Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Abstract

To provide an siRNA and a pharmaceutical composition which inhibit kininogen (KNG) expression and thus can achieve the purpose of effectively inhibiting a life span of a pathogen so as to alleviate the progress of the septicemia and reverse the pathology.SOLUTION: The siRNA contains a sense strand and an antisense strand. Each nucleotide in the siRNA is independently a modified or unmodified nucleotide. Lengths of the sense strand and the antisense strand are the same or different, the length of the sense strand is 19-23 nucleotides, and the length of the antisense strand is 19-26 nucleotides. The sense strand contains a specific nucleotide sequence I. The antisense strand contains a specific nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II form a substantially reverse complementary or completely reverse complementary double-stranded region. The siRNA inhibits expression of a kininogen gene in hepatocytes.SELECTED DRAWING: Figure 3

Description

[Technical field]

[0001] The present disclosure relates to a nucleic acid capable of suppressing kininogen gene expression, a pharmaceutical composition comprising the nucleic acid, and an siRNA. The present disclosure further relates to the nucleic acid, drug composition and siRNA complex. Regarding preparation and use. [Background technology]

[0002] Sepsis (also called pyemia) refers to a systemic inflammatory response syndrome caused by infection. There is clinical evidence of a bacterial or highly suspected focus of infection. It is caused by an infection, but once it develops, its development and progression follow its own pathological processes and laws. It is essentially the body's response to an infectious agent.

[0003] The kininogen (KNG) gene is expressed and produces activated high molecular weight kininogen. Activated high molecular weight kini nogen (HMWKa) and lipopolysaccharides (lipopolysaccharides) on the cell surface of gram-negative bacteria. It can bind to lipopolysaccharide (LPS) and extend its half-life. By suppressing the pathogen, it is possible to effectively inhibit its lifespan, slow down the progression of sepsis, and reverse the pathology. Therefore, the KNG is able to achieve the objective of preventing septicemia and other diseases caused by pathogens. It is closely related to inflammation and is one of the key target points for treating sepsis. Small interfering RNA (siRNA) Based on the mechanism of RNA interference (RNAi), The purpose of the present invention is to inhibit or block the expression of a target gene of interest in a sequence-specific manner and to treat a disease. can be achieved.

[0004] In the development of siRNA drugs to suppress the expression of KNG gene and treat sepsis, Development of suitable siRNA and its modifications, as well as effective delivery systems, is one of the key technologies. Summary of the Invention [Problem to be solved by the invention]

[0005] The inventors of the present disclosure provide the following siRNAs and modified sequences thereof: and a drug composition and a siRNA complex comprising the siRNA are The expression of genes can be specifically suppressed, and the siRNA complex specifically targets the liver. This makes it possible to suppress the expression of the KNG gene in the liver and realize the treatment or prevention of sepsis. I surprisingly discovered that it was possible. [Means for solving the problem]

[0006] In some embodiments, the present disclosure provides a first siRNA capable of suppressing KNG gene expression. The siRNA includes a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are reverse-complementary to each other in at least a portion of the double-stranded region. The nucleotide sequence I and the nucleotide sequence II are represented by the following i) to vi): ) is one selected from the sequences shown in

[0007] i) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 have a length and the nucleotide sequence II and SEQ ID NO:2 have no more than three nucleotide differences. are identical in length and have no more than three nucleotide differences to the nucleotide sequence shown in 5'-AAAGUAACAACCAGUUUGZ1-3' (SEQ ID NO: 1), 5'-Z2CAAACUGGUUGUUACUUU-3' (SEQ ID NO: 2) wherein Z1 is U and Z2 is A, and in said nucleotide sequence I, position Z1 is The corresponding nucleotide Z3 is included in the nucleotide sequence II, and the position of Z2 is included in the nucleotide sequence II. and Z4 is the first nucleotide at the 5' end of the antisense strand. It is a nucleotide.

[0008] ii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 have the same length and the nucleotide sequence II and the sequence of SEQ ID NO: The nucleotide sequence shown in 62 is the same length and has no more than three nucleotide differences. can be, 5'-AUUGAACUUUCGAAUUACZ5-3' (SEQ ID NO: 61), 5'-Z6GUAAUUCGAAAGUUCAAU-3' (SEQ ID NO: 62) 5, wherein Z5 is C and Z6 is G; and wherein in said nucleotide sequence I, position The corresponding nucleotide Z7 is included in the nucleotide sequence II, which corresponds to Z6 in position II. the antisense strand includes a nucleotide Z8 which is the first nucleotide at the 5' end of the antisense strand; It is a nucleotide.

[0009] iii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 , which are equal in length and have no more than three nucleotide differences, and which are identical to nucleotide sequence II and sequence The nucleotide sequence shown in reference number 122 is the same length and has three nucleotide differences. is as follows: 5'-UCGAAUUACCUACUCAAUZ9-3' (SEQ ID NO: 121), 5'-Z 10 AUUGAGUAGGUAAUUCGA-3' (SEQ ID NO: 122) However, Z9 is U and Z 10 is A, and in said nucleotide sequence I, position Z9 Nucleotide Z corresponding to 11 and in said nucleotide sequence II, position Z 10 To The corresponding nucleotide Z 12 wherein Z 12 is the 5' end of the antisense strand This is the first nucleotide.

[0010] iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 182 is the same length and has no more than three nucleotide differences. Below, 5'-GAUAAUGCAUACAUCGAUZ 13 -3' (SEQ ID NO: 181), 5'-Z 14 AUCGAUGUAUGCAUUAUC-3' (SEQ ID NO: 182) However, Z 13 is A and Z 14 is U, and in said nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 4 16 wherein Z 16 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0011] v) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have the same length and the nucleotide sequence II and the sequence of SEQ ID NO: The nucleotide sequence shown in 242 is the same length and has no more than three nucleotide differences. and 5'-GAAUAACGCAACUUUCUAZ 17 -3' (SEQ ID NO: 241), 5'-Z 18 UAGAAAGUUGCGUUAUUC-3' (SEQ ID NO: 242) However, Z 17 is U and Z 18 is A, and in said nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 8 20 wherein Z 20 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0012] vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 302 is the same length and has no more than three nucleotide differences. Below, 5'-AACUUUCUAUUUCAAGAUZ 21 -3' (SEQ ID NO: 301), 5'-Z 22 AUCUUGAAAUAGAAAGUU-3' (SEQ ID NO: 302) However, Z 21 is U and Z 22 is A, and in said nucleotide sequence I, position Z 21 Nucleotide Z corresponding to23 and in said nucleotide sequence II, position Z2 Nucleotide Z corresponding to 2 24 wherein Z 24 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0013] In some embodiments, the present disclosure provides a method for the preparation of a siRNA of the present disclosure and a pharma- ceutically acceptable A pharmaceutical composition is provided that includes a carrier.

[0014] In some embodiments, the present disclosure relates to siRNAs and the siRNAs provided by the present disclosure. A siRNA complex is provided that includes a conjugated group that is conjugated and bound to the siRNA.

[0015] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or the siRNA complex for treating sepsis caused by abnormal expression of the KNG gene; and / or or for use in the preparation of a medicament for prophylaxis.

[0016] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or administering an effective amount of the siRNA complex to a subject suffering from sepsis. The present invention provides a method for treating and / or preventing sepsis, comprising administering to a subject a therapeutically effective amount of sepsis to a subject.

[0017] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or contacting an effective amount of the siRNA complex with the cell. A method for inhibiting expression of the KNG gene is provided.

[0018] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or a kit comprising the siRNA complex.

[0019] INCORPORATION BY REFERENCE All publications, patents and patent applications mentioned herein are hereby incorporated by reference in their entirety. Each application is hereby incorporated by reference to the same extent as if each application was specifically and individually incorporated by reference. and is hereby incorporated by reference. Effect of the Invention

[0020] The siRNA, drug composition and siRNA complex provided by the present disclosure have excellent stability. It has high KNG mRNA suppression activity and reduced off-target effects, and / or can significantly treat or alleviate the symptoms of sepsis.

[0021] In some embodiments, the siRNA, drug composition or s The iRNA complexes show excellent target mRNA suppression activity in in vitro cell experiments. In the form, the siRNA, drug composition, or siRNA complex provided by the present disclosure , at least 20%, 30%, 40%, 50%, 60%, 70%, 80% in hepatocytes In some embodiments, the present invention exhibits a target mRNA expression inhibition rate of 90% or 95%. The siRNA complexes provided by the disclosure exhibit high inhibition in the psiCHECK system. Shows activity and IC 50 is 0.0048~0.2328nM.

[0022] The siRNAs provided by the present disclosure are identified as KNG m It showed high silencing activity against RNA and KNG target sequence at different siRNA concentrations. Both showed inhibitory effects, especially at a concentration of 0.1 nM, suppression of KNG mRNA expression was observed. The control rate will be 75% or higher in both cases.

[0023] In some embodiments, the siRNA, drug composition or s The iRNA complexes have greater stability and / or activity in the body. In the present disclosure, the siRNA, drug composition, or siRNA complex provided herein is capable of acting in vivo. At least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% In some embodiments, the present disclosure provides a method for the inhibition of expression of a target gene. The siRNA, drug composition or siRNA complex is capable of absorbing at least 20%, 30%, or 40%, 50%, 60%, 70%, 80%, 90% or 95% suppression of KNG gene expression In some embodiments, the siRNA and drug compositions provided by the present disclosure or the siRNA complex is at least 20%, 30%, 40%, 50%, 60%, The inhibition rates of intrahepatic KNG gene expression were 70%, 80%, 90%, and 95%. In an embodiment, the present disclosure provides a siRNA, a drug composition, or a siRNA complex. is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% The results show that the expression of KNG gene in the liver is suppressed by 95% or 100% in the animal model. In the form, the siRNA, drug composition, or siRNA complex provided by the present disclosure , at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% in the body Or 95% of human subjects show an inhibition rate of intrahepatic KNG gene expression. In one embodiment, the siRNA complex provided by the present disclosure inhibits KNG expression in humanized mice. It showed a significant inhibitory activity against mRNA and suppressed the expression level of KNG mRNA. In some embodiments, the present disclosure provides The siRNA complexes containing the siRNA showed highly suppressive activity in humanized mice and inhibited the KNG mR The inhibition rate for NA expression level was 97% or higher in all cases.

[0024] In some embodiments, the siRNA, drug composition or s The iRNA complexes did not show significant off-target effects. For example, the inhibition may be of the normal expression of a non-target gene. Binding / inhibition of on-target genes is 50%, 40%, 30%, 20% or less than the on-target gene effect. If it is 10% lower, the off-target effect is considered to be insignificant.

[0025] Thus, the siRNAs, drug compositions and siRNA complexes provided by the present disclosure The present invention provides an anti-sepsis agent that inhibits the expression of KNG mRNA and effectively treats and / or prevents the symptoms of sepsis. This has bright prospects for application.

[0026] Other features and advantages of the present disclosure are described in the Detailed Description section below. Let me explain in detail. [Brief description of the drawings]

[0027] [Figure 1] 13 is a histogram of the relative residual activity of Renilla in HEK293A cells in vitro after transfection with multiple siRNAs at different concentrations. [Fig. 2A-2F] Dose-effect curves fitted according to the relative residual activity of Renilla in HEK293A cells after transfection with multiple siRNAs at different concentrations. [Diagram 3]1 is a histogram of the relative expression levels of KNG protein in mice (in vivo) at different time points after administration of the siRNA complex. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Hereinafter, the embodiments of the present disclosure will be described in detail. The detailed description is merely for the purpose of explaining or interpreting the present disclosure, and It should be understood that this is not intended to be limiting.

[0029] In this disclosure, KNG mRNA is identified by Genbank accession number NM_001102 416.2. Furthermore, unless otherwise specified, The term "target gene" used in the present specification refers to a gene that transcribes the KNG mRNA. and the term "target mRNA" refers to the KNG mRNA.

[0030] (definition) Unless otherwise stated in the context, the capital letters C, G, U, and A represent the base sequences of nucleotides. A lowercase letter m indicates that one nucleotide adjacent to the left of the letter m is modified with methoxy. A lowercase letter f indicates a nucleotide that is adjacent to the left of the letter f. The nucleotide is a fluoro-modified nucleotide, and the lowercase letter s is This indicates that two adjacent nucleotides are linked by a thiophosphate group. P1 is a nucleotide sequence in which one nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or represents a 5'-phosphate analog modified nucleotide, and the combination letter VP represents the The nucleotide immediately to the right of the combination VP is a vinyl phosphate-modified nucleotide. The combination letter Ps indicates that the combination letter Ps is a 1 adjacent letter to the right of the combination letter Ps. The capital letter P indicates that the nucleotide is a phosphorothioate modified nucleotide. The nucleotide immediately to the right of the letter P is a 5'-phosphate nucleotide. represent.

[0031] In this context, the term "fluoro-modified nucleotide" refers to a nucleotide having a ribose group of This refers to a nucleotide in which the 2'-hydroxy group is replaced with fluorine. "Leuotide" is a nucleotide in which the 2' hydroxyl group of the ribose group is replaced with a non-fluorine group. "Nucleotide analog" refers to a nucleotide or nucleotide analog that is Can substitute for nucleotides in nucleic acids, including adenine ribonucleotides, Guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or It refers to a group whose structure is different from thymine deoxyribonucleotide, for example, isonucleotide, Bridged nucleic acid (BNA) or acyclic nucleic acid The "methoxy-modified nucleotide" is a nucleotide that has a 2'-hydroxyl group at the ribose group. It refers to a nucleotide in which the oxy group is replaced with methoxy.

[0032] In the context of this specification, the terms "complement" and "reverse complement" are used interchangeably. It may have the meaning well known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, each of the bases of one strand is It means that the bases on one strand complement each other. The pyrimidine base adenine (A) always mates with the pyrimidine base thymine (T) (or In the nucleosome, uracil (U) pairs with the purine base guanine (C), which is always paired with the purine base guanine (C). It pairs with the lysine base cytosine (G). Each base pair consists of one purine and one It contains two pyrimidines: an adenine on one strand is always replaced by a thymine (or uracil) on the other strand. ) and guanine always pairs with cytosine, then both strands are complementary. It is also believed that the sequence of the strand can be deduced from the sequence of its complementary strand. In the art, the term "mismatch" refers to a situation in which bases at corresponding positions in a double-stranded nucleic acid are complementary. This means that there is no pairing of the two nuclei.

[0033] Unless otherwise specified in the context, "essentially reverse complementary" refers to the complementary structure of two related nucleotides. This refers to the presence of three or fewer base mismatches between the nucleotide sequences. " refers to the presence of no more than one base mismatch between two nucleotide sequences; "Perfectly reverse complementary" means that there are no base mismatches between the two nucleotide sequences. Refers to...

[0034] In this context, one nucleotide sequence has a "nucleotide difference" with another nucleotide sequence. The presence of a "difference" means that the type of base at the same position in the former is different from that in the latter. For example, when one nucleotide base in the latter is A, the same If the corresponding nucleotide base at the same position is U, C, G, or T, Nucleotide differences between the two nucleotide sequences have been observed. In an embodiment, an abasic nucleotide or its equivalent is substituted for the nucleotide at the original position. When using the nucleotide sequence, it is considered that a nucleotide difference has occurred at that position.

[0035] In particular, in the context of the present disclosure, the method for preparing the siRNA, drug composition or siRNA complex In describing the above, unless otherwise specified, the nucleoside monomer e monomer) refers to the nucleoside in the siRNA or siRNA complex to be prepared. Depending on the type and order of phosphoramidites, modified or unmodified phosphoramidites are used in solid-phase phosphoramidite synthesis. Creoside phosphoramidite monomers (unmodified or modified d RNA phosphoramidites. RNA phosphoramid tes is sometimes called Nucleoside phosphoramidites) Phosphoramidite solid-phase synthesis is a method used for RNA synthesis known to those skilled in the art. All of the nucleoside monomers used in the present disclosure are commercially available. do.

[0036] In the context of this disclosure, unless otherwise specified, "composite" means that each has a specific function. refers to a covalent bond between two or more chemical moieties that are bonded to one another, and accordingly, A "complex" is a compound formed by covalently bonding each of the chemical moieties. Furthermore, a "siRNA complex" refers to a complex that contains one or more chemical moieties with a specific function. In the following text, the term "s" refers to a compound formed by covalently binding to an iRNA. The iRNA complex may also be referred to simply as a "complex." The siRNA complex may be A siRNA complex is a general term for multiple siRNA complexes, or a siRNA complex represented by a certain chemical formula. In the context of the present disclosure, a "composite molecule" refers to a molecule that is capable of reacting with an siRNA. and ultimately form the siRNA complex of the present disclosure. It should be understood that there is.

[0037] As used herein, "any" or "optionally" refers to the event or events described thereafter. that circumstances may or may not occur and that such statements are based on the assumption that an event or circumstance will occur. For example, "optionally substituted" "alkyl" refers to a group that may or may not occur. " includes "alkyl" and "substituted alkyl" as defined in the following sentence. With respect to any groups that contain substituents, it is important to note that these groups may be sterically impractical, synthetically impractical, or otherwise unfeasible. It is not intended to introduce any substitutions or substitution patterns that are unnecessary and / or inherently unstable. It will be understood by those skilled in the art that there is no.

[0038] As used herein, "alkyl" refers to both straight and branched chains having the specified number of carbon atoms. The specific number refers to a branched chain, and the specific number is usually 1 to 20 carbon atoms, for example, 1 to 10 carbon atoms. For example, C1-C6 alkyl is 1 to 6 Includes straight-chain and branched-chain alkyls of up to 100 carbon atoms. Refers to alkyl residues having a specific number of carbons. When used herein, it is intended to include all branched and straight chain forms having that number of carbons. Thus, for example, "butyl" includes n-butyl, sec-butyl, isobutyl and tert-butyl. -butyl, and "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl, just like alkyl, but with two points of attachment. It refers to a residue that

[0039] As used herein, "alkenyl" means an alkyl group having at least one carbon-carbon double bond. refers to an unsaturated branched or straight chain alkyl having a carbon-carbon double bond, The group is obtained by removing one hydrogen molecule from the adjacent carbon atom of the The double bonds may be in the cis or trans configuration. Exemplary alkenyls include vinyl and , prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1- propenyl, such as prop-2-en-2-yl, and but-1-en-1-yl. yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2- buta-1,3-dien-1-yl, buta-2-en-2-yl, buta-1,3-dien-1-yl, buta and butenyl, such as 1,3-dien-2-yl. In certain embodiments, alkenyl has 2 to 20 carbon atoms, while in other embodiments, Alkenylene has 2 to 10, 2 to 8, or 2 to 6 carbon atoms. A subset of alkenyl, it refers to residues similar to alkenyl, but which have two points of attachment.

[0040] As used herein, "alkynyl" means an alkynyl group having at least one carbon-carbon triple bond. The term refers to an unsaturated branched or straight chain alkyl group having a carbon-carbon triple bond, It is obtained by removing two hydrogen molecules from adjacent carbon atoms of alkyl. The alkyl groups include ethynyl, prop-1-yn-1-yl, prop-2-yn-1-yl, and prop-1-yn-1-yl. Propynyl, but-1-yn-1-yl, but-1-yn-3-yl, but- butynyl, such as 3-yn-1-yl. In certain embodiments, alkynyl has 2 to 20 carbon atoms, but in other embodiments, 2 to 1 Alkynylene is a subset of alkynyl having 0, 2 to 8, or 2 to 6 carbon atoms. and refers to a residue similar to alkynyl, but having two points of attachment.

[0041] As used herein, "alkoxy" refers to an alkyl group having a specified number of carbon atoms attached through oxygen bridges. alkyl of a carbon atom, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyl Oxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy Alkoxy is usually 1- having 10, 1-8, 1-6, or 1-4 carbon atoms bonded by oxygen bridges .

[0042] As used herein, "aryl" refers to an aromatic monocyclic or polycyclic hydrocarbon ring system. The aromatic monocyclic group is a group formed by removing a hydrogen atom from a ring carbon atom. The cyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon atoms from 6 to 18 carbon atoms, At least one of the rings in the ring system is fully unsaturated, i.e., it is The aryl group includes phenyl, fluoro, and cyclic, delocalized (4n+2) π-electron systems. Arylene includes, but is not limited to, groups such as aryl and naphthyl. A subset of aryl, it refers to residues similar to aryl but having two points of attachment.

[0043] As used herein, a "halogen substituent" or "halo" refers to any group including fluoro, chloro, , bromo or iodo, and the term "halogen" includes fluorine, chlorine, bromine or iodine. .

[0044] As used herein, "halogenated alkyl" refers to an alkyl group having a specified number of carbon atoms. is an alkyl group as defined above, substituted with up to the maximum permitted number of halogen atoms. Examples of halogenated alkyl groups include trifluoromethyl, difluoromethyl, and , 2-fluoroethyl, or pentafluoroethyl.

[0045] The term "heterocyclic group" refers to a group having 2 to 12 carbon atoms and 1 to 2 carbon atoms selected from nitrogen, oxygen, or sulfur. It refers to a stable 3- to 18-membered non-aromatic cyclic group containing 6 heteroatoms. Unless otherwise specified, heterocyclic groups may be monocyclic, bicyclic, tricyclic or tetracyclic ring systems, fused or bridged. The heteroatoms in the heterocyclic groups may be optionally oxidized. Nitrogen atoms, if present, are optionally quaternized. Heterocyclic groups may be partially saturated or completely Heterocyclic groups can be attached to the rest of the molecule through any atom of the ring. Illustrative examples of such heterocyclic groups include: Dioxanyl, thiophenyl[1,3]disulfonyl thianyl), decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isoquinolinyl Sothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindole, o 2-Oxahydroisoindole, 2-Oxapiperazinyl, 2-Oxapiperidyl, 2-Oxa Sapyrrolidinyl, oxazolidinyl, piperidyl, piperazinyl, 4-piperidonyl, rolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, thiazolidinyl trisulfonyl, tetrahydropyranyl, thiomorpholinyl hiomorpholinyl, thiamorpholinyl ), 1-oxo-thiomorpholinyl and 1,1-dioxo-thiomorpholinyl yl), but are not limited to.

[0046] "Heteroaryl" means an alkyl group having 2 to 17 carbon atoms and a group selected from nitrogen, oxygen, and sulfur. refers to a group derived from a 3- to 18-membered aromatic ring radical containing 1 to 6 heteroatoms. As used herein, heteroaryl refers to a monocyclic, bicyclic, tricyclic, or tetracyclic ring system. and at least one of the rings in the ring system is fully unsaturated, i.e., it is Heteroaryls include cyclic delocalized (4n+2) π-electron systems that conform to the Heteroaryl theory. includes bridged ring systems. The heteroatoms in heteroaryl are optionally oxidized. One or more The nitrogen atom (if present) is optionally quaternized. Heteroaryl is any of the heteroaryls in the ring. The atom that is attached to the rest of the molecule is azepinyl. acridinyl, benzimidazolyl, benzoindole, 1,3-benzodioxazoline aryl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl Benzo[b][1,4]dioxepinyl pinyl), benzo[b][1,4]oxazinyl azinyl), 1,4-benzodioxanyl, Benzonaphthofuranyl, benzoxazolyl, benzodioxolyl olyl), benzodioxinyl, benzopyranyl, Benzopyronyl, benzofuryl, benzofuranonyl, benzothiophenyl, benzothieno[ 3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2- a]pyridyl, carbazolyl, cinnolinyl, cyclopenta[d ]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d ]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl (5,6-dihydro benzo[h]quinazolinyl), 5,6-dihydrobenzo[h]quinazolinyl 5,6 dihydrobenzo[h]cinnolinyl, 6,7-dihydrobenzo[h]cinnolinyl Doro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuryl dibenzothiophenyl, furyl, furanonyl, furo[3,2-c]pyridyl, 5,6 ,7,8,9,10-Hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8, 9,10-Hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10- Hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazolyl Indazolyl, indole, isoindole, indolinyl, isoindolinyl nyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-Methano-5,6,7,8-tetrahydroquinazolinyl -5,6,7,8-tetrahydroquinazolinyl), naphthyridinyl (naphthyridinyl), 1,6-naphthyridinonyl (1,6-naphth yridinonyl, oxadiazolyl, 2-oxoazepinyl pinyl), oxazolyl, oxiranyl, 5,6,6a,7, 8,9,10,10a-Octahydrobenzo[H]quinazolinyl, 1-phenyl-1H- Pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl (pht halazinyl, pteridinyl, purinyl, pyrrolyl, Pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyridinyl Rimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl nyl, quinazolinyl, quinoxalinyl, quinolyl, tetra Hydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydroquinazolinyl Hydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl 5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7, 8-Tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, thiazolyl Triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno [3,2-d]pyrimidinyl, thieno[2,3-c]pyridinyl -c]pridinyl) and thiophenyl / thienyl Including, but not limited to:

[0047] A variety of hydroxy protecting groups may be used in the present disclosure. Generally, the protecting groups are In this way, chemical functional groups can be rendered insensitive to certain reaction conditions while leaving the remainder of the molecule substantially can be added to and removed from the relevant functional groups in a molecule without damaging the A representative hydroxy protecting group is described in Beaucage et al., Tetrahedron 19 92, 48, 2223-2311, and Greene and Wuts, Protect tive Groups in Organic Synthesis,Chapter 2,2d ed., John Wiley & Sons, New York, 1991 No. 6,393,962, each of which is incorporated herein by reference in its entirety. In some embodiments, the protecting group is stable under basic conditions but is stable under acidic conditions. In some embodiments, the hydroxy groups usable herein can be removed. Non-exclusive examples of protecting groups include dimethoxytrityl (DMT), monomethoxytrityl , 9-phenylxanthen-9-yl (Pixyl) or 9-(p-methoxyphenyl) In some embodiments, the compounds used herein include xanthen-9-yl (Mox). Non-exclusive examples of hydroxy protecting groups that can be used include Tr (trityl), MMTr (4-methyl-2-phenylpropanediol), 4,4'-dimethoxytrityl), DMTr(4,4'-dimethoxytrityl) or TMTr(4,4' ,4''-trimethoxytrityl).

[0048] The term "subject," as used herein, refers to any animal, e.g., a mammal. Subjects of the present disclosure include humans, non-human primates (e.g., monkeys or other species of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats or any type of poultry, but is not limited to such.

[0049] As used herein, "treatment" refers to a method for obtaining beneficial or desired results; "Therapeutic effect" includes, but is not limited to, the eradication or elimination of the underlying disorder being treated. Treatment efficacy means that the subject is still suffering from the underlying disorder. Although the patient may be at risk of suffering from one or more physiological symptoms associated with the underlying disorder, By eliminating or improving, an improvement is observed in the subject.

[0050] As used herein, "prophylaxis" refers to a method of obtaining a beneficial or desired result, such as prevention. In order to obtain a "preventive effect," the diagnosis of the disease in question is made. Although no cutting may have been performed, the siRNA, siRNA complex, or drug composition may be identified. The present invention relates to a method for treating a subject at risk of developing a disease, or for treating one or more pathological symptoms of the disease. The subject may be administered the drug.

[0051] In one aspect, the present disclosure provides first to sixth siRNAs capable of suppressing KNG gene expression. Each of these will be explained in detail below.

[0052] The siRNA of the present disclosure comprises a nucleotide group as a basic structural unit. It is known to those skilled in the art that a phosphate group includes a ribose group and a base. The explanation will be omitted.

[0053] The siRNA of the present disclosure comprises a sense strand and an antisense strand, The lengths of the sense strands are the same or different, the length of the sense strand is 19 to 23 nucleotides, The length of the antisense strand is 19 to 26 nucleotides. The length ratio of the sense strand to the antisense strand of the siRNA to be used was 19 / 19, 19 / 20, or 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 2 0 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20 , 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 2 3 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 2 In some embodiments, the sense strand and antisense strand of the siRNA may be The length ratio of the sense chains is 19 / 21, 21 / 23 or 23 / 25.

[0054] <First siRNA> According to the present disclosure, the siRNA may be a first siRNA.

[0055] The first siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 form a region. , which are equal in length and have no more than three nucleotide differences, and which are identical to nucleotide sequence II and sequence The nucleotide sequence shown in number 2 is the same length and has no more than three nucleotide differences. It is. 5'-AAAGUAACAACCAGUUUGZ1-3' (SEQ ID NO: 1), 5'-Z2CAAACUGGUUGUUACUUU-3' (SEQ ID NO: 2) wherein Z1 is U and Z2 is A, and in said nucleotide sequence I, position Z1 is The corresponding nucleotide Z3 is included in the nucleotide sequence II, and the position of Z2 is included in the nucleotide sequence II. and Z4 is the first nucleotide at the 5' end of the antisense strand. It is a nucleotide.

[0056] In this context, "corresponding positions" refers to positions from the same end of a nucleotide sequence to the same For example, nucleotide sequence I at position 1 at the 3' end of nucleotide sequence I The second nucleotide corresponds to the first nucleotide at the 3' end of SEQ ID NO:1. It is a nucleotide.

[0057] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0058] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are and / or There is one or more nucleotide differences between Sequence II and the nucleotide sequence shown in SEQ ID NO:2. Below.

[0059] In some embodiments, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 Nucleotide differences between the nucleotide sequences include differences at position Z4, where Z4 is U, C or G. In some embodiments, the nucleotide difference is selected from Z4 In some embodiments, the difference is in position, Z4 is selected from U, C, or G. , Z3 is a nucleotide complementary to Z4. siRNPs having the above nucleotide differences A has high target mRNA suppression ability, and siRNAs containing these nucleotide differences , are within the scope of protection of this disclosure.

[0060] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0061] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:4 It is. 5'-AAAGUAACAACCAGUUUGZ3-3' (SEQ ID NO: 3), 5'-Z4CAAACUGGUUGUUACUUUGG-3' (SEQ ID NO: 4) However, Z4 is the first nucleotide at the 5' end of the antisense strand, and Z4 is selected from A, U, G or C, Z3 is a nucleotide complementary to Z4, In some embodiments, Z3 is U and Z4 is A.

[0062] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. In some embodiments, the nucleotide sequence IV and the second nucleotide sequence The sequence is substantially reverse-complementary or completely reverse-complementary to the second nucleotide sequence. is adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 in the target mRNA. , refers to a nucleotide sequence equal in length to nucleotide sequence IV above.

[0063] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is C, The base of nucleotide sequence IV is G, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is CC, and the base sequence of nucleotide sequence IV is GG, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of string III is ACC and the base sequence of nucleotide sequence IV is GGU; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is AACC, and the base sequence of nucleotide sequence IV is The base sequence is GGUU, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is CC and the base sequence of nucleotide sequence IV is GG; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0064] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0065] <Second siRNA> According to the present disclosure, the siRNA may be a second siRNA. The iRNA comprises a sense strand and an antisense strand, and each nucleotide of the siRNA is and the sense strand has nucleotide sequence I, each of which is independently modified or unmodified nucleotide. the antisense strand comprises nucleotide sequence II and a nucleotide sequence preceding nucleotide sequence I; The nucleotide sequence II is a double-stranded region formed in a reverse-complementary manner at least in a part thereof, The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 are the same in length and have the same nucleotide sequence. The nucleotide sequence has three or fewer nucleotide differences and is shown in nucleotide sequence II and SEQ ID NO:62. Nucleotide sequences that are identical in length and differ by no more than three nucleotides. 5'-AUUGAACUUUCGAAUUACZ5-3' (SEQ ID NO: 61), 5'-Z6GUAAUUCGAAAGUUCAAU-3' (SEQ ID NO: 62) 5, wherein Z5 is C and Z6 is G; and wherein in said nucleotide sequence I, position The corresponding nucleotide Z7 is included in the nucleotide sequence II, which corresponds to Z6 in position II. the antisense strand includes a nucleotide Z8 which is the first nucleotide at the 5' end of the antisense strand; It is a nucleotide.

