Compositions, methods and kits for detecting treponema pallidum

Abstract

To provide compositions, methods and kits for detecting Treponema pallidum.SOLUTION: Presented are oligonucleotide hybridization probes, primer sets, methods, reaction mixtures, and kits for detecting nucleic acids of Treponema pallidum, the causative agent of syphilis. Disclosed assays are both highly sensitive and specific for detection of T. pallidum nucleic acids. Nucleic acid sequences of T. pallidum can be detected at a level of 100% positivity using test samples having only 30 copies / ml of a model in vitro transcript. The presence of potentially cross-reacting non-target microorganisms does not negatively impact assay results.SELECTED DRAWING: Figure 1A

Description

[Technical field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 891,181, filed Aug. 23, 2019. The entire disclosure of the above prior application is incorporated herein by reference.

[0002] The present disclosure relates to the field of biotechnology. More specifically, the present disclosure relates to nucleic acid diagnostics. Even more specifically, the present disclosure relates to assays for detecting nucleic acids of T. pallidum, the infectious pathogen that causes syphilis. [Background technology]

[0003] Syphilis is a sexually transmitted disease caused by the spirochete Treponema pallidum. This motile bacterium can also infect the fetus by transplacental passage during late pregnancy, causing congenital syphilis. The asymptomatic incubation period can last from 3 to 90 days (average 21 days), leaving a significant window period between exposure and detectable infection. (Henao-Martinez et al.,Nuerol Clin Pract.4(2):114-122(2014))

[0004] Traditional diagnostic testing has relied on a combination of clinical findings and serological assays. This may involve, for example, detecting antibodies against T. pallidum proteins. Different procedures may involve dark-field microscopy, PCR, and direct fluorescent antibody testing against T. pallidum. Few clinical centers have these tools available, but it is possible to receive a diagnosis of syphilis before serological conversion. (Henao-Martinez et al., (2014))

[0005] An analysis of the complete genome sequence of T. pallidum has been published by Fraser et al. in Science 281:375-388 (1998). Interestingly, the entire genome consists of only about 1.14 Mbp and contains 1041 open reading frames. This small genome size likely reflects the reliance of this organism on many functions provided by its mammalian host. Given that the clinical manifestations of syphilis can vary widely and can be confused with other infections, and false-positive nontreponemal tests have been reported for other conditions (including pregnancy), highly sensitive assays specific for T. pallidum are needed. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Henao-Martinez et al.,Nuerol Clin Pract.4(2):114-122(2014) [Non-Patent Document 2] Fraser et al., Science 281:375-388 (1998) Summary of the Invention

[0007] In a first aspect, the present disclosure relates to an oligonucleotide hybridization probe for detecting nucleic acids of T. pallidum. The hybridization probe comprises a target hybridization sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases, and a detectable label attached thereto. The oligonucleotide hybridization probe is up to 47 bases in length. In some embodiments, the oligonucleotide hybridization probe further comprises a fluorophore portion, a quencher portion, and at least one nucleotide analogue comprising a ribofuranosyl portion with a 2'-O-methyl substitution. In other embodiments, the oligonucleotide hybridization probe may further comprise a non-nucleotide linker and a pair of interactive labels. The oligonucleotide hybridization probe may be a molecular torch hybridization probe. For example, the pair of interactive labels may comprise a fluorophore portion and a quencher portion. In some embodiments, the non-nucleotide linker of the oligonucleotide hybridization probe is a C9 linker. In some embodiments, the target hybridizing sequence of the oligonucleotide hybridization probe is any of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27, each of which allows for the substitution of RNA and DNA equivalent bases. In some embodiments, the target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO:19 is a target hybridizing sequence of 13 to 22 consecutive bases of SEQ ID NO:21, or its complement, which allows for the substitution of RNA and DNA equivalent bases. For example, the target hybridizing sequence of the oligonucleotide hybridization probe can be any of SEQ ID NO:26 and SEQ ID NO:27, each of which allows for the substitution of RNA and DNA equivalent bases. In some embodiments, the oligonucleotide hybridization probe further comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution.

[0008] In a second aspect, the present disclosure relates to a primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence. The primer set includes a first primer having a target hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, the first primer being up to 50 bases in length. The primer set further includes a second primer having a target hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, the second primer being up to 50 bases in length, and at least one of the first and second primers includes a phage promoter sequence attached upstream of the respective target hybridizing sequence. In some embodiments, the first primer includes a phage promoter sequence attached upstream of the first target hybridizing sequence. For example, the phage promoter sequence may include a T7 promoter sequence. In some embodiments, the target hybridizing sequence of the first primer ends at its 3' end with SEQ ID NO:7. In some embodiments, the target hybridizing sequence of the first primer is either SEQ ID NO: 7 or SEQ ID NO: 8. In some embodiments, the target hybridizing sequence of the first primer is either SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. In some embodiments, the first primer is a promoter-primer selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO: 13. In some embodiments, the target hybridizing sequence of the second primer is SEQ ID NO: 16. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO: 14. In some embodiments, the target hybridizing sequence of the second primer is SEQ ID NO: 17 or SEQ ID NO: 16. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO: 15.For example, the target hybridizing sequence of the second primer can be SEQ ID NO: 18 or SEQ ID NO: 17. In some embodiments, the first primer is SEQ ID NO: 11 and the second primer is SEQ ID NO: 18. In some embodiments, the first primer is SEQ ID NO: 12 and the second primer is SEQ ID NO: 18.

[0009] In a third aspect, the present disclosure relates to a method for determining whether a sample contains T. pallidum nucleic acid, the method comprising: (a) contacting the sample with a set of primers; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the set of primers in an in vitro nucleic acid amplification reaction, thereby producing an amplification product if the sample contains T. pallidum nucleic acid; (c) detecting any amplification product produced in step (b) using a detectably labeled oligonucleotide hybridization probe; and (d) determining from the result of step (c) whether an amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid. In some embodiments, the detectably labeled hybridization probe further comprises a target hybridization sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases, and the oligonucleotide hybridization probe further comprises a detectable label that is up to 47 bases in length. In some embodiments, the detectably labeled hybridization probe is a molecular torch hybridization probe that comprises a non-nucleotide linker and a pair of interactive labels.In some embodiments, the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher.In some embodiments, the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker located at one end of the target hybridization sequence.In some embodiments, the detectably labeled hybridization probe further comprises at least one nucleotide analog that comprises a fluorophore portion, a quencher portion, and a ribofuranosyl portion with a 2'-O-methyl substitution.In some embodiments, the set of primers in step (a) comprises a first primer and a second primer, the first primer being up to 50 bases long and comprising a target hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, the second primer being up to 50 bases long and comprising a target hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, and at least one of the first and second primers further comprising a phage promoter sequence linked upstream of the respective target hybridizing sequence. In some embodiments, steps (a) and (b) occur simultaneously, and the amplification reaction is a real-time amplification reaction. In some embodiments, the amplification product detected in step (c) is an RNA amplicon of the opposite sense to the 23S rRNA of T. pallidum.

[0010] In a fourth aspect, the present disclosure relates to a reaction mixture for detecting nucleic acid of T. pallidum that may be present in a test sample. The reaction mixture may include a test sample, an oligonucleotide primer set including a first primer and a second primer, the first primer including a base sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3, and the second primer including a base sequence complementary to an extension product of the first primer when SEQ ID NO: 1 is used as a template in a polymerase-mediated primer extension reaction, and a detectably labeled hybridization probe, the probe including a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction carried out using the oligonucleotide primer set and the template including the base sequence of SEQ ID NO: 1. In some embodiments, the detectably labeled hybridization probe is a molecular torch hybridization probe including each of a fluorophore, a quencher, and a non-nucleotide linker. In some embodiments, the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution. In some embodiments, the base sequence complementary to the amplicon allows for RNA and DNA equivalent base substitutions and is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27. In some embodiments, the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:7, and SEQ ID NO:6. In some embodiments, the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO:3. In some embodiments, the promoter sequence is a T7 promoter sequence. In some embodiments, the second primer is up to 50 bases in length and comprises at least 17 consecutive bases of SEQ ID NO:13.In some embodiments, the second primer comprises a 3' end selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 17, and SEQ ID NO: 16. In some embodiments, the amplicon is an RNA amplicon having an opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum. In some embodiments, the reaction mixture comprises an RNA amplicon hybridized to a molecular torch hybridization probe. In some embodiments, the nucleic acid amplification reaction is a transcription-associated amplification reaction. In some embodiments, the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction.

[0011] In a fifth aspect, the disclosure relates to a kit of reagents for detecting nucleic acids of T. pallidum. The kit may include a set of oligonucleotide primers, a first primer of the set includes a target hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3, and a second primer of the set includes a target hybridizing sequence complementary to an extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction. The kit may further include a molecular torch hybridization probe of up to 50 bases in length, including a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO:19 or its complement, and further including each of a fluorophore moiety, a quencher moiety, a non-nucleotidic linker, and at least one nucleotide analogue including a ribofuranosyl moiety with a 2'-O-methyl substitution. There may also be one or more reagents for performing an in vitro nucleic acid amplification reaction using the set of primers. In some embodiments, the target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO:19 or its complement is a target hybridizing sequence of 13 to 22 consecutive bases of SEQ ID NO:21 or its complement. In some embodiments, the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27. In some embodiments, the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27. In some embodiments, each of the first and second primers is up to 50 bases in length. In some embodiments, there is a phage promoter sequence attached upstream of the target hybridizing sequence of the first primer. In some embodiments, the phage promoter sequence is a T7 promoter sequence. In some embodiments, the target hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7. In some embodiments, the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:8.In some embodiments, the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. In some embodiments, the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO:13. In some embodiments, the one or more reagents comprise each of a reverse transcriptase and a T7 RNA polymerase. [Brief description of the drawings]

[0012] [Figure 1A] 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1A shows results for System S2. Figure 1B shows results for System S3. Figure 1C shows results for System S4. [Figure 1B] 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1A shows results for System S2. Figure 1B shows results for System S3. Figure 1C shows results for System S4. [Figure 1C] 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1A shows results for System S2. Figure 1B shows results for System S3. Figure 1C shows results for System S4. [Figure 1D]Figures 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1D shows results from System S5. Figure 1E shows results from System S6. Figure 1F shows results from System S7. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acid and "Tdent" refers to results obtained using T. denticola target nucleic acid. [Figure 1E] Figures 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1D shows results from System S5. Figure 1E shows results from System S6. Figure 1F shows results from System S7. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acid and "Tdent" refers to results obtained using T. denticola target nucleic acid. [Figure 1F] Figures 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1D shows results from System S5. Figure 1E shows results from System S6. Figure 1F shows results from System S7. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acid and "Tdent" refers to results obtained using T. denticola target nucleic acid. [Figure 2A] Figures 2A-2B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 2A shows the results of biphasic amplification using oligonucleotides from system S5. Figure 2B shows the results of biphasic amplification using oligonucleotides from system S7. [Figure 2B]Figures 2A-2B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 2A shows the results of biphasic amplification using oligonucleotides from system S5. Figure 2B shows the results of biphasic amplification using oligonucleotides from system S7. [Figure 3A] Figures 3A-3B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 3A shows the sensitivity of the T. pallidum detection assay. Figure 3B shows that detection of T. pallidum nucleic acid is highly specific. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acid. [Figure 3B] Figures 3A-3B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 3A shows the sensitivity of the T. pallidum detection assay. Figure 3B shows that detection of T. pallidum nucleic acid is highly specific. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acid. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] Introduction and Overview The present disclosure provides a solution to the clinical need for a sensitive assay specific for T. pallidum. For example, the disclosure features a method useful for determining the presence of T. pallidum in a test sample obtained from a swab taken from an individual being tested for the bacterium. Specimens for determining the presence of T. pallidum can be obtained from the reproductive tract, cultures, bacterial lysates, and other sample media.

[0014] The present disclosure also provides a solution to the clinical need for T. pallidum specific assays by featuring oligonucleotides useful for determining the presence of T. pallidum in a test sample obtained, for example, from the human urethra, anal canal, respiratory tract, or lower genital tract. The featured oligonucleotides can be hybridization assay probes, capture probes, and / or amplification primers for detecting, immobilizing, and / or amplifying target nucleic acid sequences derived from T. pallidum in a test sample. Specifically disclosed are target regions for detecting T. pallidum in sequences derived from 23S rRNA or its complement.

[0015] In one embodiment of the present disclosure, a hybridization assay probe is provided that hybridizes to a 23S rRNA target region present in a nucleic acid derived from T. pallidum, or its complement, to form a detectable probe:target hybrid that indicates the presence of T. pallidum in a test sample. The primers and probes of this embodiment include oligonucleotides having a target binding region, the base sequence of which is contained within the base sequence of (SEQ ID NO: 1) or its complement, and which allow for RNA and DNA equivalent base substitutions and backbone modifications or analogs.

[0016] Oligonucleotide hybridization probes (or simply "probes") can be used, for example, under stringent hybridization assay conditions to preferentially detect target nucleic acids over nucleic acids derived from non-T. pallidum organisms, and particularly over nucleic acids derived from T. denticola.

[0017] The target binding region of the preferred probe may comprise DNA, RNA, a combination of DNA and RNA, or may comprise a nucleic acid analog (e.g., a peptide nucleic acid) or one or more modified nucleosides (e.g., a ribonucleoside having a ribofuranosyl moiety with a 2'-O-methyl substitution). The probes of the present disclosure are preferably oligonucleotides of at least 13 bases and up to 22, 25, 50, or even 100 bases in length. Most preferably, the hybridization probes of the present disclosure are nucleic acids or nucleic acid analogs consisting of the recited sequences, optionally including a detectable label or reporter group.

[0018] Although not required, the probe can contain a detectable label or a group of interacting labels. The label can be any suitable labeling substance, including but not limited to radioisotopes, enzymes, enzyme cofactors, enzyme substrates, dyes, haptens, chemiluminescent molecules, fluorescent molecules, phosphorescent molecules, electrochemiluminescent molecules, chromophores, base sequence regions that cannot stably bind to target nucleic acid under the conditions described, and mixtures thereof. The groups of interacting labels that can be used include but are not limited to enzyme / substrate, enzyme / cofactor, fluorophore / quencher, luminescent / adduct, dye dimer, and Forrester energy transfer pair.

