filtrate was concentrated and dried using an evaporator to obtain 3.5g of a 50% ethanol extract of dry-heat treated juniper berries.

[0035] (Production Example 3) Preparation of ethanol extract of dry-heat-treated juniper berries 200g of ethanol was added to 10g of dried juniper berries that had been subjected to dry heat treatment, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered, and the filtrate was concentrated and dried using an evaporator to obtain 2.0g of an ethanol extract of juniper berries that had been subjected to dry heat treatment.

[0036] (Production Example 4) Preparation of 1,3-butylene glycol extract of dry-heat-treated juniper berries 200g of 1,3-butylene glycol was added to 10g of dried juniper berries that had been subjected to dry heat treatment, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered to obtain 189g of 1,3-butylene glycol extract of dry-heat treated juniper berries.

[0037] (Production Example 5) Preparation of hot water extract of juniper berries 200 g of water was added to 10 g of dried juniper berry fruit, and the mixture was extracted for 2 hours at 95 to 100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 3.3 g of hot water extract of juniper berry fruit.

[0038] (Production Example 6) Preparation of 50% ethanol extract of juniper berries 200g of 50% ethanol solution was added to 10g of dried juniper berries, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered, and the filtrate was concentrated to dryness using an evaporator to obtain 3.7g of 50% ethanol extract of juniper berries.

[0039] (Production Example 7) Preparation of ethanol extract of juniper berries 200g of ethanol was added to 10g of dried juniper berries, and the mixture was left to soak at room temperature for 7 days to perform extraction. The resulting extract was filtered, and the filtrate was concentrated to dryness using an evaporator to obtain 2.1g of ethanol extract of juniper berries.

[0040] (Production Example 8) Preparation of 1,3-butylene glycol extract of juniper berry fruit 200g of 1,3-butylene glycol was added to 10g of dried juniper berry fruit, and the fruit was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered to obtain 192g of 1,3-butylene glycol extract of juniper berry fruit. EXAMPLES

[0041] (Formulation example 1) Lotion Formula Content (%) 1. Dry-heat-treated juniper berries Hot water extract (manufacturing example 1) 2.0 2.1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make up to 100% [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly with components 7 to 10, respectively, and the two are mixed and filtered to obtain the product.

[0042] (Formulation Example 2) Cream Formula Content (%) 1. Dry-heat-treated juniper berries 50% ethanol extract (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 2-9, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 1 and 11-13, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, cool with stirring, add ingredient 10 at 45°C, and cool further to 30°C to make the product.

[0043] (Formulation Example 3) Emulsion Formula Content (%) 1. Dry-heat-treated juniper berries Ethanol extract (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 1-8, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 10-13, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, cool with stirring, add ingredient 9 at 45°C, and cool further to 30°C to make the product.

[0044] (Formulation Example 4) Gel Formula Content (%) 1. Dry-heat-treated juniper berries 1,3-Butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make up to 100% [Manufacturing method] Components 2 to 5, 1 and 6 to 11 are each dissolved uniformly, and then the two are mixed to obtain the product.

[0045] (Formulation Example 5) Pack Formula Content (%) 1. Dry-heat-treated juniper berries Ethanol extract (Production Example 3) 1.0 2. Juniper berry fruit 1,3-Butylene glycol extract (Production Example 8) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Add purified water to make up to 100% [Manufacturing method] Components 1 to 11 are dissolved uniformly to produce the product.

[0046] (Formulation Example 6) Foundation Formula Content (%) 1. Dry-heat-treated juniper berries 50% ethanol extract (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetanol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 2-8, and keep at 80°C to make the oil phase. Allow ingredient 9 to swell well in ingredient 19, then add ingredients 1 and 10-13 and mix uniformly. Add ingredients 14-17, which have been ground and mixed in a grinder, and stir with a homomixer to make the water phase, keeping the temperature at 75°C. Add the water phase to the oil phase while stirring, and emulsify. Then cool, add ingredient 18 at 45°C, and cool to 30°C while stirring to make the product.

[0047] (Formulation Example 7) Bath additive Formula Content (%) 1. Hot water extract of juniper berries (Production Example 5) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total amount 100. [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0048] (Prescription Example 8) Ointment Formula Content (%) 1. Dry-heat-treated juniper berries Hot water extract (manufacturing example 1) 5.0 2. Dry-heat-treated juniper berries 50% ethanol extract (Production Example 2) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 3-6, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 1, 2, and 7-9, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, and cool to 30°C while stirring to make the product.

