Channel regulator

Abstract

To provide a method and a pharmaceutical composition for treating disorders in which regulation of a gap junction channel, gap junction hemichannel, and / or pannexin channel is effective.SOLUTION: A method for treating a subject having glaucoma, diabetic macular edema (DME), ocular fibrosis, retinal perfusion disorder, or ocular hypoxia includes administering a therapeutically effective amount of gap junction regulator, connexin regulator, pannexin regulator, or pannexin channel regulator to an eye of the subject.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This is a U.S. application claiming priority to U.S. Provisional Application Nos. 62 / 080,217, filed November 14, 2014, 62 / 085,226, filed November 26, 2014, 62 / 146,128, filed April 10, 2015, 62 / 147,488, filed April 14, 2015, 628630, filed August 22, 2014, and 709673, filed July 2, 2015, the contents of each of which are incorporated herein by reference in their entirety.

[0002] The present invention relates to connexin and pannexin channel modulators and modulation. [Background technology]

[0003] The following contains information that may be useful in understanding the present invention. No admission is made that any of the information, publications, or documents referenced herein, either expressly or implicitly, is prior art or essential to the presently described or claimed invention. All publications, patents, related applications, and other written or electronic materials mentioned or identified herein are incorporated herein by reference in their entirety. The incorporated information is effectively a part of the application as filed, and should be treated as part of the text and content of the application as filed, to the same extent as if all of the text and other content were repeated within the application.

[0004] Gap junctions are specialized intercellular connections found between most animal cell types. They are expressed in virtually all tissues of the body, except mature skeletal muscle and motile cell types such as sperm and red blood cells. Gap junctions directly connect the cytoplasm of two cells, which allows various molecules, ions, and electrical impulses to pass directly through a controlled gate between the cells.

[0005] In contrast to closed (tight) junctions and fixed (adherens and desmosomal) junctions, gap junctions do not seal membranes together or restrict the passage of materials between membranes. Rather, gap junction channels allow certain molecules to shuttle from one cell to another, thus providing a channel of physical communication by directly connecting the interiors of adjacent cells.

[0006] A gap junction channel consists of two connexons (or hemichannels) that connect across the intercellular space between adjacent cells, allowing intercellular molecules to flow between these cells. Each connexon of a gap junction resides in the membrane of adjacent cells and is formed by the covalent oligomerization of six individual connexin ("Cx", or "Cxn") proteins. Yeager (1998) Structure of cardiac gap junction intercellular channels, J Struct Biol 121:231-245. Connexons can contain one or more different connexin proteins, but connexons are usually in the form of homohexamers.

[0007] The human connexin family of genes and proteins is hereby numbered 21. (Sqhl G&Willecke K.(2004). Gap junctions and the connexin protein family. Cardiovasc Res. 62:228-232). Structural and functional diversity of connexin genes in the e mouse and human genome, Biol Chem 383:725-737. There are many variants in the range of connexins expressed in different tissue types, and often more than one connexin form is present within a cell type. See Sohl and Willecke (2004). Various combinations of connexins and connexons are capable of interacting with each other, but compatibility constraints exist. Marziano, et al. Hum Mol Genet. 12:805-812 (2003). Connexin proteins and their associated gap junction channels occur in a range of sizes and configurations that appear to provide some specificity for the chemical species that can pass through. Niessen et al. (2000) Selective permeability of different connexin channels to the second messenger inositol 1,4,5-tris trisphosphate, J Cell Sci 113(Pt 8):1365-1372. All connexins share a common structure with four transmembrane domains, two extracellular loops, a cytoplasmic loop, a short cytoplasmic amino terminus, and a carboxy terminus that can vary greatly in length. Unger,et al.(1999)Electron cryo-crystallography of a recombinant cardiac gap junction channel, Novartis Found Symp 219:22-30&discussion 31-43. Connexin proteins are generally named according to their molecular weight, e.g., Cx26 is a 26 kDa connexin protein. The main structural difference between connexin proteins is the length of the C-terminal cytoplasmic tail, connexin 26 has very little tail (16 amino acids), while connexins 43 and 32 have long and intermediate tails (156 and 73 amino acids, respectively). Differences in size and amino acid sequence of the cytoplasmic tails of different connexins are predicted to be involved, among other things, in the open and closed conformation of the channel. Gap junction function and / or dysfunction have been implicated in several disorders. For example, connexin 30 is mutated in Crowston syndrome (hidrotic ectodermal dysplasia) and mutations in the connexin 26 gene are the most common cause of inherited hearing loss. Mutations in the human connexin 32 gene cause the inherited neurological disorder Charcot-Marie-Tooth disease, while oculodentodigital dysplasia is generally thought to be caused by mutations in the gene encoding connexin 43.

[0008] Pannexins are a family of transmembrane channel glycoproteins, including Panx1, Panx2, and Panx3. Pannexins share similar structural features with connexins, consisting of four transmembrane domains, two extracellular loops, and one intracellular loop, with intracellular N- and C-terminal tails. Panx1 is expressed in many mammalian tissues, while Panx2 and Panx3 expression is more restricted. Panx1 has been implicated in calcium wave propagation, tone control, mucociliary lung clearance, and taste bud function. Panx1 is expressed in the brain, bladder, testis, and ovary, whereas Panx2 is expressed primarily in the brain and Panx3 is expressed in the skin, cartilage, heart, kidney, and cochlea. Panx1 hemichannels have been implicated in ATP release, calcium signaling, keratinocyte and osteoblast differentiation, taste sensing, cell death, postischemic neurodegeneration, tumor suppression, and seizures. Panx2 is involved in neuronal differentiation, while Panx3 is involved in chondrocyte, osteoblast differentiation, and sperm mutation and transport. Panx1 is localized to the plasma membrane, whereas Panx2 is located intracellularly. One major difference between connexins and pannexin channels is that pannexin channels do not form intercellular channels, suggesting that the highly glycosylated extracellular loops of the pannexin protein impede the docking process. Like connexin hemichannels, pannexin channels are said to be activated by several factors, but also show some differences. Both connexin hemichannels and pannexin channels contribute to glutamate and ATP release, but pannexin channels do not respond to decreases in calcium ion concentration. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Yeager (1998) Structure of cardiac gap junction intercellular channels, J Struct Biol 121:231-245 [Non-Patent Document 2] Sohl G&Willecke K. (2004). Gap junctions and the connexin protein family. Cardiovasc Res. 62:228-232 [Non-Patent Document 3] Structural and functional diversity of connexin genes in the mouse and human genome,Biol Chem 383:725-737 [Non-Patent Document 4] Marziano,et al.Hum Mol Genet. 12:805-812(2003) [Non-Patent Document 5] Niessen et al. (2000) Selective permeability of different connexin channels to the second messenger inositol 1,4,5-tris trisphosphate, J Cell Sci 113(Pt 8):1365-1372 [Non-Patent Document 6] Unger, et al. (1999) Electron cryo-crystallography of a recombinant cardiac gap junction channel, Novartis Found Symp 219:22-30&discussion 31-43 Summary of the Invention

[0010] The invention described and claimed herein has many features and embodiments, including but not limited to those described or illustrated in this Summary of the Invention, or referenced herein. Not intended to be comprehensive, the invention described and claimed herein is not limited to or by the features or embodiments set forth in this introduction, which are included for illustrative purposes only and are not limiting.

[0011] It is an object of the present invention to provide compounds, compositions, formulations, kits and methods for modulating gap junction channels, hemichannels and / or pannexin channels and / or for the treatment of disorders that would benefit from modulation of gap junction channels, hemichannels and / or pannexin channels. Thus, in one aspect, the invention relates to a method for modulation of gap junction channels, gap junction hemichannels, and / or pannexin channels, particularly, but not exclusively, for the treatment of disorders in which modulation of gap junction channels, gap junction hemichannels, and / or pannexin channels is beneficial, the method comprising administering a gap junction channel modulating agent, for example a compound of formula I (e.g., tonabersat), a connexin peptidomimetic compound, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or administering a pannexin modulating agent, such as a compound of formula VI (e.g., probenecid) and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a pannexin peptidomimetic compound and / or one or more analogs or prodrugs of any of these aforementioned compounds.

[0012] In one aspect, the invention provides methods for modulating gap junction channels and / or hemichannels using gap junction channel modulating agents or hemichannel modulating agents. In some embodiments, the gap junction channel modulating agents or hemichannel modulating agents , or a small molecule modulator. Small molecule gap junction channel modulators include, for example, compounds of Formula I, e.g., tonabersat, as well as analogs and / or prodrugs thereof. In some embodiments, the gap junction channel modulator or hemichannel modulator can be a peptidomimetic compound. Peptidomimetic gap junction channel modulators include, for example, peptide 5 (VDCFLSRPTEKT) and analogs thereof. In other embodiments, the gap junction channel modulator or hemichannel modulator can be an antisense oligonucleotide, which can be a chemically modified or unmodified oligonucleotide, e.g., an unmodified DNA oligonucleotide.

[0013] In some embodiments, the present invention provides methods for modulating pannexin channels using pannexin modulating agents. In some embodiments, the pannexin modulating agent may be a small molecule modulating agent. Small molecule pannexin channel modulating agents include, for example, compounds of formula VI, such as probenecid, as well as analogs and / or prodrugs of any of the foregoing compounds. In some embodiments, the pannexin modulating agent may be a synthetic mimetic peptide blocker of pannexin 1. Peptidomimetic pannexin channel modulating agents include, for example, 10 In some embodiments, the pannexin modulating agent may be a synthetic mimetic peptide blocker of pannexin 2. In some embodiments, the pannexin modulating agent may be a synthetic mimetic peptide blocker of pannexin 3.

[0014] In some embodiments, the method includes co-administering a gap junction channel modulating agent and a pannexin modulating agent. The co-administration of the gap junction channel modulating agent may be simultaneous with administration of the pannexin modulating agent, subsequent to administration of the pannexin modulating agent, or prior to administration of the pannexin modulating agent. In some embodiments, the compound of Formula I, e.g., tonabersat, and / or peptide 5, or an analog of either of these, or an analog of both, is administered in combination with a pannexin antagonist, e.g., a compound of Formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 It may also be co-administered with Panx1 or an analog thereof.

[0015] In another aspect, the invention provides for the manufacture of a medicament for modulating gap junction channels and / or hemichannels or the use of a hemichannel modulating agent in the treatment of any of the diseases, disorders, and / or conditions herein. Hemichannel modulating agents include, for example, compounds of formula I, e.g., tonabersat, and / or analogs thereof, and / or peptide 5 or analogs thereof, and / or antisense oligonucleotides, as described herein.

[0016] In another aspect, the invention provides gap junction channel modulating agents, hemichannel modulating agents, connexin modulating agents, and / or pannexin modulating agents, such as a compound of formula I, e.g., tonabersat, and / or an analog of any of the aforementioned compounds, or peptide 5 or an analog thereof, for use in modulating gap junction channels and / or hemichannels. In one aspect, the gap junction channel modulating agents, hemichannel modulating agents, connexin modulating agents, and / or pannexin modulating agents modulate gap junction channels and / or hemichannels and pannexins, respectively, preferably in humans or other animals. In some aspects, the invention provides pannexin modulating agents, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or synthetic mimetic peptide blockers of pannexins such as pannexin 1, e.g., 10 Panx1 or analogs thereof are also featured. A preferred pannexin channel modulating agent is a pannexin 1 channel modulating agent. In some embodiments, the gap junction channel modulating agent and / or hemichannel modulating agent is a pannexin or pannexin channel modulating agent. In addition, the present invention may be used in conjunction with pannexin modulating agents for modulation of gap junction channels and / or hemichannels. In some embodiments, modulation of pannexins and / or pannexin channels may occur before, after, or simultaneously with modulation of connexin channels. In other embodiments, modulation of connexin channels may occur before or after modulation of pannexin channels.

[0017] In another aspect, the invention provides a method for treating a disorder in which modulation of gap junction channels and / or hemichannels may be beneficial, by modulation of gap junction channels and / or hemichannels, the method comprising administering to the subject a connexin channel modulating agent and / or a hemichannel modulating agent. In some embodiments, the channel modulating agent may be, for example, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds, and / or a peptidomimetic compound, such as peptide 5 or an analog thereof, to the subject. In some embodiments in which modulation of pannexin channels may be beneficial, the method further comprises administering a pannexin antagonist or pannexin channel modulating agent. Pannexin modulating agents include, for example, a compound of formula VI, e.g., probenecid, and / or an analog or prodrug of any of the foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 In some embodiments, the method includes administering to the patient a pannexin antagonist, such as a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 The present invention includes administering a compound of formula I, such as tonabersat, and / or any analog of the aforementioned compounds together with Panx1 or an analog thereof. The administration of a compound of formula I, such as tonabersat, and / or any analog of the aforementioned compounds, may be simultaneous with, subsequent to, or prior to the administration of a pannexin antagonist. The administration of a pannexin antagonist may be subsequent to or prior to the administration of a connexin channel antagonist, such as a compound of formula I, such as tonabersat, and / or any analog of the aforementioned compounds. In some embodiments, the method of treatment is applied to a human. In some embodiments, the method of treatment is applied to a mammal, such as a human.

[0018] In another aspect, the invention features the use of a pannexin modulating agent in the manufacture of a medicament for modulating pannexin channels or treating one or more of the diseases, disorders, and / or conditions herein. Pannexin modulating agents include, for example, compounds of formula VI, such as probenecid, and / or analogs and prodrugs of any of the foregoing compounds, and / or synthetic mimetic peptide blockers of pannexin 1, such as 10 Panx1 or an analog thereof. In some embodiments, the gap junction channel modulating agent or hemichannel modulating agent and the pannexin modulating agent may be used to manufacture a single agent, or a set of agents, for modulating gap junction channels and / or hemichannels, and modulating pannexin channels.

[0019] In another aspect, the invention provides for the use of a connexin modulating agent such as a compound of formula I, e.g., tonabersat, and / or an analog thereof, or peptide 5 or an analog thereof, in the manufacture of a medicament for the treatment of a disorder in which modulation of gap junction channels and / or hemichannels may be beneficial. In some aspects in which modulation of pannexin channels may be beneficial, the invention provides for the use of a pannexin antagonist or pannexin channel modulating agent (e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 The present invention relates to the use of a phosphodiesterase inhibitor (e.g., Panx1 or its analogues).

[0020] In some embodiments, compounds of formula I, such as tonabersat, and / or analogs of any of the foregoing compounds, may be used together with pannexin antagonists in the manufacture of a medicament for the treatment of disorders in which modulation of gap junction channels and / or hemichannels, as well as pannexin channels, is beneficial.

[0021] In another aspect, the invention provides a gap junction channel modulator, e.g., a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds, or peptide 5 or an analog thereof, or another gap junction channel modulator, for use in the treatment of a disorder in which modulation of gap junction channels and / or hemichannels may be beneficial. In some aspects in which modulation of pannexin channels may be beneficial, the invention provides a pannexin antagonist, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these foregoing compounds, and / or pannexin 1, e.g., for use in the treatment of a disorder in which modulation of pannexin channels may be beneficial, including for the treatment of the diseases, disorders, and / or conditions described or indicated herein. 10 Also featured are synthetic mimetic peptide blockers of pannexins such as Panx1 or analogs thereof, or other pannexin channel modulators. In some embodiments, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, or peptide 5 or an analog thereof, may be used together with a pannexin antagonist for the treatment of disorders in which modulation of gap junction channels and / or hemichannels, as well as pannexin channels, may be beneficial. Administration of a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds, may be simultaneous with, subsequent to, or prior to administration of the pannexin antagonist.

[0022] In any of the embodiments of the present invention, for example, a compound of Formula I, such as tonabersat, or any of its analogs, peptide 5, or its analogs, may be used as a gap junction channel modulating agent. Other compounds having some gap junction channel and / or hemichannel regulating activity include anesthetics (including, for example, isoflurane, halothane, ethane), octanol, heptanol, 18α-glycyrrhetinic acid (including its metabolites), carbenoxolone, fenamic acids (including, for example, flufenamic acid or niflumic acid), cardiac glycosides (including, for example, ouabain), platelet-derived growth factor (PDGF), IGF-1, carbochol, phorbol esters, and arachidonic acid, oleic acid, or palmitoleic acid (for further examples, see Salameh A, et al., (2005) Biochim Biophys Acta 1719:36-58), and / or quinoline or mefloquine compounds (see, for example, Das S et al., Biochem Biophys Res Commun (2008) 373:504-508).

[0023] In various embodiments, the gap junction channels and / or hemichannels that are modulated include one or more of connexins 23, 25, 26, 30, 30.2, 30.3, 31, 31.1, 31.9, 32, 36, 37, 40, 40.1, 43, 45, 46, 47, 50, 59, and 62. In one embodiment, the gap junction channels and / or hemichannels that are modulated include one or more of connexins 26, 30, 32, 36, 37, 40, 45, and 47. In one particular embodiment, the gap junction channels and / or hemichannels that are modulated include connexin 30 and / or connexin 43.

[0024] In various embodiments, the pannexin and / or pannexin channel that is modulated is one or more of pannexin 1, pannexin 2, and pannexin 3.

[0025] In another aspect, the invention provides a method for the treatment of one or more diseases, disorders, or conditions described herein, comprising administering to a subject a gap junction channel modulating agent. In some embodiments, the gap junction channel modulating agent may be, for example, a compound of formula I, e.g., tonabersat, and / or an analog of any of the aforementioned compounds, or peptide 5 or an analog thereof. In some embodiments, the invention also provides a method for the treatment of one or more diseases, disorders, or conditions described herein, comprising administering a pannexin modulating agent, alone or in combination with one or more gap junction channel or hemichannel modulating agents. In some embodiments, the pannexin modulating agent is, for example, a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 It may be Panx1 or an analog thereof. In certain embodiments, the one or more diseases, disorders, or conditions are selected from the group consisting of, for example, chronic wounds, wounds that do not heal at an expected rate, dehiscence wounds; fibrosis, fibrotic diseases, disorders, or conditions; abnormal or excessive scarring; vascular disorders; tissue damage; orthopedic diseases or disorders; inflammation or inflammatory diseases; edema.

[0026] In another aspect, the present invention provides the use of a gap junction channel modulating agent or hemichannel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds, in the manufacture of a medicament for the treatment of one or more diseases, disorders, and conditions described herein. In some aspects, the present invention provides the use of a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these foregoing compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10Also provided is the use of Panx1, or any of their analogs. In some embodiments, the gap junction channel modulating agent can be used together with the pannexin modulating agent in the manufacture of separate or combined medicaments for the treatment of one or more of the diseases, disorders, and conditions described herein. In certain embodiments, the one or more disorders are selected from the group consisting of, for example, chronic wounds, wounds that do not heal at expected speed, dehiscence wounds; fibrosis, fibrotic diseases, disorders, or conditions; abnormal or excessive scarring; vascular disorders; tissue damage; orthopedic diseases or disorders; inflammation or inflammatory diseases; and edema.

[0027] In another aspect, the present invention provides gap junction channel modulating agents or hemichannel modulating agents, such as peptide 5, and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs of any of the foregoing compounds, for the treatment of one or more diseases, disorders, and conditions described herein. In some aspects, the present invention provides pannexin modulating agents, e.g., compounds of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these foregoing compounds, and / or synthetic mimetic peptide blockers of pannexin 1, e.g., for the treatment of one or more diseases, disorders, and conditions described herein. 10 Also provided is the use of Panx1, or any analog thereof, either alone or in combination with a gap junction channel and / or hemichannel modulating agent of the present disclosure. In certain embodiments, the one or more diseases, disorders, or conditions are selected from the group consisting of, for example, chronic wounds, wounds that do not heal at an expected rate, dehiscence wounds; fibrosis, fibrotic diseases, disorders, or conditions; abnormal or excessive scarring; vascular disorders; tissue damage; orthopedic diseases or disorders; inflammation or inflammatory conditions; and edema.

[0028] In another aspect, the present invention provides a gap junction channel modulator or hemichannel modulator, such as peptide 5, for the treatment of one or more of the diseases, disorders, and conditions described herein. Modulating agents, and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs of any of the foregoing compounds. In some embodiments, the present invention provides pannexin modulating agents, e.g., compounds of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of the foregoing compounds, and / or synthetic mimetic peptide blockers of pannexin 1, e.g., for the treatment of one or more disorders as set forth herein. 10 Also provided is the use of Panx1 or any of these analogs, either alone or in combination with gap junction channel modulating agents, including those disclosed herein.In certain embodiments, the one or more diseases, disorders, or conditions are selected from the group consisting of, for example, one or more of ischemia (including, for example, perinatal ischemia, cutaneous ischemia, and cardiac ischemia), stroke, asphyxia, brain trauma, spinal cord injury, heart attack, inflammatory cardiac disorders (including, for example, pericarditis), reperfusion injury (including, for example, cardiac reperfusion after surgery or transplantation), liver reperfusion after surgery or transplantation, retinal ganglion cell (RGC) loss and / or retinal ischemia, or ocular fibrosis.

[0029] In some aspects, the invention provides methods for improving recovery from surgery or procedures and / or treating post-surgical contracture, the methods comprising administering to a subject a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds. In related embodiments, the invention provides the use of a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds in the manufacture of a medicament for improving recovery from surgery or procedures and / or treating post-surgical contracture. In related embodiments, the invention provides a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds, for example, for improving recovery from surgery or procedures and / or treating post-surgical contracture.

[0030] In some embodiments, the present invention provides a method for improving recovery from surgery or procedure and / or treating post-surgical contracture, the method comprising administering to a subject a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 In a related embodiment, the invention relates to the use of a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10In a related embodiment, the present invention provides for the use of a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 In one embodiment, the surgery or procedure is an orthopedic surgery or procedure. In one embodiment, the post-operative contracture is an orthopedic post-operative joint contracture.

[0031] In another aspect, the invention provides a method for treating or reducing adhesion formation in a subject, the method comprising administering to the subject a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds. In the manufacture of a medicament for treating or reducing adhesion formation in an elephant, the present invention provides for the use of a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds. In related embodiments, the present invention provides for a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog of any of the foregoing compounds, for treating or reducing adhesion formation in a subject, for example.

[0032] In another aspect, the present invention provides a method for treating or reducing adhesion formation in a subject. The method further comprises administering to the subject a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10In a related embodiment, the invention relates to the use of a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 In a related embodiment, the present invention provides the use of a pannexin modulating agent, e.g., a compound of formula VI, e.g., probenecid, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 Panx1, or an analog of any of these.

[0033] In another aspect, the invention relates to the use of compounds of formula I, e.g., tonabersat, and / or analogs of any of the aforementioned compounds, for example, to directly and immediately block Cx43 hemichannels and cause a concentration- and time-dependent decrease in GJ coupling.

[0034] In yet other embodiments, a variety of disorders can be treated by the compositions and methods of the present invention, including methods of treatment using gap junction channel (eg, hemichannel) modulating agents, alone or in combination with pannexin channel modulating agents. These disorders include neurodegenerative diseases (e.g., Alzheimer's disease, AIDS-associated dementia, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, spinal muscular atrophy, and cerebellar degeneration); ischemic injury; pulmonary, renal, or hepatic fibrosis; vascular disease (e.g., restenosis, atherosclerosis, atherosclerotic coronary artery disease, or hypertension), respiratory disease (e.g., asthma, chronic bronchitis, bronchiectasis, or cystic fibrosis), unwanted or abnormal hypertrophy, arthritis, rheumatoid arthritis (RA), CNS trauma including psoriasis, psoriatic plaques, sarcoidosis, spinal cord injury, and optic nerve injury, diabetic and other proliferative retinopathies including retinopathy of prematurity, retrolental fibroplasia, open-angle, angle-closure, and normal tension glaucoma, as well as secondary glaucoma, pigmentary glaucoma, pseudoexfoliation, and glaucoma. Glaucoma, including traumatic glaucoma, neovascular glaucoma, and variants of open-angle and closed-angle glaucoma such as iridocorneal endothelial syndrome (ICE) and neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal graft neovascularization, corneal graft rejection, retinal / choroidal neovascularization, neovascularization of the angle (rubeosis), ocular neovascular disease, vascular restenosis, uveitis, dry eye disease, ocular and Conditions manifested by persistent epithelial defects of the cornea, arteriovenous malformations (AVMs), thyroid hyperplasia (including Graves' disease), corneal and other tissue transplants, chronic inflammation, pulmonary inflammation, ocular inflammation, acute lung injury / ARDS, sepsis, systemic capillary leak syndrome, multiple organ dysfunction syndrome (MODS), systemic inflammatory response syndrome (SIRS), acute respiratory distress syndrome, postburn vascular permeability syndrome, ascites, pleural effusion, and pericardial effusion, especially Permeability changes after cardiopulmonary bypass (in infants and young children), reperfusion injury, snakebite, primary pulmonary hypertension, malignant pulmonary effusion, cerebral edema (e.g., associated with acute stroke / close head injury / trauma), synovitis, osteoarthritis (OA), 3rd spacing of fluid disease inflammatory bowel disease (including Crohn's disease and ulcerative colitis), renal allograft rejection, inflammatory bowel disease, nephrotic syndrome, hemophilic arthropathy, hypertrophic scars, Osler's disease, pyogenic granulomatous retrolental fibroplasia, scleroderma, trachoma, vascular adhesions, synovitis, dermatitis, pre-eclampsia, ascites, pericardial effusion (such as that associated with pericarditis), pleural effusion, post-operative tissue edema, acute orthopedic injuries, hypersensitivity, cystic fibrosis, and ulcers or ulcerative lesions including chronic skin wounds, diabetic foot ulcers, venous leg ulcers, and pressure ulcers, as well as infectious diseases including malaria, dengue fever, and pneumonia.

[0035] Certain preferred treatments of these diseases, disorders, and conditions include administration of a gap junction channel modulating agent, such as a compound of formula I (e.g., tonabersat), a connexin peptidomimetic compound, and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or administration of a pannexin modulating agent, such as a compound of formula VI (e.g., probenecid) and / or one or more analogs or prodrugs of any of these aforementioned compounds, and / or a pannexin peptidomimetic compound and / or one or more analogs or prodrugs of any of these aforementioned compounds. Particularly preferred compounds are compounds of formula I, such as tonabersat, and compounds of formula VI, such as probenecid.

[0036] In some embodiments, the gap junction channel modulating agent or connexin modulating agent is a modulating agent of gap junctions and / or connexins present in blood vessels, such as a connexin 43 gap junction channel modulating agent or connexin 43 modulating agent, a connexin 40 gap junction channel modulating agent or connexin 40 modulating agent, or a connexin 45 gap junction channel modulating agent or conneixin 45 modulating agent. Preferably, the connexin modulating agent is a connexin 43 modulating agent. Connexin modulating agents and connexin 43 modulating agents include means for downregulating connexin transcription or connexin translation, such as, for example, antisense molecules. These also include, in the case of connexin 43, ZO-1 binding peptides. Preferably, the gap junction channel modulating agent is a connexin 43 gap junction channel modulating agent. A preferred connexin 43 gap junction channel modulating agent is tonabersat or another compound of formula I. The pharmaceutical composition of the present invention for any of the uses featured herein may also comprise a gap junction channel modulating agent, e.g., a polynucleotide, that can inhibit or block, for example, connexin 26 (Cx26), connexin 30 (Cx30), connexin 31.1 (Cx31.1), connexin 36 (Cx36), connexin 37 (Cx37), connexin 40 (Cx40), connexin 45 (Cx45), connexin 50 (Cx50), or connexin 57 (Cx57), or any other connexin, or connexin gap junction, or connexin hemichannel, in the eye or blood vessel. In another embodiment, the pharmaceutical composition of the present invention for any of the uses featured herein may be at least one pannexin modulating agent and may further comprise any of the gap junction channel modulating agents or connexin modulating agents described or shown herein.

[0037] In one aspect, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular and other disorders, including, for example, glaucoma, diabetic retinopathy (DR), diabetic macular edema (DME), age-related macular degeneration (AMD), ocular fibrosis, and / or neuropathic ocular disorders, by administering a therapeutically effective amount of at least one pannexin modulating agent to the eye of said subject. In some embodiments, the neuropathic ocular disorder can be, for example, glaucoma, loss of RGCs, and / or glaucomatous ocular neuropathy. In some embodiments, glaucoma is , high intraocular pressure. In some embodiments, glaucoma can be due to low-tension glaucoma or normal-tension glaucoma. In some embodiments, administration of a therapeutically effective amount of at least one connexin modulating agent is effective in treating (e.g., treating, preventing, slowing, reducing, stopping, or ameliorating) glaucoma, loss of retinal ganglion cells, and / or reducing glutamate concentration in the vitreous. The pharmaceutical composition of the present invention for any of the uses featured herein may also include a pannexin modulating agent, which may, for example, inhibit or block pannexin channels. In some embodiments, the pannexin modulating agent may or may not include a Panx1, Panx2, or Panx3 modulating agent. In some embodiments, the pannexin modulating agent may or may not include a Panx1 modulating agent.

[0038] In another aspect, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular and other disorders, including, for example, DR, glaucoma, DME, AMD, ocular fibrosis, and / or neuropathic ocular disorders, by administering a therapeutically effective amount of at least one pannexin modulating agent to the eye of the subject. In some embodiments, the neuropathic ocular disorder can be, for example, retinal ganglion cell (RGC) loss and / or glaucomatous ocular neuropathy. In some embodiments, administration of a therapeutically effective amount of at least one pannexin modulating agent is effective in treating (e.g., treating, preventing, slowing, reducing, stopping, or ameliorating) the loss of retinal ganglion cells, which is further useful in reducing vitreous glutamate concentration.

[0039] In one aspect, the invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating high intraocular pressure. In some embodiments, the treatment of high intraocular pressure treats or prevents intraocular pressure-related neuropathy. In some embodiments, the method for treating high intraocular pressure comprises, for example, administering to the eye of the subject a therapeutically effective amount of at least one hemichannel or connexin modulating agent and / or at least one pannexin channel or pannexin modulating agent. In one aspect, the invention relates to pharmaceutical compositions and methods for treating, for example, glaucoma. The methods herein provide for the treatment of intraocular pressure-related optic neuropathy, such as glaucoma, in an amount sufficient to reduce intraocular pressure. In some embodiments, the connexin modulating agent and / or pannexin modulating agent are useful for treating trauma associated with elevated intraocular pressure. In some embodiments, the connexin modulating agent is a connexin 43 modulating agent. In some embodiments, the compositions and methods of the invention are useful for treating high intraocular pressure and reducing intraocular pressure to normal levels, for example, less than 21 mm Hg, for example, levels between 8 and 21 mm Hg. In some embodiments, the compositions and methods of the present invention are useful for reducing intraocular pressure to less than about 22 mm, 21 mm, 20 mm Hg, or less.

[0040] The compositions, articles of manufacture, and methods described herein are useful in one embodiment for treating glaucoma without toxic side effects.In some embodiments, the glaucoma can be open-angle glaucoma or closed-angle glaucoma.In some embodiments, administering a therapeutically effective amount of at least one connexin or hemichannel modulating agent, such as a connexin 43 modulating agent or a connexin 43 hemichannel modulating agent, and / or at least one pannexin modulating agent to an ocular tissue of a subject in need thereof increases flow through the trabecular meshwork.

[0041] In one aspect, the invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating normal tension or normotensive glaucoma. In some embodiments, the methods include, for example, administering to the subject's eye a therapeutically effective amount of at least one connexin or hemichannel modulating agent, and / or at least one pannexin modulating agent. In one aspect, the invention relates to pharmaceutical compositions and methods for treating, for example, glaucoma. In some embodiments, the connexin modulating agent is connexin 43 or connexin 44. Nexin 43 hemichannel modulator. In some embodiments, the connexin modulator may be, or may not include, for example, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin or hemichannel modulator that includes said connexin in the eye or blood vessel, and / or at least one pannexin or pannexin channel modulator. In some embodiments, the compositions and methods of the present invention are useful for treating glaucoma even when intraocular pressure is below normal levels, e.g., 21 mm Hg. In some embodiments, the modulator may or may not include any of the foregoing.