[0019] In some embodiments, the probe comprises a homogeneous detectable label, such as a chemiluminescent label, that can be detected in a homogeneous assay format. Examples of preferred chemiluminescent labels include acridinium ester labels.

[0020] In addition to the base sequence of the target binding region, the hybridization assay probe of the present disclosure may include one or more base sequences that do not stably bind to nucleic acids derived from the target organism (i.e., T. pallidum) under stringent conditions. As an example, the additional base sequence may constitute the immobilized probe binding region of the capture probe, which is, for example, composed of a 3' poly(dA) region that hybridizes to a 5' poly(dT) region of a polynucleotide directly or indirectly bound to a solid support under stringent conditions. The additional base sequence may also be a 5' sequence that is recognized by RNA polymerase or enhances initiation or elongation by RNA polymerase (e.g., T7 promoter). When the first sequence is incorporated into, for example, a "molecular beacon" probe, multiple additional base sequences may be included. Molecular beacons are disclosed by Tyagi et al., "Detectably Labeled Dual Conformation Oligonucleotide Probes, Assays and Kits," U.S. Patent No. 5,925,517, and include a target binding region bound by two base sequences that have at least partially complementary regions to each other. "Molecular torches" are yet another example of dual-labeled structured hybridization probes that can be used to detect T. pallidum nucleic acid sequences or amplification products indicative of the presence of T. pallidum. As discussed elsewhere herein, molecular torch hybridization probes are disclosed by Becker et al., U.S. Patent No. 6,361,945. Molecular torches can include, for example, additional base sequences directly linked to the target binding region by a non-nucleotide (e.g., C9) linker.

[0021] Also contemplated is a composition that comprises a stable nucleic acid duplex formed between one or more oligonucleotides and nucleic acid amplification products under conditions that allow nucleic acid hybridization or nucleic acid amplification.For example, there may be RNA amplification products with polarity opposite to that of naturally occurring rRNA templates or targets, and the amplification products may be hybridized to synthetic oligonucleotides (e.g., primers or detectably labeled hybridization probes).In some embodiments, the hybridization probe may be a dual-labeled hybridization probe that comprises a fluorophore and a quencher.Such probes include molecular beacons, molecular torches, and hydrolysis probes.

[0022] In another embodiment, the present disclosure contemplates a probe mixture useful for determining whether T. pallidum organisms are present in a test sample. For example, to determine the presence of these organisms, the probe mixture can include one or more of the T. pallidum probes described herein.

[0023] In a further embodiment, the present disclosure provides a capture probe comprising at least one oligonucleotide comprising an immobilized probe binding region and a target binding region. The immobilized probe binding region of the capture probe may comprise any base sequence capable of stably hybridizing to the oligonucleotide bound to the solid support present in the test sample under stringent conditions. Preferably, the immobilized probe binding region is a poly(dA), homopolymeric tail located at the 3' end of the capture probe. In this embodiment, the oligonucleotide bound to the solid support will comprise a 5' poly(dT) tail of sufficient length to stably bind to the poly(dA) tail of the capture probe under assay conditions. In a preferred embodiment, the immobilized probe binding region comprises a poly(dA) tail that is about 30 adenines in length, and the capture probe comprises a spacer region that is about 3 thymines in length to link the target binding region and the immobilized probe binding region to each other.

[0024] The present disclosure also features amplification primers useful for detecting the presence of T. pallidum nucleic acid in an amplification assay. In one preferred embodiment, each amplification primer comprises an oligonucleotide, and the base sequence of the target binding region of the primer has or substantially corresponds to the base sequence contained in SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5. Specific examples of target-complementary oligonucleotide sequences used to prime nucleic acid synthesis are given by SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. The amplification primers of the present disclosure optionally include a 5' promoter sequence that is recognized by an RNA polymerase or enhances initiation or elongation by an RNA polymerase. When included, a T7 promoter such as AATTTAATACGACTCACTATAGGGAGA (SEQ ID NO:9) is preferred. Specific examples of T7 promoter-primers disclosed herein include SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0025] The amplification primers of the present disclosure are preferably used in a set of at least two amplification primers. A preferred set includes a first amplification primer comprising an oligonucleotide having a target binding region, the base sequence of which comprises at least about 80% complementary (more preferably at least about 90% complementary, most preferably 100% complementary) to a region of at least 18 consecutive bases present in a target sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. Optionally, the first amplification primer comprises a promoter sequence attached upstream (e.g., at its 5' end) of the target hybridization sequence. A second amplification primer of these preferred sets comprises an oligonucleotide having a target binding region, the base sequence of which comprises at least about 80% complementary (more preferably at least about 90% complementary, most preferably 100% complementary) to a region of at least 17 consecutive bases present in a target sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0026] The nucleic acid amplification product (i.e., "amplicon") synthesized by the combined use of the first and second amplification primers can be detected by the use of a labeled hybridization probe. In certain embodiments, the hybridization probe comprises a sequence of at least 13, 14, 16, or 22 contiguous bases of any of the sequences SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21, each of which allows for the substitution of its complement and RNA and DNA equivalent bases.

[0027] The present disclosure further features a method for determining whether T. pallidum is present in a test sample. In one embodiment, the method includes (a) contacting the test sample with one of the above hybridization assay probes for detecting T. pallidum (e.g., containing a nucleic acid amplification product) under conditions that allow the probe to preferentially hybridize to a target nucleic acid derived from T. pallidum, thereby forming a stable probe:target hybrid for detection, and (b) determining whether a hybrid is present in the test sample as an indication of the presence or absence of T. pallidum in the test sample. The method may further include a step of quantifying the amount of hybrid present in the test sample as a means to estimate the amount of T. pallidum present in the test sample. Preferably, the probe includes a detectable label, which produces a detectable signal indicating that the probe is hybridized to a nucleic acid derived from T. pallidum and not another species. For example, the signal may be at least 2-fold, at least 5-fold, at least 10-fold, or at least 500-fold stronger when the probe is hybridized to nucleic acid derived from T. pallidum compared to when the probe is hybridized to nucleic acid derived from T. pallidum.

[0028] The disclosure also features a method for amplifying a target nucleic acid sequence present in nucleic acid derived from T. pallidum present in a test sample, the method including the steps of (a) contacting the test sample under amplification conditions with at least one of the amplification primers described above, and (b) amplifying the target nucleic acid sequence. A preferred amplification method will include at least two sets of the amplification primers described above.

[0029] In one embodiment, a method for amplifying a target nucleic acid sequence present in a nucleic acid derived from T. pallidum will further comprise: (a) contacting the test sample with a hybridization assay probe that preferentially hybridizes to the target nucleic acid sequence, or its complement, under stringent hybridization conditions, thereby forming a stable probe:target hybrid for detection; and (b) determining whether a hybrid is present in the test sample as an indication of the presence or absence of T. pallidum in the test sample. This may include determining whether a nucleic acid amplification product is synthesized using a primer according to the present disclosure. The above hybridization assay probe is particularly preferred for this method.

[0030] The present disclosure also features reaction mixtures that can be used to detect nucleic acids of T. pallidum. These reaction mixtures can include a sample under test, a set of primers, and a detectably labeled hybridization probe. The primers and probes have sequences according to the disclosure and claims herein.

[0031] The present disclosure also features a kit for amplifying a target nucleic acid sequence present in a nucleic acid derived from T. pallidum, the kit comprising at least one of the above amplification primers and one or more hybridization probes for detecting T. pallidum nucleic acid. In further embodiments, the kits may comprise at least one of the above capture probes in addition to the amplification primers and hybridization probes. Such kits may further comprise a solid support material for immobilizing the capture probe in the test sample.

[0032] Detailed Description Disclosed herein are oligonucleotides that target nucleic acids derived from T. pallidum, which are useful for determining the presence or absence of T. pallidum in a test sample. Oligonucleotides can aid in the detection of T. pallidum in different ways, such as by functioning as hybridization assay probes, capture probes, and / or amplification primers. Hybridization assay probes of the present disclosure can preferentially hybridize to target nucleic acid sequences present in nucleic acids derived from T. pallidum under stringent hybridization assay conditions to form detectable duplexes that indicate the presence of T. pallidum in a test sample. Preferred probes can distinguish between a target organism and its closest known phylogenetic neighbor. Capture probes of the present disclosure can hybridize to target nucleic acid sequences present in nucleic acids derived from T. pallidum under stringent hybridization assay conditions and can be used to isolate target nucleic acids from clinical specimens. Amplification primers of the present disclosure can hybridize to target nucleic acid sequences present in nucleic acids derived from T. pallidum under amplification conditions and can be used as primers in an amplification reaction to produce nucleic acids derived from T. pallidum. The probes and amplification primers can be used in assays to detect and / or quantitate T. pallidum in a test sample.

[0033] Those skilled in the art will understand that the hybridization assay probes of the present disclosure can be used as amplification primers or capture probes, and that the target binding regions of the amplification primers of the present disclosure can be used as hybridization assay probes or capture probes, depending on the degree of specificity required by a particular assay, and that the target binding regions of the capture probes of the present disclosure can be used as hybridization assay probes or amplification primers, depending on the degree of specificity required by a particular assay.Thus, the present disclosure contemplates oligonucleotides for use in determining the presence or absence of T. pallidum in a test sample, comprising, consisting essentially of, or consisting of any of the nucleotide base sequences disclosed herein, optionally including one or more nucleotide analogs.

[0034] definition The following terms have the meanings specified herein unless expressly indicated to have a different meaning.

[0035] The terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, a "nucleic acid" as used herein is understood to refer to one or more nucleic acids. Thus, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0036] "Sample" or "test sample" refers to any material suspected of containing a target organism or nucleic acid derived from a target organism. This material may be, for example, an unprocessed clinical specimen such as a sputum or urethral specimen, a buffered medium containing the specimen, a medium containing a lysis agent for releasing the specimen and nucleic acid belonging to the target organism, or a medium containing nucleic acid derived from the target organism isolated and / or purified in a reaction vessel or on a reaction material or device. As used herein, the terms "sample" and "test sample" may refer to the specimen in its raw form or any processing step to release, isolate, and purify nucleic acid derived from the target organism in the specimen.

[0037] As used herein, a "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group, a five-carbon sugar, and a nitrogenous base (also referred to herein as a "nucleobase"). The five-carbon sugar found in RNA is ribose. In DNA, the five-carbon sugar is 2'-deoxyribose. The term also includes analogs of such subunits, such as a methoxy group at the 2' position of ribose (also referred to herein alternatively as "2'-O-methyl" or "2'-O-Me" or "2'-methoxy" or "2'-OMe").

[0038] "Analog" refers to two or more compounds that exhibit similar or related chemical structures. Despite sharing common structural similarities, analogs may have significantly different biochemical properties.

[0039] "Nucleic acid" and "polynucleotide" refer to polymeric compounds that contain nucleotides or nucleotide analogs with nitrogenous heterocyclic bases or base analogs linked together to form polynucleotides, including polymers that are conventional RNA, DNA, mixed RNA-DNA, and analogs thereof. The nucleic acid "backbone" can be composed of a variety of linkages, including sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar portion of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions (e.g., 2' methoxy or 2' halide substitutions). The nitrogenous bases can be the conventional bases (A, G, C, T, U), their analogs (e.g., inosine or others, The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992), purine or pyrimidine derivatives (e.g., N 4 -methyldeoxyguanosine, deaza or azapurines, deaza or azapyrimidines, pyrimidine bases with substituents at the 5- or 6-position, purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4-alkyl-pyrimidines, U.S. Patent No. 5,378,825 and PCT Publication No. 93 / 13121). Nucleic acids may contain one or more "non-basic" residues in which the backbone does not contain a nitrogenous base at the position of the polymer (U.S. Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy backbones, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), analogs that contain one or more LNA nucleotide monomers with bicyclic furanose units locked into the RNA that mimic the sugar configuration, which enhances hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Examples of oligomers that may affect the stability of a hybridization complex include PNA oligomers, oligomers containing 2'-methoxy or 2'-fluoro substituted RNA, or oligomers that affect the overall charge, charge density, or steric association of a hybridization complex, including oligomers containing charged linkages (e.g., phosphorothioates) or neutral groups (e.g., methylphosphonates). Unless otherwise indicated, 5-methylcytosine may be used with any of the above backbones / sugars / linkages, including RNA or DNA backbones (or mixtures thereof). When referring to a range of lengths of oligonucleotides, amplicons, or other nucleic acids, it is understood that the range includes all integers (e.g., a length of 19 to 25 contiguous nucleotides includes 19, 20, 21, 22, 23, 24, and 25).

[0040] "Oligomer," "oligonucleotide," or "oligo" generally refers to a nucleic acid less than 1,000 nucleotides (nt), including those in a size range having a lower limit of about 2-5 nucleotides and an upper limit of about 500-900 nucleotides. Some particular embodiments are oligomers in a size range having a lower limit of about 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides and an upper limit of about 50-60 nucleotides, and other particular embodiments are in a size range having a lower limit of about 10-20 nucleotides and an upper limit of about 22-100 nucleotides. Oligomers may be purified from naturally occurring sources, but may also be synthesized using any well-known enzymatic or chemical method. The term oligonucleotide does not imply any particular function of the reagent, but rather is used generically to encompass all such reagents described herein. Oligonucleotides may serve a variety of different functions. For example, an oligonucleotide can function as a primer if it is specific to a complementary strand, can hybridize to it, and can be further extended in the presence of a nucleic acid polymerase; it can function as a primer if it contains a sequence recognized by an RNA polymerase and allows transcription, and can provide a promoter (e.g., T7 primer); it can function to detect a target nucleic acid if it can hybridize to a target nucleic acid or its amplicon and further provides a detectable moiety (e.g., an acridinium-ester compound).Oligomers can be referred to by their functional names (e.g., capture probe, primer, or promoter-primer), but those skilled in the art will understand that such terms refer to oligomers.

[0041] Oligonucleotides of defined sequences can be produced by techniques known to those skilled in the art, for example, by chemical or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules (e.g., bacterial or retroviral vectors).As contemplated by the present disclosure, oligonucleotides may not consist of wild-type chromosomal DNA or its in vivo transcription products.For example, oligonucleotide hybridization probes can include non-nucleotide linkers and / or detectable labels not found in naturally occurring nucleic acids.

