Polynucleotides containing stabilizing tail region

Abstract

To provide new mRNA molecules incorporating chemical modifications which impart properties advantageous to therapeutic development.SOLUTION: Polynucleotides disclosed herein encode a polypeptide including a 3'-stabilizing region and have enhanced stability compared to wild-type polynucleotides. The 3'-stabilizing region includes at least one modified nucleoside. The modified nucleoside is L-adenosine, 2'-O-methyl-adenosine, α-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol adenosine, LNA-adenosine, PNA-adenosine, or inverted thymidine.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to polynucleotides comprising stabilizing tail regions. [Background technology]

[0002] Traditional methods for generating protein expression have many problems. For example, heterologous DNA introduced into a cell can be inherited by daughter cells (whether or not the heterologous DNA is integrated into a chromosome) or by progeny. The introduced DNA can frequently integrate into the host cell's genomic DNA, altering and / or damaging it. Furthermore, many steps must occur before a protein can be made. Once inside the cell, the DNA must be transported into the nucleus, where it is transcribed into RNA. The RNA transcribed from the DNA must then enter the cytoplasm, where it is translated into protein. This requirement for multiple processing steps creates a lag time before the desired protein is produced. Furthermore, achieving intracellular DNA expression is difficult; often, the DNA enters the cell but is not expressed, or is not expressed at an appropriate rate or concentration. This can be particularly problematic when DNA is introduced into cells, such as primary cells or modified cell lines.

[0003] Natural RNA is synthesized from four basic ribonucleotides: ATP, CTP, UTP, and GTP, but may contain post-transcriptionally modified nucleotides. Furthermore, approximately 100 different nucleoside modifications have been identified in RNA (Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Rozenski, J, Crain, P, and McCloskey, J. 1999. RNA Modification Database: 1999 Update. Nucl Acids Res. 27, 196-197. Summary of the Invention [Problem to be solved by the invention]

[0005] There is a need in the art for biological methods that address the regulation of intracellular translation of nucleic acids. The present invention solves this problem by providing novel mRNA molecules that incorporate chemical alternatives that confer advantageous properties for the development of therapeutics. [Means for solving the problem]

[0006] The present disclosure provides, inter alia, polynucleotides that include a 3'-stabilizing region (eg, containing a modified nucleobase, sugar, or backbone). In a first aspect, the present invention provides a polypeptide encoding a polypeptide having formula I: A'-L-B' Formula I (Wherein A' is (a) at least one 5'-cap structure; (b) 5′-UTR (e.g., 5′-UTR containing a Kozak sequence); (c) the coding region; and (d) 3'-UTR Includes; B' is 1 to 500 (e.g., 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 65 to 85, 70 to 90, 85 to 105, 90 to 110, 105 to 135, 120 to 150, a 3'-stabilizing region containing 130-170, 150-200, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleosides; L is a linker The present invention features a polynucleotide comprising the structure:

[0007] In some embodiments, when the 3'-stabilizing region consists of a single nucleoside, the nucleoside is not a 2'-deoxynucleoside, a 3'-deoxynucleoside, a 2',3'-dideoxynucleoside, a 2'-O-methylnucleoside, a 3'-O-methylnucleoside, a 3'-O-ethylnucleoside, or a 3'-arabinoside. In some embodiments, when the 3'-stabilizing region consists of a single nucleoside, the nucleoside is an L-nucleoside, α-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, reverse thymidine, or 3'-azido-2',3'-dideoxyadenosine.

[0008] In one embodiment, A' further comprises (e) a poly-A region. In certain embodiments, one or more nucleosides in the 3′-stabilizing region have the structure:

[0009] [ka] (In the formula, B 1 is a nucleobase; Each U and U' is independently O, S, N(R U ) nu, or C(R U ) nu where nu is 1 or 2 (e.g., N(R U ) nu 1 for C(R U ) nu For each R U is independently H, halo, or optionally substituted C1-C6 alkyl; R 1 , R 1’ , R 1” , R 2 , R 2’ , R 2” , R 3 , R 4 , and R 5 each independently represents H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C6-C 10 aryl; or R 3 and / or R 5 But R 1 , R 1’ , R 1” , R 2 , R 2’ , or R 2” and optionally substituted C3-C together with the carbon to which they are attached. 10 can form a carbocyclic ring or an optionally substituted C3-C9 heterocyclyl; each of m and n is independently 0, 1, 2, 3, 4, or 5; Y 1 , Y 2 , and Y 3 each independently represents O, S, Se, -NR N1 -, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, where R N1is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10 is aryl; Each Y 4 are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; Y 5 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; or a salt thereof.

[0010] In some embodiments, the 3'-stabilizing region comprises multiple adenosines. In some embodiments, all of the nucleosides in the 3'-stabilizing region are adenosines. In some embodiments, the 3'-stabilizing region comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) modified nucleosides (e.g., an L-nucleoside such as L-adenosine, 2'-O-methyl-adenosine, α-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, or reverse thymidine). In some embodiments, the modified nucleoside is L-adenosine, 2'-O-methyl-adenosine, or reverse thymidine. In some embodiments, the 3'-stabilizing region comprises multiple modified nucleosides. In some embodiments, all of the nucleotides in the 3'-stabilizing region are modified nucleosides. In some embodiments, the 3'-stabilizing region comprises at least two different modified nucleosides. In some embodiments, at least one modified nucleoside is 2'-O-methyl-adenosine. In some embodiments, at least one modified nucleoside is a reverse thymidine. In some embodiments, at least one modified nucleoside is a 2'-O-methyl-adenosine and at least one modified nucleoside is a reverse thymidine.

[0011] In one embodiment, the stabilization region has the structure:

[0012] [ka] wherein each X is independently O or S; A represents adenine and T represents thymine). or a salt thereof.

[0013] In some embodiments, all of the modified nucleosides are the same (e.g., all of the modified nucleosides are L-adenosine). In some embodiments, the stabilization region includes 10 nucleosides. In some embodiments, the stabilization region includes 11 nucleosides.

[0014] In certain embodiments of any of the above polynucleotides, the linker has the structure:

[0015] [ka] wherein a, b, c, e, f, and g are each independently 0 or 1; d is 0, 1, 2, or 3; R 6 , R 8 , R 10 , and R 12 each independently represents an optionally substituted C1-C6 alkylene, an optionally substituted C1-C6 heteroalkylene, an optionally substituted C2-C6 alkenylene, an optionally substituted C2-C6 alkynylene, or an optionally substituted C6-C 10 Arylene, O, S, Se, and NR 13 and; R 7 and R 11 are each independently carbonyl, thiocarbonyl, sulfonyl, or phosphoryl, where R 7 is phosphoryl, and -(R 9 ) d - is a bond and e, f, and g are 0, then R 6 or R 8 At least one of the following is R instead of O 11 is phosphoryl, and -(R 9 ) d - is a bond and a, b, and c are 0, then R 10 or R 12 at least one of is not O; Each R 9 are optionally substituted C1 to C 10Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 10 heteroalkylene, or (R 6 ) a -(R 7 ) b -(R 8 ) c (R 10 ) e -(R 11 ) f -(R 12 ) g where -(R 9 ) d - is a bond, then at least one of a, b, c, e, f, or g is 1; R 13 is hydrogen, optionally substituted C1-C4 alkyl, optionally substituted C2-C4 alkenyl, optionally substituted C2-C4 alkynyl, optionally substituted C2-C6 heterocyclyl, optionally substituted C6-C 12 aryl, or optionally substituted C1-C7 heteroalkyl).

[0016] In certain embodiments, the linker is

[0017] [ka] (In the formula, B 1 is a nucleobase, hydrogen, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C3-C10 Cycloalkyl, optionally substituted C-C 10 aryl, optionally substituted C2-C9 heterocycle; R 14 and R 15 are each independently hydrogen or hydroxy.

[0018] In one embodiment, B 1 is a nucleobase or hydrogen. 1 are nucleic acid bases. In certain embodiments, the linker is

[0019] [ka] wherein o is 0, 1, 2, or 3; Y 6 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; Each Y 7 and Y 8 independently, O, S, Se, -NR N1 -, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10 is aryl; Each Y 9 are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; Y 10 O, bond, optionally substituted C1 to C 10Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 10 heteroalkylene).

[0020] In one embodiment, Y 10 is optionally substituted C2 to C 100 It is polyethylene glycolene. In certain embodiments, the linker is

[0021] [ka] where p is 0, 1, 2, 3, 4, or 5.

[0022] In one embodiment, R 14 and R 15 and Y are both hydroxy. 6 is methylene and Y 7 and Y 8 are both O and Y 9 In some embodiments, p is 3.

[0023] In one embodiment, Y 10 are optionally substituted C1 to C 10 It is heteroalkylene. In certain embodiments, the linker is

[0024] [ka] wherein q and r are each independently 1, 2, 3, 4, or 5. In some embodiments, R14 and R 15 and Y are both hydroxy. 6 is methylene and Y 7 and Y 8 are both O and Y 9 In some embodiments, r is 3.

[0025] In certain embodiments of any of the above polynucleotides, the linker may be formed by a click chemistry reaction between a click chemistry reaction pair. In one embodiment, the linker has the structure:

[0026] [ka] , or containing an amide bond.

[0027] In one embodiment, the linker has the structure:

[0028] [ka] Includes:

[0029] In one embodiment, the linker has the structure:

[0030] [ka] Includes:

[0031] In certain embodiments, the linker is attached to the 3' end of A' and the 5' end of B'. In another aspect, the invention features a polynucleotide prepared by oxidation (e.g., by treatment with sodium periodate) of a cis-diol (e.g., a cis-diol in the sugar of a nucleoside, such as a nucleoside at the 3' terminus) of a first polynucleotide to form a di-aldehyde-containing polynucleotide, followed by treatment under suitable conditions with a second polynucleotide that includes a reactive amine moiety (e.g., a reactive alkoxyamino moiety).

[0032] In another aspect, the present invention provides a polynucleotide encoding a polypeptide, said polynucleotide comprising: (a) at least one 5'-cap structure; (b) 5′-UTR (e.g., 5′-UTR containing a Kozak sequence); (c) coding region; (d) 3'-UTR; and (e) 1 to 500 pieces (e.g., 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 65 to 85, 70 to 90, 85 to 105, 90 to 110, 105 to 135, 120 to 150, a 3'-stabilizing region containing 0, 130-170, 150-200, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleosides wherein one or more of the nucleosides is an L-nucleoside (e.g., L-adenosine), α-thio-2′-O-methyl-adenosine, 2′-fluoro-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, inverted thymidine, or 3′-azido-2′,3′-dideoxyadenosine.

[0033] In certain embodiments, the polynucleotide further comprises (f) a poly-A region. In certain embodiments, the L-nucleoside has the structure:

[0034] [ka] (In the formula, B 1 is a nucleobase; U is O, S, N(R U ) nu , or C(R U ) nu where nu is 1 or 2 (e.g., N(R U ) nu 1 for C(R U ) nu For each R U is independently H, halo, or optionally substituted C1-C6 alkyl; R 1 , R 2 , R 3 , and R 5 each independently represents H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C6-C 10 aryl; or R 3 or R 5 But R 1 or R 2 and optionally substituted C3-C together with the carbon to which they are attached. 10 can form a carbocyclic ring or an optionally substituted C3-C9 heterocyclyl; each of m and n is independently 0, 1, 2, 3, 4, or 5; Y 1 , Y 2 , and Y 3 each independently represents O, S, Se, -NR N1-, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10 is aryl; Each Y 4 are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; Y 5 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; or a salt thereof.

[0035] In certain embodiments, the 3'-stabilizing region comprises at least one L-nucleoside (eg, L-adenosine). In certain embodiments, the 3'-stabilizing region comprises a plurality of modified nucleosides.

[0036] In certain embodiments, all of the modified nucleosides are the same (eg, all of the modified nucleosides are L-nucleosides, such as L-adenosine). In some embodiments, the stabilization region comprises 10 nucleosides. In some embodiments, the stabilization region comprises 11 nucleosides.

[0037] In certain embodiments, the 5' end of the 3'-stabilizing region is attached to the 3' end of the 3'-UTR. In certain embodiments, the 5' end of the 3'-stabilizing region is attached to the 3' end of the poly-A region.

[0038] In another aspect, the present invention provides a polynucleotide encoding a polypeptide, the polynucleotide comprising: (a) at least one 5'-cap structure; (b) 5′-UTR (e.g., 5′-UTR containing a Kozak sequence); (c) coding region; (d) 3'-UTR; and (e) 1 to 500 pieces (e.g., 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 65 to 85, 70 to 90, 85 to 105, 90 to 110, 105 to 135, 120 to 150, a 3'-stabilizing region containing 0, 130-170, 150-200, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleosides wherein the 3'-stabilizing region is characterized by a polynucleotide comprising a plurality of modified nucleosides.

[0039] In certain embodiments, the polynucleotide further comprises (f) a poly-A region. In one embodiment, one or more modified nucleosides have the structure:

[0040] [ka] (In the formula, B 1 is a nucleobase; Each U and U' is independently O, S, N(R U ) nu , or C(R U ) nu where nu is 1 or 2 (e.g., N(R U ) nu 1 for C(R U ) nu For each R Uis independently H, halo, or optionally substituted C1-C6 alkyl; R 1 , R 1’ , R 1” , R 2 , R 2’ , R 2” , R 3 , R 4 , and R 5 each independently represents H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C6-C 10 aryl; or R 3 and / or R 5 But R 1 , R 1’ , R 1” , R 2 , R 2’ , or R 2” and optionally substituted C3-C, together with the carbon to which they are attached. 10 can form a carbocyclic ring or an optionally substituted C3-C9 heterocyclyl; each of m and n is independently 0, 1, 2, 3, 4, or 5; Y 1 , Y 2 , and Y 3 each independently represents O, S, Se, -NR N1 -, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10 is aryl; Each Y 4are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; Y 5 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; or a salt thereof.

[0041] In some embodiments, the modified nucleoside is 2'-O-methyl-adenosine or arabino-adenosine. In some embodiments, the polynucleotide comprises multiple modified nucleosides at the 3'-terminus. In some embodiments, the multiple modified nucleosides comprise at least two different nucleosides. In some embodiments, all of the multiple modified nucleosides are the same nucleoside. In some embodiments, all of the nucleosides in the 3'-stabilizing region are modified nucleosides.

[0042] In some embodiments, the stabilization region comprises 10 nucleosides. In some embodiments, the stabilization region comprises 11 nucleosides. In certain embodiments, the 5' end of the 3'-stabilizing region is attached to the 3' end of the 3'-UTR.

[0043] In certain embodiments, the 5' end of the 3'-stabilizing region is attached to the 3' end of the poly-A region. In certain embodiments of any of the above polynucleotides, the 5'-UTR comprises a Kozak sequence.

[0044] In certain embodiments of any of the above polynucleotides, the 3'-stabilizing region comprises the 3' end of the polynucleotide. In some embodiments of any of the above polynucleotides, the 3'-stabilizing region comprises at least one non-nucleoside. In some embodiments, the at least one non-nucleoside is at the 5' end, the 3' end, or an internal position of the 3'-stabilizing region. In some embodiments, the non-nucleoside is an abasic ribose.

[0045] In certain embodiments of any of the above polynucleotides, at least one of the coding region, 5'-UTR, 3'-UTR, and / or 5'-cap structure includes at least one modified (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) nucleoside (e.g., any modified nucleoside described herein, such as a 5-substituted uridine, e.g., 5-methoxy-uridine, 1-substituted pseudouridine, or a 5-substituted cytidine, e.g., 5-methyl-cytidine).

[0046] In certain embodiments of any of the above polynucleotides, the poly-A region, if present, comprises at least one modified (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) nucleoside (e.g., any modified nucleoside described herein, such as a 5-substituted uridine, e.g., 5-methoxy-uridine, 1-substituted pseudouridine, or a 5-substituted cytidine, e.g., 5-methyl-cytidine).

[0047] In certain embodiments of any of the above polynucleotides, the poly-A region, if present, is from about 20 to about 400 nucleosides (e.g., 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 60 to 70, 65 to 85, 70 to 90 , 85-105, 90-110, 105-135, 120-150, 130-170, 150-200, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleosides. In certain embodiments of any of the above polynucleotides, the poly-A region, if present, comprises 64 nucleosides. In certain embodiments of any of the above polynucleotides, the poly-A region, if present, comprises a polyadenylation signal.

[0048] In some embodiments of any of the above polynucleotides, the polynucleotide further comprises a poly-C region. In some embodiments of any of the above polynucleotides, the poly-C region, if present, is 1 to 500 nucleosides (e.g., 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 60 to 70, 65 to 85, 7 In some embodiments of any of the above polynucleotides, the poly-C region, if present, comprises 30 nucleosides. In some embodiments of any of the above polynucleotides, the poly-C region, if present, is linked to the 5' end of the 3'-stabilization region. In some embodiments of any of the above polynucleotides, the poly-C region, if present, is linked to the 3' end of the poly-A region and the 5' end of the 3'-stabilization region.

[0049] In some embodiments, the present disclosure provides a method for linking at least one second polynucleotide (e.g., 1 to 500, e.g., 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 65 to 85, 70 to 90, 85 to 105, 90 to 110, 105 to 135, 120 to 150, a compound comprising a first polynucleotide conjugated to a targeting moiety, small molecule, polypeptide, or polymer (a polynucleotide comprising 130-170, 150-200, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleosides), or a salt thereof;

[0050] [ka] In the formula, B 1 is a nucleobase, hydrogen, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C3-C 10 Cycloalkyl, optionally substituted C-C 10 aryl, optionally substituted C2-C9 heterocycle; X 1 But O, S, NR U , or C(R U )2, where each R U is independently H, halo, or optionally substituted C1-C6 alkyl; X 2 -O-, -NR N1 -, -NR N1 NR N1-, bond, optionally substituted C1 to C 10 Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 30 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10 is aryl; m is 1, 2, 3, 4, or 5; each L is independently an unbranched or branched linker; R 1 and R 2 are each independently hydrogen, hydroxyl, or C1-C6 alkoxy; wherein the first polynucleotide encodes a polypeptide; where R 1 and R 2 is hydrogen and the linker connects the first polynucleotide to the second polynucleotide, then X 2 -(L) m is a furanylmethyl moiety, a pyranylmethyl moiety, -P(O)OH-, or -P(O)N(R N )2-, where R N is an optionally substituted C1-C6 alkyl.

[0051] In one embodiment, B 1 is hydrogen or a nucleobase. 1 are nucleic acid bases. In one embodiment, the compound has formula XIV:

[0052] [ka] (In the formula, A 1 is the first polynucleotide, (a) at least one 5'-cap structure; (b) 5′-UTR; (c) the coding region; and (d) 3'-UTR Includes; C 1 comprises a 3'-stabilizing region, a second polynucleotide such as an aptamer, siRNA, or other non-coding RNA, a targeting moiety, a small molecule, a polypeptide, or a polymer; L 1 is an unbranched linker; L 2 is a branched linker; n is 0, 1, 2, or 3; o is 0 or 1; p is 1, 2, 3, 4, or 5; L 1 or L 2 C bonded to 1 represents the number of moieties, where if o is 0, then p is 1).

[0053] X 2 -O-, -NR N1 -, -NR N1 NR N1- , bond, optionally substituted C1 to C 10 Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 30 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C10 is aryl; Y 1 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; Each Y 2 and Y 3 independently, O, S, Se, -NR N1 -, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10 is aryl; Each Y 4 are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; where Y 2 , Y 3 , and X 1 are O and R 1 and R 2 are hydrogen, and Y 1 is CH2 and Y 4 is hydroxy, n is 1, o is 0, p is 1, and C 1 is a polynucleotide, then X 2 -L 1 is -P(O)OH- or -P(O)N(R N )2-, where R N is an optionally substituted C1-C6 alkyl; Or its salt.

[0054] In one embodiment, L 2 When present, at least one C is present at the end of each branch of the branched linker. 1 There is. In one embodiment, X 1 is O. In one embodiment, R 1 and R 2 and each is hydroxy. 1 is optionally substituted C1-C6 alkylene (e.g., methylene). In some embodiments, n is 1. In some embodiments, Y 2 is O. In one embodiment, Y 3 is O. In one embodiment, Y 4 is hydroxy. In certain embodiments, X 2 is a bond. In certain embodiments, X 2 is —O—. In certain embodiments, X 2 is -O-alkylene-. In certain embodiments, X 2 -O-(CH2) q -, where q is an integer from 1 to 30, inclusive; preferably, q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. In certain embodiments, X 2 is —O-heteroalkylene. 2 is optionally substituted C2 to C 100 In one embodiment, X is polyethylene glycol. 2 are optionally substituted C1 to C 10 It is heteroalkylene.

[0055] In one embodiment, the compound has formula XV:

[0056] [ka] wherein q is 0, 1, 2, 3, 4, or 5; or a salt thereof.

[0057] In certain embodiments, the compound has Formula XVI:

[0058] [ka] structure of; or a salt thereof.

[0059] In one embodiment, the compound has Formula XVII:

[0060] [ka] wherein r and s are each independently 1, 2, 3, 4, or 5, or a salt thereof.

[0061] In some embodiments, the compound has Formula XXII:

[0062] [ka] Includes the structure of

[0063] In certain embodiments of any of the above compounds, L 1 However, Formula XVIII:

[0064] [ka] wherein a, b, c, e, f, and g are each independently 0 or 1; d is 0, 1, 2, or 3; R 3 , R 5 , R 7 , and R 9 each independently represents an optionally substituted C1-C6 alkylene, an optionally substituted C1-C6 heteroalkylene, an optionally substituted C2-C 100 Polyethyleneglycolene, O, S, Se, and NR 10 Selected from; R 4 and R 8are each independently carbonyl, thiocarbonyl, sulfonyl, or phosphoryl; Each R 6 are optionally substituted C1 to C 10 Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 10 heteroalkylene, or (R 3 ) a -(R 4 ) b -(R 5 ) c (R 7 ) e -(R 8 ) f -(R 9 ) g is a bond connecting to; R 10 is hydrogen, optionally substituted C1-C4 alkyl, optionally substituted C2-C4 alkenyl, optionally substituted C2-C4 alkynyl, optionally substituted C2-C6 heterocyclyl, optionally substituted C6-C 12 aryl, or optionally substituted C1-C7 heteroalkyl).

[0065] In one embodiment, L 1 is a linker that can be formed by a click chemistry reaction between a click chemistry reaction pair, e.g., L 1 but,

[0066] [ka] , or amide bond).

[0067] In some embodiments, the compound has formula XIX:

[0068] [ka] The structure of or a salt thereof.

[0069] In some embodiments, o is 0. In some embodiments, the compound has the formula XX:

[0070] [ka] The structure of or a salt thereof.

[0071] In some embodiments, p is 1. In one embodiment, L 1 but,

[0072] [ka] Includes.

[0073] In one embodiment, the compound has formula XXI:

[0074] [ka] The structure of or a salt thereof.

[0075] In some embodiments, o is 1. In some embodiments, p is 3. In one embodiment, L 2 but,

[0076] [ka] Includes.

[0077] In one embodiment, L 2 but,

[0078] [ka] Includes.

[0079] In some embodiments, the compound has Formula XXII:

[0080] [ka] The structure of or a salt thereof.

[0081] In certain embodiments, the compound has Formula XXIII:

[0082] [ka] wherein t is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; u is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; or a salt thereof.

[0083] In some embodiments, t is 6. In some embodiments, u is 3. In some embodiments, o is 0. In some embodiments, the compound has formula XXIV:

[0084] [ka] wherein v is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or a salt thereof.

[0085] In some embodiments, v is 4. In some embodiments, o is 0. In one embodiment, L 1 C1~C 10 In some embodiments, the compound has Formula XXIII:

[0086] [ka] Includes the structure of

[0087] In some embodiments, o is 0. In some embodiments, p is 1. In certain embodiments of any of the above compounds, C 1 comprises the second polynucleotide. In certain embodiments, the second polynucleotide comprises multiple adenosines. In certain embodiments, all of the nucleosides of the second polynucleotide are adenosines. In certain embodiments, the second polynucleotide comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) modified nucleosides (e.g., L-adenosine, 2'-O-methyl-adenosine, α-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, or inverted thymidine). In certain embodiments, the second polynucleotide comprises multiple modified nucleosides. In certain embodiments, all of the nucleosides in the second polynucleotide are modified nucleosides. In some embodiments, the second polynucleotide comprises at least two different modified nucleosides (e.g., at least one modified nucleoside is 2'-O-methyl-adenosine and at least one modified nucleoside is reverse thymidine). In some embodiments, the second polynucleotide has the structure:

[0088] [ka] wherein each X is independently O or S; A represents adenine and T represents thymine). or a salt thereof.

[0089] In certain embodiments, all of the modified nucleosides in the plurality are the same (eg, all of the modified nucleosides are L-adenosine). In certain embodiments, the second polynucleotide comprises 10 or 11 nucleosides.

[0090] In certain embodiments of any of the above compounds, C 1 comprises a targeting moiety (e.g., a carbohydrate such as N-acetyl-galactosamine, a lipid, a vitamin, a small receptor ligand, a cell surface carbohydrate-binding protein or its ligand, a lectin, an r-type lectin, a galectin, a ligand for a cluster of differentiation (CD) antigen, a cytokine such as CD30, CD40, a type 1 cytokine or a type 2 cytokine, a chemokine, a colony-stimulating factor, an interferon, an interleukin, a lymphokine, a monokine, or a mutant, derivative and / or any combination thereof).

[0091] In certain embodiments of any of the above compounds, C 1 but include polypeptides (e.g., nuclear-localizing polypeptides such as those having the sequence PKKKRKVEDPY[K(Aoa]G-amide (SEQ ID NO: 1), ER-localizing polypeptides such as those having the sequence Aoa-KDEL-OH (SEQ ID NO: 2), endosomal escape polypeptides such as those having the sequence Aoa-HHHHHHHHHHHHHHHHHHH-amide (SEQ ID NO: 3) or corresponding all D-amino acid polypeptides, or polypeptides that can be used for affinity chromatography such as poly-histidine).

[0092] In certain embodiments of any of the above compounds, C 1comprises a polynucleotide (e.g., an aptamer, a riboswitch, a purification handle, a locked nucleic acid, or a PABP affinity sequence).

[0093] In certain embodiments of any of the above compounds, C 1 comprises a click chemistry handle. In certain embodiments, the click chemistry handle is an alkyne. In certain embodiments, the click chemistry handle is an azide. In certain embodiments, the click chemistry handle is a cyclooctyne. In certain embodiments, the click chemistry handle is a diene. In certain embodiments, the click chemistry handle is a dienophile. In certain embodiments, the click chemistry handle is a terminal alkyne. In certain embodiments, the click chemistry handle is a strained alkyne. In certain embodiments, the click chemistry handle is an activated alkyne. In certain embodiments, the click chemistry handle is an electron-deficient alkyne. In certain embodiments, the click chemistry handle is an aryne. In certain embodiments, the click chemistry handle is a tetrazine. In certain embodiments, the click chemistry handle is an alkene. In certain embodiments, the click chemistry handle is a phosphine. In certain embodiments, the click chemistry handle is a dithioester. In certain embodiments, the click chemistry handle is an alkoxyamine. In some embodiments, the click chemistry handle is an α,β-unsaturated carbonyl. In some embodiments, the click chemistry handle is a maleimide. In some embodiments, the click chemistry handle is a thiol. In some embodiments, the click chemistry handle is an enone. In some embodiments, the click chemistry handle is a hydrazide. In some embodiments, the click chemistry handle is an amine. Other suitable click chemistry handles will be known to those of skill in the art.