[0066] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0067] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 are and / or There is one nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:62. There are less than one.

[0068] In some embodiments, the nucleotide sequence II is Nucleotide differences between the nucleotide sequences include a difference at position Z8, where Z8 is A, In some embodiments, the nucleotide difference is selected from Z8 and Z8 is selected from A, U or C. Z7 is the nucleotide complementary to Z8. NAs have high target mRNA silencing ability, and siRNAs containing these nucleotide differences are also within the scope of protection of this disclosure.

[0069] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0070] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:63. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:64. It is an array. 5'-AUUGAACUUUCGAAUUACZ7-3' (SEQ ID NO: 63), 5'-Z8GUAAUUCGAAAGUUCAAU-3' (SEQ ID NO: 64) However, Z8 is the first nucleotide at the 5' end of the antisense strand, and Z8 is selected from A, U, G or C; Z7 is a nucleotide complementary to Z8; In some embodiments, Z7 is C and Z8 is G.

[0071] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 61, the length of which is adjacent to the 5' end of said nucleotide sequence It refers to the nucleotide sequence equivalent to IV.

[0072] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is G, The base of nucleotide sequence IV is C, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is GG, and the base sequence of nucleotide sequence IV is CC, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is UGG and the base sequence of nucleotide sequence IV is CCA; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is CUGG, and the base sequence of nucleotide sequence IV is The base sequence is CCAG, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is GG and the base sequence of nucleotide sequence IV is CC; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0073] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0074] <Third siRNA> According to the present disclosure, the siRNA may be a third siRNA.

[0075] The third siRNA comprises a sense strand and an antisense strand, and each nucleotide of the siRNA each nucleotide is independently a modified or unmodified nucleotide, and the sense strand is a the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are reverse-complementary to each other at least in part to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 122 is the same length and has no more than three nucleotide differences. Below. 5'-UCGAAUUACCUACUCAAUZ9-3' (SEQ ID NO: 121), 5'-Z 10 AUUGAGUAGGUAAUUCGA-3' (SEQ ID NO: 122) However, Z9 is U and Z 10 is A, and in said nucleotide sequence I, position Z9 Nucleotide Z corresponding to 11 and in said nucleotide sequence II, position Z 10 To The corresponding nucleotide Z 12 wherein Z 12 is the 5' end of the antisense strand This is the first nucleotide.

[0076] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0077] In some embodiments, the nucleotide sequence I is set forth in SEQ ID NO: 121. There is no more than one nucleotide difference between the nucleotide sequence and / or Nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:122 is less than or equal to one.

[0078] In some embodiments, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 are The nucleotide difference between the nucleotide sequence of 12 including the difference at the position of Z 12 is selected from U, C, or G. In some embodiments, the nucleotide difference is , Z 12 is the difference in position, Z 12 is selected from U, C, or G. In terms of shape, Z 11 is Z 12 The nucleotide difference is the complementary nucleotide to the nucleotide siRNAs with these nucleotide differences have high target mRNA silencing ability. siRNAs comprising the same are also within the scope of protection of the present disclosure.

[0079] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0080] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 123. Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 124. It is a chid sequence. 5'-UCGAAUUACCUACUCAAUZ 11 -3' (SEQ ID NO: 123), 5'-Z 12 AUUGAGUAGGUAAUUCGA-3' (SEQ ID NO: 124) However, the above Z 12 is the first nucleotide at the 5' end of the antisense strand, and Z 12 is selected from A, U, G or C; Z 11 is Z 12 is a nucleotide complementary to In some embodiments, Z 11 is U and Z 12 is A.

[0081] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 121, and the length of said nucleotide sequence is Refers to the nucleotide sequence equivalent to column IV.

[0082] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is U, The base of nucleotide sequence IV is A, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is UU, and the base sequence of nucleotide sequence IV is AA, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is CUU and the base sequence of nucleotide sequence IV is AAG; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is ACUU, and the base sequence of nucleotide sequence IV is The base sequence is AAGU, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is UU and the base sequence of nucleotide sequence IV is AA; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0083] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0084] <The fourth siRNA> According to the present disclosure, the siRNA may be a fourth siRNA.

[0085] The fourth siRNA comprises a sense strand and an antisense strand, each nucleotide is independently a modified or unmodified nucleotide, and the sense strand is a the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are reverse-complementary to each other at least in part to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 182 is the same length and has no more than three nucleotide differences. Below. 5'-GAUAAUGCAUACAUCGAUZ 13 -3' (SEQ ID NO: 181), 5'-Z 14 AUCGAUGUAUGCAUUAUC-3' (SEQ ID NO: 182) However, Z 13 is A and Z 14 is U, and in said nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 4 16 wherein Z 16 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0086] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0087] In some embodiments, the nucleotide sequence I is There is no more than one nucleotide difference between the nucleotide sequence and / or Nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:182 is less than or equal to one.

[0088] In some embodiments, the nucleotide sequence II and the nucleic acid sequence shown in SEQ ID NO: 182 are The nucleotide difference between the nucleotide sequence of 16 including the difference at the position of Z 16 is selected from A, C, or G. In some embodiments, the nucleotide difference is , Z 16 is the difference in position, Z 16 is selected from A, C, or G. In terms of shape, Z 15 is Z 16 The nucleotide difference is the complementary nucleotide to the nucleotide siRNAs with these nucleotide differences have high target mRNA silencing ability. siRNAs comprising the same are also within the scope of protection of the present disclosure.

[0089] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0090] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 183. Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184. It is a chid sequence. 5'-GAUAAUGCAUACAUCGAUZ 15 -3' (SEQ ID NO: 183), 5'-Z 16 AUCGAUGUAUGCAUUAUC-3' (SEQ ID NO: 184) However, the above Z 16 is the first nucleotide at the 5' end of the antisense strand, and Z 16 is selected from A, U, G or C; Z 15 is Z 16 is a nucleotide complementary to In some embodiments, Z 15 is A and Z 16 is U.

[0091] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 181 and the length of said nucleotide sequence Refers to the nucleotide sequence equivalent to column IV.

[0092] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is A, The base of nucleotide sequence IV is U, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is CA, and the base sequence of nucleotide sequence IV is UG, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is The base sequence of string III is ACA and the base sequence of nucleotide sequence IV is UGU; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is UACA, and the base sequence of nucleotide sequence IV is The base sequence is UGUA, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is CA and the base sequence of nucleotide sequence IV is UG; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0093] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0094] <The fifth siRNA> According to the present disclosure, the siRNA may be a fifth siRNA. The iRNA comprises a sense strand and an antisense strand, and each nucleotide of the siRNA is and the sense strand has nucleotide sequence I, each of which is independently modified or unmodified nucleotide. the antisense strand comprises nucleotide sequence II and a nucleotide sequence preceding nucleotide sequence I; The nucleotide sequence II is a double-stranded region formed in a reverse-complementary manner at least in a part thereof, The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 are equal in length, The nucleotide difference is three or less, and is shown in nucleotide sequence II and SEQ ID NO: 242. The nucleotide sequences that are compared are of equal length and differ by no more than three nucleotides. 5'-GAAUAACGCAACUUUCUAZ 17 -3' (SEQ ID NO: 241), 5'-Z 18 UAGAAAGUUGCGUUAUUC-3' (SEQ ID NO: 242) However, Z 17 is U and Z 18 is A, and in said nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 8 20 wherein Z 20 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0095] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0096] In some embodiments, the nucleotide sequence I is There is no more than one nucleotide difference between the nucleotide sequence and / or Nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:242 is less than or equal to one.

[0097] In some embodiments, the nucleotide sequence II and the nucleic acid sequence shown in SEQ ID NO: 242 are The nucleotide difference between the nucleotide sequence of 20 including the difference at the position of Z 20 is selected from U, C, or G. In some embodiments, the nucleotide difference is , Z 20 is the difference in position, Z 20 is selected from U, C, or G. In terms of shape, Z 19 is Z 20 The nucleotide difference is the complementary nucleotide to the nucleotide siRNAs with these nucleotide differences have high target mRNA silencing ability. siRNAs comprising the same are also within the scope of protection of the present disclosure.

[0098] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0099] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 243. Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244. It is a chid sequence. 5'-GAAUAACGCAACUUUCUAZ 19 -3' (SEQ ID NO: 243), 5'-Z 20 UAGAAAGUUGCGUUAUUC-3' (SEQ ID NO: 244) However, the above Z 20 is the first nucleotide at the 5' end of the antisense strand, and Z 20 is selected from A, U, G or C; Z 19 is Z 20 is a nucleotide complementary to In some embodiments, Z 19 is U and Z 20 is A.

[0100] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 241 and the length of said nucleotide sequence Refers to the nucleotide sequence equivalent to column IV.

[0101] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is A, The base of nucleotide sequence IV is U, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is GA, and the base sequence of nucleotide sequence IV is UC, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is AGA and the base sequence of nucleotide sequence IV is UCU; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is CAGA, and the base sequence of nucleotide sequence IV is The base sequence is UCUG, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is CA and the base sequence of nucleotide sequence IV is UG; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0102] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0103] <6th siRNA> According to the present disclosure, the siRNA may be a sixth siRNA.

[0104] The sixth siRNA comprises a sense strand and an antisense strand, each nucleotide is independently a modified or unmodified nucleotide, and the sense strand is a the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are reverse-complementary to each other at least in part to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 302 is the same length and has no more than three nucleotide differences. Below. 5'-AACUUUCUAUUUCAAGAUZ 21 -3' (SEQ ID NO: 301), 5'-Z 22 AUCUUGAAAUAGAAAGUU-3' (SEQ ID NO: 302) However, Z 21 is U and Z 22 is A, and in said nucleotide sequence I, position Z 21 Nucleotide Z corresponding to 23 and in said nucleotide sequence II, position Z2 Nucleotide Z corresponding to 2 24 wherein Z 24 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0105] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0106] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are There is no more than one nucleotide difference between the nucleotide sequence and / or Nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:302 is less than or equal to one.

[0107] In some embodiments, the nucleotide sequence II and the nucleic acid sequence shown in SEQ ID NO: 302 are The nucleotide difference between the nucleotide sequence of 24 including the difference at the position of Z 24 is selected from U, C, or G. In some embodiments, the nucleotide difference is , Z 24 is the difference in position, Z 24 is selected from U, C, or G. In terms of shape, Z 23is Z 24 The nucleotide difference is the complementary nucleotide to the nucleotide siRNAs with these nucleotide differences have high target mRNA silencing ability. siRNAs comprising the same are also within the scope of protection of the present disclosure.

[0108] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0109] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 303. Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 304. It is a chid sequence. 5'-AACUUUCUAUUUCAAGAUZ 23 -3' (SEQ ID NO: 303), 5'-Z 24 AUCUUGAAAUAGAAAGUU-3' (SEQ ID NO: 304) However, the above Z 24 is the first nucleotide at the 5' end of the antisense strand, and Z 24 is selected from A, U, G or C; Z 23 is Z 24 is a nucleotide complementary to In some embodiments, Z 23 is U and Z 24 is A.

[0110] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 301 and the length of said nucleotide sequence Refers to the nucleotide sequence equivalent to column IV.

[0111] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is C, The base of nucleotide sequence IV is G, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is GC, and the base sequence of nucleotide sequence IV is GC, and in this case, the sense strand and the anti-sense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is CGC and the base sequence of nucleotide sequence IV is GCG; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is ACGC, and the base sequence of nucleotide sequence IV is The base sequence is GCGU, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is GC, the base sequence of nucleotide sequence IV is GC, In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0112] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0113] The following describes the nucleotide sequence V, the nucleic acid sequence, the nucleotide modifications in the siRNA, and The description of the modified sequence can be applied to any one of the first to sixth siRNAs. That is, unless otherwise specified, the following description of siRNA refers to a first siRNA, a second siRNA, siRNA, third siRNA, fourth siRNA, fifth siRNA or sixth siRNA For example, a particular siRNA should be considered a description of the NA. If not, "the siRNA further comprises a nucleotide sequence V" means "the 1 siRNA, 2 siRNA, 3 siRNA, 4 siRNA, 5 siRNA the RNA or the sixth siRNA further comprises the nucleotide sequence V."

[0114] In some embodiments, the antisense strand further comprises the nucleotide sequence V. nucleotide sequence V is 1 to 3 nucleotides in length, and the 3 The 3' end of the antisense strand is bound to the 3' end, forming the 3' overhanging end of the antisense strand. As a result, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure is 1 9 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22 , 21 / 23, 21 / 24, 22 / 23, 22 / 24, 22 / 25, 23 / 24, 23 / In some embodiments, the nucleotide sequence may be 25 or 23 / 26. Column V is 2 nucleotides in length, thereby forming siRNAs provided by the present disclosure. the length ratio of the sense strand to the antisense strand is 19 / 21, 21 / 23 or 23 / 25; Good too.

[0115] Each nucleotide in the nucleotide sequence V may be any nucleotide. In order to reduce the cost of synthesis, the nucleotide sequence V is preferably composed of two consecutive thymine deoxyribonucleotides (dTdT) or two consecutive uracil ribonucleotides Alternatively, the affinity of the antisense strand of the siRNA to the target mRNA is To improve potency, the nucleotide sequence V is a nucleotide sequence corresponding to the nucleotide sequence of the target mRNA. Thus, in some embodiments, the siRNA of the present disclosure The ratio of the length of the sense strand to the antisense strand is 19 / 21 or 21 / 23. The disclosed siRNAs have higher target mRNA silencing activity.

[0116] The nucleotide at the corresponding position in the target mRNA is the nucleotide at the 5' end of the third The third nucleotide refers to a nucleotide or sequence of nucleotides adjacent to the nucleotide sequence. The nucleotide sequence is substantially or completely reverse complementary to nucleotide sequence II. nucleotide sequence II and nucleotide sequence IV. A nucleotide sequence that is substantially or completely reverse complementary to the nucleotide sequence to be It is a column.

[0117] In some embodiments, the siRNA is The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5. The base strand comprises the nucleotide sequence shown in SEQ ID NO:6. 5'-AAAGUAACAACCAGUUUGZ3-3' (SEQ ID NO: 5), 5'-Z4CAAACUGGUUGUUACUUUGG-3' (SEQ ID NO: 6)

[0118] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:7. wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:8. 5'-CCAAAGUAACAACCAGUUUGZ3-3' (SEQ ID NO: 7), 5'-Z4CAAACUGGUUGUUACUUUGGUU-3' (SEQ ID NO: 8) However, Z4 is the first nucleotide at the 5' end of the antisense strand, and Z4 is selected from A, U, G or C, and Z3 is the nucleotide complementary to Z4.

[0119] In some embodiments, the siRNA is fused to the second siRNA. The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 65. The sense strand comprises the nucleotide sequence shown in SEQ ID NO:66. 5'-AUUGAACUUUCGAAUUACZ7-3' (SEQ ID NO: 65), 5'-Z8GUAAUUCGAAAGUUCAAUCC-3' (SEQ ID NO: 66)

[0120] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 67. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 68. Includes. 5'-GGAUUGAACUUUCGAAUUACZ7-3' (SEQ ID NO: 67), 5'-Z8GUAAUUCGAAAGUUCAAUCCAG-3' (SEQ ID NO: 68) However, Z8 is the first nucleotide at the 5' end of the antisense strand, and Z8 is selected from A, U, G or C, and Z7 is the nucleotide complementary to Z8.

[0121] In some embodiments, the siRNA is a nucleotide sequence of the siRNA relative to the third siRNA. The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 125. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:126. 5'-UCGAAUUACCUACUCAAUZ 11 -3' (SEQ ID NO: 125), 5'-Z 12 AUUGAGUAGGUAAUUCGAAA-3' (SEQ ID NO: 126)

[0122] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 127. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 128. Contains arrays. 5'-UUUCGAAUUACCUACUCAAUZ 11 -3' (SEQ ID NO: 127) , 5'-Z 12 AUUGAGUAGGUAAUUCGAAAGU-3' (SEQ ID NO: 12 8) However, the above Z 12is the first nucleotide at the 5' end of the antisense strand, and Z 12 is selected from A, U, G or C; Z 11 is Z 12 is a nucleotide complementary to do.

[0123] In some embodiments, the siRNA is The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 185. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:186. 5'-GAUAAUGCAUACAUCGAUZ 15 -3' (SEQ ID NO: 185), 5'-Z 16 AUCGAUGUAUGCAUUAUCUG-3' (SEQ ID NO: 186)

[0124] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 187. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 188. Contains arrays. 5'-CAGAUAAUGCAUACAUCGAUZ 15 -3' (SEQ ID NO: 187) , 5'-Z 16 AUCGAUGUAUGCAUUAUCUGUA-3' (SEQ ID NO: 18 8) However, the above Z 16 is the first nucleotide at the 5' end of the antisense strand, and Z 16 is selected from A, U, G or C; Z 15 is Z 16 is a nucleotide complementary to do.

[0125] In some embodiments, the siRNA is The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 245. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:246. 5'-GAAUAACGCAACUUUCUAZ 19 -3' (SEQ ID NO: 245), 5'-Z 20 UAGAAAGUUGCGUUAUUCUC-3' (SEQ ID NO: 246)

[0126] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 247. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 248. Contains arrays. 5'-GAGAAUAACGCAACUUUCUAZ 19 -3' (SEQ ID NO: 247) , 5'-Z 20 UAGAAAGUUGCGUUAUUCUCUG-3' (SEQ ID NO: 24 8) However, the above Z 20 is the first nucleotide at the 5' end of the antisense strand, and Z 20 is selected from A, U, G or C; Z 19 is Z 20 is a nucleotide complementary to do.

[0127] In some embodiments, the siRNA is The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 305. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:306. 5'-AACUUUCUAUUUCAAGAUZ 23 -3' (SEQ ID NO: 305), 5'-Z 24 AUCUUGAAAUAGAAAGUUGC-3' (SEQ ID NO: 306)

[0128] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 307. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 308. Contains arrays. 5'-GCAACUUUCUAUUUCAAGAUZ 23 -3' (SEQ ID NO: 307) , 5'-Z 24 AUCUUGAAAUAGAAAGUUGCGU-3' (SEQ ID NO: 30 8) However, the above Z 24 is the first nucleotide at the 5' end of the antisense strand, and Z 24 is selected from A, U, G or C; Z 23 is Z 24 is a nucleotide complementary to do.

[0129] In some embodiments, the siRNA described in this disclosure is selected from the group consisting of siRNAs described in Tables 1a-1f. siKNa1, siKNa2, siKNb1, siKNb2, siKNc1, siKNc2, siKNd1, siKNd2, siKNe1, siKNe2, siKNf 1 and siKNf2.

[0130] As discussed above, each nucleotide in the siRNA of the present disclosure may be independently modified or is an unmodified nucleotide. In some embodiments, each of the siRNAs of the present disclosure All nucleotides are unmodified nucleotides. Some or all of the nucleotides in the disclosed siRNAs are modified nucleotides. These modifications on the nucleotide residues allow the siRNA of the present disclosure to suppress KNG gene expression. This does not appreciably impair or destroy the function of the device.

[0131] In some embodiments, the siRNA of the present disclosure comprises at least one modified nucleotide. In the context of this disclosure, the term "modified nucleotide" refers to a nucleotide A nucleotide or nucleotide in which the 2' hydroxyl group of the ribose group of the nucleotide has been replaced with another group. The term "modified nucleotide" refers to a nucleotide analogue or a nucleotide having a modified base. The siRNA clearly weakened or abolished the gene expression suppression function of siRNA. For example, JK Watts, GF Deleavey, and MJ Damha,Chemically modified siRNA: to ols and applications. Drug Discov Today, 2008,13(19-20): 842-55. This is also fine.

[0132] In some embodiments, the sense strand or the siRNA provided by the present disclosure The antisense strand has at least one modified nucleotide, and / or At least one of the phosphate ester groups is a phosphate ester group having a modifying group. In other words, at least one single stranded phosphate in the sense strand and the antisense strand At least some of the phosphate groups and / or ribose groups in the sugar backbone have a modified group. The ribose group may be a phosphate group and / or a modified group.

[0133] In some embodiments, the nucleic acid in the sense strand and / or the antisense strand In some embodiments, the nucleotides are all modified nucleotides. Each nucleotide in the sense strand and the antisense strand of the siRNA provided herein is unique. They are either fluoro-modified or non-fluoro-modified nucleotides.

[0134] The inventors of the present disclosure have surprisingly found that the siRNAs described in the present disclosure can be used in animal studies. Achieve a high balance between plasma stability and gene silencing efficiency in found.

[0135] In some embodiments, the fluoro-modified nucleotide is and located in nucleotide sequence II, from the 5' end to the 3' end, At least the nucleotides at positions 7, 8, and 9 of sequence I are fluoro-modified nucleotides; From the 5' end to the 3' end, at least the second, sixth, first and The nucleotides at positions 4 and 16 are fluoro-modified nucleotides.

[0136] In some embodiments, the fluoro-modified nucleotide is and a fluoro-modified nucleotide in nucleotide sequence I located at nucleotide sequence II; nucleotide sequence I, At least the nucleotides at positions 7, 8, and 9 are fluoro-modified nucleotides, The fluoro-modified nucleotides in nucleotide sequence II are 7 or less, At least the 2nd, 6th, 14th and 16th nucleotides of sequence II are fluoro-modified nucleotides. It's Chid.

[0137] In some embodiments, from the 5' end to the 3' end, in the sense strand, and the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of the nucleotide sequence I are and the remaining nucleotides in the sense strand are non-fluoro-modified nucleotides. the antisense strand is a fluoro-modified nucleotide from the 5' end to the 3' end In the nucleotide sequence II, The nucleotides at positions 4 and 16 are fluoro-modified nucleotides in the antisense strand. The nucleotides at the remaining positions are non-fluoro modified nucleotides.

[0138] In the context of this disclosure, a "fluoro-modified nucleotide" refers to a nucleotide that has a ribose residue that is The hydroxy group at the 2'-position of the group is substituted with fluorine, and the structure is represented by the following formula (7): A "non-fluoro modified nucleotide" refers to a nucleotide in which the ribose moiety of the nucleotide A nucleotide in which the 2'-hydroxy group of the nucleotide is replaced with a non-fluorine group, or a nucleotide In some embodiments, each non-fluoro modified nucleotide is a nucleoside. A nucleotide in which the 2'-hydroxyl group of the ribose group of the nucleotide is replaced with a non-fluorine group It is one independently selected from a nucleotide analog.

[0139] Nucleotides in which the 2' hydroxyl group of the ribose group is replaced with a non-fluorine group are , known to those skilled in the art, and these nucleotides include 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted Alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides The nucleic acid may be one selected from the group consisting of nucleotides, nucleotides, and 2'-deoxynucleotides.

[0140] In some embodiments, the 2'-alkoxy modified nucleotide is shown in formula (8): In some embodiments, the 2'-OMe nucleotide is a methoxy modified nucleotide (2'-OMe). The 2'-substituted alkoxy modified nucleotide is, for example, a 2'-O-methionyl nucleotide represented by formula (9): In some embodiments, the nucleotides may be 2'-oxyethyl modified nucleotides (2'-MOE). In the present invention, the 2'-amino modified nucleotide (2'-NH2) is shown in formula (10). In some embodiments, the 2'-deoxynucleotide (DNA) is represented by formula (11): .

[0141] [ka]

[0142] Nucleotide analogs are compounds that can replace nucleotides in nucleic acids. , adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, Refers to a group whose structure is different from that of uracil ribonucleotide or thymine deoxyribonucleotide. In some embodiments, the nucleotide analog is an isonucleotide, a bridged nucleotide, Bridged nucleic acid (BNA) or acyclic nucleic acid It may be a do.

[0143] BNA refers to constrained or inaccessible nucleotides. BNAs are five-membered, six-membered The cyclic or seven-membered rings are bridged with a "fixed" C3'-endo sugar puckering. Typically, the bridge is introduced at the 2'- and 4'-positions of the ribose to form 2',4'-BN. In some embodiments, the BNA is provided as shown in formula (12): LNA shown in formula (13), ENA shown in formula (14), cET BNA shown in formula (14), etc. It is also possible.

[0144] [ka]

[0145] Acyclic nucleotides are nucleotides in which the sugar ring of the nucleotide is opened. In some embodiments, the acyclic nucleotide is an unlocked nucleic acid represented by formula (15): (UNA), or glycerol nucleic acid (GNA) as shown in formula (16).

[0146] [ka]

[0147] In the above formula (15) and formula (16), R is H, OH or alkoxy (O-alkyl). The signal is selected from the following:

[0148] Isonucleotides are nucleotides in which the position of the base in the ribose ring changes. In some embodiments, the isonucleotide is represented by the formula (17) or ( 18), in which the base is transferred from the 1'-position to the 2'- or 3'-position of the ribose ring. It may also be a mixture.

[0149] [ka]

[0150] In the compounds represented by the above formulas (17) and (18), Base is A, U, G, C or T, where R is selected from H, OH, F or the non-fluorine groups described above.

[0151] In some embodiments, the nucleotide analog is an isonucleotide, an LNA, The present invention is directed to a method for treating a pulmonary circulation disorder (PHL) comprising the steps of: ENA, cET, UNA, and GNA. In the form, each non-fluoro modified nucleotide is a methoxy modified nucleotide. In this context, the methoxy-modified nucleotide is a nucleotide having a 2'-hydroxyl group of the ribose group. It refers to a nucleotide in which the silyl group is replaced with methoxy.

[0152] In the context, "fluoro-modified nucleotide", "2'-fluoro-modified nucleotide" "Nucleotides in which the 2'-hydroxy group of the ribose group is replaced with fluorine" and "2'- "Nucleotide having a fluororibose group" and "Nucleotide having a fluororibose group" have the same meaning. A compound having the structure shown in formula (7) in which the 2'-hydroxy group of the Refers to "methoxy-modified nucleotide," "2'-methoxy-modified nucleotide," and "ribo "Nucleotides in which the 2'-hydroxy group of the 2'-hydroxyl group is substituted with methoxy" and "2'-Methoxy "Nucleotide having a silibose group" and "nucleotide having a silibose group" have the same meaning. The 2'-hydroxy group of the bosyl group is replaced with methoxy, and the structure is shown in formula (8). This refers to a compound that

[0153] In some embodiments, the siRNA of the present disclosure has the following modifications: That is, from the 5' end to the 3' end, in the sense strand, Nucleotides at positions 7, 8, and 9 or positions 5, 7, 8, and 9 of nucleotide sequence I are fluoro-modified. nucleotides at the remaining positions in the sense strand, and nucleotides of the second and sixth sequences of nucleotide sequence II in the antisense strand; , 14, and 16 or 2, 6, 8, 9, 14, and 16 are fluoro-modified nucleotides. nucleotide, and the remaining nucleotides in the antisense strand are methoxy-modified It is a nucleotide.

[0154] In some embodiments, the siRNA of the present disclosure has the following modifications: That is, from the 5' end to the 3' end, The nucleotides at positions 5, 7, 8 and 9 of nucleotide sequence I are fluoro-modified nucleotides. and the remaining nucleotides in the sense strand of the siRNA are methoxy-modified nucleotides. from the 5' end to the 3' end in the antisense strand of the siRNA Nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence II are fluoro-modified. The remaining nucleotides in the antisense strand of the siRNA are is an oxy-modified nucleotide, Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I are fluoro-modified nucleotides. and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides. , from the 5' end to the 3' end, The nucleotides at positions 2, 6, 14, and 16 of peptide sequence II are fluoro-modified nucleotides. and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. Chid, Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 7, 8 and 9 of nucleotide sequence I are fluoro-modified nucleotides; The remaining nucleotides in the sense strand of the iRNA are methoxy-modified nucleotides, nucleotides in the antisense strand of the siRNA from the 3' end to the 3' end The nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoro-modified nucleotides. , the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. It is.

[0155] In some embodiments, the siRNA provided by the present disclosure comprises a siRNA selected from the group consisting of those listed in Tables 1a-1f. The siKNa1-M1, siKNa1-M2, siKNa1-M3, and siK Na2-M1, siKNa2-M2, siKNa2-M3, siKNb1-M1, siK Nb1-M2, siKNb1-M3, siKNb2-M1, siKNb2-M2, siK Nb2-M3, siKNc1-M1, siKNc1-M2, siKNc1-M3, siK Nc2-M1, siKNc2-M2, siKNc2-M3, siKNd1-M1, siK Nd1-M2, siKNd1-M3, siKNd2-M1, siKNd2-M2, siK Nd2-M3, siKNe1-M1, siKNe1-M2, siKNe1-M3, siK Ne2-M1, siKNe2-M2, siKNe2-M3, siKNf1-M1, siK Nf1-M2, siKNf1-M3, siKNf2-M1, siKNf2-M2 and si KNf2-M3.

[0156] The siRNAs with the above modifications are not only inexpensive but also resistant to ribonucleases in the blood. It is possible to make nucleic acids less susceptible to cleavage, thereby improving the stability of the nucleic acid and reducing the nucleic acid fragmentation. The modified siRNA has the property of being resistant to hydrolysis by enzymes. High RNA suppression activity.

[0157] In some embodiments, the sense and anti-strands of the siRNA provided by the present disclosure In the sense strand, at least one single strand has a small number of phosphate ester groups in its phosphate-sugar backbone. At least some of the phosphate groups have a modifying group. The phosphate ester group having a modifying group is a phosphodiester bond in the phosphate ester group. At least one oxygen atom of the thiophosphate group is replaced with a sulfur atom. In some embodiments, the phosphate ester group having the modifying group is represented by formula (1): It is a thiophosphate group having the structure.

[0158] [ka]

[0159] These modifications stabilize the double-stranded structure of siRNA and enhance the specificity of base pairing. and maintain a high affinity.

[0160] In some embodiments, in the siRNA provided by the present disclosure, thiophosphoryl The acid ester group is 2′-nucleotide with the first nucleotide at either end of the sense or antisense strand. between the 1st nucleotide and the 2nd nucleotide at either end of the sense or antisense strand, between the nucleotide and the third nucleotide, or any combination thereof In some embodiments, the thiophosphate is present in a carboxylic acid moiety. Terminator groups are present attached at all of the above positions except the 5' end of the sense strand. In embodiments, the thiophosphate group is at all of the above positions except the 3' end of the sense strand. In some embodiments, the thiophosphate group is bonded to is present bound at at least one of the positions. Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second nucleotide and the third nucleotide from the 3' end of the sense strand, The first and second nucleotides from the 5' end of the antisense strand Between, The second and third nucleotides from the 5' end of the antisense strand Between, The first and second nucleotides from the 3' end of the antisense strand Between, and The second and third nucleotides from the 3' end of the antisense strand Between.

[0161] In some embodiments, the siRNA provided by the present disclosure comprises a siRNA selected from the group consisting of those listed in Tables 1a-1f. siKNa1-M1S, siKNa1-M2S, siKNa1-M3S, siKNa2-M1S, siKNa2-M2S, siKNa2-M3S, siKNb1- M1S, siKNb1-M2S, siKNb1-M3S, siKNb2-M1S, siK Nb2-M2S, siKNb2-M3S, siKNc1-M1S, siKNc1-M2S , siKNc1-M3S, siKNc2-M1S, siKNc2-M2S, siKNc2 -M3S, siKNd1-M1S, siKNd1-M2S, siKNd1-M3S, si KNd2-M1S, siKNd2-M2S, siKNd2-M3S, siKNe1-M1 S, siKNe1-M2S, siKNe1-M3S, siKNe2-M1S, siKNe 2-M2S, siKNe2-M3S, siKNf1-M1S, siKNf1-M2S, s iKNf1-M3S, siKNf2-M1S, siKNf2-M2S and siKNf2- It is one of the M3S.