[0042] In some embodiments, the present invention provides a method for treating glaucoma including hypertensive and normal tension glaucoma, clinical geographic atrophy; AMD including dry and wet AMD, ocular abnormalities or disorders, chronic macular ischemia, fibrosis, idiopathic polypoidal choroidal vasculopathy (IPC); diabetic maculopathy, diabetic retinopathy; hypertensive retinopathy, inflammatory choroidal neovascularization; central serous retinochoroidopathy (CSR); macular telangiectasia; pattern dystrophy; subretinal / subPRD (subPRD) neovascularization; serous detachment of the retinal neurosensory epithelium; RPE detachment; (subretinal pigment epithelial, subretinal, intraretinal, or preretinal) hemorrhage, including breakthrough hemorrhage into the vitreous; epiretinal, intraretinal, subretinal, or subpigment epithelial scarring. The present invention relates to pharmaceutical compositions, articles of manufacture, and methods for the treatment of ocular disorders which may or may not include scar / glial tissue or fibrin-like deposits; retinal fibrosis, retinal angiomatous proliferation and retinochoroidal anastomosis; choroidal neovascularization (CNV); cystoid maculopathy; retinal thickening; non-exudative AMD; and retinal scarring, uveitis including posterior uveitis, scleritis, episcleritis including cytomegalovirus (CMV) retinitis, viral retinitis, retinopathy of prematurity, retinal hypoxia, diffuse choroidal sclerosis, choriocapillaris sclerosis, dry eye, diabetic macular edema (DME), neuropathic ocular disorders, trauma-induced intraocular pressure reduction, epithelial basement membrane dystrophy, and / or other ocular disorders. Compositions and articles of manufacture useful in any of the methods of treatment described herein include a therapeutically effective amount of at least one connexin or hemichannel modulating agent, e.g., a connexin modulating agent, or at least one pannexin or pannexin channel modulating agent. In some embodiments, the connexin modulating agent is, e.g., a modulating agent of connexin 43 (Cx43), Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or a hemichannel comprising such connexins, or any other connexin or connexin hemichannel in the eye or blood vessel. In embodiments for treating diabetic retinopathy, the compositions may include, e.g., a pannexin or pannexin channel modulating agent, and / or a small molecule connexin or hemichannel modulating agent, e.g., a small molecule inhibitor of connexin 43 hemichannel or connexin 43 itself.In some aspects, a connexin modulating agent for treating diabetic retinopathy, or other disease, disorder, or condition herein, may be any connexin 43 modulating agent of the present disclosure, with or without a polynucleotide having SEQ ID NO: 1-3, and / or a modulated version thereof. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0043] The invention described and claimed herein can also be used in the treatment of cataract.The central retinal artery supplies blood to the eye, with a branch to the choroid perfusing the posterior part of the eye, and a superficial and deep vascular network supplies the anterior retina.Furthermore, a long branch perfuses the iris and ciliary body to provide nutrition and oxygen to the anterior part of the eye, including the lens (through the ciliary body).The inventor has surprisingly determined that diseases that affect the vascular bed, including diabetic retinopathy and age-related macular degeneration, also affect the flow to the anterior part of the eye, thus contributing to cataract formation, and it is noted that cataract is one of the most common causes of visual impairment in people with diabetes mellitus, and severe cataract in the eye may also be associated with a higher prevalence of late AMD.

[0044] In some aspects, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular disorders that may or may not include macular holes, macular degeneration, retinal breaks, DME, diabetic retinopathy (DR), vitreous retinopathy, refractive errors, dry eye, viral conjunctivitis, ulcerative conjunctivitis and scarring in wound healing, epithelial wounds of the cornea, Sjogren's syndrome, cataracts, sequelae of radial keratotomy, and increased corneal tissue thickness. In this embodiment, the composition may include, for example, a pannexin modulating agent, or a connexin modulating agent, for example, a small molecule inhibitor or peptide inhibitor of connexin 43. In some aspects, the connexin modulating agent is, for example, a modulating agent of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, and Cx57, or a modulating agent of any other connexin in the eye or blood vessels. In some aspects of this embodiment, the composition may include any of the connexin 43 modulating agents of the present disclosure, with or without, for example, a polynucleotide having SEQ ID NO: 1-3. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0045] In some aspects, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating cataracts. In this embodiment, the composition may include, for example, a pannexin or pannexin channel modulating agent, a gap junction modulating agent, a gap junction or hemichannel phosphorylating agent, or a connexin antagonist, such as a polynucleotide, peptide or peptidomimetic, or a small molecule antagonist of connexin. In some aspects, the connexin modulating agent is a modulating agent of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessel. In some aspects of this embodiment, the composition may include any Cx43 modulating agent of the present disclosure, for example, without tonabersat. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0046] In some aspects, the invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular disorders that may or may not include retinal vein or artery occlusion, glaucoma, retinal stroke, trauma causing elevated intraocular pressure, diabetic retinopathy, cystoid macular edema. In this embodiment, the composition may include, for example, a pannexin or pannexin channel modulating agent, a gap junction modulating agent, a gap junction or hemichannel phosphorylating agent, in the case of Cx43, a ZO-1 binding site peptidomimetic, or another connexin antagonist, such as a polynucleotide, peptide or peptidomimetic, or a small molecule antagonist of a connexin. In some aspects, the connexin modulating agent is a modulating agent of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessels. In some aspects of this embodiment, the composition may include any of the Cx43 modulators disclosed herein, for example, without tonabersat. In some embodiments, the modulator may or may not include any of the foregoing.

[0047] In some aspects, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating Alzheimer's disease, Parkinson's disease, Huntington's chorea, and amyotrophic lateral sclerosis, migraine or aura with or without migraine, sciatica / radiculopathy. In this embodiment, the composition may include, for example, a pannexin modulating agent, a gap junction or hemichannel phosphorylating agent, or a connexin antagonist, for example, alone or in combination. In some aspects, the connexin modulating agent is, for example, a modulating agent of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessels. In some aspects of this embodiment, the composition may include, for example, a compound of formula I, for example For example, the modulating agent may include any of the connexin 43 modulating agents of the present disclosure, including tonabersat and analogs of any of the foregoing compounds, as well as, for example, tonabersat prodrugs and ocular-targeted prodrugs of the disclosed compounds of formula I. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0048] In one aspect, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular hypoxia, ocular vascular damage, and / or vascular leakage. In some embodiments, the treatment and prevention of ocular hypoxia includes treatment or prevention of vascular leakage, vascular breakdown, and / or any other condition that causes lower than normal oxygenated blood flow to the choroid or other blood vessels in the eye. In some embodiments, the treatment or prevention of ocular hypoxia includes treatment of a condition that causes blood vessel compression or otherwise affects blood flow to the eye. In some embodiments, a method for treating an ocular disorder, such as ocular hypoxia, glaucoma, AMD, DME, ocular fibrosis, and / or retinal perfusion disorder, includes, for example, administering to the subject's eye a therapeutically effective amount of at least one gap junction modulating agent or connexin modulating agent, or at least one pannexin or pannexin channel modulating agent. In one aspect, the present invention relates to pharmaceutical compositions and methods, for example, for treating glaucoma or for treating AMD.

[0049] In some embodiments, the compositions of the present invention are useful as adjuvants to improve the success rate of trabeculectomy.

[0050] The front of the eye is filled with aqueous humor, a clear fluid that provides nutrition to structures within the front part of the eye. This fluid is constantly produced by the ciliary body that surrounds the lens of the eye. Aqueous humor drains out of the eye through the pupil and through trabecular meshwork channels located at the junction where the cornea attaches to the iris, called the drainage angle of the eye. In some embodiments of the present invention, one or more gap junction or connexin modulating agents, or pannexin or pannexin channel modulating agents are administered to the trabecular meshwork or ciliary body.

[0051] In some aspects of the invention, compositions, articles of manufacture, and methods are also featured for treating other ocular conditions, such as retinal or ocular ischemic disease, in a subject, comprising administering a therapeutically effective amount of a gap junction modulating agent, a connexin modulating agent, or a pannexin or pannexin channel modulating agent, including an amount effective to reduce inflammation in the inner retina. In some aspects, the retinal ischemic disease is a retinal artery occlusion or a central retinal vein occlusion. In some aspects, the ocular ischemic disease is a retinal artery occlusion or a central retinal vein occlusion. The disease is, for example, anterior ischemic optic neuropathy. In some embodiments, the connexin modulating agent is a connexin 43 modulating agent.

[0052] The present invention also features compositions, articles of manufacture, and methods for reducing impaired choroidal perfusion and / or choroiditis, or choroidal overperfusion in a subject, comprising administering to the subject's choroid an amount of a gap junction modulating agent, a connexin modulating agent, or a pannexin or pannexin channel modulating agent effective to reduce impaired choroidal perfusion and / or choroiditis, or choroidal overperfusion in the inner retina. In some embodiments of the invention, administration of a therapeutically effective amount of a gap junction modulating agent, connexin modulating agent, or pannexin or pannexin channel modulating agent to the choroid of a subject effective to reduce impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, also reduces choriocapillaris endothelial cell loss and / or choriocapillaris shedding, thereby treating or preventing an ocular disorder. In some embodiments, reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, also reduces retinal pigment epithelial degeneration and / or drusen development, or otherwise reduces the occurrence of dry macular degeneration or wet macular degeneration. The present invention improves, stops, slows, and / or reverses the progression of macular degeneration or macular dystrophy that may occur. In some embodiments, the gap junction modulating agent, connexin modulating agent, or pannexin or pannexin channel modulating agent for reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion is a Cx43 modulating agent. The gap junction modulating agent, connexin modulating agent, or pannexin or pannexin channel modulating agent for reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion may be administered in conjunction with an ocular therapeutic agent.

[0053] Impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, can induce vascular leakage in the choroid and cause endothelial cell loss in the retinal pigment epithelium.As described herein, it has surprisingly been found that impaired choroidal perfusion and / or choroiditis, as well as choriocapillaris shedding, result from upregulation of Cx43, and that upregulation of Cx43 is a contributing cause of AMD.Vascular structures have been found in the choroid of the retina of AMD organ donors associated with changes in Cx43 expression, supporting the role of upregulation of Cx43 in AMD.In some embodiments, the treatment or prevention of impaired vascular leakage and choroidal perfusion and / or choroiditis, or choroidal hyperperfusion is useful in the treatment or prevention of retinal pigment epithelium degeneration or retinal neovascularization associated with pathologies such as non-exudative AMD, or dry AMD, neovascular AMD, or wet AMD, and drusen development. As surprisingly found and described herein, upstream events such as vascular leakage and impaired choroidal perfusion and / or choroiditis are associated with AMD choroidal changes and, in turn, symptoms, such as retinal pigment epithelial degeneration or retinal neovascularization.

[0054] Thus, in one aspect, the invention features methods of administering a gap junction modulating agent, connexin modulating agent, and / or pannexin or pannexin channel modulating agent of the invention, alone or in combination with one or more ocular therapeutics for use in the treatment of AMD, including ocular agents for use in the treatment of neovascular AMD, wet AMD, drusenogenesis, dry AMD, retinal pigment epithelial degeneration, or geographic atrophy. The gap junction modulating agent, connexin modulating agent, or pannexin or pannexin channel modulating agent of the invention may be administered separately, simultaneously, or in a combined composition with the ocular therapeutic.

[0055] In some aspects, the connexin or pannexin oligonucleotides and polynucleotides of the present invention are chemically or synthetically produced or otherwise manufactured. In some embodiments, the connexin modulating agent is a connexin oligonucleotide or polynucleotide. In one embodiment, the connexin modulating agent is a connexin antisense oligodeoxynucleotide, whether chemically modified or unmodified, such as a Cx43 antisense oligodeoxynucleotide or an antisense oligodeoxynucleotide against Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessel. In some aspects, the modified connexin antisense polynucleotide or oligonucleotide may comprise a mixture of modified and unmodified nucleotides. In some aspects, the connexin antisense compound used in the methods herein is an antisense oligonucleotide comprising natural nucleotides and unmodified internucleoside linkages. In some embodiments, the connexin oligonucleotide or polynucleotide and / or connexin antisense oligodeoxynucleotide may be, for example, a Cx43 antisense oligonucleotide, polynucleotide, and / or Cx43 antisense oligodeoxynucleotide. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0056] Connexin antisense oligonucleotides containing at least one unmodified nucleotide or polynucleotides are featured in the present invention. In one embodiment, the connexin antisense oligonucleotide or polynucleotide may comprise at least one modified nucleotide and / or may have at least one modified internucleoside linkage and / or at least one modified sugar moiety. The modified internucleoside linkage may be, for example, a phosphorothioate linkage. In some embodiments, for example, the connexin polynucleotide may comprise at least one nucleotide that comprises a conformationally strained nucleotide, for example, a locked nucleic acid (LNA) or a bridged nucleic acid (BNA). Locked nucleotides include, for example, the following types: 2′-O-CH 2 -4′(oxy-LNA), 2′-CH 2 -CH 2 -4′ (methylene-LNA), 2′-NH-CH 2 -4′(amino-LNA), 2′-N(CH 3 )-CH 2 -4′(methylamino-LNA), 2′-S-CH 2 -4′ (thio-LNA), and 2′-Se-CH 2-4' (seleno-LNA). In some embodiments, the modified nucleotide may be a locked or unlocked nucleic acid. In some embodiments, the modified and unmodified connexin antisense oligonucleotide or polynucleotide is a modified and unmodified Cx43 antisense oligonucleotide or polynucleotide. In some embodiments, the modified and unmodified connexin antisense oligonucleotide or polynucleotide is a modified and unmodified Cx26 antisense oligonucleotide or polynucleotide, a Cx31.1 antisense oligonucleotide or polynucleotide, a Cx30 antisense oligonucleotide or polynucleotide, a Cx45 antisense oligonucleotide or polynucleotide, a Cx36 antisense oligonucleotide or polynucleotide, a Cx37 antisense oligonucleotide or polynucleotide, a Cx40 antisense oligonucleotide or polynucleotide, a Cx50 antisense oligonucleotide or polynucleotide, or a Cx57 antisense oligonucleotide or polynucleotide. In some embodiments, the connexin antisense oligonucleotide or polynucleotide comprises a chiral phosphorous acid moiety, such as those described in WO2013012758.

[0057] Exemplary modified or unmodified connexin 43 antisense compounds are also featured herein, comprising a nucleotide sequence or modified from a nucleotide sequence selected from SEQ ID NOs: 1-16. Polynucleotides of the invention include polynucleotides having less than 80 nucleotides in length, e.g., 12-18 to about 50-80 nucleotides in length, preferably about 30 nucleotides in length or less, e.g., 12 to about 30 nucleotides in length, more preferably about 15 to about 30 nucleotides in length. In one example, the polynucleotide has 30 nucleotides. The methods of the invention, in some embodiments, feature the use of connexin 43 antisense compounds up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, comprising a nucleotide sequence selected from SEQ ID NOs: 1-17, SEQ ID NOs: 4-17, or comprising about 8-40 nucleotides of SEQ ID NO: 17. In some embodiments, Cx43 antisense compounds may be modified by replacing one or more thymine nucleotides in SEQ ID NOs: 4-17, or SEQ ID NOs: 1-3, with one or more uridine nucleotide residues.

[0058] Also featured herein are modified or unmodified Cx45 antisense polynucleotides comprising 8 to about 80 nucleotides of SEQ ID NO:217, and modified and unmodified pannexin antisense polynucleotides comprising 8 to about 80 nucleotides of SEQ ID NO:279. Polynucleotides of the present invention include synthetic polynucleotides having a length of less than 80 nucleotides, for example, 12 to 18 to about 50 to 80 nucleotides, preferably about 30 nucleotides or less, for example, 12 to about 30 nucleotides, more preferably about 15 to about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. The methods of the present invention, in some embodiments, include synthetic polynucleotides having a length of up to 40 nucleotides, for example, 15 to 40 nucleotides, for example, about 8 to about 40 or about 15 to about 40 nucleotides of SEQ ID NO:217. The present methods, in some embodiments, feature the use of pannexin antisense compounds comprising up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, e.g., about 8 to about 40 or about 15 to about 40 nucleotides of SEQ ID NOs: 283-287. In some embodiments, the connexin 45 or pannexin antisense compound may be modified by substituting one or more thymine nucleotides in SEQ ID NO: 217, or SEQ ID NOs: 283-287, with one or more uridine nucleotide residues.

[0059] Modified or unmodified Cx26 polynucleotide, Cx31.1 polynucleotide, Cx36 polynucleotide, Cx37 polynucleotide, Cx40 polynucleotide, Cx50 polynucleotide, or Cx57 polynucleotide, or modified or unmodified antisense polynucleotide against any other connexin in eye or blood vessel are also featured for use in any of the methods featured herein.The pharmaceutical composition of the present invention for any of the uses featured herein may also include a pannexin antisense polynucleotide modulating agent that can suppress pannexin channel, such as Panx1, or Panx2, or Panx3.In some embodiments, the modulating agent may or may not include any of the above.

[0060] In some embodiments of the invention, the connexin 43 antisense oligonucleotide or polynucleotide has at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to a polynucleotide having a sequence selected from SEQ ID NOs: 1-17. The connexin or pannexin oligonucleotide or polynucleotide may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to an 8-80 nucleotide portion of these respective sequences. For example, a connexin 45 modulating agent that is an oligonucleotide or polynucleotide may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to an 8-80 nucleotide portion of SEQ ID NO:217, while a pannexin ... 4 (Panx2 polynucleotide), (for variant 1, Panx2 polynucleotide RefSeq No. NM_052839.3), SEQ ID NO:285 (for Panx2 polynucleotide variant 2, RefSeq No. NM_001160300.1), SEQ ID NO:286 (for Panx2 polynucleotide variant 3, RefSeq No. NR_027691.1), or SEQ ID NO:287 (Panx3 polynucleotide) (Panx3 polynucleotide RefSeq No. NM_052959.2), or an 8-80 nucleotide portion of these variants. In some embodiments, the pannexin modulating agent may or may not include a pannexin peptide sequence. The pannexin peptide sequence may comprise 8-40 contiguous amino acids, the extracellular domain, the intracellular domain, the carboxy-terminal portion, or the amino-terminal portion of polypeptide SEQ ID NO:288 (Panx1 peptide), SEQ ID NO:289 (Panx2 peptide), or SEQ ID NO:290 (Panx3 peptide), or variants thereof. In some embodiments, the modulating agent may or may not comprise any of the foregoing.

[0061] In other embodiments, the gap junction modulating agent or connexin modulating agent is a connexin peptide or peptidomimetic, sometimes referred to as an anti-connexin peptide or peptidomimetic, e.g., an anti-connexin hemichannel blocking peptide or peptidomimetic, e.g., a modified peptide comprising a connexin extracellular domain, a transmembrane domain, and a connexin carboxy-terminal peptide. The gap junction modulating agent or anti-connexin hemichannel blocking peptide or peptidomimetic may be modified or unmodified. The gap junction modulating agent and anti-connexin hemichannel blocking peptide or peptidomimetic are chemically, synthetically made or otherwise manufactured. In some embodiments, the gap junction modulating agent or connexin modulating agent is a Cx43 peptide or peptidomimetic. In some aspects, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the extracellular or transmembrane domain of a connexin, such as Cx43 or Cx45. In other embodiments, the pannexin or pannexin channel modulating agent is a pannexin peptide or peptidomimetic, e.g., a modified or unmodified peptide or peptidomimetic, sometimes referred to as an anti-pannexin peptide or peptidomimetic.

[0062] In some embodiments, the modulating agent of the invention comprises an anti-Cx43 peptide or peptidomimetic, e.g., any of the peptides described herein, including peptides comprising a portion of the extracellular domain of a connexin, and peptides comprising a portion of the carboxy-terminus of a connexin, that are useful in the methods of the invention that are therapeutically effective, e.g., effective to cure any of the neuropathic eye disorders described herein. In some aspects, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the extracellular domain or transmembrane domain of a connexin, such as Cx43.

[0063] In some embodiments, the modulating agent may be a gap junction closing compound and a hemichannel closing compound. In some embodiments, the gap junction closing compound and the hemichannel closing compound are connexin 43 gap junction closing compounds and connexin 43 hemichannel closing compounds. A preferred connexin carboxy terminal polypeptide is a connexin 43 carboxy terminal polypeptide.

[0064] In other embodiments, the gap junction modulating agent is a gap junction peptide or peptidomimetic, sometimes referred to as an anti-gap junction peptide or peptidomimetic, such as an anti-gap junction or hemichannel blocking peptide or peptidomimetic, such as a modified or unmodified peptide or peptidomimetic comprising the extracellular domain, transmembrane region, or connexin carboxy-terminal peptide of a protein comprising a gap junction in the eye, including Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, and Cx57. The anti-gap junction or hemichannel blocking peptide or peptidomimetic may be modified or unmodified. The anti-gap junction or hemichannel blocking peptide or peptidomimetic may be made chemically, synthetically, or otherwise manufactured. In some embodiments, the gap junction modulation agent is a Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, and Cx57 peptide or peptidomimetic.

[0065] Treatment of a subject with any of the ocular conditions described herein, e.g., glaucoma, DME, ocular fibrosis, AMD, or other ocular disorders referenced herein with one or more pharmaceutical compositions of the invention, e.g., an anti-connexin ODN such as a connexin hemichannel blocker and a gap junction modulating agent, e.g., a peptide or peptide mimetic, or a first anti-connexin agent and a second anti-connexin agent, may include simultaneous, separate, sequential, or continuous administration thereof.

[0066] In some aspects of the invention, the modulating agent is a gap junction closing or blocking compound, such as tonabersat, or a hemichannel closing or blocking compound. In some embodiments, the gap junction modulating agent may be a small molecule, also referred to herein as an anti-connexin or connexin modulating agent. In some aspects, the anti-connexin modulating agent drug has the formula I: [ka]

[0067] wherein Y is CR 1 and

[0068] R 1 is acetyl,

[0069] R 2 is hydrogen, C 3-8 Cycloalkyl, optionally interrupted by oxygen or substituted by hydroxy 1-6 Alkyl, C 1-6 Alkoxy or substituted aminocarbonyl, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonyloxy, C 1-6 Alkoxy, nitro, cyano, halo, trifluoromethyl, or CF 3 S; or the group CF 3 -A- (wherein A is -CF 2 - is),

[0070] -CO-, -CH 2 -, CH(OH), SO 2 , SO, C.H. 2 -O, or CONH; or the group CF 2 HA'- (wherein A' is oxygen, sulfur, SO, SO 2 , C.F. 2 or CFH; any aromatic moiety is optionally substituted; trifluoromethoxy, C 1-6 Alkyl sulfinyl, perfluoro C 2-6 Alkylsulfonyl, C 1-6 Alkylsulfonyl, C 1-6 Alkoxysulfinyl, C 1-6alkoxysulfonyl, aryl, heteroaryl, arylcarbonyl, heteroarylcarbonyl, phosphono, arylcarbonyloxy, heteroarylcarbonyloxy, arylsulfinyl, heteroarylsulfinyl, arylsulfonyl, or heteroarylsulfonyl; any amino moiety optionally containing one or two C 1-6 Alkyl group, or C 1-6 Alkylsulfinylamino, C 1-6 Alkyl sulfonyl amino, C 1-6 Alkoxysulfinylamino or C 1-6 Alkoxysulfonylamino, or C 1-6 Alkylcarbonyl, nitro or cyano, or -C(C 1-6 alkyl)NOH or -C(C 1-6 Alkyl)NNH 2 substituted by ethylenyl, terminally substituted by 1-6 Alkylcarbonylamino, C 1-6 Alkoxycarbonylamino, C 1-6 Alkyl-thiocarbonyl, C 1-6 Alkoxy-thiocarbonyl, C 1-6 Alkyl-thiocarbonyloxy, 1-mercaptoC 2-7 alkyl, formyl, or aminosulfinyl, aminosulfonyl or aminocarbonyl; or optionally one or two C 1-6 By alkyl or C 2-7 Amino substituted by alkanoyl; R 3 and R 4 One of them is hydrogen or C 1-4 alkyl, the others are C 1-4 Alkyl, CF 3 or CH 2 X a Optionally, one or two C 1-4 Alkyl group, cyano, or C 1-4 Alkoxycarbonyl substituted fluoro, chloro, bromo, iodo, C 1-4 Alkoxy, Hydroxy, C 1-4 Alkylcarbonyloxy, -SC1-4 Alkyl, nitro, amino; or R 3 and R 4 Both are optionally C 1-4 Alkyl-substituted C 2 -5 Polymethylene,

[0071] R 5 is C 1-6 Alkylcarbonyloxy, benzoyloxy, ONO 2 , benzyloxy, phenyloxy or C 1-6 Alkoxy, R 6 and R 9 is hydrogen or R 5 is hydroxy and R 6 is hydrogen or C 1-2 is alkyl, R 9 is hydrogen,

[0072] R 7 is heteroaryl or phenyl, optionally both of which are optionally 1-4 Alkyl, Cyano, Azido, C 1-4 substituted one or more times with groups or atoms selected from chloro, fluoro, bromo, iodo, nitro, amino, substituted one or two times with alkoxy, trifluoromethoxy, and trifluoromethyl;

[0073] R 8 is hydrogen, C 1-6 Alkyl, OR 11 , or NHCOR 10 and R 11 is hydrogen, C 1-6 Alkyl, formyl, C 1-6 Alkanoyl, aroyl, or aryl-C 1-6 is alkyl, R 10 is hydrogen, C 1-6 Alkyl, C 1-6 Alkoxy, mono- or di-C.sub.1-6 alkylamino, amino, amino-C.sub.1-6 alkyl, hydroxy-C 1-6 Alkyl, halo-C1-6 Alkyl, C 1-6 Acyloxy-C 1-6 Alkyl, C 1-6 Alkoxycarbonyl-C 1-6 - alkyl, aryl, or heteroaryl; R 8 -N-CO-R 7 The group is R 5 group, and X is oxygen or NR 12 and R 12 is hydrogen or C 1-6 It is an alkyl.

[0074] In some embodiments, with respect to any of the above Markush groups, each group may or may not include any of the species listed for that group.

[0075] In some embodiments, the small molecule connexin modulating agent can be tonabersat, carabelsat, or SB-204269. SB-204269 is also known as (trans-(+)-6-acetyl-4S-(4-fluorobenzoylamino)-3,4-dihydro-2,2-dimethyl-2H-benzo[b]pyran-3R-ol). Carabelsat is also known as N-[(3R,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydro-2H-chromen-4-yl]-4-fluorobenzamide. Tonabelsat is also known as N-(6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydro-2H-chromen-4-yl)-3-chloro-4-fluorobenzamide.

[0076] With respect to any of the above Markush groups, the group may or may not include any of the species listed for that group.

[0077] In some embodiments, the connexin modulation agent may be a prodrug of any compound for use in the present invention. In one aspect, a connexin modulation agent prodrug of the present invention is a compound of formula II: [ka]

[0078] But often, during the ceremony,

[0079] Q is O or oxime;

[0080] R 2 is H,

[0081] A is a direct bond, -C(O)O*-, -C(R 3 )(R 4 )O*-, -C(O)OC(R 3 )(R 4 )O*-, or -C(R 3 )(R 4 )OC(O)O*-, where the atoms marked with * are R 1 Directly bonded to R 3 and R 4 are independently H, fluoro, C 1-4 Alkyl, or C 1-4 fluoroalkyl or R 3 and R 4 The atoms which together form a cyclopropyl group,

[0082] R 1 is selected from groups [1], [2], [2A], [3], [4], [5], or [6]; atoms marked with ** are directly bonded to A; [ka] R 5 and R 6 are each independently H, C 1-4 Alkyl, C 1-4 Fluoroalkyl, also is selected from benzyl,

[0083] R 7 are independent of each other, H, C 1-4 Alkyl, or C 1-4 fluoroalkyl;

[0084] R 8 (i) H, C 1-4 Alkyl or C 1-4 Fluoroalkyl, or teeth (ii) a side chain of a natural or unnatural alpha-amino acid or peptide described herein; or (iii) is selected from biotin or chemically binds to biotin;

[0085] R 9 is H, -N(R)(R 12 ), or -N + (R l )(R 12 )(R 13 )X - , or -N(R ll )C(O)R 14 is selected from

[0086] R 11 , R 12 , and R 13 are independent of each other, H, C 1-4 Alkyl, or C 1-4 fluoroalkyl; R 14 , H, C 1-4 Alkyl, or C 1-4 is a fluoroalkyl; R 10 and R 15 is independent, C 1-4 Alkyl or C 1-4 fluoroalkyl; X is a pharma- ceutically acceptable anion.

[0087] In some embodiments, R 2 is BR 21 where: B is a direct bond, -C(O)O*-, -C(R 23 )(R 24 )O*, C(O)OC(R 23 )(R 24 )*,or C(R23 )(R 24 )OC(O)O*, where the atoms marked with * are R 21 directly binds to R 23 and R 24 are independently H, fluoro, C 1-4 Alkyl, or C 1-4 fluoroalkyl; R 21 is selected from groups

[21] ,

[22] , [22A],

[23] ,

[24] ,

[25] , and

[26] ; atoms marked with ** are directly bonded to B; [ka] R 25 and R 26 are each independently H, C 1-4 Alkyl, C 1-4 fluoroalkyl, or benzyl; R 27 are independent of each other, H, C 1-4 Alkyl, C 1-4 fluoroalkyl; R 28 teeth, (i) H, C 1-4 Alkyl or C 1-4 Fluoroalkyl, or (ii) a side chain of a natural or unnatural alpha-amino acid or peptide described herein; or (iii) is selected from biotin or chemically binds to biotin;

[0088] R 29 is H, -N(R 31 )(R 32 ), or -N*(R 31 )(R 32 )(R 33 )X-, or -N(R 31 )C(O)R 34 is selected from R 31 , R 32 , and R 33 are independent of each other, H, C 1-4 Alkyl, or C1-4 fluoroalkyl; R 34 , H, C 1-4 Alkyl, or C 1-4 is a fluoroalkyl; X is a pharma- ceutically acceptable anion; R 30 and R 35 is independent, C 1-4 Alkyl or C 1-4 It is a fluoroalkyl.

[0089] With respect to any of the above Markush groups, the group may or may not include any of the species listed for that group.

[0090] In some embodiments, the peptides described herein may be connexin modulating agents, calmodulin modulating agents, or pannexin modulating agents.

[0091] In some embodiments, Q is a group of the formula =NHOR 43 where R 43 teeth, (i) H, C 1-4 Fluoroalkyl or optionally substituted C 1-4 alkyl; or (ii)-A 300 -R 300 and A 300 is a direct bond, -C(O)O*-, -C(R 3 )(R 4 )O*-, -C(O)OC(R 3 )(R 4 )O*-, or -C(R 3 )(R 4 )OC(O)O*-, where the atoms marked with * are R 30 directly binds to R 3 and R 4 are independently H, fluoro, C 1-4 Alkyl or C 1-4fluoroalkyl; or R 3 and R 4 The atoms which together form a cyclopropyl group, R 300 are selected from groups [1], [2], [2A], [3], [4], [5], or [6], and atoms marked with ** are A 300 directly binds to [ka]

[0092] R 5 and R 6 are each independently H, C 1-4 Alkyl, C 1-4 fluoroalkyl, or benzyl; R 7 are independent of each other, H, C 1-4 Alkyl, or C 1-4 fluoroalkyl; R 8 teeth, (iii) H, C 1-4 Alkyl or C 1-4 Fluoroalkyl, or (iv) a side chain of a natural or unnatural alpha-amino acid or a peptide described herein; or (v) is selected from biotin or chemically binds to biotin; R 9 is H, -N(R)(R 12 ), or -N + (R 1l )(R 12 )(R 13 )X - , or -N(R ll )C(O)R 14 is selected from R 11 , R 12 , and R 13 are independent of each other, H, C 1-4 Alkyl, or C 1-4 fluoroalkyl; R 14, H, C 1-4 Alkyl, or C 1-4 is a fluoroalkyl; R 10 and R 15 is independent, C 1-4 Alkyl or C 1-4 fluoroalkyl; X is a pharma- ceutically acceptable anion.

[0093] In one embodiment, R 43 , optionally a phosphate group (P(O)OR 61 R 62 ) replaced by C 1-4 In an example of such an embodiment, OR is alkyl. 43 -OCH 2 P(O)OR 61 OR 62 where R 61 and R 62 are independently H or C 1-4 It is an alkyl.

[0094] In another embodiment, R 43 is C(O)CH(R 100 )NH 2 wherein the group R 100 is a side chain of a natural or unnatural amino acid, or a peptide as described herein.

[0095] In one embodiment, OR 43 is -OC(O)CH(CH(CH 3 ) 2 )NH 2 It is.

[0096] In some embodiments, with respect to any of the above Markush groups, each group may or may not include any of the species listed for that group.

[0097] In some embodiments, the peptides described herein can be any of the peptide or peptidomimetic modulating agents disclosed herein, such as peptide or peptidomimetic connexin modulating agents or pannexin modulating agents. In some embodiments, the peptide connexin modulating agent can be any of SEQ ID NOs: 140-200, 237-313, and 343-356.

[0098] The compositions described herein can be used for ocular conditions that may or may not include those described herein.

[0099] In some embodiments, the prodrug may be as described in WO 2014 / 006407, incorporated herein by reference. In some embodiments, the promoiety of the connexin modulating agent may include a chaperone moiety that targets one or more regions or structures of the eye. The promoiety may be any peptide mimetic or peptide antagonist of the present disclosure. In some embodiments, the promoiety may be a single amino acid, optionally protected on the functional group of the single amino acid. In some embodiments, the promoiety may be a targeting species. In some embodiments, the promoiety may be a substrate for an inward flux or outward flux transporter on a cell membrane. The promoiety may be a substrate for an inward flux or outward flux transporter on a cell membrane. The yeti may be, for example, chemically bound biotin. The promoiety may be, for example, chemically bound D-serine.