[0094] In certain embodiments of any of the above compounds, A 1 but further comprises a poly-A region. In certain embodiments, the poly-A region, if present, comprises at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) modified nucleosides.

[0095] In one embodiment, A 1 At least one of the coding region, 5'-UTR, 3'-UTR, and / or 5'-cap structure of comprises at least one modified (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) nucleoside (e.g., a 5-substituted uridine such as 5-methoxy-uridine, a 1-substituted pseudouridine, or a 5-substituted cytidine such as 5-methyl-cytidine).

[0096] In one aspect, the present disclosure provides a method of modifying a polynucleotide, comprising: Formula XXVI:

[0097] [ka] wherein B is a nucleobase, hydrogen, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C3-C6 10 Cycloalkyl, optionally substituted C-C 10 aryl, optionally substituted C2-C9 heterocycle; X 1 But O, S, NR U , or C(R U )2, where each R Uare independently H, halo, or optionally substituted C1-C6 alkyl; Formula XXVII: H2N-R 11 Formula XXVII (In the formula, R 11 are optionally substituted C1 to C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10 Alkynyl, optionally substituted C-C 10 Heterocyclyl, optionally substituted C6-C 12 Aryl, optionally substituted C-C 100 Polyethylene glycol, optionally substituted C1-C attached to polynucleotides 10 Heteroalkyl or optionally substituted C1-C 10 a compound having the structure: When contacted under suitable conditions, a compound of formula XIII:

[0098] [ka] and generating a polynucleotide comprising the structure:

[0099] In one embodiment, B 1 is hydrogen or a nucleobase. 1 are nucleic acid bases. In one embodiment, the method comprises providing a compound of formula XXVIII:

[0100] [ka] or a salt thereof under suitable conditions (e.g., conditions including oxidizing conditions such as periodate) to produce a polynucleotide comprising the structure of formula XII.

[0101] In one embodiment, R 11 are optionally substituted C1 to C 10 It is heteroalkyl. In certain embodiments, the compound of formula XIII, or a salt thereof, has formula XXIX: H2N-OR 12 Formula XXIX (In the formula, R 12 is optionally substituted C2 to C 100 Polyethylene glycol, optionally substituted C1-C 10 Alkyl, optionally substituted C1-C 10 Heteroalkyl or optionally substituted C1-C attached to a polynucleotide 10 Heteroalkyl, e.g., C 1 It has the structure:

[0102] In one embodiment, R 11 contains an azide moiety, a carboxylate moiety, or a thiol. In some embodiments, the compound of formula XXIX has the structure:

[0103] [ka] It has.

[0104] In certain embodiments, the method further comprises reacting a polynucleotide comprising the structure of Formula I with a second polynucleotide comprising an alkyne moiety under suitable conditions to produce a compound comprising a first polynucleotide and a second polynucleotide linked via a linker comprising a triazole moiety.

[0105] In certain embodiments, the alkyne moiety has the structure:

[0106] [ka] Includes.

[0107] In one embodiment, the method comprises reacting a compound of Formula I with a second polynucleotide containing a maleimide moiety under suitable conditions to form a compound of the structure:

[0108] [ka] and forming a compound comprising the first polynucleotide and the second polynucleotide joined via a linker comprising:

[0109] In certain embodiments, the method further comprises reacting the compound of Formula I with a second polynucleotide comprising an amino moiety under suitable conditions to produce a compound comprising a first polynucleotide and a second polynucleotide linked via a linker comprising an amide bond.

[0110] In certain embodiments of the above compounds or methods, the targeting moiety, small molecule, polypeptide, or polymer is a therapeutic agent, such as a cytotoxin, radioactive ion, chemotherapeutic agent, or other therapeutic agent. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracenedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids such as maytansinol (see U.S. Pat. No. 5,208,020), CC-1065 (see U.S. Pat. Nos. 5,475,092, 5,585,499, and 5,846,545), and analogs or congeners thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium. Other therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil, CC-1065, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichloroamineplatinum(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).

[0111] In some embodiments of the above compounds or methods, the targeting moiety, small molecule, polypeptide, or polymer is a detectable substance. Examples of detectable substances include various organic small molecules, inorganic compounds, nanoparticles, enzymes or enzyme substrates, fluorescent materials, luminescent materials, bioluminescent materials, chemiluminescent materials, radioactive materials, and imaging agents. Examples of such optically detectable labels include, but are not limited to, 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS); 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-1-naphthyl)maleimide; anthraquinone; Ranilamide; BODIPY; Brilliant Yellow; Coumarin and derivatives; Coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcoumarin (Coumarin 151); Cyanine dyes; Cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5',5"-Dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red); 7-Diethylamino-3-(4'-isothiocyanatophenyl) )-4-Methylcoumarin;Diethylenetriaminepentaacetic acid;4,4'-Diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid;4,4'-Diisothiocyanatostilbene-2,2'-disulfonic acid;5-[Dimethylamino]-naphthalene-1-sulfonyl chloride (DNS, dansyl chloride);4-Dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC);Eosin and derivatives;Eosin, eosin isothiocyanate, erythrocyanate Erythrosine and derivatives; erythrosine B, erythrosine isothiocyanate; ethidium; fluorescein and derivatives; 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein, fluorescein, fluorescein isothiocyanate, QFITC, (XRITC); fluorescamine; IR144; IR1446;Malachite Green isothiocyanate; 4-methylumbelliferone orthocresolphthalein; nitrotyrosine; pararosaniline; phenol red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1-pyrene; butyrate quantum dots; Reactive Red 4 (Cibacron™ Brilliant Red 3B-A); rhodamine and derivatives: 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), Lissamine rhodamine B sulfonyl chloride Examples of detectable labels include rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivatives of sulforhodamine 101 (Texas Red); N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethylrhodamine; tetramethylrhodamine isothiocyanate (TRITC); riboflavin; rosolic acid; terbium chelate derivatives; cyanine-3 (Cy3); cyanine-5 (Cy5); cyanine-5.5 (Cy5.5), cyanine-7 (Cy7); IRD 700; IRD 800; Alexa 647; La Jolta Blue; phthalocyanines; and naphthalocyanines. In certain embodiments, the detectable label is a fluorescent dye such as Cy5 and Cy3. In certain embodiments, the detectable agent is an undetectable precursor that becomes detectable upon activation. Examples include fluorescent tetrazine-fluorochrome constructs (e.g., tetrazine-BODIPY FL, tetrazine-Oregon Green 488, or tetrazine-BODIPY TMR-X) or enzyme-activatable fluorescent agents (e.g., PROSENSE (VisEn Medical));

[0112] In some embodiments of the above compounds or methods, the targeting moiety, small molecule, polypeptide, or polymer is a luminescent material. Examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin.

[0113] In certain embodiments of the above compounds or methods, the targeting moiety, small molecule, polypeptide, or polymer comprises a radioactive material. Examples of suitable radioactive materials include those that are directly or indirectly detectable, 18 F, 67 Ga, 81m Kr, 82 Rb, 111 In, 123 I, 133 Xe, 201 Tl, 125 I, 35 S, 14 C, or 3 H, 99m Tc (e.g., pertechnetate (technetate(VII), TcO4 - as ), or other radioisotopes detectable by direct counting of radioactive emissions or by scintillation counting.

[0114] In some embodiments of the above-mentioned compounds or methods, the targeting moiety, small molecule, polypeptide, or polymer is a contrast agent. Furthermore, contrast agents, such as those for MRI or NMR, X-ray CT, Raman imaging, optical coherence tomography, absorption imaging, ultrasound imaging, or thermal imaging, can be used. Exemplary contrast agents include gold (e.g., gold nanoparticles), gadolinium (e.g., chelated Gd), iron oxide (e.g., superparamagnetic iron oxide (SPIO), monocrystalline iron oxide nanoparticles (MION), and ultrasmall superparamagnetic iron oxide (USPIO)), and manganese chelates (e.g., Mn-DPDP), barium sulfate, iodinated contrast agents (iohexol), microbubbles, or perfluorocarbons can also be used.

[0115] In certain embodiments of the above compounds or methods, the polymer is polyethylene glycol (PEG), polypropylene glycol, a peptide, a cationic polymer, or any synthetic or natural polymer made up of repeating monomeric units.

[0116] In some embodiments, the polymer is an optionally substituted linear polyalkylene, polyalkenylene, or polyoxyalkylene polymer. In some embodiments, the polymer is an optionally substituted branched polyalkylene, polyalkenylene, or polyoxyalkylene polymer. In some embodiments, the polymer is an optionally substituted branched polysaccharide. In some embodiments, the polymer is an optionally substituted unbranched polysaccharide. In some embodiments, the polymer is an optionally substituted polyethylene glycol, polypropylene glycol, or polyvinyl alcohol, or a derivative thereof. In some embodiments, the polymer is a branched polyethylene glycol, polypropylene glycol, or polyvinyl alcohol, or a derivative thereof.

[0117] In some embodiments, the polymer is polyethylene glycol (PEG). In some embodiments, the polymer is a derivatized form of PEG (e.g., an N-hydroxysuccinimide (NHS) active ester of PEG, such as succinimidyl propionate, benzotriazole active ester, and PEG derivatized with maleimide, vinyl sulfone, or thiol groups). PEG polymers useful in the present invention can be linear or branched molecules, where multiple PEG moieties are present in a single polymer.

[0118] In certain embodiments of the above compounds or methods, the small molecule comprises a benzyl group (e.g., the hydroxylamine used in the reaction to form the morpholino is o-benzylhydroxylamine, O-(2,3,4,5,6-pentafluorobenzyl)hydroxylamine, O-tritylhydroxylamine, O-(4-nitro-benzyl)hydroxylamine), and in certain embodiments of the above compounds or methods, the small molecule comprises an alkyl group (e.g., the hydroxylamine used in the reaction to form the morpholino is methoxyamine, O-ethylhydroxylamine, O-tert-butylhydroxylamine, O-tert-butyldimethylsilylhydroxylamine, O-(carboxymethyl)hydroxylamine). In certain embodiments of the above compounds or methods, the small molecule contains a heterocycle (e.g., the hydroxylamine used in the reaction to form the morpholino is O-(tetra-2H-pyran-2-yl)hydroxylamine or 10-[2-(aminooxy)ethyl]-10H-phenothiazine. In certain embodiments, the small molecule contains a heteroatom (e.g., the hydroxylamine used in the reaction to form the morpholino is hydroxylamine-O-sulfonic acid or hydroxylamine).

[0119] In certain embodiments, the compound may also include a targeting moiety, which may be a cell-penetrating moiety or drug that facilitates intracellular delivery of the composition. For example, the composition may include a cell-penetrating peptide sequence that facilitates delivery to the intracellular space, such as the HIV-derived TAT peptide, penetratin, transportan, or an hCT-derived cell-penetrating peptide (see, e.g., Caron et al., 2001, Mol Ther. 3, 3, 310-318; Langel, "Cell-Penetrating Peptides: Processes and Applications"). and Applications" (CRC Press, Boca Raton FL, 2002); El-Andaloussi et al., 2005, Curr Pharm Des. 11(28):3597-611; and Deshayes et al., 2005, Cell Mol Life Sci. 62(16):1839-49). The compositions can also be formulated to include cell-permeable agents, e.g., liposomes, to facilitate delivery of the compositions to the intracellular space.

[0120] The compounds described herein can be used to deliver drugs to any biological target for which a specific ligand exists or can be produced. The ligand can bind to the biological target either covalently or non-covalently. Exemplary biological targets include biopolymers, e.g., antibodies, nucleic acids such as RNA and DNA, proteins, and enzymes; exemplary proteins include enzymes, receptors, and ion channels. In some embodiments, the target is a tissue- or cell-type-specific marker, e.g., a protein that is specifically expressed in a selected tissue or cell type. In some embodiments, the target is a receptor, such as, but not limited to, a cell membrane receptor and a nuclear receptor; more specific examples include G protein-coupled receptors, cell pore proteins, transport proteins, surface-expressed antibodies, HLA proteins, MHC proteins, and growth factor receptors.

[0121] In certain embodiments of any of the above compounds, the poly-A region, if present, is from about 20 to about 400 nucleosides (e.g., 1-10, 5-15, 10-20, 15-25, 20-30, 25-35, 30-40, 35-45, 40-50, 45-65, 50-70, 60-70, 65-85, 70-90, 85 In some embodiments, the poly-A region, if present, comprises 64 nucleosides. In some embodiments, the poly-A region, if present, comprises a polyadenylation signal.

[0122] In certain embodiments of any of the above compounds, the first polynucleotide further comprises a poly-C region. In certain embodiments of any of the above compounds, the poly-C region, if present, comprises 1 to 500 nucleosides (e.g., 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 60 to 70, 65 to 85, 70 to 85, 85 to 90, 95 to 100, 100 to 120, 120 to 140, 140 to 160, 160 to 180, 180 to 200, 180 to 220, 180 to 240, 180 to 260, 180 to 280, 180 to 300, 180 to 320, 180 to 340, 180 to 360, 180 to 400, 180 to 420, 180 to 440, 180 to 520, 180 to 520, 180 to 520, 180 to 520, 180 to 520, 180 to 640, 180 to 700, 180 to 720, 180 to 850, 180 to 900, 180 to 1000, 180 to 220, 180 to 240, 180 to 260, 180 to 2 In some embodiments of the above compounds, the poly-C region, if present, comprises 30 nucleosides. In some embodiments of the above compounds, the poly-C region, if present, is attached to the 3' end of the first polynucleotide. In some embodiments of the above compounds, the poly-C region, if present, is attached to the 3' end of the poly-A region of the first polynucleotide.

[0123] In some embodiments, the present invention provides lipid nanoparticle compositions containing any of the above-described polynucleotides or compounds. In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. The cationic lipid may be selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319). In other embodiments, the lipid nanoparticles have a molar ratio of about 20-60% cationic lipid: about 5-25% non-cationic lipid: about 25-55% sterol; and about 0.5-15% PEG-modified lipid. In one embodiment, the lipid nanoparticles comprise a molar ratio of about 50% cationic lipid, about 1.5% PEG-modified lipid, about 38.5% cholesterol, and about 10% non-cationic lipid. In other embodiments, the lipid nanoparticles have an average diameter of 50-150 nm, or 80-100 nm.

[0124] In certain embodiments, the invention provides compounds comprising a polynucleotide modified to comprise a structure of Formula I, wherein the modified polynucleotide results in increased polypeptide expression when compared to an unmodified polynucleotide. In certain embodiments, the invention provides a method of increasing expression of a recombinant polypeptide of interest in a cell, comprising contacting the cell with a polynucleotide encoding the polypeptide, wherein the polynucleotide has been modified to comprise a structure of Formula I, and wherein expression is increased when compared to the unmodified polynucleotide. For example, the modified polynucleotide results in an increased expression level when compared to the unmodified polynucleotide by about 0.1% to about 100% (e.g., about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 100%). In certain embodiments, the modified polynucleotide results in an increase in expression levels of about 2-fold to about 100-fold (e.g., about 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, 14-fold, 16-fold, 18-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or about 100-fold) compared to an unmodified polynucleotide. In certain embodiments, the polynucleotide is mRNA. In certain embodiments, the polypeptide of interest is a therapeutic polypeptide. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the mammalian cell is a human cell.

[0125] In certain embodiments, the invention provides compounds comprising a polynucleotide modified to comprise a structure of Formula I, wherein the modified polynucleotide confers an increased half-life as compared to an unmodified polynucleotide. In certain embodiments, the invention provides a method of increasing the half-life of a polynucleotide in a cell, comprising contacting the cell with a polynucleotide, wherein the polynucleotide has been modified to comprise a structure of Formula I, and has an increased half-life as compared to the unmodified polynucleotide. For example, the modified polynucleotide has a measured half-life that is increased by about 0.1% to about 100% (e.g., about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or about 100%) as compared to the unmodified polynucleotide. In certain embodiments, the modified polynucleotide has a measured half-life that is increased by about 2-fold to about 100-fold (e.g., about 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, 14-fold, 16-fold, 18-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or about 100-fold) compared to an unmodified polynucleotide. In certain embodiments, the polynucleotide is mRNA. In certain embodiments, the mRNA encodes a therapeutic polypeptide. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the mammalian cell is a human cell. [Brief explanation of the drawings]

[0126] [Figure 1] Graph showing AUC of hEPO mRNA expression over 3 days at 0.05 mg / kg. [Figure 2] Graph showing AUC of hEPO mRNA expression at 0.05 mg / kg over 4 days. [Figure 3] Graph showing AUC of hEPO mRNA expression at 0.5 mg / kg over 4 days. [Figure 4]Graph showing the percentage of deadenylation of oligonucleotides. [Figure 5] Graph showing mRNA mCitrine expression. DETAILED DESCRIPTION OF THE INVENTION

[0127] In particular, the present disclosure provides polynucleotides that, when introduced into a cell population, exhibit improved therapeutic properties, including, but not limited to, improved stability, increased expression, and / or decreased innate immune response.

[0128] In particular, the inventors have determined that mRNAs comprising a 3'-stabilizing region (e.g., a 3'-stabilizing region comprising a modified nucleobase, sugar, and / or backbone) may be particularly effective for use in therapeutic compositions, as they benefit from improved stability, high expression levels, and limited induction of innate immune responses, as shown in the Examples (particularly, high performance can be observed across the assays of Examples 6-9).

[0129] Preferably, the modified polynucleotide is substantially non-toxic and non-mutagenic. The compositions and methods described herein can be used in assays such as in vivo and in vitro, both extracellular and intracellular, as well as cell-free assays.

[0130] In another aspect, the present disclosure provides a composition comprising the polynucleotide described herein. In some embodiments, the composition is a reaction mixture. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is a cell culture.

[0131] It will be further understood that certain features of the present disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the present disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0132] Polynucleotides Polynucleotides of the present invention typically include a first region (e.g., a coding region) of linked nucleosides encoding a polypeptide of interest, a first flanking region (e.g., a 5'-UTR) located at the 5' end of the first region, a second flanking region (e.g., a 3'-UTR) located at the 3' end of the first region, at least one 5'-cap region, and a 3'-stabilizing region. In certain embodiments, polynucleotides of the present invention further include a poly-A region. In certain embodiments, any one of the regions of a polynucleotide of the present invention includes at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) modified nucleosides. For example, the 3'-stabilizing region may contain modified nucleosides such as L-nucleosides, reverse thymidines, or 2'-O-methyl nucleosides, and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include modified nucleosides such as 5-substituted uridines (e.g., 5-methoxyuridine), 1-substituted pseudouridines (e.g., 1-methyl-pseudouridine), and / or 5-substituted cytidines (e.g., 5-methyl-cytidine).

[0133] Modified Polynucleotides The present disclosure provides polynucleotides, including RNAs such as mRNAs, that contain one or more modified nucleosides or nucleotides described herein (e.g., in the 3'-stabilizing region), which have useful properties, including improved stability and / or no substantial induction of an innate immune response in cells into which the polynucleotide is introduced. For example, in certain embodiments, the modified polynucleotides exhibit reduced degradation in cells into which the polynucleotide is introduced, compared to corresponding unmodified polynucleotides. These modified polynucleotides can improve the efficiency of protein production, intracellular retention of the polynucleotide, and / or viability of contacted cells, as well as have reduced immunogenicity.

[0134] As used herein, "polynucleotide" in its broadest sense includes any compound and / or substance that is or can be incorporated into an oligonucleotide strand. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of DNA, RNA, including messenger mRNA (mRNA), hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like, as described in detail herein.

[0135] The polynucleotide of the present invention may be uniformly modified or not uniformly modified along the entire length of the molecule.For example, one or more or all types of nucleotides (for example, purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified or not uniformly modified in the polynucleotide of the present invention or in a given predetermined sequence region thereof.In some embodiments, all nucleotides X in the polynucleotide of the present invention (or in a given sequence region thereof) are modified, where X can be any one of nucleotides A, G, U, C, or any one of combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0136] Different sugar modifications and / or internucleoside linkages (e.g., backbone structures) can be present at various positions in a polynucleotide. Those skilled in the art will understand that nucleotide analogs or other modifications can be placed at any position in a polynucleotide so that the function of the polynucleotide is not substantially impaired. Modifications can also be 5'- or 3'-terminal modifications. In some embodiments, a polynucleotide contains a modification at the 3'-terminus. Polynucleotides may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any percentage therebetween (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, The percentages may be between 10% and 95%, 10% and 100%, 20% and 25%, 20% and 50%, 20% and 60%, 20% and 70%, 20% and 80%, 20% and 90%, 20% and 95%, 20% and 100%, 50% and 60%, 50% and 70%, 50% and 80%, 50% and 90%, 50% and 95%, 50% and 100%, 70% and 80%, 70% and 90%, 70% and 95%, 70% and 100%, 80% and 90%, 80% and 95%, 80% and 100%, 90% and 95%, 90% and 100%, and 95% and 100%. It will be understood that the presence of A, G, U, or C may account for any remaining percentages.

[0137] A polynucleotide may contain at least 1% and up to 100% modified nucleotides, or any percentage therebetween, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, a polynucleotide may contain modified pyrimidines, such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in a polynucleotide are substituted with modified uracils (e.g., 5-substituted uracils). The modified uracils may be substituted with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In certain embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a polynucleotide are substituted with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines can be substituted with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0138] Other components of the polynucleotide are optional and beneficial in certain embodiments. For example, a 5'-untranslated region (UTR) and / or a 3'-UTR are provided, where either or both can independently contain one or more nucleoside modifications. In certain embodiments, nucleoside modifications can also be present in the translatable region. Polynucleotides containing a Kozak sequence (e.g., in the 5'-UTR) are also provided. In certain embodiments, polynucleotides of the invention include a poly-A region. In certain embodiments, polynucleotides of the invention include at least one 5'-cap structure.

[0139] In certain embodiments, for example, when precise timing of protein production is desired, it is desirable to degrade modified polynucleotides introduced into cells within the cell. Accordingly, the present disclosure provides modified polynucleotides that contain a degradation domain that can act in a specified manner within the cell.

[0140] Additionally, polynucleotides are provided that contain one or more intron nucleotide sequences that can be excised from the polynucleotide. Additionally, polynucleotides containing an internal ribosome entry site (IRES) are provided. The IRES can act as the sole ribosome binding site or as one of multiple ribosome binding sites of an mRNA. Polynucleotides containing two or more functional ribosome binding sites can encode several peptides or polypeptides that are independently translated by ribosomes (e.g., polycistronic mRNA). When a polynucleotide comprises an IRES, optionally, a second translatable region is further provided. Examples of IRES sequences that may be used in accordance with the present disclosure include, but are not limited to, those derived from picornaviruses (e.g., picornavirus (FMDV), plague virus (CFFV), polio virus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immune deficiency virus (SIV), or cricket paralysis virus (CrPV).

[0141] In general, the shortest length of a modified polynucleotide of the present disclosure may be a length of polynucleotide sequence sufficient to encode a dipeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tripeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tetrapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a pentapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a hexapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a heptapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode an octapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a nonapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a decapeptide.

[0142] Examples of dipeptides that the modified polynucleotide sequences can encode include, but are not limited to, carnosine and anserine. In further embodiments, the polynucleotide is greater than 30 nucleotides in length. In another embodiment, the polynucleotide molecule is greater than 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides.In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides or more than 5000 nucleotides.

[0143] 5'-cap structure The 5'-cap structure of a polynucleotide is involved in nuclear export, enhances polynucleotide stability, and binds to mRNA cap-binding protein (CBP), which is involved in intracellular polynucleotide stability and translational competence via the binding of CBP to poly-A binding protein to form mature circular mRNA species. The cap also assists in the removal of 5'-proximal introns during mRNA splicing.

[0144] Endogenous polynucleotide molecules can be capped at the 5' end to form a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5'-terminal transcribed sense nucleotide. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or anteterminal transcribed nucleotide at the 5' end of the polynucleotide can also optionally be 2'-O-methylated. 5'-cap removal by hydrolysis and cleavage of the guanylate cap structure can target degradation of polynucleotide molecules, such as mRNA molecules.

[0145] Modifications to polynucleotides of the present invention can generate non-hydrolyzable cap structures to prevent cap removal and thereby increase polynucleotide half-life. Because cap structure hydrolysis requires cleavage of the 5'-ppp-5' phosphorodiester bond, modified nucleotides can be used during the capping reaction. For example, Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to form phosphorothioate linkages within the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, can be used.

[0146] Further modifications include, but are not limited to, 2'-O-methylation (described above) of the ribose sugar of the 5'-terminus and / or penultimate nucleotide of the polynucleotide at the 2'-hydroxy group of the sugar. Several different 5'-cap structures can be used to generate the 5'-cap of a polynucleotide, such as an mRNA molecule.

[0147] 5'-cap structures include those described in International Patent Publication Nos. WO 2008 / 127688, WO 2008 / 016473, and WO 2011 / 015347, each of which is incorporated herein by reference.

[0148] A cap analog, also referred to herein as a synthetic cap analog, chemical cap, chemical cap analog, or structural or functional cap analog, differs in its chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized / linked to a polynucleotide chemically (i.e., non-enzymatically) or enzymatically.

[0149] For example, an anti-reverse cap analog (ARCA) cap can contain two guanosines linked by a 5'-5'-triphosphate group, where one guanosine has an N7-methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7 The N7- and 3'-O-methylated guanosine contains the N7- and 3'-O-methylated guanosine residues (which may also be referred to as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanosine is linked to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA).

[0150] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, mCAP). 7 Gm-ppp-G).

[0151] In one embodiment, the cap is a dinucleotide cap analog. As a non-limiting example, dinucleotide cap analogs, such as those described in U.S. Pat. No. 8,519,110 (the cap structures of which are incorporated herein by reference), can be modified with boranophosphate or phosphoroselenoate groups at various phosphate positions.

[0152] In another embodiment, the cap analog is an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., the various cap analogs and methods for synthesizing cap analogs described in Kore et al., Bioorganic & Medicinal Chemistry, 2013, 21:4570-4574, the cap structures of which are incorporated herein by reference). In another embodiment, a cap analog useful in the polynucleotides of the invention is a 4-chloro / bromophenoxyethyl analog.

[0153] Although cap analogs allow for the simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, along with the structural differences between the cap analog and the endogenous 5'-cap structure of polynucleotides produced by the endogenous cellular transcription machinery, can result in reduced translational efficiency and reduced cellular stability.

[0154] The modified polynucleotides of the present invention can also be post-transcriptionally capped using enzymes to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to features that structurally or functionally resemble or mimic endogenous or wild-type features. That is, a "more authentic" feature better represents endogenous, wild-type, native, or physiological cellular function and / or structure compared to prior art synthetic features or analogs, or outperforms the corresponding endogenous, wild-type, native, or physiological features in one or more respects. Non-limiting examples of more authentic 5'-cap structures useful for polynucleotides of the present invention are those that have, among others, increased binding of cap-binding proteins, increased half-life, reduced susceptibility to 5'-endonucleases, and / or decreased 5'-cap removal compared to synthetic 5'-cap structures (or wild-type, native, or physiological 5'-cap structures) known in the art. For example, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can form a standard 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, where the cap guanosine contains an N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl. Such a structure is called a Cap 1 structure. Cap 2 structures also contain a 2'-O-methyl at the nucleotide adjacent to the 5'-terminal nucleotide. These caps result in, for example, higher translational capacity, cellular stability, and reduced activation of cellular pro-inflammatory cytokines compared to other 5'-cap analog structures known in the art. Exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0155] Because the modified polynucleotides can be capped after transcription, and because this process is more efficient, nearly 100% of the modified polynucleotides can be capped, as opposed to about 80% when a cap analog is attached to the polynucleotide during the in vitro transcription reaction.