[0162] In some embodiments, the 5'-terminal nucleotide of the antisense strand of the siRNA The nucleotide is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

[0163] The conventional 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide is As known to those of skill in the art, for example, a 5'-phosphate nucleotide may have the following structure: .

[0164] [ka]

[0165] See, for example, Anastasia Khvorova and Jonathan K. Watts,The chemical evolution of oligo nucleotide therapies of clinical utility . Nature Biotechnology,2017,35(3): 238~4 8 discloses the following four types of 5'-phosphate analog modified nucleotides:

[0166] [ka]

[0167] In the formula, R is selected from H, OH, methoxy, and fluorine; Base represents a base; A, U , C, G or T.

[0168] In some embodiments, the 5'-phosphate nucleotide is a 5'-phosphate nucleotide as shown in formula (2): A 5'-phosphate analog modified nucleotide is a nucleotide that contains a 5'-phosphate modification. Vinyl phosphate ester (5'-(E)-vinylphospho) represented by formula (3) nucleotide containing a thiol ester (E-VP) modification, or a thiol ester (E-VP) modification, as shown in formula (5), It is a phosphate modified nucleotide.

[0169] In some embodiments, the siRNA provided by the present disclosure comprises a siRNA selected from the group consisting of those listed in Tables 1a-1f. siKNa1-M1P1, siKNa1-M2P1, and siKNa1-M3 P1, siKNa2-M1P1, siKNa2-M2P1, siKNa2-M3P1, s iKNa1-M1SP1, siKNa1-M2SP1, siKNa1-M3SP1, si KNa2-M1SP1, siKNa2-M2SP1, siKNa2-M3SP1, siK Nb1-M1P1, siKNb1-M2P1, siKNb1-M3P1, siKNb2- M1P1, siKNb2-M2P1, siKNb2-M3P1, siKNb1-M1SP 1, siKNb1-M2SP1, siKNb1-M3SP1, siKNb2-M1SP1 , siKNb2-M2SP1, siKNb2-M3SP1, siKNc1-M1P1, s iKNc1-M2P1, siKNc1-M3P1, siKNc2-M1P1, siKNc 2-M2P1, siKNc2-M3P1, siKNc1-M1SP1, siKNc1-M 2SP1, siKNc1-M3SP1, siKNc2-M1SP1, siKNc2-M2 SP1, siKNc2-M3SP1, siKNd1-M1P1, siKNd1-M2P1 , siKNd1-M3P1, siKNd2-M1P1, siKNd2-M2P1, siK Nd2-M3P1, siKNd1-M1SP1, siKNd1-M2SP1, siKNd 1-M3SP1, siKNd2-M1SP1, siKNd2-M2SP1, siKNd2 -M3SP1, siKNe1-M1P1, siKNe1-M2P1, siKNe1-M3 P1, siKNe2-M1P1, siKNe2-M2P1, siKNe2-M3P1, s iKNe1-M1SP1, siKNe1-M2SP1, siKNe1-M3SP1, si KNe2-M1SP1, siKNe2-M2SP1, siKNe2-M3SP1, siK Nf1-M1P1, siKNf1-M2P1, siKNf1-M3P1, siKNf2- M1P1, siKNf2-M2P1, siKNf2-M3P1, siKNf1-M1SP 1, siKNf1-M2SP1, siKNf1-M3SP1, siKNf2-M1SP1 , siKNf2-M2SP1, and siKNf2-M3SP1.

[0170] The inventors of the present disclosure have demonstrated that the plasma and lysosomal stability of the above siRNAs provided by the present disclosure We unexpectedly found that not only was the activity of the compound significantly improved, but it also had high target mRNA suppression activity. .

[0171] The siRNA provided by the present disclosure can be prepared by a conventional siRNA preparation method in the art (e.g. For example, solid-phase synthesis and liquid-phase synthesis. Commercial customization services are already available. The use of mers to introduce modified nucleotide groups into the siRNAs described in this disclosure and methods for preparing nucleoside monomers having corresponding modifications, and modified nucleoside monomers. Methods for introducing leutide groups into siRNA are also well known to those skilled in the art.

[0172] <Drug Composition> The present disclosure relates to a drug comprising the above-mentioned siRNA as an active ingredient and a pharma- ceutically acceptable carrier. A composition is provided.

[0173] The pharma- ceutical acceptable carrier may be a carrier commonly used in the field of siRNA administration. Often, for example, magnetic nanoparticles (e.g. , nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes (carbon nanotubes, mesoporous silicon n), calcium phosphate nanoparticles rticles), polyethyleneimine (PEI) , polyamidoamine dendrimer (polyamidoamine (PAMAM) d endrimer), poly(L-lysine, PLL), chitosan (chitosan), 1,2-dioleoyl-3-trimethylammonium propane ( 1,2-dioleoyl-3-trimethylammonium-propane , DOTAP), poly(D- or L-lactic acid / glycolic acid copolymer (poly(D&L-lactide / glycolide copolymer) (actic / glycolic acid) copolymer, PLGA), poly(acetylacetonate) Poly(2-aminoethyl ethylene phosphate) Poly(N,N-dimethylaminoethylene phosphate), PPEEA) and poly(N,N-dimethylaminoethylene Poly(2-dimethylaminoethyl methacrylate) acrylate), PDMAEMA) and one or more of their derivatives. The present invention is not limited to these.

[0174] The content of siRNA and a pharma- ceutical acceptable carrier in the pharmaceutical composition is particularly However, there is no requirement that the amount of each component be in the range of 100-150% by weight, and the amount of each component may be in the range of 100-150% by weight. The weight ratio of the siRNA to the pharma- ceutically acceptable carrier may be 1:(1 to 500). In some embodiments, the weight ratio is 1:(1 to 50).

[0175] In some embodiments, the drug composition may contain other pharma- ceutically acceptable excipients. The additive may be one or more of various agents or compounds commonly used in the art. For example, the pharma- ceutically acceptable other additives may be a pH buffer, At least one of a protective agent and an osmolality regulator may be included.

[0176] The pH buffer solution is tris(hydroxymethylaminomethane hydrochloride) having a pH of 7.5 to 8.5. Buffer solution (tris(hydroxymethyl) aminomethane hyd rochloride buffer) and / or phosphate buffer of pH 5.5 to 8.5 For example, it may be a phosphate buffer solution having a pH of 5.5 to 8.5.

[0177] The protective agent is inositol, sorbitol, sucrose, trehalose, mannose. The drug composition may be at least one of maltose, lactose and glucose. The content of the protective agent may be 0.01 to 30% by weight based on the total weight of the composition.

[0178] The osmolality adjusting agent may be sodium chloride and / or potassium chloride. The content of the osmolality adjusting agent is such that the osmolality of the drug composition is 200 to 700 mOsm / kg. Depending on the desired osmolality, one skilled in the art can determine the osmolality of the The content of the osmotic regulator can be easily determined.

[0179] In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injectable solution. Alternatively, the lyophilized powder may be mixed with a liquid additive at the time of administration to form a liquid preparation. The liquid formulation may be administered by subcutaneous, intramuscular or intravenous injection, but is not limited thereto. First, administer the drug to the lungs by aerosol, or deliver the drug to other organ tissues (e.g., the liver) through the lungs by aerosol. In some embodiments, the administration may be to, but is not limited to, The pharmaceutical composition is adapted for intravenous administration.

[0180] In some embodiments, the drug composition may be in the form of a liposomal formulation. In some embodiments, the pharma- ceutically acceptable carrier for use in the liposomal formulation is The carrier is an amine-containing transfection compound (hereinafter also referred to as an organic amine), a co-lipid, The organic amines include, for example, organic amino acids and / or PEGylated (PEGylated) lipids. The lipids, co-lipids and PEGylated lipids were prepared as described in CN103380113A (the entirety of which is incorporated herein by reference). The amine-containing transfection compounds described herein or their pharmaceutical compositions are or one or more selected from the group consisting of a salt or derivative thereof which is acceptable for There may be multiple types.

[0181] In some embodiments, the organic amine is a compound described in CN103380113A. The compound may be a compound represented by formula (201) or a pharma- ceutically acceptable salt thereof.

[0182] [ka] During the ceremony, X 101 Or X 102 are each independently O, S, NA or CA, and A is hydrogen. Or C1-C 20 is a hydrocarbon chain, Y 101 or Z 101 are each independently C=O, C=S, S=O, CH-OH or S O2, R 101 , R 102 , R 103 , R 104 , R 105 , R 106 or R 107 Each each independently being hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain aliphatic group, a cyclic or an acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic group, substituted or unsubstituted, Branched or straight chain acyl groups, substituted or unsubstituted branched or straight chain aryl groups, substituted or unsubstituted substituted, branched or straight chain heteroaryl group; x is an integer from 1 to 10; n is an integer of 1 to 3, m is an integer of 0 to 20, and p is 0 or 1, If m=p=0, R 102 is hydrogen, When at least one of n or m is 2, R 103 and nitrogen in formula (201) , forming a structure shown in formula (202) or formula (203).

[0183] [ka] In the formula, g, e, and f each independently represent an integer from 1 to 6, and "HCC" represents a hydrocarbon chain. represents each * N represents a nitrogen atom in formula (201).

[0184] In some embodiments, R 103 is a polyamine. In another embodiment, R 103 is a ketal. In some embodiments, R in formula (201) 10 1 and R 102 Each of may independently be an optionally substituted or unsubstituted branched or straight chain alkyl group. alkyl or alkenyl, said alkyl or alkenyl having from 3 to about 20 carbon atoms; For example, 8 to about 18 carbon atoms and 0 to 4 double bonds, for example, 0 to 2 double bonds. It has a combination.

[0185] In some embodiments, when n and m are each independently a value of 1 or 3, R 103 may be any one of the following formulas (204) to (213).

[0186] [ka] In formulae (204) to (213), g, e, and f each independently represent an integer of 1 to 6. where each "HCC" represents a hydrocarbon chain and each * is R 103 and nitrogen in formula (201) Indicates possible bond points with the atom, and any * Each H on the position corresponds to a nitrogen atom in formula (201). It may be substituted for binding.

[0187] The compound of formula (201) was prepared according to the method described in CN103380113A. Good too.

[0188] In some embodiments, the organic amine is an organic amine represented by formula (214): and / or an organic amine represented by formula (215).

[0189] [ka]

[0190] The co-lipid may be cholesterol, a cholesterol analogue, and / or a cholesterol analogue. It is a derivative of The PEGylated lipid is 1,2-dipalmitamido-sn-glycero-3-phosphatidylcholine. Triethanolamine-N-[methoxy(polyethylene glycol)]-2000(1,2 -dipalmitoyl-sn-glycero-3-phosphatidylet hanolamine-N-[methoxy(polyethylene glyco l)]-2000).

[0191] In some embodiments, the pharmaceutical composition further comprises the organic amine, the auxiliary lipid, The molar ratio of the PEGylated lipids was (19.7-80):(19.7-80):(0.3- 50), and may be, for example, (50-70):(20-40):(3-20). .

[0192] In some embodiments, the siRNA of the present disclosure and the amine-containing transfection The drug composition particles formed by the injection reagent have an average diameter of about 30 nm to about 200 nm. Generally, the average diameter of the liposome particles is about 40 nm to about 135 nm, and more generally, the average diameter of the liposome particles is about 10 nm to about 50 nm. The diameter is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or The average diameter of the liposome particles is about 70 nm to about 90 nm. For example, the average diameter of the liposome particles is about 30, 40 0, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 1 40, 150 or 160 nm.

[0193] In some embodiments, the siRNA of the present disclosure and the amine-containing transfection In the drug composition formed by the coupling reagent, siRNA and total lipid (e.g., organic amine , auxiliary lipid and / or PEGylated lipid) weight ratio (weight / weight ratio) is about 1:1 to about 1:5 0, approx. 1:1~approx. 1:30, approx. 1:3~approx. 1:20, approx. 1:4~approx. 1:18, approx. 1:5~ About 1:17, about 1:5 to about 1:15, about 1:5 to about 1:12, about 1:6 to about 1:12, or For example, the weight ratio of siRNA to total lipids of the present disclosure is in the range of about 1:6 to about 1:10. Approximately 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13 , 1:14, 1:15, 1:16, 1:17 or 1:18.

[0194] In some embodiments, the pharmaceutical composition is marketed with each component present independently. In some embodiments, the present disclosure provides a liquid formulation. and a pharma- ceutical composition comprising the siRNA provided by may be prepared according to various known methods, and may be used according to the present disclosure instead of conventional siRNA. In some embodiments, the siRNA provided by the following method may be used. It may also be prepared as follows.

[0195] The organic amine, auxiliary lipid, and PEGylated lipid were suspended in alcohol at the above molar ratio and mixed uniformly. The amount of alcohol is adjusted so that the total mass concentration of the resulting lipid solution is 2 to 25%. The alcohol is determined to be, for example, 8 to 18 mg / mL. Pharmaceutically acceptable alcohols, such as ethanol, propylene glycol, benzyl Alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 30 0, polyethylene glycol 400, etc., are selected from alcohols that are liquid at around room temperature. The alcohol may be one or more of the above alcohols, and may be, for example, ethanol.

[0196] The siRNA provided by the present disclosure is dissolved in a buffered salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, and may be, for example, 0.1 to 0.2 M. The pH of the buffer salt solution is adjusted to 4.0 to 5.5, and may be, for example, 5.0 to 5.2. The amount of the buffer solution is preferably such that the siRNA concentration is 0.6 mg / mL or less, e.g., 0.2 to 100 mg / mL. The buffer salts are soluble acetate, soluble citrate, and soluble sucrose. One or more selected from the group consisting of sodium acetate and / or potassium acetate. It may be Umu.

[0197] After mixing the lipid solution and the siRNA aqueous solution, the resulting product was incubated at 40-60°C for at least The mixture is then incubated for another 2 minutes, e.g., 5 to 30 minutes, to obtain an incubated liposome preparation. The volume ratio of the iRNA aqueous solution is 1:(2–5).

[0198] The cultured liposome preparation is concentrated or diluted, impurities are removed, sterilized, and the liposome preparation is prepared according to the present disclosure. To obtain the provided pharmaceutical composition. Its physicochemical parameters include a pH of 6.5 - 8 and an encapsulation efficiency of 80% or more, a particle size of 40 - 200 nm, and a polydispersity index of 0 .30 or less, and an osmotic pressure of 250 - 400 mOsm / kg. For example, the physicochemical parameters may include a pH of 7.2 - 7.6, an encapsulation efficiency of 90% or more, a particle size of 60 - 100 nm, a polydispersity index of 0.20 or less, and an osmotic pressure of 300 - 400 mOsm / kg .

[0199] Here, concentration or dilution may be performed before removing impurities, after removing impurities, or simultaneously with impurity removal. As methods for removing impurities, various conventional methods may be adopted. For example , using a tangential flow system and a hollow fiber column, performing ultrafiltration under the condition of 100 KDa, and the ultrafiltration exchange solution may be a phosphate buffer (PBS) with a pH of 7.4. As the sterilization method , various conventional methods may be adopted. For example, it may be sterilized by filtration with a 0.22 μm filter .

[0200] <siRNA complex> The present disclosure provides an siRNA complex including the above siRNA and a complex group that is complexed and bound to the siRNA .

[0201] Generally, the complex group includes at least one target group that is pharmaceutically acceptable and any linker , and the siRNA, the linker, and the target group are sequentially bound . In some embodiments, the number of the target groups is 1 - 6. In some embodiments, the number of the target groups is 2 - 4. The siRNA molecule may be complexed to the complex group non-covalently or covalently. For example, it may be covalently complexed to the complex group The conjugation site between the siRNA and the conjugation group may be at the 3' end or the 3' end of the sense strand of the siRNA. may be at the 5' end of the antisense strand, or at the 5' end of the siRNA. In some embodiments, the conjugation site between the siRNA and the conjugation group may be in a row. is at the 3' end of the sense strand of the siRNA.

[0202] In some embodiments, the conjugated group is a phosphate group of a nucleotide, a 2'-hydroxyl group In some embodiments, the conjugated group may be linked to a hydroxyl group or a base. It may be linked to the 3'-hydroxy group, in which case the internucleotide is a 2'-5' linker. The conjugated groups are attached to the ends of the siRNA strands via phosphate diester bonds. When the nucleotide is linked to the phosphate group of a nucleotide, it is usually linked to the internal sequence of the siRNA. The various methods of attachment are described in Muthia et al. h Manoharan et.al. siRNA conjugates carr ying sequentially assembled trivalent N- acetylgalactosamine linked through nucleus osides elicit robust gene silencing in v ivo in hepatocytes. ACS Chemical biology ,2015,10 (5): 1181~7.

[0203] In some embodiments, the bond between the siRNA and the conjugated group is acid labile or reducible. These chemical bonds can be linked to the endosomal acidic environment of the cell. The siRNA can be released by decomposition. The conjugated group was bound to the sense strand of siRNA, and the effect of conjugation on siRNA activity was examined. can be reduced as much as possible.

[0204] In some embodiments, the pharma- ceutically acceptable targeting group is a pharma- ceutically acceptable targeting group that is suitable for use in the field of siRNA administration. Ligands commonly used in the art, such as the various ligands described in WO2009082607A2 The disclosure of which is incorporated herein by reference in its entirety. .

[0205] In some embodiments, the pharma- ceutically acceptable targeting group is cholesterol, bile lipophilic molecules such as juices, vitamins (e.g., tocopherols), and lipid molecules of different chain lengths; Polymers such as polyethylene glycol, polypeptides such as membrane-permeable peptides, and aptamers mers, antibodies, quantum dots, lactose, polylactose, mannose, galactose It contains sugars such as galactosamine (GalNAc) and folic acid (folate). , asialoglycoprotein, asialoglycoprotein residue, lipoprotein (e.g., high density lipoprotein , low density lipoproteins, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth Target molecules such as receptor ligands expressed in hepatic parenchymal cells, such as transferrin, or The ligand may be one or more selected from the ligands formed by derivatives.

[0206] In some embodiments, each of the ligands is a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is independently selected from the group consisting of is a ligand capable of binding to a receptor on the surface of liver cells. At least one of the ligands is capable of binding to a receptor on the surface of mammalian hepatocytes. In some embodiments, the at least one ligand is a receptor on the surface of human hepatocytes. In some embodiments, at least one ligand is capable of binding to is a ligand that can bind to the asialoglycoprotein receptor (ASGPR) on the liver surface. These types of ligands are known to those skilled in the art and generally act to bind to target cell surfaces. It binds to specific receptors on the surface and mediates the delivery of siRNA bound to the ligand to target cells. do.

[0207] In some embodiments, the pharma- ceutically acceptable targeting group is a target of a mammalian hepatocyte surface. Any one of the ligands that bind to the asialoglycoprotein receptor (ASGPR) on the surface In some embodiments, each ligand may be independently an asialoglycoprotein. Proteins, e.g. asialoorosomucoid (A SOR or asialofetuin (ASF). In some embodiments, the ligand is a sugar or a sugar derivative.

[0208] In some embodiments, at least one ligand is a sugar. In some embodiments, each ligand is a sugar. Another ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide or sugar derivative. In an embodiment, at least one of the ligands may be a monosaccharide, a disaccharide, or a trisaccharide. In some embodiments, at least one ligand is a modified sugar. In some embodiments, each ligand is a modified sugar. Each ligand may be independently a polysaccharide, a modified polysaccharide, a monosaccharide, a modified monosaccharide, a polysaccharide derivative, or In some embodiments, each or at least one of the ligands is selected from the group consisting of monosaccharide derivatives. At least one of glucose and its derivatives, mannan and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives conductors, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives The glycerol derivative is selected from the group consisting of glycerol, glycerol, fructose and its derivatives, and sialic acid.

[0209] In some embodiments, each of the ligands is D-mannopyranose, L-mannopyranose, Pyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose Glucose, L-glucose, D-galactose, L-galactose, α-D-mannose D-mannose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranolate α-D-glucopyranose, β-D-glucopyranose, α-D-glucofurano β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranolate α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose Ranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N -Acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionyl Galactosamine, Nn-Butyrylgalactosamine, N-Isobutyrylgalactosamine , 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucose Glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-di Deoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy Oxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid , 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1 -Thio-6-O-trityl-α-D-glucopyranoside, 4-Thio-β-D-galactopyranoside Ranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio O-α-D-glucoheptopyranoside, 2,5-anhydro-D-allonitrile, riboflavin from D-ribose, D-4-thioribose, L-ribose or L-4-thioribose Other options for the ligand include, for example, CN1053780. 82A, the disclosure of which is incorporated herein by reference in its entirety. Can be enjoyed.

[0210] In some embodiments, the siRNA complex includes a pharma- ceutically acceptable target. The target group may be galactose or N-acetylgalactosamine, and may be galactose or The N-acetylgalactosamine molecule may be monovalent, divalent, trivalent or tetravalent. The monovalent, divalent, trivalent, and tetravalent groups are composed of siRNA molecules and galactose as a targeting group, respectively. The siRNA complex formed from the conjugate group containing galactosamine or N-acetylgalactosamine molecules The molar ratio of siRNA molecules to galactose or N-acetylgalactosamine molecules in It should be understood to mean 1:1, 1:2, 1:3 or 1:4. In an embodiment, the pharma- ceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, the siRNA described herein is N-acetylglucosamine. When conjugated to a conjugated group containing an amine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, the siRNA described in the present disclosure is N-acetylglucosamine. When conjugated to a galactosamine-containing conjugating group, the N-acetylgalactosamine molecule is trivalent.

[0211] The targeting group may be attached to the siRNA molecule via a suitable linker, and those skilled in the art will appreciate that the targeting group may be linked to the siRNA molecule via a suitable linker. An appropriate linker can be selected depending on the specific type of the target group. For the types of targeting groups and methods of binding to siRNA, see WO2015006740A2. Reference may be made to the disclosure of which, the contents of which are incorporated herein by reference in their entirety.

[0212] In some embodiments, when the targeting group is N-acetylgalactosamine, A suitable linker may be the structure shown in formula (301).

[0213] [ka] During the ceremony, k is an integer from 1 to 3; L A is a chain portion containing an amide bond having a structure represented by formula (302), L A has one of the target groups and one of the L C Bonded to the part by ether bond will be done.

[0214] [ka] L B is a chain portion containing N-acylpyrrolidine having the structure shown in formula (303). The chain portion has a carbonyl group at one end thereof, and the L C Bonded to the part by an amide bond and has an oxygen group at the other end, and is bound to the siRNA via a phosphate ester bond.

[0215] [ka] L C is hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane. is a divalent to tetravalent linker group based on hydroxymethylaminomethane, C is an oxygen source Each of the L's is bonded to an ether bond via a A is bonded to the a moiety through a nitrogen atom The L B The part is connected to the

[0216] In some embodiments, n=3 and L C Trihydroxymethylaminomethyl In the case of a tetravalent linker group based on a phenyl group, -(L A ) 3 Trihydroxy Methylaminomethane-L B - N-acetylgalactosamine and siRNA molecules The structure of the siRNA complex formed by binding is shown in the following formula (304).

[0217] [ka] In the formula, the double helix structure represents the siRNA.

[0218] Similarly, the conjugation site between the siRNA and the conjugation group is at the 3' end or 5' end of the sense strand of the siRNA. It may be located at the 5' end of the antisense strand, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. This is also possible.

[0219] In some embodiments, the 3' end of the sense strand of the siRNA described herein is , linker-(L A ) 3 Trihydroxymethylaminomethane-L B -Three N-A Covalently conjugated to a cetylgalactosamine (GalNAc) molecule, The molar ratio of GalNAc molecules is 1:3, and the structure is shown in the following formula (305): An RNA complex (hereinafter also referred to as (GalNAc)3-siRNA) is obtained.

[0220] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense domain of the siRNA. It is attached to the 3' end of the strand.

[0221] In some embodiments, when the targeting group is N-acetylgalactosamine, A suitable linker may be the structure shown in formula (306).

[0222] [ka] During the ceremony, l is an integer from 0 to 3; * represents the site on the linker that is attached to the targeting group via an ether bond, # represents the site in the linker that is bound to the siRNA via a phosphate bond. .

[0223] In some embodiments, when l=2, the siRNA complex has the formula (30 7) has the structure shown in

[0224] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense domain of the siRNA. It is attached to the 3' end of the strand.

[0225] The siRNA complexes were synthesized by methods already described in detail in the prior art. For example, WO2015006740A2 describes a method for preparing a complex containing multiple siRNAs. The siR of the present disclosure can be prepared by methods well known to those skilled in the art. For example, WO2014025805A1 describes the compound shown in formula (305): A method for preparing the structure has been described, and Rajeev et al. 15, 16, 903-908, a method for preparing the structure shown in formula (307) was described.

[0226] In some embodiments, the siRNA complex has the structure shown in formula (308): has.

[0227] [ka] During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. , m1, m2, and m3 are independently an integer selected from 2 to 10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H , or C1-C 10 Alkyl groups, C1-C 10 Halogenated alkyl groups and C1-C 10 a alkoxy groups; R3 is a group having the structure shown in formula A59.

[0228] [ka] wherein E1 is OH, SH, or BH2, and Nu is an siRNA of the disclosure.

[0229] R2 is a linear alkylene group having a length of 1 to 20 carbon atoms, Carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenira group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterosi Crylene group and C5-C 10 one or more selected from the group consisting of heteroarylene groups; Optionally substituted, R2 is C1-C 10 Alkyl groups, C6-C 10 Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1- C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkyl Phenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, Halogen Substituents: -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N( C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), -N(C1-C 10 Alkyl group)(C1-C10 Alkylphenyl group), -NH( C1-C 10 alkylphenyl group), cyano group, nitro group, -COH, -C(O)O( C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 Alki ), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1 -C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group )C(O)(C1-C 10 alkyl group), -N(C1-C 10 Alkyl group)C(O)(F phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphe Nyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group , -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 Alkyl group ), -SO2NH(phenyl group), -NHSO2(C1-C 10 alkyl group), -NHS O2 (phenyl group) and -NHSO2 (C1-C 10 halogenated alkyl groups) and optionally having one or more substituents selected from the group consisting of Each L1 is independently a straight chain alkylene group of 1 to 70 carbon atoms in length, or multiple carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10Alkynylene group, C6-C 10 Arylene group, C3-C1 8 Heterocyclylene groups and C5-C 10 Heteroarylene groups are each selected from the group consisting of or more optionally substituted, L1 being C1-C 10 Alkyl groups, C6-C 10 Aryl Group , C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C1 0 alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C1 0 alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated A alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH 2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C1 0 alkyl group), -N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group) , -NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -CO2H, -C (O)O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 Alkyl group), -CONH2, -NHC( O)(C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C(O)(C1-C 10 alkyl group), -N(C1-C 10 Alkyl group)C (O)(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 a alkylphenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, -SO2(C1-C 10 alkyl group), -SO2 (phenyl group), -SO2 (C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 (alkyl group) , -NHSO2(phenyl group) and -NHSO2(C1-C 10 Halogenated alkyl group and optionally having one or more substituents selected from the group consisting of:

[0230] In some embodiments, L1 is selected from the group A1 through A26, or any combination thereof. The structures and definitions of A1 to A26 are as follows:

[0231] [ka] In the formula, each j1 is independently an integer from 1 to 20, and each j2 is independently an integer from 1 to 20. the law of nature, Each R' is independently C1-C 10 is an alkyl group, Each Ra is independently selected from the group consisting of groups of formulae A27-A45, and any combination thereof. do.

[0232] [ka] Each Rb is independently C1-C 10 is an alkyl group, JPEG2025038097000024.jpg5170 represents the site to which the group is covalently attached.

[0233] For convenience, L1 is defined as a linear alkylene group, but may also include, for example, the above-mentioned substitutions and / or Amines and alkenyl groups resulting from substitution that may not be linear or may have different names For purposes of this disclosure, the length of L1 is determined by dividing the length of the is the number of atoms in the chain that connects the bond points. A ring obtained by replacing a nitrogen atom (e.g., heterocyclylene or heteroarylene) is formed by atoms.

[0234] M1 represents a targeting group, and its definition and selectable range are the same as those of the targeting group described above. In some embodiments, each M1 is an asialoglycoprotein on the surface of a mammalian liver cell. The ligand is one independently selected from ligands having affinity for the protein receptor.

[0235] M1 has affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells. In some embodiments, n1 is an integer from 1 to 3. n3 may be an integer of 0 to 4, and the M1 target in the siRNA complex may be In some embodiments, ensure that the number of n1+ n3≧2, so that the number of M1 targeting groups is at least 3, and the M1 targeting groups and the liver The siRNA complex can more easily bind to the asialoglycoprotein receptor on the surface of the It promotes the uptake of the drug into cells through endocytosis (intracellular uptake). As can be seen from experiments, when the number of M1 targeting groups is three or more, The mechanism by which the binding of the α-amino group to the asialoglycoprotein receptor on the liver surface is improved is unclear. Considering various aspects such as ease of synthesis, structure / process cost, and delivery efficiency, In some embodiments, n1 is an integer from 1 to 2, and n3 is an integer from 0 to 1; And n1+n3=2~3.

[0236] In some embodiments, m1, m2, or m3 is independently selected from an integer of 2 to 10. When the M1 targeting group is selected, the spatial position between the M1 targeting group and the asialoglycoprotein on the liver surface is determined. The siRNA conjugates provided by the present disclosure can be adapted to bind to protein receptors. In order to make the structure simpler, easier to synthesize, and / or less costly, several In this embodiment, m1, m2, and m3 each independently represent an integer of 2 to 5; In some embodiments, m1=m2=m3.

[0237] R 10 , R 11 , R 12 , R 13 , R 14 or R 15 But, H, C1-C 10 Alkyl group , C1-C 10 Halogenated alkyl groups and C1-C 10 Independently from each alkoxy group When one of the above is selected, any of them can change the properties of the siRNA complex of the present disclosure. It will be understood by those skilled in the art that the objectives of the present disclosure can be achieved without the need for some In the embodiment, R 10 , R 11 , R 12 , R 13 , R 14or R 15 are respectively In some embodiments, R1 is independently selected from H, a methyl group, or an ethyl group. 0, R 11 , R 12 , R 13 , R 14 or R 15 are both H.

[0238] R3 is a group having the structure shown in formula A59, where E1 is OH, SH, or BH2. In view of the availability of preparation raw materials, in some embodiments, E1 is OH or It's SH.

[0239] R2 is selected to achieve a bond between the N atom on the nitrogen-containing backbone and A59. In the present context, a "nitrogen-containing backbone" is R 10 , R 11 , R 12 , R 13 , R 14 Reach BiR 15 It refers to a chain structure in which carbon atoms with carbon atoms bonded to them and N atoms are bonded to each other. and R2 is any group capable of binding the A59 group to the N atom on the nitrogen-containing backbone in a suitable manner. In some embodiments, the linker group may be any linker group selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, When preparing the siRNA complex of formula (308), the R2 group is preferably a nitrogen-containing backbone. The site bonded to the N atom above and the site bonded to the P atom in R3 are both included. In some embodiments, the N atom on the nitrogen-containing backbone in R2 may be The bonded site forms an amide bond with the N atom and is bonded to the P atom on R3. forms a phosphate bond with the P atom, and in some embodiments, R2 is B5 , B6, B5' or B6'.