[0100] In one embodiment of the methods of the invention, one or more gap junction modulating agents, one or more pannexin channel modulating agents, one or more hemichannel modulating agents, one or more connexin modulating agents, or one or more pannexin modulating agents described herein may be administered in combination with one or more ocular therapeutic agents useful for treating ocular disorders including, for example, glaucoma, ocular fibrosis, ocular hypoxia, AMD, DME, ocular hypoxia, and / or ocular neuropathic disorders. In some embodiments of the invention, one or more connexin modulating agents or pannexin modulating agents administered for the treatment of ocular disorders, for example, wet AMD or dry AMD, neuropathic ocular disorders, for example, loss of intraocular retinal ganglion cells, glaucomatous ocular neuropathy, and / or intraocular pressure-related neuropathy, may be administered together with an ocular therapeutic agent. In some embodiments, one or more gap junction modulating agents, one or more pannexin channel modulating agents, one or more hemichannel modulating agents, one or more connexin modulating agents, or more pannexin modulating agents may be co-administered in a formulation comprising one or more gap junction modulating agents, one or more pannexin channel modulating agents, one or more hemichannel modulating agents, one or more connexin modulating agents, or more pannexin modulating agents, and an ocular therapeutic agent.

[0101] The eye therapeutic agent for use in combination with one or more gap junction modulating agents, one or more pannexin channel modulating agents, one or more hemichannel modulating agents, one or more connexin modulating agents, or one or more pannexin modulating agents of the present invention includes, for example, anti-VEGF modulating agents, such as VEGF antagonists, mTOR inhibitors, PDGF modulating agents, such as PDGF antagonists, inhibitors of S1P production, squalamine, PEDF generators, tubulin binding agents, integrin inhibitors, or other therapeutic agents useful, for example, in the treatment of neovascularization AMD or wet AMD.Preferably, the eye therapeutic agent for use in combination with one or more of the modulating agents of the present invention is a PDGF modulating agent.In some embodiments, modulating agent may or may not include any of the above.

[0102] In some embodiments, the VEGF modulator may be an antagonist that suppresses and / or inhibits VEGF or suppresses and / or blocks an upstream agonist of VEGF. In some embodiments, the VEGF antagonist includes, for example, an antagonist that binds to and suppresses VEGF, a compound that suppresses the expression of VEGF, and / or a viral vector that includes a VEGF inhibitor or encodes a protein or antisense polynucleotide that blocks or suppresses VEGF. In some embodiments, the species that suppresses VEGF and / or the upstream agonist of VEGF may be an antibody or antibody fragment, a nanobody, a peptide or peptidomimetic, a receptor fragment, a recombinant fusion protein, an aptamer, a small molecule, or a single chain variable fragment (scFv). In some embodiments, the VEGF antagonist antibody may be, for example, Lucentis™ (ranibizumab), and / or Avastin™ (bevacizumab).

[0103] Increased mTOR activity in cells can result in the secretion of VEGF and PDGF, which promote angiogenesis by increasing mTOR activity in vascular cells. In some embodiments of the present invention, the VEGF regulator reduces the activity of VEGF-R or mTOR, thereby reducing angiogenesis. In some embodiments, the VEGF antagonist that inhibits and / or blocks the upstream agonist of VEGF binding partner and inhibits VEGF can be an RTP801 inhibitor or blocker. Furthermore, increased mTOR activity in cells can result in the secretion of VEGF and PDGF, which promote angiogenesis by increasing mTOR activity in vascular cells. Thus, in some embodiments, the VEGF regulator can be an mTOR inhibitor, such as a macrolide or a small molecule.

[0104] Ocular therapeutic agents for use in combination with one or more of the gap junction modulating agents, one or more pannexin channel modulating agents, one or more hemichannel modulating agents, one or more connexin modulating agents, or one or more pannexin modulating agents of the present invention also include, for example, complement modulating agents, as well as other therapeutic agents useful, for example, in the treatment of geographic atrophy, dry AMD, non-exudative AMD, and / or drusen development. The complement modulating agent can be, for example, compstatin, TP10, eculizumab, ARC1905, JPE-1375, PMX53, lampalizumab, or rhCFHp.

[0105] In some embodiments, ocular therapeutic agents for use in combination with one or more of the gap junction modulating agents, one or more pannexin channel modulating agents, one or more hemichannel modulating agents, one or more connexin modulating agents, or one or more pannexin modulating agents of the present invention may include a TNF-alpha inhibitor, a C-raf kinase inhibitor, an NSAID, or an nAChR inhibitor.

[0106] Anti-connexin modulating agents used in any of the administration, co-administration, compositions, kits, or methods of treatment of the invention may be Cx43 modulating agents, Cx45 modulating agents, modulating agents of Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, and Cx57, or modulating agents of any connexin present in ocular (or other) blood vessels.

[0107] The eye therapeutic agent useful in treating eye disorders such as glaucoma and / or retinal perfusion disorders, wet and / or dry AMD, or any other eye disorder described herein may be, for example, an alpha 2 agonist such as brimonidine, a carbonic anhydrase inhibitor, a beta blocker, an F2α prostaglandin analog, an anti-apoptotic agent, an N-methyl-D-aspartate (NMDA) receptor antagonist, a Rho kinase inhibitor, or a glutamate release inhibitor. The eye therapeutic agent may be a combination therapy, including administration of two or more eye therapeutic agents, which may or may not include, for example, a beta blocker and a carbonic anhydrase inhibitor such as timolol & travoprost or timolol & dorzolamide, a combination of an alpha 2 agonist and a beta blocker such as brimonidine and timolol, or a combination of an alpha 2 agonist and a carbonic anhydrase inhibitor such as brinzolamide and brimonidine. In some embodiments, the eye therapeutic agent may or may not include a Rho kinase inhibitor. In other embodiments, the eye therapeutic agent may be an adenosine mimetic. Other eye therapeutic agents may include neurotrophins such as ciliary neurotropic factor or nerve growth factor. In some embodiments, the eye therapeutic agent may or may not include one or more of alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab (e.g., Lucentis™), bevacizumab (e.g., Avastin™), protein ciliary neurotrophic factor, vascular endothelial growth factor modulating compound, and hypoxia inducible factor 1-alpha modulating compound, and any mixture thereof. In one embodiment, the gap junction modulating agent, pannexin channel modulating agent, hemichannel modulating agent, connexin modulating agent, or pannexin modulating agent administered alone or in combination with one or more ocular therapeutic agents may be modified or unmodified. In some embodiments of the invention, a modified connexin or pannexin modulating agent may include modified and unmodified moieties, such as modified and unmodified nucleotides or modified and unmodified amino acids.In some embodiments, the connexin or other modulating agent may be, for example, a modified oligonucleotide, modified polynucleotide, or modified peptide or peptide mimetic as described herein. In some embodiments, the connexin modulating agent may be co-administered before, together with, or after, or on the same or parallel dosing schedule, or in the same formulation, with one or more ocular therapeutic agents. In some embodiments, the pannexin or other modulating agent. The pannexin or other modulating agent may be, for example, a modified oligonucleotide, modified polynucleotide, or modified peptide or peptidomimetic as described herein. In some embodiments, the pannexin or other modulating agent may be administered together with or after one or more treatments for ocular neuropathy, or on the same or parallel dosing schedule. In some embodiments, the pannexin or other modulating agent may be, for example, a modified oligonucleotide, modified polynucleotide, or modified peptide or peptidomimetic as described herein. In some embodiments, the pannexin or other modulating agent may be administered together with or after one or more treatments for ocular neuropathy, or on the same or parallel dosing schedule.

[0108] In some aspects of the methods of the invention, two or more gap junction modulating agents, hemichannel modulating agents, or two or more connexin modulating agents as described herein may be administered, which may be the same or different types of modulating agents, e.g., two or more polynucleotides, two or more peptide or peptidomimetic compounds, or two or more compounds. For example, in some aspects of the methods of the invention, two or more Cx43 modulating agents as described herein may be administered, which may be the same or different types of modulating agents, e.g., two or more polynucleotides, two or more peptide or peptidomimetic compounds, or two or more compounds. In some embodiments, for example, one or more Cx43 polynucleotides may be co-administered with one or more Cx43 peptides or peptidomimetics, and / or one or more anti-connexin compounds, or any subcombination thereof. In some aspects, the methods of the invention may include administration of a connexin antisense polynucleotide to transiently modulate gap junction channels by modulating protein expression, and further include administration of a connexin peptide or peptidomimetic to directly and more immediately modulate gap junction channel function. For example, the methods of the invention may include administration of a Cx43 antisense polynucleotide to transiently modulate gap junction channels by modulating protein expression, and further include administration of a Cx43 peptide or peptide mimetic to directly modulate gap junction channel function. Modulating agents may also target the same or different proteins, such as Cx43, Cx45, and / or pannexins. Connexin modulating and / or blocking agents, pannexin modulating and / or blocking agents, gap junction modulating agents, hemichannel modulating and / or blocking agents may be modified or unmodified.

[0109] In some embodiments of the methods of the invention, one or more gap junction modulating agents and / or connexin modulating agents described herein may be administered together with a pannexin modulating agent, which may be the same or different types of modulating agents, e.g., two or more polynucleotides, two or more peptides or peptidomimetic compounds, or two or more compounds. In some embodiments, the connexin modulating agent is a Cx43 modulating agent.

[0110] In some embodiments of the methods of the invention, two or more pannexin modulating agents or pannexin channel modulating agents described herein may be administered, which may be the same or different types of modulating agents, e.g., two or more polynucleotides, two or more peptide or peptidomimetic compounds, or two or more compounds.

[0111] As further described herein, modified oligonucleotides further comprise one or more of the following selected components: modified internucleoside linkages, e.g., phosphorothioate linkages, and modified sugar moieties, e.g., conformationally strained sugars, e.g., LNA or BNA.

[0112] In some embodiments of the invention, a connexin modulating agent (e.g., Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx43, Cx45, Cx50, or The Cx57 modulating agent or pannexin modulating agent of the present invention is combined with a pharma- ceutically acceptable carrier or diluent to produce a pharmaceutical composition. In some embodiments, suitable carriers and diluents include buffered aqueous solutions, isotonic saline solutions, e.g., phosphate buffered saline, isotonic water, and the like.

[0113] In another embodiment, P2X7 receptor antagonists are administered alone or together with gap junction modulating agents, pannexin channel modulating agents, hemichannel modulating agents, connexin modulating agents, and / or pannexin modulating agents to treat the diseases, disorders, and conditions presented herein. P2X7 antagonists include NF279 (suramin analog), calmidazolium (calmodulin antagonist), KN-62 (CaM kinanse II antagonist), zinc, calcium, magnesium, and copper.

[0114] Various preferred embodiments are directed to treating the diseases, disorders, and conditions set forth herein. This includes the use of small molecules that block or improve or otherwise antagonize or inhibit hemichannel opening, alone or together with small molecules that block or improve or otherwise antagonize or inhibit pannexin channel opening, to treat various conditions including ocular neovascular disease, ocular edema, ocular microvascular disease, and diabetic eye disease. In various preferred embodiments, the small molecule that blocks or improves or inhibits hemichannel opening is tonabersat or an analog thereof, or a prodrug of any of these. In various preferred embodiments, the small molecule that blocks or improves or inhibits pannexin channel opening is probenecid or an analog thereof, or a prodrug of any of these. In various preferred embodiments, the disease, disorder, or condition is ocular neovascular disease, ocular edema, ocular microvascular disease, and diabetic eye disease. In certain embodiments, the disease, disorder, or condition is diabetic retinopathy, ischemic retinopathy, choroidal neovascularization, iris neovascularization, corneal neovascularization, retinal neovascularization, intraocular neovascularization, wet age-related macular degeneration, dry age-related macular degeneration, geographic atrophy of the eye, diabetic macular edema, diabetic retinopathy, diabetic retinal ischemia, proliferative diabetic retinopathy, Coats' disease, central retinal vein occlusion (CRVO), branch central retinal vein occlusion (BRVO), retinopathy of prematurity (ROP), subconjunctival hemorrhage, and hypertensive retinopathy, uveitis, or cataract.

[0115] In another preferred embodiment, the disease, disorder, or condition is glaucoma, including open-angle, angle-closure, and normal tension glaucoma, as well as variants of open-angle and angle-closure glaucoma, such as secondary glaucoma, pigmentary glaucoma, pseudoexfoliation glaucoma, traumatic glaucoma, neovascular glaucoma, and iridocorneal endothelial syndrome (ICE), and neovascular glaucoma. In another preferred embodiment, the disease, disorder, or condition is dry eye disease. In another embodiment, the disease, disorder, or condition is persistent intraocular and corneal epithelial defects. In yet another preferred embodiment, the disease, disorder, or condition is ulcers or ulcerative lesions, including chronic skin wounds, diabetic foot ulcers, venous leg ulcers, and pressure sores. In another preferred embodiment, the disease, disorder, or condition is CNS trauma, including spinal cord injury and optic nerve injury. The present invention also features a method for treating a patient diagnosed with or at risk of developing a neovascular disorder, in addition to administering a small molecule that blocks or improves or otherwise antagonizes or inhibits hemichannel opening, alone or together with a small molecule that blocks or improves or otherwise antagonizes or inhibits pannexin channel opening, the method also includes administering an anti-VEGF agent and / or an anti-PDGF agent to the patient as a therapeutic treatment. In one aspect, the PDGF antagonist and / or VEGF antagonist is administered simultaneously with, or within about 1-5, 10, or 90 days of, administration of the hemichannel antagonist and / or pannexin channel antagonist in an amount sufficient to inhibit neovascular disorder in the patient. In certain embodiments of the methods of the present invention, the PDGF antagonist and / or VEGF antagonist is administered simultaneously with a hemichannel antagonist or inhibitor, and / or a pannexin channel antagonist or inhibitor. In one embodiment, the PDGF antagonist is a PDGF-B antagonist. In another embodiment, the VEGF antagonist is a VEGF-A antagonist. In certain embodiments, the PDGF antagonist is a nucleic acid molecule, an aptamer, an antisense RNA molecule, a ribozyme, an RNAi molecule, a protein, a peptide, a cyclic peptide, an antibody, a binding fragment of an antibody fragment, a saccharide, a polymer, or a small molecule. In another embodiment, the VEGF antagonist is a nucleic acid molecule, an aptamer, an antisense RNA molecule, a ribozyme, an RNAi molecule, a protein, a peptide, a cyclic peptide, an antibody, a binding fragment of an antibody fragment, a saccharide, a polymer, or a small molecule. In certain embodiments, the method of the invention involves administration of a VEGF antagonist that is an aptamer, such as the EYE001 aptamer. In another embodiment, the method of the invention involves administration of a VEGF antagonist that is an antibody or a binding fragment thereof, such as Avastin® (bevacizumab) or Lucentis® (ranibizumab). In certain embodiments, the method of the invention involves administration of a PDGF antagonist that is an aptamer, an antibody, or a binding fragment thereof. In another specific embodiment, the method of the invention involves administration of a PDGF antagonist that is an antisense oligonucleotide. In yet another embodiment of this aspect of the invention, the PDGF antagonist and / or the VEGF antagonist are prodrugs. In another embodiment, the method of the invention provides a means for inhibiting or treating ocular neovascular disorders. In some embodiments, ocular neovascular disorders suitable for treatment or inhibition by the method of the invention include ischemic retinopathy, iris neovascularization, intraocular neovascularization, age-related macular degeneration, corneal neovascularization, retinal neovascularization, choroidal neovascularization, diabetic retinal ischemia, or proliferative diabetic retinopathy. In yet another embodiment, the method of the invention provides a means for inhibiting or treating psoriasis or rheumatoid arthritis in patients in need of treatment or in patients diagnosed with or at risk of developing such disorders. The present invention also provides pharmaceutical compositions comprising a PDGF antagonist and / or a VEGF antagonist, alone or together with small molecules that block or improve or otherwise antagonize or inhibit pannexin channel opening, together with one or more small molecules that block or improve or otherwise antagonize or inhibit hemichannel opening, and a pharma- ceutically acceptable carrier.In this aspect, the PDGF and / or VEGF antagonist is present in an amount(s) sufficient to inhibit neovascular injury in the patient. This pharmaceutical composition of the invention may include a pharma- ceutically acceptable carrier, including microspheres, nanoparticles, or hydrogel formulations. Another embodiment of this aspect of the invention provides a pharmaceutical pack comprising a PDGF antagonist and / or a VEGF antagonist, alone or together with a small molecule that blocks or improves or otherwise antagonizes or inhibits pannexin channel opening, together with a small molecule that blocks or improves or otherwise antagonizes or inhibits hemichannel opening. In one embodiment of this aspect, the pharmaceutical pack comprises a PDGF antagonist that is a PDGF-B antagonist. In another embodiment of this aspect, the pharmaceutical pack comprises a VEGF antagonist that is a VEGF-A antagonist. In another embodiment, the PDGF antagonist and the VEGF antagonist of the pharmaceutical pack are formulated separately and in individual dosage amounts. In yet another embodiment, the PDGF antagonist and the VEGF antagonist of the pharmaceutical pack are formulated together. It will be appreciated that combinations of anti-VEGF and / or anti-PDGF agents can also provide surprising synergistic therapeutic effects for the treatment of ocular neovascular disease. [Brief description of the drawings]

[0116] [Figure 1A] Scrape challenge study using Lucifer Yellow diffusing to adjacent hCMVEC cells as an indicator of gap junction coupling levels. In untreated groups, the dye diffuses immediately to adjacent cells. Peptide 5 at the lower dose of 100 μM had little effect on coupling, but at the higher dose of 500 μM, there was an immediate decrease in diffusion. Over time, both peptide concentrations slow gap junction uncoupling by 2 hours. The graph shows quantification of a similar experiment comparing the blocking efficacy of peptide 5 (immediate block, 500 μM) to carbenoxolone, a nonspecific gap junction channel blocker. [Figure 1B]Scrape challenge study using Lucifer Yellow diffusing to adjacent hCMVEC cells as an indicator of gap junction coupling levels. In untreated groups, the dye diffuses immediately to adjacent cells. Peptide 5 at the lower dose of 100 μM had little effect on coupling, but at the higher dose of 500 μM, there was an immediate decrease in diffusion. Over time, both peptide concentrations slow gap junction uncoupling by 2 hours. The graph shows quantification of a similar experiment comparing the blocking efficacy of peptide 5 (immediate block, 500 μM) to carbenoxolone, a nonspecific gap junction channel blocker. [Diagram 2] Quantification of scrape-loaded dye diffusion in hCMVEC cells treated with 50 μM tonabersat for various periods of time. Tonabersat has some immediate channel blocking effect, and its efficacy increases with time. *=p<0.05, **=p<0.001, ***=p<0.001. [Diagram 3] Tonaversat knockdown of Cx43 in APRE-19 cells in a dose-dependent manner. ARPE-19 cells after 6 hours of preincubation with tonaversat in control vehicle and at concentrations of 50 and 100 micromolar. Cells are labeled for connexin 43. In control cells, gap junctions are clearly localized at the cell-cell interface, but after 6 hours with 50 micromolar tonaversat, most junctions are internalized or lost. At 6 hours in the higher concentration of 100 micromolar tonaversat, only a small amount of connexin 43 labeling remains. [Figure 4] DAPI (nuclear stain) and labeling for the gap junction protein connexin 43 in ARPE-19 cells (left panel) and corresponding connexin 43-only labeling (right hand panel). Gap junction labeling in untreated cells is primarily at the cell-cell contacts (top panel). In cells treated with peptide 5 (500 μM) for 1 hour, the cell-cell contacts are still evident, but the majority of gap junctions have been internalized (lower panel). [Diagram 5]Electrophysiological recordings in connexin 43 transgenic (upper trace) and connexin-deficient HeLa cells (lower trace). As the voltage step is increased, an increase in channel activity is observed in the transgenic cells but not in the connexin-deficient cells. Thus, channel activity in the transgenic cells is the result of connexin 43 hemichannel opening. [Figure 6] Electrophysiological output recordings from connexin 43 transgenic HeLa cells treated with the non-specific channel blockers carbenoxolone and LaCl3, and with peptide 5 (100 μM). The non-specific channel blockers show virtually complete hemichannel blockade (compared to untreated HeLa cells in FIG. 7), with little channel activity remaining. Peptide 5 also shows significant hemichannel blockade. [Figure 7] Electrophysiological trace recordings form equivalent experiments to those shown in Figures 5 and 6. In this case, HCMVEC cells are shown before addition of tonabersat (50 μM) (top panel), during incubation with tonabersat (middle panel), and 3 min after washout (bottom panel). These results show that tonabersat almost completely abolishes hemichannel activity, with signs of activity returning after washout, indicating that tonabersat is a highly potent, direct hemichannel blocker. [Figure 8A] Tonaversat controls hemichannel-mediated ATP release from injured hCMVEC cells. ATP released from hCMVEC cells after 2 hours of exposure to injury in vitro. Quantification of total extracellular ATP release is shown for each treatment group as a percentage of the injury control group. A significant reduction in ATP was present across all treatment groups: 100 μM CBX, 100 μM peptide 5 and 1 mM probenecid, as well as 100 μM peptide 5 combined with 1 mM probenecid, compared to the injury control group, with the latter combination reducing total ATP release to the same level as CBX. Values ​​represent the mean ± SEM. ***P<0.001 vs injury control group. [Figure 8B]Tonaversat controls hemichannel-mediated ATP release from injured hCMVEC cells. Quantification of total extracellular ATP release is shown for each treatment group as a percentage of the injury control group. A significant decrease in ATP was present across all treatment groups: 100 µM CBX, 0.1 µM to 100 µM tonaversat combined with 1 mM probenecid, compared to the injury control group. Values ​​represent the mean ± standard error. ***P<0.001 vs injury control group. [Figure 8C] Tonabersat regulates hemichannel-mediated ATP release from injured hCMVEC cells. In this experiment, tonabersat did not reduce ATP release from hCMVEC cells in the absence of 1 mM probenecid (p>0.09) one-way ANOVA, Tukey's multiple comparison test. Values ​​represent the mean ± SEM. ***P<0.001 vs. injury control group. [Figure 9] Hypoxia-reperfusion: ATP released from subconfluent hCMVEC cells after 2 hours exposure to injury followed by 2 hours exposure to reperfusion in vitro. ATP is quantified as a percent of the injury-reperfusion (IR) control group. Significant reductions in ATP were observed with 100 μM CBX, 100 μM peptide 5, and 100 μM peptide 5 and 1 mM probenecid, but not with 1 mM probenecid alone. Significant reductions in ATP were also observed with 10 μM tonabersat. Values ​​represent mean ± SEM. One-way ANOVA Tukey's multiple comparison test *P<0.05 vs. IR control group. [Figure 10A] One hour treatment with tonabersat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Immunolabeling of Cx43 for 1 hour in serum-supplemented medium with 100 μM tonabersat (top) and 100 μM tonabersat + NH4Cl (n = 3 wells, 2 independent experiments). [Figure 10B] Quantification of the total area of ​​Cx43 plaques per cell after 1 h treatment with tonabersat (5–500 μM). [Figure 10C]Quantification of the total area of ​​Cx43 plaques per cell after 6 hours of treatment with tonabersat (50-500 μM) together with NH4Cl. B and C are normalized to the untreated control group. Significant differences are indicated as ***p<.0001. Bars represent mean ± SEM and differences between. Scale bar=30 μm. [Figure 11A] Tonaversat internalizes and downregulates Cx43 GJ plaques in ARPE-19 cells. A. Immunolabeling of Cx43 in serum-supplemented media for 1 h in untreated (top) and 100 μM tonaversat (bottom) (n=3 wells, 2 independent experiments). B. Quantification of the total area of ​​Cx43 plaques per cell after 1 h treatment with tonaversat (5-500 μM). Quantification of the total area of ​​Cx43 plaques per cell after 6 h treatment with tonaversat (5-500 μM). B and C are normalized to the untreated control group. Bars represent mean ± SEM, significant differences represent ***p<.0001. Statistical test one-way ANOVA, scale bar=30 μm. [Figure 11B] Tonaversat internalizes and downregulates Cx43 GJ plaques in ARPE-19 cells. A. Immunolabeling of Cx43 in serum-supplemented media for 1 h in untreated (top) and 100 μM tonaversat (bottom) (n=3 wells, 2 independent experiments). B. Quantification of the total area of ​​Cx43 plaques per cell after 1 h treatment with tonaversat (5-500 μM). Quantification of the total area of ​​Cx43 plaques per cell after 6 h treatment with tonaversat (5-500 μM). B and C are normalized to the untreated control group. Bars represent mean ± SEM, significant differences represent ***p<.0001. Statistical test one-way ANOVA, scale bar=30 μm. [Figure 11C]Tonaversat internalizes and downregulates Cx43 GJ plaques in ARPE-19 cells. A. Immunolabeling of Cx43 in serum-supplemented media for 1 h in untreated (top) and 100 μM tonaversat (bottom) (n=3 wells, 2 independent experiments). B. Quantification of the total area of ​​Cx43 plaques per cell after 1 h treatment with tonaversat (5-500 μM). Quantification of the total area of ​​Cx43 plaques per cell after 6 h treatment with tonaversat (5-500 μM). B and C are normalized to the untreated control group. Bars represent mean ± SEM, significant differences represent ***p<.0001. Statistical test one-way ANOVA, scale bar=30 μm. [Figure 12A] Six-hour treatment with tonabersat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Immunolabeling of Cx43 for 6 hours in serum-supplemented media with 100 μM tonabersat (top) and 100 μM tonabersat + NH4Cl (n=3 wells, two independent experiments). [Figure 12B] Six-hour treatment with tonabersat downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Quantification of the total area of ​​Cx43 plaques per cell after 1-hour treatment with tonabersat (5–500 μM). [Figure 12C] Treatment with tonabersat for 6 hours downregulates Cx43 GJ plaques via the lysosomal degradation pathway in ARPE-19 cells. Quantification of the total area of ​​Cx43 plaques per cell after treatment with tonabersat (50-500 μM) together with NH4Cl for 6 hours. B and C are normalized to the untreated control group. Significant differences ***p<.0001. Bars represent mean ± SEM and differences between. Scale bar=30 μm. [Figure 13]Cx43 mRNA levels in confluent monolayers of ARPE-19 cells incubated with DMSO (vehicle control) or 50 μM tonabersat for 1 hour. Bars represent mean ± SEM (n=3). There were no significant differences in Cx43 mRNA in ARPE-19 cells following treatment with 50 μM tonabersat compared to both the untreated group (p=0.7572) and the vehicle control group (p=0.10245). One-way ANOVA with Tukey's multiple comparison test. [Figure 14A] ATP concentrations for the various treatment groups versus the control group. [Figure 14B] Comparison of % cell viability for the various treatment groups versus the control group. [Figure 15] Retinal ganglion cell density 7 days after retinal ischemia at 120 mm Hg for 60 min. Results from both ischemic and contralateral eyes are shown. Mean ± SEM. N=2, 6, 6, 6, 5, 4, 4. NT, untreated; T, tonaversat. A statistically significant (p<0.01) loss of 31% of RGCs was found in untreated ischemic eyes (167,111 ± 14,188 cells / cm2, mean ± SEM) compared to normal controls (242,558 ± 15,840 cells / cm2). A statistically significant (p=0.03) loss of 35% of RGCs was found in ischemic eyes treated with 10 mg / kg tonaversat (158,739 ± 26,370 cells / cm2). However, ischemic eyes treated with 1 mg / kg tonabersat sustained less cell loss than the other groups (18%, 199,927 ± 26,058 cells / cm2). The difference between this group and the normal control group was a trend (p = 0.17). No loss of RGCs was found in any contralateral eye. [Figure 16A] Functional effects of tonabersat on cell-cell communication in hCMVEC cells in vitro. In the solvent control group, LY dye diffuses readily through coupled GJs to adjacent cells. Immediate or 2-hour tonabersat treatment (50 μM) causes a decrease in LY dye transfer as GJs become uncoupled. [Figure 16B]Functional effects of tonabersat on cell-cell communication in hCMVEC cells in vitro. Quantification of LY-positive hCMVEC cells treated with 50 μM tonabersat at time intervals from immediate to 24 h. Tonabersat-mediated uncoupling of GJs increases over time. [Figure 16C] Functional effects of tonabersat on cell-cell communication in hCMVEC cells in vitro. Lower concentrations of tonabersat (10 μM, 1 μM, 0.1 μM) did not cause GJ uncoupling after 2 hours in this experiment. Bars represent mean ± SEM (one-way ANOVA followed by Tukey's post-hoc test) n=3 wells, 3 independent experiments. *=p<0.05, **=p<0.001, ***=p<0.001. [Figure 16D] Functional effects of tonabersat on cell-cell communication in hCMVEC cells in vitro. Lower concentrations of tonabersat (10 μM, 1 μM, 0.1 μM) did not cause GJ uncoupling after 24 hours in this experiment. Bars represent mean ± SEM (one-way ANOVA followed by Tukey's post-hoc test) n=3 wells, 3 independent experiments. *=p<0.05, **=p<0.001, ***=p<0.001. [Figure 17] FACS data of transgenic uptake of several selected antisense oligonucleotides. [Figure 18] Live cell images by confocal microscopy showing the incorporation (modification) of FAM-labeled SEQ4-PTO in HUVEC cells (4 hours after transfection). Green represents oligonucleotide 1-O (FAM-labeled) and blue represents cell nuclei stained with DAPI. [Figure 19] Green represents oligoSEQ1-O (FAM labeled) and blue represents cell nuclei stained by DAPI. [Figure 20] Figure 2 shows the efficiency of knockdown of connexin 43 as measured by qPCR. Data show standard deviation of three replicates. [Figure 21] Connexin 43 knockdown efficiency measured by Western blotting (n=3). Data show standard deviation of three replicates. [Figure 22A] Knockdown efficiency of modified (PTO) and unmodified sequences measured by qPCR 4 hours after transfection. Oligo concentrations: (1)=200nM, (3 / 4)=150nM, (1 / 2)=100nM, C:SEQ1, SEQ4:37501, Cscr:SEQ1 recombinant, LP2scr:SEQ4 recombinant, orange bars: negative control. (n=3 for each result). [Figure 22B] Knockdown efficiency of modified (PTO) and unmodified sequences measured by qPCR 8 hours after transfection. Oligo concentrations: (1)=200nM, (3 / 4)=150nM, (1 / 2)=100nM, C:SEQ1, SEQ4:37501, Cscr:SEQ1 recombinant, LP2scr:SEQ4 recombinant, orange bars: negative control. (n=3 for each result). [Diagram 23] Knockdown efficiency measured by Western blotting. Data show standard deviation of three replicates. Knockdown efficiency measured by Western blotting (n=3). Oligo concentrations: (1)=200nM; (3 / 4)=150nM; (1 / 2)=100nM; C:SEQ1; SEQ4:37501; Cscr:SEQ1 recombinant; LP2scr:SEQ4 recombinant; Orange bar: negative control group. [Figure 24] Different sequences were analyzed by qPCR for their connexin43 knockdown efficiency. Cscr: SEQ1 recombinant, Csen: SEQ1 sense strand, LP2scr2: SEQ4 recombinant, LP2sen: SEQ4 sense strand, 47001scr2: SEQ5 recombinant, 47001sen: SEQ5 sense strand, NC1: universal negation 1, NC2: universal negation 2 [Diagram 25] Different sequences were analyzed by Western blotting for their connexin43 knockdown efficiency. Cscr:SEQ1 recombinant, Csen:SEQ1 sense strand, LP2scr2:SEQ4 recombinant, LP2sen:SEQ4 sense strand, 47001scr2:SEQ5 recombinant, 47001sen:SEQ5 sense strand, NC1: universal negation 1, NC2: universal negation 2. [Figure 26]Results of Cxn43 knockdown of oligonucleotide sequences in different cell types. H: human, P: pig, LP2: SEQ4, C: SEQ1, Cscr: SEQ1 recombinant, Csen: SEQ1 sense strand, 47001scr2: SEQ5 recombinant, 47001sen: SEQ5 sense strand, other numbers represent other antisense sequences against connexin 43 described herein. [Figure 27] Dose-response performance in HUVEC cells by qPCR for various oligonucleotide sequences. LP2: SEQ4, Coda: SEQ1, 47001scr2: SEQ5 recombinant, other numbers represent other antisense sequences against connexin 43 described herein. [Figure 28A] Knockdown efficiency of Cxn43 with unmodified sequences (no phosphorothioate bonds in the backbone) measured by qPCR. Oligo concentrations: (1) = 200 nM; (2) = 400 nM; (3) = 600 nM C: SEQ1; SEQ4: 37501; Cscr: SEQ1 recombinant; LP2scr: SEQ4 recombinant. [Figure 28B] Knockdown efficiency of Cxn43 with unmodified sequences (no phosphorothioate bonds in the backbone) measured by qPCR. Oligo concentrations: (1) = 200 nM; (2) = 400 nM; (3) = 600 nM C: SEQ1; SEQ4: 37501; Cscr: SEQ1 recombinant; LP2scr: SEQ4 recombinant. [Figure 29A] Comparison of knockdown efficiency of modified sequences (all thiophosphoriate backbones). Oligo concentrations: (1) = 200 nM; (2) = 400 nM; (3) = 600 nM C: SEQ1; SEQ4: 37501; Cscr: SEQ1 recombinant; LP2scr: SEQ4 recombinant. [Figure 30A] In vitro knockdown of unmodified oligo sequences. Cscr: SEQ1 recombinant; 133704: another antisense oligo against connexin43. [Figure 30B]In vitro knockdown of unmodified oligo sequences. Cscr: SEQ1 recombinant; 133704: another antisense oligo against connexin43. [Diagram 31] Comparative knockdown activity of ASNs from Table 4. [Diagram 32] Comparative knockdown activity of ASNs from Table 4. [Diagram 33] Dose-response curves for candidate connexin 43 antisense oligonucleotides. [Diagram 34] Dye perfusion of Evans Blue dye after ischemia to map connexin 43 after ischemia-reperfusion. [Figure 35A] Calculated area (via ImageJ as described herein) of dye leakage as a function of time after ischemia-reperfusion. These results show the baseline performance of dye leakage. [Figure 35B] Calculated area (via ImageJ as described herein) of connexin 43 spot counts as a function of time after ischemia-reperfusion. These results show baseline performance of dye leakage. [Diagram 36] Effect on total dye leakage following treatment with and without Cxn43 modulators. [Figure 37A] Ability to delay expression of Cxn43 (Y-axis) compared to specific core sequence variants. Peptide 5 = SEQ ID NO: 168, Mod1 = SEQ ID NO: 171, Mod2 = SEQ ID NO: 172, Mod3 = SEQ ID NO: 173, Mod4 = SEQ ID NO: 174, Mod5 = SEQ ID NO: 175, Mod6 = SEQ ID NO: 176. [Figure 37B] Ability to delay expression of Cxn43 (Y-axis) compared to specific core sequence variants. Peptide 5 = SEQ ID NO: 168, Mod1 = SEQ ID NO: 171, Mod2 = SEQ ID NO: 172, Mod3 = SEQ ID NO: 173, Mod4 = SEQ ID NO: 174, Mod5 = SEQ ID NO: 175, Mod6 = SEQ ID NO: 176. [Figure 38] SEM images of nanoparticles (Nps, panels A and C) and microparticles (Mps, panels B and D) before (panels A and B) and after 3 days (panels C and D) in release medium. [Figure 39] In vitro release studies of connexin 43 modulating agents from microparticle formulations (data points represent mean ± SD, n=3). [Diagram 40] Unmodified (Cxn43 MP) and chemically modified (C12-C12 Cxn43 MP) connexin 43 modulator peptides measure vascular leakage after ischemia. [Diagram 41] Representative images of stained tissues and quantification of spot counts which are reduced with chemically modified (C12-C12 Cxn43 MP) connexin 43 modulator peptide compared to the unmodified peptide. [Diagram 42] Representative images and quantification of stained tissues in which formulations with nanoparticles for delivery caused lower Cxn43 expression than formulations without nanoparticles. [Diagram 43] Representative images and quantification of stained tissues in which chemically modified peptide treatment resulted in >93% RGC survival after 28 days compared to <70% in untreated eyes (ischemia only). [Diagram 44] Representative images of stained tissue showing Cxn43 distribution located within the choroid of a young (29 years old) donor without AMD (A) and an older donor diagnosed with AMD (B). In the young donor, Cxn43 labeling (red, under "RPE" label) is particularly dense adjacent to Bruch's membrane, where labeling primarily defines gap junctions between endothelial cells (white arrows). Discrete nuclei stained with the nuclear marker DAPI are endothelial cell nuclei. Scale bar represents 20 μm. [Diagram 45] Representative image of stained tissue showing Cxn43 expression profile in retinal images taken near a hemorrhage in a post-mortem human retinal sample. Merged image of DAPI stained nuclei (blue) and Cxn43 gap junction plaques (red). [Diagram 46] Representative images of stained tissue showing Cxn43 expression profile in retinal images taken near the hemorrhage of a post-mortem human retinal sample. The figure shows a merged image of DAPI stained nuclei (blue) and Cxn43 gap junction plaques (red). [Figure 47]Representative confocal microscopy images of retinas showing Cxn43 expression profile in ARPE-19 cells. After 8 h exposure to native peptide (B), Cxn43 levels in ARPE-19 cells were slightly reduced, while after 24 h (C), Cxn43 returned to normal (A). After 8 h incubation with Nps (D) and Mps (F), there was no significant difference in Cxn43 labeling, while after 24 h exposure, both Nps (E) and Mps (G) groups exhibited a significant reduction in Cxn43 levels indicating sustained peptide release, and thus the potential of longer-term treatment with these particles may reduce new gap junction channel formation. The figure shows merged images of DAPI-stained nuclei (blue) and Cxn43 gap junction plaques (red) (scale bar represents 50 μm). [Figure 48A] Representative confocal microscopy images of retinas labeling GFAP (red), Cxn43 (green), and DAPI (blue). 28 days after ischemia-reperfusion, Cx43 and GFAP were significantly upregulated in the non-treated group (B). Intravitreal injection of native Cxn43MP in solution showed limited Cxn43 upregulation after 28 days (C). While Nps-Cxn43 MP treatment group resulted in a significant reduction in Cxn43 upregulation at 28 days after injury (D), Mps-Cxn43 MP exhibited similar Cxn43 and GFAP levels at 28 days (E) and 90 days (F) after ischemia-reperfusion (scale bars represent 50 μm). [Figure 48B] (G) Mean Cxn43 spot counts in uninjured control retinas and after ischemia-reperfusion without and with treatment. Stars indicate statistical significance between groups (n=3, mean±SD, *p<0.05, **p<0.01). [Figure 49-1]Representative confocal microscopy images of flat-mounted retinas (red) with Brn3a-labeled RGCs after ischemia-reperfusion. RGC distribution is greatly reduced (B) with near complete loss of vascular delineation in untreated retinas. Eyes treated with Cxn43 MP in solution and Nps-Cxn43 MP exhibited fewer patches of RGC loss (C and D). Mps-treated eyes still exhibited some RGC loss at days 28 (E) and 90 (E). Scale bar = 300 lm. [Figure 49-2] (G) Mean density of RGCs. (H) Stars indicate statistical significance between groups (n=6, mean±SD, **p<0.01, *p<0.05).