[0156] According to the present invention, the 5'-end cap can include an endogenous cap or a cap analog. According to the present invention, the 5'-end cap can include a guanosine analog. Useful guanosine analogs include inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0157] In one embodiment, the polynucleotides described herein may contain a modified 5'-cap. Modifications to the 5'-cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase the translation efficiency of the polynucleotide. Modified 5'-caps include, but are not limited to, one or more of the following modifications: a modification at the 2' and / or 3' position of the capped guanosine triphosphate (GTP), a substitution of the sugar ring oxygen with a methylene moiety (CH2) (thereby generating a carbocyclic ring), a modification at the triphosphate bridge portion of the cap structure, or a modification at the nucleobase (G) portion.

[0158] 5'-UTR A 5'-UTR may be provided as a flanking region of a modified polynucleotide (e.g., mRNA) of the present invention. The 5'-UTR may be homologous or heterologous to the coding region found in the modified polynucleotide (mRNA) of the present invention. Multiple 5'-UTRs may be included in the flanking region and may be of the same or different sequences. Any portion (including none) of the flanking region may be codon-optimized and may independently contain one or more different structural or chemical modifications before and / or after codon optimization.

[0159] Table 21 of U.S. Provisional Patent Application No. 61 / 775,509 and Tables 21 and 22 of U.S. Provisional Patent Application No. 61 / 829,372, which are incorporated herein by reference, provide a list of start and stop sites for modified polynucleotides (e.g., mRNAs) of the invention. In Table 21, each 5'-UTR (5'-UTR-005 to 5'-UTR 68511) is identified by its start and stop sites relative to its native or wild-type (homologous) transcript (the identification number used in the ENST; ENSEMB database).

[0160] To modify one or more properties of a polynucleotide (e.g., mRNA) of the present invention, a heterologous 5'-UTR can be engineered into the compound of the present invention, which is heterologous to the coding region of the modified polynucleotide (e.g., mRNA). The modified polynucleotide (e.g., mRNA) can then be administered to a cell, tissue, or organism, and results such as protein level, localization, and / or half-life can be measured to assess the beneficial effects that the heterologous 5'-UTR may have on the modified polynucleotide (mRNA) of the present invention. 5'-UTR mutants can be used in which one or more nucleotides, including A, T, C, or G, are added to or removed from the end. The 5'-UTR can also be codon-optimized or modified by any of the methods described herein.

[0161] 5'-UTR, 3'-UTR, and translation enhancer elements (TEEs) In one embodiment, the 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least one translational enhancer element. The term "translational enhancer element" refers to a sequence that increases the amount of a polypeptide or protein produced from a polynucleotide. As a non-limiting example, a TEE may be located between the transcription promoter and the start codon. A polynucleotide (e.g., mRNA) having at least one TEE in its 5'-UTR may include a cap in the 5'-UTR. Furthermore, at least one TEE may be located in the 5'-UTR of a polynucleotide (e.g., mRNA) to effect cap-dependent or cap-independent translation.

[0162] In one embodiment, TEEs are conserved elements in UTRs that can facilitate translational activity of a polynucleotide, including, but not limited to, cap-dependent or cap-independent translation. The conservation of these sequences has been previously demonstrated by Panek et al. (Nucleic Acids Research, 2013, pp. 1-10) for 14 species, including humans.

[0163] In one non-limiting example, a known TEE can be found in the 5'-leader of the Gtx homeodomain protein (Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004, which TEE is incorporated herein by reference).

[0164] In another non-limiting example, TEEs are disclosed in U.S. Patent Application Publication No. 2009 / 0226470 as SEQ ID NOs: 1-35, in U.S. Patent Application Publication No. 2013 / 0177581 as SEQ ID NOs: 1-35, in International Patent Publication No. WO 2009 / 075886 as SEQ ID NOs: 1-35, in International Patent Publication No. WO 2012 / 009644 as SEQ ID NOs: 1-5, and 7-645, in International Patent Publication No. WO 1999 / 024595 as SEQ ID NO: 1, in U.S. Patent No. 6,310,197 as SEQ ID NO: 1, and in U.S. Patent No. 6,849,405 as SEQ ID NO: 1, each of which TEE sequences is incorporated herein by reference.

[0165] In yet another non-limiting example, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or IRES element, such as, but not limited to, those described in U.S. Pat. No. 7,468,275, U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100, and International Patent Publication Nos. WO 2007 / 025008 and WO 2001 / 055369 (the respective IRES sequences of which are incorporated herein by reference). IRES elements include, but are not limited to, the Gtx sequences (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Chappell et al. (Proc. Natl. Acad. Sci. USA, Vol. 101, pp. 9590-9594, 2004) and by Zhou et al. (Proc. Natl. Acad. Sci. USA, Vol. 102, pp. 6273-6278, 2005), and in U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication No. WO 2007 / 025008, the IRES sequences of each of which are incorporated herein by reference.

[0166] "Translation enhancer polynucleotides" are exemplified herein and / or disclosed in the art (e.g., U.S. Pat. Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, U.S. Patent Application Publication Nos. 20090 / 226470, 2007 / 0048776, 2011 / 0124100, 2009 / 0093049, 2013 / 0177581, International Patent Publication No. WO 2013 / 0177581, and the like). (See WO 2009 / 075886, WO 2007 / 025008, WO 2012 / 009644, WO 2001 / 055371, WO 1999 / 024595, and EP 2610341 and EP 2610340 (each of which TEE sequences are incorporated herein by reference)) Polynucleotides containing one or more specific TEEs or their variants, homologs, or functional derivatives. One or more copies of a specific TEE may be present in a polynucleotide (e.g., mRNA). The TEE in a translation enhancer polynucleotide may be composed of one or more sequence segments. A sequence segment may have one or more of the specific TEEs exemplified herein, and each TEE may be present in one or more copies. When multiple sequence segments are present in a translational enhancer polynucleotide, they can be homologous or heterologous. Thus, multiple sequence segments in a translational enhancer polynucleotide can possess the same or different types of specific TEEs exemplified herein, the same or different numbers of copies of each specific TEE, and / or the same or different configurations of TEEs within each sequence segment.

[0167] In one embodiment, the polynucleotide (e.g., mRNA) is a polynucleotide described in International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, WO 2007 / 025008, WO 1999 / 024595, European Patent Application Publication Nos. 2610341 and 2610340, U.S. Pat. No. 6,310,197, Nos. 6,849,405, 7,456,273, 7,183,395, and U.S. Patent Application Publication Nos. 2009 / 0226470, 2011 / 0124100, 2007 / 0048776, 2009 / 0093049, and 2013 / 0177581 (the TEE sequences of each of which are incorporated herein by reference). The TEE may be located in the 5'-UTR of a polynucleotide (e.g., an mRNA).

[0168] In another embodiment, the polynucleotide (e.g., mRNA) is prepared using a method described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, and WO 2007 / 025008, European Patent Application Publication Nos. 2610341 and 2610342, Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395 (the TEE sequences of each of which are incorporated herein by reference).

[0169] In one embodiment, the 5'-UTR of a polynucleotide (e.g., mRNA) may comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present invention may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variations thereof, repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0170] In one embodiment, the 5'-UTR may include a spacer separating the two TEE sequences. As a non-limiting example, the spacer may be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 5'-UTR may include a TEE sequence-spacer module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or ten or more times in the 5'-UTR.

[0171] In another embodiment, the spacer separating the two TEE sequences may comprise other sequences known in the art that can regulate translation of a polynucleotide of the invention (e.g., an mRNA), such as, but not limited to, an miR sequence (e.g., an miR binding site and an miR seed). As a non-limiting example, each spacer used to separate the two TEE sequences may comprise a different miR sequence or component of an miR sequence (e.g., an miR seed sequence).

[0172] In one embodiment, the TEE in the 5′-UTR of a polynucleotide (e.g., mRNA) of the invention is selected from the group consisting of those described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, and WO 2007 / 025008, European Patent Application Publication Nos. 2610341 and 2610340, and U.S. Pat. No. 6,310,030. ,197, 6,849,405, 7,456,273, and 7,183,395 (each of which TEE sequences are incorporated herein by reference) may comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in the specifications.In another embodiment, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) of the invention is selected from the group consisting of those described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886 and WO 2007 / 02500 The TEE sequences may include 5-30 nucleotide fragments, 5-25 nucleotide fragments, 5-20 nucleotide fragments, 5-15 nucleotide fragments, 5-10 nucleotide fragments of the TEE sequences disclosed in European Patent Application Publication No. 8, European Patent Application Publication Nos. 2610341 and 2610340, and U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395 (the TEE sequences of each of which are incorporated herein by reference).

[0173] In one embodiment, the TEE in the 5'-UTR of the polynucleotide (e.g., mRNA) of the present invention is selected from the group consisting of the TEEs described by Chappell et al. (Proc. Natl. Acad. Sci. USA, vol. 101, pp. 9590-9594, 2004) and Zhou et al. (Proc. Natl. Acad. Sci. USA, vol. 102, pp. 6273-6278, 2005), Wellensiek et al. (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2006), and Zhou et al. (Proc. Natl. Acad. Sci. USA, vol. 102, pp. 6273-6278, 2005). The TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed in the National Cancer Institute (NCI), 2013; DOI: 10.1038 / NMETH.2522 (each of which TEE sequences are incorporated herein by reference) may comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed in the National Cancer Institute (NCI), 2013; DOI: 10.1038 / NMETH.2522 (each of which TEE sequences are incorporated herein by reference).In another embodiment, the TEE in the 5'-UTR of the polynucleotide (e.g., mRNA) of the present invention is selected from the group consisting of the TEEs described by Chappell et al. (Proc. Natl. Acad. Sci. USA, vol. 101, pp. 9590-9594, 2004) and Zhou et al. (Proc. Natl. Acad. Sci. USA, vol. 102, pp. 6273-6278, 2005), Wellensiek et al. (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2005). The TEE sequences may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, or a 5-10 nucleotide fragment of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 (each of which TEE sequences is incorporated herein by reference) disclosed by the National Institute of Standards and Technology (NIS), 2013; DOI: 10.1038 / NMETH.2522.

[0174] In one embodiment, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) of the invention is an IRES sequence, such as, but not limited to, those described in U.S. Pat. No. 7,468,275 and International Patent Publication No. WO 2001 / 055369 (the TEE sequences of each of which are incorporated herein by reference).

[0175] In one embodiment, TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) of the invention can be identified by the methods described in U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. WO 2007 / 025008 and WO 2012 / 009644, each of which is incorporated herein by reference.

[0176] In another embodiment, the TEE used in the 5'-UTR of the polynucleotide (e.g., mRNA) of the present invention can be the transcriptional regulatory element described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO 2001 / 055371 (each of which TEE sequences are incorporated herein by reference).Transcriptional regulatory elements can be identified by methods known in the art, such as, but not limited to, the methods described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO 2001 / 055371 (each of which methods are incorporated herein by reference).

[0177] In yet another embodiment, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) of the invention is a polynucleotide or portion thereof described in U.S. Pat. Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO 2001 / 055371, the TEE sequences of each of which are incorporated herein by reference.

[0178] The 5'-UTR comprising at least one TEE as described herein can be incorporated into a monocistronic sequence, such as, but not limited to, a vector system or a polynucleotide vector. Non-limiting examples of vector systems and polynucleotide vectors include those described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication Nos. 2007 / 0048776, 2009 / 0093049 and 2011 / 0124100, and International Patent Publication Nos. WO 2007 / 025008 and WO 2001 / 055371 (each of which TEE sequences is incorporated herein by reference).

[0179] In one embodiment, the TEEs described herein may be located in the 5'-UTR and / or 3'-UTR of a polynucleotide (e.g., mRNA). The TEE located in the 3'-UTR may be the same and / or different from the TEE located in the 5'-UTR and / or described for incorporation into the 5'-UTR.

[0180] In one embodiment, the 3'-UTR of a polynucleotide (e.g., mRNA) may comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 3'-UTR of a polynucleotide (e.g., mRNA) of the present invention may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variations thereof, repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0181] In one embodiment, the 3'-UTR may include a spacer separating the two TEE sequences. As a non-limiting example, the spacer may be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a TEE sequence-spacer module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or ten or more times in the 3'-UTR.

[0182] In another embodiment, the spacer separating the two TEE sequences may comprise other sequences known in the art that can regulate translation of a polynucleotide of the invention (e.g., an mRNA), such as, but not limited to, the miR sequences described herein (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate the two TEE sequences may comprise a different miR sequence or component of a miR sequence (e.g., a miR seed sequence).

[0183] In one embodiment, incorporation of the miR sequence and / or TEE sequence alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al., "A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility," Nature Cell Biology, 2010).

[0184] Sensor Array In one embodiment, the modified polynucleotides (e.g., mRNAs) of the present invention can encode not only polypeptides but also sensor sequences. Sensor sequences include, for example, miRNA binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, or artificial binding sites engineered to act as pseudoreceptors for endogenous polynucleotide-binding molecules. Non-limiting examples of polynucleotides comprising at least one sensor sequence are described in U.S. Provisional Patent Applications Nos. 61 / 753,661, 61 / 754,159, 61 / 781,097, 61 / 829,334, 61 / 839,893, 61 / 842,733, and 61 / 857,304 (each of which sensor sequences is incorporated herein by reference).

[0185] In one embodiment, microRNA ("miRNA") profiling of a target cell or tissue is performed to determine the presence or absence of miRNAs in the cell or tissue.

[0186] miRNAs (or a single miRNA) are non-coding RNAs 19-25 nucleotides in length that downregulate gene expression by binding to the 3'-UTR of a polynucleotide and reducing polynucleotide stability or inhibiting translation. The modified polynucleotides (e.g., mRNAs) of the present invention may contain one or more miRNA target sequences, miRNA sequences, or miRNA seeds. Such sequences may correspond to any known miRNA, such as those taught in U.S. Patent Application Publication Nos. 2005 / 0261218 and 2005 / 0059005 (these miRNA sequences are incorporated herein by reference).

[0187] The miRNA sequence comprises a "seed" region, i.e., a sequence located in the region of positions 2-8 of the mature miRNA, which has perfect Watson-Crick complementarity to the miRNA target sequence. The miRNA seed may comprise positions 2-8 or positions 2-7 of the mature miRNA. In certain embodiments, the miRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), where the seed-complementary site in the corresponding miRNA target is flanked by an adenosine (A) opposite miRNA position 1. In certain embodiments, the miRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), where the seed-complementary site in the corresponding miRNA target is flanked by an adenosine (A) opposite miRNA position 1. See, for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell., July 6, 2007; Vol. 27, No. 1, pp. 91-105. The miRNA seed bases are perfectly complementary to the target sequence. If the miRNA is available, the miRNA target sequence can be engineered into the 3'-UTR of a polynucleotide (e.g., mRNA) of the invention to target the molecule for degradation or reduced translation. This process would reduce the risk of off-target effects during polynucleotide molecule delivery.The identification of miRNAs, miRNA target regions, their expression patterns, and their roles in biology have been reported (e.g., Bonauer et al., Curr Drug Targets, 2010, Vol. 11, pp. 943-949; Anand and Cheresh, Current Opinion in Hematology, 2010, Vol. 11, pp. 943-949). Hematol. 2011, 18:171-176; Contreras and Rao, Leukemia. 2012, 26:404-413 (December 20, 2011. doi:10.1038 / leu.2011.356); Bartel, Cell. 2009, 136:215-233; Landgraf et al., Cell. 2007, 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012, 80:393-403; and all references therein).

[0188] For example, if a polynucleotide is not intended to be delivered to the liver, but does reach the liver, miR-122, a miRNA abundant in the liver, can inhibit the expression of a polypeptide of interest if one or more target sites of miR-122 are engineered into the 3'-UTR of the modified polynucleotide. The introduction of one or more binding sites for various miRNAs can be engineered to further reduce the lifespan, stability, and protein translation of the modified polynucleotide. As used herein, the term "miRNA site" refers to a miRNA target site or miRNA recognition site, or any nucleotide sequence to which a miRNA binds or associates. It should be understood that "binding" can follow traditional Watson-Crick hybridization rules or reflect any stable association of a miRNA with a target sequence at or adjacent to the miRNA site.

[0189] Conversely, for modified polynucleotides of the present invention, miRNA binding sites can be engineered (i.e., removed) from the sequences in which they naturally occur to increase protein expression in specific tissues, for example, the miR-122 binding site can be removed to improve protein expression in the liver.

[0190] In one embodiment, the modified polynucleotides of the invention may contain at least one miRNA-binding site in the 3'-UTR to target cytotoxic or cytoprotective polynucleotide therapeutics to specific cells, such as, but not limited to, normal and / or cancerous cells (e.g., HEP3B or SNU449).

[0191] In another embodiment, the modified polynucleotides of the invention may contain three miRNA-binding sites in the 3'-UTR to target cytotoxic or cytoprotective polynucleotide therapeutics to specific cells, such as, but not limited to, normal and / or cancerous cells (e.g., HEP3B or SNU449).

[0192] Modulation of expression in multiple tissues can be achieved by introducing and / or removing one or several polynucleotide binding sites. The decision to remove and / or insert miRNA binding sites, or any combination, depends on the miRNA expression patterns and their profiling in disease.

[0193] Examples of tissues in which miRNAs are known to regulate mRNA and thereby protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), bone marrow cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

[0194] Specifically, miRNAs are known to be differentially expressed in immune cells, such as antigen-presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, and natural killer cells. Immune cell-specific miRNAs are involved in immune responses to immunogenicity, autoimmunity, infection, and inflammation, as well as undesirable immune responses after gene therapy and tissue / organ transplantation. Immune cell-specific miRNAs also regulate many aspects of immune cell development, proliferation, differentiation, and apoptosis. For example, miR-142 and miR-146 are expressed exclusively in immune cells and are particularly abundant in myeloid dendritic cells. It has been demonstrated in the art that immune responses to exogenous polynucleotides can be blocked by adding miR-142 binding sites to the 3'-UTR of delivered gene constructs, allowing for more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen-presenting cells and suppresses cytotoxic elimination of transduced cells (see, e.g., Annoni A et al., Blood, 2009, 114, pp. 5152-5161; Brown BD et al., Nat Med., 2006, 12, 5, pp. 585-591; and Brown BD et al., Blood, 2007, 110, pp. 13-4144).

[0195] An antigen-mediated immune response can refer to an immune response triggered by a foreign antigen, which, upon entry into an organism, is processed by antigen-presenting cells and displayed on their surface. T cells can recognize the presented antigen and induce cytotoxic elimination of cells expressing the antigen.

[0196] By introducing miR-142 binding site into the 3'-UTR of the polynucleotide of the present invention, miR-142-mediated polynucleotide degradation can selectively suppress gene expression in antigen-presenting cells, limiting antigen presentation in APCs (e.g., dendritic cells), thereby preventing antigen-mediated immune responses after polynucleotide delivery.Therefore, the polynucleotide can be stably expressed in target tissues or cells without causing cytotoxic ablation.

[0197] In one embodiment, a miRNA binding site known to be expressed in immune cells, particularly antigen-presenting cells, can be engineered into the polynucleotide to suppress expression of the sensor-signal polynucleotide in APCs by miRNA-mediated polynucleotide degradation, so as to suppress antigen-mediated immune responses, while maintaining expression of the polynucleotide in non-immune cells in which immune cell-specific miRNAs are not expressed. For example, to prevent immunogenic reactions caused by liver-specific protein expression, the miR-122 binding site can be removed, and a miR-142 (and / or miR-146) binding site can be engineered into the 3'-UTR of the polynucleotide.

[0198] To further drive selective degradation and suppression of the polynucleotide in APCs and macrophages, the polynucleotide may contain another negative regulatory element in the 3'-UTR, either alone or in combination with the mir-142 and / or mir-146 binding site. As a non-limiting example, one regulatory element is a constitutive decay element (CDE).

[0199] In one embodiment, the binding site for an embryonic stem cell-specific miRNA can be included in or removed from the 3'-UTR of the polynucleotide to regulate the development and / or differentiation of embryonic stem cells, suppress senescence of stem cells in degenerative conditions (e.g., degenerative diseases), or stimulate senescence and apoptosis of stem cells in pathological conditions (e.g., cancer stem cells).

[0200] As a non-limiting example, miRNA sites that are overexpressed in certain cancer and / or tumor cells can be removed from the 3'-UTR of a polynucleotide encoding a polypeptide of interest to restore the expression suppressed by the overexpressed miRNA in cancer cells, thereby improving the corresponding biological functions, such as transcriptional stimulation and / or repression, cell cycle arrest, apoptosis, and cell death. Normal cells and tissues in which miRNA expression is not upregulated remain unaffected.

[0201] miRNAs can also regulate complex biological processes such as angiogenesis (miR-132) (Anand and Cheresh, Curr Opin Hematol, 2011, 18:171-176). In the modified polynucleotides of the present invention, binding sites for miRNAs involved in such processes can be removed or introduced to tailor expression of the modified polynucleotide to the context of a biologically relevant cell type or relevant biological process. In this regard, the polynucleotide is defined as an auxotrophic polynucleotide.

[0202] MiRNA gene regulation can be influenced by the sequences surrounding the miRNA, including, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, or artificial), the regulatory elements of the surrounding sequence, and / or the structural elements of the surrounding sequence. miRNA can be influenced by the 5'-UTR and / or 3'-UTR. As a non-limiting example, a non-human 3'-UTR can increase the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest compared to a human 3'-UTR of the same sequence type.

[0203] In one embodiment, other regulatory and / or structural elements in the 5'-UTR may affect miRNA-mediated gene regulation. One example of a regulatory and / or structural element is a structured IRES (internal ribosome entry site) in the 5'-UTR, which is required for binding of translation elongation factors to initiate protein translation. EIF4A2, which binds to this secondary structured element in the 5'-UTR, is required for miRNA-mediated gene expression (see, for example, Meijer HA et al., Science, 2013, 340:82-85). The modified polynucleotides of the present invention can be further modified to include this structured 5'-UTR to promote miRNA-mediated gene regulation.

[0204] At least one miRNA site can be engineered into the 3'-UTR of a modified polynucleotide of the present invention. In this regard, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA sites can be engineered into the 3'-UTR of a polynucleotide of the present invention. In one embodiment, the miRNA sites incorporated into the modified polynucleotide can be the same or different miRNA sites. In another embodiment, the miRNA sites incorporated into the modified polynucleotide can target the same or different tissues in the body. As a non-limiting example, the introduction of tissue-, cell-, or disease-specific miRNA binding sites into the 3'-UTR of a modified polynucleotide (e.g., mRNA) can reduce the level of expression in specific cell types (e.g., hepatocytes, bone marrow cells, endothelial cells, cancer cells).

[0205] In one embodiment, the miRNA site may be engineered to be located near the 5' end of the 3'-UTR, approximately midway between the 5' and 3' ends of the 3'-UTR, and / or near the 3' end of the 3'-UTR. As a non-limiting example, the miRNA site may be engineered to be located near the 5' end of the 3'-UTR and approximately midway between the 5' and 3' ends of the 3'-UTR. As another non-limiting example, the miRNA site may be engineered to be located near the 3' end of the 3'-UTR and approximately midway between the 5' and 3' ends of the 3'-UTR. As yet another non-limiting example, the miRNA site may be engineered to be located near the 5' end of the 3'-UTR and approximately midway between the 5' and 3' ends of the 3'-UTR.

[0206] In another embodiment, the 3'-UTR may contain four miRNA sites, which may be complete miRNA binding sites, miRNA seed sequences, and / or miRNA binding site sequences without seed sequences.

[0207] In one embodiment, the polynucleotide of the present invention can be engineered to contain at least one miRNA to attenuate antigen presentation by antigen-presenting cells.The miRNA can be a complete miRNA sequence, a miRNA seed sequence, a miRNA sequence without a seed, or a combination thereof.As a non-limiting example, the miRNA incorporated into the polynucleotide can be specific to the hematopoietic system.As another non-limiting example, the miRNA incorporated into the polynucleotide of the present invention to attenuate antigen presentation is miR-142-3p.

[0208] In one embodiment, a polynucleotide can be engineered to contain miRNA sites expressed in various tissues of a subject. As a non-limiting example, a modified polynucleotide of the present invention can be engineered to contain miR-192 and miR-122 to regulate the expression of the modified polynucleotide in the liver and kidney of a subject. In another embodiment, a modified polynucleotide can be engineered to contain two or more miRNA sites in the same tissue. For example, a modified polynucleotide of the present invention can be engineered to contain miR-17-92 and miR-126 to regulate the expression of the modified polynucleotide in endothelial cells of a subject.

[0209] In one embodiment, the therapeutic window and / or differential expression associated with a target polypeptide encoded by a modified signal-encoding polynucleotide (also referred to herein as a polynucleotide) of the present invention can be modified. For example, the polynucleotide can be designed to cause a higher expression of a death signal in cancer cells (or a survival signal in normal cells) due to the miRNA signature of the cells. If cancer cells express lower levels of a particular miRNA, the polynucleotide encoding the binding site for that miRNA (or multiple miRNAs) can be more highly expressed. Thus, the target polypeptide encoded by the polynucleotide is selected as a protein that causes or induces cell death. Adjacent non-cancerous cells with higher expression of the same miRNA can express the polynucleotide at a lower level due to the action of the miRNA binding to the binding site or "sensor" encoded in the 3'-UTR, and thus be less affected by the encoded death signal. Conversely, cell survival or cytoprotective signals can be delivered to tissues containing cancer and non-cancerous cells where the miRNA is more highly expressed in the cancer cells, resulting in a lower survival signal for cancer cells and a greater survival signature for normal cells. Following previous paradigms, multiple polynucleotides with different signals can be designed and administered.

[0210] In one embodiment, expression of a polynucleotide can be controlled by incorporating at least one sensor sequence into the polynucleotide and formulating the polynucleotide. As a non-limiting example, a polynucleotide can be targeted to an orthotopic tumor by incorporating a miR-122 binding site into the polynucleotide and formulating it into lipid nanoparticles containing the cationic lipid DLin-KC2-DMA.

[0211] In accordance with the present invention, a polynucleotide may be modified to avoid the deficiencies of other polypeptide-encoding molecules in the art, and thus, in this embodiment, the polynucleotide is referred to as a modified polynucleotide.

[0212] By understanding the expression patterns of miRNAs in various cell types, modified polynucleotides can be engineered for more targeted expression in specific cell types or only under specific biological conditions. By introducing tissue-specific miRNA binding sites, modified polynucleotides can be designed that may be optimal for protein expression in tissues or under biological conditions.

[0213] Using engineered modified polynucleotide and protein production, transfection experiments can be carried out in relevant cell lines, and can be assayed at various time points after transfection.For example, cells can be transfected with various miRNA binding site-engineered polynucleotides (e.g., mRNA), and the protein produced can be assayed 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days after transfection using ELISA kits for relevant proteins.In order to investigate the tissue-specific expression changes of formulated modified polynucleotides, in vivo experiments can also be carried out using miRNA-binding site-engineered molecules.