[0240] [ka] During the ceremony, JPEG2025038097000026.jpg5170 represents the site to which the group is covalently attached.

[0241] The value of q2 may range from 1 to 10, and in some embodiments, q 2 is an integer from 1 to 5.

[0242] L1 binds the M1 targeting group to the N on the nitrogen-containing backbone, forming a siRNP shown in formula (308). In some embodiments, the L 1 is a combination of one or more bonds selected from the groups of formulae A1 to A26. In an embodiment, L1 is selected from A1, A4, A5, A6, A8, A10, A11 and A13. In some embodiments, L is a combination of one or more bonds selected from the following: A combination of at least two bonds selected from A1, A4, A8, A10 and A11. In some embodiments, L1 is at least one selected from A1, A8, and A10. Both are combinations of two bonds.

[0243] In some embodiments, the length of L1 is 3 to 25 atoms, 3 to 20 atoms, It may be 4 to 15 atoms or 5 to 12 atoms. The length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21 pieces, 22 pieces, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 It is an atom.

[0244] In some embodiments, j1 is an integer from 2 to 10. In some embodiments, j1 is an integer from 3 to 5. In some embodiments, j2 is an integer from 2 to 10. In some embodiments, j2 is an integer from 3 to 5. R' is a C1-C4 alkyl group. In some embodiments, R' is an alkyl group, and in some embodiments, R' is a methyl group, an ethyl group, and an isopropyl group. Ra is one of A27, A28, A29, A30 and A31. In some embodiments, Ra is A27 or A28. Rb is C1-C 5 alkyl group, and in some embodiments, Rb is a methyl group, an ethyl group, an isopropyl group, In some embodiments, the aryl group is one of a propyl group and a butyl group. By selecting j1, j2, R', Ra, and Rb, respectively, the M1 target group and the nitrogen The binding to the N atom on the containing skeleton is realized, and the spatial position between the M1 targeting group and the liver surface is adjusted. It is further adapted for binding to the asialoglycoprotein receptor.

[0245] In some embodiments, the siRNA complex has the formula (403), (404), (405), (406), (407), (408), (409), (410), (411 ), (412), (413), (414), (415), (416), (417), (4 18), (419), (420), (421) or (422).

[0246] [ka] JPEG2025038097000028.jpg186170JPEG2025038097000029.jpg184170JPEG2025038097000030.jpg173170 JPEG2025038097000031.jpg208170JPEG2025038097000032.jpg193170JPEG2025038097000033.jpg149170

[0247] In some embodiments, the P atom in formula A59 is any atom in the siRNA sequence. For example, the P atom in formula A59 may be bonded to any available position of the siRNA. It may be bound to one nucleotide of either the sense strand or the antisense strand, and any number of In some embodiments, the P atom in formula A59 is any one of the P atoms in the sense strand of the siRNA. In some embodiments, the P atom in formula A59 is linked to one nucleotide. is attached to the end of the sense strand or antisense strand of the siRNA, and in some embodiments In the formula A59, the P atom is bound to the end of the sense strand of the siRNA. The portion is the first four nucleotides from one end of the sense strand or the antisense strand. In some embodiments, the P atom in formula A59 is a nucleotide of the siRNA. and attached to the end of the sense strand or the antisense strand, in some embodiments, The P atom in is attached to the 3' end of the sense strand of the siRNA. When the siRNA complex represented by formula (308) is bound to the above position, the siRNA complex represented by formula (308) enters the cell. When the siRNA is unwound after loading, it releases the single antisense strand of the siRNA, and the KNG It is possible to block the process of mRNA translation into protein and suppress KNG gene expression. Cut.

[0248] In some embodiments, the P atom in formula A59 is a nucleotide in the siRNA. Any possible position on the nucleotide, for example, the 5' position of the nucleotide, the 2' position of the nucleotide, It may be attached to the 3' position of the nucleotide or to the base of the nucleotide. In the formula A59, the P atom forms a phosphodiester bond to It may be attached to the 2', 3' or 5' position of the nucleotide in the siRNA. In some embodiments, the P atom in formula A59 is at the 3' end of the sense strand of the siRNA. The 3' hydroxyl group of the nucleotide is dehydrogenated to the oxygen atom (A59 is The P atom in the nucleotide sequence can be regarded as the P atom of the phosphate group contained in the siRNA. The P atom in formula A59 is the 2 nucleotide of one nucleotide in the sense strand of the siRNA. or is attached to the nucleotide by replacing the hydrogen in the '-hydroxy group, The P atom at 59 is the 5' hydroxyl group of the 5' terminal nucleotide of the sense strand of the siRNA. It is attached to the nucleotide by replacing a hydrogen in the group.

[0249] The inventors of the present disclosure have found that the siRNA complex of the present disclosure has significantly improved stability in plasma and The target effect was reduced and the KNG mRNA silencing activity was enhanced. In some embodiments, the siRNA of the present disclosure is as shown in Tables 1a-1. f. siRNA complexes containing these siRNAs. The combination exhibits higher KNG mRNA silencing activity.

[0250] [Table 1a] JPEG2025038097000035.jpg229170 [Table 1b] JPEG2025038097000037.jpg226170 [Table 1c] JPEG2025038097000039.jpg228170 [Table 1d] JPEG2025038097000041.jpg229170 [Table 1e] JPEG2025038097000043.jpg230170 [Table 1f] JPEG2025038097000045.jpg227170 where the capital letters C, G, U, and A represent the base sequence of a nucleotide, and the lower case letter m represents the The letter m indicates that the 1 nucleotide adjacent to the left is a methoxy-modified nucleotide. The lowercase letter f indicates that the 1 nucleotide adjacent to the left of the letter f is a fluoro-modified nucleotide. The lowercase letter s indicates that the two nucleotides on either side of the letter are thiol. P1 is bonded to the 1-membered ring adjacent to the right of P1 through a phosphate group. One nucleotide is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. In some embodiments, P1 represents a VP, Ps or represents P, and the combination letter VP is one adjacent letter to the right of the combination letter VP. Nucleotides are vinyl phosphate esters (5'-(E)-vinylphosphonates e, E-VP) modified nucleotide, and the combination letter Ps represents the combination letter One nucleotide adjacent to the right of Ps is a phosphorothioate-modified nucleotide The capital letter P indicates that the nucleotide immediately to the right of the letter P is a 5'-phosphoryl nucleotide. This indicates that the acid is a nucleotide.

[0251] In the siRNA or siRNA complex described in this disclosure, each adjacent nucleotide The bonds between the diesters are phosphate diester bonds or thiophosphate diester bonds. The non-bridging oxygen or sulfur atoms in the ester or thiophosphate bond are negatively charged. It is charged with a hydroxyl or sulfhydryl group. The hydrogen ions at the hydroxyl or sulfhydryl groups may be partially or completely substituted. may be entirely substituted with a cation. The cation may be any cation, for example a metal Cation, ammonium ion NH4 + may be one of the organic ammonium cations. In view of improving solubility, in some embodiments, the cation is an alkali metal cation. Ammonium cations and quaternary ammonium cations formed by tertiary amines. The alkali metal ion is one or more selected from the group consisting of K + and / or N a + The cation formed by the tertiary amine may be Ammonium ions formed by the reaction with N,N-diisopropylethylamine Therefore, the ammonium ion formed by the si The RNA or siRNA complex may be present at least in part as a salt. In embodiments, the non-crosslinking of phosphodiester or thiophosphodiester bonds The oxygen or sulfur atoms are at least partially bonded to sodium ions, The siRNA or siRNA complex is present as a sodium salt or partial sodium salt. There is.

[0252] As will be apparent to those skilled in the art, nucleoside monomers having corresponding modifications can be used. The modified nucleotide groups can be introduced into the siRNAs described in this disclosure by using Methods for preparing nucleoside monomers having corresponding modifications and methods for preparing modified nucleoside monomers are provided. Methods for introducing nucleotide groups into siRNA are also well known to those skilled in the art. The leioside monomers may be purchased commercially or may be prepared by known methods. stomach.

[0253] <Preparation of siRNA complex represented by formula (308)> The siRNA complex represented by formula (308) may be prepared by any reasonable synthetic route. good.

[0254] In some embodiments, the siRNA complex of formula (308) can be prepared in the following manner: The method can be carried out under the conditions of phosphoramidite solid phase synthesis. Depending on the nucleotide types and order of the sense and antisense strands of the siRNA, the 3' Nucleoside monomers are sequentially linked from the 5' to the 5', and the linkage of each nucleoside monomer is The process involves four reactions: deprotection, coupling, capping, and oxidation or sulfurization. and isolating and annealing the sense and antisense strands of the siRNA. , the siRNA of the present disclosure.

[0255] The method also includes reacting a compound of formula (32) under coupling reaction conditions and in the presence of a coupling reagent. 1) The compound shown in 1) is mixed with a nucleoside monomer or a nucleotide bound to a solid support. and contacting the compound of formula (321) with the sequence to form a nucleotide sequence. The compound represented by formula (321) below is a conjugated molecule. It is also called.

[0256] [ka] During the ceremony, R4 is capable of binding to siRNA represented by Nu in the compound represented by formula (308). In some embodiments, R4 is a si which is represented by a covalent bond to Nu. In some embodiments, R4 is a group capable of binding to RNA. A group capable of being conjugated to any functional group of the siRNA represented by Nu via a diester bond, Each S1 was independently prepared by substituting all active hydroxy groups in M1 with YCOO- groups. each Y is a methyl group, a trifluoromethyl group, a difluoromethyl group, a fluoromethyl group, ethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl group, n-propyl group Independent of propyl, isopropyl, phenyl, halophenyl and alkylphenyl groups In some embodiments, Y is a methyl group.

[0257] n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , The definitions and selectable ranges of L1 and M1 are as described above.

[0258] R4 provides a bond with the N atom on the nitrogen-containing backbone and is represented by the formula (308). In some embodiments, the aryl group is selected to provide a suitable reactive site for the synthesis of the A-complex. In this case, R4 is an R2 linker group or a protected R2 linker group, and It contains a functional group that can form the structure shown in A59 with siRNA.

[0259] In some embodiments, R4 is an siRNA or nucleoside molecule designated Nu. a first functional group capable of forming a phosphite ester with a group on the monomer; and a hydroxy group. or a second functional group capable of reacting with an amino group to form a covalent bond, and a solid support bound by a bond. In some embodiments, the first functional group is a phosphoramidite, a hydroxy group or a protected hydroxy group. In an embodiment, the second functional group is a phosphoramidite, a carboxy group or a carbo In some embodiments, the second functional group is a phosphate. a solid support that is bound to another moiety of the molecule, said covalent bond being a hydroxy or amino group; In some embodiments, the solid support is formed of a phosphate ester In some embodiments, the bond is a carboxylic acid ester bond or an amide bond. In one embodiment, the solid support is a resin.

[0260] In some embodiments, the first functional group is a hydroxy group, -OR k or the formula ( C3), and the second functional group is represented by the formula (C1), (C2), (C3), ( It includes the structure shown in (C1') or (C3').

[0261] [ka] In the formula, q1 is an integer of 1 to 4, X is O or NH, and M + is a cation and R k is a hydroxy protecting group, SPS represents a solid phase support, JPEG2025038097000048.jpg5170 represents the site to which the group is covalently attached.

[0262] In some embodiments, the first functional group is a phosphine oxide, as shown in formula (C3): The phosphoramidite group may be at any position on the nucleotide. Coupling with a hydroxy group, for example, a hydroxy group at the 2' position or a hydroxy group at the 3' position This is reacted to form a phosphite, which is then oxidized or sulfurized to form the diphosphate shown in formula A59. The conjugated molecule is conjugated to the siRNA by forming an ester or thiophosphate bond. In this case, even if the second functional group is not present, the compound represented by formula (321) can be obtained. The compound can be conjugated to a nucleotide, and the siRNA complex shown in formula (308) is In this case, the synthesis of the compound by a method such as phosphoramidite solid phase synthesis is not affected. After obtaining the sense strand or antisense strand of siRNA, a compound represented by formula (321) and In a nucleotide sequence, the hydroxy group on the terminal nucleotide is reacted with the nucleotide, and subsequent oxidation or During the sulfurization process, phosphate diester bonds or thiophosphate bonds are formed. Then, a compound represented by formula (321) is conjugated to siRNA.

[0263] In some embodiments, the first functional group comprises a protected hydroxy group. In some embodiments, the second functional group comprises a group capable of reacting with a solid support. The reaction provides a composite molecule comprising a solid support. The functional group of 2 is a carboxy group, a carboxyl group, or a carboxyl group as shown in formula (C1), (C2) or (C3). The second functional group includes a carboxylate or a phosphoramidite. In the case of a compound having a phosphate, the compound of formula (321) can be combined with a solid support, e.g., an arsenic salt in a resin. The hydroxyl or amino group is subjected to an esterification or amidation reaction to form a carboxylic acid ester bond. The second functional group is a phosphoryl group, and the second functional group is a phosphoryl group. When the compound contains an amidite functional group, the compound represented by formula (321) can be reacted with a general-purpose solid support, e.g. The hydroxyl groups on the resin are then coupled and oxidized to form phosphate diester bonds. The solid phase carrier is then bound to the solid phase carrier to form a complex molecule. Starting from the product, nucleoside monomers were synthesized according to the phosphoramidite solid phase synthesis method. The sense strand or antisense strand of the siRNA is obtained by binding the complex group. In the phosphoramidite solid phase synthesis process, the first functional group is deprotected and then Coupling of phosphoramidite groups in nucleoside monomers under coupling reaction conditions Make them do it.

[0264] In some embodiments, the first functional group is a hydroxy group or a protected hydroxy group. The second functional group includes an oxy group, as shown in formula (C1') or (C3'): Carboxylic acid ester bonded solid phase support or amide bonded solid phase support The solid phase carrier may be a solid support or a solid support bound by a phosphate ester bond. Using the compound represented by formula (321) instead of a solid support, phosphoramidite solid phase synthesis The nucleoside monomers are linked in sequence according to the method, and the sense siRNA to which the composite group is linked is The sense strand or the antisense strand is obtained.

[0265] In some embodiments, the carboxylate is -COO - M + This may be expressed as So, M + is a cation, e.g., a metal cation, the ammonium cation NH + , In one embodiment, the gold cation is one selected from the group consisting of organic ammonium cations. The group ion is one selected from alkali metal ions, for example, K + Or Na + in In order to improve the solubility and facilitate the reaction, some embodiments are In this case, the organic ammonium ion is the ammonium cation formed by a tertiary amine. or quaternary ammonium cations, e.g., ammonia formed by triethylamine. Ammonium ion or ammonium ion formed by N,N-diisopropylethylamine In some embodiments, the carboxylate is triethylamine carboxylate. salt or N,N-diisopropylethylamine carboxylate.

[0266] In some embodiments, R4 is selected from the group consisting of formula (B9), (B10), (B9′), (B1 0'), (B11), (B12), (B11') or (B12') .

[0267] [ka] In the formula, q1 is an integer of 1 to 4, q2 is an integer of 1 to 10, and X is O or NH. Ri, M +is a cation and R k is a hydroxy protecting group, SPS represents a solid phase support, JPEG2025038097000050.jpg5170 represents the site to which the group is covalently attached. In some embodiments, q1 is 1 or In some embodiments, q2 is an integer from 1 to 5. In some embodiments, R4 comprises a structure shown in formula (B9) or (B10). In some embodiments, R4 comprises a structure shown in formula (B11) or (B12).

[0268] In some embodiments, R k Tr (trityl group), MMTr (4-methoxy trityl group), DMTr (4,4'-bismethoxytrityl group), TMTr (4,4', 4″-trimethoxytrityl group). In some embodiments, R k DMTr, i.e., 4,4'-bismethoxytrityl (4,4'-dimetho xytrityl).

[0269] The definition of L1 is as described above.

[0270] In some embodiments, L1 binds the M1 targeting group to an N atom on the nitrogen-containing backbone. , is used to provide liver targeting functionality to the siRNA complex shown in formula (308). In some embodiments, L1 includes any one or combination of A1 to A26. nothing.

[0271] From the above description, it will be readily understood by those skilled in the art that the phosphorylation Compared with the midite solid phase synthesis method, the above first functional group and the optional second functional group allow for complex The nucleotide sequence may be inserted at any possible position in the nucleotide sequence, for example at the end of the nucleotide sequence, and obtaining an siRNA complex represented by formula (308) linked to the end of the nucleotide sequence. Accordingly, unless otherwise specified, the following refers to siRNA complexes and / or complexes. In the description of the preparation of molecules, terms such as "deprotection", "coupling", "capping", When referring to reactions such as "oxidation", "sulfurization", etc., the term refers to the phosphoramidite nucleic acid reactions known in the art. It should be understood that reaction conditions and reagents relating to solid phase synthesis methods also apply to these reactions. Exemplary reaction conditions and reagents are described in detail below.

[0272] In some embodiments, each S1 is independently M1. In the formula, each S1 independently represents a hydroxy group in M1, and In some embodiments, each S1 is independently a group protected by a protecting group. All of the active hydroxy groups present in are protected with hydroxy protecting groups. In embodiments, any hydroxy protecting group known to one of skill in the art can be used to protect the active hydroxyl group in M1. In some embodiments, the protected hydroxyl group can be used to protect the hydroxyl group. The hydroxy group may be represented by the formula YCOO-, where each Y is independently C1-C 10 Al Alkyl groups and C6-C 10 aryl groups, wherein the C1-C 10 Alkyl Groups and C6-C 10 The aryl group is optionally substituted with one or more substituents, said substituents being , halogen, and a C1-C6 alkyl group. In the formula, each Y is independently a methyl group, a trifluoromethyl group, a difluoromethyl group, a monomethyl group, Monofluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group and C1-C6 arsenic group alkylphenyl groups.

[0273] In some embodiments, each S1 is independently selected from the group consisting of formulae A46-A54. is selected from the group.

[0274] [ka]

[0275] In some embodiments, S1 is of formula A49 or A50.

[0276] In some embodiments, each Y is a methyl group, a trifluoromethyl group, a difluoro Methyl group, fluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group , ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group and alkyl group. In some embodiments, Y is independently selected from the group consisting of phenyl and phenyl. It is a ethyl group.

[0277] As described above, the method for preparing the siRNA complex represented by formula (308) is The other strand of the siRNA is synthesized (for example, the sense strand of the siRNA to which the conjugated molecule is bound in the above step). When the siRNA is synthesized, the antisense strand of the siRNA is further synthesized according to a solid phase synthesis method. and vice versa), isolating and annealing the sense and antisense strands. Specifically, in the isolating step, the nucleotide sequence and / or The solid support bound to the conjugate molecule is cleaved and the necessary protecting groups are removed (in this case In this case, each S1 group in the compound of formula (321) is converted to the corresponding M1 target group. The sense strand (or antisense strand) of the siRNA to which the complex molecule is bound and the corresponding The antisense strand (or sense strand) is obtained, and the sense strand and the antisense strand are annealed to form a bilayer. A double-stranded RNA structure is formed to obtain the siRNA complex represented by formula (308).

[0278] In some embodiments, the method for preparing the siRNA complex represented by formula (308) is Under coupling reaction conditions and in the presence of a coupling reagent, a compound of formula (321) can be obtained. contacting the first nucleoside monomer at the 3' end of the sense strand or the antisense strand; The compound represented by formula (321) is attached to the first nucleotide in the sequence, and phospho The desired sense or antisense nucleotide species are synthesized under the conditions of fluoroamidite solid phase synthesis. Depending on the type and order, nucleoside monomers are linked in the 3' to 5' direction to form siRNP. A step of synthesizing a sense strand or an antisense strand of A, comprising synthesizing a compound represented by formula (321): The compound has in R4 a first functional group containing a protected hydroxy group and a compound of formula (C1') or (C 3') is a compound containing a second functional group having the structure shown in Before coupling with the side monomer, the compound of formula (321) is deprotected and each nucleoside is The bond between the doped monomers is subjected to four reactions: deprotection, coupling, capping, oxidation or sulfurization. obtaining a sense strand or an antisense strand of a nucleic acid having a conjugated group; Under the conditions of solid-phase synthesis of 1,000 nucleotides, the sequence and type of nucleotides in the antisense or sense strand are determined. The nucleoside monomers are linked in sequence from 3' to 5' to form the antisense strand of the nucleic acid. Or the sense strand is synthesized, and the bonds of each nucleoside monomer are deprotected, coupled, capped, and The reaction involves four steps: cleavage, oxidation, or sulfurization, followed by removal of the protecting group, cleavage from the solid support, and isolation. The process includes purifying the sense strand and the antisense strand, and annealing the strand.

[0279] In some embodiments, the method for preparing the siRNA complex represented by formula (308) is The types and order of nucleotides in the sense strand or antisense strand of the double-stranded siRNA The nucleoside monomers are linked in sequence from 3' to 5' to form the sense strand and the α strand. The antisense strand is synthesized, and the bonds of each nucleoside monomer are deprotected, coupled, and capped. The reaction involves four steps: ping, oxidation or sulfurization, and the sense strand bound to a solid support, and Obtaining the antisense strand bound to the substrate; coupling reaction conditions and coupling reagents In the presence of The antisense strand is contacted with a carrier and a first phosphoramidite group is attached to R4. A compound represented by formula (321) containing a functional group is bound to the sense strand or antisense strand. The protecting groups are removed, the solid support is cleaved, and each is isolated and purified, and the complex group-bound s The method includes the steps of obtaining a sense strand or an antisense strand of an iRNA and annealing it.

[0280] In some embodiments, the P atom in formula A59 is a sense atom in the siRNA. The method for preparing the siRNA complex shown in formula (308) is as follows: (1) Compound represented by formula (321) (The compound represented by formula (321) has a bond in R4. Protected hydroxy group OR k and a first functional group comprising the formula (C1') or (C3'): a hydroxy-protecting group R k and removing the deprotected product under coupling reaction conditions and in the presence of a coupling reagent. The product is contacted with a nucleoside monomer to form a nucleoside bonded to the solid support by a conjugate molecule. obtaining a domonomer, (2) Starting with the nucleoside monomer that is bound to the solid support by the conjugated molecule, The sense strand of siRNA was synthesized by phosphoramidite solid-phase synthesis in the '-5' direction. To do, (3) Synthesize the antisense strand of siRNA by phosphoramidite solid-phase synthesis. To do so, (4) The sense and antisense strands of the siRNA are isolated and annealed to give the following formula (308): The method includes obtaining a siRNA complex as shown in

[0281] In step (1), the protecting group R in the compound represented by the above formula (321) k Remove The method includes contacting a compound of formula (321) with a deprotecting reagent under deprotecting conditions. The deprotection conditions include a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The reaction time is 30 to 300 seconds, and in some embodiments, 50 to 150 seconds. The drug is selected from trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. The deprotection reagent may be one or more of the above-mentioned compounds, and in some embodiments is dichloroacetic acid. The molar ratio of the compound represented by formula (321) is 10:1 to 1000:1, and some In another embodiment, the ratio is 50:1 to 500:1.

[0282] The coupling reaction conditions and coupling reagents may be any suitable for the coupling reaction. Any suitable conditions and reagents may be used. In some embodiments, the solid phase synthesis method employed The same conditions and reagents as in the coupling reaction in may be used.

[0283] In some embodiments, the coupling reaction conditions include a reaction temperature of 0 to 50° C. In some embodiments, the reaction temperature is 15 to 35° C. The molar ratio of the oxoside monomer is 1:1 to 1:50, and in some embodiments is 1:2 to The molar ratio of the compound represented by formula (321) to the coupling reagent is 1:1 to 1:5. The ratio may be 1:50, and in some embodiments is 1:3 to 1:10, and the reaction time is 200 to 3000 seconds, in some embodiments 500 to 1500 seconds. The reagents were 1H-tetrazole, 5-ethylthio 1H-tetrazole, and 5-benzylthio 1H-tetrazole. H-tetrazole, and in some embodiments, 5- The coupling reaction may be carried out in an organic solvent. The organic solvent is selected from anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane. In some embodiments, the compound represented by formula (3) is anhydrous acetonitrile. For the compound shown in 21), the amount of the organic solvent is 3 to 50 L / mol, and some In this embodiment, the concentration is 5 to 20 L / mol.

[0284] In step (2), the nucleic acid prepared in the above step is synthesized by a phosphoramidite nucleic acid solid phase synthesis method. Starting with a nucleoside monomer that is bound to a solid support by a conjugated molecule, 3'-5' The sense strand SS of the second siRNA complex is synthesized in the direction of the nucleotide sequence of the complex. The 3′ end of the sense strand is linked to the 3′ end of the

[0285] Other conditions for the solid phase synthesis in steps (2) and (3) include deprotection of nucleoside monomers. Protection conditions, type and amount of deprotection reagent, coupling reaction conditions, type and amount of coupling reagent Dosage, conditions for capping reaction, type and dosage of capping reagent, conditions for oxidation reaction, oxidation The types and amounts of reagents, sulfurization reaction conditions, and the types and amounts of sulfurization reagents are included. Various reagents, dosages and conditions are used.

[0286] For example, in some embodiments, in steps (2) and (3), the solid phase synthesis Then, the following conditions may be used:

[0287] The deprotection conditions for the nucleoside monomers are a temperature of 0 to 50° C., and in some embodiments, 1 The temperature is 5 to 35° C., and the reaction time is 30 to 300 seconds, and in some embodiments, 50 to 150 seconds. and the deprotection reagent is trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, chloroacetic acid and in some embodiments, dichloroacetic acid. The molar ratio of the deprotection reagent to the 4,4'-dimethoxytrityl protecting group on the solid support is It may be from 2:1 to 100:1, and in some embodiments is from 3:1 to 50:1.

[0288] The coupling reaction conditions are at a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The molar ratio of the nucleic acid sequence bound to the solid support to the nucleoside monomer is 1:1 to 1: 50, and in some embodiments 1:5 to 1:15, bound to a solid support. The molar ratio of the nucleic acid sequence to be coupled is 1:1 to 1:100. The reaction time and the selection of coupling reagents are the same as above. be.

[0289] The capping reaction conditions include a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The reaction time is 5 to 500 seconds, and in some embodiments, 10 to 100 seconds. The selection of capping reagent is the same as above. The total amount of capping reagent and the amount of the solid support bound to the capping reagent are the same as above. The molar ratio of the nucleic acid sequence to the nucleic acid sequence is 1:100 to 100:1, and in some embodiments, 1:10 to 1 0:1. Equimolar amounts of acetic anhydride and N-methylimidazole are used as capping reagents. When using the method described above, acetic anhydride, N-methylimidazole, and the nucleic acid sequence to be bound to the solid support are used. The molar ratio may be from 1:1:10 to 10:10:1, and in some embodiments is 1:1 :2~2:2:1.

[0290] The oxidation reaction conditions are a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The reaction time is from 1 to 100 seconds, in some embodiments from 5 to 50 seconds, and the oxidation reagent is In some embodiments, it is iodine (provided in some embodiments as iodine water). The molar ratio of the oxidation reagent to the nucleic acid sequence bound to the solid support in the coupling step is 1. The ratio may be from 5:1 to 100:1, and in some embodiments, from 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a 3:1 mixture of tetrahydrofuran:water:pyridine. The sulfurization reaction is carried out in a mixed solvent of 1 to 1:1:3. The sulfurization reaction conditions are temperature of 0 to 50°C, several In some embodiments, the temperature is 15 to 35° C., and the reaction time is 50 to 2000 seconds. is 100 to 1000 seconds, and the sulfurizing reagent is, in some embodiments, xanthan hydride. The molar ratio of the sulfurization reagent to the nucleic acid sequence that is bound to the solid support in the coupling step is The ratio is from 10:1 to 1000:1, and in some embodiments, from 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a solvent mixture of acetonitrile:pyridine=1:3 to 3: It is carried out in a mixed solvent of 1:1.

[0291] After all nucleoside monomers have been coupled and before annealing, the method further comprises: The method further comprises isolating the sense and antisense strands of A. Methods for isolating are known to those skilled in the art. Generally, the synthesized nucleotide sequence is cleaved from the solid support and the base is phosphorylated. This includes removing the protecting groups on the acid groups and on the ligands, purifying and desalting.

[0292] The synthesized nucleotide sequence is cleaved from the solid support and the bases, phosphate groups and ligands are removed. The above protecting groups can be removed by standard cleavage and deprotection methods used in siRNA synthesis. For example, the resulting solid support-bound nucleotide sequence may be dissolved in concentrated aqueous ammonia. In the deprotection process, the protecting group YCOO- of A46 to A54 is converted to a hydroxy group. and converting the S1 group to the corresponding M1 group to obtain the siRNA complex shown in formula (308). Here, the concentrated ammonia water is 25 to 30% by weight of ammonia water. The amount of concentrated ammonia water is 0.2 ml / mL for the siRNA sequence of interest. It may be from μmol to 0.8 ml / μmol.

[0293] If the synthesized nucleotide sequence has at least one 2'-TBDMS protection, The method comprises the steps of: cleaving the nucleotide sequence from the solid support by cleaving the nucleotide sequence with triethylamine trihydrofluoride; This further comprises removing the 2'-TBDMS protection by contacting the In this case, the corresponding nucleotide in the obtained siRNA sequence of interest contains two free The dose of pure triethylamine trihydrofluoride is The concentration may be 0.4 ml / μmol to 1.0 ml / μmol for the corresponding siRNA sequence. In this manner, the siRNA complex shown in formula (308) can be obtained.

[0294] Methods of purification and desalting are well known to those skilled in the art. For example, preparative ion chromatography. Purification of nucleic acids using a chromatographic purification column and gradient elution with NaBr or NaCl The product was collected, combined, and desalted using a reversed-phase chromatography purification column. It is possible.

[0295] In the thus obtained siRNA complex represented by formula (308), the nucleotide A non-bridging oxygen atom or sulfur atom in the phosphodiester or thiophosphodiester bond between The yellow atom is essentially bound to a sodium ion, and is represented by the formula (308): The NA complex exists primarily as a sodium salt. and replacing the sodium ions with hydrogen ions and / or other cations to form other types of formulas. The cation can be used in the same manner as described above. That is correct.

[0296] During the synthesis process, the purity and molecular weight of the nucleic acid sequence can be constantly detected to better control the synthesis quality. Such detection methods are known to those skilled in the art. For example, ion exchange chromatography Nucleic acid purity was detected by liquid chromatography tandem mass spectrometry (LCMS). The molecular weight can be measured by C-MS.

[0297] Annealing methods are also well known to those skilled in the art. The sense strand (S strand) and antisense strand (AS strand) were mixed in an equal molar ratio in water for injection and incubated for 70-95 min. C. and then cooled to room temperature, allowing hydrogen bonds to form a double-stranded structure. In this manner, the siRNA complex shown in formula (308) can be obtained.

[0298] After obtaining the siRNA complex, in some embodiments, the siRNA complex is subjected to, for example, liquid chromatography. The synthesized compound (30) was analyzed by molecular weight detection using methods such as HPLC-tandem mass spectrometry. 8) and characterized the siRNA complex. The siRNA complex shown in formula (308) was synthesized. Confirm that the sequence of the NA is the sequence of the desired siRNA, e.g., one of the sequences shown in Table 1. It is also possible.

[0299] The compound of formula (321) can be prepared by the reaction of the esterification reaction with a base in an organic solvent. and contacting the compound represented by formula (313) with a cyclic acid anhydride in the presence of an esterification catalyst. followed by ion exchange and isolation to obtain the compound of formula (321). can be obtained by:

[0300] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15, L 1、 The definition and selectable range of each S1 are as described above. R6 is a group that provides R4 in formula (321). In some embodiments, , R6 has the structure shown in formula (A61).