[0117] Detailed Disclosure The present invention relates to modulators of connexin transcription, translation, function and / or activity, including modulators of gap junction channels, modulators of hemichannels, modulators of pannexin channels, modulators of pannexin transcription, translation, function and / or activity, and small molecule modulators. The modulators may be used alone or in combination to treat the diseases, disorders or conditions described herein, including ocular diseases, disorders or conditions in the anterior segment, posterior segment, and within the blood vessels, including the retina, choroid, and choriocapillaris.

[0118] Tonabersat, a benzoylaminobenzopyran, has been reported to be central nervous system specific and to act at the level of downregulation of connexin 26 and / or p38 expression. The inventors have surprisingly determined that gap junction channel modulators such as tonabersat can modulate the activity of gap junction channels and hemichannels in several different cell types, not limited to the central nervous system, and in a manner that is not specific for a particular connexin (such as connexin 26). Specifically, the inventors show that tonabersat can modulate the activity of hemichannels, including connexin 43. While not wishing to be bound by any particular theory, the inventors have surprisingly found that tonabersat acts directly on gap junction channels and / or hemichannels, rather than indirectly through a cellular receptor or by affecting the expression of a connexin (e.g., connexin 26) and / or p38.

[0119] Gap junction channel modulators, such as peptide 5, have been shown to inhibit Cx43 hemichannel activity and / or ATP release during and after injury, e.g., during ischemia and in hypoxia-reperfusion, as described in detail herein. Pannexin modulators, such as probenecid, have also been shown to inhibit injury-induced ATP release, e.g., ATP release during ischemia.

[0120] The present invention relates in particular to (1) methods for modulating gap junction channels and / or hemichannels, and (2) the use of gap junction channel modulating agents, such as peptide 5, and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, and / or pannexin modulating agents, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10and (3) the use of a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, and / or a pannexin modulating agent, e.g., probenecid and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 Panx1, or any analog thereof; and (4) modulation of gap junction channels, hemichannels, and / or pannexin channels with a gap junction channel modulator, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, and / or a pannexin modulator, such as probenecid and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 and (5) the use of a gap junction channel modulating agent, such as peptide 5, peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, and / or a pannexin modulating agent, e.g., probenecid and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., in the manufacture of a medicament for the treatment of a disorder in which modulation of gap junction channels, hemichannels, and / or pannexin channels may be beneficial. , 10 and (6) gap junction channel modulators such as peptide 5, and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, and / or pannexin modulators, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10Panx1, or an analog of any of these.

[0121] In some embodiments, the present invention provides a pannexin modulating agent, e.g., probenecid and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., ribavirin ... 10 The present invention relates to the use of Panx1, or an analogue of any of these.

[0122] In certain embodiments, the inventors have described the following methods: administering to a subject a gap junction channel modulating agent, such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, either alone or in combination with a gap junction channel modulating agent, and / or a pannexin modulating agent, e.g., probenecid and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 and / or administering to the subject a gap junction channel modulating agent such as peptide 5, and / or an analog thereof, a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, to the site of the excision, either alone or in combination with a gap junction channel modulating agent, and / or a pannexin modulating agent, e.g., probenecid and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10a method for treating a subject having abnormal scarring by administering Panx1, or an analog of any of these; a method for preventing or reducing contracture in a tissue of a subject, thereby reducing fibrosis; a method for tissue engineering in association with ophthalmic procedures; a method for promoting epithelial cell accumulation in the eye or tissue associated with the eye; a method for inhibiting cellular hyperplasia in the eye or tissue associated with the eye; a method for preventing, reducing, decreasing lesion expansion; a method for the treatment of vascular leakage, or any disorder in which vascular leakage is implicated; a method for the treatment of one or more of ischemia (including, for example, perinatal ischemia, cutaneous ischemia, and cardiac ischemia), stroke, asphyxia, brain trauma, spinal cord injury, heart attack, inflammatory cardiac disorders (including, for example, pericarditis), reperfusion injury (including, for example, cardiac reperfusion after surgery or transplantation, liver reperfusion after surgery or transplantation); injury associated with surgical or medical procedures (including, for example, chemotherapy, radiation therapy, plastic surgery, and including, for example, such treatments associated with stomatitis or rash), tissue injury, or The present invention relates to methods for treating inflammation, methods for treating injuries or lesions (including, for example, persistent epithelial defects of the cornea, ulcers, burns, psoriasis), methods for treating hearing impairment, methods for treating eye disorders (including, for example, retinal vein or artery occlusion, glaucoma, retinal stroke, injuries causing elevated intraocular pressure, diabetic retinopathy, cystoid macular edema, age-related macular degeneration, infections, burns (including, for example, chemical burns and thermal burns), epilepsy, Parkinson's disease, and methods for treating disorders of the eye (including, for example, vascular hemorrhage, edema, lesions, and / or analogs or prodrugs of any of the foregoing compounds, either alone or in combination with a gap junction channel modulating agent, such as peptide 5, and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, and / or pannexin modulating agents, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10 The present invention contemplates the administration of one or more of the peptides Panx1, Panx2, or any of their analogs in the manufacture of a medicament for the treatment of the disorders described herein. 5, and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, and / or pannexin modulating agents, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10 Panx1, or any analogues thereof, and / or gap junction channel modulating agents such as peptide 5, and / or analogues thereof, compounds of formula I, e.g., tonabersat, and / or analogues or prodrugs of any of the foregoing compounds, and / or pannexin modulating agents, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10 It is contemplated that the invention provides a dressing for preventing and / or treating fibrosis or other disorders comprising the administration of Panx1, or any analog thereof.

[0123] In some embodiments, the present invention features the use of a compound of formula I, such as tonabersat, and / or any analog or prodrug of the aforementioned compounds, to directly and immediately block Cx43 hemichannels and cause a concentration- and time-dependent decrease in GJ coupling. In some aspects, low concentrations of a compound of formula I, such as tonabersat, and / or any analog or prodrug of the aforementioned compounds, may be used in any of the methods of treatment or uses of the present invention. In some embodiments, low doses of a compound of formula I, such as tonabersat, and / or any analog or prodrug of the aforementioned compounds, may be combined with a pannexin channel modulator in any of the methods of treatment or uses of the present invention. In some embodiments, low doses of a compound of formula I, e.g., tonabersat, and / or an analog or prodrug of any of the foregoing compounds, may be combined with a pannexin channel modulator, which may be used as an effective treatment during ischemic injury, for example, to protect RGCs from damage following retinal ischemia, or to treat retinal ischemia or ocular fibrosis, or in any of the methods or uses of treatment of the present invention.

[0124] Channel Modulators As an example, tonabersat may be known by the IUPAC name N-[(3S,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydrochromen-4-yl]-3-chloro-4-fluorobenzamide or (3S-cis)-N-(6-acetyl-3,4-dihydro-3-hydroxy-2,2-(dimethyl-d6)-2H-1-benzopyran-4-yl)-3-chloro-4-fluorobenzamide.

[0125] In one embodiment, tonabersat and / or its analogs or prodrugs have formula I: [ka] and Y is selected from the group of compounds having the formula: 1and R 1 is acetyl, R 2 is hydrogen, C 3-8 Cycloalkyl, optionally interrupted by oxygen or substituted by hydroxy 1-6 Alkyl, C 1-6 Alkoxy or substituted aminocarbonyl, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonyloxy, C 1-6 Alkoxy, nitro, cyano, halo, trifluoromethyl, or CF 3 S; or the group CF 3 -A- (wherein A is -CF 2 -, -CO-, -CH 2 -, CH(OH), SO 2 , SO, C.H. 2 -O-, or CONH), or the group CF 2 HA'- (wherein A' is oxygen, sulfur, SO, SO 2 , C.F. 2 or CFH; any aromatic moiety is optionally substituted; trifluoromethoxy, C 1-6 Alkyl sulfinyl, perfluoro C 2-6 Alkylsulfonyl, C 1-6 Alkylsulfonyl, C 1-6 Alkoxysulfinyl, C 1-6 alkoxysulfonyl, aryl, heteroaryl, arylcarbonyl, heteroarylcarbonyl, phosphono, arylcarbonyloxy, heteroarylcarbonyloxy, arylsulfinyl, heteroarylsulfinyl, arylsulfonyl, or heteroarylsulfonyl; any amino moiety optionally containing one or two C 1-6 Alkyl group, or C 1-6 Alkylsulfinylamino, C 1-6 Alkyl sulfonyl amino, C 1-6 Alkoxysulfinylamino or C 1-6 Alkoxysulfonylamino, or C1-6 Alkylcarbonyl, nitro or cyano, or -C(C 1-6 alkyl)NOH or -C(C 1-6 Alkyl)NNH 2 substituted by ethylenyl, terminally substituted by 1-6 Alkylcarbonylamino, C 1-6 Alkoxycarbonylamino, C 1-6 Alkyl-thiocarbonyl, C 1-6 Alkoxy-thiocarbonyl, C 1-6 Alkyl-thiocarbonyloxy, 1-mercaptoC 2-7 alkyl, formyl, or aminosulfinyl, aminosulfonyl or aminocarbonyl; or optionally one or two C 1-6 By alkyl or C 2-7 Amino substituted by alkanoyl; R 3 and R 4 One of them is hydrogen or C 1-4 alkyl, the others are C 1-4 Alkyl, CF 3 or CH 2 X a Optionally, one or two C 1-4 Alkyl group, cyano or C 1-4 Alkoxycarbonyl substituted fluoro, chloro, bromo, iodo, C 1-4 Alkoxy, Hydroxy, C 1-4 Alkylcarbonyloxy, -SC 1-4 Alkyl, nitro, amino; or R 3 and R 4 Both are optional. 1-4 Alkyl-substituted C 2-5 Polymethylene,

[0126] R 5 is C 1-6 Alkylcarbonyloxy, benzoyloxy, ONO 2 , benzyloxy, phenyloxy or C 1-6 Alkoxy, R 6 and R 9is hydrogen or R 5 is hydroxy and R 6 is hydrogen or C 1-2 is alkyl, R 9 is hydrogen,

[0127] R 7 is heteroaryl or phenyl, optionally both of which are optionally 1-4 Alkyl, Cyano, Azido, C 1-4 substituted one or more times with groups or atoms selected from chloro, fluoro, bromo, iodo, nitro, amino, substituted one or two times with alkoxy, trifluoromethoxy, and trifluoromethyl;

[0128] R 8 is hydrogen, C 1-6 Alkyl, OR 11 , or NHCOR 10 and R 11 is hydrogen, C 1-6 Alkyl, formyl, C 1-6 Alkanoyl, aroyl, or aryl-C 1-6 is alkyl, R 10 is hydrogen, C 1-6 Alkyl, C 1-6 Alkoxy, mono or di C 1-6 Alkylamino, Amino, Amino-C.sub.1-6 alkyl, Hydroxy-C 1-6 Alkyl, halo-C 1-6 Alkyl, C 1-6 Acyloxy-C 1-6 Alkyl, C 1-6 Alkoxycarbonyl-C 1-6 - alkyl, aryl, or heteroaryl; R 8 -N-CO-R 7 The group is R 5 is cis to the X group; is oxygen or NR 12 and R 12 is hydrogen or C 1-6 It is an alkyl.

[0129] With respect to any of the above Markush groups, the group may or may not include any of the species listed for that group.

[0130] Tonabersat is sometimes known by the IUPAC names N-[(3S,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydrochromen-4-yl]-3-chloro-4-fluorobenzamide or (3S-cis)-N-(6-acetyl-3,4-dihydro-3-hydroxy-2,2-(dimethyl-d6)-2H-1-benzopyran-4-yl)-3-chloro-4-fluorobenzamide.

[0131] In an embodiment, the analog of Formula 1 is the compound caraversat (N-[(3R,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydrochromen-4-yl]-4-fluorobenzamide) or trans-(+)-6-acetyl-4-(S)-(4-fluorobenzoylamino)-3,4-dihydro-2,2-dimethyl-2H-1-benzo[b]pyran-3R-ol, hemihydrate.

[0132] In certain embodiments, tonabersat and / or an analog thereof in the form of a free base or a pharma- ceutically acceptable salt. Exemplary pharma- ceutically acceptable salts include, but are not limited to, 1-hydroxy-2-naphthoic acid, 2,2-dichloroacetic acid, 2-hydroxyethanesulfonic acid, 2-oxoglutaric acid, 4-acetamidobenzoic acid, 4-aminosalicylic acid, acetic acid, adipic acid, ascorbic acid (L), aspartic acid (L), benzenesulfonic acid (besylic acid), benzoic acid, camphoric acid (+), camphor-10-sulfonic acid (+), capric acid (decanoic acid), caproic acid (hexanoic acid), caprylic acid (octanoic acid), carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid (D), Included are hydrochlorides and salts derived from acids including gluconic acid (D), glucuronic acid (D), glutamic acid, glutaric acid, glycerolin, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid, isobutyric acid, lactic acid (DL), lactobionic acid, lauric acid, maleic acid, malic acid (-L), malonic acid, mandelic acid (DL), methanesulfonic acid (mesylate), naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, nicotinic acid, nitric acid, oleic acid, oxalic acid, palmitic acid, pamoic acid, phosphoric acid, propionic acid, pyroglutamic acid (-L), salicylic acid, sebacic acid, stearic acid, succinic acid, sulfuric acid, tartaric acid (+L), thiocyanic acid, toluenesulfonic acid (p), and undecylenic acid. In one embodiment, the salt is a hydrochloride salt.

[0133] In other embodiments, one or more polymorphs, one or more isomers, and / or one or more solvates of tonabersat and / or its analogs may be used.

[0134] Peptide 5 A variety of small organic molecules have been reported to have activity in inhibiting gap junction or hemichannel currents. These include triarylmethanes (TRAMs), quinines, mefloquine, fenamic acids, 2-aminophenoxyborates and derivatives, glycyrrhetinic acid and derivatives, volatile anesthetics such as halothane and ethane, lipophilic compounds such as long-chain alcohols (e.g., heptanol and octanol), fatty acid amides including oleamide, cyclodextrins, cisplatin, polyamines, and tetraalylammonium ions. A growing number of studies have also demonstrated the inhibition of gap junction channels and hemichannel currents using peptides corresponding to specific sequences within the extracellular loops E1 and E2 with the conserved QPG and SHVR motifs in E1 (Gap26 peptide) and the SRPTEK motif in E2 (Gap27 peptide) and within the cytoplasmic loop (Gap19 peptide). The most potent such peptide mimetic is peptide 5 (VDCFLSRPTEKT) (SEQ ID NO: 168).

[0135] In some embodiments, the gap junction channel modulating agent is a connexin peptide or peptidomimetic, sometimes referred to as an anti-connexin peptide or peptidomimetic, e.g., an anti-connexin hemichannel blocking peptide or peptidomimetic, e.g., a modified or unmodified peptide or peptidomimetic comprising a connexin extracellular domain, a transmembrane region, and a connexin carboxy-terminal peptide. The anti-connexin hemichannel blocking peptide or peptidomimetic may be modified or unmodified. The anti-connexin hemichannel blocking peptide or peptidomimetic is chemically, synthetically produced, or otherwise manufactured. In some embodiments, the gap junction channel modulating agent is a connexin 43 peptide or peptidomimetic. In some aspects, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the extracellular or transmembrane domain of a connexin, such as connexin 43 or connexin 45. In some embodiments, the peptide or peptide mimetic comprises a portion of the extracellular or transmembrane domain of connexin Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessel.

[0136] In some embodiments, the modulating agent of the invention comprises an anti-connexin 43 peptide or peptidomimetic, e.g., any of the peptides described herein, including peptides comprising a portion of the extracellular domain of a connexin, and peptides comprising a portion of the carboxy terminus of a connexin, that are useful in the methods of the invention that are therapeutically effective, e.g., effective to cure any of the neuropathic eye disorders described herein. In some aspects, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the extracellular domain of a connexin, such as connexin 43 or connexin 45, preferably connexin 43.

[0137] Peptide 5 is an established gap junction channel blocker that can act in a dose-dependent manner, with lower doses blocking gap junction hemichannel opening and higher doses uncoupling gap junctions between cells. See, e.g., O'Carroll et al., 2008. With sustained low dose application of peptide 5, there is a gradual loss of gap junction coupling that is believed to be due to peptide interference with hemichannel docking (in parallel with the gradual release of existing gap junctions during normal turnover). Peptide 5 has proven effective in several in vitro, ex vivo, and in vivo (animal) studies (see, e.g., Davidson et al., 2012; Danesh-Meyer et al., 2012; O'Carroll et al., 2013), especially when used at doses that block hemichannels without uncoupling gap junctions. The results in O'Carroll et al., 2008 show that low or high concentrations of peptide 5 block hemichannels, but directly uncouple gap junctions at high concentrations. Peptide 5 data is shown here for comparison with tonabersat.

[0138] The pannexin modulating compound is a compound of formula VI: [ka] <t0 / > But often, during the ceremony,

[0139] Z 1 and Z 2 are independent, (C 1 -C 4 ) alkyl, halo(C 1 -C 4 ) alkyl, (C 1 -C 4 )Alkoxy, halo(C 1 -C 4 ), (C 1 -C 4 ) cycloalkyl, (C 1 -C 4 ) alkyl-S-, (C 1 -C 4) alkylamino, (C 1 -C 4 )Cycloalkylamino, di(C 1 -C 4 ) alkylamino, and amino (C 1 -C 4 ) alkyl;

[0140] Y is hydrogen, halo, cyano, hydroxy, (C 1 -C 4 ) alkyl, halo(C 1 -C 4 ) alkyl, (C 1 -C 4 )Alkoxy, halo(C 1 -C 4 )Alkoxy, Cyano(C 1 -C 4 ) alkyl, amino, (C 1 -C 4 ) alkylamino, di(C 1 -C 4 ) Alkylamino, Amino(C 1 -C 4 ) alkyl, (C 1 -C 4 ) Alkylamino(C 1 -C 4 ) alkyl, di[(C 1 -C 4 ) alkyl] amino (C1-C4) alkyl, trifluoromethylthio, hydroxy (C 1 -C 4 ) alkyl, (C 1 -C 4 )Alkoxy(C 1 -C 4 ) alkyl, -C(O)R 1 , -C(O)OR 1 , -OC(O)R 1 , -C(O)-N(R 1 ) 2 , -CH 2 -C(O)R 1 , -CH 2 -C(O)OR 1 , -CH 2 -OC(O)R 1 , -CH 2 -C(O)-N(R1 ) 2 , S(O) 2 R 1 , S(O) 2 N(R 1 ) 2 , (C 3 -C 8 ) cycloalkyl, (C 3 -C 8 )Cycloalkyl(C 1 -C 4 ) Alkyl, SO 3 H and SO 4 H,

[0141] R 1 is hydrogen, NH 2 , N.R. 2 R 3 , OH, -CH 2 OH and -CH 2 CH 2 OH,

[0142] R2 and R3 are independently hydrogen, (C 1 -C 4 ) alkyl, (C 1 -C 4 ) alkoxy, and (C 1 -C 4 ) cycloalkyl;

[0143] Halo is chlorine, bromine, iodine, or fluorine.

[0144] For example, the compound of formula VI can be probenecid, shown below.

[0145] [ka]

[0146] Probenecid is known by the IUPAC name p-[dipropylsulfamoyl]benzoic acid. In some cases, the compound has the structure shown above.

[0147] In certain embodiments, probenecid and / or its analogs are non-ionic and in the form of free base, free acid, or pharmaceutically acceptable salt. By way of example, pharmaceutically acceptable salts include, but are not limited to, hydrochloride salt(s) derived from acids including hydrobromic acid, phosphoric acid, acetic acid, fumaric acid, maleic acid, salicylic acid, citric acid, oxalic acid, lactic acid, malic acid, methanesulfonic acid, and p-toluenesulfonic acid, per se salts. In one embodiment, the salt is a hydrochloride salt. In other embodiments, one or more polymorphs, one or more isomers, and / or one or more solvates of probenecid and / or its analogs may be used.

[0148] Panx1 In some embodiments, the pannexin modulating agent may or may not include a pannexin peptide sequence. The pannexin peptide sequence may include 8-40 contiguous amino acids, the extracellular domain, the intracellular domain, the carboxy-terminal portion, or the amino-terminal portion of the polypeptide Panx1, Panx2, or Panx3. In some embodiments, the pannexin modulating agent may include a portion of the extracellular loop of Panx1, 2, or 3. In some embodiments, for example, the pannexin modulating agent may include, for example, a Panx1 mimetic blocking peptide. 10It may include Panx1 (WRQAAFVDSY). In some embodiments, a pannexin modulating agent that is an oligonucleotide or polynucleotide may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to an 8-80 nucleotide portion of SEQ ID NO:283 (Panx1 polynucleotide), (Panx1 polynucleotide RefSeq No. NM_015368.3), SEQ ID NO:284 (Panx2 polynucleotide), (for variant 1, Panx2 polynucleotide RefSeq No. NM_052839.3), SEQ ID NO:285 (for Panx2 polynucleotide variant 2, RefSeq No. NM_001160300.1), SEQ ID NO:286 (for Panx2 polynucleotide variant 3, RefSeq No. NR_027691.1), or SEQ ID NO:287 (Panx3 polynucleotide) (Panx3 polynucleotide RefSeq No. NM_052959.2). In some embodiments, the pannexin modulating agent may or may not include a pannexin peptide sequence. The pannexin peptide sequence may include 8-40 contiguous amino acids, the extracellular domain, the intracellular domain, the carboxy-terminal portion, or the amino-terminal portion of the polypeptide SEQ ID NO:288 (Panx1 peptide), SEQ ID NO:289 (Panx2 peptide), or SEQ ID NO:290 (Panx3 peptide), or variants thereof. The sequences of Panx1, 2, and 3 polypeptides are shown below.

[0149] SEQ ID NO: 288 (Panx1) Sequence Listing 1 [ka]

[0150] SEQ ID NO: 289 (Panx2) Sequence Listing 2 [ka]

[0151] SEQ ID NO: 290 (Panx3) Sequence Listing 3 [ka]

[0152] The sequence of the mRNA encoding pannexin is shown below.

[0153] SEQ ID NO: 283 (Panx1 mRNA) Sequence Table 4-1 [ka] Sequence Table 4-2 [ka] Sequence Table 4-3 [ka]

[0154] SEQ ID NO: 284 (Panx2 mRNA, transcript variant 1) Sequence Table 5-1 [ka] Sequence Table 5-2 [ka] Sequence Table 5-3 [ka]

[0155] SEQ ID NO: 285 (Panx2 mRNA, transcript variant 2) Sequence Listing 6-1 [ka] Sequence Table 6-2 [ka] Sequence Table 6-3 [ka]

[0156] SEQ ID NO: 286 (Panx2 mRNA, transcript variant 3) Sequence Listing 7-1 [ka] Sequence Table 7-2 [ka]

[0157] SEQ ID NO: 287 (Panx3 mRNA) Sequence Listing 8 [ka]

[0158] Connexins and pannexins are hemichannel-forming proteins in vertebrates. In one aspect, the present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular and other disorders, such as glaucoma, DME, AMD, DR, ocular fibrosis, ocular hypoxia, retinal perfusion disorders, and / or neuropathic ocular disorders, by administering a therapeutically effective amount of at least one connexin modulating agent to the eye of the subject. In some embodiments, the neuropathic ocular disorder can be, for example, retinal ganglion cell loss and / or glaucomatous optic neuropathy. In some embodiments, the administration of a therapeutically effective amount of at least one connexin modulating agent that is effective in stopping, preventing, or treating retinal ganglion cell loss is further useful for increasing neurotrophic factors in glaucomatous optic nerve and reducing vitreous glutamate concentration.

[0159] The main risk factor for most glaucoma is elevated intraocular pressure, or hypertension. Intraocular pressure is a function of the production of liquid aqueous humor by the ciliary processes of the eye and its drainage through the trabecular meshwork. Aqueous humor flows from the ciliary processes into the posterior chamber, which is bounded posteriorly by the lens and the zonules of the common tendon, and anteriorly by the iris. It then flows through the pupil of the iris into the anterior chamber, which is bounded posteriorly by the iris and anteriorly by the cornea. From here, the trabecular meshwork drains the aqueous humor via Schlemm's canal into the scleral plexus and onward blood flow. However, in other glaucoma patients, normal tension glaucoma may be present.

[0160] In open-angle / wide-angle glaucoma, flow is reduced through the trabecular meshwork due to degeneration and blockage of the meshwork, whose original function is to absorb aqueous humor. Loss of aqueous absorption results in increased resistance and thus a chronic, painless rise in pressure within the eye. In closed-angle / narrow-angle glaucoma, the iridocorneal angle undergoes a final roll and is forced into the cornea. Complete closure to the anterior movement of the adjacent iris root results in the inability of aqueous humor to drain from the posterior to the anterior chamber and then out of the trabecular meshwork. This accumulation of aqueous humor causes acute pressure elevation and pain.

[0161] The inconsistent relationship between high intraocular pressure and glaucoma has prompted research into anatomy, ocular development, nerve compression trauma, optic nerve blood flow, excitatory neurotransmitters, nutrients, retinal ganglion cell / axon degeneration, glial support cells, immune system, aging mechanisms of neuronal loss, and scleral edge nerve fiber disconnection. In some embodiments, the gap junction, connexin, and / or pannexin modulating agents featured herein are useful for treating or preventing ocular disorders disclosed herein, including conditions such as hypertensive and normal tension glaucoma, as well as other uses featured herein, treating or preventing DME or ocular fibrosis, or treating AMD, from its earliest stages all the way to its later stages.

[0162] Age-related macular degeneration (ARMD or AMD) is another leading cause of irreversible visual impairment and visual impairment in people aged 61 years or older in developed countries. AMD most commonly affects the macula, an area of ​​the retina that aids in fine and detailed vision (although it may not be restricted to the macula). In the United States, one in seven people over the age of 50 have neovascular AMD and / or geographic atrophy, and 1.8 million people have AMD (expected to increase to 3 million by 2020). Friedman,et al.(2004)Prevalence of age-related macular degeneration in the United States,Arch Ophthalmol 122:564-572. The incidence of AMD increases dramatically with age, but more than 15% of white women aged 81 years or older have neovascular AMD and / or geographic atrophy. The global cost of AMD is estimated at $345 billion annually, of which $255 billion is direct medical costs. AMD was included in the 2010 Eye Disease Priority List by the World Health Organization as a disease with no satisfactory treatment options.

[0163] The pathogenesis of AMD is likely multifactorial, involving a complex interplay of metabolic, genetic, and environmental factors. The conventional understanding of AMD is that it affects four functionally interrelated layers in the eye: photoreceptors, RPE, Bruch's membrane, and choriocapillaris. Shelley,et al. (2009) Cone degeneration in aging and age-related macular degeneration,Arch Ophthalmol 127: 483-492. Research has focused primarily on the degeneration of the RPE, which leads to irreversible damage to the photoreceptors. Nowak (2006) Age-related macular degeneration (AMD): pathogenesis and therapy,Pharmacol Rep 58: 353-363. Along with this degeneration, deposits (drusen) can accumulate within the RPE and Bruch's membrane. These deposits can be associated with abnormal vascular epithelial proliferation, which can then lead to leakage, bleeding, and ultimately scarring at the macula. See de Jong PT (2006) Age-related macular degeneration, N Engl J Med 355: 1474-1485; Finger, et al. (1999) Ophthalmic plaque radiotherapy for age-related macular degeneration associated with subretinal neovascularization, Am J Ophthalmol 127: 170-177.