[0214] In some embodiments, modified polynucleotides can be designed to incorporate miRNA binding region sites that have 100% identity to known seed sequences or less than 100% identity to seed sequences.Seed sequences can be partially mutated to reduce miRNA binding affinity, thereby reducing the downregulation of its polynucleotide transcripts.In essence, the degree of match or mismatch between target polynucleotides and miRNA seeds can act as a rheostat to finely adjust the ability of miRNA to regulate protein expression.In addition, mutations in non-seed regions of miRNA binding sites can also affect the ability of miRNA to regulate protein expression.

[0215] In one embodiment, the miR sequence can be incorporated into the loop of the stem-loop. In another embodiment, an miR seed sequence can be incorporated into the loop of the stem-loop, and an miR binding site can be incorporated into the 5'- or 3'-stem of the stem-loop.

[0216] In one embodiment, a TEE can be incorporated into the 5' end of the stem of the stem-loop, and an miR seed can be incorporated into the stem of the stem-loop. In another embodiment, a TEE can be incorporated into the 5' end of the stem of the stem-loop, an miR seed can be incorporated into the stem of the stem-loop, and / or an miR binding site can be incorporated into the 3' end of the stem or the sequence after the stem-loop. The miR seed and miR binding site can be the same and / or different miR sequences.

[0217] In one embodiment, incorporation of the miR sequence and / or TEE sequence alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al., Nature Cell Biology, 2010).

[0218] In one embodiment, incorporation of the miR sequence and / or TEE sequence alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al., Nature Cell Biology, 2010).

[0219] In one embodiment, the 5'-UTR may comprise at least one miRNA sequence, which may be, but is not limited to, a 19 or 22 nucleotide sequence and / or a seedless miRNA sequence.

[0220] In one embodiment, miRNA sequences in the 5'-UTR may be used to stabilize the polynucleotides (eg, mRNA) described herein. In another embodiment, the miRNA sequence in the 5'-UTR can be used to reduce the accessibility of a translation initiation site, such as, but not limited to, the start codon. Matsuda et al. (PLoS One, 2010, Vol. 11, No. 5, e15057) used antisense locked nucleic acid (LNA) oligonucleotides and exon junction complexes (EJCs) around the first start codon (AUG) (-4 to +37, where the A in the AUG codon is +1) to reduce the accessibility of the first start codon. Matsuda demonstrated that modifying the sequence around the start codon with LNA or EJCs affected the efficiency, length, and structural stability of polynucleotides (e.g., mRNA). The polynucleotide (e.g., mRNA) of the present invention may contain an miRNA sequence near the translation start site instead of the LNA or EJC sequence described by Matsuda et al., in order to reduce the accessibility of the translation start site. The translation start site may be before, after, or within the miRNA sequence. As a non-limiting example, the translation start site may be located within the miRNA sequence, such as the seed sequence or binding site. As another non-limiting example, the translation start site may be located within the miR-122 sequence, such as the seed sequence or the miR-122 binding site.

[0221] In one embodiment, the polynucleotide (e.g., mRNA) of the present invention may contain at least one miRNA to attenuate antigen presentation by antigen-presenting cells. The miRNA may be a complete miRNA sequence, a miRNA seed sequence, a miRNA sequence without a seed, or a combination thereof. As a non-limiting example, the miRNA incorporated into the polynucleotide (e.g., mRNA) of the present invention may be specific to the hematopoietic system. As another non-limiting example, the miRNA incorporated into the polynucleotide (e.g., mRNA) of the present invention to attenuate antigen presentation is miR-142-3p.

[0222] In one embodiment, the polynucleotide (e.g., mRNA) of the present invention may contain at least one miRNA to attenuate the expression of the encoded polypeptide in a cell of interest. As a non-limiting example, the polynucleotide (e.g., mRNA) of the present invention may contain at least one miR-122 binding site to attenuate the expression of the encoded polypeptide of interest in the liver. As another non-limiting example, the polynucleotide (e.g., mRNA) of the present invention may contain at least one miR-142-3p binding site, miR-142-3p seed sequence, miR-142-3p binding site without a seed, miR-142-5p binding site, miR-142-5p seed sequence, miR-142-5p binding site without a seed, miR-146 binding site, miR-146 seed sequence, and / or miR-146 binding site without a seed sequence.

[0223] In one embodiment, the polynucleotide (e.g., mRNA) of the present invention can contain at least one miRNA binding site in the 3'-UTR to selectively degrade the polynucleotide therapeutic agent in immune cells, thereby suppressing undesirable immunogenic reactions caused by therapeutic agent delivery. Non-limiting examples of the miRNA binding site can be modified polynucleotides that are less stable in antigen-presenting cells. Non-limiting examples of these miRNAs include mir-142-5p, mir-142-3p, mir-146a-5p, and mir-146-3p.

[0224] In one embodiment, a polynucleotide (eg, mRNA) of the invention comprises at least one miRNA sequence in a region of the polynucleotide (eg, mRNA) that can interact with an RNA-binding protein.

[0225] RNA motifs for RNA binding proteins (RBPs) RNA-binding proteins (RBPs) can regulate many aspects of co- and post-transcriptional gene expression, including, but not limited to, RNA splicing, localization, translation, turnover, polyadenylation, capping, modification, transport, and localization. RNA-binding domains (RBDs), such as, but not limited to, RNA recognition motifs (RRs) and hnRNP K-homology (KH) domains, typically regulate sequence binding between RBPs and their RNA targets (Ray et al., Nature, 2013, 499:172-177). In one embodiment, a canonical RBD can bind to a short RNA sequence. In another embodiment, a canonical RBD can recognize structural RNA.

[0226] In one embodiment, to increase the stability of a polynucleotide of interest, a polynucleotide encoding HuR can be co-transfected or co-injected into cells or tissues together with the polynucleotide of interest. These proteins can also be linked to the polynucleotide of interest in vitro and then administered together to cells. Poly(A)-binding protein (PABP) interacts with the eukaryotic translation initiation factor eIF4G to stimulate translation initiation. Co-administration of polynucleotides encoding these RBPs with a polynucleotide drug and / or linking these proteins to the polynucleotide drug in vitro and administering the protein-bound polynucleotide to cells can increase the translation efficiency of the polynucleotide. The same concept can be extended to co-administration of polynucleotides encoding various translation factors and promoters, as well as proteins themselves that affect polynucleotide stability and / or translation efficiency.

[0227] In one embodiment, a polynucleotide (e.g., mRNA) may comprise at least one RNA-binding motif, such as, but not limited to, an RNA-binding domain (RBD).

[0228] In one embodiment, the RBD can be any of the RBDs described by Ray et al. (Nature, 2013, 499:172-177, the RBD sequence of which is incorporated herein by reference), fragments, or variants thereof.

[0229] In one embodiment, a polynucleotide (e.g., mRNA) of the invention can comprise a sequence for at least one RNA-binding domain (RBD). When a polynucleotide (e.g., mRNA) of the invention comprises more than one RBD, the RBDs need not be from the same species or the same structural class.

[0230] In one embodiment, at least one flanking region (e.g., 5'-UTR and / or 3'-UTR) may comprise at least one RBD. In another embodiment, both the first flanking region and the second flanking region may comprise at least one RBD. The RBDs may be the same, or each of the RBDs may have at least 60% sequence identity to the other RBD. As a non-limiting example, at least one RBD may be located before, after, and / or within the 3'-UTR of a polynucleotide (e.g., mRNA) of the present invention. As another non-limiting example, at least one RBD may be located before or within the first 300 nucleosides of the 3'-UTR.

[0231] In another embodiment, a polynucleotide (e.g., mRNA) of the invention can comprise at least one RBD in the first region of linked nucleosides. The RBD can be located before, after, or within the coding region (e.g., ORF).

[0232] In yet another embodiment, the first region of linked nucleosides and / or at least one flanking region can include at least one RBD. By way of non-limiting example, the first region of linked nucleosides can include an RBD associated with a splicing factor, and at least one flanking region can include an RBD for stability and / or a translation factor.

[0233] In one embodiment, a polynucleotide (e.g., mRNA) of the present invention may comprise at least one RBD located in a coding and / or non-coding region of the polynucleotide (e.g., mRNA).

[0234] In one embodiment, at least one RBD may be incorporated into at least one flanking region to increase the stability of a polynucleotide (e.g., mRNA) of the present invention.

[0235] In one embodiment, the miRNA sequence in the RNA-binding protein motif can be used to reduce the accessibility of a translation start site, such as, but not limited to, a start codon. The polynucleotide (e.g., mRNA) of the present invention can include a miRNA sequence near the translation start site instead of the LNA or EJC sequence described by Matsuda et al. to reduce the accessibility of the translation start site. The translation start site can be before, after, or within the miRNA sequence. As a non-limiting example, the translation start site can be located within the miRNA sequence, such as a seed sequence or binding site. As another non-limiting example, the translation start site can be located within the miR-122 sequence, such as a seed sequence or a miR-122 binding site.

[0236] In another embodiment, antisense locked nucleic acid (LNA) oligonucleotides and exon junction complexes (EJCs) can be used for RNA-binding protein motifs. LNAs and EJCs can be used around the first start codon (AUG) (-4 to +37, where the A in the AUG codon is +1) to reduce its accessibility.

[0237] 3'-UTR and triple helix In one embodiment, a polynucleotide of the invention may comprise a triple helix at the 3' end of the modified polynucleotide. The 3' end of a polynucleotide of the invention may comprise a triple helix, either alone or in combination with a poly-A region.

[0238] In one embodiment, a polynucleotide of the invention may comprise at least a first and a second U-rich region, a conserved stem-loop region between the first and second regions, and / or an A-rich region. The first and second U-rich regions and the A-rich region may combine to form a triple helix at the 3' end of the polynucleotide. This triple helix may stabilize the polynucleotide, increase translation efficiency of the polynucleotide, and / or protect the 3' end from degradation. Exemplary triple helices include, but are not limited to, the triple helix sequences of metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), MEN-β, and polyadenylated nuclear (PAN) RNA (Wilusz et al., Genes & Development, 2004). Development, 2012, vol. 26, pp. 2392-2407 (the triple helix sequences of which are incorporated herein by reference). In one embodiment, the 3' end of a modified polynucleotide of the invention comprises a first U-rich region comprising TTTTTCTTTT (SEQ ID NO: 1), a second U-rich region comprising TTTTGCTTTTT (SEQ ID NO: 2) or TTTTGCTTTT (SEQ ID NO: 3), and / or an A-rich region comprising AAAAAGCAAAA (SEQ ID NO: 4). In another embodiment, the 3' end of a polynucleotide of the invention comprises a triple helix-forming structure comprising a first U-rich region, a conserved region, a second U-rich region, and an A-rich region.

[0239] In one embodiment, the triple helix may be formed from the cleavage of the MALAT1 sequence prior to the formation of the cloverleaf structure. Without intending to be bound by theory, MALAT1 is a long non-coding RNA that, upon cleavage, forms a triple helix and a tRNA-like cloverleaf structure. In this case, the MALAT1 transcript is localized in nuclear speckles, and the tRNA-like cloverleaf structure is localized in the cytoplasm (see, for example, Wilusz et al., Cell, 2008, vol. 135, no. 5, pp. 919-932).

[0240] As a non-limiting example, the ends of the polynucleotide of the present invention comprising the MALAT1 sequence can then form a triple helix structure after RNase P cleavage from the cloverleaf structure, which stabilizes the polynucleotide (see, for example, Peart et al., "Non-mRNA 3'-end formation: how the other half lives"; WIREs RNA 2013).

[0241] In one embodiment, the polynucleotide (e.g., mRNA) described herein comprises a MALAT1 sequence. In another embodiment, the polynucleotide (e.g., mRNA) may be polyadenylated. In yet another embodiment, the polynucleotide (e.g., mRNA) is not polyadenylated but has increased resistance to degradation compared to an unmodified polynucleotide (e.g., mRNA).

[0242] In one embodiment, the polynucleotide of the present invention may comprise a MALAT1 sequence in the second flanking region (e.g., 3'-UTR). As a non-limiting example, the MALAT1 sequence may be human or mouse.

[0243] In another embodiment, the cloverleaf structure of the MALAT1 sequence can also be processed by RNaseZ and CCA-adding enzymes to form tRNA-like structures called mascRNAs (MALAT1-associated small cytoplasmic RNAs). By way of non-limiting example, the mascRNAs may encode proteins or fragments thereof and / or contain miRNA sequences. The mascRNAs may contain at least one chemical modification described herein.

[0244] stem loop In one embodiment, a polynucleotide of the present invention may comprise a stem loop, such as, but not limited to, a histone stem loop. The stem loop may be a nucleotide sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, SEQ ID NOS: 7-17, as set forth in International Patent Publication No. WO 2013 / 103659 (SEQ ID NOS: 7-17 of which are incorporated herein by reference). The histone stem loop may be located 3' to the coding region (e.g., at the 3' end of the coding region). As a non-limiting example, the stem loop may be located at the 3' end of a polynucleotide described herein. In certain embodiments, the polynucleotide comprises two or more stem loops (e.g., two stem loops). In certain embodiments, the polynucleotide comprises any of the stem loop sequences described in International Patent Publication Nos. WO 2012 / 019780 and WO 201502667 (these stem loop sequences are incorporated herein by reference). In some embodiments, the polynucleotide comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 5). In some embodiments, the polynucleotide comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 6).

[0245] In one embodiment, the stem loop may be located in the second terminal region. As a non-limiting example, the stem loop may be located in an untranslated region (e.g., 3'-UTR) of the second terminal region.

[0246] In one embodiment, a polynucleotide, such as, but not limited to, an mRNA containing a histone stem loop, can be stabilized by the addition of a 3'-stabilizing region (e.g., a 3'-stabilizing region comprising at least one chain-terminating nucleoside). Without intending to be bound by theory, the addition of at least one chain-terminating nucleoside can slow down degradation of the polynucleotide, thereby increasing the half-life of the polynucleotide.

[0247] In another embodiment, polynucleotides such as, but not limited to, mRNAs containing histone stem loops can be stabilized by modifications to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO 2013 / 103659).

[0248] In yet another embodiment, polynucleotides such as, but not limited to, mRNAs containing histone stem loops can be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other modified nucleosides known in the art and / or described herein.

[0249] In one embodiment, a polynucleotide of the present invention can contain a histone stem loop, a poly-A tract, and / or a 5'-cap structure. The histone stem loop can precede and / or follow the poly-A tract. Polynucleotides containing histone stem loop and poly-A tract sequences can contain chain-terminating nucleosides as described herein.

[0250] In another embodiment, a polynucleotide of the invention may comprise a histone stem loop and a 5'-cap structure, which may include, but is not limited to, those described herein and / or known in the art.

[0251] In one embodiment, the conserved stem-loop region can comprise a miR sequence described herein. As a non-limiting example, the stem-loop region can comprise a seed sequence of a miR sequence described herein. In another non-limiting example, the stem-loop region can comprise a miR-122 seed sequence.

[0252] In another embodiment, the conserved stem-loop region may comprise a miR sequence described herein, and may also comprise a TEE sequence. In one embodiment, incorporation of the miR and / or TEE sequences alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al., "A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility," Nature Cell Biology, 2010, incorporated herein by reference in its entirety).

[0253] In one embodiment, the modified polynucleotides described herein may comprise at least one histone stem loop and poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding at least one histone stem loop and poly-A region or polyadenylation signal are described in International Patent Publication Nos. WO 2013 / 120497, WO 2013 / 120629, WO 2013 / 120500, WO 2013 / 120627, WO 2013 / 120498, WO 2013 / 120626, WO 2013 / 120499, and WO 2013 / 120628 (the sequences of each of which are incorporated herein by reference). In one embodiment, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a pathogen antigen or fragment thereof, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120499 and WO 2013 / 120628 (both of which sequences are incorporated herein by reference). In another embodiment, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120497 and WO 2013 / 120629 (both of which sequences are incorporated herein by reference). In one embodiment, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. WO 2013 / 120500 and WO 2013 / 120627 (both of which sequences are incorporated herein by reference).In another embodiment, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode an allergenic antigen or an autoimmune autoantigen, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120498 and WO 2013 / 120626 (both of which sequences are incorporated herein by reference).

[0254] Poly-A region During RNA processing, long chains of adenosine nucleotides (poly-A tracts) are typically added to messenger RNA (mRNA) molecules to increase the molecule's stability. Shortly after transcription, the 3' end of the transcript is cleaved, releasing a 3'-hydroxyl group. Poly-A polymerase then adds chains of adenosine nucleotides to the RNA. This process, called polyadenylation, adds poly-A tracts that are 100 to 250 residues in length.

[0255] The length of the unique poly-A region can confer several advantages to the modified polynucleotides of the present invention. Generally, the length of a poly-A region of the present invention is at least 30 nucleotides. In another embodiment, the poly-A region is at least 35 nucleotides long. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides.In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[0256] In one embodiment, the poly-A region can be 80, 120, 160 nucleotides in length in the modified polynucleotide molecules described herein.

[0257] In another embodiment, the poly-A region can be 20, 40, 80, 100, 120, 140 or 160 nucleotides in length in the modified polynucleotide molecules described herein.

[0258] In one embodiment, the poly-A region is designed for the entire length of the modified polynucleotide. This design can be based on the length of the coding region of the modified polynucleotide, the length of a particular feature or region of the modified polynucleotide (such as mRNA), or the length of the final product expressed from the modified polynucleotide. Compared to any feature of the modified polynucleotide (e.g., other than the mRNA portion containing the poly-A region), the poly-A region can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer in length than the additional feature. The poly-A region can also be designed as part of the modified polynucleotide to which it belongs. In this regard, the poly-A region can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the poly-A region.

[0259] In one embodiment, engineered binding sites and / or conjugates of polynucleotides (e.g., mRNA) for poly-A binding protein can be used to enhance expression. The engineered binding site can be a sensor sequence that can act as a binding site for a ligand in the local microenvironment of the polynucleotide (e.g., mRNA). As a non-limiting example, a polynucleotide (e.g., mRNA) can contain at least one engineered binding site to modify the binding affinity of poly-A binding protein (PABP) and its analogs. Incorporation of at least one engineered binding site can increase the binding affinity of PABP and its analogs.

[0260] Furthermore, multiple different polynucleotides (e.g., mRNAs) can be linked together via their 3' ends to PABP (poly-A binding protein) using modified nucleotides at the 3' end of the poly-A region. Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days after transfection. As a non-limiting example, transfection experiments can be used to evaluate the effect of the addition of at least one engineered binding site on binding affinity for PABP or its analogs.

[0261] In one embodiment, poly-A regions can be used to regulate translation initiation. Without intending to be bound by theory, poly-A regions may be essential for protein synthesis because they recruit PABP, which can then interact with the translation initiation complex.

[0262] In another embodiment, a poly-A region may also be used in the present invention to protect against 3'-5'-exonuclease digestion. In one embodiment, a polynucleotide (e.g., mRNA) of the present invention is designed to contain a poly-AG quadruplet. A G-quartet is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, a G-quartet is incorporated at the end of a poly-A region. The resulting polynucleotide (e.g., mRNA) can be assayed at various time points for stability, protein production, and other parameters, including half-life. It has been discovered that a poly-AG quadruplet results in protein production equivalent to at least 75% of that seen using only a 120-nucleotide poly-A region.

[0263] In one embodiment, a polynucleotide (e.g., mRNA) of the present invention may contain a poly-A region and may be stabilized by the addition of a 3'-stabilizing region. A polynucleotide (e.g., mRNA) containing a poly-A region may further contain a 5'-cap structure.

[0264] In another embodiment, a polynucleotide (e.g., mRNA) of the present invention can comprise a poly-AG quartet. A polynucleotide (e.g., mRNA) comprising a poly-AG quartet can further comprise a 5'-cap structure.

[0265] In one embodiment, 3'-stabilizing regions that can be used to stabilize polynucleotides (e.g., mRNA) that contain poly-A tracts or poly-AG quartets can be, but are not limited to, those described in International Patent Publication No. WO 2013 / 103659 (the poly-A tracts and poly-AG quartets of which are incorporated herein by reference). In another embodiment, a 3'-stabilizing region that can be used in the present invention includes a chain-terminating nucleoside such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, a 2',3'-dideoxynucleoside, e.g., 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an O-methylnucleoside.

[0266] In another embodiment, polynucleotides such as, but not limited to, mRNAs containing poly-A tracts or poly-AG quartets can be stabilized by modifications to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO 2013 / 103659).

[0267] In yet another embodiment, polynucleotides such as, but not limited to, mRNAs containing poly-A regions or poly-AG quartets can be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other modified nucleosides known in the art and / or described herein.

[0268] Poly-C region In certain embodiments, a polynucleotide of the invention comprises a poly-C region. The length of the unique poly-C region can confer several advantages to the modified polynucleotides of the present invention.

[0269] Generally, the length of a poly-C region of the present invention is at least 10 nucleotides. In another embodiment, the poly-C region is at least 15 nucleotides in length. In another embodiment, the poly-C region is at least 20 nucleotides in length. In another embodiment, the poly-C region is at least 25 nucleotides in length. In another embodiment, the poly-C region is at least 30 nucleotides in length. In another embodiment, the poly-C region is at least 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides.In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[0270] In one embodiment, the poly-C region can be 80, 120, or 160 nucleotides in length in a modified polynucleotide molecule described herein.

[0271] In another embodiment, the poly-C region can be 20, 40, 80, 100, 120, 140 or 160 nucleotides in length in the modified polynucleotide molecules described herein.

[0272] In one embodiment, the length of the poly-C region is designed relative to the entire length of the modified polynucleotide. This design can be based on the length of the coding region of the modified polynucleotide, the length of a specific feature or region of the modified polynucleotide (such as mRNA), or the length of the final product expressed from the modified polynucleotide. Compared to any feature of the modified polynucleotide (e.g., other than the mRNA portion containing the poly-C region), the poly-C region can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the additional feature. The poly-C region can also be designed as part of the modified polynucleotide to which it belongs. In this regard, the poly-C region can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the poly-C region.

[0273] Complementary Stabilizing Polynucleotides In certain embodiments, a polynucleotide of the present invention further comprises one or more complementary stabilizing polynucleotides. A complementary stabilizing polynucleotide is a polynucleotide comprising 5 to 20 nucleotides complementary to or near one of both ends of a polynucleotide (e.g., mRNA). In certain embodiments, the complementary stabilizing polynucleotide increases the stability (e.g., plasma stability) and / or expression level of a polynucleotide of the present invention. In certain embodiments, the complementary stabilizing polynucleotide is complementary to or near the 5' end of a polynucleotide of the present invention. In certain embodiments, the complementary stabilizing polynucleotide is complementary to or near the 3' end of a polynucleotide of the present invention. In certain embodiments, the one or more complementary stabilizing polynucleotides are complementary to both the 5' and 3' regions of a polynucleotide of the present invention and, when bound to a polynucleotide of the present invention, form a circularized construct with the polynucleotide of the present invention. In certain aspects, the present invention provides a composition comprising a polynucleotide of the present invention and one or more complementary stabilizing polynucleotides that form a circularized construct when bound to a polynucleotide of the present invention.

[0274] 3'-stabilization region In eukaryotes, the 3' end of most polynucleotides is polyadenylated. A poly-A tail is added to the 3' end to promote translation and inhibit degradation of polynucleotides by exosomes and exonucleases. Polyadenylation also plays a role in transcription termination, transport of polynucleotides from the nucleus to the cytosol, and translation. Polyadenylation regulates intracellular molecular activities, including RNA stability and translation efficiency.

[0275] Stabilization of certain polynucleotides in eukaryotic cells is of interest because the protein encoded by the polynucleotide may be produced in greater quantities with longer exposure of the polynucleotide to the translation machinery.

[0276] The present invention features a 3'-stabilizing region that provides increased stability to a polynucleotide compared to a corresponding polynucleotide that does not include a 3'-stabilizing region. In some embodiments, the 3'-stabilizing region comprises a modified nucleoside. In some embodiments, the 3'-stabilizing region is attached to the remainder of the polynucleotide via a linker (e.g., a linker that can be formed by a click chemistry reaction between a click chemistry reaction pair). In some embodiments, the 3'-stabilizing region comprises the 3' end of the polynucleotide. In some embodiments, the 3'-stabilizing region is attached to the 3'-UTR of the polynucleotide. In some embodiments, the 3'-stabilizing region is attached to a poly-A region.

[0277] In some embodiments, the 3'-stabilizing region comprises one or more non-nucleosides (e.g., abasic ribose). In some embodiments, the one or more non-nucleosides are at the 5' end, the 3' end, and / or an internal position of the 3'-stabilizing region.

[0278] In some embodiments, the polynucleotide comprises: i) a coding region; ii) a 5'-UTR optionally containing a Kozak sequence; iii) a 3'-UTR; iv) at least one 5'-cap structure; v) a poly-A region; and vi) a 3'-stabilization region, wherein the 3'-stabilization region is linked to the poly-A region via a linker that can be formed by a click chemistry reaction between a click chemistry reaction pair. In some embodiments, the 3'-stabilization region comprises an L-nucleoside (e.g., L-adenosine). In some embodiments, all of the nucleosides in the 3'-stabilization region are L-nucleosides (e.g., L-adenosine). In some embodiments, the 3'-stabilization region comprises at least two different modified nucleosides (e.g., 2'-O-methyladenosine and reverse thymidine or α-thio-2'-O-methyladenosine and reverse thymidine). In certain embodiments, the 3'-stabilizing region has at least 5 nucleosides (eg, at least 10 nucleosides, at least 20 nucleosides, at least 30 nucleosides, at least 40 nucleosides, at least 50 nucleosides).

[0279] In certain embodiments, the polynucleotide comprises: i) a coding region encoding a polypeptide; ii) a 5'-UTR comprising a Kozak sequence; iii) a 3'-UTR; iv) at least one 5'-cap structure, such as cap0, cap1, cap2, or ARCA cap; v) a poly-A region (e.g., a poly-A region comprising 100 adenosines); and vi) a 3'-stabilization region (e.g., a 3'-stabilization region comprising 10 nucleosides, such as 10 L-adenosines or 7 adenosines, 2 2'-O-methyladenosines, and 1 inverted thymidine, wherein the 3'-stabilization region is attached to the poly-A region via a linker, which can be formed by a click chemistry reaction between a click chemistry pair, and / or the linker comprises a morpholino moiety.

[0280] Polypeptides bound to polynucleotides In some embodiments, a polypeptide is attached to a polynucleotide via a linker having the structure of Formula XIII. For example, a polynucleotide is reacted with an oxidizing agent (e.g., sodium periodate) to generate a dialdehyde by oxidative ring-opening of the sugar at the 3'-terminus, followed by condensation with a polypeptide containing an aminooxy group, for example, at the N-terminus, C-terminus, or internal position, such as a modified lysine. Polypeptides that can be attached to a polynucleotide of the invention include nuclear localization peptides, ER localization peptides, endosomal escape peptides, immunostimulatory peptides, Golgi apparatus localization peptides, lysosome localization peptides, mitochondrial localization peptides, and / or peptides that can be used for affinity chromatography. Polypeptides attached to a polynucleotide of the invention can further localize the polynucleotide to a desired location within a cell and / or aid in the purification of the polynucleotide. In some embodiments, a polypeptide attached to a polynucleotide of the invention is any of the polypeptides listed in Table 1.

[0281] [Table 1] Linker The 3'-stabilizing region can be attached to the remainder of the polynucleotide directly (eg, covalently) or via a linker.