[0042] "Detection probe oligomer", "detection probe", or "probe" refers to an oligomer that specifically hybridizes to a target sequence, including an amplification sequence, under conditions that promote nucleic acid hybridization for detection of a target nucleic acid. Detection can be either direct (i.e., a probe hybridized directly to the target or its amplification product) or indirect (i.e., a probe hybridized to an intermediate structure that binds the probe to the target or its amplification product). Detection probes can be DNA, RNA, analogs thereof, or combinations thereof (e.g., DNA / RNA chimeras), and they can be labeled or unlabeled. Detection probes can further include alternative backbone linkages (e.g., 2'-O-methyl linkages). The target sequence of a probe generally refers to the specific sequence within a larger sequence to which the probe specifically hybridizes. Detection probes can include target-specific and non-target-specific sequences. Such non-target specific sequences may include sequences that will impart desired secondary or tertiary structures, such as hairpin structures, that can be used to facilitate detection and / or amplification (see, e.g., U.S. Patent Nos. 5,118,801, 5,312,728, 6,835,542, and 6,849,412). Probes of defined sequences may be produced by techniques known to those of skill in the art, such as by chemical synthesis and by in vitro or in vivo expression from recombinant nucleic acid molecules.

[0043] "Label" or "detectable label" refers to a moiety or compound directly or indirectly attached to a probe that is detected or produces a detectable signal. Direct attachment can use covalent or non-covalent interactions (e.g., hydrogen bonds, hydrophobic or ionic interactions, and chelate or coordinate complex formation), while indirect attachment can use a bridging moiety or linker (e.g., via an antibody or additional oligonucleotide). Any detectable moiety can be used, including radionuclides, ligands such as biotin or avidin, or even polynucleotide sequences, enzymes, enzyme substrates, reactive groups, chromophores, such as dyes or particles that impart detectable color (e.g., latex or metal beads), luminescent compounds (e.g., bioluminescent, phosphorescent, or chemiluminescent compounds), and fluorescent compounds or moieties (i.e., fluorophores). Embodiments of fluorophores include those that absorb light in the range of about 495-650 nm and emit light in the range of about 520-670 nm, including those known as FAM™, TET™, CAL FLUOR™ (Orange or Red), and QUASAR™ compounds. Fluorophores may be used in combination with a quencher molecule that absorbs light when in close proximity to the fluorophore, reducing background fluorescence. Such quenchers are well known in the art and include, for example, BLACK HOLE QUENCHER™ (or BHQ™) compounds or TAMRA™ compounds. Certain embodiments include "homogeneous detectable labels" that are detectable in a homogeneous system in which bound labeled probes in a mixture exhibit a detectable change compared to unbound labeled probes, allowing the label to be detected without physically removing hybridized from unhybridized labeled probes (e.g., U.S. Pat. Nos. 5,283,174, 5,656,207, and 5,658,737). Certain homogeneous detectable labels include acridinium ester ("AE") compounds, such as chemiluminescent compounds, including well-known standard AE or AE derivatives (U.S. Pat. Nos. 5,656,207, 5,658,737, and 5,639,604).Methods for synthesizing labels, binding labels to nucleic acids, and detecting signals from labels are well known (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Chapter 10, and U.S. Patent Nos. 5,658,737, 5,656,207, 5,547,842, 5,283,174, and 4,581,333, and European Patent Application No. 0 747 706). Certain methods for binding AE compounds to nucleic acids are known (e.g., see U.S. Patent Nos. 5,585,481 and 5,639,604, column 10, line 6 to column 11, line 3, and Example 8). Specific AE labeling locations are the central region of the probe and near the region of A / T base pairs, the 3' or 5' end of the probe, or at or near the mismatch site with a known sequence that the probe should not detect compared to the desired target sequence. Other detectably labeled probes include TaqMan™ probes, molecular torches, and molecular beacons. TaqMan™ probes contain donor and acceptor labels, where fluorescence is detected when the probe is enzymatically degraded during amplification to release the fluorophore from the presence of the quencher. Molecular torches and beacons exist in open and closed configurations, where the closed configuration quenches the fluorophore and the open position separates the fluorophore from the quencher to allow fluorescence. Hybridization to the target nucleic acid opens the probe, which is otherwise closed.

[0044] By "stable", "stable" or "stable for detection" is meant that the temperature of the reaction mixture is at least 2° C. below the melting temperature of the nucleic acid duplex. More preferably, the temperature of the reaction mixture is at least 5° C. below the melting temperature of the double-stranded nucleic acid, and even more preferably, at least 10° C. below the melting temperature of the reaction mixture.

[0045] "Substantially homologous", "substantially corresponding" or "substantially corresponding" means that the subject oligonucleotide has a base sequence that includes at least about 80% homology, preferably at least about 90% homology, and most preferably 100% homology with at least 10 consecutive base regions present in a reference base sequence (excluding RNA and DNA equivalents). (Those skilled in the art will easily understand the appropriate modifications that can be made to hybridization assay conditions at various percentages of homology to allow hybridization of oligonucleotides to target sequences while preventing a level of non-specific hybridization sufficient to interfere with detection of target nucleic acid.) The degree of similarity is determined by comparing the order of the nucleic acid bases that make up the two sequences, and does not take into account other structural differences that may exist between the two sequences, so long as the structural differences do not prevent hydrogen bonding with complementary bases. The degree of homology between two sequences can also be expressed in terms of the number of base differences between each set of at least 10 contiguous bases compared, which can be 0, 1, or 2 base differences.

[0046] "Substantially complementary" means that the subject oligonucleotide has a base sequence that includes a region of at least 10 consecutive bases that is at least 80% complementary, preferably at least 90% complementary, and most preferably 100% complementary to a region of at least 10 consecutive bases present in a target nucleic acid sequence (excluding RNA and DNA equivalents). Those skilled in the art will easily understand the appropriate modifications that can be made to hybridization assay conditions at various percentages of complementarity to allow hybridization of the oligonucleotide to the target sequence while preventing a level of non-specific hybridization sufficient to interfere with the detection of the target nucleic acid. The degree of complementarity is determined by comparing the order of the nucleic acid bases that make up the two sequences, without taking into account other structural differences that may exist between the two sequences, provided that the structural differences do not prevent hydrogen bonding with complementary bases. The degree of complementarity between two sequences can also be expressed in terms of the number of base mismatches present in each set of at least 10 consecutive bases compared, which can be 0, 1, or 2 base mismatches.

[0047] Temperatures, concentrations, and times discussed in this disclosure are preceded by an implicit "about" and it will be understood that minor, non-substantial deviations are within the scope of the present teachings. In general, the term "about" refers to non-substantial variations in the amounts of components of a composition that do not have any significant effect on the activity or stability of the composition. All ranges should be interpreted as including the endpoints unless expressly excluded, such as "not including the endpoints," thus, for example, "within 10 to 15" includes the values ​​10 and 15.

[0048] "RNA and DNA equivalents" refers to RNA and DNA molecules that have essentially the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar moieties (i.e., ribose versus deoxyribose) and may further differ by the presence of uracil in RNA and thymine in DNA. Because RNA and DNA equivalents have the same degree of complementarity to a particular sequence, the differences between RNA and DNA equivalents do not contribute to differences in homology.

[0049] "RNA and DNA equivalent base" refers to a nucleotide base that has the same complementary base pair hybridization properties in RNA and DNA. Here, the base uracil can be used instead of the base thymine, and vice versa, and therefore uracil and thymine are RNA and DNA equivalent bases. The polynucleotide base sequence 5'-AGCT-3', which allows for the substitution of RNA and DNA equivalent bases, would also describe the sequence 5'-AGCU-3'. Since RNA and DNA equivalents have the same degree of complementarity to a particular sequence, the difference between the RNA equivalent base and the DNA equivalent base does not contribute to the difference in homology.

[0050] The term "complement" refers to a nucleic acid molecule that contains a contiguous nucleic acid sequence (for standard nucleotides, A:T, A:U, C:G) that is complementary to a contiguous nucleic acid sequence of another nucleic acid molecule. For example, 5'-AACTGUC-3' is the complement of 5'-GACAGTT-3'.

[0051] As used herein, a "target nucleic acid" (or sometimes simply "target") is a nucleic acid that contains a sequence to be amplified and / or detected. A target nucleic acid may be DNA or RNA and may be either single-stranded or double-stranded. A target nucleic acid may contain other sequences other than the target sequence that may not be amplified. Examples of target nucleic acids include 16S rRNA and 23S rRNA. The claims may limit the target sequence to the specific meaning of the recited sequence, provided that complementary sequences are excluded.

[0052] The term "target sequence" as used herein refers to a specific nucleotide sequence of a target nucleic acid to be amplified and / or detected. "Target sequence" includes a complexing sequence to which an oligonucleotide (e.g., a priming oligonucleotide and / or a promoter oligonucleotide) is complexed during an amplification process (e.g., PCR, TMA). If the target nucleic acid is originally single-stranded, the term "target sequence" will also refer to a sequence complementary to the "target sequence" present in the target nucleic acid. If the target nucleic acid is originally double-stranded, the term "target sequence" refers to both the sense (+) strand and the antisense (-) strand.

[0053] "Target hybridizing sequence of bases" or "target hybridizing sequence" or "target specific sequence" are used herein to refer to a portion of an oligomer configured to hybridize with a target nucleic acid sequence. Preferably, the target hybridizing sequence is configured to specifically hybridize with a target nucleic acid sequence. Target hybridizing sequences may be, but are not necessarily, 100% complementary to the portion of the target sequence to which they are configured to hybridize. Target hybridizing sequences may also include inserted, deleted, and / or substituted nucleotide residues compared to the target sequence. Less than 100% complementarity of a target hybridizing sequence to a target sequence may occur when the target nucleic acid is multiple strains within a species, for example, as in the case of an oligomer configured to hybridize to a sequence variant. It is understood that there are other reasons for configuring a target hybridizing sequence to have less than 100% complementarity to a target nucleic acid.

[0054] "Hybridization" or "hybridize" refers to the ability of two fully or partially complementary nucleic acid strands to come together and form a stable structure having a double-stranded region under specified hybridization assay conditions in a parallel or antiparallel orientation. The two constituent strands of this double-stranded structure, sometimes called a hybrid, are held together by hydrogen bonds. These hydrogen bonds are most commonly formed between nucleotides containing the bases adenine and thymine or uracil (A and T or U) or cytosine and guanine (C and G) on a single nucleic acid strand, although base pairing can also be formed between bases that are not members of these "canonical" pairs. Non-canonical base pairing is known in the art. See, for example, RLP Adams et al., The Biochemistry of the Nucleic Acids (11th ed. 1992).

[0055] "Preferentially hybridize" means that under stringent hybridization assay conditions, hybridization assay probes can hybridize to their target nucleic acids to form stable probe:target hybrids ("detectable hybrids") that indicate the presence of at least one organism of interest, and that a sufficient number of detectable stable probe:non-target hybrids are not formed to indicate the presence of non-target organisms ("non-detectable hybrids"), especially phylogenetically closely related organisms. Thus, the probes hybridize to the target nucleic acids to a sufficiently greater extent than the non-target nucleic acids to allow one of skill in the art to accurately detect the presence (or absence) of nucleic acids from T. pallidum and distinguish its presence from the presence of phylogenetically closely related organisms in a test sample. In general, decreasing the degree of complementarity between an oligonucleotide sequence and its target sequence will decrease the degree or rate of hybridization of the oligonucleotide to its target region. However, the inclusion of one or more non-complementary bases may facilitate the ability of the oligonucleotide to distinguish non-target organisms.

[0056] Preferential hybridization can be measured using any of a variety of techniques known in the art, including but not limited to those based on luminescence, mass change, and conductivity or turbidity change.Several detection means are described herein, one of which is used in particular in the examples provided below.Preferably, there is at least a 10-fold difference between target hybridization signal and non-target hybridization signal in test sample, more preferably at least a 100-fold difference, and most preferably at least a 500-fold difference.Preferably, non-target hybridization signal in test sample is below background signal level.

[0057] "Stringent hybridization assay conditions", "hybridization assay conditions", "stringent hybridization conditions", or "stringent conditions" refer to conditions that allow a hybridization assay probe to hybridize preferentially to target nucleic acids (preferably rRNA or rDNA) derived from T. pallidum over nucleic acids derived from closely related non-target microorganisms. Stringent hybridization assay conditions can vary depending on factors including the GC content and length of the probe, the degree of similarity between the probe sequence and the sequences of non-target sequences that may be present in the test sample, and the degree of similarity between the probe sequence and the target sequence. Hybridization conditions include temperature and the composition of the hybridization reagent or solution. The Examples section below provides preferred hybridization assay conditions for detecting target nucleic acids derived from T. pallidum using the probes of the present disclosure, although other stringent conditions can be readily ascertained by one of skill in the art.

[0058] "Assay conditions" refers to conditions that allow for stable hybridization of an oligonucleotide to a target nucleic acid. Assay conditions do not require preferential hybridization of an oligonucleotide to a target nucleic acid.

[0059] "Homogeneous detectable label" refers to a label that can be detected in a homogeneous manner by determining whether the label is on the probe hybridized to the target sequence. That is, homogeneous detectable label can be detected without physically removing the unhybridized form of the label or the hybridized one from the labeled probe. When using the labeled probe to detect the amplified nucleic acid, homogeneous detectable label is preferred. Examples of homogeneous labels are described in detail in U.S. Patent No. 5,283,174 to Arnold et al., U.S. Patent No. 5,656,207 to Woodhead et al., and U.S. Patent No. 5,658,737 to Nelson et al. Preferred labels for use in homogeneous assays include chemiluminescent compounds (see, for example, U.S. Patent No. 5,656,207 to Woodhead et al., U.S. Patent No. 5,658,737 to Nelson et al., and U.S. Patent No. 5,639,604 to Arnold, Jr. et al.). Preferred chemiluminescent labels are acridinium ester ("AE") compounds, such as standard AE or its derivatives (e.g., naphthyl-AE, ortho-AE, 1- or 3-methyl-AE, 2,7-dimethyl-AE, 4,5-dimethyl-AE, ortho-dibromo-AE, ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE, ortho-methoxy(cinnamyl)-AE, ortho-methyl-AE, ortho-fluoro-AE, 1- or 3-methyl-ortho-fluoro-AE, 1- or 3-methyl-meta-difluoro-AE, and 2-methyl-AE).