[0301] [ka] In the formula, R i can achieve bonding with the N atom on the nitrogen-containing backbone, R k Combined with O to form one is any group to which a free hydroxy group of k is a hydroxy protecting group. In this case, R4 includes a first functional group as a hydroxy protecting group and a second functional group, The second functional group is a compound represented by formula (321) containing a structure represented by formula (C1) or (C2). A compound is obtained.

[0302] The esterification reaction conditions are a reaction temperature of 0 to 100° C. and a reaction time of 8 to 48 hours. In some embodiments, the esterification reaction conditions include a reaction temperature of 10 to 4 The temperature is 0°C and the reaction time is 20 to 30 hours.

[0303] In some embodiments, the organic solvent is an epoxy solvent, an ether solvent, a haloperidol solvent, or a cyclohexane solvent. Alkyl halogenated solvents, dimethyl sulfoxide, N,N-dimethylformamide and N , N-diisopropylethylamine. In some embodiments, The epoxy solvent is dioxane and / or tetrahydrofuran, and the acetone is The tert-butyl ether solvent is ethyl ether and / or methyl tert-butyl ether, The halogenated alkyl solvents are dichloromethane, trichloromethane and 1,2-dichloromethane. In some embodiments, the organic solvent is one or more of dichloromethane. The amount of the organic solvent is 3 to 3% by weight based on the compound represented by the formula (313). ~50 L / mol, and in some embodiments, 5-20 L / mol.

[0304] In some embodiments, the cyclic acid anhydride is succinic anhydride, glutaric anhydride. anhydride, adipic anhydride, or pimelic anhydride, and in some embodiments , succinic anhydride. The compound represented by the formula (313) and the cyclic acid anhydride The ratio of the fluorine atom to the fluorine atom is 1:1 to 10:1, and in some embodiments, 2:1 to 5:1.

[0305] The esterification catalyst may be any catalyst that catalyzes the esterification reaction, e.g. For example, the catalyst may be 4-dimethylaminopyridine. ) is 1:1 to 10:1 in some embodiments. , 2:1~5:1.

[0306] In some embodiments, the base is any inorganic base, organic base, or combination thereof. Considering the solubility and stability of the product, the base may be, for example, In some embodiments, the tertiary amine is a triethylamine. The tertiary amine and the formula (3 13) is 1:1 to 20:1 in molar ratio, and in some embodiments, The ratio is between 3:1 and 10:1.

[0307] The ion exchange reaction is carried out by reacting the compound of formula (321) with the desired carboxylic acid or carbo The ion exchange method is known to those skilled in the art and is suitable for converting the phosphate form. Using the exchange solution and exchange conditions, + A complex molecule having a cation can be obtained, In some embodiments, the ion exchange reaction is carried out by The reaction is carried out using an ethylamine phosphate solution, the concentration of which is In some embodiments, the triethylamine phosphate The concentration of the salt solution is 0.4 to 0.6 M, and the compound represented by formula (313) is The dosage of the triethylamine phosphate solution is 3-6 L / mol, and in a further embodiment The average concentration is 4-5 L / mol.

[0308] Isolate the compound of formula (321) from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is evaporated, the chromatograph may be The compound of formula (321) can be isolated by the Fie method, for example, by the reaction of (1) Normal phase purification silica gel: 200-300 mesh silica gel packing material is packed with 1wt‰ triethylene Gradient elution with dichloromethane:methanol = 100:18 to 100:20 containing dimethylamine or (2) reverse phase purification: C18, C8 reverse phase packing is eluted with methanol:acetonitrile. The two chromatographic conditions were: gradient elution with a ratio of 0.1:1 to 1:0.1; In some embodiments, the solvent can be directly removed to obtain a product of formula (321). The crude product of the compound shown in the formula (I) can be obtained, and the crude product can be used in the subsequent reaction as it is. It is possible.

[0309] In some embodiments, the method for preparing a compound of formula (321) comprises the steps of: The above ion is reacted in an organic solvent in the presence of a condensation agent, a condensation catalyst and a tertiary amine under the conditions described above. The product obtained by the ion exchange reaction is further treated with a solid phase carrier containing an amino group or a hydroxy group. contacting, wherein R4 includes a first functional group and a second functional group. wherein the first functional group comprises a hydroxy protecting group and the second functional group has a structure represented by formula (C1'): A compound represented by formula (321) containing

[0310] The solid phase support is one of the supports used in solid phase synthesis of siRNA. Some are known to those of skill in the art. For example, the solid phase support may have an active hydroxy or amino group. In some embodiments, the solid support may be selected from a solid support that includes a functional group. In some embodiments, the amino resin is a hydroxy resin. The resin or hydroxy resin has a particle size of 100 to 400 mesh, and the surface The amino or hydroxyl group loading parameter is 0.2 to 0.5 mmol / g. The dosage ratio of the compound represented by the formula (321) to the solid phase carrier is 10 to 400 μmol. Compound / gram of solid support (μmol / g). The dosage ratio of the compound represented by formula (321) to the solid support is 50 to 200 μmol / g. .

[0311] The organic solvent may be any suitable solvent or mixture of solvents known to those skilled in the art. In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ether, Solvents, halogenated alkyl solvents, dimethyl sulfoxide, N,N-dimethylformamide In some embodiments, the amine is one or more of N,N-diisopropylethylamine and N,N-diisopropylethylamine. In the embodiment, the epoxy solvent is dioxane and / or tetrahydrofuran. The ether solvent is ethyl ether and / or methyl tert-butyl ether. The halogenated alkyl solvent is dichloromethane, trichloromethane, and 1,2 In some embodiments, the organic solvent is one or more of: is acetonitrile. The organic solvent used for the compound represented by formula (321) is The amount is 20 to 200 L / mol, and in some embodiments, 50 to 100 L / m She is an office lady.

[0312] In some embodiments, the condensing agent is benzotriazol-1-yl-oxy Tripyrrolidino-phosphonium hexafluorophosphate / ester (benzotri iazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate, PyBop), 3-diethoxyphosphoryl -1,2,3-Benzoxazol-4(3H)-one (3-(Diethoxyphos phoryloxy)-1,2,3-benzotriazin-4(3H)-one, DEPBT) and / or O-benzotriazole-tetramethyluronium hexafluoro O-benzotriazol-1-yl-tetramethylbenzoate / ester thyluronium hexafluorophosphate), In some embodiments, the condensing agent is O-benzotriazole-tetramethyl ether. The condensation agent is tetrafluoromethane hexafluorophosphate / ester. The molar ratio of the compound to be treated is 1:1 to 20:1, and in another embodiment, 1:1 to 5: The answer is 1.

[0313] In some embodiments, the tertiary amine is triethylamine and / or N, N-diisopropylethylamine, and in some embodiments, N,N-diisopropyl propylethylamine, and the molar ratio of the tertiary amine to the compound represented by formula (321) The ratio of the fluorine-containing polymer to the fluorine-containing polymer is from 1:1 to 20:1, and in some embodiments, from 1:1 to 5:1.

[0314] In some embodiments, the method for preparing a compound of formula (321) includes the step of: The resulting condensation product is reacted with a capping reagent and an acyl group in an organic solvent under capping reaction conditions. and isolating to obtain a compound of formula (321). The effect of the capping reaction is to prevent the generation of unwanted by-products in subsequent reactions. To avoid this, any reactive functional groups that have not yet reacted completely should be removed. The capping reaction conditions are a reaction temperature of 0 to 50° C., and in some embodiments, The temperature is 15 to 35° C., and the reaction time is 1 to 10 hours, and in some embodiments, 3 to 6 hours. The capping reagent may be a capping reagent known to those skilled in the art that is used in siRNA solid-phase synthesis. A binding reagent may also be used.

[0315] In some embodiments, the capping reagent is capping reagent 1 (cap 1) and capping reagent 2 (cap2), where capping reagent 1 is N-methyl imidazole, and in some embodiments, pyridine of N-methylimidazole. It is supplied as a pyridine / acetonitrile mixture with a volume ratio of 1:1. 10 to 1:1, and in some embodiments, 1:3 to 1:1, and pyridine and The volume ratio of the total volume of acetonitrile to N-methylimidazole is 1:1 to 10:1. In some embodiments, the ratio is 3:1 to 7:1. In some embodiments, the capping reagent 2 is acetic anhydride. It is supplied as a solution in acetonitrile with a volume ratio of acetic anhydride to acetonitrile of 1:1. to 1:10, and in a further embodiment from 1:2 to 1:6.

[0316] In some embodiments, the N-methylimidazole is The ratio of the volume of the mixture to the mass of the compound shown in formula (321) is 5 ml / g to 50 ml. / g, and in some embodiments, from 15 ml / g to 30 ml / g. The ratio of the volume of the acetonitrile solution of the compound to the mass of the compound of formula (321) is 0.5 m l / g to 10 ml / g, and in some embodiments 1 ml / g to 5 ml / g.

[0317] In some embodiments, the capping reagent comprises equimolar amounts of acetic anhydride and N In some embodiments, the organic solvent is acetonitrile. Nitriles, epoxy solvents, ether solvents, halogenated alkyl solvents, dimethyl sulfur 1) 1-Hexoxide, N,N-dimethylformamide and N,N-diisopropylethylamine In some embodiments, the organic solvent is acetonitrile. The amount of the organic solvent is 10 to 50 L / m for the compound represented by formula (321). ol, and in some embodiments, 5 to 30 L / mol.

[0318] In some embodiments, the acylation catalyst is an esterification condensation or an amidation condensation catalyst. The catalyst may be selected from any catalyst that can be used in the reaction of the present invention, for example, an alkali heterocyclic compound. In one embodiment, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the solvent to the compound represented by formula (321) is 0.001:1 to 1:1. In some embodiments, the ratio is 0.01:1 to 0.1:1.

[0319] In some embodiments, the compound of formula (321) is isolated from the reaction mixture by any suitable isolation method. In some embodiments, the compound can be isolated by reaction with an organic solvent. Wash and filter thoroughly to remove unreacted reactants, excess capping reagent, and other impurities. The compound represented by formula (321) can be obtained by the above-mentioned organic solvent. acetonitrile, dichloromethane, methanol, and in some embodiments The solvent is acetonitrile.

[0320] In some embodiments, the method for preparing the conjugated molecule of formula (321) comprises the steps of: In the present invention, under coupling reaction conditions and in the presence of a coupling reagent, The compound shown is contacted with a phosphorodiamidite and isolated to give the compound shown in formula (321). In this case, R4 includes a first functional group and a second functional group, and the first functional group is wherein the functional group comprises a hydroxy protecting group and the second functional group comprises a structure shown in formula (C3): The compound shown in (321) is obtained.

[0321] In some embodiments, the coupling reaction conditions may be at a temperature of 0 to 50° C. The reaction temperature is usually, for example, 15 to 35° C. The compound represented by formula (313) and phosphoramidite are The molar ratio of the aryl group to the aryl group may be 1:1 to 1:50, for example, 1:5 to 1:15. The molar ratio of the compound shown in 313) to the coupling reagent is 1:1 to 1:100. For example, the reaction time may be 200 to 3000 seconds. The phosphorodiamidite is, for example, bis(diamino) Alternatively, 2-propylamino(2-cyanoethoxy)phosphine may be used, which is available commercially. Coupling agents may be prepared by the methods known in the art, such as 1H -Tetrazole, 5-ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole For example, 5-ethylthio-1H-tetrazole. The coupling reaction may be carried out in an organic solvent, and the organic solvent may be anhydrous aldehyde. one or more selected from acetonitrile, anhydrous DMF, and anhydrous dichloromethane; For example, anhydrous acetonitrile. In some embodiments, The amount of the organic solvent is 3 to 50 L / mol, for example, 5 to 20 By carrying out the coupling reaction, the compound represented by formula (313) can be obtained. The hydroxy group in the compound to be synthesized is reacted with phosphorodiamidite to produce phosphoramidite. In some embodiments, the solvent is directly removed to form the aryl group shown in formula (321). A crude product of the compound to be synthesized can be obtained, and the crude product can be used in the subsequent reaction as it is. can be done.

[0322] In some embodiments, the method for preparing a compound of formula (321) includes coupling The resulting product was isolated under coupling reaction conditions in an organic solvent in the presence of a coupling agent. The method further comprises the step of contacting the product with a hydroxyl-containing solid support. After capping and oxidation, the compound represented by formula (321) is obtained. wherein R4 comprises a first functional group and a second functional group, and the first functional group is a hydroxy protecting group. and the second functional group has a structure represented by formula (C3'). A compound is obtained.

[0323] In some embodiments, the solid support is a suitable substrate for solid phase synthesis of nucleic acids as known in the art. For example, a commercially available general-purpose solid phase support (NittoPhase) that has been deprotected is ase(R)HL UnyLinker TM 300 Oligonucleotides ide Synthesis Support, Kinovate Life Science Nces Corporation, the structure of which is shown in formula B80.

[0324] [ka]

[0325] Deprotection reactions are known to those skilled in the art. In some embodiments, the deprotection conditions are The temperature is 0 to 50°C, for example 15 to 35°C, and the reaction time is 30 to 300 seconds, for example 50 to The deprotection reagents were trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. and in some embodiments, one or more selected from: The deprotection reagent is dichloroacetic acid. -dimethoxytrityl) protecting group is 2:1 to 100:1 in molar ratio, for example, 3:1 to The ratio of the deprotection ratio to the ratio of the reaction mixture to the reaction mixture is 50:1. By carrying out the deprotection, reactive A free hydroxy group is obtained, making it accessible for the next coupling reaction.

[0326] The coupling reaction conditions and the selection of coupling reagents are as described above. By carrying out a coupling reaction, the free hydroxyl group formed in the deprotection reaction and the phosphoryl group The midite groups are reacted to form phosphite linkages.

[0327] In some embodiments, the capping reaction conditions include a temperature of 0 to 50° C., e.g., 1 The temperature is 5 to 35° C., the reaction time is 5 to 500 seconds, for example, 10 to 100 seconds, The capping reaction is carried out in the presence of a capping reagent. The choice and dosage of the capping reagent are as described above. As follows.

[0328] The conditions for the oxidation reaction are a temperature of 0 to 50° C., for example, 15 to 35° C., and a reaction time of The time may be 1 to 100 seconds, for example 5 to 50 seconds, and the oxidation reagent may be, for example, iodine. In some embodiments, the iodine may be provided as iodine water. The molar ratio of the oxidation reagent to the nucleic acid sequence bound to the solid support is 1:1 to 100:1, e.g. For example, the ratio may be 5:1 to 50:1. The reaction is carried out in a mixed solvent of dihydrofuran:water:pyridine=3:1:1 to 1:1:3.

[0329] In some embodiments, R6 is one of the groups of formula B7 or B8.

[0330] [ka] In the formula, q 2、 R k The definition is as described above.

[0331] In this case, the compound represented by formula (313) can be reacted in an organic solvent under amidation reaction conditions: and amidation reaction: In the presence of a condensing agent and a tertiary amine, a compound represented by formula (314) is converted into contacting the compound represented by formula (A-1) or the compound represented by formula (A-2), and then isolating The compound can be obtained by the preparation method of:

[0332] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , L1, S1, q2 and R k The definitions and available ranges of each are as described above. be.

[0333] The amidation reaction conditions are a reaction temperature of 0 to 100° C. and a reaction time of 1 to 48 hours. In some embodiments, the amidation reaction conditions include a reaction temperature of 10 to 4 The temperature is 0°C and the reaction time is 2 to 16 hours.

[0334] In some embodiments, the organic solvent is an alcohol solvent, an epoxy solvent, Ether solvents, halogenated alkyl solvents, dimethyl sulfoxide, N,N-dimethyl formamide and N,N-diisopropylethylamine. In some embodiments, the alcohol solvent is methanol, ethanol, propanol, or the like. In some embodiments, the epoxy is one or more of ethanol. The alkoxy solvent, in some embodiments, is dioxane and / or tetrahydrofuran. In some embodiments, the ether solvent is ethyl ether and / or is methyl tert-butyl ether. The halogenated alkyl solvents include In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane In some embodiments, the organic solvent is dichloromethane. For the compound represented by formula (314), the amount of organic solvent is 3 to 50 L / mol. and in a further embodiment from 3 to 20 L / mol.

[0335] In some embodiments, the amidation reaction condensing agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -Diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one, 4-(4 ,6-Dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (4-(4,6 -dimethoxytriazin-2-yl)-4-methylmorpholi ne hydrochloride), 2-ethoxy-1-ethoxycarbonyl-1,2 -Dihydroquinoline (EEDQ) or O-benzotriazole-tetramethyluronium In a further embodiment, 3-diethoxy hexafluorophosphate / ester. The amidation is diphosphoryl-1,2,3-benzoxazol-4(3H)-one. The molar ratio of the reaction condensation agent to the compound represented by formula (314) may be 1:1 to 10:1. In some embodiments, the ratio is from 2.5:1 to 5:1.

[0336] In some embodiments, the tertiary amine is triethylamine or N,N-diethylamine. In a further embodiment, N,N-diisopropyl ethyl amine. The molar ratio of the tertiary amine to the compound represented by formula (314) is 3: It is 1 to 20:1, and in some embodiments, it is 5:1 to 10:1.

[0337] In some embodiments, the compounds of formula (A-1) and formula (A-2) are any It may be prepared by any suitable method. For example, R k When is a DMTr group, glycerol The compound represented by formula (A-1) is prepared by reacting calcium phosphate with DMTrCl. Similarly, 3-amino-1,2-propanediol can be contacted with a cyclic acid anhydride to obtain Then, the compound represented by formula (A-2) can be prepared by reacting with DMTrCl. The cyclic acid anhydride may be a cyclic acid anhydride having 4 to 13 carbon atoms, and in some embodiments, 4 to 8 carbon atoms. As can be easily understood by those skilled in the art, the cyclic acid anhydride may be The selection corresponds to different values ​​of q2 in the compound shown in (A-2), for example: When the cyclic acid anhydride is succinic anhydride, q2=1; In the case of butyl ether, q2=2, which may be inferred.

[0338] In some variations, the compound of formula (314) can be prepared by reacting the cyclic anhydride, 3- By reacting sequentially with amino-1,2-propanediol and DMTrCl, 313) can also be prepared. As such, these modifications affect the structure and function of the compound of formula (313). This is not necessary and can be easily achieved by a person skilled in the art using the above method.

[0339] Similarly to the above, the compound represented by formula (313) can be isolated from the reaction mixture by any suitable isolation method. The compound can be isolated. In some embodiments, after the solvent is evaporated, the crystals can be The compound of formula (313) can be isolated by chromatographic methods, e.g. For example, (1) normal phase purification silica gel: 200-300 mesh silica gel packing is packed in petroleum benzene. Ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0 Gradient elution from 0.5 to 1:1:1:0.6; and (2) reverse phase purification: C18, C8 reverse phase. The phase packing was eluted with a gradient of methanol:acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the compound can be isolated using two chromatographic conditions: The solvent can then be removed directly to give the crude compound of formula (313). The crude product can be used as is in the subsequent reaction.

[0340] In some embodiments, the compound represented by Formula (314) is reacted in an organic solvent with Amidation reaction In the presence of a condensing agent and a tertiary amine, under condensation reaction conditions, a compound represented by formula (320) is obtained. contacting a compound represented by formula (316) with a compound represented by formula (316), followed by isolation. It can be obtained by law.

[0341] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R13 , R 14 , R 15 The definitions and selectable ranges of each are as described above.

[0342] The compound represented by formula (316) is, for example, 2014, 136, 16958-16961 may be used, or Alternatively, the compound represented by formula (316) can be prepared by a person skilled in the art by various methods. See, for example, the method disclosed in Example 1 of US Pat. No. 8,106,022 B2. Several compounds of formula (316) can be prepared by the above-mentioned method. The entire contents of the references are incorporated herein in their entirety.

[0343] In some embodiments, the condensation reaction conditions include a reaction temperature of 0 to 100° C. The reaction time is 0.1 to 24 hours, and in some embodiments, the reaction temperature is 10 to 40° C. and the reaction time is 0.5 to 16 hours.

[0344] Considering the structure of the desired product, the compound of formula (314), The molar ratio of the compound represented by formula (6) to the compound represented by formula (320) is In some embodiments, , for example, when n1+n3=3, to ensure that the reaction is complete and not excessive. The molar ratio of the compound represented by formula (316) to the compound represented by formula (320) is 3. :1 to 3.5:1, and in some embodiments, 3.01:1 to 3.1 The ratio is 5:1.

[0345] In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ethylene oxide solvent, Ether solvents, halogenated alkyl solvents, dimethyl sulfoxide, N,N-dimethyl ether and N,N-diisopropylethylamine, The alkoxy solvent, in some embodiments, is dioxane and / or tetrahydrofuran. In some embodiments, the ether solvent is ethyl ether and / or is methyl tert-butyl ether, and the halogenated alkyl solvent is In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane In some embodiments, the organic solvent is dichloromethane. For the compound represented by formula (320), the amount of the organic solvent is 3 to 50 L / m ol, and in some embodiments, 5 to 20 L / mol.

[0346] In some embodiments, the amidation reaction condensing agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -Diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one (DEPB T), O-benzotriazole-tetramethyluronium hexafluorophosphate / Ester, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine salt or 1-hydroxybenzotriazole, in further embodiments. In the present invention, benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluoride It is a mixture of fluorophosphates / esters and 1-hydroxybenzotriazole. Triazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphonium The phosphate / ester and 1-hydroxybenzotriazole are used in equimolar amounts. The molar ratio of the total amidation reaction condensing agent to the compound represented by formula (316) is 1:1 to 3:1. In some embodiments, the ratio is 1.05:1 to 1.5:1.

[0347] The tertiary amine is N-methylmorpholine, triethylamine or N,N-diisopropylamine. In some embodiments, N-methylmorpholino The molar ratio of the tertiary amine to the compound represented by formula (316) is 2:1 to 10. :1, and in some embodiments, is from 2:1 to 5:1.

[0348] Similarly to above, the compound of formula (314) can be isolated from the reaction mixture by any suitable isolation method. The compound can be isolated. In some embodiments, after the solvent is evaporated, the crystals can be The compound of formula (314) can be isolated by chromatographic methods, e.g. For example, (1) normal phase purification silica gel: 200 to 300 mesh silica gel packing is (2) Gradient elution with hexane:methanol = 100:5 to 100:7; and Purification: C18, C8 reverse phase packing, methanol:acetonitrile = 0.1:1 to 1:0. The compound can be isolated using two chromatographic conditions: 1) gradient elution with 100% ethanol; In some embodiments, the solvent is directly removed to give a crude compound of formula (314). The crude product can be used as is in the subsequent reaction.

[0349] Compounds of formula (320) can be purchased commercially or obtained by methods known to those skilled in the art. For example, m1=m2=m3=3, n1=1, n3=2. Yes, each R 10 , R 11 , R 12 , R 13 , R 14 , R 15 If both are H, then the formula The compound shown in (320) is commercially available from Alfa Acer. can.

[0350] The siRNA complexes of the present disclosure may be used in combination with other pharma- ceutically acceptable additives. The additive may be one or more of a variety of agents or compounds commonly used in the art. For details, see the description of the pharmaceutical composition of the present disclosure above.

[0351] Use of the siRNA, drug composition, and siRNA complex of the present disclosure In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or the siRNA complex in the preparation of a medicament for the treatment and / or prevention of sepsis. Provide for the use of

[0352] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or administering to a subject in need thereof an effective amount of the siRNA complex. The present invention provides a method for preventing and / or treating sepsis.

[0353] siRNA active components of the present disclosure can be administered to a subject in need thereof to induce RNase activity. The purpose of preventing and / or treating sepsis can be achieved through the A-interference mechanism. Therefore, the siRNA and / or drug composition and / or siRNA complex of the present disclosure can be used to treat sepsis. or for the preparation of drugs for the prevention and / or treatment of sepsis. It can be used for manufacturing.

[0354] In some embodiments, the sepsis is a condition characterized by a systemic inflammatory response syndrome, usually due to an infection. It refers to essentially the body's response to an infectious agent. Blood poisoning is always common in patients with serious illnesses, such as severe burns, multiple injuries, and after surgery. In some embodiments, sepsis occurs in patients with diabetes, chronic obstructive pulmonary disease, etc. Also for patients suffering from chronic diseases such as spinal cord disease, leukemia, aplastic anemia and urinary stones. It's often viewed.

[0355] As used herein, the term "pharmaceutical administration / administration" refers to the administration of siRNA, drug compositions of the present disclosure. and / or localizing at least a portion of the siRNA complex to a desired site to produce a desired effect. The siRNA, drug composition and / or siRNA complex of the present disclosure can be administered by any method or route that allows the siRNA to be administered. Suitable routes of administration for the methods of the present disclosure include topical administration and Local administration generally results in more siRNA being delivered to the subject than to the systemic circulation of the subject. The complex is delivered to a specific site, but systemic administration of the siRNA, drug composition of the present disclosure and / or the siRNA complex is delivered to the basal systemic circulation of the subject. Considering the ability to provide prophylactic and / or therapeutic measures, some embodiments In this case, an administration method capable of delivering the drug to the liver is employed.

[0356] Administration to a subject can be by any suitable route known in the art, including, but not limited to, Oral or non-gastrointestinal routes, e.g., intravenous, intramuscular, subcutaneous, transdermal, intratracheal Intravenous (aerosol), pulmonary, nasal, rectal and local (buccal and sublingual) The frequency of administration may be daily, weekly, or biweekly. , once or more than once every three weeks, once a month, twice a month, three months, six months or once a year.

[0357] The dosage of the siRNA, drug composition or siRNA complex described in this disclosure may be determined by methods known in the art. The dose may be a usual dose for the patient, said dose being determined according to various parameters, in particular the age of the subject. Toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals. Measure sex and treatment effects, e.g., LD 50 (the dose that kills 50% of the colony) and ED5 0 (refers to the dose that can induce 50% of the maximum reaction intensity in a quantitative response, In qualitative reactions, this refers to the dose at which a positive reaction occurs in 50% of experimental subjects. Based on data from cell culture assays and animal studies, a range of human dosages is available. The range can be obtained.

[0358] When administering the siRNA, drug composition and / or siRNA complex described in this disclosure, For example, male or female, 6 to 12 weeks old, weighing 18 to 25 g, C57BL / 6J or For ob / ob mice weighing 0 to 45 g, the amount of siRNA was: (i) siRNA complex; For the body, the siRNA dosage may be 0.001 to 100 mg / kg body weight; In some embodiments, the dose is 0.01 to 50 mg / kg body weight, and in some embodiments, the dose is 0.01 to 50 mg / kg body weight. 0.05 to 20 mg / kg body weight, and in some embodiments, 0.1 to 1 5 mg / kg body weight, and in some embodiments, 0.1 to 10 mg / kg (ii) a pharmaceutical composition formed by the siRNA and a pharma- ceutically acceptable carrier. For the subject, the siRNA dosage may be 0.001 to 50 mg / kg body weight, and In some embodiments, the dose is 0.01 to 10 mg / kg body weight, and in some embodiments, the dose is 0 0.05-5 mg / kg body weight, and in some embodiments 0.1-3 mg / kg body weight. be.

[0359] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or contacting a liver cell with an effective amount of the siRNA complex of the present disclosure. Alternatively, a drug composition and / or a siRNA complex is introduced into the hepatocytes, and the hepatocytes are stimulated by the RNA interference mechanism. and inhibiting the expression of KNG gene in hepatocytes. The present invention provides a method for inhibiting the expression of the KNG gene in hepatocytes, the hepatocytes being SMMC-7721. Hepatoma cell lines such as HepG2, Huh7, or isolated primary hepatocytes. .

[0360] The method provided by the present disclosure inhibits expression of the KNG gene in a cell. siRNA dosage in the modified siRNA, drug composition and / or siRNA complex to be administered can generally reduce the expression of target mRNA, at concentrations between 1 pM and 1 μM on the surface of target cells, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM The amount required to achieve that local concentration will depend on the delivery method, delivery method, and delivery method. The site, the number of cell layers between the delivery site and the target cell or tissue, the route of delivery (local or systemic), etc. The concentration at the delivery site varies depending on a variety of factors, including the amount of The concentration may be significantly higher than that in the

[0361] <Kit> The present disclosure provides a method for the preparation of at least one of the siRNA, drug composition, and siRNA complex of the present disclosure. A kit containing an effective amount is provided.

[0362] In some embodiments, the kits described herein include a container containing the modified siRNA. In some embodiments, the kits described herein can include In some embodiments, the container may include a container providing a pharma- ceutically acceptable excipient. Thus, the kit may contain other ingredients, such as stabilizers or preservatives. In some embodiments, the kits described herein include the modified s At least one other therapeutic agent may be included in a container separate from the container providing the iRNA. In some embodiments, the kit comprises a modified siRNA and a pharma- ceutically acceptable carrier and and / or instructions for mixing the composition and / or additives or other ingredients, if present.

[0363] In the kit of the present disclosure, the siRNA and a pharma- ceutically acceptable carrier and / or additive are and the siRNA, drug composition and / or siRNA complex, and / or pharmaceutical The commercially acceptable excipients may be in any form, e.g., liquid, dried or lyophilized. In some embodiments, the siRNA and the pharma- ceutical acceptable salt may be provided as a Possible carriers and / or excipients, as well as the drug composition and / or siRNA complex and and any pharma- ceutically acceptable excipients are essentially clean and / or sterile. In some embodiments, sterile water may be provided in the kits of the present disclosure.

[0364] The present disclosure will be further described below with reference to examples, but the present disclosure is not limited thereto. do not have. EXAMPLES

[0365] Unless otherwise specified, all reagents and media used in the following examples are commercially available products. The nucleic acid electrophoresis and real-time PCR procedures used are all performed by Molecular cular Cloning(Cold Spring Harbor Laborat This is carried out with reference to the method described in (Ory Press, 1989).

[0366] siRNA, siRNA complex or negative control against the KNG gene synthesized according to the present disclosure When cells were transfected with control siRNA or siRNA complex, Lipofectamine as a transfection reagent TM 2000(Invitro gen) and refer to the instructions provided by the manufacturer for specific operations. and.

[0367] Unless otherwise stated, all reagent proportions provided below are by volume (v / v). It is calculated.

[0368] Unless otherwise stated, the experimental data for in vivo / in vitro effects are all

number

[0369] (Preparation Example 1) Preparation of siRNA complex L10-siKNa1M1SP In this preparation example, the siRNA complex L10-siKNa1M1SP was synthesized. The siRNA complexed to the NA complex was the siRNA complex L10-siKN in Table 3. It has sense and antisense strand sequences corresponding to a1M1SP.

[0370] (1-1) Synthesis of Compound L-10 Compound L-10 was synthesized according to the following method.

[0371] [ka]

[0372] (1-1-1) Synthesis of Complex Terminal Segment GAL-5 [ka]

[0373] (1-1-1a) Synthesis of GAL-2 100.0 g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS number: 1772-03-8, purchased from Ningbo Hongxiang Biochemical Co., Ltd., 463.8 mmol) 1000 ml 100 ml of anhydrous pyridine, and 540 ml of acetic anhydride (purchased from Enox, The reaction mixture was stirred at room temperature for 1.5 hours. The reaction mixture was poured into 10 L of ice water. The cake was washed with 2 L of ice water and then cooled to room temperature until completely dissolved. Add acetonitrile / toluene mixed solvent (acetonitrile:toluene volume ratio = 1:1) The solvent was evaporated to dryness to obtain 130.0 g of a white solid product, GAL-2.