[0282] The 3'-stabilizing region and the remainder of the polynucleotide can be linked by reaction of sulfhydryl (-SH), amino (amine), and / or hydroxyl groups or any suitable reactive group. Homobifunctional and heterobifunctional cross-linking agents (conjugation agents) are available from many commercial sources. Regions available for cross-linking are found in the polynucleotides and 3'-stabilizing regions of the present invention. Cross-linking agents can include, for example, flexible arms of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 carbon atoms. Exemplary crosslinkers include BS3 ([bis(sulfosuccinimidyl)suberate]; BS3 is a homobifunctional N-hydroxysuccinimide ester that targets accessible primary amines), NHS / EDC (N-hydroxysuccinimide and N-ethyl-N'-(dimethylaminopropyl)carbodiimide; NHS / EDC allows for the coupling of primary amine and carboxyl groups), sulfo-EMCS ([Ne-maleimidocaproic acid]hydrazide; sulfo-EMCS is a heterobifunctional reactive group (maleimide and NHS-ester) reactive toward sulfhydryl and amino groups), hydrazide, and SATA (N-succinimidyl-S-acetylthioacetate; SATA is reactive toward amines and adds protected sulfhydryl groups).

[0283] The compounds of the present invention may contain branched and / or unbranched linkers. As used herein, the term "linker" refers to a chemical group or molecule that connects two adjacent molecules or moieties, such as a morpholino group, to a polynucleotide. Typically, an unbranched linker is located between or adjacent to two groups, molecules, or other moieties, and is covalently linked to each of them, thus connecting the two. Alternatively, a branched linker connects three or more groups, molecules, or other moieties, and typically serves as a structural assembly point for three or more groups, molecules, or other moieties. In some embodiments of any of the compounds herein, the linker is not a natural phosphate linker or phosphoramidite linker. In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety.

[0284] In certain embodiments, the linker group has the formula:

[0285] [ka] (In the formula, R L is hydrogen or substituted or unsubstituted alkyl, and m is 0 or an integer between 1 and 10 (inclusive), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In certain embodiments, m is 3 or 4.

[0286] Various activated carboxyl groups (e.g., esters) can be used as chemically reactive groups capable of reacting with nucleosides to form covalent bonds. Specific examples include N-hydroxysuccinimide (NHS), N-hydroxysulfosuccinimide (sulfo-NHS), maleimide-benzoyl-succinimide (MBS), gamma-maleimido-butyryloxy succinimide ester (GMBS), and maleimido propionic acid (MPA). Examples of maleimido undecanoic acid include maleimido hexanoic acid (MHA), and maleimido undecanoic acid (MUA).

[0287] Primary amines are the primary target of NHS esters. Accessible α-amine groups present at the N-terminus of polynucleotides or 3'-stabilized regions can react with NHS esters. When NHS esters react with primary amines to release N-hydroxysuccinimide, an amide bond is formed. In certain embodiments of the present invention, the functional group in the polynucleotide or 3'-stabilized region is a thiol group, and the chemically reactive group is a maleimide-containing group, such as γ-maleimide-butyramide (GMBA or MPA).

[0288] When the pH of the reaction mixture is between 6.5 and 7.4, the maleimide group is most selective for sulfhydryl groups. At pH 7.0, the reaction rate of the maleimide group with sulfhydryls is 1,000 times faster than with amines. Therefore, a stable thioether bond between the maleimide group and sulfhydryls can be formed.

[0289] In one embodiment, the linker has the structure:

[0290] [ka] wherein a, b, c, e, f, and g are each independently 0 or 1; d is 0, 1, 2, or 3; R 6 , R 8 , R 10 , and R 12 each independently represents an optionally substituted C1-C6 alkylene, an optionally substituted C1-C6 heteroalkylene, an optionally substituted C2-C6 alkenylene, an optionally substituted C2-C6 alkynylene, or an optionally substituted C6-C 10 Arylene, O, S, Se, or NR 13 and; R 7 and R 11 are each independently carbonyl, thiocarbonyl, sulfonyl, or phosphoryl, where R 7 is phosphoryl, and -(R 9 ) d - is a bond and e, f, and g are 0, then R 6 or R 8 At least one of the following is R instead of O 11 is phosphoryl, and -(R 9 ) d - is a bond and a, b, and c are 0, then R 10 or R 12 at least one of is not O; Each R 9 are optionally substituted C1 to C 10 Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 10 heteroalkylene, or (R 6 ) a -(R 7 )b -(R 8 ) c (R 10 ) e -(R 11 ) f -(R 12 ) g where -(R 9 ) d - is a bond, then at least one of a, b, c, e, f, or g is 1; R 13 is hydrogen, optionally substituted C1-C4 alkyl, optionally substituted C2-C4 alkenyl, optionally substituted C2-C4 alkynyl, optionally substituted C2-C6 heterocyclyl, optionally substituted C6-C 12 aryl, or optionally substituted C1-C7 heteroalkyl).

[0291] Click Chemistry Linkers In certain embodiments, the linker is formed by a reaction between a click chemistry reaction pair. By "click chemistry reaction pair" is meant a pair of reactive groups that participate in a modular reaction with high yield and high thermodynamic gain, thereby generating a click chemistry linker. In this embodiment, one of the reactive groups is attached to the 3'-stabilized region, and the other reactive group is attached to the remainder of the polynucleotide. Exemplary reactions and click chemistry pairs include the Huisgen 1,3-dipolar cycloaddition reaction between an alkynyl group and an azide group to form a triazole-containing linker; the Huisgen 1,3-dipolar cycloaddition reaction between a diene having a four π-electron system (e.g., an optionally substituted 1,3-unsaturated compound, e.g., optionally substituted 1,3-butadiene, 1-methoxy-3-trimethylsilyloxy-1,3-butadiene, cyclopentadiene, cyclohexadiene, or furan) and a dienophile or heterodienophile having a two ...). These include Diels-Alder reactions between nucleophiles and strained heterocyclyl electrophiles; splint ligation reactions with phosphorothioates and iodo groups; and reductive amination reactions with aldehydes and amino groups (Kolb et al., Angew. Chem. Int. Ed., 40, 2004-2021, 2001; Van der Eycken et al., QSAR Comb. Sci., 26, 1115-1326, 2007).

[0292] In certain embodiments of the invention, the 3'-stabilizing region is linked to the remainder of the polynucleotide by a triazole-containing linker formed by the reaction between an alkynyl group and an azide group click chemistry pair. In such cases, the azide group can be attached to the 3' end of the polynucleotide, and the alkynyl group can be attached to the 5' end of the 3'-stabilizing region. Alternatively, the azide group can be attached to the 5' end of the 3'-stabilizing region, and the alkynyl group can be attached to the 3' end of the polynucleotide. In certain embodiments, the reaction between the azide and alkynyl groups is uncatalyzed; in other embodiments, the reaction is catalyzed using a copper(I) catalyst (e.g., copper(I) iodide), a copper(II) catalyst in the presence of a reducing agent (e.g., copper(II) sulfate or copper(II) acetate with sodium ascorbate), or a ruthenium-containing catalyst (e.g., Cp * RuCl(PPh3)2 or Cp * It is catalyzed by RuCl(COD)).

[0293] Exemplary linkers include linkers containing monofluorocyclooctyne (MFCO), difluorocyclooctyne (DFCO), cyclooctyne (OCT), dibenzocyclooctyne (DIBO), biarylazacyclooctyne (BARAC), difluorobenzocyclooctyne (DIFBO), and bicyclo[6.1.0]nonyne (BCN).

[0294] The linker can be attached by reacting a click chemistry handle pair. As used herein, the term "click chemistry handle" refers to a reactant or reactive group that can participate in a click chemistry reaction. For example, a strained alkyne, such as cyclooctyne, is a click chemistry handle because it can participate in strain-promoted cycloaddition. Generally, a click chemistry reaction requires at least two molecules containing click chemistry handles that can react with each other. For example, an azide is a partner click chemistry handle for cyclooctyne or any other alkyne. Further examples of partner click chemistry handle pairs include dienes and dienophiles, azides and terminal alkynes, azides and strained alkynes, azides and activated alkynes, azides and electron-deficient alkynes, azides and arynes, tetrazines and alkenes, tetrazoles and alkenes, dithioesters and dienes, anthracenes and maleimides, thiols and alkenes, thiols and enones, thiols and maleimides, thiols and para-fluoros, and amines and para-fluoros. Other suitable click chemistry handles are known to those skilled in the art.

[0295] Additional click chemistry handles suitable for use in the methods described herein are known to those of skill in the art and include, but are not limited to, click chemistry handles described in [1] H.C. Kolb, M.G. Finn, K.B. Sharpless, Angew. Chem., 2001, 113:2056-2075; Angew. Chem. Int. Ed., 2001, 40:2004-2021. [2] a) CJ Hawker, KL Wooley, Science, 2005, Vol. 309, pp. 1200-1205; b) D. Fournier, R. Hoogenboom, U.S. Schubert, Chem. Soc. Rev., 2007, Vol. 36, pp. 1369-1380; c) W.H. Binder, R. Sachsenhofer, Macromol. Rapid Communications. Commun., 2007, Vol. 28, pp. 15-54; d) H.C. Kolb and K.B. Sharpless, Drug Discovery Today, 2003, Vol. 8, pp. 1128-1137; e) V.D. Bock, H. Hiemstra, J.H. van Maarseveen, Eur. J. Org. Chem., 2006, pp. 51-68.[3] a) V.O. Rodionov, V.V. Fokin, M.G. Finn, Angewandte Chemie, 2005, Vol. 117, pp. 2250-2255; Angewandte Chemie International Edition, 2005, Vol. 44, pp. 2210-2215; b) P.L. Golas, N.V. Tsarevsky, B. S. S. Sumerlin, K. Matyjaszewski, Macromolecules, 2006, Vol. 39, pp. 6451-6457; c) C. N. Urbani, C. A. Bell, M. R. Whittaker, M. J. Monteiro, Macromolecules, 2008, Vol. 41, pp. 1057-106 0; d) S. Chassaing, A. Sido, A. Alix, M. Kumarraja, P. Pale, J. Sommer, Chem.Eur.J., 2008, Vol. 14, pp. 6713-6721; e) BC Boren, S. Narayan, LK Rasmussen en), L. Zhang, H. Zhao, Z. Lin, G. Jia, and V.V. Fokin, Journal of the American Chemical Society, 2008, Vol. 130, pp. 8923-8930; f), B. Saba, S. Sharma, D. Sawant, and B. Kundu, Synlett, 2007, pp. 1591-1594.[4] JF Lutz, Angewandte Chemie, 2008, Vol. 120, pp. 2212-2214; Angewandte Chemie, Int. Ed., 2008, Vol. 47, pp. 2182-2184. [5] a) Q. Wang, T. R. Chan, R. Hilgraf, V. V. Fokin, K. B. Sharpless, M. G. Finn, Journal of the American Chemical Society, 2003, Vol. 125, pp. 3192-3193; b) J. Gierlich, G. A. Burley, P. M. E. Gramlich, D. M. Hammond, T. Carell, Organic Letters, 2006, Vol. 8, pp. 3639-3642.[6] a) JM Baskin, JA Prescher, ST Laughlin, NJ Agard, PV Chang, IA Miller, A. Lo, JA Codelli, and CR Bertozzi, Proc. Natl. Acad. Sci. USA, 2007, 104, pp. 16793-16797; b) ST Laughlin, JM Baskin, SL Amacher, and CR Bertozzi, Science, 2008, 320, pp. 664-667; c) JA Johnston, JM Baskin, and CR Bertozzi. C.R. Bertozzi, J.F. Koberstein, and N.J. Turro, Chem. Commun., 2008, pp. 3064-3066; d. J.A. Codelli, J.M. Baskin, N.J. Agard, and C.R. Bertozzi, J.A. Journal of the American Chemical Society. em. Soc., 2008, vol. 130, pp. 11486-11493; e) E. M. Sletten and C. R. Bertozzi, Org. Lett., 2008, vol. 10, pp. 3097-3099; f) J. M. Baskin and C. R. Bertozzi, QSAR Comb. Sci., 2007, vol. 26, pp. 1211-1219.[7] a) G. Wittig and A. Krebs, Chem. Ber. Recl., 1961, 94, pp. 3260-3275; b) A.T. Blomquist and L.H. Liu, J. Am. Chem. Soc., 1953, 75, pp. 2153-2154. [8] D.H. Ess, G.O. Jones, K.N. Houk, Org. Lett., 2008, 10, pp. 1633-1636. [9] W.D. Sharpless, P. Wu, T.V. Hansen, and J.G. Lindberg, J.Chem.Educ., 2005, Vol. 82, pp. 1833-1836.

[10] Y. Zou and J. Yin, Bioorg.Med.Chem.Lett., 2008, Vol. 18, pp. 5664-5667.

[11] X. Ning, J. Guo, MA Wolfert, and GJ Boons. Angewandte Chemie, 2008, 120, pp. 2285–2287; Angewandte Chemie, Int. Ed., 2008, 47, pp. 2253–2255.

[12] S. Sawoo, P. Dutta, A. Chakraborty, R. Mukhopadhyay, O. Bouloussa, and A. Sarkar, Chemical Communications, 2008, pp. 5957–5959.

[13] a) Z. Li, T.S. Seo, J.Ju, Tetrahedron Lett., 2004, Vol. 45, pp. 3143-3146; b) SS van Berkel. Berkel, AJ Dirkes, MF Debets, FL van Delft, JJL Cornelissen, RJM Nolte, FPJ Rutjes, ChemBioChem, 2007, Vol. 8, pp. 1504-1508; c) SS van Berkel, AJ Dirks, SA Meeuwissen, DLL Pingen, OC Boerman, P. Laverman, FL van Delft Delft, JJL Cornelissen, and F.P.J. Rutjes, ChemBio-Chem, 2008, 9, pp. 1805-1815.

[14] F. Shi, J.P. Waldo, Y. Chen, and R.C. Larock, Org. Lett., 2008, 10, pp. 2409-2412.

[15] L. Campbell-Verduyn, P.H. Elsinga, L. Mirfeizi, R.A. Dierckx, B.L. Feringa, Org. Biomol. Chem., 2008, Vol. 6, pp. 3461-3463.

[16] a) "The Chemistry of the Thiol Group" (S. Patai, ed.), Wiley, New York, 1974; b) A.F. Jacobine. "In Radiation Curing in Polymer Science and Technology III" (JD Fouassier, JF Labek, eds.), Elsevier, London, 1993, Chapter 7, pp. 219-268.

[17] C.E. Hoyle, T.Y. Lee, T.Roper, J.Polym.Sci. Part A, 2008, Vol. 42, pp. 5301-5338.

[18] L. M. Campos, K. L. Killops, R. Sakai, J. M. J. Paulusse, D. Damiron, E. Drockenmuller, B. W. Messmore, and C. J. Hawker, Macromolecules, 2008, vol. 41, pp. 7063–7070.

[19] a) R.L.A. David and J.A. Kornfield, Macromolecules, 2008, Vol. 41, pp. 1151-1161; b) C. Nilsson, N. Simpson, M. Malkoch, M. Johansson, E. Malmstrom, J. Polym. Sci., Part A. 2008, Vol. 46, pp. 1339-1348; c) A. Dondoni, Angewandte Chemie, Vol. 120, pp. 9133-9135; Angewandte Chemie Int. Ed., Vol. 47, pp. 8995-8997, 2008; d) JF Lutz, H. Schlaad, Polymer, Vol. 49, pp. 817-824, 2008.

[20] A. Gress, A. Voelkel, and H. Schlaad, Macromolecules, 2007, Vol. 40, pp. 7928–7933.

[21] N. ten Brummelhuis, C. Diehl, and H. Schlaad, Macromolecules, 2008, Vol. 41, pp. 9946–9947.

[22] KL Killops, LMCampos, and CJ Hawker, Journal of the American Chemical Society, 2008, Vol. 130, pp. 5062-5064.

[23] JW Chan, B. Yu, C.E. Hoyle, and A.B. Lowe, Chemical Communications, 2008, pp. 4959-4961.

[24] a) G. Moad, E. Rizzardo, S.H. Tang, Accounts of Chemical Research (Acc. Chem. Res.), 2008, Vol. 41, pp. 1133-1142; b) C. Barner-Kowollik, M. Buback, B. Charleux, ML Coote, M. Drach. e), T. Fukuda, A. Goto, B. Klumperman, A. B. Lowe, J. B. McLeary, G. Moad, M. J. Monterio, R. D. Sanderson, M. P. Tonge, and P. Vana, J. Polym. Sci. Part A, 2006, Vol. 44, pp. 5809-5831.

[25] a) RJ Pounder, MJ Stanford, P. Brooks, S. P. Richards, and A. P. Dove, Chem. Commun., 2008, pp. 5158–5160; b) MJ Stanford and A. P. Dove, Macromolecules, 2009, vol. 42, pp. 141–147.

[26] M. Li, P. De, S. R. Gondi, and B. S. Summerlin, J. Polym. Sci. Part A, 2008, vol. 46, pp. 5093–5100.

[27] ZJ Witczak, D. Lorchak, and N. Nguyen, Carbohydrates Research, 2007, Vol. 342, pp. 1929–1933.

[28] a) D. Samaroo, M. Vinodu, X. Chen, C. M. Drain, J. Comb. Chem., 2007, 9, 998–1011; b) X. Chen, D. A. Foster, C. M. Drain, Biochemistry, 2004, 43, pp. 10918–10929; c) D. Samaroo, C. E. Soll, L. J. Todaro, C. M. Drain, Org. Lett., 2006, 8, pp. 4985–4988.

[29] P. Battioni, O. Brigaud, H. Desvaux, D. Mansuy, and T.G. Traylor, Tetrahedron Lett., 1991, vol. 32, pp. 2893–2896.

[30] C. Ott, R. Hoogenboom, and U.S. Schubert, Chem. Commun., 2008, pp. 3516–3518.

[31] a) V. Ladmiral, G. Mantovani, G. J. Clarkson, S. Cauet, J. L. Irwin, and D. M. Haddleton, Journal of the American Chemical Society, 2006, Vol. 128, pp. 4823–4830; b) S. G. Spain, M. I. Gibson, and N. R. Cameron, Journal of Polymer Science, Part A, 2007, Vol. 45, pp. 2059–2072.

[32] C.R. Becer, K. Babiuch, K. Pilz, S. Hornig, T. Heinze, M. Gottschaldt, U.S. Schubert, Macromolecules, 2009, vol. 42, pp. 2387-2394.

[33] "Otto Paul Hermann Diels and Kurt Alder first documented the reaction in 1928. They received the Nobel Prize in Chemistry in 1950 for their work on the eponymous reaction."

[34] a) H.L. Holmes, R.M. Husband, C.C. Lee, and P. Kawulka, J.Am.Chem.Soc., 1948, 70, pp. 141-142; b) M. Lautens, W. Klute, and W. Tam, Chem.Rev., 1996, 96, pp. 49-92; c) K.C. Nicolaou, S.A. Snyder, T. Montagnon, and G. Vasilikogiannakis. .Vassilikogiannakis, Angewandte Chemie, 2002, Vol. 114, pp. 1742-1773; Angewandte Chemie Int. Ed., 2002, Vol. 41, pp. 1668-1698; d) EJ Corey, Angewandte Chemie, 2002, Vol. 114, pp. 1724-1741; Angewandte Chemie Int. Ed., 2002, Vol. 41, pp. 1650-1667.

[35] a) H. Durmaz, A. Dag, O. Altintas, T. Erdogan, G. Hizal, U. Tunca, Macromolecules, 2007, Vol. 40, pp. 191-198; b) H. Durmaz, A. Dag, A. Hizal, G. Hizal, U. Tunca, J. Polym. Sci., Part A. 2008, Vol. 46, pp. 7091-7100; c) A. Dag, H. Durmaz, E. Demir, G. Hizal, U. Tunca, J. Polym. Sci. Part A 2008, Vol. 46, pp. 6969-6977; d) B. Gacal, H. Akat, DK Balta, N. Arsu, Y. Yagci, Macromolecules, 2008, Vol. 41, pp. 2401-2405; e) A. Dag, H. Durmaz, U. Tunca, G. Hizal, J. Polym. Sc. i.) Part A, 2009, Vol. 47, pp. 178-187.

[36] M.L. Blackman, M. Royzen, and J.M. Fox, J.Am.Chem.Soc., 2008, Vol. 130, pp. 13518-13519.

[38] N.K. Devaraj, R. Weissleder, and S.A. Hilderbrand, Bioconjugate Chem., 2008, Vol. 19, pp. 2297-2299.

[39] W. Song, Y. Wang, J. Qu, and Q. Lin, Journal of the American Chemical Society, 2008, 130, pp. 9654–9655.

[40] W. Song, Y. Wang, J. Qu, M. M. Madden, and Q. Lin, Journal of the American Chemical Society, 2008, 120, pp. 2874–2877; Angewandte Chemie International Edition, 2008, 47, pp. 2832–2835.

[41] A. Dag, H. Durmaz, G. Hizal, and U. Tunca, Journal of Polymer Science, Part A, 2008, Vol. 46, pp. 302–313.

[42] a) AJ Inglis, S. Sinnwell, T.P. Davis, C. Barner-Kowollik, M.H.Stenzel, Macromolecules, 2008, vol. 41, pp. 4120-4126; b) S. Sinnwell, AJ Inglis, T.P. Davis, M.H.Stenzel, C. Barner-Kowollik, Chem. Commun., 2008, pp. 2052-2054.

[43] AJ Inglis, S. Sinwell, M.H. Stenzel, and C. Barner-Kowollik, Angewandte Chemie, 2009, 121, pp. 2447-2450; Angewandte Chemie Int. Ed., 2009, 48, pp. 2411-2414. All references cited above are incorporated herein by reference for their disclosure of click chemistry handles suitable for incorporation in accordance with the inventive concepts and methods provided herein.

[0296] Morpholino linker In certain embodiments, the linker may comprise a morpholino moiety, which may be formed by oxidation of the cis-diol of the sugar of a nucleoside, such as the 3'-terminal nucleoside in a polynucleotide (e.g., by treatment with sodium periodate), followed by condensation of the resulting dialdehyde with a reactive amino moiety, such as the alkoxyamino moiety shown below.

[0297] [ka] In one embodiment, the linker has the structure:

[0298] [ka] (In the formula, B 1 is a nucleobase, hydrogen, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C3-C 10 Cycloalkyl, optionally substituted C-C 10 aryl, optionally substituted C2-C9 heterocycle; R 14 and R 15 are each independently hydrogen or hydroxy.

[0299] In one embodiment, the linker has the structure:

[0300] [ka] wherein o is 0, 1, 2, or 3; Y 6 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; Each Y 7 and Y 8 independently, O, S, Se, -NR N1 -, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, where R N1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted C6-C 10is aryl; Each Y 9 are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; Y 10 O, bond, optionally substituted C1 to C 10 Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10 Heterocyclylene, optionally substituted C6-C 12 Arylene, optionally substituted C-C 100 Polyethylene glycolene or optionally substituted C1-C 10 heteroalkylene).

[0301] In one embodiment, Y 10 is optionally substituted C2 to C 100 It is polyethylene glycolene. In one embodiment, the reactive amino moiety is a PEG-alkoxyamine and the linker has the structure:

[0302] [ka] where p is 0, 1, 2, 3, 4, or 5.

[0303] In one embodiment, R 14 and R 15 and Y are both hydroxy. 6 is methylene and Y 7 and Y 8 are both O and Y 9In some embodiments, p is 3.

[0304] In one embodiment, the PEG-alkoxyamine comprises an azide that is further reacted in a click chemistry reaction with an alkyne, and the linker has the structure:

[0305] [ka] Includes:

[0306] In one embodiment, Y 10 are optionally substituted C1 to C 10 In one embodiment, the reactive amino moiety is a carbamidoalkoxyamine and the linker has the structure:

[0307] [ka] wherein q and r are each independently 1, 2, 3, 4, or 5.

[0308] In one embodiment, R 14 and R 15 and Y are both hydroxy. 6 is methylene and Y 7 and Y 8 are both O and Y 9 In some embodiments, r is 3.

[0309] In one embodiment, the linker has the structure:

[0310] [ka] Includes:

[0311] As will be appreciated by those skilled in the art, the structure

[0312] [ka] can exist in equilibrium with other structures shown below.

[0313] [ka] The present invention is intended to encompass all of the possible structures in equilibrium with the morpholino structure.

[0314] phosphate bond In some embodiments, the 3'-stabilizing tail is linked to the remainder of the polynucleotide at the 3'-end of the 3'-UTR or poly-A region, for example, via a phosphate bond. In some embodiments, the phosphate bond is a natural phosphate bond. In some embodiments, the bond between the 3'-stabilizing tail and the remainder of the polynucleotide is formed enzymatically or by splint ligation.

[0315] Codon optimization The polynucleotides of the present invention, their regions, parts, or subregions can be codon-optimized. Codon optimization methods are known in the art and can be useful for achieving one or more of several objectives. These objectives include: matching the codon frequency in target organisms and host organisms to ensure proper folding; biasing GC content to increase mRNA stability or reduce secondary structure; minimizing tandem repeat codons or base runs that may impair gene assembly or expression; customizing transcriptional and translational control regions; inserting or removing protein transport sequences; removing / adding post-translational modification sites in encoded proteins (e.g., glycosylation sites); adding, removing, or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting the translation rate so that various domains of proteins can fold properly; or reducing or eliminating problematic secondary structures in polynucleotides. Codon optimization tools, algorithms, and services are known in the art, and non-limiting examples include GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), and others. These include services from CA) and / or proprietary methods. In one embodiment, the ORF sequence is optimized using an optimization algorithm. The codon choices for each amino acid are shown in Table 2.

[0316] [Table 2] "Codon optimization" refers to the modification of a starting nucleotide sequence by replacing at least one codon therein with another codon that encodes the same amino acid (e.g., to increase in vivo expression). Table 3 contains codon usage frequencies for humans (codon usage database: [[www.]]kazusa.or.jp / codon / cgi-bin / showcodon.cgi?species=9606&aa=1&style=N).

[0317] [Table 3] In Table 3, the number in parentheses after the single-letter amino acid code indicates the frequency of that codon relative to other codons that encode the same amino acid, where "1" indicates the highest frequency and larger integers indicate less frequent codons.

[0318] A guanine-maximizing codon is a codon with the highest possible number of guanines for a particular amino acid. A cytosine-maximizing codon is a codon with the highest possible number of cytosines for a particular amino acid. A guanine-maximizing codon and / or a cytosine-maximizing codon refers to a codon with the highest number of guanines, cytosines, or a combination of guanines and cytosines for a particular amino acid. When two or more codons have the same number of guanines, cytosines, or a combination thereof for a particular amino acid, the less frequent maximizing codon is the codon with a higher integer value in Table 3 than another maximizing codon.

[0319] In one embodiment, after a nucleotide sequence has been codon-optimized, it can be further evaluated for regions containing restriction sites. To remove the restriction site from the sequence, at least one nucleotide in the restriction site region can be replaced with another nucleotide, but the nucleotide replacement alters the amino acid sequence encoded by the codon-optimized nucleotide sequence.

[0320] Features that may be beneficial in certain embodiments of the present invention may be encoded by regions of the polynucleotide, and such regions may be upstream (5') or downstream (3') of the region encoding the polypeptide. These regions may be incorporated into the polynucleotide before and / or after codon optimization of the protein-coding region or open reading frame (ORF). A polynucleotide need not contain both 5'- and 3'-flanking regions. Examples of such features include, but are not limited to, untranslated regions (UTRs), Kozak sequences, oligo(dT) sequences, and detectable tags, and may include multiple cloning sites that may have XbaI recognition.