[0060] "Homogeneous assay" refers to a detection procedure that does not require physical separation of hybridized from unhybridized probes prior to determining the degree of specific probe hybridization. Exemplary homogeneous assays, such as those described herein, can use molecular torches, molecular beacons, or other self-reporting probes that emit a fluorescent signal when hybridized to an appropriate target, chemiluminescent acridinium ester labels that can be selectively destroyed by chemical means if not present in the hybrid duplex, and other homogeneously detectable labels that will be familiar to those of skill in the art.

[0061] By "nucleic acid duplex," "duplex," "nucleic acid hybrid," or "hybrid" is meant a stable nucleic acid structure that contains double-stranded hydrogen-bonded regions. Such hybrids include RNA:RNA, RNA:DNA, and DNA:DNA double-stranded molecules, and analogs thereof. The structure is sufficiently stable to be detectable by any known means.

[0062] An "amplification oligonucleotide" or "amplification oligomer" is an oligonucleotide that hybridizes to a target nucleic acid or its complement and participates in a nucleic acid amplification reaction (e.g., functions as a primer or promoter-primer). Particular amplification oligomers contain at least about 10 contiguous bases, optionally at least 17, 18, 19, 20, 21, or 22 contiguous bases, that are complementary to a region of the target nucleic acid sequence or its complementary strand. The contiguous bases may be at least about 80%, at least about 90%, or fully complementary to the target sequence to which the amplification oligomer binds. One of skill in the art will appreciate that the recited ranges include all integers and rational numbers within the range (e.g., 92% or 98.377%). Particular amplification oligomers are about 17 to about 50 bases in length, or more preferably about 17 to about 22 bases in length, and may optionally include modified nucleotides or extra base sequences not found in T. pallidum attached at the 5' end.

[0063] A "primer" is an amplification oligomer that hybridizes to a template nucleic acid and has a 3' end that is extended by a polymerase enzyme. A primer may be optionally modified (e.g., by including a 5' region that is non-complementary to the target sequence). Such modifications may include functional additions such as tags, promoters, or other non-target specific sequences that are used or useful for manipulating or amplifying the primer or target oligonucleotide.

[0064] Within the context of transcription-mediated amplification, a primer modified with a 5' promoter sequence is referred to herein as a "promoter-primer". Those skilled in the art of molecular biology or biochemistry will understand that an oligomer capable of functioning as a primer can be modified to include a 5' promoter sequence and then function as a promoter-primer, and similarly, any promoter-primer can serve as a primer with or without its 5' promoter sequence. A promoter-primer modified to incorporate a 3' blocked end is referred to herein as a "promoter provider", which can hybridize to a target nucleic acid and provide an upstream promoter sequence that serves to initiate transcription, but does not provide a primer for oligo extension.

[0065] "Nucleic acid amplification" or "target amplification" or simply "amplification" refers to any in vitro procedure that produces multiple copies of a target nucleic acid sequence, or its complement, or fragments thereof (i.e., amplified sequences that contain less than the entire target nucleic acid). Examples of nucleic acid amplification procedures include transcription-related methods, such as transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA) and others (e.g., U.S. Pat. Nos. 5,399,491, 5,554,516, 5,437,990, 5,130,238, 4,868,105, and 5,124,246), replicase-mediated amplification (e.g., U.S. Pat. Nos. 4,786,602, 4,786,602, and 4,786,602). 0), polymerase chain reaction (PCR) (e.g., U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), ligase chain reaction (LCR) (e.g., European Patent No. 0320308), helicase-dependent amplification (e.g., U.S. Pat. No. 7,282,328), and strand displacement amplification (SDA) (e.g., U.S. Pat. No. 5,422,252). Amplification can be linear or exponential. PCR amplification uses DNA polymerase, primers, and thermal cycling steps to synthesize multiple copies of two complementary strands of DNA or cDNA. LCR amplification uses at least four separate oligonucleotides to amplify a target and its complementary strand by using multiple cycles of hybridization, ligation, and denaturation. Helicase-dependent amplification uses a helicase to separate the two strands of a DNA duplex to produce a single-stranded template, followed by hybridization of a sequence-specific primer that hybridizes to the template and extension by DNA polymerase to amplify the target sequence. SDA uses a primer that contains a recognition site for a restriction endonuclease that nicks one strand of a semi-modified DNA duplex containing the target sequence, followed by amplification in a series of primer extension and strand displacement steps. Replicase-mediated amplification uses self-replicating RNA molecules and a replicase, such as Qβ-replicase. Although certain embodiments use PCR or TMA, it will be apparent to one skilled in the art that the oligomers disclosed herein can be readily used as primers in other amplification methods.

[0066] Transcription-associated amplification uses oligonucleotides containing DNA polymerase, RNA polymerase, deoxyribonucleoside triphosphates, ribonucleoside triphosphates, a promoter, and optionally other oligonucleotides, to ultimately produce multiple RNA transcripts from a nucleic acid template (see, e.g., U.S. Pat. Nos. 5,399,491 and 5,554,516 to Kacian et al., U.S. Pat. No. 5,437,990 to Burg et al., PCT Publication Nos. 88 / 01302 and 88 / 10315 to Gingeras et al., U.S. Pat. No. 5,130,238 to Malek et al., U.S. Pat. Nos. 4,868,105 and 5,124,246 to Urdea et al., PCT Publication Nos. 94 / 03472 to McDonough et al., and PCT Publication No. 95 / 03430 to Ryder et al.). (E.g., U.S. Pat. Nos. 5,399,491 and 5,554,516). Methods using TMA have been described in detail previously (e.g., U.S. Pat. Nos. 5,399,491 and 5,554,516).

[0067] "Amplification conditions" refers to conditions that permit nucleic acid amplification. The Examples section below provides preferred amplification conditions for amplifying target nucleic acid sequences from T. pallidum using the primers of the present disclosure in a transcription-mediated amplification method, although other acceptable amplification conditions can be readily determined by one of skill in the art depending on the particular amplification method desired.

[0068] By "reverse sense" or "reverse strand" is meant a nucleic acid molecule that is completely complementary to a reference or sense nucleic acid strand.

[0069] By "sense," "homogeneous sense," or "positive sense" is meant a nucleic acid molecule that is completely homologous to a reference nucleic acid molecule.

[0070] "Amplicon" refers to a nucleic acid molecule produced in a nucleic acid amplification reaction that is derived from a target nucleic acid. The amplicon contains a target nucleic acid sequence that can be of the same sense or the opposite sense as the target nucleic acid. "Derived from" means that the nucleic acid referred to is obtained directly from the target organism or indirectly as a product of nucleic acid amplification, which product can be, for example, an antisense RNA molecule that is not present in the target organism.

[0071] By "capture probe" is meant an oligonucleotide or a set of at least two oligonucleotides bound together that can hybridize to a target nucleic acid and an immobilized probe, thereby providing a means for immobilizing and isolating a target nucleic acid in a test sample. That portion of the capture probe that hybridizes to the target nucleic acid is called the "target binding region" and that portion of the capture probe that hybridizes to the immobilized probe is called the "immobilized probe binding region". Although preferred capture probes hybridize to both the target nucleic acid and the immobilized probe under assay conditions, the target binding region and the immobilized probe binding region can be designed to hybridize to their respective target sequences under different hybridization conditions. In this way, the capture probe can be designed to first hybridize to the target nucleic acid under more favorable solution phase kinetics before adjusting the conditions that allow hybridization of the immobilized probe binding region to the immobilized probe. When the target binding and immobilized probe binding regions are provided on the same capture probe, they may be directly adjacent to each other on the same oligonucleotide, they may be separated from each other by one or more optionally modified nucleotides, or they may be linked to each other by a non-nucleotide linker.

[0072] "Target hybridizing sequence" or "target binding region" refers to a portion of an oligonucleotide that stably binds to a target sequence present in a target nucleic acid, the DNA or RNA equivalent of the target sequence, or the complement of the target sequence under assay conditions. Assay conditions can be stringent hybridization conditions or amplification conditions.

[0073] By "immobilized probe binding region" is meant that portion of an oligonucleotide that hybridizes to an immobilized probe under assay conditions.

[0074] In the claims, "homopolymer tail" means a consecutive base sequence of at least 10 identical bases (eg, 10 consecutive adenines or thymines).

[0075] "Immobilized probe" refers to an oligonucleotide for binding a capture probe to an immobilized support. The immobilized probe is bound to a solid support either directly or indirectly by a bond or interaction, and remains stable under the conditions used to hybridize the capture probe to the target nucleic acid and the immobilized probe, whether those conditions are the same or different. The immobilized probe facilitates the separation of the bound target nucleic acid from the unbound material in the sample.

[0076] By "isolate" or "isolating" is meant that at least a portion of the target nucleic acid present in a test sample is concentrated in a reaction vessel, or on a reaction device or solid support (e.g., a test tube, cuvette, microtiter plate well, nitrocellulose filter, slide, or pipette tip) in a fixed or releasable manner such that the target nucleic acid can be purified without significant loss of the target nucleic acid from the vessel, device, or support.

[0077] "Separate," "separate," "separating," or "purify," "purified," or "purifying" means that one or more components of a sample contained in or on a container, device, or carrier are physically removed from one or more other sample components present in or on the container, device, or carrier. Sample components that may be removed during a separation or purification step include proteins, carbohydrates, lipids, inhibitors, non-target nucleic acids, and unbound probes. Preferably, target nucleic acids bound to immobilized capture probes are retained in the sample during the separation or purification step.

[0078] By "species-specific" it is meant that the referenced hybridization assay probe is capable of preferentially detecting (e.g., under stringent hybridization assay conditions) a target nucleic acid sequence present in nucleic acid derived from organisms belonging to the species T. pallidum.

[0079] "Consisting essentially of" means that additional components, compositions, or method steps that do not materially change the basic and novel characteristics of the invention may be included in the composition or kit or method of the invention. Any components, compositions, or method steps that materially affect the basic and novel characteristics of the invention will not fall within this term. For example, additions or deletions to an oligonucleotide may be non-material changes that do not prevent the oligonucleotide from having its claimed properties (i.e., hybridizing preferentially to target nucleic acids over non-target nucleic acids under stringent hybridization assay conditions). An oligonucleotide may contain other nucleic acid molecules that are not involved in and do not affect hybridization of the probe to the target nucleic acid.

[0080] Hybridization conditions and probe design Hybridization reaction conditions, most importantly, the temperature of hybridization and the concentration of salt in the hybridization solution can be selected to allow the hybridization assay probe of the present disclosure to preferentially hybridize to nucleic acids having target nucleic acid sequences derived from T. pallidum. At reduced salt concentration and / or elevated temperature (conditions of increased stringency), the degree of nucleic acid hybridization decreases when hydrogen bonds between paired nucleotide bases in double-stranded hybrid molecules are broken. This process is known as "melting".

[0081] Generally speaking, the most stable hybrids are those that have the greatest number of contiguous perfectly matched (i.e. hydrogen bonded) nucleotide base pairs. Such hybrids are usually expected to melt last when the stringency of hybridization conditions is increased. However, double-stranded nucleic acid regions that contain one or more mismatches, "non-canonical", or imperfect base pairs (resulting in weaker or non-existent base pairing at that position in the nucleotide sequence of the nucleic acid) may still be sufficiently stable under relatively high stringency conditions, allowing nucleic acid hybrids to form and be detected in hybridization assays without cross-reacting with other unselected nucleic acids that may be present in the test sample.

[0082] Thus, depending on, on the one hand, the degree of similarity between the nucleotide sequence of the target nucleic acid and the nucleotide sequences of non-target nucleic acids belonging to phylogenetically distinct but closely related organisms, and, on the other hand, the degree of complementarity between the nucleotide sequence of a particular probe and the nucleotide sequences of the target and non-target nucleic acids, one or more mismatches will not necessarily overcome the ability of the oligonucleotides contained in the probe or primer to hybridize to the target nucleic acid but not to the non-target nucleic acid.

[0083] The hybridization assay probes of the present disclosure are characterized by the melting temperature (T m )(T m is defined as the temperature at which half of the potentially double-stranded molecules in a given reaction mixture are in a single-stranded denatured state) and the T of mismatched hybrids formed between the probe and the rRNA or rDNA of the phylogenetically most closely related organism not sought to be detected but expected to be present in the test sample. mThe sequences were chosen, selected, and / or designed to maximize the difference between the non-labeled amplification primers and capture probes. Unlabeled amplification primers and capture probes do not need to have a very high degree of specificity as hybridization assay probes to be useful in this disclosure, but they are similarly designed to hybridize preferentially to one or more target nucleic acids over other nucleic acids under designated amplification or hybridization assay conditions. The sequences used in this comparison were determined in the laboratory or obtained from published sources.

[0084] Within rRNA molecules, there is a close relationship between secondary structure (caused in part by intramolecular hydrogen bonds) and function. This fact places restrictions on evolutionary changes in primary nucleotide sequences, forcing secondary structure to be maintained. For example, when a base is changed in one "strand" of a double helix (both "strands" are part of the same rRNA molecule due to intramolecular hydrogen bonds), a compensatory substitution usually occurs in the primary sequence of the other "strand" to preserve the complementarity (called covariance) and thus the required secondary structure. This allows two very different rRNA sequences to align based on both conserved primary sequences and also conserved secondary structure elements. Potential target sequences for the hybridization assay probes described herein were identified by noting changes in homology of aligned sequences.

[0085] The mere identification of a putatively unique potential target nucleotide sequence does not guarantee that a functional species-specific hybridization assay probe can be made to hybridize to the rRNA or rDNA of T. pallidum containing that sequence. A variety of other factors will determine the suitability of a nucleic acid locus as a target site for a species-specific probe. The extent and specificity of the hybridization reaction, such as those described herein, are influenced by several factors, and manipulation of one or more of those factors will determine the exact sensitivity and specificity of a particular oligonucleotide, whether or not it is perfectly complementary to its target. The importance and impact of various assay conditions are known to those of skill in the art and are described in Kohne, "Method for Detection, Identification and Quantitation of Non-Viral Organisms" (U.S. Pat. No. 4,851,330), Hogan et al., "Nucleic Acid Probes to Mycobacterium gordonae” (U.S. Pat. No. 5,216,143), and Hogan, “Nucleic Acid Probes for Detection and / or Quantitation of Non-Viral Organisms” (U.S. Pat. No. 5,840,488).