[0374] (1-1-1b) Synthesis of GAL-3 The GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1-1a) was The mixture was dissolved in 3 ml of anhydrous 1,2-dichloroethane and heated in an ice-water bath under nitrogen protection to obtain a 24.0 mL sample. g of TMSOTf (CAS number: 27607-77-8, purchased from Macklin, 108 0.0 mmol) was added and the reaction was carried out at room temperature overnight.

[0375] The reaction mixture was diluted with 400 ml of dichloromethane, filtered through diatomaceous earth, and then added to 1 L of saturated charcoal. Add an aqueous solution of sodium hydrogen carbonate, stir evenly, separate the organic phase, and dichloroethane into the aqueous phase. Extract twice with 300 ml each time, combine the organic phases, and add 300 ml of saturated The mixture was washed with an aqueous solution of sodium bicarbonate and 300 ml of saturated saline, and the organic phase was separated and dried. The mixture was dried over sodium sulfate, and the solvent was evaporated to dryness under reduced pressure to give 26.9 g of a pale yellow, viscous starch syrup-like product. The product GAL-3 was obtained.

[0376] (1-1-1c) Synthesis of GAL-4 The GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1-1b) was Dissolve in 6 ml of anhydrous 1,2-dichloroethane and add 30 g of dried 4 Å molecular sieve powder. 9.0 g of 5-hexen-1-ol (CAS number: 821-41-0, Adamas- Beta Co., 89.9 mmol) was added, stirred at room temperature for 30 minutes, and then cooled in an ice bath and nitrogen. 9.08 g of TMSOTf (40.9 mmol) was added under protection and reacted at room temperature overnight with stirring. The 4 Å molecular sieve powder was removed by filtration, and the filtrate was diluted with 300 ml of dichloromethane. Filter through diatomaceous earth, add 500 ml of saturated aqueous sodium bicarbonate solution, stir for 10 minutes, and wash. The organic phase was separated, the aqueous phase was extracted once with 300 ml of dichloroethane, and the organic phase was evaporated. Then, 300 ml of saturated sodium bicarbonate solution and 300 ml of saturated saline solution were used. The organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was evaporated to dryness under reduced pressure. The yellow syrup-like product GAL-4 was obtained in an amount of 0.3 g, and was used in the next oxidation reaction without purification. I did.

[0377] (1-1-1d) Synthesis of GAL-5 GAL-4 (14.9 g, 34 0.7 mmol) was dissolved in a mixture of 77 ml of dichloromethane and 77 ml of acetonitrile. The mixture was dissolved in 103 ml of deionized water and 29.7 g of sodium periodate (CA S number: 7790-28-5, purchased from Aladdin, 138.8 mmol) was added. The mixture was stirred in an ice-water bath for 10 minutes, and ruthenium(III) chloride (CAS number: 14898-6 7-0, purchased from Energy Co., 238 mg, 1.145 mmol) was added and the mixture was stirred at room temperature for 1 h. The reaction mixture was diluted with 300 ml of water and stirred, and saturated sodium bicarbonate was added. The pH was then adjusted to about 7.5, the organic phase was separated and discarded, and the aqueous phase was washed once with dichloromethane. The mixture was extracted three times with 200 ml of water per 100 ml of water, and the organic phase was discarded. The pH of the aqueous phase was adjusted to about 3 with solid citric acid. The extract was then extracted three times with dichloromethane, each time at 200 ml. The organic phases were combined and washed with anhydrous sulfuric acid. The solvent was evaporated to dryness under reduced pressure to give 6.85 g of a white foamy solid product, GAL I got -5. 1 H NMR (400 MHz,DMSO) δ 12.01 (br, 1H),7.83 (d,J = 9.2 Hz,1H),5.21 (d,J = 3 .2 Hz,1H),4.96 (dd,J = 11.2,3.2 Hz,1H),4 .49 (d,J = 8.4 Hz,1H),4.07-3.95 (m,3H),3 .92-3.85 (m,1H),3.74-3.67 (m,1H),3.48-3. 39 (m,1H),2.20 (t,J = 6.8 Hz,2H),2.11 (s ,3H),2.00 (s,3H),1.90 (s,3H),1.77 (s,3H) ,1.55-1.45 (m,4H).

[0378] (1-1-2) Synthesis of L-8 [ka]

[0379] J-0 (9.886 g, 52.5 mmol, purchased from Alfa Acer Inc.) and process ( GAL-5 (72.819 g, 162.75 mmol, multiple loci) obtained in 1-1-1 Dissolve the above mixture (a combination of the products from the previous batch) in 525 ml of dichloromethane and add diisopropyl Ethylamine (DIEA, 44.782g, 346.50mmol), Benzotriazol 1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / ess PyBOP (90.158 g, 173.25 mmol) and hydroxybenzotriester Add azole (HOBt, 23.410 g, 173.25 mmol) and react at room temperature for 4 hours. Then, 20 ml of saturated sodium bicarbonate and 200 ml of saturated saline were added to wash the mixture. The aqueous phase was extracted twice with dichloromethane, each time with 100 ml of dichloromethane, and the organic phases were combined and After drying over aqueous sodium sulfate and filtration, the solvent was evaporated to dryness under reduced pressure to obtain a crude product. For the separation, 200-300 mesh normal phase silica gel was used and 10 wt% triethylamine was used. The acidity of the silica gel was neutralized, the column was equilibrated with 1 wt‰ triethylamine, and dichloromethane was added. Gradient elution was performed with ethanol:methanol = 100:25 to 100:40, and the product eluate was collected. The solvent was evaporated to dryness under reduced pressure to give 38.8 g of pure L-8. 1 H NMR (400 M Hz,DMSO) δ 7.84 (d,J = 9.0 Hz,3H),7.27-7 .23 (m,1H),7.13-7.18 (m,1H),5.22 (d,J = 3.1 Hz,3H),4.97 (dd,J = 11.3,3.1 Hz,3H), 4.48 (d,J = 8.4 Hz,3H),4.09-3.98 (m,9H), 3.88 (dd,J = 19.3,9.3 Hz,3H),3.75-3.66 ( m,3H),3.44-3.38 (m,3H),3.17-3.30 (m,4H), 3.10-2.97 (m,4H),2.35-2.20 (m,6H),2.15-2 .08 (m,9H),2.07-1.98 (m,13H),1.94-1.87 ( m,9H),1.81-1.74 (m,9H),1.65-1.42 (m,18H) MS m / z:C 85 H 119 N7O 30 , [M+H] + , Theoretical value: 1477.59 , Actual value: 1477.23.

[0380] (1-1-3a) Synthesis of A-1 [ka]

[0381] DMTrCl (4,4'-bismethoxytrityl chloride, 101.65 g, 300 m mol) was dissolved in 1000 ml of anhydrous pyridine and DL-calcium glycerate hydrate was obtained. The reaction mixture was added to the flask (28.63 g, 100 mmol) and reacted at 45° C. for 20 hours. The reaction mixture was then filtered. The cake was rinsed with 200 ml of DCM, the filtrate was concentrated under reduced pressure to dryness, and the remainder was 1 of dichloromethane, and 0.5 M triethylamine phosphate (pH = 7.5-1.0). 8), wash twice with 200 ml each time, and then wash the aqueous phase with dichloromethane, 20 The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed. The mixture was evaporated to dryness under reduced pressure, and purified using a 200-300 mesh normal phase silica gel column. Alcohol:ethyl acetate:dichloromethane:methanol=1:1:1:0.35 to 1:1:1:0 The product eluate was collected and the solvent was evaporated to dryness under reduced pressure. Redissolve in dichloromethane and wash once with 200 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted once with 200 ml of dichloromethane, and the organic phases were combined and washed with anhydrous sodium sulfate. The mixture was dried over sodium, filtered, and the solvent was evaporated to dryness under reduced pressure, then the mixture was cooled to 50°C overnight using a vacuum oil pump. 7 g of a white solid product A-1 was obtained. 1 H NMR (400 MHz, DMSO-d6) δ 7.46 (ddd,J = 6.5,2.3,1.1 Hz,1H),7.40 -7.28 (m,7H),6.89-6.81 (m,4H),4.84 (d,J = 5.0 Hz,1H),4.36-4.24 (m,1H),4.29 (s,6H ),3.92 (dd,J = 12.4,7.0 Hz,1H),3.67 (dd, J = 12.3,7.0 Hz,1H),2.52 (q,J = 6.3 Hz,6 H),1.03 (t,J = 6.3 Hz,9H). MS m / z:C24 H 23 O6, [MH] - , theoretical value: 407.15, measured value: 406.92.

[0382] (1-1-3b) Synthesis of L-7 [ka]

[0383] L-8 (40 g, 27.09 mmol, multiple lots) obtained in step (1-1-2) The products were combined and A-1 (41.418 g, 81 0.27mmol) and dissolved in 271ml of dichloromethane, and Phosphoryl-1,2,3-benzoxazol-4(3H)-one (DEPBT) (24. Add 318 g, 81.37 mmol of diisopropylethylamine (21.0 07g, 162.54mmol) was added, and the mixture was stirred at 25°C for 1.5 hours. Wash the organic phase with saturated sodium bicarbonate and the aqueous phase with dichloromethane, 50 ml at a time. The organic phase was washed with 150 ml of saturated saline, and the aqueous phase was extracted with 50 ml of dichloromethane. Extract once with methane, combine the organic phases, dry over anhydrous sodium sulfate, filter, and dissolve. The agent was evaporated to dryness under reduced pressure, and then foam-dried overnight using a vacuum oil pump to obtain a crude product. 2 kg of 200-300 mesh normal phase silica gel was used, and 200 ml of triethylamine was added. The acidity of the silica gel was neutralized with amine, and the silica gel was then colored with petroleum ether containing 1 wt% triethylamine. The mixture was equilibrated with petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide. Gradient elution with mido = 1:1:1:0.5 to 1:1:1:0.6 was performed, and the product eluate was collected. The solvent was evaporated to dryness under reduced pressure to give 40.4 g of pure L-7. 1 H NMR (400 M Hz,DMSO) δ7.90-7.78 (m,4H),7.75-7.64 (m, 1H),7.38-7.18 (m,9H),6.91-6.83 (m,4H),5. 25-5.10 (m,4H),4.97 (dd,J = 11.2,3.2 Hz, 3H),4.48-4.30 (m,4H),4.02 (s,9H),3.93-3. 84 (m,3H),3.76-3.66 (m,9H),3.45-3.35 (m, 3H),3.24-2.98 (m,10H),2.30-2.20 (m,2H),2 .11-1.88 (m,31H),1.80-1.40 (m,28H). MS m / z:C 90 H 128 N7O 35 , [M-DMTr] + ,Theoretical value: 1564.65,Actual value Value: 1564.88.

[0384] Synthesis of (1-1-4)L-9 [ka]

[0385] L-7 (40 g, 21.4247 mmol) obtained in step (1-1-3b), amber Acid anhydride (4.288 g, 42.8494 mmol) and 4-dimethylaminopyridine ( DMAP, 5.235 g, 42.8494 mmol) was mixed in 215 mL of dichloromethane. Dissolve diisopropylethylamine (DIEA, 13.845 g, 10 Add 7.1235 mmol) and stir at 25°C for 24 hours. Add 800 ml of 0.5 M triethyl ether. Wash the reaction mixture with diethylamine phosphate, and then wash the aqueous phase with dichloromethane, 3 times with 5 ml each. The organic phases were combined and evaporated to dryness under reduced pressure to obtain the crude product. Normal phase silica gel of 00 to 300 mesh was used, and silica gel was purified with 1 wt% triethylamine. The acidity of the column was neutralized, and the column was equilibrated with dichloromethane and diluted with 1 wt‰ triethylamine. Gradient elution with dichloromethane:methanol = 100:18 to 100:20, product eluate The extract was collected and the solvent was evaporated to dryness under reduced pressure to obtain 31.0 g of pure L-9 complex molecule. 1 HN MR (400 MHz,DMSO) δ 8.58 (d,J = 4.2 Hz,1 H),7.94-7.82 (m,3H),7.41-7.29 (m,5H),7.2 2 (d,J = 8.1 Hz,5H),6.89 (d,J = 8.3 Hz,4 H),5.49-5.37 (m,1H),5.21 (d,J = 3.0 Hz,3 H),4.97 (d,J = 11.1 Hz,3H),4.49 (d,J = 8 .2 Hz,3H),4.02 (s,9H),3.88 (dd,J = 19.4, 9.4 Hz,3H),3.77-3.65 (m,9H),3.50-3.39 (m ,6H),3.11-2.90 (m,5H),2.61-2.54 (m,4H),2 .47-2.41 (m,2H),2.26-2.17 (m,2H),2.15-1. 95 (m,22H),1.92-1.84 (m,9H),1.80-1.70 (m ,10H),1.65-1.35 (m,17H),1.31-1.19 (m,4H) ,0.96 (t,J = 7.1 Hz,9H). MS m / z:C 94 H 132 N 7O 38, [M-DMTr] + , theoretical value: 1664.72, actual value: 1665.03.

[0386] (1-1-5) Synthesis of Compound L-10 [ka]

[0387] In this step, the L-9 conjugate molecule is bound to a solid support to form the L-10 compound. was prepared.

[0388] The L-9 complex molecule (22.751 g, 11 mmol) obtained in step (1-1-4), O -Benzotriazole-tetramethyluronium hexafluorophosphate (HBTU , 6.257 g, 16.5 mmol) and diisopropylethylamine (DIEA, 2. Mix 843g, 22mmol) and dissolve in 900ml of acetonitrile. The reaction mixture was stirred for 1 min and then added with aminomethyl resin (88 g, 100-200 mesh, amino group-bearing The reaction was carried out at 25°C on a shaker. The mixture was then stirred at 150 rpm for 18 h, filtered, and the cake was washed once with DCM. Rinse twice with 300 ml each time, then rinse three times with acetonitrile, each time at 300 ml. After drying for 18 hours with a vacuum oil pump, the raw materials (CapA , CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) were added to The capping reaction was carried out by placing the mixture in a shaker at 25°C and rotating at 150 rpm for 5 h. The reaction mixture was filtered and the cake was washed three times with acetonitrile, each time at 300 ml. The mixture was then dried overnight under reduced pressure using a vacuum oil pump to remove the solvent, and 102 g of the carrier was weighed. The L-10 compound had a capacity of 90.8 μmol / g (i.e., the L-9 compound bound to the solid support). child).

[0389] [Table 2] where CapA and CapB are capping reagent solutions, CapA is 20 volumes % N-methylimidazole in a pyridine / acetonitrile mixture. The volume ratio of acetonitrile to acetic anhydride is 3:5, and CapB is 20% by volume of acetonitrile. It is a tolyl solution.

[0390] (1-2) Synthesis of the sense strand of siRNA complex L10-siKNa1M1SP Starting from the L-10 compound prepared in the above step, the solid-phase phosphoramidite method was used to Circulate the sense strand nucleotides corresponding to L10-siKNa1M1SP in Table 3. Nucleoside monomers were linked one by one in the 3'-5' direction according to the order of the nucleosides. Each time a side monomer is bonded, the following steps are performed: deprotection, coupling, capping, oxidation, or sulfurization. Four reactions were performed. When two nucleotides are linked by a phosphate ester, When combining nucleoside monomers, deprotection, coupling, capping, and oxidation are performed. Four reactions were performed. When the two nucleotides were linked by a phosphorothioate, When attaching the next nucleoside monomer, deprotection, coupling, capping, sulfurization, The synthesis conditions were as follows:

[0391] Nucleoside monomers were provided in acetonitrile at 0.1 M concentration for each deprotection reaction. The conditions were the same, that is, the temperature was 25° C., the reaction time was 70 seconds, and the deprotection reagent was , a solution of dichloroacetic acid in dichloromethane (3% v / v), The molar ratio of the 4,4'-dimethoxytrityl protecting group in the dimethylformamide was 5:1.

[0392] The coupling reaction conditions were the same for all reactions, with the temperature at 25°C and the solid support The molar ratio of the nucleic acid sequence to be bound to the nucleoside monomer is 1:10, and the nucleic acid sequence is bound to a solid support. The molar ratio of the nucleic acid sequence to the coupling reagent was 1:65, and the reaction time was 600 seconds. and the coupling reagent is 5-ethylthio-1H-tetrazole (5-(Ethyl thio)-1H-tetrazole (ETT) in 0.5M acetonitrile .

[0393] The capping conditions were the same for all of them, with the temperature being 25°C and the reaction time being 15 min. The capping reagent solution was a mixture of CapA and CapB in a molar ratio of 1:1. A solution in which the molar ratio of the capping reagent to the nucleic acid sequence to be bound to the solid support is acetic anhydride The ratio of the substance:N-methylimidazole:nucleic acid sequence bound to the solid support was 1:1:1.

[0394] The conditions for each oxidation reaction were the same: temperature 25°C, reaction time 15 seconds, and acid The iodine-based reagent was 0.05M iodine water. The molar ratio of the nucleic acid sequence bound to the carrier was 30:1. The reaction was carried out in tetrahydrofuran: The reaction was carried out using a mixed solvent of water:pyridine = 3:1:1.

[0395] After the coupling of the last nucleoside monomer is completed, the nucleic acid sequence bound to the solid support is The resulting mixture was then cleaved, deprotected, purified, and desalted in that order, and then lyophilized to obtain the sense strand.

[0396] The cleavage and deprotection conditions are as follows: The column was added to ammonia water with a concentration of 25 wt%, and the dosage of ammonia water was 0.5 ml / μmo. The mixture was reacted at 55°C for 16 h, the remaining carrier was removed by filtration, and the supernatant was concentrated under vacuum to dryness. did.

[0397] The purification and desalting conditions were as follows: Preparative ion chromatography purification column Purification of the nucleic acids was accomplished by gradient elution with NaCl (Source 15Q). Specifically, eluent A was 20 mM sodium phosphate (pH 8.1), and the solvent was water / acetonitrile. Nitrile = 9:1 (volume ratio), eluent B: 1.5M sodium chloride, 20mM phosphorus The solvent was water / acetonitrile = 9:1 (volume ratio), Elution gradient: Eluent A:Eluent B = 100:0 to 50:50. After collecting, they are combined and desalted using a reverse phase chromatography purification column. The desalted sample was collected using a dextran gel column, and the packing material was dextran gel G25 (Se phadex G25) and was eluted with deionized water.

[0398] The detection method is as follows: Ion exchange chromatography (IEX-HPLC) The purity of the sense strand was detected using HPLC and analyzed by liquid chromatography-mass spectrometry (LC-MS). The molecular weight was analyzed by the method described above. The measured value was consistent with the theoretical value, and the L-9 complex molecule was conjugated to the 3' end. This indicates that the intended sense strand SS was synthesized.

[0399] (1-3) Synthesis of antisense strand of siRNA complex L10-siKNa1M1SP The solid-phase phosphoramidite method was used to prepare a standard solid-phase support (UnyLinker TM loa Deded NittoPhase® HL Solid Supports, Novate Life Sciences) was used as the starting material, and the L 10-siKNa1M1SP according to the order of nucleotides in the antisense strand The antisense strand of the iRNA complex L10-siKNa1M1SP was synthesized. For the base strand, the first nucleotide at the 5'-end is a 5'-phosphate nucleotide. Therefore, in the process of preparing the antisense strand by the solid-phase phosphoramidite method, After the last nucleoside monomer of the transsense strand is attached, deprotection, coupling, capping CPR-I monomer (Suzhou Jiji, Cat#13- 2601-XX) was attached to the 5' end of the antisense strand, and 5'-phosphate nucleotide modification was performed. In addition to forming the above, the deprotection, coupling, capping, and acid synthesis in the solid phase synthesis method are performed. The conditions for the cleavage, deprotection, purification and desalting were the same as those for the synthesis of the sense strand. .

[0400] [ka]

[0401] the conditions of the deprotection, coupling, capping and oxidation reactions used in said conjugation; The conditions for cleavage, deprotection, purification and desalting were the same as those for the synthesis of the sense strand. The antisense strand was isolated by ion exchange chromatography (IEX-HPLC). The purity of the antisense strand was detected and analyzed by liquid chromatography-mass spectrometry (LC-MS). The molecular weight was analyzed. As a result, the measured value was consistent with the theoretical value, and the antisense oligonucleotide had the target sequence. This shows that the AS chain was synthesized.

[0402] (1-4) Synthesis of siRNA complex L10-siKNa1M1SP The sense strand and the antisense strand obtained in (1-2) and (1-3) were dissolved in water for injection, respectively. The resulting solution was dissolved in 100 mL of 10 ... The mixture was mixed at 100°C, heated at 50°C for 15 min, cooled at room temperature, and then annealed to obtain the product. The solution was freeze-dried to obtain a freeze-dried powder. Dilute the siRNA complex to a concentration of 0.2 mg / mL using a 500 sachette (8.2 MΩ*cm (25°C)). After reducing the volume to mL, the mixture was analyzed by liquid chromatography mass spectrometry (LC-MS, Liquid Chr omatography-mass spectrometry, purchased from Waters The molecular weight was detected using a chromatograph (model number: LCT Premier). The measured value was consistent with the theoretical value. The synthesized siRNA complexes were composed of double-stranded nucleic acid sequences containing L-9 complex molecules. It has been shown that the siRNA is a sequence of the formula (403). The sense and amplicon strands corresponding to the siRNA complex L10-siKNa1M1SP shown in Figure 3 It has a sense strand sequence.

[0403] [Table 3] Here, capital letters C, G, U, and A represent the base sequence of a nucleotide, and lower case letter m represents the corresponding The letter m indicates that the 1 nucleotide adjacent to the left is a methoxy-modified nucleotide. The lowercase letter f indicates that the 1 nucleotide adjacent to the left of the letter f is a fluoro-modified nucleotide. The lowercase letter s indicates that the nucleotide is a thiol. The capital letter P indicates that the P is bonded to the right of the This indicates that the adjacent nucleotide is a 5'-phosphate nucleotide.

[0404] (Preparation Examples 2 to 6) Synthesis of siRNA Complexes of the Disclosure The sense and antisense strands of siRNA corresponding to each siRNA complex in Table 3 were The same procedure as in Preparation Example 1 was repeated except that the sense and antisense strands were synthesized according to the sequence of the sense strand. Therefore, the siRNA complexes L10-siKNb1M1SP, L10 -siKNc1M1SP, L10-siKNd1M1SP, L10-siKNe1M1S P and L10-siKNf1M1SP were synthesized. The siRNAs were the sense and antisense strands corresponding to each siRNA complex in Table 3. It has a sequence of the sense strand.

[0405] After the preparation was completed, the molecular weight of each siRNA complex prepared was determined by the method of Preparation Example 1. The measured values ​​were consistent with the theoretical values, and the synthesized siRNA complexes were It was shown that the L-9 complex molecule contains a double-stranded nucleic acid sequence with a specific design. The structures of both are shown in formula (403). are the siRNA complexes L10-siKNb1M1SP and L10- siKNc1M1SP, L10-siKNd1M1SP, L10-siKNe1M1SP and L10-siKNf1M1SP.

[0406] (Preparation Examples 7 to 14 and Comparative Preparation Examples 15 and 16) <Synthesis of siRNA sequences> The sense strand or antisense strand of the siRNA sequences shown in Table 4 was synthesized by a solid-phase synthesis method, and an equimolar mixture of the sense strand and the antisense strand was dissolved using DEPC-treated water. After that, annealing was performed to form siRNA duplexes, and siKNa1M1 S, siKNb1M1S, siKNc1M1S, siKNd1M1S, siKNe1M1 S, siKNf1M1S, siKNa0, siKNc0, siKNa0-com, and NC were obtained.

[0407]

Table 4

[0408] In the preparation process of the above sequences, when the target sequence contains unmodified nucleotides, after treatment with aqueous ammonia under cleavage and deprotection conditions, the product was dissolved in N-methylpyrrolidone at 0.4 ml / μmol based on the amount of single-stranded nucleic acid, and then 0.3 ml / μmol of triethylamine and 0.6 ml / μmol of triethylamine hydrofluoride were added to remove the 2'-TBDMS protection at the ribose. When the molecular weights of the above siRNAs were detected by the method of Preparation Example 1, the measured values were consistent with the theoretical values, and the obtained siRNAs were respectively ​​​​​​​​​It was confirmed that they had sequences corresponding to each of the siRNAs shown in Table 4.

[0409] After the preparation of the siRNA or siRNA complex of the present disclosure is completed, the siRNA or siRNA complex may be administered as a solid powder. It was stored by lyophilization. When used, it is added to water for injection, saline (NS), phosphate Dissolve again in buffer solution (PB) or phosphate buffer solution (PBS) to the desired concentration. It can be used in this manner.

[0410] (Experimental Example 1) In vitro suppression activity of the disclosed siRNA 10% fetal bovine serum (FBS, Hyclone) and 0.2% penicillin (v / v) Streptomycin (Penicillin-Streptomycin, Gibco, HEK2 cells were cultured in H-DMEM complete medium (Hyclone) containing 93A cells (purchased from Nanjing Kebei Biotechnology Co., Ltd.) with 5% CO2 / 95% air-containing ink The cells were cultured at 37°C in an incubator.

[0411] Kumico Ui-Tei et.al., Functional dissec tion of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammali an gene silencing with significantly red uced off-target effect. Nucleic Acids Re According to the method described in , 2008.36(7), 2136-2151, the test sample was Construct plasmids and evaluate co-transfection into HEK293A cells with siRNA The expression level of the dual luciferase reporter gene was used to determine the inhibitory activity of siRNA. The specific process is as follows:

[0412] [1] Construction of test plasmids psiCHECK TM -2(Promega TM ) plasmid, Test plasmids containing siRNA target sequences were constructed. The sequence is shown below.

[0413] Target sequence of siKNa0: AAAGTAACAACCAGTTTGT (SEQ ID NO: 393) Target sequence of siKNc0: TCGAATTACCTACTCAATT (SEQ ID NO: 394)

[0414] psiCHECK the target sequence TM -2 plasmid cloned into the Xho I / Not I site I trained.

[0415] [2] Transfection 8 × 10 HEK293A cells 3 Seed cells / well into 96-well plates and incubate at 16 When the cell growth density reached 70-80% after a period of incubation, add H-DMEM complete medium to the culture well. Remove all of the medium by suction and add 80 μl of Opti-MEM medium (GIBCO) to each well. The incubation was then continued for 1.5 hours.

[0416] For each siRNA, the corresponding test plasmid was diluted 20 The test plasmid diluted standard solution (Working Solution) was 0 ng / μl. For each siRNA, siRNA was dissolved in DEPC-treated water at a concentration of 10 Prepare siRNA dilution standard solutions with 1 nM, 3 nM, and 1 nM (as the amount of siRNA). Ta.

[0417] 1 μl of 10 nM siRNA dilution standard solution, 0 μl of test plasmid dilution standard solution 0.05 μl (containing 10 ng of test plasmid) and 10 μl of Opti-MEM medium A 1A1 solution was prepared.

[0418] 1 μl of 3 nM siRNA diluted standard solution, 0. 1005μl (containing 10ng of test plasmid) and 10μl of Opti-MEM medium Solution A2 was prepared.

[0419] 1 μl of 1 nM siRNA diluted standard solution, 0. 1005μl (containing 10ng of test plasmid) and 10μl of Opti-MEM medium A3 solution was prepared.

[0420] 0.2 μl Lipofectamine TM 2000 and 10 μl Opti-M A 1B solution containing EM medium was prepared.

[0421] 0.05μl of test plasmid dilution standard solution (containing 10ng of test plasmid) and Op A 1C solution containing 10 μl of ti-MEM medium was prepared.

[0422] For each siRNA, one 1B solution, one 1A1 solution, and one 1A2 solution were used. 1x1 solution, 1x1A3 solution, 20min incubation at room temperature, transfection complex 1x1 , 1X2, and 1X3 were obtained. One 1B solution and one 1C solution were mixed and incubated at room temperature. After culturing for 20 min, transfection complex 1X4 was obtained.

[0423] For each siRNA, 20 μl of each was added to three culture wells. Add 1X1 transfection complex and mix evenly until the final siRNA concentration is approximately 0. A co-transfection mixture containing 1 nM was obtained and designated test group 1.

[0424] For each siRNA, 20 μl / well of each was added to three separate culture wells. Add 1X2 of the transfection complex and mix thoroughly until the final concentration of siRNA is approximately A co-transfection mixture containing 0.03 nM was obtained and designated test group 2.

[0425] For each siRNA, 20 μl / well of each was added to three separate culture wells. Add 1X3 of the transfection complex and mix thoroughly until the final siRNA concentration is approximately The resulting co-transfection mixture was 0.01 nM and designated test group 3.

[0426] Three separate culture wells were transfected with 20 μl of each solution. Complex 1X4 was added to obtain a transfection mixture without siRNA, which served as a control group. did.

[0427] Cotransfection mixtures containing siRNA and transfection mixtures without siRNA were The transfection mixture was allowed to co-transfect in culture wells for 4 hours, and then each well was 100 μl of H-DMEM complete medium containing 20% ​​FBS was added. The 96-well plate was placed in a The culture was continued for 24 hours in an O2 incubator.

[0428] [3] Detection The medium in the culture wells was removed by suction, and 150 μl of Dual-Glo ( Add a mixture of Luciferase reagent and H-DMEM (volume ratio 1:1) After incubation at room temperature for 10 minutes, 120 μl of the mixture was added to 9 Transfer to a 6-well ELISA plate and place on the Synergy II Multifunctional Microplate Reader. The Firefly chemiluminescence value (Fir) was read using a Firefly reader (BioTek). Additionally, add 60 μl of Dual-Glo® to each well. Stop & Glo (Registered Add the reagent (Trademark) and mix thoroughly until homogenous. Incubate at room temperature for 10 minutes and then read. According to the arrangement of the Fir, the R in each culture well was measured using a microplate reader. The chemiluminescence value (Ren) of enilla was read.

[0429] The luminescence ratio of each well, Ratio=Ren / Fir, was calculated, and the luminescence ratio of each test group or control group was Ratio(Test) or Ratio(Control) is the average of the Ratios of three culture wells. The emission ratio of each test group was normalized based on the emission ratio of the control group, and the ratio was calculated as Ratio(Test) / R The ratio R of the control to the Renilla reporter gene expression level was obtained. That is, the residual activity is shown. The inhibition rate of siRNA = (1-R) ​​x 100%.

[0430] HEK293A after transfection with siKNa0 and siKNc0, respectively. The residual activity of the Renilla reporter gene in the cells is shown in FIG.

[0431] <Comparative Experiment Example 1> In vitro suppression activity of reference siRNA The siRNAs measured were the reference siRNA NC and siKNa0-com, respectively. The same procedure as in Experimental Example 2 was followed except that the reference siRNA NC and siKNa0-co The residual activity of m was simultaneously examined in the psiCHECK system.

[0432] Target sequence of siKNa0-com: CCAAAGTAACAACCAGTTT (SEQ ID NO: 395)

[0433] The target sequence of NC was the same as that of siKNa0.

[0434] The results are shown in Figure 1.

[0435] As can be seen from the results in FIG. 1, the siRNA of the present disclosure exhibited the target expression in HEK293A cells. All of the compounds showed excellent inhibitory effects against the target sequences, and the inhibitory rate was concentration-dependent. At an siRNA concentration of 0.1 nM, the inhibition rates of siKNa0 and siKNc0 were both 75%. % or more, showing a good effect of inhibiting the expression of the KNG gene. Although the sequence of siKNa0-com is very similar to that of siKNa0, the siRNA concentration was Even at 0.1 nM, the inhibition rate for the target sequence is less than 50%, and the siRNA of the present disclosure Surprisingly, it showed excellent inhibitory effect on KNG gene expression.