[0049] (Formulation Example 9) Powder Formula Content (%) 1. 50% ethanol extract of juniper berries (Example 6) 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to make a powder.

[0050] (Formulation Example 10) Tablets Formula Content (%) 1. Ethanol extract of juniper berries (Example 7) 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing method] Mix ingredients 1 to 4, then add an aqueous solution of ingredient 5 as a binder and mold into granules. Add ingredient 6 to the molded granules and compress into tablets. Each tablet weighs 0.52 g.

[0051] (Prescription Example 11) Tablets Formula Content (%) 1. Dry-heat-treated juniper berries Ethanol extract (Production Example 3) 2.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing method] Mix ingredients 1-4 and 7 and mold into granules. Add ingredients 5 and 6 to the molded granules and compress into tablets. Each tablet weighs 1.0 g.

[0052] (Formulation Example 12) Beverage Formula Content (%) 1. Dry-heat-treated juniper berries Hot water extract (manufacturing example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Add purified water to make up to 100% [Production method] Dissolve ingredients 1 to 3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0053] Next, experimental examples will be given to explain the effects of the present invention in detail. EXAMPLES

[0054] (Experimental Example 1) Evaluation of autophagy promotion using gene expression related to autophagy induction as an indicator Human dermal fibroblasts were seeded and cultured in DMEM culture medium containing 10% FBS under 37°C and 5% CO2 conditions. When the cells reached a confluent state, they were cultured for 24 hours in a culture medium to which a hot water extract (Production Example 1) of juniper berries subjected to dry heating treatment was added to a final concentration of 200 μg / mL, and total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The amount of mRNA expression was measured by real-time RT-PCR based on the total RNA extracted from the cells. For the real-time RT-PCR, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures were performed according to the prescribed method, and the expression levels of ATG7 (autophagy related 7) and BECN1 (beclin 1), which are factors that induce autophagy, were calculated as a ratio to the expression level of GAPDH mRNA, which is an internal standard. The expression levels of ATG7 and BECN1 were calculated as the ratio of the expression levels of ATG7 and BECN1 mRNA in the sample-added group to the expression levels of ATG7 and BECN1 mRNA in the sample-unadded group. The primers used to measure the expression level of each gene are as follows.

[0055] Primer set for ATG7 CTGTAACTTAGCCCAGTACCCTGGA (SEQ ID NO: 1) TACGGTCACGGAAGCAAACAAC (SEQ ID NO: 2) Primer set for BECN1 CCAGATGCGTTATGCCCAGAC (SEQ ID NO: 3) CATTCCATTCCACGGGAACAC (SEQ ID NO: 4) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 5) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 6)

[0056] The experimental results are shown in Table 1. As a result, the hot water extract of juniper berry fruit subjected to the dry heat treatment of the present invention (Production Example 1) was found to have excellent ATG7 expression promoting effect and BECN1 expression promoting effect. The same effect was also observed in the extracts of juniper berry fruit obtained by other extraction methods (Production Examples 2 to 8). Among them, the extracts of juniper berry fruit subjected to the dry heat treatment (Production Examples 1 to 4) were found to have a high effect. Thus, the extract of juniper berry was found to have an autophagy promoting effect, and the extract of juniper berry subjected to the dry heat treatment was found to have an extremely excellent autophagy promoting effect.

[0057] [Table 1]

[0058] (Experimental Example 2) Evaluation of autophagy promotion effect using autophagosomes as an indicator Human dermal fibroblasts were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. When the cells reached a confluent state, they were stained with DAPRed (Dojindo), an autophagosome staining reagent, according to the protocol. After that, the cells were cultured for 48 hours in a culture medium containing a hot water extract (Production Example 1) of juniper berries that had been dry-heated to a final concentration of 200 μg / mL. After staining the nuclei with Hoechst3342 (Dojindo), the area of ​​autophagosomes per nucleus (fluorescent area / nucleus) was calculated using a fluorescence microscope and image analysis software (ImageJ) and calculated as a ratio to the group to which no sample was added.