[0086] The desired temperature of hybridization and the hybridization solution composition (such as salt concentration, detergents, and other solutes) can also affect the stability of double-stranded hybrids. Conditions such as ionic strength and the temperature that will allow the probe to hybridize to the target must be considered when constructing species-specific probes. The thermal stability of hybrid nucleic acids generally increases with the ionic strength of the reaction mixture. On the other hand, chemical reagents that disrupt hydrogen bonds, such as formamide, urea, dimethyl sulfoxide, and alcohols, can greatly reduce the thermal stability of hybrids.

[0087] In order to maximize the specificity of the probe to its target, the probes of the present disclosure are designed to hybridize to their targets under high stringency conditions. Under such conditions, only single nucleic acid strands (or regions) with a high degree of complementarity will hybridize with each other. Single nucleic acid strands that do not have such a high degree of complementarity will not form a hybrid. Thus, the stringency of the assay conditions determines the amount of complementarity that must exist between two nucleic acid strands to form a hybrid. The stringency is chosen to maximize the difference in stability between the hybrid formed between the probe and the target nucleic acid and the potential hybrid between the probe and any non-target nucleic acid present in the test sample.

[0088] Appropriate specificity can be achieved by minimizing the length of hybridization assay probes that have perfect complementarity to sequences of non-target organisms, by avoiding G- and C-rich regions of complementarity to non-target nucleic acids, and by constructing the probe to contain as many destabilizing mismatches as possible to the non-target sequences. Whether a probe is suitable for detecting only a particular type of organism depends largely on the difference in thermal stability between the probe:target hybrid and the probe:non-target hybrid. These Ts should be considered when designing the probe. m The difference in values ​​should be as large as possible (preferably 2°C to 5°C or more). m Manipulation of the sequence can be achieved by varying probe length and probe composition, such as GC versus AT content, or the inclusion of nucleotide analogs (e.g., ribonucleotides with 2'-O-methyl substitutions for ribofuranosyl moieties).

[0089] Generally, the optimal hybridization temperature for an oligonucleotide probe is about 5° C. lower than the melting temperature of a given duplex. Incubation at a temperature lower than the optimal temperature may allow mismatched base sequences to hybridize, thus reducing specificity. The longer the probe and the more hydrogen bonds between base pairs, the higher the Tm Increasing the percentage of G and C also increases the thermal stability of T because GC base pairs offer additional hydrogen bonds and therefore greater thermal stability than AT base pairs. m Such considerations are known in the art. See, e.g., J. SAMBROOK ET AL., MOLECULAR CLONING: A LABORATORY MANUAL CH. 11 (2d ed. 1989).

[0090] T m A preferred method for determining T is to measure hybridization using the well-known Hybridization Protection Assay (HPA) disclosed by Arnold et al., "Homogenous Protection Assay" (U.S. Patent No. 5,283,174). m can be measured using HPA in the following manner: A probe molecule is labeled with an acridinium ester and an excess of target is used to form a probe:target hybrid in lithium succinate buffer (0.1 M lithium succinate buffer, pH 4.7, 20 mM EDTA, 15 mM aldrithiol-2, 1.2 M LiCl, 3% (vol / vol) ethanol absolute, 2% (wt / vol) lithium lauryl sulfate). An aliquot of the solution containing the probe:target hybrid is then diluted with lithium succinate buffer solution to obtain the expected T. m Incubate for 5 min at various temperatures, starting at a lower temperature (typically 55 °C) and increasing in 2-5 °C increments. Then dilute the solution with weakly alkaline borate buffer (600 mM boric acid, 240 mM NaOH, 1% (vol / vol) TRITON® X-100, pH 8.5) and incubate for 10 min at an equivalent or lower temperature (e.g., 50 °C).

[0091] Under these conditions, the acridinium ester attached to the single-stranded probe is hydrolyzed, while the acridinium ester attached to the hybridized probe is relatively protected from hydrolysis. Thus, the amount of acridinium ester remaining after the hydrolysis process is proportional to the number of hybrid molecules. The remaining acridinium ester can be measured by monitoring the chemiluminescence produced from the remaining acridinium ester by adding hydrogen peroxide and alkali to the solution. The chemiluminescence can be measured with a luminometer such as the LEADER® 450i Luminometer (Gen-Probe Incorporated, San Diego, CA). The resulting data can be plotted as a percentage of the maximum signal (usually from the lowest temperature) versus temperature. T m is defined as the temperature at which 50% of the maximum signal remains. In addition to the above method, T m can be determined by isotopic methods known to those of skill in the art (see, for example, U.S. Pat. No. 5,840,488).

[0092] T of a given hybrid m It should be noted that the thermal stability of hybrid nucleic acids varies depending on the nature of the hybridization solution used. Factors such as salt concentration, detergents, and other solutes can affect hybrid stability during thermal denaturation (see, e.g., Chapter 11 of SAMBROOK ET AL. (above)). Conditions such as ionic strength and temperature that will allow the probe to hybridize to the target should be considered during construction of the probe. Generally speaking, the thermal stability of hybrid nucleic acids increases with the ionic strength of the reaction mixture. On the other hand, chemical reagents that disrupt hydrogen bonds, such as formamide, urea, dimethyl sulfoxide, and alcohols, can greatly reduce the thermal stability of hybrids.

[0093] To ensure the specificity of hybridization assay probe to its target, it is preferable to design the probe to hybridize only to the target nucleic acid under high stringency conditions. Only highly complementary sequences will form hybrids under high stringency conditions. Thus, the stringency of the assay conditions determines the amount of complementarity required between two sequences to form a stable hybrid. Stringency should be chosen to maximize the difference in stability between probe:target hybrid and potential probe:non-target hybrid.

[0094] Examples of specific stringent hybridization conditions are provided herein. Of course, alternative stringent hybridization conditions can be determined by those skilled in the art based on the present disclosure. (See, e.g., Chapter 11 of SAMBROOK ET AL. (supra).)

[0095] The length of the target nucleic acid sequence region and therefore the length of the probe sequence may also be important.In some cases, there may be several sequences from a particular region, differing in position and length, which can be used to design a probe with desired hybridization properties.In other cases, one probe may be significantly better in terms of specificity than another probe that differs only by a single base.Although it is possible for nucleic acids that are not completely complementary to hybridize, the longest stretch of completely complementary bases, as well as the base composition, will generally determine hybrid stability.

[0096] Regions of rRNA that are known to form strong internal structures that are inhibitory to hybridization are less preferred target regions. Similarly, probes with extensive self-complementarity are generally avoided. However, some degree of self-complementarity may be desirable in a probe, such as hairpin probes, such as molecular torches and molecular beacons, discussed herein. If a strand is fully or partially contained in an intramolecular or intermolecular hybrid, it will be less likely to participate in the formation of a new intermolecular probe:target hybrid without changing reaction conditions. Ribosomal RNA molecules are known to form highly stable intramolecular helices and secondary structures through hydrogen bonding. By designing a probe to a region of the target nucleic acid that remains substantially single-stranded under hybridization conditions, the rate and extent of hybridization between the probe and the target can be increased.

[0097] Genomic ribosomal nucleic acid (rDNA) targets occur naturally in double-stranded form, as do the products of polymerase chain reaction (PCR). These double-stranded targets are naturally inhibitory to hybridization with a probe and require denaturation before hybridization. Appropriate denaturation and hybridization conditions are known in the art (see, for example, Southern, EM, J. Mol. Biol., 98:503 (1975)).

[0098] Several formulas are available that will provide an estimate of the melting temperature of oligonucleotides perfectly matched to their target nucleic acid. One such formula is: T m =81.5+16.6(log 10 [Na + ])+0.41(Fraction G+C)-(600 / N) where N is the length of the oligonucleotide in number of nucleotides, and the T of oligonucleotides between 14 nucleotides and 60-70 nucleotides in length. m From such calculations, T mSubsequent empirical validation or "fine-tuning" of the hybridization sequence may be performed using screening techniques well known in the art. For further information regarding hybridization and oligonucleotide probes, see Chapter 11 of SAMBROOK ET AL. (supra). This reference contains, among other things known in the art, the following sections: m Thus, from the known nucleotide sequences of a given region of the ribosomal RNA (or rDNA) of two or more organisms, oligonucleotides can be designed that will distinguish these organisms from one another.

[0099] Preparation of oligonucleotides The hybridization assay probes, amplification primers, and capture probes of the present disclosure can be readily prepared by methods known in the art. Preferably, the oligonucleotides are synthesized using solid-phase methods. Standard phosphoramidite solid-phase chemistry for linking nucleotides by phosphodiester bonds is described in Caruthers et al., J. Am. Chem. Soc., 1999, 143:1311-1323, 1999. et al., "Chemical Synthesis of Deoxynucleotides by the Phosphoramidite Method," Methods Enzymol., 154:287 (1987). Automated solid-phase chemical synthesis using cyanoethyl phosphoramidite precursors is described by Barone et al., "In Situ Activation of bis-dialkylaminephosphines -- a New See, "Method for Synthesizing Deoxyoligonucleotides on Polymer Supports," Nucleic Acids Res., 12(10):4051 (1984). Batt discloses a procedure for synthesizing oligonucleotides having phosphorothioate linkages in U.S. Pat. No. 5,449,769, entitled "Method and Reagent for Sulfurization of Organophosphorous Compounds." In addition, Riley et al. disclose a process for the synthesis of oligonucleotides having phosphorothioate linkages. No. 5,811,538, entitled "Purification of Oligomers," discloses the synthesis of oligonucleotides having different linkages, including methylphosphonate linkages. Additionally, methods for the organic synthesis of oligonucleotides are known to those skilled in the art and are described, for example, in Chapter 10 of SAMBROOK ET AL. (supra).

[0100] Following synthesis and purification of a particular oligonucleotide, several different procedures can be utilized to purify and control the quality of the oligonucleotide. Suitable procedures include polyacrylamide gel electrophoresis or high pressure liquid chromatography. Both of these procedures are well known to those skilled in the art.

[0101] All of the oligonucleotides of the present disclosure, whether hybridization assay probes, amplification primers, or capture probes, can be modified with chemical groups to enhance their performance or to facilitate the characterization of amplification products. For example, backbone-modified oligonucleotides that make the oligonucleotide resistant to the nucleolytic activity of certain polymerases or nuclease enzymes, such as oligonucleotides with phosphorothioate, methylphosphonate, 2'-O-alkyl, or peptide groups, can allow the use of such enzymes in amplification or other reactions. Another example of modification includes using non-nucleotidic linkers that are incorporated between nucleotides in the nucleic acid chain of the probe or primer and do not prevent the hybridization of the probe or the hybridization and extension of the primer. See Arnold et al., "Non-Nucleotide Linking Reagents for Nucleotide Probes" (US Patent No. 6,031,091). The oligonucleotides of the present disclosure can also include a mixture of desired modifications and natural nucleotides.

[0102] The 3' end of the amplification oligonucleotide can be modified or blocked to prevent or inhibit initiation of DNA synthesis as disclosed by Kacian et al. in U.S. Pat. No. 5,554,516. The 3' end of the amplification oligonucleotide can be modified in a variety of ways well known in the art. By way of example, suitable modifications include ribonucleotides, 3' deoxynucleotide residues (e.g., cordycepin), 2',3'-dideoxynucleotide residues, modified nucleotides such as phosphorothioates, and non-nucleotide linkages such as those disclosed by Arnold et al. in U.S. Pat. No. 6,031,091 or alkane-diol modifications (Wilk et al., "Backbone-Modified Oligonucleotides Containing a Butanediol-1,3 Moiety as a 'Vicarious Segment' for The modification may include the addition of a 3' blocked primer (see, for example, "The Deoxyribosyl Moiety -- Synthesis and Enzyme Studies," Nucleic Acids Res., 18(8):2065 (1990)), or the modification may simply consist of a region 3' of the priming sequence that is non-complementary to the target nucleic acid sequence. In addition, different 3' blocked primers or mixtures of 3' blocked or unblocked primers can increase the efficiency of nucleic acid amplification, as disclosed therein.

[0103] The 5' end of the primer can be modified to resist the 5'-exonuclease activity present in some nucleic acid polymerases. Such modifications can be made by adding a non-nucleotide group to the terminal 5' nucleotide of the primer using techniques such as those disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. To facilitate strand displacement, the 5' end can also be modified to include a non-complementary nucleotide as disclosed in Dattagupta et al., "Isothermal Strand Displacement Nucleic Acid Amplification" (U.S. Pat. No. 6,087,133).

[0104] Once synthesized, selected oligonucleotides can be labeled by any of a number of well-known methods (see, e.g., Chapter 10 of SAMBROOK, supra). Useful labels include radioisotopes and non-radioactive reporting groups. Isotopic labels include: 3 H, 35 S, 32 P, 125 I, 57 Co, and 14Isotopic labels can be introduced into oligonucleotides by techniques known in the art, such as using nick translation, end labeling, second strand synthesis, reverse transcription, and by chemical methods. When using radiolabeled probes, hybridization can be detected by autoradiography, scintillation counting, or gamma counting. The detection method selected will depend on the specific radioisotope used for labeling.

[0105] Nonisotopic materials can also be used for labeling and can be introduced internally or at the end of a nucleic acid sequence. Modified nucleotides can be incorporated enzymatically or chemically. Chemical modification of the probe can be performed during or after the synthesis of the probe using non-nucleotidic linker groups, for example, as disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. Nonisotopic labels include fluorescent molecules (individual labels or combinations of interacting labels, such as fluorescence resonance energy transfer (FRET) pairs disclosed by Tyagi et al. in U.S. Pat. No. 5,925,517), chemiluminescent molecules, enzymes, cofactors, enzyme substrates, haptens, or other ligands. In some embodiments, the hybridization assay probes of the present disclosure are labeled with non-nucleotidic linkers bearing AEs, such as standard acridinium esters (AEs). Acridinium ester labeling can be performed as disclosed by Arnold et al., "Acridinium Ester Labelling and Purification of Nucleotide Probes" (U.S. Pat. No. 5,185,439).

[0106] Nucleic Acid Amplification Preferably, the amplification primer of the present disclosure is oligomeric and long enough to be used as a substrate for extension by nucleic acid polymerase.The optimal primer length should take into account several factors, including the temperature of the reaction, the structure and base composition of the primer, and how the primer should be used.For example, for optimal specificity, the oligonucleotide primer should generally be at least 12 bases long, depending on the complexity of the target nucleic acid sequence.When such specificity is not essential, shorter primers can be used.In such cases, it may be desirable to carry out the reaction at a lower temperature to form a stable hybrid complex with the template nucleic acid.