[0436] (Experimental Example 2) IC of target sequence by siRNA in the psiCHECK system 50 Measurement 10% fetal bovine serum (FBS, Hyclone) and 0.2% penicillin (v / v) Streptomycin (Penicillin-Streptomycin, Gibco, HEK2 cells were cultured in H-DMEM complete medium (Hyclone) containing 93A cells (purchased from Nanjing Kebei Biotechnology Co., Ltd.) with 5% CO2 / 95% air-containing ink The cells were cultured at 37°C in an incubator.

[0437] Kumico Ui-Tei et.al., Functional dissec tion of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammali an gene silencing with significantly red uced off-target effect. Nucleic Acids Re According to the method described in , 2008.36(7), 2136-2151, the test sample was The plasmid was constructed and cotransfected with the test plasmid and the test siRNA into HEK293A cells. The expression level of dual luciferase reporter genes was used to determine the The results reflect the iRNA's activity in suppressing the target sequence. The specific steps are as follows.

[0438] [1] Construction of test plasmids psiCHECK TM -2(Promega TM ) plasmid, Test plasmids containing siRNA target sequences were constructed. The columns are shown below.

[0439] siKNa1M1S target sequence: CATGGCCACGGAAAACATAAAAATAAAGGCAAAAAGAAT GGAAAGCACAATGGTTGGAAAACAGAGCATTTGGCAAGCT CTTCTGAAGACAGTACTACACCTTCTGCACAGACACAAGA GAAGACAGAAGGGCCAACACCCATCCCTTCCCTAGCCAAG CCAGGTGTAACAGTTACCTTTTCTGACTTTCAGGACTCTG ATCTCATTGCAACTATGATGCCTCCTATATCACCAGCTCC CATACAGAGTGATGACGATTGGATCCCTGATATCCAGATA GACCCAAATGGCCTTTCATTTAACCCAATATCAGATTTTC CAGACACGACCTCCCCAAAATGTCCTGGACGCCCCTGGAA GTCAGTTAGTGAAATTAATCCAACCACACAAATGAAAGAA TCTTATTATTTCGATCTCACTGATGGCCTTTCTTAATTTA AGTGGCTATGGGTATTTCTTTCATACTTTATTAAAGTATC AATATCCCTCTCTCCATTGTCCAGATGAAAATATCCTGAT ATAATGCACCAAAAACCATGCAGCTTCGGAACAGTCTAAA GAGAAGTGGTGAGACTCCCAGTGGAGACACC (SEQ ID NO: 39 6) siKNb1M1S, siKNc1M1S, siKNd1M1S, siKNe1M1S and the target sequences of siKNf1M1S: CATGGCCACGGAAAACATAAAAATAAAGGCAAAAAGAAT GGAAAGCACAATGGTTGGAAAACAGAGCATTTGGCAAGCT CTTCTGAAGACAGTACTACACCTTCTGCACAGACACAAGA GAAGACAGAAGGGCCAACACCCATCCCTTCCCTAGCCAAG CCAGGTGTAACAGTTACCTTTTCTGACTTTCAGGACTCTG ATCTCATTGCAACTATGATGCCTCCTATATCACCAGCTCC CATACAGAGTGATGACGATTGGATCCCTGATATCCAGATA GACCCAAATGGCCTTTCATTTAACCCAATATCAGATTTTC CAGACACGACCTCCCCAAAAATGTCCTGGACGCCCCTGGAA GTCAGTTAGTGAAATTAATCCAACCACACAAATGAAAGAA TCTTATTATTTCGATCTCACTGATGGCCTTTCTTAATTTA AGTGGCTATGGGTATTTCTTTCATACTTTATTAAAGTATC AATATCCCTCTCTCCATTGTCCAGATGAAAATATCCTGAT ATAATGCACCAAAAACCATGCAGCTTCGGAACAGTCTAAA GAGAAGTGGTGAGACTCCCAGTGGAGACACC (SEQ ID NO: 39 7)

[0440] The above target sequences were all gene fragments encoding the human KNG mRNA gene. Ta.

[0441] psiCHECK the target sequence TM -2 plasmid cloned into the Xho I / Not I site I trained.

[0442] [2] Transfection 8 × 10 HEK293A cells 3 Seed cells / well into 96-well plates and incubate at 16 When the cell growth density reached 70-80% after a period of incubation, add H-DMEM complete medium to the culture well. Remove all of the medium by suction and add 80 μl of Opti-MEM medium (GIBCO) to each well. The incubation was then continued for 1.5 hours.

[0443] The above test plasmid was diluted with DEPC-treated water to obtain a test plasmid concentration of 200 ng / μl. The dilution standard solution was prepared using DEPC-treated water. 1S, siKNc1M1S, siKNd1M1S, siKNe1M1S and siKNf1 From each siRNA of M1S, the concentrations were 100nM, 50nM, 25nM, 12.5nM, and 6 .25nM, 3.125nM, 1.5625nM, 0.7813nM and 0.3906n A total of nine types of siRNA dilution standard solutions were prepared, each of which was M.

[0444] For each siRNA, prepare 2A1 to 2A9 solutions. 1 μl of the 9 concentrations of siRNA diluted standard solution and 0. 05μl (containing 10ng of test plasmid) and 10μl of Opti-MEM medium, nothing.

[0445] Mix one 1B solution with one 2A1-2A9 solution of each siRNA obtained. Then, the cells were incubated at room temperature for 20 min, and each siRNA transfection complex was added 2x. Got 1~2X9.

[0446] Add 20 μl of each siRNA transfection complex to the culture wells. Add 2X1 to 2X9 of each siRNA and mix thoroughly until the final concentration of each siRNA is approximately 1nM, 0.5nM, 0.25nM, 0.125nM, 0.0625nM, 0.0312 5nM, 0.015625nM, 0.007813nM and 0.003906nM. Obtain transfection complexes, and transfection complexes 2x1 for each siRNA. Transfect three culture wells each with 2X9 and siRNA-containing cotransfection. The resulting transfection mixture was used as the test group.

[0447] Add 20 μl of transfection complex 1 to three separate culture wells. X3 was added to obtain a cotransfection mixture without siRNA, and It was decided.

[0448] Cotransfection mixtures containing siRNA and those without siRNA were The transfection mixture was allowed to transfect the culture wells for 4 hours, and then 100 μg of each 100 μl of H-DMEM complete medium containing 20% ​​FBS was added. The 96-well plate was placed in a The culture was continued for 24 hours in an O2 incubator.

[0449] [3] Detection The medium in the culture wells was removed by suction, and 150 μl of Dual-Glo ( Add a mixture of Luciferase reagent and H-DMEM (volume ratio 1:1) After incubation at room temperature for 10 minutes, 120 μl of the mixture was added to 9 Transfer to a 6-well ELISA plate and place on the Synergy II Multifunctional Microplate Reader. Using a marker (BioTek), each well of a 96-well ELISA plate was The chemiluminescence value (Fir) of Firefly was read in the 96-well ELISA. Add 60 μl of Dual-Glo® to each well on the plate Stop & G The lo® reagent was added, mixed thoroughly until homogenous, and incubated at room temperature for 10 min. Then, following the arrangement of the read Fir, a microplate reader was used to read the 96-well E The chemiluminescence value (Ren) of Renilla in each culture well on the LISA plate was I read it.

[0450] The emission ratio of each well on a 96-well ELISA plate is Ratio = Ren / Fir. The emission ratios of each test group or control group are calculated as Ratio(Test) or Ratio(Control). The luminescence ratio of each test group is calculated based on the luminescence ratio of the control group. Normalize the ratio R, Ratio(Test) / Rati(Control), to obtain the ratio R, la: Relative expression level of the reporter gene, i.e., residual activity. The inhibition rate for this is (1-R) ​​x 100%.

[0451] After transfection with different concentrations of test siRNA, HEK293A cells were The relative residual activity of Renilla in the culture was calculated using nonlinear analysis with Graphpad 5.0 software. Linear regression analysis function was used to compare log(inhibitor) vs. response-Va riable slope (four parameters) Dose-effect curve 2A to 2F show siKNa1M1S, siKNb1M1S, and siK Doses of Nc1M1S, siKNd1M1S, siKNe1M1S and siKNf1M1S The effect curves are shown in Fig. 1. The logarithm of the final siRNA concentration (lgnM) is plotted as a function of time. The ordinate is the relative remaining activity (%) of Renilla, and each black circle represents the The average relative residual activity of Renilla in three culture wells of each test group is shown.

[0452] From the fitted dose-effect curve, the following function was obtained: A is an IC targeting the target sequence 50 The value was calculated.

[0453]

number

[0454] From the dose-effect curve and the corresponding function, the corresponding X when Y=50% is 50 value Determine the IC of each siRNA 50 Value=10^X 50 (nM) was calculated and IC 50 Values I have summarized it in 5.

[0455] [Table 5]

[0456] As can be seen from the results of Figures 2A to 2F and Table 5 above, the siR provided by the present disclosure The NA complex has high target sequence suppression activity in HEK293A cells in vitro and IC 50 but, The range was 0.0048-0.2328 nM.

[0457] (Experimental Example 3) In vivo analysis of the siRNA complex provided by the present disclosure in humanized mice Activity measurement The construction of the humanized mice used in this study was entrusted to the Tang Zhongying Hematology Research Center of Soochow University. Six to eight week old humanized mice were randomly assigned to groups of four (two males and two females). Each group of mice was administered 6 mg / kg (as siRNA) of siRNA complexes. Combined L10-siKNa1M1SP, L10-siKNc1M1SP, L10-siKN e1M1SP and L10-siKNf1M1SP, and saline (sali ne) was administered as a single subcutaneous injection. Each siRNA complex was administered at 0.6 mg / mL (siR The doses were administered in a 0.9% sodium chloride solution (as NA) at a volume of 10 The dose was 1 mL / kg.

[0458] The animals were then killed on the 28th day, and the liver tissues of each mouse were collected. Approximately 100 mg of each mouse was collected and purified using RNA later (Sigma Aldrich). The liver tissue of each mouse was then homogenized using a tissue homogenizer. The samples were then purified using Trizol (Thermo Fisher) as described in the manufacturer's instructions. Total RNA was obtained from the liver tissue of each mouse by extraction according to the procedure described above.

[0459] ImProm-II TM A reverse transcription kit (Promega) was used according to the manufacturer's instructions. The total RNA extracted by the method was reverse transcribed into cDNA to obtain a solution containing cDNA, which was then quantitatively analyzed by fluorescence spectrometry. The expression of KNG mRNA in liver tissue was measured using a PCR kit (Beijing Kangwei Century Biotechnology Co., Ltd.). Except for detecting the amount of the substance, the fluorescent quantitative PCR detection and KNG were performed according to the method of Experimental Example 2. The relative expression level and inhibition rate of mRNA were calculated. The β-actin gene was used as an endogenous reference gene, and primers for KNG and β- The primers for actin gene were used to detect KNG and β-actin genes, respectively. The sequences of the detection primers are shown in Table 6. KNG mRNA expression level and inhibition rate In the calculation of , the control group was the control group mice administered with PBS in this experiment, and each The test groups were mice treated with different siRNA complexes. The KNG mRNA expression level was set as 100%, and the KNG mRNA expression suppression level was calculated accordingly. The rate was set at 0%, and the test results were normalized to the KNG mRNA expression level in the control group. The results are shown in Table 6.

[0460] [Table 6]

[0461] Using the comparative Ct (ΔΔCt) method, the expression of the target gene KNG in each test group and the control group was A relative quantitative calculation was performed on the amount, and the calculation method is as follows. ΔCt(test group)=Ct(target gene in test group)-Ct(endogenous reference gene in test group) ΔCt(control group)=Ct(gene of interest in control group)-Ct(endogenous reference gene in control group) ΔΔCt(test group)=ΔCt(test group)-ΔCt(average of control group) ΔΔCt(control group) = ΔCt(control group) - ΔCt(average of control group) Here, ΔCt (average of the control group) is the ΔCt (average of the control group) for each mouse in the control group. The mean of the mean of the ΔΔΔT1 and ΔΔΔT2 mice was 1. Therefore, each mouse in the test and control groups had one ΔΔΔT1 and ΔΔΔT2 mice. It corresponds to the Ct value.

[0462] The expression levels of KNG mRNA in the test group were normalized to those in the control group. The expression level of G mRNA was defined as 100%.

[0463] Relative expression level of KNG mRNA in the test group = 2 -ΔΔCt(試験群) ×100% do.

[0464] Average relative expression level of KNG mRNA in a test group compared to siRNA in the same test group is the arithmetic mean of the relative expression levels of each group of mice at that concentration.

[0465] The test results were normalized to the KNG mRNA expression level in the control group. The results are shown in Table 7. In Table 7, the human KNG mRNA suppression rate was 1.0% when the corresponding siRNA complex was administered. 1 shows the mean and standard deviation of the mouse human KNG mRNA suppression rates given the respective treatments.

[0466] [Table 7]

[0467] As can be seen from the results in Table 7, the siRNA complex of the present disclosure inhibited the expression of siRNA in the humanized mouse liver. Both of these showed excellent inhibitory effects on human KNG mRNA. The inhibition rates were 48.35%-56.29%.

[0468] (Experimental Example 4) In vivo analysis of the siRNA complex provided by the present disclosure in humanized mice Measurement of effects on KNG protein concentration The humanized mice used in this experiment were the same as those in Experiment 3. The test group was aged 6 to 8 weeks. Two humanized mice of the age of 18 were used, and each mouse was administered 6 mg / kg (siRNA and The siRNA complex L10-siKNa1M1SP was administered as a single dose by subcutaneous injection. The siRNA complex L10-siKNa1M1SP was prepared at 0.6 mg / mL (siRNA and The dosage volume is 10 mL / The mouse body weight was 1 kg. Another humanized mouse was administered 1×PBS, and the administration volume was The volume was 10 mL / kg mouse body weight and served as the control group.

[0469] The mice were then cultured on the day of administration and on days 7, 14, 21, and 28 after administration. Blood was collected (each of the above time points is designated as D0, D7, D14, D21, and D28, respectively) and whole blood samples were taken. The whole blood samples from each mouse were diluted with anticoagulant and whole blood at a volume ratio of 1:9 (v / v). The anticoagulant, 3.8 wt% sodium citrate aqueous solution, was added in such proportions as to obtain the supernatant. Certain test plasma samples were obtained and stored at -80°C.

[0470] 6× Protein Loading Buffer (containing DTT, from Beijing Baerdi Bio-Tech Co., Ltd. Purchased from the manufacturer, product number DE0105-1mL) and diluted with sterile water to prepare 2x protein loading buffer. The plasma samples from each of the three mice in the test and control groups were used as the test samples. Add 5 μL of each to a separate 1.5 mL centrifuge tube, then add 5 μL of sterile water and Add 15 μL of 2× protein loading buffer, mix evenly, and then heat in a metal bath for 1 The mixture was denatured at 00°C for 10 minutes to obtain a protein sample solution.

[0471] A 10% separating gel and a 4% stacking gel were prepared. 200 mL of 5x SDS-PAGE Electrophoresis buffer (purchased from Beijing Baerdi Biotechnology Co., Ltd., No. DE0100-500 ) was added with water to make 800 mL, and mixed uniformly to obtain a dilution buffer. Dilution buffer was poured in. 10 μL of each prepared protein sample solution was taken. , and added to different gel holes of an SDS-PAGE gel, and added a protein marker to another gel hole. (Spectra Multcolor Broad Range Protein L adder (Thermo Scientific, no. 26634) and constant voltage After electrophoresis at 120 V for 80 min, the electrophoresis was stopped.

[0472] 10× Protein Electrophoresis Transfer Buffer (Beijing Baerdi Biotechnology Co., Ltd., No. DE01 81-500mL) Add water to 100mL to make 800mL, and then add 200mL of anhydrous methanol. The mixture was mixed with methanol to obtain a diluted transfer buffer. After soaking the PVDF film for 2 minutes, it was placed in the diluted transfer buffer. The sponge, filter paper and PVDF film were soaked. The gel was removed from the gel plate and Negative electrode plate (black) - sponge - filter paper - gel - PVDF film - filter paper - sponge - positive electrode plate ( The sandwich boards were then made in the order of white (black) and white (white) and placed in the transfer tank. The transfer tank was placed in an ice box and placed in a fixed Transfer was performed at a voltage of 100V for 1 hour.

[0473] After the transfer was completed, the PVDF film was removed and the protein markers of 80 to 150 KD were The corresponding PVDF films were sheared and the sheared PVDF films were then washed with 5 wt% skim milk ( Skim milk powder was purchased from Beijing Soraibo Technology Co., Ltd. (No. D8340) and soaked in a shaker for 2 The primary antibody (an ti-h-KNG (purchased from Tang Zhongying Hematology Research Center, Soochow University) was diluted and incubated overnight at 4°C. The cells were then cultured to obtain PVDF films.

[0474] 20× TBS buffer (purchased from Beijing Baerdi Biotechnology Co., Ltd., No. DE0190- 500) Add water to 50 mL to make 1 L, then add 1000 μl of Tween n-20 (purchased from Beijing Soraibao Technology Co., Ltd., No. T8220) was added and mixed uniformly. Then, a TBST buffer was prepared.

[0475] The incubated PVDF film was eluted three times with excess TBST buffer for 5 min each. Afterwards, the secondary antibody (horseradish) was diluted with 5 wt% skim milk at a volume ratio of 1:2000. Peroxidase-labeled goat anti-rabbit IgG (H+L) (Beijing Zhongsugi Jinqiao Biotechnology Co., Ltd.) The diluted solution (purchased from Iwate Pharmaceutical Co., Ltd., No. ZB-2301) was incubated in a shaker at room temperature for 1 hour, and then the excess The PVDF film was eluted three times with TBST buffer for 5 minutes each. A PVDF film was obtained.

[0476] Western Bioluminescence Detection Kit (Vigorous Biotechnology, The tamper-evident process was carried out according to the instructions in the manual. The antibody was then transferred to a 1:1 (v / v) mixture of solution A and solution B (W Mix estern (included in the luminescence detection kit) and horseradish peroxidase The enzyme reaction substrate solution (HRP reaction substrate) was obtained, and the HRP reaction substrate was applied to the washed PVDF film. It was distributed.

[0477] Place the PVDF film coated with HRP reaction substrate on the imager and follow the instructions in the manual. Protein markers were photographed in bright field mode according to the method. Protein luminescence was observed in chemiluminescence mode. The bands were photographed and the exposure time was 10 min.

[0478] As can be seen from the protein marker images, the control group and each test group at different time points Both showed clear protein markers, and the results were analyzed by ImageJ software. Protein markers were analyzed to determine the protein markers of the control group and each test group at different time points. The light intensity values ​​of the first band were obtained. Analysis showed that each test group was significantly higher than the control group and the data of D0. The light intensity values ​​of the protein blot bands were all significantly decreased at different time points after administration. It was discovered that...

[0479] In addition, the light intensity value of the protein blot band of the control group was used as the standard, and the light intensity values ​​of the test group at each time point were The light intensity values ​​of the KNG protein blot bands were normalized to set the protein expression level of the control group at 1 The relative expression level of KNG protein in the test group was calculated using the following formula: .

[0480] KNG protein relative expression level = (light intensity value of KNG protein blot band of test group / (Light intensity value of control KNG protein blot band) x 100% Inhibition rate of KNG protein expression = (1 - relative expression level of KNG protein) x 10 0%

[0481] For the test groups, the relative expression levels and inhibition rates were calculated as the arithmetic mean of the test results for two mice. It is.

[0482] Figure 3 shows the relative expression of KNG protein in the control group and the test group samples at different blood collection times. level was shown.

[0483] As can be seen from the results in FIG. 3, the siRNA complex provided by the present disclosure The compound showed excellent inhibitory effect against KNG protein in the test plasma samples. The siRNA complexes provided by The KNG protein inhibition rate in each study was 97% or higher, and even reached approximately 99%. This indicates that the siRNA complex of the present disclosure has a significant inhibitory effect on the KNG protein. It can effectively suppress the expression of KNG, and thus is useful in the treatment of KNG-related diseases, especially sepsis. It is clear that there is great potential for application in this field.

[0484] Although several embodiments of the present disclosure have been described in detail above, the present disclosure The present disclosure is not limited to the specific details, but is within the scope of the technical idea of ​​the present disclosure. A number of simple modifications can be made to the present disclosure, all of which are within the scope of the present disclosure. Belongs to the range.

[0485] In addition, it should be noted that each of the specific techniques described in the above embodiments Technical features may be combined in any suitable manner, provided there is no contradiction, and To avoid unnecessary duplication, this disclosure will not separately describe the various possible combination methods.

[0486] In addition, various different embodiments of the present disclosure may be combined in any combination, and the spirit of the present disclosure will be apparent to those skilled in the art. Unless otherwise stated, such combinations should also be considered as disclosed in this disclosure. be.

Claims

1. A siRNA comprising a sense strand and an antisense strand, each independently being a modified or unmodified nucleotide, and the sense strand is the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, Sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence II are as shown in the following i) to vi). is one selected from the sequences i) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 have a length and the nucleotide sequence II and SEQ ID NO:2 are identical and have no more than three nucleotide differences. is the same length as the nucleotide sequence shown in 5'-AAAGUAACAACCAGUUUGZ １ -3' (SEQ ID NO: 1), 5'-Z ２ CAAACUGGUUGUUACUUU-3' (SEQ ID NO: 2) However, Z １ is U and Z ２ is A, In said nucleotide sequence I, position Z １ Nucleotide Z corresponding to ３ The above-mentioned In nucleotide sequence II, position Z ２ Nucleotide Z corresponding to ４ and Z ４ teeth, the first nucleotide at the 5' end of the antisense strand, ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 have the same length and the nucleotide sequence II and the sequence ID No. The nucleotide sequence shown in 62 is identical in length and has no more than three nucleotide differences. can be, 5'-AUUGAACUUUCGAAUUACZ ５ -3' (SEQ ID NO: 61), 5'-Z ６ GUAAUUCGAAAGUUCAAU-3' (SEQ ID NO: 62) However, Z ５ is C, and Z ６ is G, In said nucleotide sequence I, position Z ５ Nucleotide Z corresponding to ７ The above-mentioned In nucleotide sequence II, position Z ６ Nucleotide Z corresponding to ８ and Z ８ teeth, the first nucleotide at the 5' end of the antisense strand, iii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 , which are equal in length and have no more than three nucleotide differences, and which are identical to nucleotide sequence II and sequence The nucleotide sequence shown in FIG. 122 is the same length and has three nucleotide differences. is as follows: 5'-UCGAAUUACCUACUCAAUZ ９ -3' (SEQ ID NO: 121), 5'-Z １０ AUUGAGGUAGGUAAUUCGA-3' (SEQ ID NO: 122) However, Z ９ is U and Z １０ is A, In said nucleotide sequence I, position Z ９ Nucleotide Z corresponding to １１ The above-mentioned In nucleotide sequence II, position Z １０ Nucleotide Z corresponding to １２ and Z １２ is the first nucleotide at the 5' end of the antisense strand, iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 182 is the same length and has no more than three nucleotide differences. Below, 5'-GAUAAUGCAUACAUCGAUZ １３ -3' (SEQ ID NO: 181), 5'-Z １４ AUCGAUGUAUGCAUUAUC-3' (SEQ ID NO: 182) However, Z １３ is A and Z １４ is U, In said nucleotide sequence I, position Z １３ Nucleotide Z corresponding to １５ Contains, before In the nucleotide sequence II, position Z １４ Nucleotide Z corresponding to １６ The above-mentioned Z １６ is the first nucleotide at the 5' end of the antisense strand, v) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have the same length and the nucleotide sequence II and the sequence ID No. The nucleotide sequence shown in 242 is identical in length and has no more than three nucleotide differences. and 5'-GAAUAAACGCAACUUUCUAZ １７ -3' (SEQ ID NO: 241), 5'-Z １８ UAGAAAGUUGCGUUAUUC-3' (SEQ ID NO: 242) However, Z １７ is U and Z １８ is A, In said nucleotide sequence I, position Z １７ Nucleotide Z corresponding to １９ Contains, before In the nucleotide sequence II, position Z １８ Nucleotide Z corresponding to ２０ The above-mentioned Z ２０ is the first nucleotide at the 5' end of the antisense strand, vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 302 is the same length and has no more than three nucleotide differences. Below, 5'-AACUUUCUAUUUCAAGAUZ ２１ -3' (SEQ ID NO: 301), 5'-Z ２２ AUCUUGAAAUAGAAAGUU-3' (SEQ ID NO: 302) However, Z ２１ is U and Z ２２ is A, In said nucleotide sequence I, position Z ２１ Nucleotide Z corresponding to ２３ Contains, before In the nucleotide sequence II, position Z ２２ Nucleotide Z corresponding to ２４ The above-mentioned Z ２４ is the first nucleotide at the 5' end of the antisense strand, siRNA.

2. A nucleotide sequence between said nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 is inserted. and / or the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 have no more than one side difference. and the nucleotide sequence differs by no more than one nucleotide from the nucleotide sequence Alternatively, between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 and / or said nucleotide sequence II and SEQ ID NO: 62, which has no more than one nucleotide difference between it and the nucleotide sequence shown in Alternatively, the nucleotide sequence I may be a nucleotide sequence as shown in SEQ ID NO:

121. and / or said nucleotide sequence II and said sequence no. No. 122 has no more than one nucleotide difference, Alternatively, the nucleotide sequence I may be a nucleotide sequence as set forth in SEQ ID NO:

181. and / or said nucleotide sequence II and said sequence no. No. 182, which has no more than one nucleotide difference between it and the nucleotide sequence shown in Alternatively, the nucleotide sequence I may be a nucleotide sequence as set forth in SEQ ID NO:

241. and / or said nucleotide sequence II and said sequence no. No. 242 has no more than one nucleotide difference, Alternatively, the nucleotide sequence I may be a nucleotide sequence as set forth in SEQ ID NO:

301. and / or said nucleotide sequence II and said sequence no. 302 and the nucleotide sequence shown in The siRNA described in claim 1.

3. The nucleotide sequence between said nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 The difference between the punch lines is Z. ４ Including the difference at the position of Z ４ is selected from U, C or G; Alternatively, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 The nucleotide difference between Z ８ Including the difference at the position of Z ８ is selected from A, U or C 、 Alternatively, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 The nucleotide difference between Z １２ Including the difference at the position of Z １２ is selected from U, C, or G Selected, Alternatively, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 The nucleotide difference between Z １６ Including the difference at the position of Z １６ is selected from A, C or G Selected, Alternatively, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 The nucleotide difference between Z ２０ Including the difference at the position of Z ２０ is selected from U, C, or G Selected, Alternatively, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 The nucleotide difference between Z ２４ Including the difference at the position of Z ２４ is selected from U, C, or G The siRNA according to claim 1 or 2, selected from the group consisting of

4. Z ３ Is, Z ４ or Z ７ Is, Z ８ and complementary nuclease or Z １１ Is, Z １２ or Z １ ５ Is, Z １６ or Z １９ Is, Z ２０ and complementary Nuk or Z ２３ Is, Z ２４ The nucleotide sequence of claim 1 to 3. An siRNA according to any one of claims 1 to 3.

5. The sense strand and the antisense strand may have the same or different lengths, and the length of the sense strand is 19 23 nucleotides in length and the antisense strand is 19-26 nucleotides in length; The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:4; 5'-AAAGUAACAACCAGUUUGZ ３ -3' (SEQ ID NO: 3), 5'-Z ４ CAAACUGGUUGUUACUUU-3' (SEQ ID NO: 4) However, Z ４ is selected from A, U, G or C; Z ３ Is, Z ４ and complementary nucleotide It is Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:

63. and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 64; 5'-AUUGAACUUUCGAAUUACZ ７ -3' (SEQ ID NO: 63), 5'-Z ８ GUAAUUCGAAAGUUCAAU-3' (SEQ ID NO: 64) However, Z ８ is selected from A, U, G or C; Z ７ Is, Z ８ and complementary nucleotide It is Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:

123. and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:

124. the law of nature, 5'-UCGAAUUACCUACUCAAUZ １１ -3' (SEQ ID NO: 123), 5'-Z １２ AUUGAGGUAGGUAAUUCGA-3' (SEQ ID NO: 124) However, Z １２ is selected from A, U, G or C; Z １１ Is, Z １２ and complementary Nuk It is leotide, Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:

183. and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:

184. the law of nature, 5'-GAUAAUGCAUACAUCGAUZ １５ -3' (SEQ ID NO: 183), 5'-Z １６ AUCGAUGUAUGCAUUAUC-3' (SEQ ID NO: 184) However, Z １６ is selected from A, U, G or C; Z １５ Is, Z １６ and complementary Nuk It is leotide, Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:

243. and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:

244. the law of nature, 5'-GAAUAAACGCAACUUUCUAZ １９ -3' (SEQ ID NO: 243), 5'-Z ２０ UAGAAAGUUGCGUUAUUC-3' (SEQ ID NO: 244) However, Z ２０ is selected from A, U, G or C; Z １９ Is, Z ２０ and complementary Nuk It is leotide, Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:

303. and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:

304. the law of nature, 5'-AACUUUCUAUUUCAAGAUZ ２３ -3' (SEQ ID NO: 303), 5'-Z ２４ AUCUUGAAAUAGAAAGUU-3' (SEQ ID NO: 304) However, Z ２４ is selected from A, U, G or C; Z ２３ Is, Z ２４ and complementary Nuk The siRNA according to any one of claims 1 to 4, which is a leucine.

6. Z ３ is U and Z ４ is A, or Z ７ is C, and Z ８ is G, or , Z １１ is U and Z １２ is A, or Z １５ is A and Z １６ is U , or Z １９ is U and Z ２０ is A, or Z ２３ is U and Z ２４ teeth The siRNA of claim 5, which is A.

7. The sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence III. The length of nucleotide sequence III and nucleotide sequence IV is are each independently 1 to 4 nucleotides, and said nucleotide sequence III is a nucleotide nucleotide sequence I is linked to the 5' end of nucleotide sequence I, and nucleotide sequence IV is linked to the 3' end of nucleotide sequence II. The nucleotide sequence III and the nucleotide sequence IV are equal in length. The term "substantially reverse complementary" refers to a combination of two This refers to the presence of one or fewer base mismatches between nucleotide sequences, making it completely reverse-complementary. Any of claims 1 to 6, wherein "no mismatch" means that there is no mismatch between the two nucleotide sequences.