[0164] In one aspect, the invention provides a method for treating a subject's eye disease, for example, by administering to the subject an effective amount of at least one connexin modulating agent and / or at least one pannexin modulating agent. The present invention relates to pharmaceutical compositions, articles of manufacture, and methods for treating ocular disorders, such as glaucoma, DME, AMD, DR, ocular fibrosis, and / or ocular hypoxia, and / or retinal perfusion disorders, and / or neuropathic ocular disorders, such as intraocular pressure-related neuropathy. In one aspect, the present invention relates to pharmaceutical compositions and methods for treating, for example, glaucoma. The methods herein provide for the treatment of intraocular pressure-related optic neuropathy, such as glaucoma, in an amount sufficient to reduce intraocular pressure. In some embodiments, the connexin modulating agent is useful for treating trauma associated with elevated intraocular pressure. In some embodiments, the connexin modulating agent is a connexin 43 modulating agent. In some embodiments, the compositions and methods of the present invention are useful for reducing intraocular pressure to normal levels, such as less than 21 mm Hg, such as less than 21, 20, or 19 mm Hg, such as to a level of about 8 to about 21 mm Hg.

[0165] The compositions, articles of manufacture, and methods described herein are useful in one embodiment for treating glaucoma without toxic side effects. In some embodiments, the glaucoma can be open-angle glaucoma or closed-angle glaucoma. In some embodiments, administering a therapeutically effective amount of at least one pannexin modulating agent and / or at least one connexin modulating agent, such as a connexin 43 channel modulating agent, to an ocular tissue in need thereof increases flow through the trabecular meshwork. Gap junction modulating agents, pannexin channel modulating agents, and hemichannel modulating agents are also useful. In some embodiments, the compositions of the present invention are useful as adjuvants for improving the success rate of trabeculectomy.

[0166] The front of the eye is filled with aqueous humor, a clear fluid that provides nutrition to structures in the front part of the eye. This fluid is constantly produced by the ciliary body that surrounds the lens of the eye. Aqueous humor drains out of the eye through the pupil and through trabecular meshwork channels located at the junction where the cornea attaches to the iris, called the drainage angle of the eye. In some embodiments of the present invention, one or more gap junction or connexin modulating agents, or pannexin modulating agents, such as connexin 43 modulating agents, are administered to or near the trabecular meshwork or ciliary body. Gap junction modulating agents, pannexin channel modulating agents, and hemichannel modulating agents are also useful.

[0167] In one aspect of the present invention, compositions, articles of manufacture, and methods are also provided for treating retinal perfusion disorders, retinal ischemic disease, or ocular ischemic disease in a subject, comprising administering a therapeutically effective amount of a gap junction modulating agent and / or a connexin modulating agent, and / or a pannexin modulating agent or a pannexin channel modulating agent, effective to reduce inflammation in the inner retina. In some embodiments, the retinal ischemic disease is a retinal artery occlusion or a central retinal vein occlusion. In some embodiments, the optic ischemic disease is, for example, anterior ischemic optic neuropathy. In some embodiments, the connexin modulating agent is a modulating agent of Cx43, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye or blood vessel. In some embodiments, the connexin modulating agent is a Cx43 modulating agent, for example, a Cx43 hemichannel modulating agent. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0168] The present invention also features compositions, articles of manufacture, and methods for treating ocular disorders, e.g., glaucoma, AMD, ocular fibrosis, and / or ocular hypoxia, and / or impaired retinal perfusion, and / or neuropathic ocular disorders, intraocular pressure-related neuropathy, by, for example, reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion in a subject, comprising administering to the subject's choroid an amount of a gap junction modulating agent and / or a connexin modulating agent, and / or a pannexin modulating agent or pannexin channel modulating agent effective to reduce impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion and / or inflammation in the inner retina. In some embodiments of the present invention, the subject's choroid is administered a gap junction modulating agent and / or a connexin modulating agent and / or a pannexin channel modulating agent in an amount effective to reduce impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion and / or inflammation in the inner retina. Administration of a therapeutically effective amount of a gap junction modulating agent and / or connexin modulating agent effective to reduce impaired perfusion and / or choroiditis, or choroidal hyperperfusion, also reduces choriocapillaris endothelial cell loss and / or choriocapillaris shedding. In some embodiments, reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, also reduces retinal pigment epithelial degeneration and / or drusen development, or otherwise improves, stops, slows, and / or reverses the progression of macular degeneration or macular dystrophy, which may be dry macular degeneration or wet macular degeneration. A connexin modulating agent or pannexin modulating agent for reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion, may be administered in conjunction with an ocular therapeutic agent. In some embodiments, the modulator for reducing impaired choroidal perfusion and / or choroiditis, or choroidal hyperperfusion is a Cx43 modulator, a hemichannel modulator, a pannexin modulator, or a pannexin channel modulator.

[0169] In some embodiments of the methods of the invention, the gap junction modulating agent and / or connexin modulating agent, or pannexin modulating agent or pannexin channel modulating agent may be administered to the eye by intraocular injection or intravitreal injection. The gap junction modulating agent and / or connexin modulating agent, pannexin or pannexin channel modulating agent may be administered once or more than once. Other methods of administering the modulating agent are provided herein.

[0170] In some embodiments, the connexin modulating agent of the invention comprises a connexin oligonucleotide, such as a connexin antisense oligonucleotide or polynucleotide. Connexin peptides or peptidomimetics, such as nucleotides or polynucleotides, or connexin peptides or peptidomimetics, including any of the peptides described herein, including, for example, peptides comprising a portion of the extracellular domain of a connexin, and peptides comprising a portion of the carboxy-terminal portion of a connexin or gap junction closing compound, as well as hemichannel closing compounds useful in the methods of the invention, such as the treatment of any of the ocular disorders described herein.

[0171] In some embodiments, connexin protein modulating agents of the invention include connexin 43 oligonucleotides or polynucleotides, such as connexin 43 antisense oligonucleotides or polynucleotides, or anti-connexin 43 peptides or peptidomimetics, such as peptides comprising a portion of the extracellular domain of a connexin, and peptides comprising a portion of the carboxy-terminal portion of a connexin or a gap junction closing compound, useful in the methods of the invention, such as the treatment of any of the neuropathic eye disorders described herein, as well as hemichannel closing compounds.

[0172] In some embodiments, the pannexin modulating agents of the invention include pannexin oligonucleotides or polynucleotides, such as pannexin antisense oligonucleotides or polynucleotides, or anti-pannexin peptides or peptidomimetics, useful in the methods of the invention, such as the treatment of any of the ocular disorders, such as the neuropathic ocular disorders described herein, including glaucoma, AMD, ocular fibrosis, DME, ocular hypoxia, and / or anti-pannexin peptides or peptidomimetics.

[0173] In some embodiments, a "promoiety" refers to a species that acts as a protecting group to mask a functional group in an active agent, thereby converting the active agent into a prodrug. The active agent may be any of the modulators or ocular therapeutic agents disclosed herein. Typically, the promoiety is attached to the drug via a bond(s) that is cleaved in vivo by enzymatic or non-enzymatic means, thereby converting the prodrug to its active form. In some embodiments, the promoiety may be an active agent. In some embodiments, the promoiety is a gap junction modulating agent, a connexin modulating agent, or a pannexin modulating agent. In some embodiments, the promoiety may be conjugated to a polynucleotide, a peptide or peptidomimetic, a small molecule antagonist, and / or any of the ocular therapeutic agents disclosed herein. In some embodiments, the promoiety may be conjugated to a compound of formula I, and in some embodiments, the prodrug may be a compound of formula II.

[0174] In some embodiments, the promoiety may be any peptide mimetic or peptide antagonist of the present disclosure. In some embodiments, the promoiety is a single amino acid, optionally protected on the functional group of the single amino acid. In some embodiments, the promoiety is a targeting species. In some aspects, the promoiety is a substrate for an inward flux or outward flux transporter on the cell membrane, such as those described in Gaudana, R. et al. The AAPS Journal, 12:3, 348-360 (2012). The promoiety may be, for example, chemically bound biotin. The promoiety may be, for example, chemically bound D-serine.

[0175] In some embodiments, the pannexin modulating agents of the invention include pannexin oligonucleotides or polynucleotides, such as pannexin antisense oligonucleotides or polynucleotides, or anti-pannexin peptides or peptidomimetics, useful in the methods of the invention, such as treating any of the ocular hypoxia or neuropathic eye disorders described herein.

[0176] Definitions "Small molecule" as used herein refers to a molecule having a molecular weight of less than about 600 Daltons and generally consisting of an organic molecule. A small molecule may be the active agent of a prodrug.

[0177] As used herein, "treatment" (and grammatical variations thereof, such as "treat" or "treating") refers to clinical intervention in an attempt to alter the natural course of the individual, tissue, or cell being treated, and may be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, prevention of the onset or recurrence of a disease, disorder, or condition, alleviation of signs or symptoms, reduction of any direct or indirect pathological consequences of a disease, reduction in the rate of disease progression, improvement or mitigation of the disease, and remission or improved prognosis. In some embodiments, the compounds, methods, and compositions of the invention may be used to delay the onset of a disease, disorder, or condition, or to slow the progression of a disease, disorder, or condition. The term does not necessarily mean that the subject is treated until fully cured. Thus, "treatment" includes reducing, alleviating, or ameliorating the symptoms or severity of a particular disease, disorder, or condition, or preventing or otherwise reducing the risk of developing a particular disease, disorder, or condition. "Treatment" may also include maintaining or promoting complete or partial alleviation of a disease condition.

[0178] The term "treatment of an ocular disorder," including diseases and conditions, can refer to, for example, preventing, slowing, alleviating, reducing, halting, and / or reversing an ocular disorder, disease, or condition, such as neuronal loss and / or neuropathy, vascular leakage and / or hemorrhage, angiogenesis, inflammation and / or edema, within the eye.

[0179] The term "prevent" means to prevent, in whole or in part, or to ameliorate or control.

[0180] As used herein, an "effective amount" refers to an amount, at dosages and for periods of time necessary, effective to achieve a desired therapeutic or prophylactic result. For example, and not by way of limitation, an "effective amount" can refer to any amount of a compound or compound combination that is capable of treating the signs and / or symptoms of a disease, disorder, or condition, as described herein. It may refer to an amount of a compound or composition disclosed in the specification.

[0181] As used herein, a "therapeutically effective amount" of a substance / molecule, agonist, or antagonist of the invention may vary according to factors such as the medical condition, age, sex, and weight of the individual, and the ability of the substance / molecule, agonist, or antagonist to elicit a desired response in the individual. A therapeutically effective amount is preferably one in which any toxic or detrimental effects of the substance / molecule, agonist, or antagonist may be outweighed by the therapeutically beneficial effects.

[0182] As used herein, a "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of a disease, disorder, or condition, the prophylactically effective amount will be less than the therapeutically effective amount.

[0183] The term "pharmaceutical formulation" refers to a formulation that is effective, in a form that permits the biological activity of the active ingredients contained therein, and that does not contain additional components that are unacceptably toxic to the subject to which the preparation is administered.

[0184] "Pharmaceutically acceptable carriers" as used herein refer to ingredients in a pharmaceutical formulation, other than the active ingredient, that can be safely administered to a subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0185] As used herein, the terms "subject" and the like, including "individual" and "patient", all of which may be used interchangeably herein, refer to any mammal, including humans, domestic and farm animals such as dogs, horses, cats, sheep, pigs, cows, and zoo, wildlife park, sports, or pet animals. Preferred mammals herein are humans, including adults, children, and seniors. Preferred sports animals are horses and dogs. Preferred pet animals are dogs and cats. The subject may also be an aquatic park animal, such as, for example, a dolphin, whale, sea lion, or walrus. In certain embodiments, the subject, individual, or patient is a human.

[0186] The invention is described herein with reference to the use of gap junction channel modulating agents, including modulators such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, and / or the use of pannexin modulating agents, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10Panx1, or analogs of any of these. It should be understood that one or more salts, polymorphs, solvates and / or isomers of gap junction channel modulating agents such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, and / or pannexin modulating agents, e.g., probenecid and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10Panx1, or analogs of any of these, may also be used in the present invention. Thus, reference to "tonabersat and / or analogs thereof," "peptide 5 and / or analogs thereof," "probenecid and / or analogs thereof," or "10Panx1, or analogs of any of these," should be deemed to include a reference to any one or more salts, solvates, polymorphs, and / or isomers of any of the foregoing compounds.

[0187] The methods, uses, and compositions of the present invention include a compound of formula I, e.g., tonabersat, and / or analogs of any of the foregoing compounds, and one or more of their analogs, peptides, 5 and one or more of its analogues, probenecid and one or more of its analogues, or 10 The present invention may include the use of a combination of Panx1 and one or more analogs thereof, or a combination of one or more of these analogs. Thus, the term "compound of formula I, e.g., tonabersat, and / or analogs thereof," "peptide 5, and / or analogs thereof," "compound of formula VI, e.g., probenecid, and / or analogs thereof," or "compound of formula VI, e.g., probenecid, and / or analogs thereof" herein may include the use of a combination of Panx1 and one or more analogs thereof, or a combination of one or more of these analogs. 10 Reference to "Panx1, or an analog of any of these" should be deemed to include reference to such combinations.

[0188] As used herein, the term "hemichannel" refers to a part of a gap junction (two hemichannels or connexons connect across the intercellular space between adjacent cells to form a gap junction) and includes several connexin proteins, typically hexamers of homomers or heteromers of connexin proteins that form the gap junction pore between the cytoplasm of two adjacent cells. A hemichannel is provided by a cell on one side of the junction, and two hemichannels from opposing cells usually join together to form a complete intercellular gap junction channel. However, in some cells, and under certain circumstances, the hemichannel itself is effective as a conduit between the cytoplasm and the extracellular space, allowing the movement of ions and small molecules.

[0189] Compounds of formula I, e.g., tonabersat, and / or analogs or prodrugs of any of the foregoing compounds, can modulate the function and / or activity of hemichannels, preferably hemichannels comprising any type of connexin protein. Thus, references to "hemichannels" should be taken broadly to include hemichannels comprising any one or more of several different connexin proteins, unless the context requires otherwise. However, by way of example, hemichannels include connexin 23, In one embodiment, the hemichannel comprises one or more of connexins 26, 30, 32, 36, 37, 40, 45, 46, 47, 50, 59, and 62. In one embodiment, the hemichannel comprises one of the aforementioned connexins. In one embodiment, the hemichannel comprises one or more of connexins 26, 30, 32, 36, 37, 40, 45, and 47. In one embodiment, the hemichannel comprises one of connexins 26, 30, 32, 36, 37, 40, 45, or 47. In one particular embodiment, the hemichannel comprises one or more of connexins 30 and 43. In one particular embodiment, the hemichannel comprises one of connexins 30 or 43. In one particular embodiment, the hemichannel consists of one of connexin 45 or connexin 46 or connexin 50; in one embodiment, the hemichannel comprises one or more connexins excluding connexin 26.

[0190] As used herein, the term "gap junction channel" includes two hemichannels that connect across the intercellular space between adjacent cells and allow certain molecules to flow between those cells.

[0191] Hemichannels and gap junction channels can be present in any type of cell. Thus, a reference to a "hemichannel" or "gap junction channel" should be deemed to include a reference to a hemichannel or gap junction channel present in any cell type, unless the context requires otherwise. In one embodiment of the invention, the hemichannel or gap junction channel is present in a cell outside the central nervous system. In one embodiment, the hemichannel or gap junction channel comprises one or more connexins other than connexin 26 and is present in a cell outside the central nervous system. In one embodiment of the invention, the hemichannel or gap junction channel is present in a cell within the eye. In one embodiment of the invention, the hemichannel or gap junction channel is present in a cell within the anterior segment of the eye, i.e., the anterior segment. In one embodiment of the invention, the hemichannels or gap junction channels are present in cells at the back of the eye, i.e., in the posterior segment. In one embodiment of the invention, the hemichannels or gap junction channels are present in cells in the uvea. In one embodiment of the invention, the hemichannels or gap junction channels are present in cells in the optic nerve. In one embodiment of the invention, the hemichannels or gap junction channels are present in cells in the microvasculature of the eye. In one embodiment of the invention, the hemichannels or gap junction channels are present in cells in the choroid. In one embodiment of the invention, the hemichannels or gap junction channels are present in cells in the choriocapillaris.

[0192] As used herein, "modulation of hemichannels and / or gap junction channels" is modulation of one or more functions and / or activities of hemichannels and / or gap junction channels. Such functions and activities can include, for example, docking of a hemichannel onto an adjacent cell and opening to form a gap junction channel. These can also include intercellular communication between cells and the flow of molecules between cells through gap junction channels. Such functions and activities can include, for example, the flow of molecules from the extracellular space or environment through the hemichannel into the cell, and / or the flow of molecules from the intracellular space or environment of the cell through the hemichannel into the extracellular space or environment.

[0193] Modulation of hemichannel and / or gap junction channel function may occur by any means. However, by way of example only, modulation may occur by one or more of: preventing, blocking, inhibiting, or reducing the formation of gap junctions by hemichannel docking; inducing or promoting closing of hemichannels; preventing, blocking, inhibiting, or reducing hemichannel opening; inducing or promoting loss of coupling between hemichannels; causing, inducing, or promoting internalization of hemichannels and / or gap junctions. Use of words such as "block," "inhibit," "prevent," "reduce," and "antagonize" should not be taken to mean complete blocking, inhibition, prevention, or antagonism, although this may be preferred, and should be taken to include at least partial blocking, inhibition, prevention, or antagonism to reduce the function or activity of hemichannels and / or gap junction channels. Similarly, "induce" or "promote" should not be construed to mean complete loss of coupling or complete internalization of hemichannels and / or gap junctions (or groups of hemichannels and / or gap junctions), but should be construed to include at least partial loss of coupling or partial internalization to reduce the function or activity of hemichannels and / or gap junction channels.

[0194] As used herein, the term "gap junction channel modulator" refers to a compound that inhibits, inhibits, and / or reduces the function or activity of a gap junction channel, including, for example, inhibiting, inhibiting, and / or reducing the expression, activity, and / or formation of hemichannels and / or gap junctions, including the expression of connexin proteins, their trafficking, and / or assembly, or the function or activity of a gap junction hemichannel, either together or separately. Inhibition, inhibition, and / or reduction of function or activity can be direct or indirect (for example, but not limited to, directly blocking the channel, inducing a conformational change, or altering the connexin phosphorylation state). Gap junction channel blockers can be of any chemical nature. However, by way of example, the agent can be a nucleic acid (including antisense molecules, RNAi molecules, morpholinos, and other nucleic acids described herein), a peptide, a small molecule, a chemical element, a hormone, an antibody, an antibody fragment, or a metabolite. In certain embodiments, the agent is a compound that targets one or more components of gap junctions, including connexins, hemichannels (also known as connexons), to inhibit or block the activity, expression, trafficking, and / or assembly of gap junctions. "Inhibit" or "block" refers to inhibiting or blocking the activity, expression, trafficking, and / or assembly of connexins, hemichannels, or gap junctions. This should not be taken to mean that assembly is completely inhibited or blocked, although this may be preferred, but should be taken to include any reduction in connexin, hemichannel, or gap junction activity, expression, trafficking, and / or assembly.

[0195] As used herein, the term "disorders in which modulation of gap junction hemichannels and / or gap junction channels may be beneficial" may include any disease, disorder, or condition in which gap junction channel and / or hemichannel function or activity may be associated with the onset, progression, or persistence of the disease, disorder, or condition. In one embodiment, the disease, disorder, or condition is associated with gap junction channel and / or hemichannel function or activity that comprises one or more of connexins 23, 25, 26, 30, 30.2, 30.3, 31, 31.1, 31.9, 32, 36, 37, 40, 40.1, 43, 45, 46, 47, 50, 59, and 62. In one embodiment, the disease, disorder, or condition is associated with gap junction channel and / or hemichannel function or activity that comprises one of the aforementioned connexins. In one embodiment, the disease, disorder, or condition is associated with a function or activity of gap junction channels and / or hemichannels comprising one or more of connexins 26, 30, 32, 36, 37, 40, 45, and 47. In one embodiment, the disease, disorder, or condition is associated with a function or activity of gap junction channels and / or hemichannels comprising one of connexins 26, 30, 32, 36, 37, 40, 45, or 47. In one particular embodiment, the disease, disorder, or condition is associated with a function or activity of gap junction channels and / or hemichannels comprising one or more of connexin 30 and connexin 43. In one particular embodiment, the disease, disorder, or condition is associated with a function or activity of gap junction channels and / or hemichannels comprising one of connexin 30 or connexin 43 or connexin 45 or connexin 46 or connexin 50. In one embodiment, the disease, disorder, or condition is one which is associated with the function or activity of gap junction channels and / or hemichannels comprising one or more connexins, except for connexin 26.In one embodiment, the disease, disorder, or condition is one in which the function or activity of gap junction channels and / or hemichannels present in cells outside the central nervous system is associated. In one embodiment, the disease, disorder, or condition is one in which the function or activity of gap junction channels and / or hemichannels present in cells outside the central nervous system includes one or more connexins, except connexin 26, and is associated. In one embodiment of the invention, the disease, disorder, or condition is one in which the hemichannel or gap junction channel function or activity that is modulated is present in cells within the eye. In one embodiment of the invention, the disease, disorder, or condition is one in which the hemichannel or gap junction channel function or activity that is modulated is present in cells within the anterior segment of the eye, i.e., the anterior segment. In one embodiment of the invention, the disease, disorder, or condition is one in which the hemichannel or gap junction channel function or activity that is modulated is present in cells within the uvea, i.e., the posterior segment of the eye. In one embodiment of the invention, the disease, disorder, or condition is one in which the hemichannel or gap junction channel function or activity that is modulated is present in cells within the uvea. In one embodiment of the invention, the disease, disorder, or condition is one in which the modulated hemichannel or gap junction channel function or activity is present in cells within the optic nerve. In one embodiment of the invention, the disease, disorder, or condition is one in which the modulated hemichannel or gap junction channel function or activity is present in cells within the choroid. In one embodiment of the invention, the disease, disorder, or condition is one in which the modulated hemichannel or gap junction channel function or activity is present in cells within the choriocapillaris. In one embodiment of the invention, the disease, disorder, or condition is one in which the modulated hemichannel or gap junction channel function or activity is present in cells within the ocular microvasculature. In one embodiment, the composition may include any of the gap junction channel and / or hemichannel modulating agents described above. , or may not be included.

[0196] As used herein, the term "disorder in which modulation of pannexin channels may be beneficial" should be considered to include any disorder in which pannexin or pannexin channel function or activity may be associated with the onset, progression, or persistence of a disease, disorder, or condition. In one embodiment, the disease, disorder, or condition is one in which the pannexin channel function or activity involves one or more of the three isoforms of pannexin. In one embodiment, the disease, disorder, or condition is one in which the modulated pannexin channel function or activity involves pannexin 1. In one embodiment, the disease, disorder, or condition is one in which the modulated pannexin channel function or activity involves or is associated with the ocular surface, retina, and eye. or in or on the eye, including the blood vessels that contain the eye.

[0197] "Chronic wound", "wound that does not heal at the expected rate", and "dehiscence wound" and similar terms and phrases, as used herein, have the meanings as provided in US 2011 / 0300130, which is incorporated herein by reference and includes some examples of wound types to which the present invention may be applied. However, by way of example, such wounds may include diabetic ulcers (including, for example, diabetic foot ulcers), venous ulcers, venous stasis ulcers, pressure ulcers, decubitus ulcers, vasculitic ulcers, arterial ulcers, infectious ulcers, pressure ulcers, burn ulcers, traumatic or trauma-induced ulcers, inflammatory ulcers, ulcers associated with pyoderma gangrenosum, ocular ulcers containing persistent epithelial defects, and mixed ulcers.

[0198] "Fibrosis" and "fibrotic disease, disorder, or condition" or similar terms and expressions, as used herein, have the meaning as provided in US 2011 / 0092449, which is incorporated herein by reference and includes some examples of fibrosis, disease, disorder, or condition to which the present invention may be applied. However, by way of example, such fibrosis, fibrotic disease, disorder, or condition may include liver fibrosis, cardiac fibrosis, pulmonary fibrosis (including, for example, silicosis, asbestosis, idiopathic pulmonary fibrosis), oral fibrosis (including, for example, oral submucous fibrosis), retroperitoneal fibrosis, deltoid fibrosis, endomyocardial fibrosis, renal fibrosis (including, for example, diabetic nephropathy), glomerulosclerosis, acute fibrosis. In one embodiment, liver fibrosis results from chronic liver injury or is associated with hemochromatosis, Wilson's disease, alcoholism, schistosomiasis, viral hepatitis, biliary obstruction, exposure to toxins, and / or metabolic disorders. In one embodiment, the cardiac fibrosis is endocardial fibrosis or endomyocardial fibrosis. In one embodiment, the acute fibrosis is associated with accidental injury, infection, and / or radiation and / or chemotherapy treatment. In one embodiment, the fibrosis may occur in a subject with a disease, disorder, or condition selected from the group including scleroderma, pancreatitis, inflammatory bowel disease, Crohn's disease, nodular fasciitis, and / or eosinophilic fasciitis. In one embodiment, the scleroderma may be morphea, generalized morphea, or linear scleroderma.

[0199] "Abnormal or excessive scarring" and the like, as used herein, has the meaning as provided in US 2011 / 0130710, which is incorporated herein by reference and includes several examples of abnormal or excessive scarring to which the present invention may be applied. However, by way of example, abnormal or excessive scarring may include scars present in or on the skin, scars in or on the eye, keloid scars, hypertrophic scars, atrophic scars and extensive scars.

[0200] "Vascular disorder" and similar terms or expressions as used herein have the meaning as provided in EP 2510939, which is incorporated herein by reference and includes several examples of vascular disorders to which the present invention may be applied. However, by way of example, vascular disorders include atherosclerosis, microvascular disorders, macrovascular disorders, thrombosis, blood vessel disorders due to trauma, and the like. These may include vascular disease, vascular injury, diabetic retinopathy, organ ischemia, endothelial cell destruction, and vascular disease of the extremities.

[0201] "Orthopedic disease or disorder" and similar expressions, as used herein, have the meaning as provided in EP 2238250, which is incorporated herein by reference, including several examples of orthopedic diseases or disorders to which the present invention may be applied. However, by way of example, orthopedic diseases or disorders include those that are characterized in whole or in part by abnormal tissue formation in and / or around a joint, e.g., those associated with altered or abnormal joint mobility or structure that may be associated with or caused by a variety of injuries and conditions, such as metabolic disorders, ischemia, trauma, injury to a joint, capsule, bone, cartilage, tendon, ligament, or muscle, fracture, subluxation, dislocation, crush injury, prolonged immobilization (e.g., immobilization of a joint in a cast or splint), and / or paralysis.

[0202] The phrase "orthopedic surgery or procedure" and similar phrases as used herein will be readily understood by those skilled in the art. However, by way of example, "orthopedic surgery or procedure" and similar phrases should be considered to include any surgery or procedure outlined in EP 2242844. "Improvement" of recovery from such procedures should also be considered broadly and may include, for example, reduction in pain, as well as improvement in mobility and / or recovery time.

[0203] "Post-orthopedic surgical joint contracture" as used herein has the meaning as provided in EP 2242844, which is incorporated herein by reference.

[0204] "Adhesion" and similar expressions, as used herein, have the meaning as provided in EP 2252690, which is incorporated herein by reference. However, by way of example, "adhesion" can include surgical adhesions as well as adhesions that form in any tissue, including epithelium, connective tissue, muscle, and tissue.

[0205] "Tissue damage," "tissue damage associated with ophthalmic procedures," and similar expressions and terms, as used herein, have the meanings as provided in U.S. Patent Publication No. 2012 / 0093768, which is incorporated herein by reference, and which includes several examples of tissue damage to which the present invention may be applied. By way of example, however, tissue damage may include promoting tissue repair processes and / or ameliorating tissue damage.

[0206] "Inflammatory disorder", "inflammatory disease" and similar expressions as used herein have the meaning as provided in WO 2013 / 148736, which is incorporated herein by reference and includes some examples of disorders to which the present invention may be applied. In one embodiment, hemichannels and pannexin modulating agents are used alone or together to inhibit the activation of one or more inflammasomes. In one embodiment, modulating agents including hemichannels and pannexin modulating agents or pannexin channel modulating agents are used alone or together to inhibit the activation of inflammatory cascades by inflammasomes. In one embodiment, modulating agents including gap junctions, hemichannels and pannexins and / or pannexin channel modulating agents are used alone or together to treat a subject with a disease, disorder, or condition characterized, at least in part, by the activation of one or more inflammasomes and / or the activation of inflammatory cascades by inflammasomes. In one embodiment, gap junctions, hemichannels, pannexin channels, connexins, and pannexin modulating agents are used alone or together to modulate the activity of NLRP3 inflammasomes.

[0207] The inflammasome is a complex of caspase-1, PYCARD, NALP, and, optionally, (Ca Inflammasomes are multiprotein complexes that contain caspase 5 (also known as inflammasome 11 or ICH-3). The exact composition of the inflammasome depends on the activator that initiates inflammasome assembly. For example, dsRNA results in one inflammasome composition, whereas asbestos assembles different variants. Inflammasomes promote the maturation of the proinflammatory cytokines interleukin 1β (IL-1β) and interleukin 18 (IL-18). Inflammasomes are involved in the activation of inflammatory processes and have been shown to induce cell pyroptosis, a process of programmed cell death distinct from apoptosis. NLRP3 inflammasome blockade suppresses VEGF-A-induced senile macular degeneration.

[0208] The terms "modulator," "modulator," and "modulation" of gap junction channel, hemichannel, pannexin or pannexin channel, or connexin function or activity, as used herein in their various forms, refer to the total or partial inhibition of connexin or connexin hemichannel or connexin gap junction, or pannexin or pannexin channel expression, action, or activity, and may function as anti-connexin agents, including gap junction modulating agents, and as anti-pannexin acting agents, including pannexin channel modulating agents. In some embodiments, the gap junction modulating agent and / or connexin modulating agent may be a modulating agent of connexins present in blood vessels, e.g., a connexin 43 modulating agent and / or a connexin 45 modulating agent. Thus, as used herein, the term "connexin modulating agent" refers generally to connexin modulating agents, but also specifically to connexin 43 modulating agents and connexin 45 modulating agents (as well as Cx43 and Cx45 hemichannel modulating agents), and modulating agents of other vascular connexins and hemichannels, unless otherwise specified. In some embodiments, the connexin modulating agent is a connexin 43 modulating agent, e.g., a connexin 43 hemichannel modulating agent that blocks hemichannel opening. In some embodiments, the gap junction modulating agent also includes other connexins found in the eye, such as Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, and Cx57, as well as modulating agents of these hemichannels and gap junctions. In some embodiments, the pannexin and / or pannexin channel modulating agent may be a modulating agent of pannexin 1, specifically, a modulating agent of pannexin 1 channel opening. In some embodiments, the modulating agent may or may not include any of the foregoing.

[0209] In some embodiments, "ocular disorders" include glaucoma, including hypertensive and normal tension glaucoma; clinical geographic atrophy; AMD, including dry and wet AMD, abnormalities, or disorders; chronic macular ischemia, ocular fibrosis; idiopathic polypoidal choroidal vasculopathy (IPC); diabetic maculopathy, diabetic retinopathy; hypertensive retinopathy, inflammatory CNV; central serous retinochoroidopathy (CSR); macular telangiectasia; pattern dystrophy; subretinal / subPRD (subPRD) neovascularization; serous detachment of the retinal neurosensory epithelium; RPE detachment; hemorrhage (subretinal pigment epithelium, subretinal, intraretinal, or preretinal, including breakthrough hemorrhage into the vitreous); epiretinal, intraretinal, subretinal, or subpigment epithelial scarring. scar / glial tissue or fibrin-like deposits; retinal fibrosis, retinal angiomatous proliferation and retinochoroidal anastomosis; choroidal neovascularization (CNV); cystoid macular disease; retinal thickening; non-exudative AMD; and retinal scarring, uveitis including posterior uveitis, scleritis, episcleritis including cytomegalovirus (CMV) retinitis viral retinitis, retinopathy of prematurity, retinal hypoxia, diffuse choroidal sclerosis, sclerosis of the choriocapillaris, dry eye, persistent epithelial defects of the eye and cornea, diabetic macular edema (DME), neuropathic eye disorders, trauma-induced decreased intraocular pressure, epithelial basement membrane dystrophy, and / or other eye disorders including those mentioned elsewhere herein.

[0210] As used herein, an "ocular neuropathy" or "neuropathic eye disorder" refers to a neuropathic eye disorder that is characterized by an ocular neuropathic disorder, such as the halting or reduction of loss of RGCs or damage to or loss of other ocular neurons or structures, or the repair of lost RGCs or other ocular structures or neurons. Any ocular disorder, disease, or condition that would benefit from an agent that treats neuronal loss in the ocular. Also included are injuries associated with ocular neuropathic, ischemic perfusion injury, inflammatory, or microvascular lesions that may result from choroidal or retinal perfusion disorders, ocular hypertension, inflammation of the choroid or inner retina or other internal tissues of the eye, or retinal vein or artery occlusion. In some embodiments, choroidal or retinal perfusion disorders may cause ocular hypoxia. Also included are any ocular diseases, disorders, and conditions that are characterized by increased expression of connexins present in the blood vessels or neurons of the eye. Unwanted pannexins Also included are ocular diseases, disorders, and conditions characterized by undesirable ZO-1 protein or ZO-1 protein activity or that would benefit from a reduction in ZO-1 protein or ZO-1 protein activity.Also included are diseases, disorders, and conditions characterized by undesirable lower Rac1 or Rac1 activity or that would benefit from an increase in Rac1 or Rac1 activity.Also included are diseases, disorders, and conditions characterized by undesirable reduced RhoA GTPase or RhoA GTPase activity or that would benefit from a reduction in RhoA GTPase or RhoA GTPase activity.