[0321] In some embodiments, 5'-UTR and / or 3'-UTR regions can be provided as flanking regions. Multiple 5'- or 3'-UTRs can be included in a flanking region and can be of the same or different sequences. Any portion (including none) of a flanking region can be codon-optimized and can independently contain one or more different structural or chemical modifications before and / or after codon optimization.

[0322] After optimization (if necessary), the polynucleotide components are reconstituted and transformed into vectors such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes. For example, optimized polynucleotides can be reconstituted and transformed into chemically competent E. coli, yeast, Neurospora, maize, Drosophila, etc., where the methods described herein generate high copy plasmid-like or chromosomal structures.

[0323] Modified Nucleotides, Nucleosides and Polynucleotides of the Invention As used herein, the term "alteration" or, where appropriate, "alternative" in reference to a nucleotide, nucleoside, or polynucleotide (such as a polynucleotide of the invention, e.g., an mRNA molecule) refers to a modification to an A, G, U, or C ribonucleotide. Generally, as used herein, these terms are not intended to refer to ribonucleotide modifications in the native 5'-terminal mRNA cap portion.

[0324] The modification can be a variety of different modifications. In some embodiments, when the polynucleotide is mRNA, the coding region, flanking region and / or terminal region (e.g., 3'-stabilizing region) can contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, the modified polynucleotide introduced into cells can exhibit reduced degradation in cells compared to unmodified polynucleotides.

[0325] Polynucleotides of the present invention can include any useful modification, such as those to the nucleobase, sugar, or internucleoside linkage (e.g., linking phosphate / phosphodiester bond / phosphodiester backbone). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the nucleobase, sugar, and internucleoside linkage. Modifications of the present invention can be modifications of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA) (e.g., replacement of 2'-OH of a ribofuranosyl ring with 2'-H), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or hybrids thereof. Additional modifications are described herein.

[0326] As described herein, in certain embodiments, the polynucleotides of the present invention do not substantially induce an innate immune response in cells into which the polynucleotides (e.g., mRNA) have been introduced. Characteristics of the induced innate immune response include: 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular PRRs (e.g., RIG-I, MDA5, etc.), and / or 3) termination or reduction of protein translation.

[0327] The polynucleotide may optionally contain other agents (e.g., RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, tRNA, RNA that induces triple helix formation, aptamers, vectors). In certain embodiments, the polynucleotide may contain one or more messenger RNAs (mRNAs) with one or more modified nucleosides or nucleotides (i.e., modified mRNA molecules). More details about these polynucleotides follow below.

[0328] Nucleobase Modification Modified nucleoside and nucleotide can comprise modified nucleobase.Examples of nucleobase found in RNA include but are not limited to adenine, guanine, cytosine and uracil.Examples of nucleobase found in DNA include but are not limited to adenine, guanine, cytosine and thymine.These nucleobases can be modified or completely replaced to provide polynucleotide molecules with improved properties, for example, improved stability, such as resistance to nuclease.

[0329] Modified nucleotide base pairing encompasses not only standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides containing non-standard or modified bases, where the configuration of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard base and the standard base, or between two complementary non-standard base structures. One example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil.

[0330] In some embodiments, the nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3 U), 5-methoxy-uracil (mo 5 U), uracil 5-hydroxyacetic acid (cmo 5 U), uracil 5-hydroxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s 2U), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thiouracil (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (inm 5 U), 5-(isopentenylaminomethyl)-2-thiouracil (inm 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil.

[0331] In some embodiments, the nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine Pseudoisocytidine, Zebularine, 5-Aza-Zebularine, 5-Methyl-Zebularine, 5-Aza-2-Thio-Zebularine, 2-Thio-Zebularine, 2-Methoxy-Cytosine, 2-Methoxy-5-Methyl-Cytosine, 4-Methoxy-Pseudoisocytidine, 4-Methoxy-1-Methyl-Pseudoisocytidine, Lysidine (k2C), 5,2'-O-Dimethyl-Cytidine (m5Cm), N4-Aza- These include cetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0332] In some embodiments, the nucleobase is a modified adenine.Exemplary nucleobases and nucleosides having modified adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza- 2,6-Diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio- These include adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0333] In some embodiments, the nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyobutosine (yW), peroxywyobutosine (o2yW), hydroxywyobutosine (OHyW), and unmodified hydroxywyobutosine (OHyW). * ), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-di These include methyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0334] The modified nucleobase of a nucleotide can independently be a purine, a pyrimidine, a purine or pyrimidine analog. For example, the nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobases can also include, for example, natural and synthetic derivatives of bases, such as pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol , 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When nucleotides are designated using the abbreviations A, G, C, T, or U, each letter refers to a representative base and / or its derivatives. For example, A includes adenine or an adenine analog, such as 7-deazaadenine.

[0335] Modifications in sugars Modified nucleosides and nucleotides that can be incorporated into polynucleotides of the invention (e.g., RNA or mRNA as described herein) can be modified in the sugar of the nucleoside or nucleotide. In some embodiments, the modified nucleoside or nucleotide has the structure:

[0336] [ka] Includes.

[0337] In certain embodiments, the 2'-hydroxy group (OH) can be modified or substituted with several different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, azido, halo (e.g., fluoro), optionally substituted C 1~6 alkyl (e.g., methyl); optionally substituted C 1~6 Alkoxy (e.g., methoxy or ethoxy); optionally substituted C 6~10 Aryloxy; optionally substituted C 3~8 Cycloalkyl; optionally substituted C 6~10 Aryl-C 1~6 Alkoxy, optionally substituted C 1~12 (heterocyclyl)oxy; sugars (e.g., ribose, pentose, or any described herein); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR (wherein R is H or optionally substituted alkyl and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); "locked" nucleic acids (LNAs) (wherein the 2'-hydroxy is 1~6 Alkylene or C 1~6linked to the 4'-carbon of the same ribose sugar by a heteroalkylene bridge, exemplary bridges included methylene, propylene, ether, or amino bridges); aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino, as defined herein; and amino acid, as defined herein.

[0338] Generally, RNA contains the sugar group ribose, which is a five-membered ring containing oxygen. Exemplary, non-limiting modified nucleotides include substitution of oxygen in ribose (e.g., with S, Se, or alkylenes such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to add additional carbon or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (also having a phosphoramidate backbone)). to form 6- or 7-membered rings having atoms therein; polycyclic forms (e.g., tricyclic and "unlocked" forms such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which the ribose is replaced by a glycol unit linked to a phosphodiester bond), threose nucleic acids (TNA, in which the ribose is replaced by α-L-threofuranosyl-(3'→2')), and peptide nucleic acids (PNA, in which a 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone).

[0339] In certain embodiments, the sugar group contains one or more carbons that have the opposite stereochemical configuration as the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides that contain, for example, arabinose or L-ribose as the sugar.

[0340] In certain embodiments, a polynucleotide of the invention comprises at least one nucleoside, wherein the sugar is L-ribose, 2'-O-methyl-ribose, 2'-fluoro-ribose, arabinose, hexitol, LNA, or PNA.

[0341] Modifications in internucleoside linkages The modified nucleotide that can be incorporated into the polynucleotide of the present invention can be modified in the internucleoside bond (e.g., phosphate backbone).In this specification, the terms "phosphate" and "phosphodiester" are used interchangeably with respect to the polynucleotide backbone.The backbone phosphate group can be modified by replacing one or more of the oxygen atoms with different substituents.

[0342] Modified nucleotides can include wholesale substitution of unmodified phosphate moieties with other internucleoside linkages as described herein.Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, phosphorodiamidate, alkyl or aryl phosphonate, and phosphotriester.Phosphorodithioate has both non-linked oxygens replaced by sulfur.Phosphate linker can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene-phosphonate).

[0343] Modified nucleosides and nucleotides can include substitution of one or more non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β), or gamma (γ) position) can be substituted with sulfur (thio) and methoxy.

[0344] Substitution of one or more oxygen atoms at the α-position of the phosphate moiety (e.g., α-phosphate thiolate) provides RNA and DNA with unnatural phosphorothioate backbone linkages to provide stability (e.g., against exonucleases and endonucleases).Phosphorothioate DNA and RNA have increased nuclease resistance and therefore a longer half-life in the cellular environment.

[0345] Other internucleoside linkages that can be used in accordance with the present invention are described herein, including internucleoside linkages that do not contain a phosphorus atom. Synthesis of Polynucleotide Molecules Polynucleotide molecules for use in accordance with the present invention can be prepared according to any useful technique known in the art. The modified nucleosides and nucleotides used in the synthesis of the polynucleotide molecules disclosed herein can be prepared from readily available starting materials using the following general methods and procedures. When typical or preferred process conditions (e.g., reaction temperature, time, molar ratio of reactants, solvent, pressure, etc.) are provided, those skilled in the art will be able to optimize and develop further process conditions. Optimal reaction conditions may vary depending on the specific reactants or solvents used, but such conditions can be determined by those skilled in the art through routine optimization procedures.

[0346] The processes described herein can be monitored according to any suitable method known in the art. For example, product formation can be monitored by nuclear magnetic resonance spectroscopy (e.g., 1 H or 13 C), can be monitored by spectroscopic means such as infrared spectroscopy, spectrophotometry (e.g., UV-visible), or mass spectrometry, or by chromatography such as high performance liquid chromatography (HPLC) or thin layer chromatography.

[0347] Preparation of the polynucleotide molecules of the present invention can involve the protection and deprotection of various chemical groups. The need for protection and deprotection, and the selection of appropriate protecting groups, can be readily determined by one of ordinary skill in the art. The chemistry of protecting groups can be found, for example, in Greene et al., Protective Groups in Organic Synthesis, 2nd Edition, Wiley & Sons, 1991.

[0348] The reactions of the processes described herein can be carried out in a suitable solvent that can be easily selected by those skilled in the art of organic synthesis.Suitable solvents can be substantially non-reactive with the starting materials (reactants), intermediates, or products at the temperature at which the reaction is carried out, i.e., temperatures that can range from the freezing temperature of the solvent to the boiling temperature of the solvent.A given reaction can be carried out in one solvent or a mixture of two or more solvents.A suitable solvent for a particular reaction step can be selected depending on the particular reaction step.

[0349] Resolution of racemic mixtures of modified polynucleotides (e.g., modified mRNA molecules) can be carried out by any of a number of methods known in the art. Exemplary methods include fractional recrystallization using a "chiral resolving acid," which is an optically active, salt-forming organic acid. Suitable resolving agents for fractional recrystallization are optically active acids, such as tartaric acid, diacetyltartaric acid, dibenzoyltartaric acid, mandelic acid, malic acid, lactic acid, or the D and L forms of various optically active camphorsulfonic acids. Resolution of racemic mixtures can also be carried out by elution on a column packed with an optically active resolving agent (e.g., dinitrobenzoylphenylglycine). Suitable elution solvent compositions can be determined by those skilled in the art.

[0350] Synthesis of modified polynucleotides Polynucleotides for use in accordance with the present disclosure may be prepared according to any available technique, including, but not limited to, chemical synthesis, enzymatic synthesis (commonly referred to as in vitro transcription), and enzymatic or chemical cleavage of longer precursors. Modified nucleosides and nucleotides can be prepared by methods known in the art, for example, according to the synthetic methods described in Ogata et al., J. Org. Chem., Vol. 74, pp. 2585-2588, 2009; Purmal et al., Nucl. Acids Res., Vol. 22, No. 1, pp. 72-78, 1994; Fukuhara et al., Biochemistry, Vol. 1, No. 4, pp. 563-568, 1962; and Xu et al., Tetrahedron, Vol. 48, No. 9, pp. 1729-1740, 1992. Additional methods for synthesizing RNA are known in the art (see, e.g., Gait, MJ (ed.), Oligonucleotide synthesis: a practical approach, Oxford (Oxfordshire), Washington, DC: IRL Press, 1984; and Herdewijn, P. (ed.), Oligonucleotide synthesis: methods and applications, Methods in Molecular Biology, Vol. 288 (Clifton, NJ), Totowa, NJ: Humana Press, 2005).

[0351] In certain embodiments, a method for generating a polynucleotide encoding a polypeptide of interest comprises contacting a cDNA encoding a protein of interest with an RNA polymerase in the presence of a nucleotide triphosphate mix, wherein, for example, at least 90% (e.g., at least 95% or 100%) of the uracils are 5-methoxyuracil. The present invention also provides polynucleotides generated by such a method. The method may include additional steps such as capping (e.g., adding a 5' cap structure), adding a poly-A region, and / or formulating into a pharmaceutical composition. The RNA polymerase may be T7 RNA polymerase. The in vitro transcription reaction mixture may include a transcription buffer (e.g., 400 mM Tris-HCl pH 8.0, or equivalent), and may include MgCl2, DTT, and / or spermidine or equivalent. An RNase inhibitor may be included. The remaining reaction volume generally consists of dH2O. The reaction may be incubated at about 37°C (such as 30-40°C) for 3-5 hours (such as 3.5-4.5 hours, or about 4 hours). The polynucleotides may then be purified using DNase and a purification kit.

[0352] For example, the modified polynucleotides described herein can be prepared using methods known to those skilled in the art of polynucleotide synthesis. In certain embodiments, the present disclosure provides a method of synthesizing a pharmaceutical polynucleotide, comprising: a) providing a complementary deoxyribonucleic acid (cDNA) encoding a pharmaceutical protein of interest; b) selecting a nucleotide; c) contacting the provided cDNA and selected nucleotides with an RNA polymerase under conditions such that a pharmaceutical polynucleotide is synthesized.

[0353] In a further embodiment, the pharmaceutical polynucleotide is a ribonucleic acid (RNA). In yet other aspects of the present disclosure, modified polynucleotides may be prepared using solid phase synthesis methods.

[0354] In one embodiment, a polynucleotide of the invention is generated by a) synthesizing a polynucleotide comprising: i) a coding region; ii) a 5'-UTR, optionally containing a Kozak sequence; iii) a 3'-UTR; iv) at least one 5'-cap structure; and v) a poly-A region; b) incorporation of a 3'-azide-containing nucleoside; and c) attachment of a 3'-stabilizing region containing an alkyne functionality (e.g., a cyclooctyne-containing functionality) at the 5' terminus.

[0355] Preventing or reducing the innate cellular immune response The term "innate immune response" generally includes the cellular response to exogenous single-stranded polynucleotides derived from viruses or bacteria, which includes cytokine expression and release, particularly interferon, and the induction of cell death. Protein synthesis is also reduced during innate cellular immune responses. While it would be advantageous to eliminate the intracellular innate immune response triggered by the introduction of exogenous polynucleotides, the present disclosure provides modified polynucleotides, such as mRNAs, that substantially reduce immune responses, including interferon signaling, without completely eliminating such responses. In certain embodiments, the immune response is reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or more than 99.9% compared to the immune response induced by a corresponding unmodified polynucleotide. Such reduction can be measured by the expression or activity level of type 1 interferon or the expression of interferon-regulated genes, such as Toll-like receptors (e.g., TLR7 and TLR8). The reduction or lack of induction of an innate immune response can also be measured by a decrease in cell death following one or more administrations of the modified RNA to a cell population; for example, cell death is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or greater than 95% less than the frequency of cell death observed with a corresponding unmodified polynucleotide. Furthermore, cell death can affect less than 50%, 40%, 30%, 20%, 10%, 5%, 1%, 0.1%, 0.01%, or less than 0.01% of cells contacted with the modified polynucleotide.

[0356] In certain embodiments, modified polynucleotides, including mRNA molecules, are modified so as to not induce, or only minimally induce, an immune response by a recipient cell or organism. This avoidance or prevention of elicitation or activation of an immune response is a novel feature of the modified polynucleotides of the present invention.

[0357] The present disclosure provides for the repeated introduction (e.g., transfection) of modified polynucleotides into target cell populations, for example, in vitro, ex vivo, or in vivo. The step of contacting the cell population can be repeated one or more times (e.g., two, three, four, five, six, or more times). In some embodiments, the step of contacting the cell population with the modified polynucleotide is repeated a sufficient number of times to achieve a predetermined efficiency of protein translation within the cell population. Given the reduced cytotoxicity of the target cell population provided by the nucleotide modification, such repeated transfection can be achieved in a wide variety of cell types in vitro and / or in vivo.

[0358] Methods for determining the effectiveness of modified polynucleotides relative to wild-type polynucleotides can include measuring and analyzing one or more cytokines whose expression is induced by administration of the exogenous polynucleotides of the present invention. These values ​​are compared to standard metrics, such as administration of an unmodified polynucleotide, or cytokine response, or polyIC (PolyIC), R-848, etc. One example of a standard metric is measuring the ratio of the level or amount of the encoded polypeptide (protein) produced in a cell, tissue, or organism to the level or amount of one or more cytokines (or groups) whose expression is induced in a cell, tissue, or organism as a result of administration of or contact with the modified polynucleotide. Such ratios are referred to herein as protein:cytokine ratios or "PC" ratios. The higher the PC ratio, the more effective the modified polynucleotide (the polynucleotide encoding the measured protein) is. Preferred PC ratios for cytokines of the present invention can be greater than 1, greater than 10, greater than 100, greater than 1000, greater than 10,000, or even more. Modified polynucleotides having a higher PC ratio than modified polynucleotides of a different or unmodified construct are preferred. The PC ratio can also be determined by the percent modification present in the polynucleotide. For example, protein production as a function of cytokine (or risk) or cytokine profile can be determined, normalizing to 100% modified polynucleotides.

[0359] Polypeptides The polypeptide of interest expressed by the polynucleotides of the present invention can be any polypeptide known in the art, for example, those described in U.S. Patent Application Publication Nos. 2013 / 0259924 and 2013 / 0259923, International Publication Nos. WO 2013 / 151663, WO 2013 / 151669, WO 2013 / 151670, WO 2013 / 151664, WO 2013 / 151665, WO 2013 / 151736, U.S. Provisional Patent Application Nos. 61 / 618,862, 61 / 681,645, and 61 / 618,873. , Specification No. 61 / 681,650, Specification No. 61 / 618,878, Specification No. 61 / 681,654, Specification No. 61 / 618,885, Specification No. 61 / 681 ,658 specification, 61 / 618,911 specification, 61 / 681,667 specification, 61 / 618,922 specification, 61 / 681,675 specification, The polypeptides may be selected from those disclosed in US Pat. Nos. 61 / 618,935, 61 / 681,687, 61 / 618,945, 61 / 681,696, 61 / 618,953, and 61 / 681,704, each of which is incorporated herein by reference.

[0360] Erythropoietin (EPO) and granulocyte colony-stimulating factor (GCSF) are exemplary polypeptides. Polypeptide variants Also provided are polynucleotides encoding variant polypeptides that have a certain identity with a reference polypeptide sequence.The term "identity" as known in the art refers to the relationship between the sequences of two or more peptides, determined by comparing the sequences.In the art, "identity" also means the degree of sequence relatedness between peptides, determined by the number of matches between strings of two or more amino acid residues."Identity" is measured by the percentage of identical matches between the smaller sequences of two or more sequences, including gap alignment (if any), which is handled by a specific mathematical model or computer program (i.e., "algorithm").The identity of related peptides can be easily calculated by known methods. Such methods include, but are not limited to, those described in "Computational Molecular Biology," Lesk, AM (ed.), Oxford University Press, New York, 1988; "Biocomputing: Informatics and Genome Projects," Smith, DW (ed.), Academic Press, New York, 1993; "Computer Analysis of Sequence Data," "Sequence Analysis in Molecular Biology," by von Heinje, G., Academic Press, 1987; "Sequence Analysis Primers," by Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and those described in Carillo et al., SIAM J. Applied Mathematics, Vol. 48, p. 1073, 1988.

[0361] In some embodiments, a polypeptide variant has the same or similar activity as a reference polypeptide. Alternatively, a variant has altered activity (e.g., increased or decreased) compared to the reference polypeptide. Generally, a variant of a particular polynucleotide or polypeptide of the present disclosure will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the corresponding particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art.

[0362] As will be recognized by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered within the scope of the present disclosure. For example, any protein fragment of a reference protein (meaning a polypeptide sequence that is at least one amino acid residue shorter than the reference polypeptide sequence but otherwise identical) having a length of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 amino acids is provided herein. In another example, any protein comprising a section of about 20, about 30, about 40, about 50, or about 100 amino acids that is about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 100% identical to any of the sequences described herein can be used in accordance with the present disclosure. In certain embodiments, the protein sequence used in accordance with the present disclosure includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations as shown in any of the sequences provided or referenced herein.

[0363] Polynucleotide Library Also provided are polynucleotide libraries comprising nucleoside modifications, wherein the polynucleotides contain first polynucleotide sequences that individually encode polypeptides, such as antibodies, protein-binding partners, scaffold proteins, and other polypeptides known in the art. Preferably, the polynucleotides are mRNA in a form suitable for direct introduction into a target cell host, which then synthesizes the encoded polypeptides.

[0364] In certain embodiments, multiple variants of a protein, each containing a different amino acid modification, are generated and tested to determine the best variant with respect to biophysical properties such as pharmacokinetics, stability, biocompatibility, and / or biological activity, or expression levels. Such libraries can be used in a variety of applications, including: 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9, or 10 9 The present invention may contain more than one possible variant, including substitution, deletion, and insertion of one or more residues.

[0365] Polypeptide-Polynucleotide Complexes Suitable protein translation involves the physical aggregation of several polypeptides and polynucleotides linked to mRNA.The present disclosure provides a protein-polynucleotide complex that contains a translatable mRNA with one or more nucleoside modifications (e.g., at least two different nucleoside modifications) and one or more polypeptides linked to mRNA.Generally, the protein is provided in an amount that is effective to prevent or reduce the innate immune response of the cell into which the complex is introduced.

[0366] Uses of Modified Polynucleotides therapeutic agent The modified polynucleotides described herein can be used as therapeutic agents. For example, the modified polynucleotides described herein can be administered to animals or subjects, where the modified polynucleotides are translated in vivo to produce therapeutic peptides in the animals or subjects. Thus, provided herein are mRNAs, compositions (such as pharmaceutical compositions), methods, kits, and reagents for the treatment or prevention of diseases or pathologies in humans and other mammals. The active therapeutic agents of the present disclosure include modified polynucleotides, cells containing modified polynucleotides or polypeptides translated from the modified polynucleotides, polypeptides translated from the modified polynucleotides, cells contacted with modified polynucleotides or cells containing polypeptides translated from the modified polynucleotides, tissues containing cells containing modified polynucleotides, and organs containing tissues containing cells containing modified polynucleotides.

[0367] A method is provided for using the modified polynucleotides described herein to induce the translation of synthetic or recombinant polynucleotides to produce polypeptides in a cell population. Such translation can be performed in vivo, ex vivo, in culture, or in vitro. The cell population is contacted with an effective amount of a composition containing a polynucleotide with at least one nucleoside modification and a translatable region encoding the polypeptide. The cell population is contacted under conditions such that the polynucleotide is localized in one or more cells of the cell population and a recombinant polypeptide is translated from the polynucleotide in the cell.

[0368] The effective amount of the composition is provided based, at least in part, on the target tissue, target cell type, means of administration, physical characteristics of the polynucleotide (e.g., size and degree of modified nucleosides), and other determinants. Generally, the effective amount of the composition results in efficient protein production in cells, preferably more efficient than a composition containing a corresponding unmodified polynucleotide. Increased efficiency can be demonstrated by increased cell transfection (i.e., the percentage of cells transformed with the polynucleotide), increased protein translation from the polynucleotide, decreased polynucleotide degradation (e.g., as demonstrated by an increased duration of protein translation from the modified polynucleotide), or a decreased innate immune response of the host cell or improved therapeutic utility.

[0369] An embodiment of the present disclosure relates to a method for inducing in vivo translation of a recombinant polypeptide in a mammalian subject in need thereof. In this method, an effective amount of a composition containing a polynucleotide having at least one nucleoside modification and a translatable region encoding the polypeptide is administered to the subject using a delivery method described herein. The polynucleotide is provided in an amount and under other conditions such that the polynucleotide is localized in one or more cells of the subject and the recombinant polypeptide is translated from the polynucleotide in the cells. The cells in which the polynucleotide is localized, or the tissue in which the cells reside, can be targeted by one or more polynucleotide administrations.

[0370] Another aspect of the present disclosure relates to the transplantation of cells containing modified polynucleotides into mammalian subjects. Administration of cells to mammalian subjects, such as local transplantation (e.g., topical or subcutaneous administration), organ delivery, or systemic injection (e.g., intravenous injection or inhalation), as well as the formulation of cells in a pharmaceutically acceptable carrier, is well known to those skilled in the art. Compositions containing modified polynucleotides are formulated for intramuscular, intraarterial, intraperitoneal, intravenous, intranasal, subcutaneous, endoscopic, transdermal, or intrathecal administration. In some embodiments, the compositions are formulated for sustained release.

[0371] In certain embodiments, the subject to whom the therapeutic agent is administered is suffering from or at risk of developing a disease, disorder, or adverse condition. Clinical diagnosis, biomarker level, genome-wide association study (GWAS), Methods for identifying, diagnosing, and classifying subjects are provided, which may include a genomic DNA analysis (e.g., a genomic DNA analysis study), and other methods known in the art.

[0372] In certain embodiments, the administered modified polynucleotide directs the production of one or more recombinant polypeptides that confer a functional activity substantially absent in the cell in which the recombinant polypeptide is translated. For example, the missing functional activity can be a naturally occurring enzymatic, structural, or gene regulatory activity.

[0373] In other embodiments, the administered modified polynucleotide directs the production of one or more recombinant polypeptides that replace a polypeptide (or polypeptides) that is substantially absent in the cell in which the recombinant polypeptide is translated. Such absence may be due to a genetic mutation in the encoding gene or its regulatory pathway. In other embodiments, the administered modified polynucleotide directs the production of one or more recombinant polypeptides to supplement the amount of the polypeptide (or polypeptides) present in the cell in which the recombinant polypeptide is translated. Alternatively, the recombinant polypeptide functions to antagonize the activity of an endogenous protein present on the surface of the cell or secreted from the cell. Typically, the endogenous protein activity is harmful to the subject, for example, due to a mutation in the endogenous protein that results in altered activity or localization. Furthermore, the recombinant polypeptide directly or indirectly antagonizes the activity of a biological moiety present on the surface of the cell or secreted from the cell. Examples of antagonized biological moieties include lipids (e.g., cholesterol), lipoproteins (e.g., low-density lipoprotein), polynucleotides, carbohydrates, or small molecule toxins.

[0374] The recombinant proteins described herein are engineered for localization within a specific compartment within the cell, perhaps the nucleus, or for secretion from the cell or translocation to the plasma membrane of the cell.

[0375] As described herein, a useful feature of the modified polynucleotides of the present disclosure is their ability to reduce, avoid, prevent, or eliminate a cellular innate immune response to an exogenous polynucleotide. A method for titrating, reducing, or eliminating an immune response in a cell or a population of cells is provided. In one embodiment, cells are contacted with a first composition containing a first dose of a first exogenous polynucleotide comprising a translatable region and at least one nucleoside modification, and the level of the cellular innate immune response to the first exogenous polynucleotide is determined. Subsequently, the cells are contacted with a second composition containing a second dose of the first exogenous polynucleotide, where the second dose contains a reduced amount of the first exogenous polynucleotide compared to the first dose. Alternatively, the cells are contacted with a first dose of a second exogenous polynucleotide. The second exogenous polynucleotide may contain one or more modified nucleosides, which may be the same or different from those of the first exogenous polynucleotide, or the second exogenous polynucleotide may not contain modified nucleosides. The step of contacting the cells with the first composition and / or the second composition can be repeated one or more times. Further, the efficiency of protein production (e.g., protein translation) in the cells can be optionally determined, and the cells can be re-transfected with the first and / or second composition until a target protein production efficiency is achieved.