[0107] Useful guidelines for designing amplification primers with desired characteristics are provided above in the section entitled "Preparation of Oligonucleotides." Optimal sites for amplification and probing include at least two, and preferably three, conserved regions of T. pallidum nucleic acid. These regions are about 15-350 bases in length, preferably about 15-150 bases in length.

[0108] The degree of amplification observed with a set of amplification primers (primers and / or promoter-primers) depends on several factors, including the ability of the primers to hybridize to their particular target sequence and their ability to be enzymatically extended or copied. Although amplification primers of different lengths and base compositions can be used, preferred amplification primers in this disclosure have a target binding region of 17-22 bases and a predicted T m is preferably targeted to be above 42°C, preferably at least about 50°C.

[0109] Parameters that affect probe hybridization, such as melting temperature, complementarity, and secondary structure of the target sequence, also affect amplification primer hybridization and thus amplification primer performance. The degree of non-specific extension (primer-dimer or non-target copy) can also affect amplification efficiency. Thus, amplification primers are generally selected to have low self- or cross-complementarity, especially at the 3' end of their sequence. Self-reporting "signal primers" as disclosed in Nadeau et al., "Detection of Nucleic Acids by Fluorescence Quenching" (U.S. Pat. No. 5,958,700) and Nazarenko et al., "Nucleic Acid Amplification Oligonucleotides with Molecular Energy Amplification primers containing self-complementary regions, such as the "hairpin primers" disclosed in "Transfer Labels and Methods Based on Chromatography" (U.S. Pat. No. 5,866,336), can be useful. To reduce spurious primer extension, long homopolymer runs and high GC content are avoided. Computer programs are available to aid in this aspect of the design, including Oligo Tech® analysis software available from Oligo Therapeutics, Inc.

[0110] A nucleic acid polymerase used with the amplification primers of the present disclosure refers to a chemical, physical, or biological agent that incorporates either ribonucleotides or deoxyribonucleotides, or both, into a nucleic acid polymer or strand in a template-dependent manner. Examples of nucleic acid polymerases include DNA-directed DNA polymerases, RNA-directed DNA polymerases, and RNA-directed RNA polymerases. DNA polymerases effect nucleic acid synthesis in a template-dependent 5' to 3' direction. Due to the typical antiparallel orientation of the two strands in a double-stranded nucleic acid, this direction is from the 3' region on the template to the 5' region on the template. Examples of DNA-directed DNA polymerases include E. coli DNA polymerase I, thermostable DNA polymerase from Thermus aquaticus (Taq), and a large fragment of DNA polymerase I from Bacillus stearothermophilus (Bst). See, for example, Riggs et al., "Purified DNA Polymerases: A Novel Polymerase for the Synthesis of ribonucleotides and ribonucleotides," in J. Biol. Soc. 2002, 144:1311-1323, 1999. See, "DNA Polymerase from Bacillus stearothermophilus" (U.S. Pat. No. 6,066,483). Examples of RNA-directed DNA polymerases include various retroviral reverse transcriptases, such as Moloney murine leukemia virus (MMLV) reverse transcriptase or avian myeloblastosis virus (AMV) reverse transcriptase.

[0111] During most nucleic acid amplification reactions, a nucleic acid polymerase adds nucleotide residues to the 3' end of the primer using the target nucleic acid as a template, thus synthesizing a second nucleic acid strand with a nucleotide sequence that is partially or completely complementary to a region of the target nucleic acid. In many nucleic acid amplification reactions, the two strands comprising the resulting double-stranded structure must be separated by chemical or physical means in order for the amplification reaction to proceed. Alternatively, the newly synthesized template strand may be made available for hybridization with a second primer or promoter-primer by other means, such as strand displacement or the use of nucleases that digest part or all of the original target strand. In this way, the process may be repeated for several cycles, resulting in a large increase in the number of nucleic acid molecules with the target nucleotide sequence.

[0112] Either the first amplification primer or the second amplification primer or both of them can be promoter-primers. In some applications, the amplification primer can consist only of a promoter-primer complementary to the sense strand, as disclosed in Kacian et al., "Nucleic Acid Sequence Amplification Method, Composition and Kit" (US Pat. No. 5,554,516). Promoter-primers usually contain an oligonucleotide segment that is not complementary to the nucleotide sequence present in the target nucleic acid molecule or primer extension product (see, for example, Kacian et al., "Nucleic Acid Sequence Amplification Methods" (US Pat. No. 5,399,491)). These non-complementary sequences can be located 5' to the complementary sequence on the amplification primer and can provide a locus for the initiation of RNA synthesis when made double-stranded by the action of nucleic acid polymerase. The promoter so provided can allow for the in vitro transcription of multiple RNA copies of the target nucleic acid sequence. It will be understood that all references to primers herein include primers and promoter-primers unless the context clearly dictates otherwise.

[0113] A preferred amplification method is the transcription-mediated amplification method disclosed by Kacian et al., "Nucleic Acid Sequence Amplification Methods", US Patent No. 5,480,784. According to this method, a promoter-primer having a 3' region and a 5' promoter region complementary to a portion of the target, and a primer having the same nucleotide sequence as a portion of the target, are contacted with a target RNA molecule. The primer and the promoter-primer define the boundaries of the target region to be amplified, including both the sense present on the target molecule and its complement, and thereby the length and sequence of the amplicon. In this preferred embodiment, the amplification oligonucleotide and the immobilized target RNA are contacted at 42°C in the presence of an effective amount of Moloney murine leukemia virus reverse transcriptase and T7 RNA polymerase, both ribonucleotide and deoxyribonucleotide triphosphates, and necessary salts and cofactors. Under these conditions, nucleic acid amplification occurs, resulting mainly in the production of RNA amplicons of the opposite sense to the target nucleic acid. These amplicons can then be detected in solution, for example, by using one or more detectably labeled hybridization probes. In some embodiments, the hybridization probe is an acridinium ester labeled hybridization probe of the same sense as the target nucleic acid and can be detected using HPA technology, as disclosed by Arnold et al. in US Pat. No. 5,283,174.

[0114] The 3' ends of the immobilized and capture probes are preferably "capped" or blocked to prevent or inhibit their use as substrates for nucleic acid polymerase activity. Capping can include 3' deoxyribonucleotides (such as cordycepin), 3',2'-dideoxynucleotide residues, non-nucleotide linkers such as those disclosed by Arnold et al. in U.S. Pat. No. 6,031,091, alkane-diol modifications, or non-3' terminal non-complementary nucleotide residues.

[0115] Those skilled in the art will recognize that the above methodology is amenable to a variety of other amplification schemes, either as described or with obvious modifications, including, for example, polymerase chain reaction (PCR), Qβ replicase-mediated amplification, self-sustained sequence replication (3SR), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), and ligase chain reaction (LCR).

[0116] Sample processing Sample processing prior to amplification or detection of target sequences may be necessary or useful to distinguish target sequences from non-target nucleic acids present in the sample. Sample processing procedures may include, for example, direct or indirect immobilization of nucleic acids and / or oligonucleotides from the solution phase in heterogeneous assays. In some procedures, such immobilization may require multiple hybridization events. Ranki et al. in "Detection of Microbial Nucleic Acids by a One-Step Sandwich Hybridization Test," U.S. Pat. Nos. 4,486,539 and 4,563,419, for example, disclose a one-step nucleic acid "sandwich" hybridization method that includes the use of solid-phase bound nucleic acids having a target complementary sequence and labeled nucleic acid probes that are complementary to distinct regions of the target nucleic acid. Stabinsky, "Methods and Kits for Performing Nucleic Acid Hybridization Assays," U.S. Patent No. 4,751,177, discloses a method involving a "mediator" polynucleotide that reportedly overcomes the sensitivity problems associated with the Ranki method due to leakage of the immobilized probe from the solid support. Instead of directly immobilizing the target nucleic acid, Stabinsky's mediator polynucleotide is used to bind and indirectly immobilize target polynucleotide:probe polynucleotide complexes that form free in solution.

[0117] Any known solid support, such as matrices and particles free in solution, can be used for sample processing. The solid support can be, for example, nitrocellulose, nylon, glass, polyacrylate, mixed polymers, polystyrene, silane polypropylene, and preferably magnetically attractable particles that facilitate sample recovery and / or removal of unbound nucleic acids or other sample components. Particularly preferred supports are magnetic spheres that are monodisperse (i.e., uniform in size to ±5%), thereby providing consistent results, which is particularly advantageous for use in automated procedures. One such automated procedure is described in Ammann et al., “Automated Process for Isolating and Amplifying a Target Nucleic Acid.” Sequence”, U.S. Patent No. 6,335,166.

[0118] The oligonucleotide for immobilizing the target nucleic acid on the solid support can be directly or indirectly bound to the solid support by any bond or interaction that is stable under assay conditions (e.g., conditions for amplification and / or detection). This oligonucleotide, referred to herein as "immobilized probe", can directly bind to the target nucleic acid or can contain a base sequence region, such as a homopolymer tract (e.g., poly dT) or a simple short repeat sequence (e.g., AT repeat), which hybridizes to a complementary base sequence region present on the capture probe. Direct binding occurs when the immobilized probe is bound to the solid support in the absence of an intermediate oligonucleotide. For example, direct binding can be via covalent binding, chelation, or ionic interaction. Indirect binding occurs when the immobilized probe is bound to the solid support by one or more linkers. A "linker" is a means for binding at least two different molecules into a stable complex, containing one or more components of a binding partner set.

[0119] The members of a binding partner set can recognize and bind to each other. A binding partner set can be, for example, a receptor and a ligand, an enzyme and a substrate, an enzyme and a cofactor, an enzyme and a coenzyme, an antibody and an antigen, a sugar and a lectin, biotin and streptavidin, a ligand and a chelator, nickel and histidine, a substantially complementary oligonucleotide, and a complementary homopolymeric nucleic acid or a homopolymeric portion of a polymeric nucleic acid. The components of a binding partner set are the regions of the members that are involved in binding.

[0120] A preferred sample processing system, which has practical advantages in terms of its ease of use and rapidity, includes an immobilized probe that includes a base sequence that is complementary to the base sequence of the capture probe, referred to herein as the "immobilized probe binding region." The capture probe further includes a base sequence, referred to herein as the "target binding region," that can specifically hybridize to a target sequence contained in the target nucleic acid under assay conditions. Although the specificity of the target binding region of the capture probe for the region of the target nucleic acid is desirable to minimize the number of non-target nucleic acids remaining from the sample after the separation step, it is not a requirement of the capture probe of the present disclosure when the capture probe is used only to isolate the target nucleic acid. When the capture probe is not used to isolate the target nucleic acid for subsequent amplification of the target sequence, the capture probe may further include a detectable label attached in or near the target binding region, such as a substituted or unsubstituted acridinium ester. The labeled capture probe may be used in homogeneous or semi-homogeneous assays to specifically detect hybrid nucleic acids without detecting single-stranded nucleic acids such as the capture probe.

[0121] The advantage of this system is that only a single target-specific hybridization event (capture probe:target) is required for target detection, rather than multiple such events (e.g., capture probe:target and probe:target or probe:amplicon) as required in other sample processing procedures described herein. Also, since the overall rate at which the target nucleic acid is captured and detected is limited by the slowest hybridizing oligonucleotide, fewer oligonucleotides in the assay tend to make the assay faster and easier to optimize. Although the target binding region of the capture probe may be less specific in alternative assay systems, it must still be rare enough to avoid significant saturation of the capture probe with non-target nucleic acids. Thus, the requirement that two separate specific target sequences be identified in these alternative systems may impose constraints on the identification of appropriate targets. In contrast, when the capture probe simultaneously functions as a detection probe, only one such target sequence is required.

[0122] Regardless of which approach is adopted, the assay may include a means for detecting the presence of target nucleic acid in the test sample. Various means for detecting target nucleic acid, including means that do not require the presence of a detectable label, are well known to those skilled in the art of nucleic acid detection. Nevertheless, a probe that includes a detectable label is preferred. A labeled probe for detecting the presence of a target nucleic acid will have to include a base sequence that is substantially complementary to and specifically hybridizes to a target sequence contained in the target nucleic acid. Once the probe is stably bound to the target nucleic acid and the resulting target:probe hybrid is directly or indirectly immobilized, unbound probe can be washed away or inactivated, and the remaining bound probe can be detected and / or measured.

[0123] Preferred sample processing systems combine elements of detection and nucleic acid amplification. These systems first immobilize the target nucleic acid directly or indirectly (e.g., using a capture probe), and the captured target nucleic acid is purified by removing cellular debris, non-target nucleic acids, and amplification inhibitors from the vessel containing the sample, followed by amplification of the target sequence contained in the target nucleic acid. The amplification product is then detected with a labeled probe, preferably in solution. The target nucleic acid can remain immobilized during amplification, or the T of the capture probe:target complex can be detected. m and / or the T of the capture probe:immobilized probe complex mThe capture probe may be eluted or separated from the solid support prior to amplification using appropriate conditions, such as first incubating at a temperature above 100° C. A preferred embodiment of this system is disclosed by Weisburg et al., “Two-Step Hybridization and Capture of a Polynucleotide”, U.S. Pat. No. 6,110,678. In this system, the capture probe hybridizes to the target nucleic acid and the immobilized probe hybridizes to the capture probe:target complex under different hybridization conditions. Under a first set of hybridization conditions, hybridization of the capture probe to the target nucleic acid is preferred over hybridization of the capture probe to the immobilized probe. Thus, under this first set of conditions, the capture probe is in solution rather than bound to a solid support, thereby maximizing the concentration of free capture probe and utilizing solution phase kinetics that favor hybridization to the target nucleic acid. After the capture probe has had sufficient time to hybridize to the target nucleic acid, a second set of hybridization conditions is imposed, allowing it to hybridize to the immobilized probe in the capture probe:target complex, thereby isolating the target nucleic acid in the sample solution. The immobilized target nucleic acid can then be purified and the target sequence present in the target nucleic acid can be amplified and detected. When treating crude samples (e.g., clinical, environmental, industrial, food, water, etc.) to prevent enzyme inhibition and / or nucleic acid degradation by substances present in the sample, a purification procedure that includes one or more wash steps is generally desirable.