[0211] "Glaucomatous ocular neuropathy" refers to any "ocular neuropathy" associated with glaucoma, such as neuropathic damage to retinal ganglion cells (RPG) associated with glaucoma and glaucomatous optic neuropathy. In some embodiments, glaucomatous optic neuropathy may or may not be associated with elevated intraocular pressure or choroidal or retinal perfusion disorders. In some embodiments, methods of treating neovascular glaucoma include treatment by administering a modulating agent, including a gap junction modulating agent, a pannexin modulating agent, a pannexin channel modulating agent, and / or a connexin modulating agent.

[0212] The term "ocular pressure-associated neuropathy" refers to glaucomatous optic neuropathy associated with ocular hypertension, i.e., elevated pressure within the eye.

[0213] The term "ocular hypoxia" refers to any ocular condition or disorder resulting from hypoxia, including, for example, choroidal or retinal perfusion disorders, including vascular leakage and / or vascular breakdown, hypertension, or disruption of blood and / or oxygen flow to the eye, including ischemia within the eye. Conditions resulting from ocular hypoxia include, for example, glaucoma, glaucomatous ocular neuropathy, intraocular pressure-related neuropathy, ocular neuropathy, clinical geographic atrophy, DME, choriocapillaris dropout, and / or capillary breakdown in the choroid, or other conditions described herein and below.

[0214] Clinical geographic atrophy (GA) Symptoms of GA are usually insidious and are often discovered during routine fundus examination. When GA is bilateral and involves the fovea of ​​both eyes, patients may complain of decreased central vision. The general presentation is initially difficulty reading the smallest print, then later larger print and / or letters. Confirmation of the diagnosis of GA is by clinical examination using a high-resolution fundus lens of stereo biomicroscopy. This shows a characteristic area or areas of discoloration with clear and wavy edges like the edges of a scallop. When the area of ​​GA is larger than 500 micrometers, large choroidal vessels are clearly visible within the area of ​​discoloration.

[0215] Usually, drusen and areas of focal hyperpigmentation are visible within the retina adjacent to the ga plaque. Several imaging modalities, specifically fundus autofluorescence, can be useful in the evaluation of GA. Fundus autofluorescence in conjunction with spectral domain OCT has made the diagnosis of GA easier, as these imaging modalities can reveal areas of GA that may not be clinically visible by biomicroscopy.

[0216] Geographic atrophy is an advanced (late) form of dry AMD. Herein, atrophy refers to the degeneration of the deepest cells of the retina. It is usually defined as any sharply delineated circular or oval area of ​​hypopigmentation or apparent absence of retinal pigment epithelium (RPE) where the choroidal vessels are more visible than in the surrounding areas. The most common sequence of events leading to GA is the progression of large drusen to hyperpigmentation, sometimes beginning with the appearance of refractile deposits, with the development of atrophic areas of the retina and underlying choriocapillaris, followed by regression of drusen, hypopigmentation, and ultimately RPE cell death.

[0217] In some embodiments, the modulating agent, e.g., a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, prevents inflammation of the choroidal vessels, maintains the retinal pigment epithelial cell layer, and / or prevents atrophy in the area of ​​the retina and underlying choriocapillaris.

[0218] Wet Age-Related Macular Degeneration (AMD) The most typical symptom of the onset of wet AMD is blurred and distorted central vision. Most patients complain that straight lines appear curved or wavy. Patients may not notice visual symptoms when the first eye is affected. When wet AMD occurs in the second eye, patients suddenly lose the ability to read, drive, or see details such as facial expressions and features. This symptom is described by many patients with AMD of a central dark spot in the visual field that is noticed at night but resolves within a few minutes as the patients become accustomed to it. This symptom may also be present in patients with AMD who do not necessarily develop wet AMD.

[0219] Examination of the macula usually reveals wet macular lesions along with other features of early AMD such as drusen and pigmentary abnormalities. These latter features may not be visible after wet AMD has developed. However, the fellow eye will often exhibit some or all of these early clinical signs in the absence of advanced disease, and their presence is useful in supporting the diagnosis that neovascular lesions are due to AMD. After slit lamp biomicroscopy, the presence or absence of the following signs should be noted: (1) subretinal or sub-RPE neovascularization, which may be visible as a gray-green lesion (occasionally the lesion will have a pigmented rim thought to be due to proliferation of the RPE at the edge of the membrane), serous detachment of the neurosensory retina, (3) RPE detachment, (4) hemorrhage-subretinal pigment epithelium, subretinal, intraretinal, or preretinal (breakthrough hemorrhage into the vitreous may also occur), (5) hard exudates (lipids) in the macular region associated with any of the above but not associated with other retinal vascular disease, (6) scar / glial tissue or fibrin-like deposits on the retina, intraretinal, subretinal, or under the pigment epithelium, (7) retinal angiomatous proliferation and retinochoroidal anastomosis. This disorder may be treated with a modulating agent, e.g., a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, as described herein.

[0220] Idiopathic polypoidal choroidal vasculopathy (IPC) This is the classic form of neovascular AMD, in which highly exudative lesions with steep walled hemorrhagic pigment epithelial detachments are most typically found adjacent to the optic disc, but can occur anywhere within and even outside the macula. High-speed fluorescein or indocyanine green angiography typically reveals hyperfluorescent dilated complexes (branching vascular networks) of leaking choroidal vessels in the late phase of angiography. These dilated complexes look like polyps or grapes, hence the name. It was originally described in middle-aged black populations and was more commonly seen in women. IPC is considered part of the spectrum of AMD, and a strong association with hypertension and ischemic heart disease has been described. The use of confocal high-speed imaging devices has allowed the diagnosis of IPC more frequently, and IPC has been shown to be a rare condition in serous vascular grafts in elderly Asian populations. It accounts for over one-third of blood maculopathies and 8-13% of those seen in Caucasians. This disorder can also be treated with a modulating agent, e.g., a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, as described herein.

[0221] ocular fibrosis Disruption of the highly ordered tissue structure in the eye caused by vascular leakage, hemorrhage, and concurrent fibrosis can lead to mechanical disruption of the visual axis and / or biological dysfunction. Ocular fibrosis can also include, for example, fibrosis of the lens, macula, or retina, and may include, for example, progressive subretinal fibrosis and premacular fibrosis (PMF). Macular fibrosis occurs when a thin layer of fibrotic scar tissue forms on top of the macula in response to injury or damage. Damage to the macula can occur due to ocular trauma, retinal tears or detachment, vitreous contraction, or systemic diseases such as diabetes or hypertension. Macular fibrosis can also be referred to as macular fold formation, epiretinal membrane, or cellophane maculopathy. Subretinal fibrosis can be associated with chronic vitreous inflammation resulting in progressively enlarging and coalescing fibrotic subretinal lesions, and can be associated with cystoid macular edema. PMF affects the macula in front of the retina, while macular degeneration affects the lower side of the retina. The primary symptom of PMF is the gradual onset of visual distortion in one eye, which may take weeks to months to develop. The disorder can be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein.

[0222] Uveitis Uveitis is an inflammation of the uvea, the middle layer of the eye. The uvea is made up of the middle pigmented vascular structure of the eye, including the iris, choroid, and ciliary body. The choroid is sandwiched between the retina and the white of the eye (sclera) and provides blood flow to the deeper layers of the retina. Uveitis can include inflammation of the iris, called iritis (anterior uveitis). This disorder may also be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein.

[0223] diabetic maculopathy It is the most common exudative central maculopathy in the elderly. Patients with diabetes frequently present with retinal microaneurysms, hemorrhages, and exudates, often in the context of macular edema. The presence of more extensive vascular findings outside the macular arcade along with venous congestion or beading would alert the clinician to the diagnosis of diabetic maculopathy. The reduction in visual function is less evident in eyes with diabetic maculopathy compared to eyes with CNV involving the fovea. Blood vessels near the macula leak fluid or protein into the macula. Fluorescein angiography is required to confirm the absence of choroidal neovascularization and pathology under the RPE. Wet AMD and diabetic maculopathy may coexist as both are common conditions. This disorder, like high myopia associated with choroidal neovascularization, can be treated with a modulating agent, e.g., a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, as described herein.

[0224] High myopia may be associated with choroidal neovascularization. These neovascular complexes are thought to result from the development of microcracks in thinned Bruch's membrane that allow access of the choroidal vessels to the subretinal space.

[0225] diabetic macular edema Diabetic macular edema is swelling of the retina in subjects with diabetes due to leakage of fluid from blood vessels in the macula. The macula is the central part of the retina; it is a small area rich in cone photoreceptors, specialized nerve endings that detect color and on which daytime vision depends. As macular edema develops, blurring occurs in the middle or just to the side of central vision. Vision loss from diabetic macular edema can progress over several months and make it impossible to focus clearly. Macular edema common in diabetes. Diabetic patients have about a 10% lifetime risk of developing macular edema. The condition is closely related to the degree of diabetic retinopathy (retinal disease). Hypertension (high blood pressure) and fluid retention also increase the hydrostatic pressure in the capillaries that force fluid from within the blood vessels into the retina. A common cause of fluid retention in diabetic patients is kidney disease with loss of protein in the urine (proteinuria). Diabetic macular edema is classified as focal and diffuse type. This is an important distinction because the treatment of the two types is different. Focal macular edema is caused by foci of vascular abnormalities, mainly retinal microaneurysms, that tend to leak fluid, while diffuse macular edema is caused by dilated retinal capillaries in the retina. This disorder may also be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, as described herein.

[0226] diabetic retinopathy Diabetic retinopathy can ultimately lead to blindness. It is an ocular manifestation of a systemic disease and afflicts up to 80% of all patients who have had diabetes for at least 10 years. Diabetic retinopathy hyperglycemia induces pericyte death and basement membrane thickening leading to damage of the vessel walls. This damage alters the blood-retinal barrier, rendering retinal vessels permeable. Microvessels such as those in the eye are particularly vulnerable to poor glycemic control. Aberrant connexin expression in diabetes is associated with complications in several tissues, including the skin, kidney, bladder, perineurium, lens, and heart. In the retina, hyperglycemia is known to induce apoptosis leading to vascular dropout and pericyte loss, hallmarks of underlying diabetic retinopathy. Recent findings show that the reduction of Cxn43 expression initiates apoptosis and disruption of vascular homeostasis (Bobbie MW, Roy S, Trudeau K, Munger SJ, Simon AM, Roy S, Invest Ophthalmol Vis Sci.;51(7):3758-63,2010). However, the above statements mostly refer to the underlying background of the disease in the early stages of non-proliferative diabetic retinopathy, and while some patients will develop macular edema when damaged blood vessels leak fluid and lipids into the macula, most patients do not notice any changes in their vision. As the disease progresses, diabetic retinopathy enters the vascular proliferation stage. Due to low oxygen levels in the retina, new blood vessels are fragile and grow along the retina into the vitreous humor. These blood vessels can bleed, clouding vision and destroy the retina. Fibrovascular proliferation can cause retinal detachment, and blood vessels can also grow into the angle of the anterior chamber of the eye, causing neovascular glaucoma. Diabetic retinopathy is characterized by chronic, subclinical inflammation (Zhang W, Liu H, Rojas (M, Caldwell RW, Caldwell RB, Immunotherapy, 3(5):609-28, 2011). This disorder can be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein. In some embodiments, the modulating agent can also treat the inflammatory phase of this diabetic retinopathy.

[0227] Inflammatory CNV Some choroidal inflammatory white dot syndromes (e.g., presumed ocular histoplasmosis, punctate inner choroidopathy, multifocal inner choroidopathy) may be associated with inflammatory choroidal neovascularization. In some embodiments, the modulating agents described herein prevent inflammation of the choroid, thereby preventing inflammatory CNV.

[0228] Central serous retinochoroidopathy (CSR) Central serous chorioretinopathy is characterized by the accumulation of serous fluid beneath the retinal neurosensory epithelium without any evidence of neovascularization. Chronic CSR is occasionally confused with AMD, and again a combination of history, symptoms, and retinal imaging usually helps distinguish the two. CNV and IPC V may occur as a complication of chronic CSR. Chronic CSR is characterized by leakage of subretinal fluid that tends to accumulate under the central macula. This allows choroidal fluid to leak into the subretinal space. The accumulation of outflow occurs due to small tears in the retinal pigment epithelium. In some embodiments, the modulating agent described herein prevents or otherwise improves inflammation of the choroid and / or prevents or improves choriocapillary dropout. Maintenance of the choroid can prevent leakage of choroidal fluid into the subretinal space.

[0229] Macular telangiectasia Idiopathic macular telangiectasia (MACTEL), sometimes referred to as perifoveal or parafoveal telangiectasia, can be difficult to distinguish from nAMD, especially with the RAP form of nAMD. Two types of telangiectasia have been described: type 1 MACTEL occurs in middle-aged people, the condition is usually unilateral, and the vessels are leaky and exhibit exudative features with intraretinal fluid accumulation along with cystic maculopathy and peripheral exudation. Type 2 MACTEL occurs in older people, and is usually bilateral, with obvious chronological progression to the fovea and spreading throughout the perifoveal region, crystallin deposits, pigmentary changes, and evidence of right-angled venules. While leakage is detectable with fluorescein angiography, there is no evidence of increased retinal thickening. Cystic cavities are evidence within the retina using OCT, and these cavities are thought to reflect loss of retinal tissue. Occasionally, subretinal neovascularization develops and arises from the retinal circulation. Macular telangiectasia develops when there is a problem with the small blood vessels around the fovea, the center of the macula. There are two types of macular telangiectasia, each of which develops separately. Type 2 macular telangiectasia: The most common form of macular telangiectasia is type 2 macular telangiectasia, where the small blood vessels around the fovea leak, dilate (widen), or both. In some cases, new blood vessels form under the retina, which may break or leak. Fluid from the leaking blood vessels causes swelling or thickening of the macula, a condition called macular edema, which affects central vision. Scar tissue can also sometimes form on the macula and fovea, causing loss of fine detail vision. Both types can affect both eyes, but not necessarily with the same severity. Type 1 macular telangiectasia: In type 1 macular telangiectasia, blood vessels dilate to form small aneurysms, causing swelling and damage to macular cells. The disease almost always occurs in one eye, which distinguishes it from type 2. These disorders can also be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein.

[0230] Pattern dystrophy (PD) PD affects the macula and can be mistaken for non-exudative AMD. The most common type of PD seen is adult vitelliform macular dystrophy (AVMD), and less commonly butterfly pattern dystrophy. PD is a condition that has a genetic basis, although a family history is often absent. PD is usually associated with better visual outcomes than AMD unless complicated by choroidal neovascularization or atrophic changes. Distinguishing AVMD from AMD can be difficult. Symptoms can be similar, especially when CNV or atrophy accompanies PD, but AVMD is often identified in asymptomatic individuals on routine fundus examination. Fundus autofluorescence imaging, especially when combined with optical coherence tomography, helps distinguish PD from AMD. Fluorescein angiography can show the classic "corona sign" in AVMD, and the branching lines seen in butterfly PD are associated with hyperfluorescence dispersed in areas of deposits that show no leakage throughout the angiographic phase. Occasionally, fluorescein angiographic staining of vitellogenic lesions can be mistaken for active leakage from CNV. This disorder can be treated with a modulator, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein.

[0231] Subretinal / subPRD neovascularization Subretinal neovascularization is a pathological process that consists of the formation of new blood vessels in the choroid.In wet AMD, abnormal blood vessels grow under the macula and leak fluid and blood.These abnormal blood vessels, called subretinal neovascularization, can also lift the retina.This disorder can be treated with a modulating agent, for example, a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, as described herein.

[0232] Serous detachment of the retinal neurosensory epithelium Retinal detachment occurs when subretinal fluid accumulates between the retinal neurosensory epithelium and the retinal pigment epithelium. This process can occur by three means. One mechanism involves a break in the retina that allows the vitreous to enter the subretinal space directly. This is known as rhegmatogenous retinal detachment. The second mechanism involves proliferative membranes on the surface of the retina or vitreous. These membranes exert traction on the retinal neurosensory epithelium, causing a physical separation between the retinal neurosensory epithelium and the retinal pigment epithelium. This is called tractional retinal detachment. The third mechanism of retinal detachment is due to the accumulation of subretinal fluid resulting from exudation of fluid from inflammatory intervening material or mass lesions. This mechanism is known as serous or exudative retinal detachment. Serous detachment is caused by several inflammatory, or exudative retinal disease processes, such as sarcoidosis or choroidal neoplasms. In some embodiments, the modulating agents described herein are used to control inflammation in the underlying choriocapillaris, control the accumulation of subretinal fluid, and / or prevent the accumulation of subretinal fluid that can lead to, for example, serous detachment of the retinal neurosensory epithelium.

[0233] RPE peeling RPE detachment is a non-specific anatomical change that can be caused by any number of choroidal disorders that disrupt the normal bond between the basement membrane of the RPE and the inner collagen layer of Bruch's membrane. This disruption allows serous fluid from the underlying choriocapillaris to gain access into the subretinal pigment epithelium space. Age-related macular degeneration, choroidal neovascular membrane, high myopia, pigmented streaks, hereditary choroidal degeneration, POHS, and choroidal tumors have all been identified as precipitating conditions in the development of RPE detachment. This disorder can be treated with a modulator, for example, a gap junction modulator and / or connexin modulator, or a pannexin modulator or pannexin channel modulator, as described herein.

[0234] Hemorrhage - Subretinal pigment epithelium, subretinal, intraretinal, or preretinal hemorrhage, including breakthrough hemorrhage into the vitreous Retinal hemorrhage is an injury to the eye in which bleeding occurs into the retensitive tissue on the posterior wall of the eye. Retinal hemorrhage can be caused by high blood pressure, retinal vein occlusion (blockage of the retinal vein), or diabetes mellitus (which causes the formation of small, fragile blood vessels that are easily damaged). Retinal hemorrhage, especially mild ones not associated with chronic disease, usually resorbs without treatment. Laser surgery is a treatment option, which uses a laser beam to seal damaged blood vessels in the retina. This disorder can be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein.

[0235] Epiretinal, intraretinal, subretinal, or subpigment epithelial scar / glial or fibrinoid deposits In some embodiments, the connexin modulating agent can prevent scarring, inflammation, and fibrinogenesis. Thus, the connexin modulating agent can prevent epiretinal, intraretinal, subretinal, or subpigment epithelial scar / glial tissue or fibrin-like deposits. The disorder can be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or pannexin channel modulating agent, as described herein.

[0236] Retinal angiomatous proliferation and retinochoroidal anastomosis Retinal choroidal anastomosis represents the communication between the retina and the choroidal circulation, and is described in a subset of patients with neovascular senile macular degeneration (AMD). Retinal hemangioma proliferation is evidenced by the presence of anastomosis between the retinal circulation and the choroidal circulation in eyes with discoid scars. This disorder can be treated with a regulator, such as a gap junction regulator and / or a connexin regulator, or a pannexin regulator or pannexin channel regulator, as described herein.

[0237] Choroidal neovascularization (CNV) Choroidal neovascularization (CNV) is the generation of new blood vessels in the choroid layer of the eye. It is a common sign of degenerative macular disease wet AMD (age-related macular degeneration). CNV can occur rapidly in individuals with defects in Bruch's membrane, the innermost layer of the choroid. CNV is also associated with excessive amounts of vascular endothelial growth factor (VEGF). Similar to wet AMD, CNV can often occur with the rare genetic disease pseudoxanthoma elasticum, and rarely with the more common optic nerve head drusen. CNV is also associated with extreme myopia or malignant myopic degeneration, and occurs primarily in the presence of cracks in the retinal (specific) macular tissue, known as lacquer cracks in choroidal neovascularization. This disorder can be treated with a modulator, such as a gap junction modulator and / or connexin modulator, or a pannexin modulator or pannexin channel modulator, as described herein.

[0238] Cystic maculopathy Cystic maculopathy are cysts in or around the macula and can be treated with modulating agents, such as gap junction modulating agents and / or connexin modulating agents, or pannexin modulating agents or pannexin channel modulating agents described herein.

[0239] retinal thickening Macular thickening (edema) is the swelling or thickening of the part of the retina that is involved in central vision. In some embodiments, the modulating agent described herein can control choriocapillaris rupture, thereby preventing retinal thickening. Thus, the modulating agent can treat retinal thickening. Retinal thickening can be treated with a modulating agent, such as a gap junction modulating agent and / or a connexin modulating agent, or a pannexin modulating agent or a pannexin channel modulating agent, described herein.

[0240] wet AMD Non-exudative AMD ("dry AMD") results from the gradual breakdown of the retinal pigment epithelium (RPE), the accumulation of drusen deposits, and loss of function of the overlying photoreceptors. In some embodiments, as described above, a modulating agent, e.g., a gap junction or connexin modulating agent, alone or together with a pannexin modulating agent or pannexin channel modulating agent described herein, can treat non-exudative AMD.

[0241] Retinal scarring Retinal scarring is the development of scar tissue on, in, or under the retina, a vital structure at the back of the eye. Mild scarring may not be a serious medical problem, but large scars can cause vision distortion and eventual vision loss. A caregiver may evaluate a patient with retinal scarring to determine the extent and provide advice on treatment options. Treatment of this condition can be invasive, and doctors do not want to suggest procedures that may do more harm than good. Patients may develop retinal scarring for several reasons, including very severe myopia, ocular histoplasmosis syndrome, and wet age-related macular degeneration. Retinal scarring begins with irritation to the retina that causes inflammation, resulting in changes in the tissue. If this occurs repeatedly, it can begin to cause serious problems for the patient. This may cause wrinkles on the surface of the retina or cause swelling of the retina. Sometimes, retinal scarring causes retinal detachment. In some embodiments, the modulating agent, for example, a gap junction modulating agent and / or a connexin modulating agent, and / or a pannexin modulating agent or a pannexin channel modulating agent, can control or suppress retinal scarring and retinal inflammation, which controls tissue changes and thereby prevents or improves retinal scarring.

[0242] Ocular hypoxia Ocular hypoxia, including retinal hypoxia, is a potentially blinding mechanism underlying several sight-threatening disorders including some types of glaucoma, central retinal artery occlusion, ischemic central retinal vein thrombosis, complications of diabetic eye disease (e.g., DME), AMD, and ocular fibrosis. Hypoxia has been associated with the loss of retinal ganglion cells (RGCs) that occurs in such pathologies. Death of RGCs occurs by apoptosis or necrosis. Hypoxia-ischemia induces the expression of hypoxia-inducible factor-1α and its target genes such as vascular endothelial growth factor (VEGF) and nitric oxide synthase (NOS). Increased production of VEGF causes disruption of the blood-retinal barrier leading to retinal edema. Enhanced expression of NOS causes increased production of nitric oxide, which can be toxic to cells and causes cell death. Excessive glutamate release in hypoxic-ischemic conditions causes excitotoxic damage to RGCs by ionotropic and metabotropic glutamate receptor activation. Activation of glutamate receptors is thought to initiate damage in the retina through a cascade of biochemical effects, including neuronal NOS activation, and intracellular Ca 2+ Elevated levels of retinal oxidative stress are the main contributors to RGC loss. In the posterior segment of the eye, diabetes-related retinal hypoxia can lead to fibrosis and tractional retinal detachment, which are complications of advanced diabetic retinopathy (DR). Under the retina, similar fibrosis can occur following subretinal hemorrhage associated with neovascular senile macular degeneration (AMD). A therapeutically effective amount of a modulator, for example, a connexin modulator, such as a connexin 43 modulator, is any amount effective to slow, stop, or reverse ocular neuropathy or treat any of the ocular disorders described herein.

[0243] The gap junction and / or connexin polynucleotide or oligonucleotide may be selected from modified or unmodified connexin polynucleotides or oligonucleotides, such as, for example, modified or unmodified connexin 43 antisense polynucleotides or oligonucleotides. In some embodiments, the modified connexin antisense polynucleotide or oligonucleotide or polynucleotide comprises a mixture of modified and unmodified nucleotides. In some aspects, the connexin 43 antisense compound used in the methods herein is an antisense oligonucleotide comprising naturally occurring nucleobases and unmodified internucleoside linkages.

[0244] In some embodiments, gap junction, connexin and / or pannexin modulating agents are antagonists that inhibit and / or block gap junctions, connexins and / or pannexins or inhibit and / or block upstream agonists of gap junctions, connexins and / or pannexins. In some embodiments, gap junction, connexin and / or pannexin antagonists include, for example, antagonists that bind to and inhibit gap junctions, connexins and / or pannexins, compounds that inhibit expression of gap junctions, connexins and / or pannexins, and / or viral vectors that include gap junction, connexin and / or pannexin inhibitors or that encode proteins or antisense polynucleotides that block or inhibit gap junctions, connexins and / or pannexins. In some embodiments, the species that inhibits gap junctions, connexins, and / or pannexins, and / or upstream agonists of gap junctions, connexins, and / or pannexins may be an antibody or antibody fragment, a nanobody, a peptide or peptidomimetic, a receptor fragment, a genetically engineered fusion protein, an aptamer, a small molecule, or a single chain variable fragment (scFv).

[0245] The methods herein provide for the treatment of intraocular pressure-related optic neuropathy, such as glaucoma, in an amount sufficient to reduce intraocular pressure. In some embodiments, the pannexin modulating agents and connexin modulating agents are useful for treating trauma associated with elevated intraocular pressure. In some embodiments, the compositions, articles of manufacture, and methods of the invention are useful for reducing intraocular pressure to normal levels, e.g., less than 21 mm Hg, e.g., less than 21, 20, or 19 mm Hg. In some embodiments, for example, the connexin modulating agents and pannexin modulating agents and methods of the invention are useful for reducing intraocular pressure, e.g., to about 8 to about 21 mm Hg, about 10 to about 22 mm Hg, about 10 to 21 mm Hg, or about 12 to about 21 mm Hg. In some embodiments, the compositions and methods of the invention are also useful for treating glaucomatous optic neuropathy, even in the absence of elevated intraocular pressure. In some embodiments, the connexin modulating agent is, for example, a connexin 43 modulating agent or a connexin 45 modulating agent, preferably a connexin 43 modulating agent. In some embodiments, the connexin modulating agent is a modulating agent of Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessel. In some embodiments, the connexin modulating agent may or may not include any of the foregoing.

[0246] Connexin or pannexin antisense oligonucleotides or polynucleotides comprising at least one unmodified nucleotide are featured in the present invention. In one embodiment, the connexin antisense oligonucleotides or polynucleotides may comprise at least one modified nucleotide and / or may have at least one modified internucleoside bond and / or at least one modified sugar moiety. The modified internucleoside bond may be, for example, a phosphorothioate bond. In some embodiments, for example, the connexin 43 polynucleotide may comprise at least one nucleotide that comprises a conformationally strained nucleotide, for example, a locked nucleic acid (LNA) or a bridged nucleic acid (BNA). The locked nucleotide may be selected from one of the following types, for example: 2'-O-CH2-4' (oxy-LNA), 2'-CH2-CH2-4' (methylene-LNA), 2'-NH-CH2-4' (amino-LNA), 2'-N(CH3)-CH2-4' (methylamino-LNA), 2'-S-CH2-4' (thio-LNA), and 2'-Se-CH2-4' (seleno-LNA). In some aspects, the modified nucleotide may be a locked or unlocked nucleic acid. In some embodiments, the connexin antisense oligonucleotide or polynucleotide is, for example, a connexin 43 antisense oligonucleotide or polynucleotide, or a connexin 45 antisense oligonucleotide or polynucleotide, preferably a connexin 43 antisense oligonucleotide or polynucleotide. In some embodiments, the connexin antisense oligonucleotide or polynucleotide is a modulator of, for example, Cx26, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessel.

[0247] Also featured herein are exemplary modified or unmodified connexin 43 antisense compounds that include a nucleotide sequence or are modified from a nucleotide sequence selected from SEQ ID NOs: 1-16 and / or that may be included or excluded from the disclosed methods, compositions, kits, and articles of manufacture. Polynucleotides of the invention include synthetic polynucleotides having less than 80 nucleotides in length, e.g., 12-18 to about 50-80 nucleotides in length, preferably about 30 nucleotides in length or less, e.g., 12 to about 30 nucleotides in length, more preferably about 15 to about 30 nucleotides in length. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the methods of the invention feature the use of connexin 43 antisense compounds up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, that include a nucleotide sequence selected from SEQ ID NOs: 1-17 or that include about 8-40 nucleotides of SEQ ID NO: 17. [Table 1] TIFF2025038085000025.tif50160

[0248] Table 1 lists polynucleotide sequences of exemplary connexin 43 polynucleotide modulating agents. When sequences such as SEQ ID NOs: 1-16 are provided, they represent both modified and unmodified oligonucleotides or polynucleotides. In some embodiments, the linkage between the nucleotides and the structure of the sugar portion of the nucleotide may be modified. In some embodiments, the internucleoside linkage between any two nucleotides may be a standard phosphodiester linkage. In some embodiments, the internucleoside linkage between any two nucleotides may be a phosphorothioate linkage. For example, SEQ ID NO: 1 contains the following selected structure: G s T s A s A s TTGCGGCAAGAAGAATTGTTTC s T s G s T sC, wherein " s " is between two nucleotides As another non-limiting example, SEQ ID NO:1 can be (G)(T)(A)(A)TTGCGGCAAGAAGAATTGTTTC(T)(G)(T)(C), where the inserted nucleotide has a modified sugar moiety, as described below.

[0249] Exemplary sequences are shown in Table 2 and are useful in the treatment of ocular diseases, disorders, and conditions that are characterized by undesirable ZO-1 protein or ZO-1 protein activity or that would benefit from reduced ZO-1 protein or ZO-1 protein activity. [Table 2] TIFF2025038085000027.tif54156

[0250] Table 2 lists the polynucleotide sequences of ZO-1 AS ODNs (antisense oligodeoxyribonucleotides), shRNAs (small hairpin RNA molecules), and siRNAs (small interfering RNA molecules).

[0251] ZO-1 was initially identified in tight junctions, which form an intracellular network. These structures are present only at the intersection between two cells in the cell-cell contact zone. ZO-1 is a 220-kDa membrane protein that colocalizes with the transmembrane proteins claudins and occludin. Later, ZO-1 was shown and identified in adherens junctions, which clamp cells together and thereby maintain cell and tissue polarity. These junctions also anchor the cytoskeleton and allow the formation of large complexes of the plasma membrane.

[0252] One sequence selected for synthesis of an antisense polynucleotide targeting ZO-1, 5'-CTGCTTTCTGTTGAGAGGCT-3' (SEQ ID NO: 325), corresponds to a segment from base pairs 3154 to 3169 of MUSZO1 accession number D14340I.

[0253] In some embodiments, connexin 43 antisense compounds include polynucleotides and oligonucleotides directed to at least about 8 nucleobases of a nucleic acid molecule encoding a connexin having a nucleobase sequence selected from SEQ ID NO: 17, e.g., connexin 43 antisense compounds. The antisense compounds may have about 8 to about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, or about 80 nucleotides of SEQ ID NO: 17, or a sequence complementary thereto, and / or the antisense polynucleotide or oligonucleotide may include any range of lengths between any two of the lengths listed. Polynucleotides of the present invention include synthetic polynucleotides having less than 80 nucleotides in length, e.g., 12-18 to about 50-80 nucleotides in length, preferably about 30 nucleotides in length or less, e.g., 12 to about 30 nucleotides in length, more preferably about 15 to about 30 nucleotides in length. In one example, the polynucleotide has 30 nucleotides. In some embodiments, the methods of the invention feature the use of connexin 43 antisense compounds up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, comprising a nucleotide sequence selected from SEQ ID NOs: 1-17. In some embodiments, the methods of the invention feature the use of connexin 43 antisense compounds up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, comprising a nucleotide sequence selected from SEQ ID NOs: 4-17.

[0254] Human Cx43, alpha 1 (SEQ ID NO: 17) locus NM_000165 3088b p mRNA linear PRI 26-OCT-2004 Definition Homo sapiens gap junction protein, alpha 1, 43 kDa (connexin 43) (GJA1), mRNA. Sequence Listing 9-1 [ka] Sequence Listing 9-2 [ka]

[0255] In some embodiments, the sugar moiety can be a modified sugar moiety. In some embodiments, the modified sugar moiety can be a sugar moiety that is a conformationally strained sugar. In some embodiments, the conformationally strained sugar can be a locked nucleotide (locked nucleic acid, or LNA). In some embodiments, a locked nucleotide is a 2'-O-CH 2 -4′(oxy-LNA), 2′-CH 2 -CH 2 -4′ (methylene-LNA), 2′-NH-CH 2 -4′(amino-LNA), 2′-N(CH 3 )-CH 2 -4′(methylamino-LNA), 2′-S-CH 2 -4′ (thio-LNA), and 2′-Se-CH 2 -4' (seleno-LNA). In some embodiments, the conformationally strained sugar may be a bridged nucleic acid (BNA).