[0376] Drugs for treating diseases and conditions Methods are provided for treating or preventing symptoms of diseases characterized by missing or abnormal protein activity by replacing missing or abnormal protein activity or eliminating the abnormal protein activity. The rapid onset of protein production after introduction of the modified mRNA compared to viral DNA vectors makes the compounds of the present disclosure particularly advantageous in treating acute diseases such as sepsis, stroke, and myocardial infarction. Furthermore, the lack of transcriptional regulation of the modified mRNA of the present disclosure is advantageous in that precise titration of protein production can be achieved. Many diseases are characterized by missing (or substantially reduced to the point where proper protein function does not occur) protein activity. Such proteins may be absent, present in very low amounts, or essentially non-functional. The present disclosure provides methods for treating such conditions or diseases in a subject by introducing a polynucleotide- or cell-based therapeutic agent containing the modified polynucleotide provided herein, wherein the modified polynucleotide encodes a protein that replaces the missing protein activity in the subject's target cells.

[0377] Diseases characterized by dysfunctional or aberrant protein activity include, but are not limited to, cancer and other proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular diseases, and metabolic diseases. The present disclosure provides methods for treating such conditions or diseases in a subject by introducing a polynucleotide- or cell-based therapeutic containing a modified polynucleotide provided herein, wherein the modified polynucleotide encodes a protein that antagonizes or eliminates the aberrant protein activity present in the subject's cells.

[0378] Specific examples of dysfunctional proteins are missense or nonsense mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which produce dysfunctional or non-functional protein variants of the CFTR protein, respectively, which cause cystic fibrosis.

[0379] Therefore, provided is a method for treating cystic fibrosis in a mammalian subject by contacting the cells of the subject with a modified polynucleotide having a translatable region encoding a functional CFTR polypeptide under conditions that an effective amount of CTFR polypeptide is present in the cells.Preferred target cells are epithelial cells such as lung cells, and the administration method is determined by considering the target tissue; that is, for pulmonary delivery, the polynucleotide is formulated for administration by inhalation.Therefore, in certain embodiments, the target polypeptide encoded by the polynucleotide of the present invention is CTFR polypeptide, and the polynucleotide or pharmaceutical composition of the present invention is used to treat cystic fibrosis.

[0380] In another embodiment, the present disclosure provides a method for treating dyslipidemia in a subject by introducing a modified polynucleotide molecule encoding sortilin (a protein recently characterized through genomic studies) into a cell population of the subject, thereby improving the subject's dyslipidemia. The SORT1 gene encodes a trans-Golgi network (TGN) transmembrane protein (called sortilin). Genetic studies have shown that one in five individuals carry a single nucleotide polymorphism, rs12740374, at the 1p13 locus of the SORT1 gene, which predisposes the individual to low levels of low-density lipoprotein (LDL) and very-low-density lipoprotein (VLDL). Each copy of the minor allele, present in approximately 30% of individuals, alters LDL cholesterol by 8 mg / dL, while two copies of the minor allele, present in approximately 5% of the population, reduce LDL cholesterol by 16 mg / dL. Carriers of the minor allele have also been shown to have a 40% lower risk of myocardial infarction. Functional in vivo studies in mice have shown that overexpression of SORT1 in mouse liver tissue resulted in significantly lower LDL-cholesterol levels (as much as 80% lower), and silencing SORT1 increased LDL cholesterol by approximately 200% (Musunuru K et al., "From noncoding variants to phenotypes via SORT1 at the 1p13 cholesterol locus," Nature, 2010, vol. 466, pp. 714-721). Thus, in a specific embodiment, the polypeptide of interest encoded by the mRNA of the present invention is sortilin, and the polynucleotide or pharmaceutical composition of the present invention is for use in treating dyslipidemia.

[0381] In certain embodiments, the polypeptide of interest encoded by the polynucleotide of the invention is granulocyte colony-stimulating factor (GCSF), and the polynucleotide or pharmaceutical composition of the invention is for use in treating a neurological disease such as cerebral ischemia, or for treating neutropenia, or for use in increasing the number of hematopoietic stem cells in the blood (e.g., prior to collection by leukapheresis for use in hematopoietic stem cell transplantation).

[0382] In certain embodiments, the polypeptide of interest encoded by the polynucleotide of the invention is erythropoietin (EPO), and the polynucleotide or pharmaceutical composition of the invention is for use in treating anemia, inflammatory bowel disease (such as Crohn's disease and / or ulcerative colitis), or myelodysplasia.

[0383] Methods for cellular polynucleotide delivery The disclosed method facilitates polynucleotide delivery to a cell population in vivo, ex vivo, or in culture. For example, a cell culture containing a plurality of host cells (e.g., eukaryotic cells such as yeast or mammalian cells) is contacted with a composition containing a modified polynucleotide having at least one nucleoside modification and, optionally, a translatable region. The composition generally also contains a transfection reagent or other compound that increases the efficiency of modified polynucleotide uptake into host cells. The modified polynucleotide exhibits improved retention in a cell population compared to the corresponding unmodified polynucleotide. The retention of the modified polynucleotide is higher than that of the unmodified polynucleotide. In certain embodiments, it is at least about 50%, 75%, 90%, 95%, 100%, 150%, 200%, or more than 200% higher than that of the unmodified polynucleotide. Such retention benefits can be achieved by a single transfection with the modified polynucleotide or can be obtained after repeated transfections.

[0384] In some embodiments, the modified polynucleotide is delivered to a target cell population together with one or more additional polynucleotides. Such delivery may be simultaneous, or the modified polynucleotide is delivered before the delivery of one or more additional polynucleotides. The one or more additional polynucleotides may be modified or unmodified polynucleotides. It is understood that the initial presence of the modified polynucleotide does not substantially induce the innate immune response of the cell population, and furthermore, the innate immune response is not activated by the subsequent presence of the unmodified polynucleotide. In this regard, if the protein desired to be present in the target cell population is translated from the unmodified polynucleotide, the modified polynucleotide itself may not contain a translatable region.

[0385] Targeting section In embodiments of the present disclosure, modified polynucleotides are provided to express protein binding partners or receptors on the surface of cells that function to target cells to specific tissue spaces or interact with specific moieties, either in vivo or in vitro. Suitable protein binding partners include antibodies and functional fragments thereof, scaffold proteins, or peptides. Furthermore, modified polynucleotides can be used to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties.

[0386] Permanent gene expression silencing A method for epigenetically silencing gene expression in a mammalian subject, the method comprising a polynucleotide whose translatable region encodes one or more polypeptides capable of directing sequence-specific histone H3 methylation to initiate heterochromatin formation and reduce gene transcription around a specific gene for silencing the gene, for example, gain-of-function mutations in the Janus kinase 2 gene are involved in a family of myeloproliferative disorders.

[0387] lipid nanoparticles In some embodiments, the polynucleotides of the present invention are encapsulated in lipid nanoparticles. Thus, in some aspects, the present invention provides nanoparticle compositions comprising the polynucleotides of the present invention encapsulated in lipid nanoparticles. Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, lipid vesicles, and lipoplexes. In some embodiments, the nanoparticle compositions are vesicles comprising one or more lipid bilayers. In certain embodiments, the nanoparticle compositions comprise two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers can be functionalized and / or crosslinked to each other. The lipid bilayers can comprise one or more ligands, proteins, or channels.

[0388] Cationic / Ionic Lipids The nanoparticle compositions of the present invention contain a lipid component in addition to the polynucleotide of the present invention. The lipid component of the nanoparticle composition may include one or more lipids. For example, the nanoparticle composition may include one or more cationic and / or ionic lipids. Examples of cationic and / or ionic lipids include 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminepropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[ 1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminepropane (DODMA), 2-( {8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), 2-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2R)), and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)). In addition, the cationic lipid may also be a lipid containing a cyclic amine.

[0389] PEG lipids The lipid component of the nanoparticle compositions of the present invention can include one or more PEG or PEG-modified lipids. Such species are alternatively referred to as PEGylated lipids. PEG lipids are lipids modified with polyethylene glycol.

[0390] Lipid component can comprise one or more PEG lipids.PEG lipids can be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.For example, PEG lipids can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipids.

[0391] structural lipids The lipid component of the nanoparticle composition can include one or more structural lipids (eg, cholesterol, fecosterol, sitosterol, campesterol, stigmasterol, brassicasterol, ergosterol, tomatidine, tomatine, ursolic acid, or α-tocopherol).

[0392] phospholipids The lipid component of the nanoparticle composition may comprise one or more phospholipids, such as one or more (poly)unsaturated lipids. Generally, such lipids may comprise a phospholipid portion and one or more fatty acid portions. For example, a phospholipid may be represented by the formula:

[0393] [ka] (In the formula, R p represents the phospholipid moiety, and R 1p and R 2prepresents a fatty acid moiety with or without saturation, which may be the same or different. The phospholipid moiety may be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, α-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Non-naturally occurring species are also contemplated, including naturally occurring species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes.

[0394] In certain embodiments, the nanoparticle composition may include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), or both DSPC and DOPE. Phospholipids useful in the compositions and methods of the present invention include DSPC, DOPE, 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DMPC). glycero-3-phosphocholine), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerin) sodium salt (DOPG), and sphingomyelin.

[0395] Other ingredients The nanoparticle composition may include one or more ingredients in addition to those described in the previous section. For example, the nanoparticle composition may include one or more hydrophobic small molecules, such as vitamins (e.g., vitamin A or vitamin E) or sterols.

[0396] The nanoparticle composition may also include one or more permeability enhancer molecules, carbohydrates, polymers, therapeutic agents, surface altering agents, or other components. Permeability enhancer molecules may be, for example, molecules described in U.S. Patent Application Publication No. 2005 / 0222064. Carbohydrates may include monosaccharides (e.g., glucose) and polysaccharides (e.g., glycogen and its derivatives and analogs).

[0397] Polymers may be included in the nanoparticle composition and / or used to encapsulate or partially encapsulate the nanoparticle composition. The polymer may be biodegradable and / or biocompatible. The polymer may be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. For example, polymers may be poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic-co-glycolic acid) (PLGA), poly(L-lactic-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lact ...).L-lactide), alkyl polycyanoacrylates, polyurethanes, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers , cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polymers of acrylic acid such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamers, polyoxamines, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), and trimethylene carbonate.

[0398] Therapeutic agents include, but are not limited to, cytotoxic agents, chemotherapeutic agents, and other therapeutic agents. Cytotoxic agents include, for example, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracenedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, rachelmycin, and analogs thereof. Radioactive ions may also be used as therapeutic agents, including, for example, radioactive iodine, strontium, phosphorus, palladium, cesium, iridium, cobalt, yttrium, samarium, and praseodymium. Other therapeutic agents may include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, and 5-fluorouracil, and dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, rachelmycin, melphalan, carmustine, lomustine, cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichloroamineplatinum(II) (DDP), and cisplatin), anthracyclines (e.g., daunorubicin and doxorubicin), antibiotics (e.g., dactinomycin, bleomycin, mithramycin, and anthramycin), and antimitotic agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).

[0399] Surface modifiers include, but are not limited to, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytic agents (e.g., acetylcysteine, artemisia, bromelain, papain, clerodendrum, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin β4, dornase alfa, neltenexin, and erdosteine), and DNase (e.g., rhDNase). Surface modifiers can be disposed within the nanoparticles and / or on the surface of the nanoparticle composition (e.g., by coating, adsorption, covalent bonding, or other process).

[0400] In addition to these components, the nanoparticle composition of the present invention can contain any substance useful in pharmaceutical compositions.For example, the nanoparticle composition can contain one or more pharmaceutically acceptable excipients or auxiliary components, such as, but not limited to, one or more solvents, dispersion media, diluents, dispersion aids, suspension aids, granulation aids, disintegrants, fillers, lubricants, liquid vehicles, binders, surfactants, isotonicity agents, thickeners or emulsifiers, buffers, lubricants, oils, preservatives, and other species.Excipients such as waxes, butters, colorants, coating agents, flavors, and fragrances can also be included. Pharmaceutically acceptable excipients are well known in the art (see, e.g., Remington's The Science and Practice of Pharmacy, 21st ed., A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[0401] Examples of diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and / or combinations thereof. Granulating and dispersing agents may be selected from the non-limiting list consisting of potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, quaternary ammonium compounds, and / or combinations thereof.

[0402] Surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and VEEGUM® [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymers, and carboxyvinyl polymers), carrageenan, cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose). , methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [TWEEN® 20], polyoxyethylene sorbitan [TWEEN® 60], polyoxyethylene sorbitan monooleate [TWEEN® 80], sorbitan monopalmitate [SPAN® 40], sorbitan monostearate [SPAN® 60], sorbitan tristearate [SPAN® 65], ], glyceryl monooleate, sorbitan monooleate [SPAN® 80]), polyoxyethylene esters (e.g., polyoxyethylene monostearate [MYRJ® 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and SOLUTOL®), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers,(e.g., polyoxyethylene lauryl ether [BRIJ® 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, PLURONIC® F 68, POLOXAMER® 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and / or combinations thereof.

[0403] The binder may be starch (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, isapol husk mucilage, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (VEEGUM®), and larch arabinogalactan); alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohol; and combinations thereof, or any other suitable binder.

[0404] Preservatives include, but are not limited to, antioxidants, chelating agents, antibacterial preservatives, antifungal preservatives, alcoholic preservatives, acidic preservatives, and / or other preservatives. Antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and / or trisodium edetate. Antibacterial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal. Antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Examples of alcoholic preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, benzyl alcohol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoates, and / or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and / or phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopheryl acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, GLYDANT PLUS®, PHENONIP®, methylparaben, GERMALL® 115, GERMABEN® II, NEOLONE™, KATHON™, and / or EUXYL®.

[0405] Examples of buffering agents include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, dibasic potassium phosphate, potassium mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium mixtures, tromethamine, amino-sulfonic acid buffers (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free distilled water, isotonic saline, Ringer's solution, ethyl alcohol, and / or combinations thereof. The lubricant may be selected from the non-limiting group consisting of magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0406] Examples of oils include, but are not limited to, almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cucumber, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange rough palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, camellia, vetiver, walnut, and wheat germ oils as well as butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, simethicone, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and / or combinations thereof.

[0407] composition The nanoparticle composition may comprise a polynucleotide of the invention, a cationic / ionic lipid, a phospholipid (an unsaturated lipid such as DOPE), a PEG lipid, and a structured lipid, as follows:

[0408] In some embodiments, the lipid component comprises a cationic / ionic lipid, a phospholipid, a PEG lipid, and a structured lipid. The lipid component may comprise about 35 mol% to about 45 mol% of a cationic / ionic lipid, about 10 mol% to about 20 mol% of a phospholipid, about 38.5 mol% to about 48.5 mol% of a structured lipid, and about 1.5 mol% of a PEG lipid, provided that the total mol% does not exceed 100%. For example, the lipid component may comprise about 40 mol% of a cationic / ionic lipid, about 20 mol% of a phospholipid, about 38.5 mol% of a structured lipid, and about 1.5 mol% of a PEG lipid. In some embodiments, the phospholipid may be DOPE, and / or the structured lipid may be cholesterol.

[0409] In some embodiments, the lipid component may comprise about 40 mol% cationic / ionic lipid, about 15 mol% phospholipid, about 43.5 mol% structural lipid, and about 1.5 mol% PEG lipid. In some cases, the phospholipid may be DOPE. In other embodiments, the lipid may be DSPC. In certain embodiments, the structural lipid may be cholesterol.

[0410] In other embodiments, the lipid component may comprise about 45 mol% to about 55 mol% cationic / ionic lipid, about 15 mol% to about 25 mol% phospholipid, about 23.5 mol% to about 33.5 mol% structured lipid, and about 1.5 mol% PEG lipid, provided that the total mol% does not exceed 100%. For example, the lipid component may comprise about 50 mol% cationic / ionic lipid, about 20 mol% phospholipid, about 28.5 mol% structured lipid, and about 1.5 mol% PEG lipid. In certain embodiments, the phospholipid may be DOPE. In other cases, the phospholipid may be DSPC. In certain embodiments, the structured lipid may be cholesterol.

[0411] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed to deliver polynucleotides of the present invention to specific cells, tissues, organs, or systems or groups thereof in the mammalian body (such as the renal system). The physiochemical properties of nanoparticle compositions can be modified to enhance selectivity for specific bodily targets. For example, particle size can be adjusted based on the size of fenestrations in various organs. The polynucleotides of the present invention included in nanoparticle compositions can also depend on one or more desired delivery targets. For example, polynucleotides of the present invention can be selected for a particular indication, condition, disease, or disorder and / or for specific cells, tissues, organs, or systems or groups thereof (e.g., localized or specific delivery). Nanoparticle compositions can contain one or more polynucleotides of the present invention encoding one or more polypeptides of interest.

[0412] The amount of polynucleotides of the present invention in a nanoparticle composition can depend on the size, sequence, and other characteristics of the polynucleotides of the present invention. The amount of polynucleotides of the present invention in a nanoparticle composition can also depend on the size, composition, desired target, and other characteristics of the nanoparticle composition. The relative amounts of polynucleotides of the present invention and other components (e.g., lipids) can also vary. In certain embodiments, the wt / wt ratio of lipid components to polynucleotides of the present invention in a nanoparticle composition can be about 5:1 to about 50:1, e.g., 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, and 50:1. For example, the wt / wt ratio of lipid components to polynucleotides of the present invention can be about 10:1 to about 40:1. The amount of polynucleotide of the invention in the nanoparticle composition can be measured, for example, using absorption spectroscopy (eg, UV-visible spectroscopy).

[0413] In certain embodiments, one or more polynucleotides of the present invention, lipids, and their amounts can be selected to provide a specific N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in a polynucleotide of the present invention. Generally, lower N:P ratios are preferred. One or more polynucleotides of the present invention, lipids, and their amounts can be selected to provide an N:P ratio of about 2:1 to about 8:1, e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, and 8:1. In certain embodiments, the N:P ratio can be about 2:1 to about 5:1. In preferred embodiments, the N:P ratio can be about 4:1. In other embodiments, the N:P ratio can be about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1.

[0414] physical properties The properties of a nanoparticle composition depend on its components and may also vary depending on the method and conditions of preparation of the nanoparticle composition.

[0415] The average size of the nanoparticle composition of the present invention can be several tens of nanometers to several hundreds of nanometers, for example, about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In certain embodiments, the average size of the nanoparticle composition can be about 80 nm to about 120 nm, about 80 nm to about 110 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, about 90 nm to about 120 nm, about 90 nm to about 110 nm, about 90 nm to about 100 nm, about 100 nm to about 120 nm, or about 110 nm to about 120 nm. In certain embodiments, the average size can be about 90 nm. In other specific embodiments, the average size can be about 100 nm.

[0416] The nanoparticle compositions of the present invention can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow particle size distribution. The nanoparticle compositions of the present invention can have a polydispersity index of about 0 to about 0.18, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, or 0.18. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.13 to about 0.17.

[0417] The zeta potential of a nanoparticle composition can be used to indicate the kinetic potential of the composition. Nanoparticle compositions having a relatively low charge (whether positive or negative) are generally desirable because more highly charged species may undesirably interact with cells, tissues, and other elements in the body. In certain embodiments, the zeta potential of the nanoparticle composition of the present invention can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0418] The encapsulation efficiency of the polynucleotide of the present invention represents the amount of the polynucleotide of the present invention encapsulated or otherwise associated with the nanoparticle composition after preparation, compared to the initial amount provided. A high encapsulation efficiency is desirable (e.g., nearly 100%). In the nanoparticle compositions of the present invention, the encapsulation efficiency of the polynucleotide of the present invention can be at least 50%, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.

[0419] The nanoparticle composition of the present invention can optionally comprise one or more coatings.For example, the nanoparticle composition can be formulated in the capsule, film or tablet with coating.The capsule, film or tablet that comprises the composition of the present invention can have any useful size, tensile strength, hardness or density.

[0420] Pharmaceutical Composition The present disclosure provides modified polynucleotides capable of expressing proteins. Pharmaceutical compositions may optionally contain one or more additional therapeutically active substances. According to certain embodiments, methods are provided for administering pharmaceutical compositions containing modified polynucleotides encoding one or more proteins to be delivered to a subject in need thereof. In certain embodiments, the compositions are administered to humans. For purposes of this disclosure, the phrase "active ingredient" generally refers to a protein, protein-encoded, or protein-containing complex as described herein. The nanoparticle compositions of the present invention may also be formulated, in whole or in part, as pharmaceutical compositions. The pharmaceutical compositions of the present invention may contain one or more nanoparticle compositions. For example, the pharmaceutical composition may contain one or more nanoparticle compositions containing one or more different polynucleotides.

[0421] Although the description of pharmaceutical compositions provided herein primarily relates to pharmaceutical compositions suitable for administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to all kinds of animals.The modification of pharmaceutical compositions suitable for administration to humans to make the compositions suitable for administration to various animals is well understood, and an ordinary veterinary pharmacologist can design and / or implement such modifications, if any, using only routine experimentation.The subjects to which the pharmaceutical compositions are intended to be administered include, but are not limited to, humans and / or other primates; mammals, including commercially valuable mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially valuable birds such as chickens, ducks, geese, and / or turkeys.

[0422] The formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the field of pharmacology. Generally, such preparation methods include combining the active ingredient with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desired, shaping and / or packaging the product into a desired single or multiple dosage unit.

[0423] The pharmaceutical compositions of the present disclosure can be prepared, packaged, and / or sold in bulk as a single unit dose and / or a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of active ingredient. The amount of active ingredient is generally equal to the dosage of the active ingredient that can be administered to a subject, and / or a convenient fraction of such a dosage, for example, one-half or one-third of such a dosage.

[0424] The relative amounts of the active ingredient, pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is administered. By way of example, the composition may contain from 0.1% to 100% (w / w) of the active ingredient.

[0425] Pharmaceutical formulations may further comprise pharmaceutically acceptable excipients, which, as used herein, include any solvent, dispersion medium, diluent, or other liquid vehicle, dispersing or suspending aid, surfactant, isotonicity agent, thickener or emulsifier, preservative, solid binder, and lubricant, as appropriate for the particular dosage form desired. Remington's The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006), discloses various excipients used in formulating pharmaceutical compositions and known techniques for their preparation. Except insofar as any conventional excipient medium is incompatible with the substance or its derivatives, such as by producing some undesirable biological effect or by interacting in a deleterious manner with any other component of the pharmaceutical composition, its use is contemplated within the scope of the present disclosure.

[0426] In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the United States Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and / or International Pharmacopoeia.

[0427] Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersing and / or granulating agents, surface active agents and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants, and / or oils. Such excipients may optionally be included in the pharmaceutical preparation. Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweeteners, flavoring agents, and / or perfuming agents may be present in the composition according to the discretion of the formulator.

[0428] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and the like, and / or combinations thereof.

[0429] Exemplary granulating and / or dispersing agents include, but are not limited to, potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose (croscarmellose), methyl cellulose, pregelatinized starch (Starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and the like, and / or combinations thereof.

[0430] Exemplary surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and Veegum® [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymers, and carboxyvinyl polymers), carrageenan, cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydroxypropyl ... sorbitan monolaurate [Tween® 20], polyoxyethylene sorbitan [Tween® 60], polyoxyethylene sorbitan monooleate [Tween® 80], sorbitan monopalmitate [Span® 40], sorbitan monostearate [Span® 60], sorbitan tristearate [Span® 60], sorbitan hydroxybenzoate [Span® 8 ... pan)® 65], glyceryl monooleate, sorbitan monooleate [Span® 80]), polyoxyethylene esters (e.g., polyoxyethylene monostearate [Myrj® 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol®), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor®),Polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [Brij® 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic® F 68, Poloxamer® 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and / or combinations thereof.

[0431] Exemplary binders include, but are not limited to, starches (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, isapol bark mucilage, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (Veegum®), and larch arabinogalactan); alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohols, etc.; and combinations thereof.

[0432] Exemplary preservatives include, but are not limited to, antioxidants, chelating agents, antibacterial preservatives, antifungal preservatives, alcoholic preservatives, acidic preservatives, and / or other preservatives. Exemplary antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and / or trisodium edetate. Exemplary antibacterial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal. Exemplary antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Exemplary alcoholic preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoates, and / or phenylethyl alcohol. Exemplary acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and / or phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopheryl acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus®, Phenonip®, methylparaben, Germall® 115, Germaben® II, Neolone™, Kathon™, and / or Euxyl®.

[0433] Exemplary buffering agents include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, dibasic potassium phosphate, potassium mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free distilled water, isotonic saline, Ringer's solution, ethyl alcohol, and the like, and / or combinations thereof.

[0434] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and the like, and combinations thereof.

[0435] Exemplary oils include, but are not limited to, almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lavender Oils suitable for use in skincare include dandelion, lemon, litsea globulus, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquat, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, camellia, vetiver, walnut, and wheat germ oil. Exemplary oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and / or combinations thereof.

[0436] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and / or elixirs.In addition to active ingredients, liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, and their mixtures.In addition to inert diluents, oral compositions can contain auxiliary agents such as wetting agents, emulsifiers and suspending agents, sweeteners, flavorings, and / or fragrances. In certain embodiments for parenteral administration, the composition is mixed with a solubilizing agent such as Cremophor®, alcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or combinations thereof.

[0437] Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known techniques using suitable dispersants, wetting agents, and / or suspending agents.Sterile injectable preparations can be sterile injectable solutions, suspensions, and / or emulsions in non-toxic parenterally acceptable diluents and / or solvents, such as solutions in 1,3-butanediol.Among acceptable vehicles and solvents that can be used are water, Ringer's solution, USP, and isotonic sodium chloride solution.Sterile fixed oils are usually used as solvents or suspending media.For this purpose, any non-irritating fixed oil can be used, including synthetic mono- or diglycerides.Fatty acids such as oleic acid can be used to prepare injectables.

[0438] Injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0439] To prolong the effect of an active ingredient, it is often desirable to slow the absorption of the active ingredient from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or non-crystalline material with poor water solubility. The rate of absorption of the drug depends on its rate of dissolution, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending on the drug-to-polymer ratio and the nature of the particular polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0440] Compositions for rectal or vaginal administration are typically suppositories, which can be prepared by mixing the composition with a suitable non-irritating excipient such as cocoa butter, polyethylene glycol or a suppository wax which is solid at ambient temperature but liquid at body temperature and therefore melts in the rectum or vaginal cavity and releases the active ingredient.

[0441] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active ingredient is mixed with at least one inert pharmaceutically acceptable excipient, such as sodium citrate or dicalcium phosphate and / or fillers or extenders (e.g., starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders (e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g., glycerol), disintegrating agents (e.g., agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate), solution retarders (e.g., paraffin), absorption accelerators (e.g., quaternary ammonium compounds), wetting agents (e.g., cetyl alcohol and glycerol monostearate), absorbents (e.g., kaolin and bentonite clay), and lubricants (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents.