[0124] Capture probes for isolating ribosomal nucleic acid The capture probe of the present disclosure is designed to bind and isolate nucleic acid derived from 23S ribosomal nucleic acid of T. pallidum in the presence of non-target nucleic acid. As such, the capture probe comprises both a target binding region and an immobilized probe binding region. The target binding region of the capture probe comprises a base sequence that hybridizes to a target sequence derived from 23S ribosomal nucleic acid from T. pallidum under assay conditions. Although not required, the target binding region preferably exhibits specificity for the target sequence in the presence of non-target nucleic acid under assay conditions. The immobilized probe binding region has a base sequence that hybridizes to an immobilized probe that comprises a polynucleotide or a chimera that comprises a polynucleotide sequence that is bound to a solid support present in a test sample, either directly or indirectly. The target binding region and the immobilized probe binding region can be bound to each other directly or by, for example, a nucleotide base sequence, an abasic sequence, or a non-nucleotide linker.

[0125] In a preferred embodiment, the capture probe according to the present disclosure comprises a target binding region comprising a base sequence region that is at least about 85% homologous (preferably at least about 90% homologous, more preferably at least about 95% homologous, most preferably 100% homologous) to one of the capture probes disclosed herein. The immobilized probe binding region of these preferred capture probes comprises a base sequence that hybridizes to an immobilized probe that is directly or indirectly bound to a solid support provided to a test sample under assay conditions. The immobilized probe binding region preferably comprises a homopolymeric region (e.g., poly(dA)) located at the 3' end of the capture probe that is complementary to a homopolymeric region (e.g., poly(dT)) located at the 5' end of the immobilized probe. Other base sequences can be incorporated into the immobilized probe binding region, including, for example, short repeat sequences.

[0126] In order to prevent undesired cross-hybridization reactions, the capture probe of the present disclosure preferably excludes nucleotide base sequences other than the nucleotide base sequence of the target binding region, which can stably bind to nucleic acids from any organism that may be present in the test sample under assay conditions. Consistent with this approach, in order to maximize the immobilization of the capture probe:target complex formed, the nucleotide base sequence of the immobilized probe binding region is preferably designed to be stably bound to the nucleotide base sequence present in the immobilized probe under assay conditions, but not to nucleic acids from any organism that may be present in the test sample.

[0127] The target binding region of the capture probe and the immobilized probe binding region are such that the capture probe:target complex is a T of the capture probe:immobilized probe complex. m Higher than T m In this way, a first set of conditions can be imposed that favors hybridization of the capture probe to the target sequence over the immobilized probe, thereby providing optimal solution-phase hybridization kinetics for hybridization of the capture probe to the target sequence. Once sufficient time has passed for the capture probe to bind to the target sequence, a second set of less stringent conditions can be imposed that allows hybridization of the capture probe to the immobilized probe. Sets of conditions useful for these applications can be established by those of skill in the art using only routine experimentation.

[0128] The capture probes of the present disclosure can also include a label or an interactive label pair for direct detection of a target sequence in a test sample. Non-limiting examples of labels, combinations of labels, and means for labeling probes are described above.

[0129] Regardless of their application in direct detection assays, the most common use of capture probes is in the isolation and purification of target nucleic acids prior to amplifying the target sequence contained therein. By isolating and purifying the target nucleic acid prior to amplification, the number of unintended amplification reactions (i.e., amplification of non-target nucleic acids) can be advantageously reduced. The 3' end of the capture probe can be capped or blocked to prevent or inhibit the capture probe itself from functioning as a substrate for nucleic acid polymerase activity in the presence of amplification reagents and under amplification conditions. Examples of capping agents include 3' deoxyribonucleotides, 3',2'-dideoxynucleotide residues, non-nucleotide linkers, alkane-diol modifications, and non-complementary nucleotide residues at the 3' end.

[0130] The following specific examples incorporated a target capture step to isolate and purify the target nucleic acid prior to amplification of the target nucleic acid sequence. The capture probes in these examples had 5' target binding regions of SEQ ID NO:34, SEQ ID NO:35, and SEQ ID NO:36, and further contained 3' immobilized probe binding regions with 30 nucleotide long poly dA tails given by SEQ ID NO:37, SEQ ID NO:38, and SEQ ID NO:39. The target binding regions of the capture probes were designed to bind to a region of the target nucleic acid that was distinct from the regions bound by the primers, promoter-primers, and hybridization assay probes. The solid support for this target capture assay was Sera-Mag™ MG-CM Carboxylate Modified (Seradyn, Inc., Indianapolis, Indiana, Cat. No. 24152105-050450), 1 micron, covalently linked oligo(dT) that was capable of binding to the poly dA tails of the capture probes under hybridization conditions. 14The magnetic particles may be superparamagnetic particles having a magnetic field of 0.1 to 1.0 nm. Similar magnetic particles are disclosed by Sutor, "Process for Preparing Magnetically Responsive Microparticles", US Patent No. 5,648,124. To remove the particles from suspension and immobilize them along the inner wall of the sample tube, the tube was transferred to a magnetic separation rack as disclosed by Acosta et al. in US Patent No. 6,254,826. While the particles were immobilized, fluid was aspirated from the tube and the tube was washed with a wash buffer as described below. The wash step can be repeated before adding the amplification and enzyme reagents described below for amplifying the target sequence. Between the wash steps, the particles can be resuspended in a wash buffer.

[0131] Amplification of T. pallidum ribosomal nucleic acid The amplification primer of the present disclosure is directed to a region of 23S ribosomal nucleic acid from T.pallidum.The amplification primer can be adjacent to, overlapping, or contained within at least one of the target nucleic acid sequences (or its complement) of the hybridization assay probe used to detect the presence of T.pallidum using nucleic acid amplification assay.As shown above, the amplification primer can also contain non-complementary bases at their 5' ends, and can optionally contain a promoter sequence (e.g., T7 promoter sequence) that can bind RNA polymerase and induce RNA transcription using the target nucleic acid as a template.

[0132] The amplification primers of the present disclosure are capable of amplifying a target nucleic acid sequence present in a nucleic acid derived from T. pallidum. A first strand amplification primer comprises an oligonucleotide having a target hybridizing sequence of 18-22 contiguous bases of any of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and optionally includes a 5' promoter sequence (e.g., SEQ ID NO:9). An exemplary first strand primer has a target hybridizing sequence of SEQ ID NO:8, SEQ ID NO:7, or SEQ ID NO:6. A second strand amplification primer comprises an oligonucleotide having a target hybridizing sequence of 17-20 contiguous bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15. An exemplary second strand primer has a target hybridizing sequence of SEQ ID NO:18, SEQ ID NO:17, or SEQ ID NO:16.

[0133] Amplification primers of the present disclosure may have modifications such as blocked 3' and / or 5' ends (discussed above), or sequence additions including, but not limited to, specific nucleotide sequences recognized by RNA polymerase (e.g., promoter sequences for T7, T3, or SP6 RNA polymerase), sequences that enhance the initiation or elongation of RNA transcription by RNA polymerase, or sequences that provide intramolecular base pairing and may promote the formation of secondary or tertiary nucleic acid structures.

[0134] Amplification primers are used in nucleic acid amplification procedures such as polymerase chain reaction (PCR), Q replicase-mediated amplification, self-sustained sequence replication (3SR), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), ligase chain reaction (LCR), strand displacement amplification (SDA), and loop-mediated isothermal amplification (LAMP), each of which are well known in the art. See, for example, Mullis, "Process for Amplifying Nucleic Acid Sequences," U.S. Pat. No. 4,683,202; Erlich et al., "Kits for Amplifying and Detecting Nucleic Acid Sequences," U.S. Pat. No. 6,197,563; Walker et al., "Strand Displacement Amplification--an Isothermal, In Vitro DNA Amplification," U.S. Pat. Amplification Technique,” ​​Nucleic Acids Res., 20(7):1691-1696(1992); Fahy et al., “Self-sustained Sequence Replication (3SR): An Isothermal Transcription-Based Amplification System Alternative to PCR,” PCR Methods and Applications, 1:25-33(1991); Kacian et al., U.S. Pat. No. 5,399,491; Davey et al., “Nucleic Acid Amplification Process,” U.S. Pat. No. 5,554,517; Birkenmeyer et al., “Amplification of Target Nucleic Acids Using Gap Filling Ligase Chain Reaction,” U.S. Pat. No. 5,427,930; Marshall et al., “Amplification of RNA Sequences Using the Ligase Chain No. 5,712,124; Notomi et al., "Process for Synthesizing Nucleic Acid", U.S. Pat. No. 6,410,278; Dattagupta et al., "Isothermal Strand Displacement Amplification", U.S. Pat. No. 6,214,587; and Helen H. Lee et al., Nucleic Acid Amplification Technologies: Application to Disease Diagnosis (1997). Other amplification procedures not specifically indicated but which meet the definition of "nucleic acid amplification" are also contemplated by the inventors.

[0135] The amplification primer of the present disclosure is preferably unlabeled, but may contain one or more reporter groups to facilitate detection of target nucleic acid in combination with or without hybridization assay probe.A wide variety of methods are available for directly detecting amplified target sequence.For example, nucleotide substrate or primer can contain detectable label that is incorporated into newly synthesized DNA.The resulting labeled amplification product is then generally separated from unused labeled nucleotide or primer, and the label is detected in the separated product fraction.See, for example, Wu, "Detection of Amplified Nucleic Acid Using Secondary Capture Oligonucleotides and Test Kit", U.S. Patent No. 5,387,510.

[0136] If the primer is modified, for example, by binding to two dyes that form a donor / acceptor dye pair (i.e., a pair of interacting labels), no separation step is required. The modified primer can be designed such that the fluorescence of one dye pair member remains quenched by the other dye pair member unless the primer hybridizes to the target nucleic acid, thereby physically separating the two dyes. In addition, the primer can be further modified to include a restriction endonuclease recognition site positioned between the two dyes, so that when a hybrid is formed between the modified primer and the target nucleic acid, the restriction endonuclease recognition site becomes double-stranded and available for cleavage or nicking by the appropriate restriction endonuclease. Cleavage or nicking of the hybrid then separates the two dyes, resulting in a change in fluorescence due to reduced quenching, which can be detected as an indication of the presence of the target organism in the test sample. Such modified primers are disclosed by Nadeau et al., "Detection of Nucleic Acids by Fluorescence Quenching," U.S. Pat. Nos. 5,958,700 and 6,054,279.

[0137] Substances that can function as useful detectable labels are well known in the art and include radioisotopes, fluorescent molecules, chemiluminescent molecules, chromophores, and ligands such as biotin and haptens, which are not directly detectable but can be readily detected upon reaction with a labeled form of their specific binding partner (e.g., avidin and antibodies, respectively).

[0138] Another approach is to detect the amplification product by hybridization with a detectably labeled probe and measuring the resulting hybrid by any conventional method.For example, the product can be assayed by hybridizing a chemiluminescent acridinium ester-labeled probe to the target sequence, selectively hydrolyzing the acridinium ester present on the unhybridized probe, and measuring the chemiluminescence generated from the remaining acridinium ester with a luminometer.See, for example, Arnold et al., U.S. Patent No. 5,283,174, and Nelson et al., Nonisotopic Probing, Blotting, and Sequencing, ch.17 (Larry J. Kricka ed., 2d ed.1995).

[0139] Hybridization assay probes for T. pallidum ribosomal nucleic acid Disclosed herein are novel hybridization assay probes useful for detecting nucleic acids (e.g., nucleic acid amplification products) derived from T. pallidum. Hybridization is the association of two single strands of complementary nucleic acids forming a hydrogen-bonded duplex. A nucleic acid sequence capable of hybridizing to a nucleic acid sequence ("target sequence") desired to be detected can serve as a probe for the target sequence. Hybridization can occur between complementary nucleic acid strands, including DNA / DNA, DNA / RNA, and RNA / RNA. Two single strands of deoxyribo-(DNA) or ribo-(RNA) nucleic acids formed from nucleotides including the bases adenine (A), cytosine (C), thymidine (T), guanine (G), uracil (U), inosine (I), and their analogs, can hybridize to form a double-stranded structure in which the two strands are held together by hydrogen bonds between pairs of complementary bases. Generally, A is hydrogen bonded to T or U, and G is hydrogen bonded to C. Thus, at any point along the hybridized strand, the classical base pairs AT or AU, TA or UA, GC or CG may be found. Thus, if a first single strand of nucleic acid contains enough contiguous complementary bases to a second, and the two strands are brought together under conditions that will promote their hybridization, a double-stranded nucleic acid will result. Under appropriate conditions, DNA / DNA, RNA / DNA, or RNA / RNA hybrids may be formed.

[0140] The rate and extent of hybridization are influenced by many factors. For example, if one of the two strands is fully or partially included in the hybrid, it implies that it is less able to participate in the formation of new hybrids. By designing the probe so that a significant portion of the sequence of interest is single-stranded, the rate and extent of hybridization can be greatly increased. Also, if the target is an integrated genomic sequence, it will naturally occur in double-stranded form, as is the case with the products of PCR. These double-stranded targets are naturally inhibitory to hybridization with the probe and require denaturation before the hybridization step. In addition, if there is sufficient self-complementarity, there may be intramolecular hybrids formed within the probe. Regions of nucleic acids that are known to form strong internal structures that are inhibitory to hybridization are typically less favored. Examples of such structures include hairpin loops. Undesirable secondary structures in hybridization assay probes can be avoided through careful probe design, and commercial computer programs, such as Oligo Tech® analysis software available from Oligo Therapeutics, Inc., are available to search for these types of interactions.

[0141] In some applications, such as homogeneous assays, a probe that exhibits at least some degree of self-complementarity may be desirable to facilitate detection of probe:target duplexes in test samples. As discussed herein above, such probes include "molecular torches" that are designed to include separate regions of self-complementarity, called "target binding domains" and "target closing domains." These two domains are connected by a binding region in the molecular torch and hybridize to each other under hybridization assay conditions. The binding region can be a non-nucleotide linker, such as polyethylene glycol. Molecular torches are disclosed by Becker et al., "Molecular Torches," U.S. Pat. No. 6,361,945.

[0142] When exposed to denaturing conditions, the two complementary regions of the molecular torch (which may be fully or partially complementary) melt, making the target binding domain available for hybridization to the target sequence when the original hybridization assay conditions are restored. The molecular torch is designed such that the target binding domain prefers hybridization to the target sequence over the target closing domain. The target binding domain and the target closing domain of the molecular torch contain interactive labels (e.g., fluorophores / quenchers) positioned such that when the molecular torch is self-hybridized, it produces a different signal than when the molecular torch is hybridized to the target nucleic acid, thereby allowing detection of the probe:target duplex in the test sample in the presence of an unhybridized probe having a viable label associated therewith.