[0256] As shown in formula III, the conformationally strained sugar may be a locked nucleic acid. In some embodiments, the sugar moiety of the nucleoside compound may be ribofuranose. Thus, a particularly preferred substituent X is oxygen. However, it is contemplated that a variety of other alternative sugar moieties are also suitable, and in general, modified sugars and carbocyclic moieties are also considered suitable for use herein. Thus, X may also include atoms or groups other than oxygen, and particularly contemplated alternative groups X include S, where the sugar is a sulfur sugar, CH, where the sugar is a carbocyclic compound, and CH, where the sugar is a cyclic compound. 2 , C=O, C=CH 2, or a covalent bond, and NR where R is an amino sugar, where R is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, and acyl. The groups Y and Z can also vary. In some embodiments, the substituents Y and Z are O, S, CH 2 , NR, C=O, C=CH 2 or a covalent bond, where R is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, and acyl. In some embodiments, Q is none, O, S, NHR, or CH 2 where R is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, and acyl. [ka]

[0257] In some embodiments, B can be a base selected from one of the following types of bases: substituted and unsubstituted deazapurines, azapurines, deazapyrimidines, purines, pyrimidines, and azapyrimidines. The term "substituted" as used herein refers to the addition of one or more functional groups, with specifically contemplated functional groups including nucleophilic groups (e.g., -NH 2 , -OH, -SH, and -NC), as well as electrophilic groups (e.g., C(O)OR and C(X)OH), polar groups, non-polar groups (e.g., aryl, alkyl, alkenyl, or alkynyl), ionic groups (e.g., -NH 3 + ), and halogens (-F, -Cl, -I, -Br), and all chemically appropriate combinations thereof. In some embodiments, B is selected from one of adenosine, thymine, uracil, guanine, and cytosine.

[0258] The group R 1 , R 2 , and R 3 None, -H, -OH, -OCH 3 , alkyl, and especially methyl, -O-acyl, -N3 , -CN, and halogen. Additionally, when contemplated nucleoside analogs contain a phosphate, phosphonate, or phosphorothioate group, particularly preferred R 1 and / or R 2 Groups are contemplated to include monophosphates, diphosphates, triphosphates, monophosphonates, diphosphonates, triphosphonates, phosphorothioates, amino acid esters with a sugar OH group, or prodrugs of a monophosphate, diphosphate, triphosphate, monophosphonate, diphosphonate, triphosphonate, or phosphorothioate.

[0259] As shown in Formula IV, the structure of the locked nucleic acid can further include Z as oxygen ("O") and Y as CH 2 , and there is no Q, but R 3 There is no. The groups B and R 1 , and R 2 may be selected from the groups mentioned above.

[0260] In some embodiments, with respect to any of the above Markush groups, each group may or may not include any of the species listed for that group. [ka]

[0261] The conformationally strained nucleotide structure may be a bridged nucleic acid (BNA), as shown in formula V. The groups X, Y, Z, R 1 , R 2 , R 3、 and B may be selected from the groups described above. [ka]

[0262] In some embodiments, the connexin 43 modulating agent may comprise a peptide. The peptide sequence may include, for example, one or more of the following sequences: SRPTEKT "Mod3", (SEQ ID NO: 173), "peptide 1" ADCFLSRPTEKT (SEQ ID NO: 291), "peptide 2" VACFLSRPTEKT (SEQ ID NO: 292), "peptide 11" VDCFLSRPTAKT (SEQ ID NO: 293), "peptide 12" VDCFLSRPTEAT (SEQ ID NO: 294), "peptide 5" VDCFLSRPTEKT (SEQ ID NO: 168), "Mod1" CFLSRPTEKT (SEQ ID NO: 171), "Mod2" LSRPTEKT (SEQ ID NO: 172). In some embodiments, the carboxy terminus may be modified. In some aspects, the carboxy terminus modification may include an n-alkyl chain, which may optionally be further linked to hydrogen or other moieties. In some embodiments, the connexin 43 peptide may or may not include any of the peptides listed above or disclosed herein.

[0263] In some embodiments of the invention, the connexin 43 antisense oligonucleotide or polynucleotide has at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to a polynucleotide having a sequence selected from SEQ ID NOs: 1-64.

[0264] Modified or unmodified connexin 45 antisense polynucleotides comprising 8 to about 80 nucleotides of SEQ ID NO: 217, and 8 to about 80 nucleotides of SEQ ID NO: 279. Also featured herein are modified and unmodified pannexin antisense polynucleotides comprising the polynucleotides. Polynucleotides of the invention include synthetic polynucleotides having lengths of less than 80 nucleotides, e.g., 12-18 to about 50-80 nucleotides, preferably less than about 30 nucleotides, e.g., 12 to about 30 nucleotides, more preferably about 15 to about 30 nucleotides. In one example, the polynucleotide has 30 nucleotides. The methods of the invention, in some embodiments, feature the use of connexin 45 antisense compounds comprising up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, e.g., about 8 to about 40 or about 15 to about 40 nucleotides of SEQ ID NO: 217. The methods of the invention, in some embodiments, feature the use of pannexin antisense compounds comprising up to 40 nucleotides in length, e.g., 15-40 nucleotides in length, e.g., about 8 to about 40 or about 15 to about 40 nucleotides of SEQ ID NO: 283-287. In some embodiments, connexin 45 or pannexin antisense compounds may be modified by substituting one or more thymine nucleotides in SEQ ID NO:217, or SEQ ID NOs:283-287, with one or more uridine nucleotide residues.

[0265] Human Cx45, α7 (SEQ ID NO: 217) locus NM_005497 1191 bp mRNA linear PRI 23-DEC-2003 Definition Homo sapiens gap junction protein, alpha 7, 45 kDa (connexin 45) (GJA7), mRNA. Sequence Listing 10 [ka]

[0266] In some embodiments of the invention, a connexin 43 antisense oligonucleotide or polynucleotide has at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to a polynucleotide having a sequence selected from SEQ ID NOs: 1-17. A connexin or pannexin oligonucleotide or polynucleotide may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to an 8-80 nucleotide portion of their respective sequences. For example, a connexin 45 modulating agent that is an oligonucleotide or polynucleotide may have at least about 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to an 8-80 nucleotide portion of SEQ ID NO: 217. While the pannexin modulating agent may have 80%, 85%, 90%, 95%, 97%, 98%, or 99% homology to the pannexin modulating agent, the pannexin modulating agent may be an oligonucleotide or polynucleotide having a sequence similar to SEQ ID NO:283 (Panx1 polynucleotide), (Panx1 polynucleotide RefSeq No. NM_015368.3), SEQ ID NO:284 (Panx2 polynucleotide), (for variant 1, Panx2 polynucleotide RefSeq No. NM_052839.3), SEQ ID NO:285 (Panx2 polynucleotide). In the case of Panx2 polynucleotide variant 2, RefSeq No. NM_001160300.1), SEQ ID NO: 286 (for Panx2 polynucleotide variant 3, RefSeq No. NR_027691.1), or an 8 to 80 nucleotide portion of SEQ ID NO: 287 (Panx3 polynucleotide) (Panx3 polynucleotide RefSeq No. NM_052959.2).

[0267] In some embodiments, the pannexin modulating agent may or may not include a pannexin peptide sequence, which may include 8-40 contiguous amino acids, the extracellular domain, the intracellular domain, the carboxy-terminal portion, or the amino-terminal portion of the polypeptide SEQ ID NO:288, Panx1 peptide), SEQ ID NO:289, Panx2 peptide), or SEQ ID NO:290, Panx3 peptide).

[0268] In other embodiments, the connexin modulation agent is a connexin peptide or peptidomimetic, sometimes referred to as an anti-connexin peptide or peptidomimetic, e.g., an anti-connexin hemichannel blocking peptide or peptidomimetic, e.g., a modified or unmodified peptide or peptidomimetic comprising a connexin extracellular domain, a transmembrane region, and a connexin carboxy-terminal peptide. The anti-connexin hemichannel blocking peptide or peptidomimetic may be modified or unmodified. The anti-connexin hemichannel blocking peptide or peptidomimetic is chemically, synthetically produced, or otherwise manufactured. In some embodiments, the connexin modulation agent is a connexin 43 peptide or peptidomimetic. In some aspects, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the extracellular or transmembrane domain of a connexin, such as connexin 43 or connexin 45. In some embodiments, the peptide or peptide mimetic comprises a portion of the extracellular or transmembrane domain of connexin Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessel. In other embodiments, the modulating agent is a pannexin peptide or peptidomimetic, such as a modified or unmodified peptide or peptidomimetic, sometimes referred to as an anti-pannexin peptide or peptidomimetic. In other embodiments, the modulating agent is a pannexin peptide or peptidomimetic, such as a modified or unmodified peptide or peptidomimetic, sometimes referred to as an anti-pannexin pannexin or peptidomimetic. In some embodiments, the connexin modulating agent may or may not include any of the foregoing.

[0269] In some embodiments, the connexin modulating agent of the invention comprises an anti-connexin 43 peptide or peptidomimetic, e.g., any of the peptides described herein, including peptides comprising a portion of the extracellular domain of a connexin, and peptides comprising a portion of the carboxy terminus of a connexin, useful in the methods of the invention that are therapeutically effective, e.g., effective to cure any of the neuropathic eye disorders described herein. In some aspects, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the extracellular domain of a connexin, such as connexin 43 or connexin 45, preferably connexin 43. The protein sequence of connexin 43 is shown below. Connexin 43 (SEQ ID NO: 19) Sequence Listing 11-1 [ka] Sequence Table 11-2 [ka]

[0270] Table 3 shows the extracellular loops of connexin 43 and connexin 45. In some embodiments, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the E2 extracellular domain of a connexin, such as connexin 43 or connexin 45, preferably connexin 43. In some embodiments, the therapeutically effective modified or unmodified peptide or peptidomimetic comprises a portion of the C-terminal domain of a connexin, such as connexin 43 or connexin 45, preferably connexin 43. When the peptide or peptidomimetic modulating agent comprises a portion of the intracellular domain of a connexin, in some embodiments the peptide may complex with a cellular internalization transporter, and in some cases may block zona occludens (ZO-1) binding to connexin 43. [Table 3]

[0271] The sequences of the E2 domains of the different connexin isotypes are shown in Table 4 with amino acids homologous to peptide SEQ ID NO: 35 and peptide SEQ ID NO: 36 shown in bold. Note that the last four amino acids of peptide SEQ ID NO: 36 are part of the fourth membrane domain.

[0272] Table 4 provides the extracellular domains of connexin family members that are used to develop the peptide inhibitors described herein. In certain non-limiting embodiments, peptides and those provided in Table 4, as well as fragments thereof, are used as peptide inhibitors. In other non-limiting embodiments, peptides comprising about 8 to about 15, about 11 to about 13 amino contiguous amino acids of the peptides in this table are peptide inhibitors of the invention. In other embodiments, conservative amino acid changes are made to the peptides or fragments thereof. [Table 4]

[0273] Other peptide sequences known to inhibit inter-connexin junctions that can modulate connexin activity are the cytoplasmic loop of the L2 peptide of connexin 43 (amino acids 119-144) and subparts of the L2 peptide of connexin 43. In some embodiments, these peptides include, for example, the 9 amino acid sequence of Gap19, KQIEIKKFK (SEQ ID NO: 299); the native Gap19 sequence, DGVNVEMHLKQIEIKKFKYGIEEHGK (SEQ ID NO: 300); the His144→Glu L2 derivative of Gap19 reported by Shibayama (Shibayama, J. et al., Biophys. J. 91, 405404063, 2006), DGVNVEMHLKQIEIKKFKYGIEEQGK (SEQ ID NO: 301); the TAT-Gap19 sequence, YGRKKRRQRRRKQIEIKKFK (SEQ ID NO: 302); the SH3 binding domain, CSSPTAPLSPMSPPGYK (SEQ ID NO: 303), or its subpart PTAPLSPMSPP (SEQ ID NO: 304); the C-terminal sequence of the CT9 or CT10 peptide, RPRDDEI (SEQ ID NO: 305), with or without the TAT leader sequence to increase cell penetration. 05), SRPRDDLEI (SEQ ID NO: 307), YGRKKRRQRRRSRPRDDEI (SEQ ID NO: 306), or YGRKKRRQRRRRPRDDEI (SEQ ID NO: 308). Other peptide mimetic sequences that may or may not be included within the compositions, methods, kits, or articles of manufacture disclosed herein include those reported by Dhein (Dhein, S., Naunyn-Schmiedeberg, Arch. Pharm., 350:174-184, 1994); AAP10 peptide, H 2 N-Gly-Ala-Gly-4Hyp-Pro Tyr-CONH 2 (SEQ ID NO: 309), and ZP123 peptide (rotigapeptide), Ac-D-Tyr-Pro-D-4Hyp-Gly-D-Ala-Gly-NH 2(SEQ ID NO: 310), (Dhein, S., et al. Cell Commun. Adhes. 10, 371-378, 2013). Rotigapeptides contain D-peptides to improve efficacy over the natural L-peptides.

[0274] Examples of anti-pannexin agents are anti-pannexin polynucleotides, including anti-pannexin antisense oligodeoxynucleotides ("ODN") described below. Examples of anti-pannexin polynucleotides include antisense (including modified and unmodified backbone antisense), RNAi, and anti-pannexin oligodeoxynucleotides, including miRNA and siRNA. Suitable anti-pannexin peptides include, for example, peptides that bind the pannexin extracellular domain or the pannexin intracellular domain. Suitable anti-pannexin agents include, for example, antisense ODNs, peptides, and peptidomimetics against Panx1. Peptides or peptidomimetics include anti-pannexin peptides or peptidomimetics, such as pannexin complex blocking peptides (e.g., anti-pannexin antibodies and antibody binding fragments) or peptidomimetics (e.g., peptidomimetics directed to one or more extracellular or intracellular regions of pannexin). Peptidomimetics may be conjugated to one or more other agents, such as antennapedia, to facilitate membrane trafficking for binding of intracellular pannexin regions and domains.

[0275] The terms "peptide", "peptidomimetic" and "mimetics" include synthetic or genetically engineered chemical compounds that may have substantially the same structural and functional properties of the protein regions they mimic. In the case of connexins, they may, for example, mimic the extracellular loops of antagonistic connexins involved in interconnexon docking and intercellular channel formation, and / or the extracellular loops of hemichannel connexins.

[0276] As used herein, the term "peptide analog" refers to a compound that has properties similar to those of a template peptide and may be a non-peptide drug. "Peptidomimetics," including peptides and peptide-based compounds (also known as peptidomimetics), also include such non-peptide-based compounds, such as peptide analogs. Peptidomimetics that are structurally similar to therapeutically useful peptides can be used to produce the same or improved therapeutic or prophylactic effect. In some embodiments, peptides and peptidomimetics may be modified or unmodified. In general, peptidomimetics are structural or functional mimics (e.g., identical or similar) to a paradigm polypeptide (i.e., a polypeptide that has a biological or pharmacological function or activity), but may optionally include a structural or functional mimic ... such as, for example, -CH 2 NH-, -CH 2 S-, -CH 2 -CH 2 -, -CH=CH- (cis and trans), -COCH 2 -, -CH(OH)CH 2 - and -CH 2 The mimetics may also have one or more peptide bonds replaced by a bond selected from the group consisting of SO-. The mimetics can be either entirely composed of natural amino acids, synthetic chemical compounds, non-natural analogues of amino acids, or are chimeric molecules of partial natural peptide amino acids and partial non-natural analogues of amino acids. The mimetics may also contain any amount of conservative substitutions of natural amino acids, so long as such substitutions also do not substantially alter the mimetic activity. In the case of connexins, they may mimic, for example, the extracellular loops of antagonistic connexins involved in interconnexon docking and intercellular channel formation. For example, mimetic compositions may be useful as gap junction modulating agents if they can downregulate a biological effect or activity of a connexon, such as, for example, preventing the docking of a connexon to form gap junction-mediated intercellular communication, or preventing the opening of a connexon to expose the cytoplasm to the extracellular environment. Peptide mimetics include those described herein and those that may be known in the art, whether currently known or later developed. Peptide and peptidomimetic connexin modulating agents may also be modified to increase stability, improve bioavailability, and / or increase cell membrane permeability.

[0277] In some aspects of the invention, the connexin modulating agent is a peptide or peptide mimetic. Exemplary connexin 43 (Cx43), or Cx26, Cx30, Cx30.3, Cx31, Cx31.1, Cx32, Cx36, Cx37, Cx40.1, Cx43, Cx46, Cx46.6, or Cx40 peptide modulating agents that may or may not be included in certain embodiments of the present disclosure are provided in Table 64 below (E2 and T2 refer to the location of the peptide, e.g., in the second extracellular domain or the second transmembrane domain). [Table 5] TIFF2025038085000039.tif226164TIFF2025038085000040.tif222156TIFF2025038085000041.tif221153TIFF2025038085000042.tif74155

[0278] In some embodiments, the connexin 43 modulating agent may include, for example, a peptide or peptide mimetic including, for example, SEQ ID NO: 173 (SRPTEKT). The peptide or peptide mimetic may also include, for example, SEQ ID NO: 168 (VDCFLSRPTEKT). The peptide may include one or more modified amino acids, amino acid analogs, or may otherwise be modified to improve bioavailability or increase permeability across a cell membrane. For example, SEQ ID NO: 168 may be modified to obtain SEQ ID NOs: 300-306. In some embodiments, the peptide or peptide mimetic including, for example, SEQ ID NO: 173 (SRPTEKT) or SEQ ID NO: 168 (VDCFLSRPTEKT) includes 7-40 amino acids or amino acid analogs and does not include a C-terminal peptide. In some embodiments, the peptide may be used as a promoiety.

[0279] In some embodiments, a connexin 45 modulating agent may be a peptide or peptidomimetic that includes a portion of the connexin 45 protein that antagonizes or inhibits or blocks interactions between connexins. Exemplary peptide sequences for connexin 45 peptide and peptidomimetic modulating agents are provided in Table 63. [Table 6] TIFF2025038085000044.tif217158

[0280] In some embodiments, a connexin 45 modulating agent may include a peptide or peptidomimetic comprising a portion of the E2 or C-terminal domain of connexin 45, including, for example, SEQ ID NO: 280 (SRPTEKT). A peptide or peptidomimetic may also include, for example, SEQ ID NO: 279 (DCFISRPTEKT). In some embodiments, a peptide is SRL, PCH, LCP, CHP, IYY, SKF, QPC, V It may be as little as three amino acids long, including CY, APL, HVR or more.

[0281] In some embodiments, a connexin 40 modulating agent may be a peptide or peptidomimetic that includes a portion of the connexin 40 protein that antagonizes or inhibits or blocks interactions between connexins.

[0282] Peptide Chemical Modification In certain embodiments, the connexin 43 modulator peptides of the present invention may be linked to an internalization transporter at the amino or carboxy terminus. The internalization transporter linked to the connexin 43 modulator peptides of the present invention may be any internalization sequence known or newly discovered in the art, or a conservative variant thereof. Non-limiting examples of internalization transporters and sequences include antennapedia sequence, TAT, HIV-Tat, penetratin, Antp-3A (Antp variant), bufonin II, transportan, MAP (model amphipathic peptide), K-FGF, Ku70, prion, pVEC, Pep-1, SynB1, Pep-7, HN-1, BGSC (bis-guanidinium-spermidine-cholesterol, and BGTC (bisguanidinium-tren-cholesterol).

[0283] Exemplary internalization peptide sequences are provided in Table 65 below. [Table 7] TIFF2025038085000046.tif57156

[0284] Table 65 lists exemplary internalization transporter sequences.

[0285] In some embodiments, connexin, pannexin and / or pannexin modulator peptides are fused to a transport peptide to increase penetration into target cells. In some embodiments, the transport peptide can be part of a viral coating for cell penetration. In some embodiments, the transport peptide can be fused to the carboxy terminus or or fused at the amino terminus to a connexin and / or pannexin modulator peptide. The transport peptide may be selected from one of the following peptides: ANTP, HIV-TAT, transportan, bufonin II, Tat, penetratin, MAP, K-FGF, Ku70, prion, pVEC, Pep-1, SynB1, Pep-7, RGD, or HN-1. In some embodiments, the connexin, pannexin, and / or pannexin modulator peptide may or may not include any of the foregoing.

[0286] In one embodiment of the invention, the amino acid sequence of the connexin 43 modulator peptide may be selected from the group consisting of any peptide SEQ ID NO: listed herein, or conservative variants thereof. In a further embodiment of the invention, the connexin 43 modulator peptide may comprise the amino acid sequence of SEQ ID NO: 140-200. In another embodiment of the invention, the connexin 43 modulator peptide further comprises an internalization transporter. In a further embodiment, the connexin 43 modulator peptide may be bound to the internalization transporter at the amino terminus.

[0287] When a specific protein is referred to herein, derivatives, variants, and fragments are contemplated. Protein derivatives and variants are well understood by those of skill in the art and may involve modifications of the amino acid sequence. For example, amino acid sequence modifications may fall into one or more of three classes: insertion variants, substitution variants, or deletion variants. Insertions include amino and / or carboxyl terminal fusions, as well as intrasequence insertions of single or multiple amino acid residues. Insertions may be smaller than the insertion of an amino or carboxyl terminal fusion, such as, for example, one to four residues. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence(s). Substitutions, deletions, insertions, or any combination thereof may be combined to arrive at a final construct. Substitution variants are those in which at least one residue has been removed and a different residue has been inserted in its place. Such substitutions are referred to as conservative substitutions. The replacement of one amino acid residue with another that is biologically and / or chemically similar is known to those skilled in the art as a conservative substitution. A conservative substitution may replace one hydrophobic residue with another, or one polar residue with another. Conservative substitution variants of each explicitly disclosed sequence are included within the peptides provided herein. Conservative substitutions typically have little effect on the biological activity of the resulting polypeptide. Conservative substitutions may be amino acid substitutions within a peptide that do not substantially affect the biological function of the peptide. A peptide may contain one or more amino acid substitutions, 2-10 conservative substitutions, 2-5 conservative substitutions, or 4-9 conservative substitutions.

[0288] Chemical structure modification In certain embodiments, the chemical structure of the peptide or peptidomimetic may be synthetically modified to increase the transgenic uptake of the peptide. In some embodiments, for example, the peptide or peptidomimetic may be modified by conjugating the peptide to a hydrophobic compound through a linker moiety. The hydrophobic compound may be, for example, one or more n-alkyl groups, which may be, for example, C6-C14 alkyl groups. In some embodiments, the peptide may be conjugated to one or two dodecyl (C12) groups at the N-terminus, as described in Chen, YS et al., J.Pharm. Sci., 102:2322-2331 (2013), which is incorporated herein by reference. In one embodiment, the peptide sequence CFLSRPTEKT or VD CFLSRPTEKT can be conjugated with two dodecyl groups to produce a modified peptide capable of modulating connexin 43, "C12-C12-Cxn43 MP" (SEQ ID NO: 326). The resulting structure is shown in FIG. [ka] Figure 80. Structure of C12-C12-Cxn43 MP (SEQ ID NO: 326). 1 and R 2 may be hydrogen or an alkyl group. In some embodiments, R 1 =R 2 = n-dodecyl chain.

[0289] Anti-connexin modulator drugs In some embodiments, the gap junction modulation agent may be a small molecule that is an anti-connexin modulation agent drug. In some aspects, the anti-connexin modulation agent drug may have the structure of Formula I described herein.

[0290] Pannexins, Pannexin Channel Modulating Agents, and Other Gap Junction Modulating Agents Alternatively or in addition to connexin modulating agents or pannexin modulating agents, modulating agents including pannexin and pannexin channel modulating agents, as well as gap junction modulating agents or connexin modulating agent drugs, that may be used in any of the compositions, kits, and methods described herein, are also useful in the methods of the invention.

[0291] The modulating agents of the invention for any of the uses featured herein may also include gap junction modulating agents that may inhibit or block Cx26, Cx31.1, Cx36, Cx37, Cx40, Cx50, Cx57, or any other connexin in the eye or blood vessel. The pharmaceutical compositions of the invention for any of the uses featured herein may also include pannexin modulating agents that may inhibit or block pannexin channels, for example.

[0292] Gap junction modulating agents include connexin modulating agents and gap junction drugs. Thus, a connexin modulating agent is not necessarily a gap junction drug modulating agent, and not all gap junction drug modulating agents are connexin modulating agents. Tonabersat, carabersat, and the compounds of formula I are connexin modulating agents.

[0293] Gap junction drugs can be, for example, mycotoxins, glycyrrhetinic acid and glycyrrhetinic acid derivatives, phorbol esters, DDT, triphenylmethane, triphenylethane, long chain alcohols, anesthetics, fatty acid amides, fenamic acids, quinine and quinine derivatives, 2-APB and 2-APB derivatives, polyamines, cyclodextrins, and peptides not discussed above.

[0294] In some embodiments, the gap junction drug is carbamazepine, octanol, bisphenol-A, heptanol, 4-(2-butyl-6,7-dichloro-2-cyclopentyl-indan-1-on-5-yl) oxobutyric acid (DCPIB), carabelsat, genistein, trans-resveratrol, carbenoxolone, the HMG-CoA reductase inhibitor lovastatin, rotigaptide, metoprolol, forskolin, egenin, tangeritin, halothane, ochratoxin A mycotoxin, patulin mycotoxin, okadaic acid, 18-alpha- and 18-beta-glycyrrhetinic acid, 17-beta-etanoside, 18-alpha- and 18-beta-glycyrrhetinic acid, 17-beta-etanoside, 18-alpha- and 18-beta-etanoside, 17 ... Stradiol methyl ester, testosterone methyl ester, 12-O-tetradecanoylphorbol-13-acetate (TPA), phorbol esters, 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane, triphenylmethane, tris(4-chlorophenyl)methanol, (2-chlorophenyl)(diphenyl)methane, triphenylmethyl chloride, sodium tetraphenylborate, tamoxifen, clomiphene, enflurane, oleamide, anandamide, aryl aminobenzoates such as meclofenamic acid and flufenamic acid, niflumic acid, 5-nitro-2-(3-phenylpropionyl)propionate ... The peptide may be selected from one of the following: phenylpropylmino benzoate (NPPB), quinine, quinidine, mefloquine, PQ1 (the primaquine derivative of mefloquine), 2-aminophenoxyborate (2-APB), spermidine, spermine, cyclodextrin containing six, seven, or eight glycopyranose units, Gap26 peptide (Val-Cys-Tyr-Asp-Lys-Ser-Phe-Pro-Ile-Ser-His-Val-Arg), and Gap27 peptide (Ser-Arg-Pro-Thr-Glu-Lys-Thr-Ile-Phe-Ile-Ile).

[0295] Any antisense molecule or shRNA that targets a suitable region to disrupt pannexin expression is useful in the practice of the present invention.In some embodiments, the present invention features RNA interference (RNAi) to pannexin.Like the expression of many other genes, pannexin expression can be knocked down in vivo or in vitro by using RNAi.A representative class of molecules that can be used for RNAi is short hairpin RNA (shRNA).One such anti-pannexin shRNA molecule can be constructed as follows, using a vector called pSuper-Ncad:

[0296] Antisense and short hairpin RNAs targeting human pannexins include those that target specific sequences. Any antisense molecule or shRNA that targets a suitable region to disrupt pannexin expression, for example, the expression of Panx1 or Panx2 or Panx3, is useful in the practice of the present invention. In some embodiments, the present invention features RNA interference (RNAi) to Panx1 or Panx2 or Panx3. As with the expression of many other genes, Panx1 or Panx2 or Panx3 expression can be knocked down in vivo or in vitro by using RNAi. A representative class of molecules that can be used for RNAi is short hairpin RNA (shRNA). Inhibitors of Panx1 can include probenecid, mefloquine, and carbenoxolone, or antipeptides.

[0297] Chemical Delivery Modification The modulators, including the gap junction, connexin, and / or pannexin and pannexin channel modulators of the present invention, may also be formulated in microparticle (microsphere, Mps) or nanoparticle (nanosphere, Nps) formulations, or both. Particulate ocular drug delivery systems include nanoparticles (1-1,000 nm) and microparticles (1-1,000 μm), which are further classified as nanospheres and microspheres, and nanocapsules and microcapsules. In nanocapsules and microcapsules, drug particles or droplets are encapsulated within a polymer membrane. Particulate systems have the advantage of intraocular delivery by injection, and their size and polymer composition clearly affect their biological behavior in vivo. Microspheres can remain in the vitreous for a much longer period of time than nanospheres, and thus microparticles act like a reservoir after intravitreous injection. Nanoparticles rapidly diffuse and are internalized into ocular tissues and cells in the anterior and posterior segments of the eye.

[0298] The pharmaceutical compositions may be in the form of a combined preparation for co-administration, e.g., two or more modulating agents, e.g., gap junction, connexin, and / or pannexin modulating agents, which may or may not be modified, or pannexin channel modulating agents, e.g., one or more Also provided are mixtures of one or more gap junction, connexin and / or pannexin modulating agent, or pannexin channel modulating agent polynucleotides with one or more gap junction, connexin and / or pannexin modulating agent, or pannexin channel modulating agent peptides or peptidomimetics.

[0299] The term "combined preparation" includes a "kit of parts" or "article of manufacture" in the sense that the combination partners defined above, whether in pharmaceutical form or in the form of a dressing / matrix, or both, may be administered independently or by use of different predefined combinations with different amounts of combination partners (a) and (b), i.e. simultaneously, separately or sequentially. The kit of parts may then, for example, be administered simultaneously or chronologically staggered at different time points and with equal or different time intervals for any part of the kit of parts.

[0300] In one embodiment, a combined preparation is administered and two or more separate modulating agent compositions are administered to a subject, a first composition comprising a therapeutically effective amount of a modulating agent, such as a gap junction, connexin, and / or pannexin modulating agent, e.g., an anti-connexin 43 polynucleotide, peptide, or peptidomimetic, or a hemichannel closing compound, and a second composition comprising a therapeutically effective amount of a second modulating agent, such as a gap junction, connexin, and / or pannexin modulating agent, or an ocular therapeutic, e.g., an anti-connexin 43 polynucleotide, peptide, or peptidomimetic, a hemichannel closing compound, and / or an ocular therapeutic. In another embodiment, a third composition comprising one or more anti-connexin polynucleotides, peptides, or peptidomimetics, hemichannel closing compounds, and / or ocular therapeutics is administered.

[0301] The pharmaceutical compositions are provided for single, combined, simultaneous, separate, sequential, or sustained administration. In one embodiment, a composition comprising one or more gap junction, connexin, and / or pannexin modulating agent polynucleotides is administered one or more times at a desired dosage within or more than one time. In another embodiment, a composition comprising one or more gap junction, connexin, and / or pannexin modulating agents is administered at about the same time as one or more peptide or peptidomimetic gap junction, connexin, and / or pannexin modulating agents. When the two compositions are administered at different times, they may be administered within, for example, 30 minutes, an hour, a day, a week, or a month, or any time interval between any two of the recited periods. In one embodiment, for example, a composition comprising one or more anti-connexin polynucleotides is administered at about the same time as one or more anti-connexin peptides or peptidomimetics. In one embodiment, a composition comprising one or more gap junction, connexin, and / or pannexin modulating agent polynucleotides is administered within at least about 30 minutes of one or more gap junction, connexin, and / or pannexin modulating agent peptides. In one embodiment, a composition comprising one or more gap junction, connexin, and / or pannexin modulating agent polynucleotides is administered within at least 1 hour of one or more gap junction, connexin, and / or pannexin modulating agent peptides or peptidomimetics. In one embodiment, a composition comprising one or more gap junction, connexin, and / or pannexin modulating agent polynucleotides is administered within at least 12 hours of one or more gap junction, connexin, and / or pannexin modulating agent peptides or peptidomimetics. In one embodiment, a composition comprising one or more gap junction, connexin, and / or pannexin modulating agent polynucleotides is administered within at least 24 hours of one or more gap junction, connexin, and / or pannexin modulating agent peptides or peptidomimetics.In another embodiment, the anti-connexin polynucleotide and the gap junction, connexin, and / or pannexin modulating agent peptide or peptidomimetic are administered within about one hour of each other, within about one day of each other, or within about one week of each other. , and / or pannexin modulating agent polynucleotides, and / or one or more anti-connexin peptides or peptidomimetics (e.g., anti-connexin peptides or peptidomimetics including connexin extracellular and / or connexin carboxy-terminal peptides useful for wound healing), and one or more gap junction closing compounds useful for wound healing, one or more hemichannel closing compounds useful for wound healing, and / or one or more connexin carboxy-terminal polypeptides useful for wound healing. Modulating agent dosages may be administered once a day, twice a day, three times a day, four times a day, or once a week, e.g., four times a week, twice a week, once a week. They may also be administered during PRN and before sleep.

[0302] Dosage Forms and Formulations and Administration Unless expressly stated otherwise, all discussions regarding dosing apply to the modulating agents of the present invention, including gap junction modulating agents, pannexin channel modulating agents, connexin modulating agents and pannexin modulating agents.