[0442] Similar types of solid compositions can be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings known in the pharmaceutical formulation art.They can optionally contain opacifying agents and can be of a composition that releases the active ingredient preferentially, or optionally delayed, in a certain part of the intestinal tract.Examples of embedding compositions that can be used include polymeric substances and waxes.Similar types of solid compositions can be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0443] Dosage forms for topical and / or transdermal administration of the composition include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and / or patches. Generally, the active ingredient is mixed with a pharmaceutically acceptable excipient and / or any necessary preservatives and / or buffers under sterile conditions, as needed. In addition, the present disclosure also contemplates the use of transdermal patches, which often have the additional advantage of providing controlled delivery of the compound to the body. Such dosage forms can be prepared, for example, by dissolving and / or dispersing the compound in a suitable medium. Alternatively or additionally, the rate can be controlled by providing a rate-controlling membrane and / or dispersing the compound in a polymer matrix and / or gel.

[0444] Suitable devices for use in delivering intradermal pharmaceutical compositions described herein include short needle devices, such as those described in U.S. Patent No. 4,886,499; U.S. Patent No. 5,190,521; U.S. Patent No. 5,328,483; U.S. Patent No. 5,527,288; U.S. Patent No. 4,270,537; U.S. Patent No. 5,015,235; U.S. Patent No. 5,141,496; and U.S. Patent No. 5,417,662.Intradermal compositions can be administered by devices that limit the effective penetration length of needles into the skin, such as those described in PCT Publication WO 99 / 34850, and their functional equivalents.Preferably, liquid jet injectors and / or jet injection devices are used to deliver liquid compositions to the dermis through needles that generate a jet that penetrates the stratum corneum and reaches the dermis. Jet injection devices are described, for example, in U.S. Patent Nos. 5,480,381; 5,599,302; 5,334,144; 5,993,412; 5,649,912; 5,569,189; 5,704,911; 5,383,851; 5,893,397; 5,466,220; and 5,339,163. The details are described in the following documents; 5,312,335; 5,503,627; 5,064,413; 5,520,639; 4,596,556; 4,790,824; 4,941,880; 4,940,460; and PCT Publication No. WO 97 / 37705 and WO 97 / 13537. A ballistic powder / particle delivery device is suitable, which uses compressed gas to accelerate powdered vaccine from the outer layer of the skin to the dermis.Alternatively or additionally, a conventional syringe can be used for the classical Mantoux method of intradermal administration.

[0445] Formulations suitable for topical administration include, but are not limited to, liquid and / or semi-liquid formulations such as oil-in-water and / or water-in-oil emulsions, and / or solutions and / or suspensions, such as liniments, lotions, creams, ointments, and / or pastes. Topically administrable formulations may contain, for example, about 1% to about 10% (w / w) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further include one or more of the additional ingredients described herein.

[0446] Pharmaceutical compositions may be prepared, packaged, and / or sold as formulations suitable for pulmonary administration via the buccal cavity. Such formulations may comprise dry particles containing the active ingredient and having diameters ranging from about 0.5 nm to about 7 nm or from about 1 nm to about 6 nm. Such compositions are conveniently in the form of a dry powder for administration using a device containing a dry powder reservoir capable of directing a flow of propellant to disperse the powder, and / or using a self-propelling solvent / powder dispensing container, such as a device containing the active ingredient dissolved and / or suspended in a low-boiling propellant in a sealed container. Such powders comprise particles in which at least 98% of the particles by weight have a diameter greater than 0.5 nm and at least 95% of the particles by number have a diameter less than 7 nm. Alternatively, at least 95% of the particles by weight have a diameter greater than 1 nm and at least 90% of the particles by number have a diameter less than 6 nm. Dry powder compositions may contain a solid fine powder diluent, such as sugar, and are conveniently provided in unit dosage form.

[0447] Low-boiling propellants generally include liquid propellants having a boiling point below 18.3°C (65°F) at atmospheric pressure. Generally, the propellant may comprise 50% to 99.9% (w / w) of the composition, and the active ingredient may comprise 0.1% to 20% (w / w) of the composition. The propellant may further include additional components such as liquid nonionic and / or solid anionic surfactants and / or solid diluents (which may have particle sizes similar to those of the particles containing the active ingredient).

[0448] Pharmaceutical compositions formulated for pulmonary delivery may provide the active ingredient in the form of droplets of a solution and / or suspension. Such formulations may be prepared, packaged, and / or sold as optionally sterile aqueous and / or dilute alcoholic solutions and / or suspensions containing the active ingredient, and may be conveniently administered using any spray and / or atomizing device. Such formulations may further contain one or more additional ingredients, including, but not limited to, flavorings such as saccharin sodium, volatile oils, buffers, surfactants, and / or preservatives such as methylhydroxybenzoates. The droplets provided by this administration route may have an average diameter ranging from about 0.1 nm to about 200 nm.

[0449] The formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of pharmaceutical compositions. Another formulation suitable for intranasal administration is a coarse powder containing the active ingredient and having an average particle size of about 0.2 μm to 500 μm. Such formulations are administered by nasal inhalation, i.e., by high-velocity inhalation through the nasal passages from a container of the powder held close to the nose.

[0450] Formulations suitable for nasal administration may contain, for example, as little as about 0.1% (w / w) to as much as 100% (w / w) of the active ingredient, and may include one or more additional ingredients described herein. Pharmaceutical compositions may be prepared, packaged, and / or sold in formulations suitable for buccal administration. Such formulations may be, for example, in the form of tablets and / or lozenges made using conventional methods and may contain, for example, 0.1% to 20% (w / w) of the active ingredient, with the remainder comprising an orally dissolvable and / or degradable composition and, optionally, one or more additional ingredients described herein. Alternatively, formulations suitable for buccal administration may comprise a powder and / or aerosolized and / or atomized solution and / or suspension comprising the active ingredient. Such powdered, aerosolized, and / or aerosolized formulations, when dispersed, may have an average particle and / or droplet size in the range of about 0.1 nm to about 200 nm and may further include any one or more additional ingredients described herein.

[0451] The pharmaceutical composition may be prepared, packaged, and / or sold as a formulation suitable for ocular administration. Such a formulation may be in the form of, for example, eye drops comprising a 0.1 / 1.0% (w / w) solution and / or suspension of the active ingredient in an aqueous or oily liquid vehicle. Such eye drops may further comprise one or more buffers, salts, and / or any other additional ingredients described herein. Other useful ophthalmically administrable formulations include those comprising the active ingredient in microcrystalline form and / or in a liposomal formulation. Ear drops and / or eye drops are considered within the scope of the present disclosure.

[0452] General considerations in the formulation and / or manufacture of pharmaceuticals can be found, for example, in Remington's The Science and Practice of Pharmacy, 21st ed., A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[0453] Administration The present disclosure provides methods comprising administering a polynucleotide of the present disclosure to a subject in need thereof. The polynucleotide, or a pharmaceutical, imaging, diagnostic, or prophylactic composition thereof, can be administered to a subject in any amount and via any route of administration effective for preventing, treating, diagnosing, or imaging a disease, disorder, and / or condition (e.g., a disease, disorder, and / or condition related to working memory impairment). The exact amount required will vary from subject to subject, depending on the subject's species, age, and general condition, the severity of the disease, the specific composition, its method of administration, and its mode of activity. Compositions of the present disclosure are typically formulated in dosage unit form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage of the compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific compound used; the specific composition used; the patient's age, weight, general health, sex, and dietary habits; the time of administration, route of administration, and excretion rate of the specific compound used; the duration of treatment; drugs used in combination with or concurrently with the specific compound used; and similar factors well known in the medical arts.

[0454] The delivered polynucleotide and / or pharmaceutical, prophylactic, diagnostic, or imaging composition may be administered to an animal, such as a mammal (e.g., a human, livestock, cat, dog, mouse, rat, etc.). In certain embodiments, the pharmaceutical, prophylactic, diagnostic, or imaging composition is administered to a human.

[0455] The polynucleotide and / or pharmaceutical, prophylactic, diagnostic, or imaging composition thereof to be delivered according to the present disclosure can be administered by any route. In certain embodiments, the polynucleotide and / or pharmaceutical, prophylactic, diagnostic, or imaging composition thereof is administered by one or more of a variety of routes, including oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, intradermal, rectal, intravaginal, intraperitoneal, topical (e.g., powder, ointment, cream, gel, lotion, and / or liquid drop), mucosal, nasal, buccal, enteral, intravitreal, intratumoral, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; as an oral spray, nasal spray, and / or aerosol, and / or via a portal vein catheter. In certain embodiments, the polynucleotide and / or pharmaceutical, prophylactic, diagnostic, or imaging composition thereof is administered by systemic intravenous injection. In certain embodiments, the polynucleotide and / or pharmaceutical, prophylactic, diagnostic, or imaging composition thereof can be administered intravenously and / or orally. In certain embodiments, the polynucleotide, and / or pharmaceutical, prophylactic, diagnostic, or imaging composition thereof, may be administered in a manner that allows the polynucleotide to cross the blood-brain barrier, vascular barrier, or other epithelial barrier.

[0456] However, the present disclosure encompasses delivery of polynucleotides, and / or pharmaceutical, prophylactic, diagnostic, or imaging compositions thereof, by any suitable route, taking into consideration possible advances in the science of drug delivery.

[0457] Generally, the most appropriate route of administration will depend on various factors, including the properties of the polynucleotide, including the polynucleotide conjugated to at least one agent to be delivered (e.g., its stability in the environment of the gastrointestinal tract, bloodstream, etc.), the condition of the patient (e.g., whether the patient can tolerate a particular route of administration), etc. The present disclosure encompasses delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions by any appropriate route, taking into account possible advances in the science of drug delivery.

[0458] In certain embodiments, compositions of the present disclosure may be administered one or more times daily at a dosage level sufficient to deliver about 0.0001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 25 mg / kg of subject body weight per day to achieve the desired therapeutic, diagnostic, prophylactic, or imaging effect. The desired dosage may be delivered three times daily, twice daily, once daily, every other day, every third day, weekly, every other week, every three weeks, or every four weeks. In certain embodiments, the desired dose can be delivered using multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more administrations).

[0459] Polynucleotides may be used in combination with one or more other therapeutic, preventive, diagnostic, or imaging agents. "In combination with" is not intended to imply that the agents must be administered simultaneously and / or formulated for delivery together, although these delivery methods are within the scope of the present disclosure. The compositions may be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. Generally, each agent is administered at a dose and / or time schedule determined for that agent. In certain embodiments, the present disclosure encompasses the delivery of pharmaceutical, preventive, diagnostic, or imaging compositions in combination with agents that improve their bioavailability, inhibit and / or regulate their metabolism, inhibit their excretion, and / or regulate their distribution in the body.

[0460] It will be further understood that therapeutic, prophylactic, diagnostic, or imaging agents used in combination can be administered together in a single composition or separately in different compositions. In general, it is expected that agents used in combination will be used at levels that do not exceed the levels at which they are used individually. In certain embodiments, the levels used in combination are less than the levels at which they are used individually.

[0461] The particular combination of therapies (therapeutics or procedures) to use in a combination regimen will take into account the compatibility of the desired therapeutics and / or procedures and the desired therapeutic effect to be achieved. It will also be understood that the therapies used can achieve a desired effect for the same disorder (e.g., a composition useful for treating cancer according to the present disclosure can be administered simultaneously with a chemotherapeutic agent), or they can achieve a different effect (e.g., control of some adverse effect).

[0462] kit The present disclosure provides various kits for conveniently and / or effectively carrying out the methods of the present disclosure. Typically, the kits contain components in amounts and / or numbers sufficient to allow a user to perform multiple treatments of subjects and / or perform multiple experiments.

[0463] In one aspect, the present disclosure provides a kit for protein production, comprising a first isolated polynucleotide comprising a translatable region and a nucleotide modification, wherein the polynucleotide is capable of avoiding or preventing induction of an innate immune response in a cell into which the first isolated polynucleotide has been introduced, and packaging and instructions.

[0464] In one aspect, the present disclosure provides a kit for protein production, comprising: a first isolated modified polynucleotide comprising a translatable region, provided in an amount effective to produce a desired amount of the protein encoded by the translatable region when introduced into a target cell; a second polynucleotide comprising an inhibitory polynucleotide, provided in an amount effective to substantially inhibit a cellular innate immune response; and packaging and instructions.

[0465] In one aspect, the disclosure provides a kit for protein production, comprising a first isolated polynucleotide comprising a translatable region and nucleoside modifications, wherein the polynucleo...

Claims

1. The polypeptide is encoded by the formula I: A'-L-B' Formula I (Wherein, A' is (a) at least one 5'-cap structure; (b) 5′-UTR; (c) a coding region; and (d) 3′-UTR Including; B' comprises a 3'-stabilizing region comprising 1 to 500 nucleosides; A polynucleotide comprising the structure:

2. The polynucleotide of claim 1, wherein A' further comprises (e) a poly-A region.

3. One or more nucleosides in the 3'-stabilizing region has the structure: 【Chemistry 1】 (In the formula, B １ is a nucleobase; Each U and U′ is independently O, S, N (R Ｕ ) ｎｕ , or C(R Ｕ ) ｎｕ where nu is an integer from 1 to 2, and each R Ｕ are independently H, halo, or optionally substituted C １ ~C ６ is alkyl; R １ , R １” , R ２ , R ２” , R ３ , R ４ , and R ５ each independently represents H, halo, hydroxy, thiol, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ Heteroalkynyl, optionally substituted amino, azido, optionally substituted C ６ ~C １０ aryl; or R ３ and / or R ５ But, R １ , R １” , R ２ , or R ２” and optionally substituted C together with the carbon to which they are attached. ３ ~C １０ Carbocyclic or optionally substituted C ３ ~C ９ can form a heterocyclyl; each of m and n is independently an integer from 0 to 5; Y １ , Y ２ , and Y ３ each independently represents O, S, Se, -NR Ｎ１ -, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ heteroalkylene, where R Ｎ１ is H, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ alkynyl, or optionally substituted C ６ ~C １０ is aryl; Each Y ４ are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ heteroalkynyl, or optionally substituted amino; Y ５ is O, S, Se, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ 3. The polynucleotide of claim 1 or 2, comprising:

4. The polynucleotide of any one of claims 1 to 3, wherein the 3'-stabilizing region comprises a plurality of adenosines.

5. 5. The polynucleotide of claim 4, wherein all of the nucleosides of the 3'-stabilizing region are adenosine.

6. The polynucleotide of any one of claims 1 to 3, wherein the 3'-stabilizing region comprises at least one modified nucleoside.

7. 7. The polynucleotide of claim 6, wherein the modified nucleoside is L-adenosine, 2'-O-methyl-adenosine, α-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, or inverted thymidine.

8. 8. The polynucleotide of claim 7, wherein the modified nucleoside is L-adenosine, 2'-O-methyl-adenosine, or inverted thymidine.

9. The polynucleotide of any one of claims 6 to 8, wherein the stabilizing region comprises a plurality of modified nucleosides.

10. 10. The polynucleotide of claim 9, wherein the stabilizing region comprises at least two different modified nucleosides.

11. 11. The polynucleotide of claim 10, wherein at least one modified nucleoside is a 2'-O-methyl-adenosine and at least one modified nucleoside is a reverse thymidine.

12. The stabilizing region has a structure: 【Chemistry 2】 wherein each X is independently O or S; A represents adenine and T represents thymine). or a salt thereof.

13. 10. The polynucleotide of claim 9, wherein all of said multiple modified nucleosides are the same.

14. The polynucleotide of claim 13, wherein the modified nucleoside is L-adenosine.

15. The polynucleotide of any one of claims 1 to 14, wherein the stabilizing region comprises 10 nucleosides.

16. The linker has the structure: 【Chemistry 3】 wherein a, b, c, e, f, and g are each independently 0 or 1; d is 0, 1, 2, or 3; R ６ , R ８ , R １０ , and R １２ each independently represents an optionally substituted C １ ~C ６ Alkylene, optionally substituted C １ ~C ６ Heteroalkylene, O, S, Se, and NR １３ Selected from: R ７ and R １１ is each independently carbonyl, thiocarbonyl, sulfonyl, or phosphoryl, where R ７ is phosphoryl, -(R ９ ) ｄ When - is a bond and e, f, and g are 0, R ６ Or R ８ At least one of is not O; １１ is phosphoryl, -(R ９ ) ｄ When - is a bond and a, b, and c are 0, R １０ Or R １２ at least one of is not O; Each R ９ is optionally substituted C １ ~C １０ Alkylene, optionally substituted C ２ ~C １０ Alkenylene, optionally substituted C ２ ~C １０ Alkynylene, optionally substituted C ２ ~C １０ Heterocyclylene, optionally substituted C ６ ~C １２ Arylene, optionally substituted C ２ ~C １００ Polyethylene glycol, or optionally substituted C １ ~C １０ Heteroalkylene, or (R ６ ) ａ - (R ７ ) ｂ - (R ８ ) ｃ (R １０ ) ｅ - (R １１ ) ｆ - (R １２ ) ｇ is a bond connecting to -(R ９ ) ｄ when - is a bond, at least one of a, b, c, d, e, or f is 1; R １３ is hydrogen, optionally substituted C １ ~C ４ Alkyl, optionally substituted C ２ ~C ４ Alkenyl, optionally substituted C ２ ~C ４ Alkynyl, optionally substituted C ２ ~C ６ Heterocyclyl, optionally substituted C ６ ~C １２ Aryl, or optionally substituted C １ ~C ７ The polynucleotide of any one of claims 1 to 15, having a heteroalkyl group.

17. The linker is 【Chemistry 4】 (In the formula, B １ is a nucleobase; R １４ and R １５ The polynucleotide of any one of claims 1 to 16, comprising:

18. The linker is 【Chemistry 5】 wherein o is 0, 1, 2, or 3; Y ６ is O, S, Se, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ is heteroalkylene; Each Y ７ and Y ８ are independently O, S, Se, -NR Ｎ１ -, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ heteroalkylene, where R Ｎ１ is H, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ alkynyl, or optionally substituted C ６ ~C １０ is aryl; Each Y ９ are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ heteroalkynyl, or optionally substituted amino; Y １０ is O, a bond, optionally substituted C １ ~C １０ Alkylene, optionally substituted C ２ ~C １０ Alkenylene, optionally substituted C ２ ~C １０ Alkynylene, optionally substituted C ２ ~C １０ Heterocyclylene, optionally substituted C ６ ~C １２ Arylene, optionally substituted C ２ ~C １００ Polyethylene glycol, or optionally substituted C １ ~C １０ 20. The polynucleotide of claim 17, comprising:

19. Y １０ is optionally substituted C ２ ~C １００ 20. The polynucleotide of claim 18 which is polyethylene glycolene.

20. The linker is 【Chemistry 6】 20. The polynucleotide of claim 19 comprising:

21. R １４ and R １５ The polynucleotide of any one of claims 17 to 20, wherein both are hydroxy.

22. o is 1, and Y ６ is methylene, and Y ７ and Y ８ are both O, and Y ９ The polynucleotide of any one of claims 18 to 21, wherein is hydroxy.

23. The polynucleotide of any one of claims 20 to 22, wherein p is 3.

24. Y １０ is optionally substituted C １ ~C １０ 20. The polynucleotide of claim 18 which is a heteroalkylene.

25. The linker is 【Chemistry 7】 wherein q and r are each independently 1, 2, 3, 4, or 5.

26. R １４ and R １５ The polynucleotide of claim 25, wherein both are hydroxy.

27. q is 5; Y ６ is methylene, and Y ７ and Y ８ are both O, and Y ９ is hydroxy.

28. 28. The polynucleotide of any one of claims 25 to 27, wherein r is 3.

29. The polynucleotide of any one of claims 1 to 28, wherein the linker is capable of being formed by a click chemistry reaction between a click chemistry reaction pair.

30. The linker is 【Chemistry 8】 or an amide bond.

31. The linker has the structure: 【Chemistry 9】 The polynucleotide of claim 30, comprising:

32. The linker has the structure: 【Chemistry 10】 The polynucleotide of claim 31 , comprising:

33. The polynucleotide of any one of claims 1 to 32, wherein the linker is attached to the 3' end of A' and the 5' end of B'.

34. A polynucleotide encoding a polypeptide, said polynucleotide comprising: (a) at least one 5'-cap structure; (b) 5′-UTR; (c) a coding region; (d) a 3′-UTR; and (e) a 3'-stabilizing region comprising 1 to 500 nucleosides; wherein one or more of said nucleosides is an L-nucleoside, α-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, inverted thymidine, or 3'-azido-2',3'-dideoxyadenosine.

35. The polynucleotide of claim 34, wherein the polynucleotide further comprises (f) a poly-A region.

36. The L-nucleoside has the structure: 【Chemistry 11】 (In the formula, B １ is a nucleobase; U is O, S, N (R Ｕ ) ｎｕ , or C(R Ｕ ) ｎｕ where nu is an integer from 1 to 2, and each R Ｕ are independently H, halo, or optionally substituted C １ ~C ６ is alkyl; R １ , R ２ , R ３ , and R ５ each independently represents H, halo, hydroxy, thiol, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ Heteroalkynyl, optionally substituted amino, azido, optionally substituted C ６ ~C １０ aryl; or R ３ Or R ５ But, R １ Or R ２ and optionally substituted C together with the carbon to which they are attached. ３ ~C １０ Carbocyclic or optionally substituted C ３ ~C ９ can form a heterocyclyl; each of m and n is independently an integer from 0 to 5; Y １ , Y ２ , and Y ３ each independently represents O, S, Se, -NR Ｎ１ -, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ heteroalkylene, where R Ｎ１ is H, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ alkynyl, or optionally substituted C ６ ~C １０ is aryl; Each Y ４ are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ heteroalkynyl, or optionally substituted amino; Y ５ is O, S, Se, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ 36. The polynucleotide of claim 34 or 35, having the following structure:

37. The polynucleotide of claim 36, wherein the L-nucleoside is L-adenosine.

38. 38. The polynucleotide of any one of claims 34 to 37, wherein the stabilizing region comprises a plurality of modified nucleosides.

39. 39. The polynucleotide of claim 38, wherein all of said multiple modified nucleosides are the same.

40. 40. The polynucleotide of any one of claims 34 to 39, wherein the stabilizing region comprises 10 nucleosides.

41. The polynucleotide of any one of claims 34 to 40, wherein the 5' end of the 3'-stabilized region is attached to the 3' end of the 3'-UTR.

42. The polynucleotide of any one of claims 35 to 40, wherein the 5' end of the 3'-stabilization region is linked to the 3' end of the poly-A region.

43. A polynucleotide encoding a polypeptide, said polynucleotide comprising: (a) at least one 5'-cap structure; (b) 5′-UTR; (c) a coding region; (d) a 3′-UTR; and (e) a 3'-stabilizing region comprising 1 to 500 nucleosides; wherein the 3'-stabilizing region comprises a plurality of modified nucleosides.

44. The polynucleotide of claim 43, wherein the polynucleotide further comprises (f) a poly-A region.

45. The one or more modified nucleosides have the structure: 【Chemistry 12】 (In the formula, B １ is a nucleobase; Each U and U′ is independently O, S, N (R Ｕ ) ｎｕ , or C(R Ｕ ) ｎｕ where nu is an integer from 1 to 2, and each R Ｕ are independently H, halo, or optionally substituted C １ ~C ６ is alkyl; R １ , R １” , R ２ , R ２” , R ３ , R ４ , and R ５ each independently represents H, halo, hydroxy, thiol, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ Heteroalkynyl, optionally substituted amino, azido, optionally substituted C ６ ~C １０ aryl; or R ３ and / or R ５ But, R １ , R １” , R ２ , or R ２” and optionally substituted C together with the carbon to which they are attached. ３ ~C １０ Carbocyclic or optionally substituted C ３ ~C ９ can form a heterocyclyl; each of m and n is independently an integer from 0 to 5; Y １ , Y ２ , and Y ３ each independently represents O, S, Se, -NR Ｎ１ -, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ heteroalkylene, where R Ｎ１ is H, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ alkynyl, or optionally substituted C ６ ~C １０ is aryl; Each Y ４ are independently H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C １ ~C ６ Alkyl, optionally substituted C ２ ~C ６ Alkenyl, optionally substituted C ２ ~C ６ Alkynyl, optionally substituted C １ ~C ６ Heteroalkyl, optionally substituted C ２ ~C ６ Heteroalkenyl, optionally substituted C ２ ~C ６ heteroalkynyl, or optionally substituted amino; Y ５ is O, S, Se, optionally substituted C １ ~C ６ Alkylene, or optionally substituted C １ ~C ６ 40. The polynucleotide of claim 38 or 39, comprising:

46. 46. ​​The polynucleotide of claim 45, wherein the modified nucleoside is 2'-O-methyl-adenosine.

47. The polynucleotide of any one of claims 43 to 46, wherein the polynucleotide comprises a plurality of modified nucleosides at the 3' end.

48. 48. The polynucleotide of any one of claims 43-47, wherein the plurality of modified nucleosides comprises at least two different nucleosides.

49. 48. The polynucleotide of any one of claims 43 to 47, wherein the multiple modified nucleosides are all the same nucleoside.

50. 48. The polynucleotide of any one of claims 43-47, wherein all of the nucleosides in the 3'-stabilizing region are modified nucleosides.

51. 51. The polynucleotide of any one of claims 43 to 50, wherein the stabilizing region comprises 10 nucleosides.

52. The polynucleotide of any one of claims 43 to 51, wherein the 5' end of the 3'-stabilizing region is attached to the 3' end of the 3'-UTR.

53. The polynucleotide of any one of claims 44 to 51, wherein the 5' end of the 3'-stabilization region is linked to the 3' end of the poly-A region.

54. The polynucleotide of any one of claims 1 to 53, wherein the 5'-UTR comprises a Kozak sequence.

55. The polynucleotide of any one of claims 1 to 54, wherein the 3'-stabilizing region comprises the 3' end of the polynucleotide.

56. 56. The polynucleotide of any one of claims 1 to 55, wherein at least one of the coding region, the 5'-UTR, the 3'-UTR, and / or the 5'-cap structure comprises at least one modified nucleoside.

57. 57. The polynucleotide of claim 56, wherein the modified nucleoside is a 5-substituted uridine, a 1-substituted pseudouridine, or a 5-substituted cytidine.

58. 58. The polynucleotide of claim 57, wherein the modified nucleoside is 5-methoxy-uridine or 5-methyl-cytidine.

59. The polynucleotide of any one of claims 2-33, 35-42, or 44-58, wherein the poly-A region comprises at least one modified nucleoside.

60. A method for increasing expression of a recombinant polypeptide of interest in a cell, comprising contacting the cell with a polynucleotide encoding the polypeptide, wherein the polynucleotide has been modified to contain a structure of Formula I, and wherein expression is increased when compared to an unmodified polynucleotide.

61. 61. The method of claim 60, wherein the polynucleotide is mRNA.

62. The method of any one of claims 60 to 61, wherein said polypeptide of interest is a therapeutic polypeptide.

63. The method of any one of claims 60 to 62, wherein the cell is a mammalian cell.

64. 64. The method of claim 63, wherein the mammalian cell is a human cell.

65. A method for increasing the half-life of a polynucleotide in a cell, comprising contacting the cell with a polynucleotide, wherein the polynucleotide has been modified to contain a structure of Formula I, and wherein the half-life is increased as compared to an unmodified polynucleotide.

66. 66. The method of claim 65, wherein the polynucleotide is mRNA.

67. 67. The method of claim 66, wherein the mRNA encodes a therapeutic polypeptide.

68. The method of any one of claims 65 to 67, wherein the cell is a mammalian cell.

69. 69. The method of claim 68, wherein the mammalian cell is a human cell.

Images