1. An siRNA according to claim 1.

8. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length. and the nucleotide sequences III and IV have a length of 3 or less. each of the nucleotides is a single nucleotide, and the base of said nucleotide sequence III is C; or The nucleotide sequences III and IV are each 2 nucleotides in length and each have a 5' end from the 3' end to the nucleotide sequence III is CC; or Nucleotide sequences III and IV are each 3 nucleotides in length and begin at the 5' end with Towards the 3' end, the base sequence of nucleotide sequence III is ACC; or Nucleotide sequences III and IV are each 4 nucleotides in length and are 3 nucleotides from the 5' end. 'towards the end, the base sequence of nucleotide sequence III is AACC; Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 are The nucleotide sequences III and IV are equal in length and have no more than three nucleotide differences. each of which is one nucleotide in length, and the base of said nucleotide sequence III is G; or the nucleotide sequences III and IV are each 2 nucleotides in length; , from the 5' end to the 3' end, the base sequence of nucleotide sequence III is GG; Alternatively, the nucleotide sequences III and IV are each 3 nucleotides in length and From the 3' end to the 3' end, the base sequence of nucleotide sequence III is UGG; and The nucleotide sequences III and IV are each 4 nucleotides in length and 5' From the terminus towards the 3' terminus, the base sequence of nucleotide sequence III is CUGG; Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 , the nucleotide sequences III and I are equal in length and have no more than three nucleotide differences; V is one nucleotide in length, and the base of the nucleotide sequence III is U. or said nucleotide sequences III and IV are each 2 nucleotides in length; From the 5' end to the 3' end, the base sequence of nucleotide sequence III is UU. or the nucleotide sequences III and IV are each 3 nucleotides in length; From the 5' to the 3' end, the base sequence of nucleotide sequence III is CUU; Alternatively, the nucleotide sequences III and IV are each 4 nucleotides in length and From the 3' end to the 3' end, the base sequence of nucleotide sequence III is ACUU; Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 , the nucleotide sequences III and I are equal in length and have no more than three nucleotide differences; V is one nucleotide in length and the base of the nucleotide sequence III is A. or said nucleotide sequences III and IV are each 2 nucleotides in length; From the 5' end to the 3' end, the base sequence of nucleotide sequence III is CA. or the nucleotide sequences III and IV are each 3 nucleotides in length; From the 5' to the 3' end, the base sequence of nucleotide sequence III is ACA; Alternatively, the nucleotide sequences III and IV are each 4 nucleotides in length and From the 3' end to the 3' end, the base sequence of nucleotide sequence III is UACA; Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 , the nucleotide sequences III and I are equal in length and have no more than three nucleotide differences; V is one nucleotide in length and the base of the nucleotide sequence III is A. or said nucleotide sequences III and IV are each 2 nucleotides in length; From the 5' end to the 3' end, the base sequence of nucleotide sequence III is GA. or the nucleotide sequences III and IV are each 3 nucleotides in length; From the 5' to the 3' end, the base sequence of nucleotide sequence III is AGA; Alternatively, the nucleotide sequences III and IV are each 4 nucleotides in length and From the 3' end to the 3' end, the base sequence of nucleotide sequence III is CAGA; Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 , the nucleotide sequences III and I are equal in length and have no more than three nucleotide differences; V is one nucleotide in length and the base of the nucleotide sequence III is C. or said nucleotide sequences III and IV are each 2 nucleotides in length; The base sequence of nucleotide sequence III from the 5' end to the 3' end is GC. or the nucleotide sequences III and IV are each 3 nucleotides in length; From the 5' to the 3' end, the base sequence of nucleotide sequence III is CGC; Alternatively, the nucleotide sequences III and IV are each 4 nucleotides in length and From the 3' end to the 3' end, the base sequence of nucleotide sequence III is ACGC; The siRNA described in claim 7.

9. The antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V having a length The length of the antisense strand is 1 to 3 nucleotides, and the antisense strand is bound to the 3' end of the antisense strand. The siRNA according to any one of claims 1 to 8, wherein the 3'-overhanging end of the siRNA strand is a 3'-overhanging end of the siRNA strand.

10. The siRNA of claim 9, wherein the nucleotide sequence V is 2 nucleotides in length. 。

11. The nucleotide sequence V is a sequence of two consecutive thymine deoxyribonucleotides or or the nucleotide sequence V is a target The si gene of claim 9 or 10 is complementary to a nucleotide at a corresponding position in mRNA. RNA.

12. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, The antisense strand comprises the nucleotide sequence shown in SEQ ID NO:6, 5'-AAAGUAACAACCAGUUUGZ ３ -3' (SEQ ID NO:5), 5'-Z ４ CAAACUGGUUGUUACUUUGG-3' (SEQ ID NO: 6) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

7. the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 8; 5'-CCAAAGUAAACAACCAGUUUGZ ３ -3' (SEQ ID NO: 7), 5'-Z ４ CAAACUGGUUGUUACUUUGGUU-3' (SEQ ID NO: 8) However, the Z ４ is the first nucleotide at the 5' end of the antisense strand, and Z ３ is selected from A, U, G or C; Z ４ Is, Z ３ is a nucleotide complementary to Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

65. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

66. Including, 5'-AUUGAACUUUCGAAUUACZ ７ -3' (SEQ ID NO: 65), 5'-Z ８ GUAAUUCGAAAGUUCAAUCC-3' (SEQ ID NO: 66) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

67. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

68. Including, 5'-GGAUUGAACUUUCGAAUUACZ ７ -3' (SEQ ID NO: 67), 5'-Z ８ GUAAUUCGAAAGUUCAAUCCAG-3' (SEQ ID NO: 68) However, the Z ８ is the first nucleotide at the 5' end of the antisense strand, and Z ７ is selected from A, U, G or C; Z ８ Is, Z ７ is a nucleotide complementary to Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

125. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

126. Contains an array, 5'-UCGAAUUACCUACUCAAUZ １１ -3' (SEQ ID NO: 125), 5'-Z １２ AUUGAGGUAGGUAAUUCGAAA-3' (SEQ ID NO: 126) Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

127. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

128. Contains an array, 5'-UUUCGAAUUACCUACUCAAUZ １１ -3' (SEQ ID NO: 127) 、 5'-Z １２ AUUGAGGUAAUUCGAAAGU-3' (SEQ ID NO: 12 ８） However, the Z １２ is the first nucleotide at the 5' end of the antisense strand, and Z １１ is selected from A, U, G or C; Z １２ Is, Z １１ is a nucleotide complementary to the law of nature, Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

185. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

186. Contains an array, 5'-GAUAAUGCAUACAUCGAUZ １５ -3' (SEQ ID NO: 185), 5'-Z １６ AUCGAUGUAUGCAUUAUCUG-3' (SEQ ID NO: 186) Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

187. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

188. Contains an array, 5'-CAGAUAAUGCAUACAUCGAUZ １５ -3' (SEQ ID NO: 187) 、 5'-Z １６ AUCGAUGUAUGCAUUAUCUGUA-3' (SEQ ID NO: 18 ８） However, the Z １６ is the first nucleotide at the 5' end of the antisense strand, and Z １５ is selected from A, U, G or C; Z １６ Is, Z １５ is a nucleotide complementary to the law of nature, Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

245. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

246. Contains an array, 5'-GAAUAAACGCAACUUUCUAZ １９ -3' (SEQ ID NO: 245), 5'-Z ２０ UAGAAAGUUGCGUUAUUCUC-3' (SEQ ID NO: 246) Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

247. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

248. Contains an array, 5'-GAGAAUAAACGCAACUUUCUAZ １９ -3' (SEQ ID NO: 247) 、 5'-Z ２０ UAGAAAGUUGCGUUAUUCUCUG-3' (SEQ ID NO: 24 ８） However, the Z ２０ is the first nucleotide at the 5' end of the antisense strand, and Z １９ is selected from A, U, G or C; Z ２０ Is, Z １９ is a nucleotide complementary to the law of nature, Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

305. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

306. Contains an array, 5'-AACUUUCUAUUUCAAGAUZ ２３ -3' (SEQ ID NO: 305), 5'-Z ２４ AUCUUGAAAUAGAAAGUUGC-3' (SEQ ID NO: 306) Alternatively, the sense strand of the siRNA has the nucleotide sequence shown in SEQ ID NO:

307. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

308. Contains an array, 5'-GCAACUUUCUAUUUCAAGAUZ ２３ -3' (SEQ ID NO: 307) 、 5'-Z ２４ AUCUUGAAAUAGAAAGUUGCGU-3' (SEQ ID NO: 30 ８） However, the Z ２４ is the first nucleotide at the 5' end of the antisense strand, and Z ２３ is selected from A, U, G or C; Z ２４ Is, Z ２３ is a nucleotide complementary to The siRNA according to any one of claims 1 to 11.

13. The siRNA is siKNa1, siKNa2, siKNb1, siKNb2, si KNc1, siKNc2, siKNd1, siKNd2, siKNe1, siKNe2, The siRN according to any one of claims 1 to 12, which is siKNf1 and siKNf2. A.

14. The sense strand or the antisense strand has at least one modified nucleotide. and / or at least one phosphate ester group is a phosphate having a modifying group. The siRNA according to any one of claims 1 to 13, which is an ester group.

15. Each nucleotide in the sense strand and the antisense strand is independently fluoro-modified.

15. The method according to claim 1, wherein the nucleotide is a nucleotide or a non-fluoro modified nucleotide. The siRNA described herein.

16. The fluoro-modified nucleotides are located at nucleotide sequence I and nucleotide sequence II. and from the 5' end to the 3' end, at least the 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29 The 9th nucleotide is a fluoro-modified nucleotide, and from the 5' to the 3' end At least the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are The siRNA of claim 15, which is a fluoro-modified nucleotide.

17. From the 5' end to the 3' end, in the sense strand, The nucleotides at positions 7, 8, and 9 or positions 5, 7, 8, and 9 are fluoro-modified nucleotides. and the nucleotides at the remaining positions in the sense strand are non-fluoro modified nucleotides. From the 5' end to the 3' end, in the antisense strand, The nucleotides at positions 2, 6, 14, and 16 or 2, 6, 8, 9, 14, and 16 of column II are and the nucleotides at the remaining positions in the antisense strand are fluoro-modified nucleotides. The siRNA of claim 16, wherein is a non-fluoro modified nucleotide.

18. Each non-fluoro modified nucleotide has a hydroxy group at the 2' position of the ribose group of the nucleotide. are independently selected from nucleotides or nucleotide analogs substituted with non-fluorine groups. The siRNA according to any one of claims 15 to 17, which is one of the above.

19. A nucleoside in which the 2'-hydroxyl group of the ribose group of a nucleotide is replaced with a non-fluorine group. 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-Alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino Modified nucleotides, 2'-substituted amino modified nucleotides, 2'-deoxy nucleotides and the nucleotide analog is an isonucleotide, an LNA, an ENA 19. The siRNA of claim 18, which is one selected from the group consisting of cET, UNA and GNA. 。

20. Each non-fluoro modified nucleotide is a methoxy modified nucleotide, Toxo-modified nucleotides are nucleotides in which the 2'-hydroxy group of the ribose group is replaced with methoxy. The siRNA of any one of claims 15 to 19, which refers to a nucleotide.

21. From the 5' end to the 3' end, the nucleotide sequence in the sense strand of the siRNA The nucleotides at positions 5, 7, 8 and 9 of column I are fluoro-modified nucleotides; The remaining nucleotides in the sense strand of the nucleic acid are methoxy-modified nucleotides, and the 5' end From the 3' end to the nucleotide sequence in the antisense strand of the siRNA The nucleotides at positions 2, 6, 8, 9, 14, and 16 of II are fluoro-modified nucleotides. and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. It is Chid. Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I are fluoro-modified nucleotides. and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides. , from the 5' end to the 3' end, The nucleotides at positions 2, 6, 14, and 16 of peptide sequence II are fluoro-modified nucleotides. and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. It is Chid. Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 7, 8 and 9 of nucleotide sequence I are fluoro-modified nucleotides; The nucleotides at the remaining positions of the sense strand of the iRNA are methoxy-modified nucleotides, nucleotides in the antisense strand of the siRNA from the 3' end to the 3' end The nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoro-modified nucleotides. , the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides The siRNA of claim 17,

22. siKNa1-M1, siKNa1-M2, siKNa1-M3, siKNa2-M1 , siKNa2-M2, siKNa2-M3, siKNb1-M1, siKNb1-M2 , siKNb1-M3, siKNb2-M1, siKNb2-M2, siKNb2-M3 , siKNc1-M1, siKNc1-M2, siKNc1-M3, siKNc2-M1 , siKNc2-M2, siKNc2-M3, siKNd1-M1, siKNd1-M2 , siKNd1-M3, siKNd2-M1, siKNd2-M2, siKNd2-M3 , siKNe1-M1, siKNe1-M2, siKNe1-M3, siKNe2-M1 , siKNe2-M2, siKNe2-M3, siKNf1-M1, siKNf1-M2 , siKNf1-M3, siKNf2-M1, siKNf2-M2 and siKNf2-M The siRNA according to any one of claims 1 to 21, which is any one of the above 3.

23. The phosphate ester group having the modifying group is a phosphate diester bond of the phosphate ester group. wherein at least one oxygen atom of the formula (I) is replaced with a sulfur atom. Item 15. The siRNA described in item 14.

24. The phosphate ester group having the modifying group is a thiophosphoric acid group having a structure represented by formula (1). The siRNA of claim 14 or 23, which is an ester group. 【Chemistry 1】

25. In the siRNA, the thiophosphate group is Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, The first and second nucleotides from the 5' end of the antisense strand Between, The second and third nucleotides from the 5' end of the antisense strand Between, The first and second nucleotides from the 3' end of the antisense strand Between, and The second and third nucleotides from the 3' end of the antisense strand and wherein the at least one selected from the group consisting of The siRNA described herein.

26. siKNa1-M1S, siKNa1-M2S, siKNa1-M3S, siKNa2 -M1S, siKNa2-M2S, siKNa2-M3S, siKNb1-M1S, si KNb1-M2S, siKNb1-M3S, siKNb2-M1S, siKNb2-M2 S, siKNb2-M3S, siKNc1-M1S, siKNc1-M2S, siKNc 1-M3S, siKNc2-M1S, siKNc2-M2S, siKNc2-M3S, s iKNd1-M1S, siKNd1-M2S, siKNd1-M3S, siKNd2-M 1S, siKNd2-M2S, siKNd2-M3S, siKNe1-M1S, siKN e1-M2S, siKNe1-M3S, siKNe2-M1S, siKNe2-M2S, siKNe2-M3S, siKNf1-M1S, siKNf1-M2S, siKNf1- siKNf2-M3S, siKNf2-M1S, siKNf2-M2S, or siKNf2-M3S The siRNA according to any one of claims 1 to 25,

27. siKNa1-M1P1, siKNa1-M2P1, siKNa1-M3P1, siK Na2-M1P1, siKNa2-M2P1, siKNa2-M3P1, siKNa1- M1SP1, siKNa1-M2SP1, siKNa1-M3SP1, siKNa2-M 1SP1, siKNa2-M2SP1, siKNa2-M3SP1, siKNb1-M1 P1, siKNb1-M2P1, siKNb1-M3P1, siKNb2-M1P1, s iKNb2-M2P1, siKNb2-M3P1, siKNb1-M1SP1, siKN b1-M2SP1, siKNb1-M3SP1, siKNb2-M1SP1, siKNb 2-M2SP1, siKNb2-M3SP1, siKNc1-M1P1, siKNc1- M2P1, siKNc1-M3P1, siKNc2-M1P1, siKNc2-M2P1 , siKNc2-M3P1, siKNc1-M1SP1, siKNc1-M2SP1, s iKNc1-M3SP1, siKNc2-M1SP1, siKNc2-M2SP1, si KNc2-M3SP1, siKNd1-M1P1, siKNd1-M2P1, siKNd 1-M3P1, siKNd2-M1P1, siKNd2-M2P1, siKNd2-M3 P1, siKNd1-M1SP1, siKNd1-M2SP1, siKNd1-M3SP 1, siKNd2-M1SP1, siKNd2-M2SP1, siKNd2-M3SP1 , siKNe1-M1P1, siKNe1-M2P1, siKNe1-M3P1, siK Ne2-M1P1, siKNe2-M2P1, siKNe2-M3P1, siKNe1- M1SP1, siKNe1-M2SP1, siKNe1-M3SP1, siKNe2-M 1SP1, siKNe2-M2SP1, siKNe2-M3SP1, siKNf1-M1 P1, siKNf1-M2P1, siKNf1-M3P1, siKNf2-M1P1, s iKNf2-M2P1, siKNf2-M3P1, siKNf1-M1SP1, siKN f1-M2SP1, siKNf1-M3SP1, siKNf2-M1SP1, siKNf 2-M2SP1 and siKNf2-M3SP1 according to any one of claims 1 to 26. The siRNA according to any one of claims 1 to 4.

28. A composition comprising the siRNA of any one of claims 1 to 27 and a pharma- ceutically acceptable carrier. A pharmaceutical composition comprising:

29. The weight ratio of the siRNA to the pharma- ceutical acceptable carrier is 1:(1-500). Item 29. The pharmaceutical composition according to item 28.

30. The weight ratio of the siRNA to the pharma- ceutically acceptable carrier is 1:(1-50).

29. The pharmaceutical composition according to claim 29.

31. The pharma- ceutical acceptable carrier comprises an organic amine, a co-lipid and a PEGylated lipid, The functional amine is a compound represented by formula (201) and / or a pharma- ceutically acceptable salt thereof; 【Chemistry 2】 During the ceremony, Each X １０１ Or X １０２ are each independently O, S, N-A or C-A, and A is water. or a C1-C20 hydrocarbon chain; Each Y １０１ Or Z １０１ are each independently C=O, C=S, S=O, CH-OH, or SO ２ and Each R １０１ , R １０２ , R １０３ , R １０４ , R １０５ , R １０６ Or R １０７ That each independently represents hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain aliphatic group, a ring or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic groups of the formula , branched or straight chain acyl groups, substituted or unsubstituted branched or straight chain aryl groups, substituted or unsubstituted a substituted, branched or straight chain heteroaryl group; x is an integer from 1 to 10; n is an integer from 1 to 3, m is an integer from 0 to 20, and p is 0 or 1, If m=p=0, then R １０２ is hydrogen, When at least one of n or m is 2, R １０３ and nitrogen in formula (201) , forming a structure represented by formula (202) or formula (203), 【Chemistry 3】 In the formula, g, e, and f are each independently an integer from 1 to 6, and "HCC" represents a hydrocarbon chain. represents each ＊ Any one of claims 28 to 30, wherein N represents a nitrogen atom in formula (201). The pharmaceutical composition according to item 1.

32. The organic amine is an organic amine represented by formula (214) and / or an organic amine represented by formula (215): It is an organic amine that is 【Chemistry 4】 The co-lipid may be cholesterol, a cholesterol analogue, and / or a cholesterol analogue. It is a derivative of The PEGylated lipid is 1,2-dipalmitamide-sn-glycero-3-phosphatidylcholine. ethanolamine-N-[methoxy(polyethylene glycol)]-2000, 32. The pharmaceutical composition of claim 31.

33. The molar ratio of the organic amine, the co-lipid and the PEGylated lipid is (19.7-80): The pharmaceutical composition according to claim 31 or 32, wherein the ratio is (19.7-80):(0.3-50). 。

34. The molar ratio of the organic amine, the co-lipid, and the PEGylated lipid is (50-70):(20 34. The pharmaceutical composition of claim 33, wherein:

35. siRNA according to any one of claims 1 to 27 and a compound that binds to the siRNA The siRNA conjugate comprises a conjugated group.

36. The conjugate group comprises a pharma- ceutical acceptable targeting group and a linker, 36. The method of claim 35, wherein the anchor and the targeting group are in turn covalently or non-covalently linked. The siRNA complexes shown above.

37. The linker has a structure shown in formula (301): 【Chemistry 5】 In the formula, k is an integer from 1 to 3; L Ａ is a chain portion containing an amide bond having a structure represented by formula (302), L Ａ Each of the two ends of the target group and the L Ｃ Bonded to the part by ether bond And, 【Chemistry 6】 L Ｂ is a chain portion containing an N-acylpyrrolidine having the structure shown in formula (303): The chain portion has a carbonyl group at one end thereof, and the L Ｃ Bonded to the part by an amide bond and having an oxygen atom at the other end and being bound to the siRNA via a phosphate bond; 【Chemistry 7】 L Ｃ is hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane. is a divalent to tetravalent linker group based on hydroxymethylaminomethane, Ｃ is an oxygen source Each of the L's is bonded to an ether bond via a Ａ is bonded to the a moiety through a nitrogen atom The L Ｂ The siRNA conjugate of claim 36 , wherein the siRNA conjugate is linked to the moiety.

38. The siRNA conjugate has the structure shown in formula (305): 【Chemistry 8】 wherein the double helix structure represents the siRNA. The siRNA complexes shown above.

39. The linker has a structure shown in formula (306): 【Chemistry 9】 In the formula, l is an integer from 0 to 3; ＊ represents a site on the linker that is attached to the targeting group via an ether bond; ＃ represents the site of the linker that is linked to the siRNA via a phosphate bond; The siRNA complex of claim 38.

40. The siRNA conjugate has the structure shown in formula (307): 【Chemistry 10】 wherein the double helix structure represents the siRNA.

2. The siRNA complex described in claim 1.

41. The linker is attached to the 3' end of the sense strand of the siRNA.

13. The siRNA complex according to any one of claims 1 to 12.

42. The siRNA conjugate has the structure shown in formula (308): 【Chemistry 11】 During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. 、 Each m1, m2, or m3 is independently an integer selected from 2 to 10; R １０ , R １１ , R １２ , R １３ , R １４ Or R １５ are each independently H; , or C １ -C １０ Alkyl group, C １ -C １０ Halogenated alkyl group and C １ -C １０ a alkoxy groups; R ３ is a group having the structure shown in formula A59, 【Chemistry 12】 In the formula, E １ is OH, SH or BH ２ and Nu is any one of the elements described in any one of claims 1 to 26. The siRNA is R ２ is a straight chain alkylene group of 1 to 20 carbon atoms in length, Carbon atoms are C(O), NH, O, S, CH=N, S(O) ２ , C ２ -C １０ Alkenile group, C ２ -C １０ Alkynylene group, C ６ -C １０ Arylene group, C ３ -C １８ Heterosi Crylene group and C ５ -C １０ one or more selected from the group consisting of heteroarylene groups; Optionally substituted, R ２ is C １ -C １０ Alkyl group, C ６ -C １０ Aryl group, C ５ -C １０ Heteroaryl group, C １ -C １０ Halogenated alkyl group, -OC １ -C １０ Alkyl group, -OC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-OH, -OC １ - C １０ Halogenated alkyl group, -SC １ -C １０ Alkyl group, -SC １ -C １０ Alkyl Phenyl group, -C １ -C １０ Alkyl-SH, -SC １ -C １０ Halogenated alkyl groups, Halogen Substituents, -OH, -SH, -NH ２ , -C １ -C １０ Alkyl-NH ２ , -N ( C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -NH(C １ -C １０ Alkyl group), -N(C １ -C １０ Alkyl group) (C １ -C １０ alkylphenyl group), -NH( C １ -C １０ alkylphenyl group), cyano group, nitro group, -CO ２ H, -C(O)O( C １ -C １０ alkyl group), -CON(C １ -C １０ Alkyl group) (C １ -C １０ Alki group), -CONH(C １ -C １０ alkyl group), -CONH ２ , -NHC(O)(C １ -C １０ -NHC(O) (phenyl group), -N(C １ -C １０ Alkyl group ) C(O)(C １ -C １０ alkyl group), -N(C １ -C １０ Alkyl group)C(O)(F phenyl group), -C(O)C １ -C １０ Alkyl group, -C(O)C １ -C １０ Alkylphe Nyl group, -C(O)C １ -C １０ Haloalkyl groups, —OC(O)C １ -C １０ Alkyl group , -SO ２ (C １ -C １０ alkyl group), -SO ２ (phenyl group), -SO ２ (C １ -C １０ halogenated alkyl group), -SO ２ N.H. ２ , -SO ２ NH (C １ -C １０ Alkyl group ), -SO ２ NH (phenyl group), -NHSO ２ (C １ -C １０ alkyl group), -NHS O ２ (phenyl group) and -NHSO ２ (C １ -C １０ halogenated alkyl groups) may optionally have one or more substituents of any one of Each L １ are independently a straight chain alkylene group of 1 to 70 carbon atoms in length, Or multiple carbon atoms are C(O), NH, O, S, CH=N, S(O) ２ , C ２ -C １０ Alkenylene group, C ２ -C １０ Alkynylene group, C ６ -C １０ Arylene group, C ３ -C １ ８ Heterocyclylene group and C ５ -C １０ Heteroarylene groups are each selected from the group consisting of or more optionally substituted with L １ is C １ -C １０ Alkyl group, C ６ -C １０ Aryl Group , C ５ -C １０ Heteroaryl group, C １ -C １０ Halogenated alkyl group, -OC １ -C １ ０ Alkyl group, -OC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-OH, -OC １ -C １０ Halogenated alkyl group, -SC １ -C １０ Alkyl group, -SC １ -C １ ０ Alkylphenyl group, -C １ -C １０ Alkyl-SH, -SC １ -C １０ Halogenated A alkyl groups, halogen substituents, -OH, -SH, -NH ２ , -C １ -C １０ Alkyl-NH ２ , -N(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -NH(C １ -C １ ０ alkyl group), -N(C １ -C １０ Alkyl group) (C １ -C １０ alkylphenyl group) , -NH(C １ -C １０ alkylphenyl group), cyano group, nitro group, -CO ２ H, -C (O)O(C １ -C １０ alkyl group), -CON(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -CONH(C １ -C １０ alkyl group), -CONH ２ , -NHC ( O) (C １ -C １０ -NHC(O) (phenyl group), -N(C １ -C １０ alkyl group)C(O)(C １ -C １０ alkyl group), -N(C １ -C １０ Alkyl group) C (O) (phenyl group), -C(O)C １ -C １０ Alkyl group, -C(O)C １ -C １０ a alkylphenyl group, —C(O)C １ -C １０ Haloalkyl groups, —OC(O)C １ -C １０ Alkyl group, -SO ２ (C １ -C １０ alkyl group), -SO ２ (phenyl group), -SO ２ (C １ -C １０ halogenated alkyl group), -SO ２ N.H. ２ , -SO ２ NH (C １ -C １０ alkyl group), -SO ２ NH (phenyl group), -NHSO ２ (C １ -C １０ Alkyl group) , -NHSO ２ (phenyl group) and -NHSO ２ (C １ -C １０ Halogenated alkyl group) and optionally having one or more substituents selected from the group consisting of 【change】 represents the site at which the group is covalently attached, M １ The siRNA conjugate of claim 35 , wherein represents a targeting group.

43. Each L １ is independently selected from the group consisting of groups A1-A26, and any combination thereof; 【Chemistry 13】 wherein each j1 is independently an integer from 1 to 20; each j2 is independently an integer from 1 to 20; Each R' is independently C １ -C １０ is an alkyl group, each Ra is independently selected from the group consisting of A27 to A45 groups, and any combination thereof; 【Chemistry 14】 Each Rb is independently C １ -C １０ is an alkyl group, 【change】 The siRNA conjugate of claim 42, wherein represents the site to which the group is covalently attached.

44. L １ represents groups A1, A4, A5, A6, A8, A10, A11, A13 and their bond pairs. The siRNA conjugate of claim 43, wherein the siRNA conjugate is selected from the group consisting of:

45. L １ represents a combination of at least two bonds of groups A1, A4, A8, A10 and A11. The siRNA conjugate of claim 44.

46. L １ is a combination of at least two bonds of groups A1, A8 and A10.

46. ​​The siRNA complex according to item 45.

47. L １ The si according to any one of claims 42 to 46, wherein the length of RNA complexes.

48. L １ The siRNA conjugate of claim 47, wherein the length of

49. j1 is an integer from 2 to 10, j2 is an integer from 2 to 10, and R′ is C １ -C ４ Al Kil; Ra is one of A27, A28, A29, A30 and A31; Rb is , C １ -C ５ The siRNA conjugate of any one of claims 43 to 48, wherein the siRNA conjugate is alkyl. body.

50. j1 is an integer from 3 to 5, j2 is an integer from 3 to 5, and R' is a methyl group or an ethyl group. and an isopropyl group, Ra is A27 or A28, and Rb is a methyl group.

50. The siRNA of claim 49, wherein the aryl group is one of an ethyl group, an isopropyl group, and a butyl group. Complex.

51. n1 is an integer from 1 to 2, n3 is an integer from 0 to 1, and n1+n3=2 to 3. The siRNA complex according to any one of claims 42 to 50.

52. Any of claims 42 to 51, wherein each m1, m2 or m3 is independently an integer from 2 to 5. The siRNA complex according to any one of claims 1 to 4.

53. 53. The siRNA complex according to any one of claims 42 to 52, wherein m1 = m2 = m3. 。

54. Each of said targeting groups independently has an affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes. The siRNA complex according to any one of claims 35 to 53, wherein the siRNA complex is a ligand having

55. 55. The method of claim 54, wherein each said targeting group is independently an asialoglycoprotein or a sugar. RNA complexes.

56. Each of said targeting groups is D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D- Galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose α-D-Mannopyranose, β-D-Mannopyranose, α-D-Glucopyranose , β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose Nose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N- Trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyl N-isobutyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R -1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy- 2-Methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2 , 3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D- Glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose Nose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α- D-Glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7 -Tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyrano Cid, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thio ribose, L-ribose, L-4-thioribose, 56. The siRNA complex of claim 55.

57. At least one or each of the targeting groups is galactose or N-acetylgalactosamine The siRNA complex of claim 56, wherein

58. R １０ , R １１ , R １２ , R １３ , R １４ Or R １５ are independently H, a methyl group or an ethyl group. The siRNA conjugate of any one of claims 42 to 57, wherein the aryl group is a methyl group.

59. R ２ The nitrogen-containing backbone is bonded to the N at the site and R ３ The site that is bonded to the P atom in the The siRNA complex according to any one of claims 43 to 58,

60. R ２ The site bonded to N on the nitrogen-containing backbone of ３ The moiety bonded to the P atom in the formula (I) forms a phosphate bond with P.

10. The siRNA complex according to any one of claims 9.

61. R ２ is selected from B5, B6, B5' or B6'; 【Chemistry 15】 represents the site at which the group is covalently attached; q ２ is an integer of 1 to 10, 61. The siRNA complex of any one of claims 60.

62. q ２ The siRNA conjugate of claim 61, wherein is an integer from 1 to 5.

63. The siRNA complexes are represented by the formulas (403), (404), (405), (406), and (4 ０７）、（４０８）、（４０９）、（４１０）、（４１１）、（４１２）、（４１３）、 （４１４）、（４１５）、（４１６）、（４１７）、（４１８）、（４１９）、（４２０ ), (421) or (422) according to any one of claims 35, 42 to 62, The siRNA complex according to any one of claims 1 to 4. 【Chemistry 16】 【change】 【change】 【change】 【change】 【change】 【change】

64. The P atom in formula A59 is attached to the end of the sense or antisense strand of the siRNA. The end refers to the four nucleic acids preceding one end of the sense strand or the antisense strand. The siRNA conjugate of any one of claims 42 to 63, which refers to a nucleotide.

65. The P atom in formula A59 is bonded to the end of the sense strand or antisense strand of the siRNA. The siRNA conjugate of claim 64 .

66. The P atom in formula A59 is attached to the 3' end of the sense strand of the siRNA.

66. The siRNA complex according to claim 65.

67. The P atom in formula A59 is linked to the nucleic acid in the siRNA by a phosphodiester bond.

67. The method according to claim 42, wherein the 2', 3' or 5' position of the leucine is linked to the The siRNA conjugates described herein.

68. The siRNA according to any one of claims 1 to 27, or any one of claims 28 to 34. and / or the siRNA complex according to any one of claims 35 to 67.

23. Use of the present invention in the preparation of a medicament for the treatment and / or prevention of sepsis.

69. The siRNA according to any one of claims 1 to 27, or any one of claims 28 to 34. and / or the siRNA complex according to any one of claims 35 to 67. and / or administering to a subject suffering from sepsis an effective amount of the is a preventative method.

70. The siRNA according to any one of claims 1 to 27, or any one of claims 28 to 34. and / or the siRNA complex according to any one of claims 35 to 67. contacting said hepatocytes with an effective amount of said compound.

71. The siRNA according to any one of claims 1 to 27, or any one of claims 28 to 34. and / or the siRNA complex according to any one of claims 35 to 67. Kit including body.

Images