[0303] Modulating agents, including hemichannel, gap junction and / or pannexin modulating agents of the present invention may be dosed, administered or formulated as described herein.

[0304] Modulating agents, including hemichannel, gap junction, and / or pannexin modulating agents of the present invention, may be administered to a subject having an ocular neuropathy and in need of treatment. Thus, in accordance with the present invention, formulations are provided in which pannexins and / or connexins, such as connexin 43 or connexin 45, may be modulated and / or intercellular communication may be downregulated in a temporal and site-specific manner.

[0305] The modulating agents, including gap junction, connexin, and / or pannexin and pannexin channel modulating agents, may be present in the formulation in substantially isolated form. It will be understood that the product may be mixed with carriers or diluents that do not interfere with the intended purpose of the product and still be considered to be substantially isolated. The product of the invention may be in substantially purified form, where the product generally comprises about 80%, 85%, or 90%, e.g., at least about 88%, at least about 90, 95, or 98%, or at least about 99%, e.g., of the polynucleotide (or other connexin modulating agent, such as a connexin 43 modulating agent) or dry weight of the preparation.

[0306] In one embodiment, the gap junction, connexin, and / or modulating agent is a modified or unmodified connexin 43 or 45 antisense polynucleotide or oligonucleotide, a modified or unmodified connexin peptide, or an anti-connexin 43 or 45 peptide mimetic. In some embodiments, the connexin modulating agent may block or reduce hemichannel opening. In some embodiments, the modified or unmodified connexin peptide or peptide mimetic is administered to provide a modulating effect of blocking hemichannel or gap junction function and / or reducing connexin expression or formation of hemichannels or gap junctions, for example, by downregulation of connexin protein expression. In some embodiments, the modified or unmodified connexin peptide or peptide mimetic is administered prior to administration of a modified or unmodified anti-connexin polynucleotide or oligonucleotide to block hemichannel or gap junction function prior to downregulation of connexin protein expression by the polynucleotide or oligonucleotide. In some embodiments, the connexin modulating agent is a connexin 43 modulating agent.

[0307] The pharmaceutical formulations of the present invention may further comprise one or more pharma- ceutically acceptable excipients suitable for delivering modulating agents, including gap junctions, connexins, and / or pannexins, and pannexin channel modulating agents, to the eye. In some embodiments, a pannexin modulating agent, or a connexin modulating agent (e.g., a connexin 43 modulating agent or a connexin 44 modulating agent) is administered to the eye of a subject. Administration of a connexin 45 modulating agent, preferably a connexin 43 modulating agent, provides a therapeutically effective amount of the connexin modulating agent or pannexin modulating agent to the eye or a particular compartment of the eye. In some cases, the gap junction, connexin and / or pannexin modulating agent may be administered topically, corneal, intravitreal, subconjunctival, or periocular administration. In some embodiments, administration may be intraperitoneal or parenteral, provided that a therapeutically effective amount contacts the eye. In some embodiments of the methods of the invention, the gap junction, connexin and / or pannexin modulating agent may be administered to the eye by injection, for example, by intraocular injection, intravitreal injection, or by periocular routes of administration including subconjunctival, retrobulbar, periocular, and posterior subtenon injection. In some embodiments, the gap junction, connexin and / or pannexin modulating agent may be provided to the trabecular meshwork or may be injected directly into or around the trabecular meshwork. In some aspects, subconjunctival administration can provide sustained delivery while minimizing dosing frequency. In some embodiments, subconjunctival administration can increase the bioavailability of hydrophilic drugs since they do not need to penetrate the conjunctival epithelium. In some embodiments, microneedles, needles, iontophoretic devices or implants can be used for administration of connexin modulating agents or pannexin modulating agents. The implants can be dissolvable disk materials such as those described in, for example, S. Pflugfelder et al., ACS Nano, 9(2), pp1749-1758 (2015). Modulating agents, for example, gap junction, connexin, and / or pannexin modulating agents or pannexin channel modulating agents of the present invention, can also be administered to or around the trabecular meshwork or ciliary body such that the gap junction, connexin, and / or pannexin modulating agent or pannexin channel modulating agent contacts the trabecular meshwork and / or ciliary body, respectively. The modulating agent, e.g., a gap junction, connexin, and / or pannexin and / or pannexin channel modulating agent, may be administered once, twice or more. The connexin modulating agent may, for example, be a connexin 43 modulating agent or a connexin 45 modulating agent, preferably a connexin 43 modulating agent.In some embodiments, microneedles may be used to deliver any of the compositions of the present invention to the choroid.

[0308] For example, in some embodiments, a modulating agent, such as a connexin 43 modulating agent, may be administered to a subject, e.g., the eye of a subject, to provide a therapeutically effective amount of the modulating agent to the eye or a particular compartment of the eye. In some cases, the modulating agent, e.g., connexin 43 or pannexin 1 or pannexin 1 channel modulating agent, may be administered by topical, corneal, intravitreal, subconjunctival, or periocular administration. In some embodiments, administration may be intraperitoneal. In some embodiments, a microneedle, needle, iontophoretic device, or implant may be used for administration of the modulating agent, e.g., a connexin 43 modulating agent. The modulating agent, e.g., a connexin 43 modulating agent of the present invention, may also be administered to the trabecular meshwork or ciliary body. In some embodiments, the modulating agent, e.g., a connexin 43 modulating agent of the present invention, may be administered via intracerebroventricular and / or intrathecal and / or epidural and / or subdural and / or epidural routes.

[0309] Modulating agents, e.g., gap junction channel modulating agents such as peptide 5 and / or analogs or prodrugs thereof, compounds of formula I, e.g., tonabersat, and analogs or prodrugs of any of the foregoing compounds, and / or pannexin modulating agents or pannexin channel modulating agents, e.g., compounds of formula VI, e.g., probenecid and analogs or prodrugs thereof, and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10Panx1 or analogs or prodrugs thereof, may be administered alone or in combination with one or more additional ingredients and may be formulated into pharmaceutical compositions comprising one or more pharma- ceutically acceptable excipients, diluents, and / or carriers.

[0310] "Pharmaceutically acceptable diluents, carriers, and / or excipients" refers to compounds of formula I, e.g., It is intended to include substances useful in the preparation of pharmaceutical compositions that allow the compounds of formula I, such as tonabersat and any analogs of the aforementioned compounds, to perform their intended function while being co-administered with tonabersat and any analogs of the aforementioned compounds, and are generally safe, non-toxic, and neither biological nor undesirable pharmaceutical compositions. Pharmaceutically acceptable diluents, carriers, and / or excipients include those suitable for veterinary and human pharmaceutical use. Suitable carriers and / or excipients will be readily recognized by those skilled in the art, taking into account the properties of the compounds of formula I, such as tonabersat and any analogs of the aforementioned compounds. However, by way of example, diluents, carriers, and / or excipients include solutions, solvents, dispersion media, retardants, polymeric and lipid agents, emulsions, and the like. By way of further example, suitable liquid carriers, particularly for injectable solutions, include water, saline solutions, dextrose solutions, and the like, with isotonic solutions being preferred for intravenous, intrathecal, and intracisternal administration, and vehicles such as liposomes being particularly suitable for administration of the agent.

[0311] The compositions may take the form of any standard known dosage form, including tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, liquids for injection, gels, creams, transdermal delivery devices (e.g., transdermal patches), inserts such as eye inserts, or any other suitable compositions. Those skilled in the art to which the present invention pertains will readily recognize the most appropriate dosage form, without any undue experimentation, taking into account the condition being treated and the nature of the active agent being used. Gap junction channel modulating agents such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonabersat and analogs of any of the aforementioned compounds, and / or pannexin modulating agents, e.g., probenecid and analogs thereof, and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10 It should be understood that one or more of Panx1 or its analogs may be formulated into a single composition. In certain embodiments, preferred dosage forms include injectable solutions and oral formulations.

[0312] The compositions of the invention may be used in combination with a modulator, e.g., a gap junction channel modulator such as peptide 5 and / or analogs thereof, a compound of formula I, e.g., tonabersat and analogs of any of the foregoing compounds, and / or a pannexin modulator, e.g., probenecid and analogs thereof, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 Any suitable level of Panx1 or analogs thereof may be contained. However, by way of example, the compositions for use in the present invention may contain from about 0.1% to about 99% by weight, preferably from about 1% to about 60% by weight, of a compound of formula I, such as tonabersat and analogs of any of the foregoing compounds, depending on the method of administration.

[0313] In addition to standard diluents, carriers, and / or excipients, compositions according to the invention may contain, for example, a gap junction channel modulating agent, such as peptide 5 and / or analogs thereof, a compound of formula I, such as tonabersat and analogs of any of the foregoing compounds, and / or a pannexin modulating agent, such as probenecid and analogs thereof, and / or a synthetic mimetic peptide blocker of pannexin 1, such as 10 Panx1 or its analogue may be formulated with or in such a manner as to improve its activity or bioavailability, protect its integrity, or help extend its half-life or shelf life, allow slow release after administration to a subject, or provide other desirable advantages.For example, slow release vehicles include macromers, poly(ethylene glycol), hyaluronic acid, poly(vinylpyrrolidone), or hydrogels.As further examples, the composition may also include preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavorings, coating agents, buffers, etc.Those skilled in the art to which the present invention pertains will easily identify additional additives that may be desirable for a particular purpose.

[0314] Compounds of formula I, such as tonabersat and analogs of any of the foregoing compounds, may also be administered by sustained release systems. Suitable examples of sustained release compositions include semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained release matrices include polylactides (U.S. Pat. No. 3,773,919; European Patent No. 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamic acid, poly(2-hydroxyethyl methacrylate), ethylene vinyl acetate, or poly-D-(-)-3-hydroxybutyric acid (European Patent No. 133,988). Sustained release compositions also include liposomally encapsulated compounds. Liposomes containing compounds of formula I, such as tonabersat and analogs of any of the aforementioned compounds, may be prepared by known methods, including, for example, those described in German Patent No. 3,218,121, European Patent No. 52,322, European Patent No. 36,676, European Patent No. 88,046, European Patent No. 143,949, European Patent No. 142,641, Japanese Patent Application No. 83-118008, U.S. Patent Nos. 4,485,045 and 4,544,545, and European Patent No. 102,324. Typically, the liposomes are of the small (or about 200-800 angstroms) unilamellar type with lipid content greater than about 30 mole percent cholesterol, with the selected percentage adjusted for the most effective therapy. Slow release delivery, for example, using PGLA nanoparticles or microparticles, or in situ ionically activated gelation systems, may also be used.

[0315] It is further contemplated that pharmaceutical compositions according to the present invention may be formulated with additional active ingredients or agents that may be of therapeutic or other benefit to the subject in a particular case. Those skilled in the art to which the present invention pertains will readily recognize suitable additional active ingredients in light of the description of the invention herein and the nature of the disorder being treated.

[0316] The composition is described, for example, in Gennaro AR: Remington: The Science and Practice of Pharmacy, 20th They may be formulated according to standard techniques that may be found in standard references such as U.S. Pat. No. 6,200,133,621, published by Lippincott, Williams & Wilkins, ed., Lippincott, Williams & Wilkins, 2000. However, as a further example, the information provided in U.S. Pat. No. 2013 / 0281524 or U.S. Pat. No. 5,948,811 may be used.

[0317] In certain embodiments, the present invention provides combination products comprising (a) a compound of formula I, e.g., tonabersat and analogs of any of the foregoing compounds, and (b) one or more additional active agents, wherein components (a) and (b) are adapted for simultaneous or sequential administration.

[0318] In certain embodiments of the invention, the combination product according to the invention is used in a manner such that at least one of the components is administered while the other component still has an effect on the subject being treated.

[0319] Gap junction channel modulating agents such as peptide 5 and / or analogs thereof, compounds of formula I, e.g., tonabersat and analogs of any of the foregoing compounds, and / or pannexin modulating agents, e.g., probenecid and analogs thereof, and / or synthetic mimetic peptide blockers of pannexin 1, e.g., 10 Panx1 or its analog and one or more additional active agents may be formulated in a form suitable for direct administration to a subject (e.g., as an agent or pharmaceutical composition). Alternatively, the combination product may comprise one or more pharmaceutical carrier compositions in one or more separate containers, and the agent(s) are mixed with one or more pharmaceutical carrier compositions before administration.

[0320] The compounds of formula I, e.g., tonabersat and analogs of any of the foregoing compounds, and one or more additional active agents may be contained in the same or one or more different containers and administered separately or may be mixed together in any combination and administered simultaneously.

[0321] The combination product may also include additional agents and compositions in further separate containers as may be necessary for a particular application.

[0322] Any suitable container for storing and / or administering a pharmaceutical composition may be used in the combination product of the present invention. Suitable containers will be understood by those skilled in the art. By way of example, such containers include vials and syringes. The container may be suitably sterilized and sealed.

[0323] Such combination products may be prepared following the methods and guidelines provided herein as well as those known in the art.

[0324] Combination products for use in the methods described herein are also provided.

[0325] The pharmaceutical compositions of the present invention include, for example, ocular delivery forms and formulations. Such delivery forms and formulations include those for the treatment of the subjects disclosed herein. The pharmaceutical formulations of the present invention may further include one or more pharma- ceutically acceptable excipients. The pharma-ceutically acceptable excipients for ocular administration may be ophthalmologically acceptable excipients. In some embodiments, the formulations may provide sustained delivery of the connexin modulating agent and / or ocular therapeutic agent to a selected ocular site or compartment. In some embodiments, the formulations may provide high ocular drug bioavailability, may be safe and non-toxic, and / or may have few systemic side effects or site of administration complications. Exemplary polynucleotide formulations for use in the methods of the present invention have ease of local delivery, ease of administration, and a "no side effects" profile.

[0326] In some embodiments, the pharmaceutical formulations of the invention may include a modulating agent, such as any of the gap junction modulating agents and / or connexin modulating agents described herein, or a pannexin modulating agent, such as a modified or unmodified connexin 43 antisense oligonucleotide or polynucleotide, or a modified or unmodified connexin 43 peptide or peptidomimetic. In some embodiments, the connexin 43 antisense oligonucleotide included in the formulation may be an unmodified connexin 43 antisense oligodeoxynucleotide or a modified connexin 43 antisense oligodeoxynucleotide. In some aspects, the pharmaceutical composition may or may not include any of the foregoing.

[0327] In some embodiments, administration of a modulating agent, e.g., a connexin modulating agent, a pannexin modulating agent, and / or a gap junction modulating agent (e.g., a connexin 43 modulating agent or Cx45, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx45, Cx50, Cx57, or any other connexin in the eye) to the eye of a subject provides a therapeutically effective amount of the connexin modulating agent or pannexin modulating agent to the eye or a particular compartment of the eye. The connexin modulating agent may preferably be a connexin 43 modulating agent. In some cases, the pannexin modulating agent or connexin modulating agent may be administered topically, intravitreal, subconjunctival, or periocularly. In some embodiments, administration may be intraperitoneally or parenterally, provided that a therapeutically effective amount of the dose contacts the eye. In some embodiments of the methods of the invention, the connexin modulating agent or pannexin modulating agent is administered by injection, for example, by intraocular injection, intravitreal injection, or by subconjunctival, retrobulbar, The connexin modulating agent may be administered to the eye by periocular routes of administration, including periocular and posterior sub-Tenon injection. In some embodiments, the connexin modulating agent may be injected directly into or around the trabecular meshwork. In some embodiments, subconjunctival administration may provide sustained delivery while minimizing dosing frequency. In some embodiments, subconjunctival administration may increase the bioavailability of hydrophilic drugs since they do not have to penetrate the conjunctival epithelium. In some embodiments, microneedles, needles, or implants may be used for administration of the connexin modulating agent. The connexin modulating agent of the present invention may also be administered to the ciliary body. The connexin modulating agent may be administered once or more than once. The connexin modulating agent may be, for example, any of the connexin modulating agents described herein. In some embodiments, the connexin or pannexin modulating agent may or may not include any of the foregoing.

[0328] Connexin and pannexin channel modulating agents of the invention may also be administered to the trabecular meshwork or ciliary body.

[0329] Connexin and pannexin channel modulating agents of the invention may also be administered to the trabecular meshwork or ciliary body.

[0330] In some embodiments, the gap junction, connexin, hemichannel, and / or pannexin modulating agents, such as connexin 43 modulating agents and pannexin 1 modulating agents, may be formulated to provide controlled and / or compartmentalized release to the site of administration within the eye. In some embodiments of the invention, the formulation may be an immediate, or extended or sustained release dosage form. In some embodiments, the dosage form may include both an immediate release dosage form combined with an extended and / or sustained release dosage form. In some embodiments, both immediate and sustained and / or extended release of the connexin or pannexin modulating agent may be obtained by combining a modified or unmodified connexin or pannexin antisense oligonucleotide or polynucleotide together with an immediate release form of a modified or unmodified peptide or peptide mimetic. In some embodiments of the invention, the connexin modulating agent is, for example, a connexin 43 modulating agent or other connexin modulating agent of the present disclosure. In some embodiments of the invention, the dosage form may be an ocular implant, such as a biodegradable or non-biodegradable implant.

[0331] In some embodiments of the invention, the caderin modulating agent or gap junction modulating agent and / or connexin modulating agent, e.g., connexin 43 modulating agent, may be formulated for compartmentalized release of the modulating agent, e.g., by adjusting the size or coating of the particle. For example, in some embodiments, a particulate formulation of the caderin modulating agent or connexin modulating agent, e.g., connexin 43 modulating agent, may be administered for use in the methods of the invention. In some embodiments, the ocular drug delivery system comprising particles may comprise nanoparticles having an average diameter of less than 1,000 nm, e.g., 1-1000 nm, and / or microparticles having an average diameter of 1-1,000 μm. The nanoparticles or microparticles may be nanospheres or microspheres, or encapsulated nanocapsules and microcapsules, e.g., where the connexin modulating agent is encapsulated within a polymer coating. The particulate formulation may also comprise liposomes. In some embodiments, the connexin modulating agent may or may not include connexin 45, Cx26, Cx30, Cx31.1, Cx36, Cx37, Cx40, Cx50, or Cx57 or any other connexin modulating agent in the eye or blood vessel.

[0332] In some embodiments, the gap junction modulating agent and / or connexin modulating agent or pannexin modulating agent may be formulated for targeted delivery to the choroid and / or retina following peripheral administration, e.g., intravenous or intraperitoneal administration. The connexin modulating agent may be, for example, a connexin 43 modulating agent or other connexin modulating agent of the present disclosure.

[0333] In some embodiments, formulations for targeted delivery to the choroid and / or retina may involve administration of gap junction modulating agent and / or connexin modulating agent or pannexin modulating agent infused particles that present a target portion of the eye on the surface of the particle.

[0334] The present invention provides methods for modulating gap junction channel and / or hemichannel function and for the treatment of various disorders. It should be understood that such methods may be performed in vivo, ex vivo, and / or in vitro, as appropriate. In certain embodiments, the methods may be performed for experimental and / or non-experimental purposes. In certain embodiments, such methods include administering to one or more cells or a sample comprising one or more cells, in vitro or in vivo, a gap junction channel modulating agent, such as peptide 5 and / or analogs thereof, a compound of formula I, e.g., tonabersat, and analogs of any of the foregoing compounds, and / or a pannexin modulating agent, e.g., probenecid and analogs thereof, and / or a synthetic mimetic peptide blocker of pannexin 1, e.g., 10 In other embodiments, such methods may include administering to the subject a gap junction channel modulating agent, such as peptide 5 and / or analogs thereof, a compound of formula I, ...

Claims

1. A method for treating a subject with glaucoma, DME, ocular fibrosis, retinal perfusion disorders, or ocular hypoxia, comprising administering to the eye of the subject a therapeutically effective amount of a gap junction modulating agent, a connexin modulating agent, a pannexin modulating agent, or a pannexin channel modulating agent.

2. 2. The method of claim 1, wherein the glaucoma is characterized by glaucomatous ocular neuropathy and / or intraocular pressure-related neuropathy.

3. The method of claim 1 or 2, wherein the connexin modulating agent is a connexin 43 modulating agent.

4. The method of claim 3 , wherein the glaucoma is an intraocular pressure-related neuropathy.

5. 5. The method of claim 4, wherein the glaucoma is open-angle glaucoma or closed-angle glaucoma.

6. The method of claim 5 , wherein loss of retinal ganglion cells is treated.

7. The method of claim 1 , wherein inflammation in the inner retina is reduced.

8. The method of claim 1 , wherein flow through the trabecular meshwork is increased.

9. 10. The method of claim 1, wherein the gap junction modulating agent, connexin modulating agent, or pannexin modulating agent is administered in combination with one or more of a Rho kinase inhibitor, a prostaglandin, a prostaglandin analog, a carbonic anyhydrase inhibitor, an alpha 2 agonist, a beta blocker, an F2α prostaglandin analog, an anti-apoptotic agent, an N-methyl-D-aspartate (NMDA) receptor antagonist, and a glutamate release inhibitor.

10. The method of claim 9 , wherein the gap junction modulating agent is a connexin modulating agent administered in combination with a Rho kinase inhibitor.

11. 13. The method of claim 1, wherein treating ocular hypoxia reduces choroiditis.

12. The method of claim 11 , wherein the connexin modulating agent is a connexin 43 modulating agent.

13. The method of claim 11 , wherein the connexin modulating agent is a connexin 43 modulating agent, and the connexin 43 modulating agent is administered in combination with an ocular therapeutic agent.

14. 12. The method of claim 11, wherein choriocapillaris endothelial cell loss and / or choriocapillaris shedding is reduced.

15. 12. The method of claim 11, wherein choroiditis is reduced.

16. 13. The method of claim 12, wherein choriocapillaris endothelial cell loss is slowed or prevented.

17. A method for treating a subject with retinal artery occlusion or central retinal vein occlusion, comprising administering to an eye of the subject a therapeutically effective amount of a connexin modulating agent or pannexin modulating agent.

18. 20. The method of any one of claims 1, 3, 11, or 17, wherein the gap junction modulating agent, connexin modulating agent, or pannexin modulating agent is selected from the group consisting of an antisense oligonucleotide, an antisense polynucleotide, a compound of formula I, and a compound of formula VI.

19. 20. The method of claim 18, wherein at least one nucleotide of the oligonucleotide or polynucleotide is modified.

20. 20. The method of claim 18, wherein at least one nucleotide of the oligonucleotide or polynucleotide comprises at least one conformationally strained nucleotide, at least one modified internucleoside linkage, at least one modified sugar moiety, and / or at least one modified nucleobase.

21. 20. The method of claim 19, wherein the conformationally strained nucleotide is a locked nucleotide (LNA).

22. 20. The method of claim 19, wherein the conformationally strained nucleotide is a bridged nucleic acid (BNA). (BNA).

23. The locked nucleotides are of the following type: 2'-O-CH ２ -4'(oxy-LNA), 2'-CH ２ -CH ２ -4'(methylene-LNA), 2'-NH-CH ２ -4'(amino-LNA), 2'-N(CH ３ )-CH ２ -4'(methylamino-LNA), 2'-S-CH ２ -4'(thio-LNA), and 2'-Se-CH ２ -4'(seleno-LNA).

24. 20. The method of claim 19, wherein the antisense compound is an antisense oligonucleotide comprising naturally occurring nucleobases and unmodified internucleoside linkages.

25. 20. The method of claim 18, wherein the antisense compound is an antisense oligonucleotide containing at least one modified internucleoside linkage.

26. 26. The method of claim 25, wherein the modified internucleoside linkage is a phosphorothioate linkage.

27. 20. The method of claim 19, wherein the antisense compound is an oligonucleotide comprising at least one modified sugar moiety or at least one modified nucleobase.

28. 20. The method of claim 18, wherein the antisense compound comprises an oligonucleotide sequence selected from SEQ ID NOs: 1-16, and the oligonucleotide is no more than 40 nucleotides in length.

29. The method of claim 18, wherein the antisense compound targets at least about 8 nucleotides of a nucleic acid molecule encoding a connexin having a sequence selected from SEQ ID NO:

17.

30. 30. The method of any one of claims 1, 3, 11, or 18-29, wherein the antisense compound is an antisense oligonucleotide from about 15 to about 35 nucleotides in length, or from about 15 to about 40 nucleotides in length.

31. The method of claim 18, wherein the antisense compound comprises a nucleobase sequence not exceeding 40 nucleotides in length selected from SEQ ID NOs: 1-16, or a region of SEQ ID NO:

17.

32. 20. The method of any one of claims 1, 3, 11, 13, 17, or 18, wherein the connexin modulating agent is administered by topical, corneal, intraocular, intravitreal, subconjunctival, or periocular administration.

33. 33. The method of claim 32, wherein the connexin modulating agent is administered by intraocular injection or by intravitreal injection.

34. 34. The method of claim 32 or 33, wherein the antisense compound is administered once.

35. The method of any one of claims 1 to 34, wherein the subject is a human.

36. 29. The method of claim 28, wherein the antisense compound has at least about 80 percent, at least about 90 percent, at least about 95 percent, or at least about 97 percent homology to a polynucleotide having a sequence selected from a region of SEQ ID NOs:1-16 or SEQ ID NO:

17.

37. 14. The method of claim 13, wherein the ocular therapeutic agent is selected from anti-VEGF modulators, mTOR inhibitors, complement modulators, PDGF modulators such as PDGF antagonists, inhibitors of S1P production, squalamine, PEDF producers, tubulin binding agents, integrin inhibitors, and any mixtures thereof.

38. 38. The method of claim 37, wherein the ocular therapeutic agent is selected from one or more of the following ocular therapeutic agents: alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab, bivacizumab, protein ciliary neurotrophic factor, vascular endothelial growth factor modulating compounds, and hypoxia inducible factor 1-alpha modulating compounds, brimonidine, timolol, travoprost, dorzolamide, carbonic anhydrase inhibitors, beta blockers, prostaglandin analogs, anti-apoptotic agents, N-methyl-D-aspartate (NMDA) receptor antagonists, or glutamate release inhibitors, combinations of alpha 2 agonists and beta blockers, combinations of alpha 2 agonists and carbonic anhydrase inhibitors, and any mixtures thereof.

39. 39. The method of claim 38, wherein choriocapillaris shedding is reduced compared to a subject treated with monotherapy using the ocular therapeutic agent alone.

40. The method of claim 39, wherein the connexin 43 modulating agent is an anti-connexin 43 antisense oligonucleotide comprising a nucleotide sequence not exceeding 40 nucleotides in length selected from SEQ ID NOs: 1-16, or a region of SEQ ID NO:

17.

41. 41. The method of claim 40, wherein the anti-connexin 43 antisense oligonucleotide further comprises naturally occurring nucleotides and unmodified internucleoside linkages.

42. The method of claim 40, wherein the anti-connexin 43 antisense oligonucleotide is modified.

43. The modified oligonucleotide comprises at least one modified internucleoside linkage, at least 43. The method of claim 42, further comprising at least one modified sugar moiety, or at least one modified nucleobase, or any combination thereof.

44. 40. The method of claim 1, 3, 11, 13, 17, or 38, wherein the connexin modulating agent is a compound according to formula I.

45. 40. The method of claim 1, 3, 11, 13, 17, or 38, wherein the connexin modulating agent is a compound according to formula II.

46. The method of claim 1, 3, 11, 13, 17, or 38, wherein the connexin modulating agent is tonabersat.

47. 39. The method of any one of claims 1, 3, 11, 13, 17, or 38, wherein the connexin 43 modulating agent is a peptide comprising SEQ ID NO: 173 (SRPTEKT).

48. The method of any one of claims 1, 3, 11, 13, 17, 38, and 47, wherein the connexin 43 peptide further comprises SEQ ID NO: 168 (VDCFLSRPTEKT).

49. 49. The method of claim 48, wherein the connexin 43 peptide is modified.

50. 50. The method of claim 49, wherein the connexin 43 peptide modification comprises two C12 alkyl groups SEQ ID NO: 326 (C12-C12-VDCFLSRPTEKT).

51. 51. The method of any one of claims 38 to 50, wherein the connexin modulating agent is administered by topical, corneal, local, intraocular, intravitreal, subconjunctival, iontophoretic, or periocular administration.

52. 52. The method of claim 51, wherein the connexin modulating agent is administered by intraocular injection or by intravitreal injection.

53. 53. The method of claim 51 or 52, wherein the antisense compound is administered once.

54. 53. The method of claim 51 or 52, wherein the antisense compound is administered two or more times.

55. 53. The method of claim 51 or 52, wherein the antisense compound is administered before, together with, or after administration of the ocular therapeutic agent.

56. 53. The method of claim 51 or 52, wherein the antisense compound is formulated as an ophthalmic aqueous preparation, microspheres, nanospheres, or implants.

57. 57. The method of claim 56, wherein the microspheres or nanospheres comprise poly(D,L-lactide-co-glycolic acid).

58. 57. The method of claim 56, wherein the nanospheres have an average particle size of 100-140 nm.

59. 57. The method of claim 56, wherein the microspheres have an average particle size of 6 to 12 microns.

60. 57. The method of claim 56, wherein the microsphere, nanosphere, or implant comprises an encapsulation efficiency of greater than 50%.

61. 61. The method of claim 60, wherein the microsphere, nanosphere, or implant comprises an encapsulation efficiency of greater than 65%.

62. 57. The method of claim 56, wherein the microsphere, nanosphere, or implant comprises a loading of greater than 1.5%.

63. 63. The method of claim 62, wherein the microsphere, nanosphere, or implant comprises a loading of greater than 1.7%.

64. 52. The method of claim 51, wherein the connexin modulating agent is formulated for parenteral administration.

65. 65. The method of claim 64, wherein the connexin modulating agent is formulated for intravenous or intraperitoneal administration.

66. AMD, clinical geographic atrophy, chronic macular ischemia, ocular fibrosis, idiopathic polypoidal choroidal vasculopathy (IPC), diabetic maculopathy, diabetic retinopathy, hypertensive retinopathy, inflammatory CNV, central serous choroidopathy (CSR), macular telangiectasia, pattern dystrophy, subretinal / subPRD neovascularization, serous detachment of the retinal neurosensory epithelium, RPE detachment, hemorrhage (subretinal pigment epithelium, subretinal, intraretinal, or preretinal, including breakthrough hemorrhage into the vitreous), epiretinal, intraretinal, subretinal, or subpigment epithelial scar / glial tissue or fibrinous deposits, retinal streaks, 5. A method for treating a subject suffering from retinal fibrosis, retinal angiomatous proliferation and retinal choroidal anastomosis, choroidal neovascularization (CNV), cystoid maculopathy, retinal thickening, retinal scarring, uveitis (including posterior uveitis), scleritis, episcleritis viral retinitis (including cytomegalovirus (CMV) retinitis), retinopathy of prematurity, retinal hypoxia, diffuse choroidal sclerosis, choriocapillaris sclerosis, dry eye, neuropathic eye disorders, trauma-induced intraocular pressure reduction, or epithelial basement membrane dystrophy, comprising administering a therapeutically effective amount of a connexin modulating agent.

67. 67. The method of claim 66, wherein the connexin modulating agent is selected from a compound of formula I, a compound of formula II, tonabersat, a peptide, and a modified peptide.

68. 68. The method of claim 67, wherein the peptide is a peptide comprising SEQ ID NO: 173 (SRPTEKT).

69. 69. The method of claim 68, wherein the peptide further comprises SEQ ID NO: 168 (VDCFLSRPTEKT).

70. 68. The method of claim 67, wherein the modified peptide is SEQ ID NO: 326 (C12-C12-VDCFLSRPTEKT).

71. 1. A pharmaceutical composition comprising a combination of anti-connexin 43 compounds, said compounds comprising a connexin-43 modifying peptide and The following compounds: alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab, bivacizumab, proteins ciliary neurotrophic factor, Rho kinase, and adenosine mimetics, vascular endothelial growth factor modulating compounds, and hypoxia inducible factor 1-alpha modulating compounds, brimonidine, timolol, and a compound selected from one of travoprost, dorzolamide, a carbonic anihydrase inhibitor, a beta blocker, a prostaglandin analog, an anti-apoptotic agent, an N-methyl-D-aspartate (NMDA) receptor antagonist, or a glutamate release inhibitor, a combination of an alpha 2 agonist and a beta blocker, a combination of an alpha 2 agonist and a carbonic anihydrase inhibitor, and any mixture thereof.

72. 1. A pharmaceutical composition comprising a combination of anti-connexin 43 antisense compounds, the antisense compounds comprising the following selected components: internucleoside linkages which are phosphorothioate linkages, and modified sugar moieties which are conformationally strained sugars; A pharmaceutical composition comprising a compound selected from one of the following compounds: alibercept, lampalizumab, sonepcizumab, fenretinide, ranibizumab, bivacizumab, the protein ciliary neurotrophic factor, a vascular endothelial growth factor modulating compound, and a hypoxia inducible factor 1-alpha modulating compound, and any mixtures thereof, and an antisense oligonucleotide comprising one or more of the following compounds:

73. 73. The composition of claim 72, wherein the antisense oligonucleotide comprises a nucleobase sequence not exceeding 40 nucleotides in length selected from SEQ ID NOs: 1-16, or a region of SEQ ID NO: 17.

Images