[0059] The test results are shown in Table 2. As a result, the hot water extract of juniper berry fruit subjected to the dry heat treatment of the present invention (Production Example 1) was found to have an excellent effect of increasing autophagosomes. The same effect was also observed in the extracts of juniper berry fruit obtained by other extraction methods (Production Examples 2 to 8). Among these, the extracts of juniper berry fruit subjected to the dry heat treatment (Production Examples 1 to 4) were found to have a high effect. Thus, the extract of juniper berry was found to have an autophagy-promoting effect, and the extract of juniper berry subjected to the dry heat treatment was found to have an extremely excellent autophagy-promoting effect.

[0060] [Table 2]

[0061] (Experimental Example 3) Evaluation of collagen production in waste-containing cultures Human dermal fibroblasts were seeded and cultured in a DMEM culture medium containing 10% FBS under conditions of 37°C and 5% CO2. When the cells were confluent, they were cultured for 48 hours in a culture medium to which a hot water extract (Production Example 1) of juniper berries subjected to dry heating treatment was added to a final concentration of 100 μg / mL, and the cell supernatant was collected to obtain a culture medium containing waste products (waste product-containing culture medium). The culture medium of another confluent human dermal fibroblast was replaced with the above waste product-containing culture medium, cultured for 24 hours, and the cells were collected and total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The amount of mRNA expression was measured by real-time RT-PCR based on the total RNA extracted from the cells. For real-time RT-PCR, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other operations were performed according to the prescribed method, and the expression level of COL1A1 (Collagen Type I Alpha 1 Chain) mRNA was calculated as a ratio to the expression level of GAPDH mRNA, which is an internal standard. The expression level of COL1A1 was calculated as a ratio to the expression level of COL1A1 mRNA in the sample-free group, which was cultured by replacing the waste-containing culture medium with a normal culture medium that did not contain waste. The primers used to measure the expression level of each gene are as follows.

[0062] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 7) TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 8)

[0063] The experimental results are shown in Table 3. As a result, when human skin fibroblasts were cultured in a waste product-containing culture medium without the addition of the sample, COL1A1 expression was decreased compared to when the cells were cultured in a normal culture medium without the addition of the sample and without the addition of waste products. This indicates that collagen production is decreased due to waste products. However, when the cells were cultured in a cell supernatant (waste product-containing culture medium) cultured with the hot water extract of the juniper berry fruit subjected to the dry heat treatment of the present invention (Production Example 1), the decrease in COL1A1 gene expression was suppressed compared to when the cells were cultured in a waste product-containing culture medium without the addition of the sample. Since no COL1A1 expression promoting effect was observed when the cells were cultured in a normal culture medium without the addition of the hot water extract of the juniper berry fruit subjected to the dry heat treatment of the present invention, it was shown that the hot water extract of the juniper berry fruit subjected to the dry heat treatment of the present invention suppresses the production of waste products, thereby suppressing the decrease in collagen production caused by waste products. The same effect was observed in the juniper berry fruit extracts obtained by other extraction methods (Production Examples 2 to 8). Among them, a high effect was observed in the dry-heat-treated juniper berry extract (Production Examples 1 to 4). Thus, the juniper berry extract was observed to have an inhibitory effect on the production of waste products and an inhibitory effect on the decrease in collagen production caused by the waste products, and the dry-heat-treated juniper berry extract was observed to have an extremely excellent inhibitory effect on the production of waste products and an inhibitory effect on the decrease in collagen production caused by the waste products.

[0064] [Table 3] [Industrial Applicability]

[0065] The present invention can be used as an autophagy promoter, a waste product production inhibitor, and an inhibitor of collagen production decrease caused by waste products, containing a juniper berry extract. It can also be used in cosmetics, foods, quasi-drugs, and medicines containing these. Furthermore, it can be used as a method for promoting autophagy or an additive for promoting autophagy to a medium, a method for inhibiting waste product production, or an additive for inhibiting waste product production to a medium in in vitro cell culture.

Claims

1. An autophagy promoter characterized by containing an extract of juniper berries.

2. A waste product production inhibitor characterized by containing an extract of juniper berries.

3. An agent for inhibiting the decline in collagen production caused by waste products, characterized by containing an extract of juniper berries.

4. The agent according to any one of claims 1 to 3, characterized in that the juniper berry extract is an extract of juniper berries that has been subjected to a dry heat treatment in which the extract is heated to 100°C or higher.

Images