[0143] In accordance with the teachings of Becker et al. in U.S. Pat. No. 6,361,945, the hybridization assay probes of the present disclosure can be designed and constructed to contain a "target closing domain," a "binding region," and interactive labels characteristic of molecular torches, in addition to a "target binding domain" capable of distinguishing between nucleic acids derived from T. pallidum.

[0144] Another example of a self-complementary hybridization assay probe is a "molecular beacon". A molecular beacon comprises a nucleic acid molecule having a target complementary sequence, an affinity pair (or nucleic acid arm) that holds the probe in a closed conformation in the absence of a target nucleic acid sequence, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target nucleic acid with the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable by a reduction in the interaction of the label pair, which can be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Examples of various molecular beacon configurations and applications are disclosed by Tyagi et al. in U.S. Pat. No. 5,925,517. Following the teachings of Tyagi et al., a probe according to the present disclosure can be designed and constructed to include an "affinity pair" and dual labels characteristic of molecular beacons in addition to a "target complementary sequence" that can distinguish between nucleic acids derived from T. pallidum.

[0145] In the case of hybridization assays, the length of the target nucleic acid sequence, and therefore the length of the probe sequence, may be important. In some cases, there may be several sequences from a particular region, differing in location and length, which will result in a probe with the desired hybridization properties. In other cases, one sequence may have better hybridization properties than another that differs only by a single base. Although it is possible for nucleic acids that are not perfectly complementary to hybridize, the longest stretch of perfectly homologous base sequence will usually primarily determine hybrid stability. Although probes of different lengths and base compositions may be used, preferred probes have oligonucleotides that are up to 100 bases long, more preferably 13-50 bases long, and even more preferably 13-22 bases long.

[0146] The hybridization assay probe comprises a base sequence that is substantially complementary to a 23S rRNA or rDNA target sequence present in or derived from the nucleic acid of T. pallidum (e.g., comprising a nucleic acid amplification product). Thus, the probe can stably bind to the T. pallidum target sequence under stringent hybridization assay conditions or under conditions used during nucleic acid amplification. As discussed above, the hybridization assay probe may have additional base sequences that do not stably bind to the target nucleic acid.

[0147] In addition to self-complementary probes, the probes of the present disclosure can be designed and constructed to include an immobilized probe binding region of a capture probe, which is composed of a nucleotide base sequence that can hybridize to a substantially complementary nucleotide base sequence contained in an immobilized probe directly or indirectly bound to a solid support under a predetermined hybridization condition. The immobilized probe binding region is preferably selected so that it does not stably bind to nucleic acids from any organism that may be present in a test sample, including T. pallidum, under a predetermined hybridization condition. Thus, the preferred nucleotide base sequence for the immobilized probe binding region of a capture probe according to the present disclosure is a homopolymer tail, such as a 3' poly-dA tail that matches the 5' poly-dT tail on the immobilized probe. These tails can be of any length sufficient to promote stable hybridization under a predetermined hybridization condition, and are preferably about 30 bases in length.

[0148] The immobilized probe is preferably bound to a magnetically attractable particle that can be isolated in a reaction vessel during a purification step once the probe has had sufficient time to hybridize to the target nucleic acid present in the sample. Acosta et al., in U.S. Pat. No. 6,254,826 ("Assay Work Station"), disclose an instrument that can be used to perform such a purification step. The capture probe is preferably designed such that the melting temperature of the capture probe:target hybrid is higher than the melting temperature of the capture probe:immobilized probe hybrid. In this way, a different set of hybridization assay conditions can be used to promote hybridization of the capture probe to the target nucleic acid prior to hybridization of the capture probe to the immobilized oligonucleotide, thereby maximizing the concentration of free probe and providing favorable solution-phase hybridization kinetics. This "two-step" target capture method is discussed above and disclosed by Weisburg et al., U.S. Pat. No. 6,110,678. Other target capture schemes that can be readily adapted to the present disclosure are well known in the art and include, without limitation, those disclosed by Dunn et al., Methods in Enzymology, "Mapping viral mRNAs by sandwich hybridization," 65(1):468-478 (1980); Ranki et al., U.S. Pat. No. 4,486,539; Stabinsky, U.S. Pat. No. 4,751,177; and Becker et al., U.S. Pat. No. 6,130,038.

[0149] With respect to T. pallidum probes, the terms "target nucleic acid sequence," "target nucleotide sequence," "target sequence," and "target region" all refer to a nucleic acid sequence present in T. pallidum rRNA or rDNA, or a sequence complementary thereto, that is not present in the nucleic acids of closely related non-T. pallidum species.

[0150] The T. pallidum probes of the present disclosure include oligonucleotides having a target hybridizing sequence of at least 13 nucleotides in length that allows for the substitution of RNA and DNA equivalent bases and nucleotide analogs, and that are entirely contained within a base sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21, or its complement. The probes hybridize preferentially to target nucleic acids derived from T. pallidum over nucleic acids derived from non-T. pallidum organisms under stringent hybridization conditions. In some embodiments, the probes do not contain any other target-complementary base sequence regions overlapping or in addition to the target hybridizing sequence of bases that can form stable hybrids with nucleic acids derived from T. pallidum under the same conditions. In some embodiments, the probes are labeled with a fluorophore and a quencher, and optionally include an internally located non-nucleotide linker (e.g., a C9 linker).

[0151] The probes can be labeled with detectable labels or reporter groups by any known method. For example, the probes can be labeled with detectable moieties, such as radioisotopes, antigens, or chemiluminescent moieties, to facilitate detection of the target sequence. Useful labels include radioisotopes and non-radioactive reporting groups. Isotopic labels include: 3 H, 35 S, 32 P, 125 I, 57 Co, and 14 C. Isotopic labels can be introduced into oligonucleotides by techniques known in the art, such as nick translation, end labeling, second strand synthesis, reverse transcription, and by chemical methods. When using radiolabeled probes, hybridization can be detected by techniques such as autoradiography, scintillation counting, or gamma counting. The detection method selected depends on the specific radioisotope used for labeling.

[0152] As discussed above, nonisotopic materials can also be used for labeling and can be introduced internally between nucleotides or at the end of the oligonucleotide. Modified nucleotides can be incorporated enzymatically or chemically. Chemical modification of oligonucleotides can be performed during or after the synthesis of the oligonucleotide using techniques known in the art. For example, by using non-nucleotide linker groups as disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. Nonisotopic labels include fluorescent molecules, chemiluminescent molecules, fluorescent chemiluminescent molecules, phosphorescent molecules, electrochemiluminescent molecules, chromophores, enzymes, enzyme cofactors, enzyme substrates, dyes, and haptens or other ligands. Another useful labeling technique is a base sequence that cannot stably bind to the target nucleic acid under stringent conditions. The probes of the present disclosure can be labeled with acridinium esters that are attached to the probes by non-nucleotide linkers. Acridinium ester labeling techniques are disclosed by Arnold et al. in U.S. Pat. No. 5,185,439. Binding reagents are disclosed by Arnold et al. in US Pat. No. 6,031,091.

[0153] The selected hybridization assay probe can be contacted with a test sample suspected of containing T.pallidum nucleic acid. Generally, the test sample is derived from a source that also contains unknown organisms. After contacting the probe with the test sample that may contain the amplified nucleic acid from T.pallidum, the test sample can be incubated under conditions that allow the preferential hybridization of the probe to the target nucleic acid from T.pallidum over the nucleic acid from non-target organisms in the test sample.

[0154] Nucleic acid composition In another related aspect, the disclosure features a composition that includes a nucleic acid hybrid formed between a hybridization assay probe and a target nucleic acid ("probe:target"). One use of the hybrid formed between the probe and the target nucleic acid is to provide an indication of the presence or amount of a target organism or group of organisms in a test sample.

[0155] The present disclosure also contemplates compositions comprising nucleic acid hybrids formed between capture probes and target nucleic acids ("capture probe:target"), for example, under stringent hybridization assay conditions.One use of the hybrids formed between capture probes and target nucleic acids is to isolate and purify target nucleic acids in test samples prior to amplification of target sequences contained in the target nucleic acid or detection of the target nucleic acid, for example, in heterogeneous assays.By isolating and purifying target nucleic acids prior to amplification or detection, the chance of non-specific binding or amplification is advantageously reduced.

[0156] The present disclosure further features compositions that include a nucleic acid hybrid formed between an amplification primer and a target nucleic acid ("primer:target") under amplification conditions. One use of the hybrid formed between the primer and the target nucleic acid is to provide a nucleic acid polymerase initiation site at the 3' end of the amplification primer. For example, the hybrid can form an initiation site for reverse transcriptase, DNA polymerase such as Taq polymerase or T4 DNA polymerase, and RNA polymerase such as T7 polymerase, SP6 polymerase, T3 polymerase, etc.

[0157] The compositions of the present disclosure include compositions for determining the presence or amount of T. pallidum in a test sample, comprising a nucleic acid hybrid formed between a target nucleic acid derived from T. pallidum and a probe comprising an oligonucleotide having a target binding region, the base sequence of the target binding region consisting of any of the base sequences of the probes disclosed herein. The oligonucleotides of these compositions may contain at least one additional nucleotide base sequence region that does not stably bind to a nucleic acid derived from T. pallidum under stringent hybridization conditions.

[0158] Compositions for immobilizing target nucleic acids from T. pallidum present in a test sample are also contemplated by the present disclosure, comprising a nucleic acid hybrid formed between the target nucleic acid and a capture probe having a target binding region, the base sequence of the target binding region being at least about 85% homologous (preferably at least about 90% homologous, more preferably at least about 95% homologous, most preferably 100% homologous) to the base sequence of any of the target capture oligonucleotides disclosed herein. In further embodiments, these compositions further comprise a nucleic acid hybrid formed between the immobilized probe binding region of the capture probe and the immobilized probe.

[0159] Assay Method The present disclosure contemplates a variety of methods for determining the presence or amount of nucleic acid derived from T. pallidum in a test sample. Those skilled in the art will understand that the exact assay conditions, probes, and / or primers used will vary depending on the particular assay format and sample source used.

[0160] One aspect of the present disclosure relates to a method for determining the presence or amount of T. pallidum in a test sample by contacting the test sample with a hybridization assay probe that can hybridize preferentially to nucleic acid derived from T. pallidum under stringent hybridization assay conditions over nucleic acid derived from non-T. pallidum organisms present in the test sample under stringent hybridization conditions. The probe of the method can include at least one additional base sequence region that does not stably bind to nucleic acid derived from T. pallidum under stringent hybridization conditions.

[0161] A further aspect of the present disclosure relates to a method for amplifying nucleic acid from T. pallidum present in a test sample by contacting the test sample with one or more amplification primers under amplification conditions, each amplification primer comprising an oligonucleotide having a target binding region, the base sequence of the target binding region having or substantially corresponding to the base sequence of an oligonucleotide primer as set forth herein. The amplification primer of this embodiment optionally comprises a 5' sequence that is recognized by an RNA polymerase or enhances initiation or elongation by an RNA polymerase. When included, a T7 promoter is preferred.

[0162] In a preferred embodiment, the method for amplifying T. pallidum derived nucleic acid in a test sample further comprises contacting the test sample under stringent hybridization conditions with a hybridization assay probe that can preferentially hybridize to the amplified T. pallidum target nucleic acid over nucleic acid from non-T. pallidum organisms present in the test sample under stringent hybridization conditions. The test sample may be optionally contacted with the hybridization assay probe after a sufficient period of time for amplification has elapsed, but alternatively, the amplification primers and the hybridization assay probe may be added to the sample in any order, especially when the hybridization assay probe is a self-hybridizing probe such as a molecular torch or molecular beacon.

[0163] Certain preferred embodiments of the disclosed technology can be carried out using a real-time format in which the synthesis of T. pallidum specific nucleic acid amplification products is monitored as the amplification reaction occurs. Molecular torches or molecular beacons can be included in the amplification reaction mixture to allow sequence-specific detection. Molecular torches can be particularly useful for real-time detection of target nucleic acids.

[0164] Yet another aspect of the present disclosure relates to a method for immobilizing a target nucleic acid from T. pallidum in a test sample, which includes providing a capture probe having a target binding region and an immobilized probe binding region to the test sample under a first set of hybridization conditions that allow the capture probe to stably bind to the target nucleic acid, thereby forming a capture probe:target complex, and a second set of hybridization conditions that allow the capture probe to stably bind to the immobilized probe in the test sample, thereby forming an immobilized probe:capture probe:target complex. The first and second sets of hybridization conditions can be the same or different, and the capture probe:target complex remains stable under the second set of hybridization conditions. The target hybridizing sequence of bases of the capture probe can have the base sequence of SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36. The target capture oligonucleotide can further include a 3' immobilized probe binding region with a poly(dA) tail of 30 bases in length, as given by SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39.

[0165] Oligonucleotide segments incorporating these target binding region sequences can be synthesized to contain 2'-O-methyl substitutions (sometimes called "2' methoxy" or "2'OMe") on the sugar residues of the oligonucleotide backbone.

[0166] A purification step may be performed following the immobilization step to remove one or more components of the test sample that may interfere with or prevent the amplification or specific detection of the target sequence contained in the immobilized target nucleic acid. This method for immobilizing and optionally purifying nucleic acid from T. pallidum may precede any of the above-mentioned methods for amplifying and / or detecting the presence of a target nucleic acid from T. pallidum. When a purification step is included, the target nucleic acid may be indirectly eluted or separated from the immobilized probe by changing the sample conditions before amplifying or detecting the target sequence, or may be directly eluted or separated from the capture probe of the immobilized probe:capture probe:target complex.

[0167] kit The present disclosure also features kits useful for detecting and / or quantifying T. pallidum. The kits may include any hybridization assay probe, capture probe and / or amplification primer of the present disclosure in a suitable packaging material, as is well known to those of skill in the art, in an amount sufficient for at least one assay. Typically, the kits will also include instructions recorded in tangible form (e.g., contained in paper or electronic media) for using the packaged probe and / or primer in an amplification and / or detection assay to determine the presence or amount of T. pallidum in a test sample. The various kit components may be provided in various formats. For example, the necessary enzymes, nucleotide triphosphates, probes, and / or primers may be provided as lyophilized reagents. The components of the lyophilized reagents may be premixed prior to lyophilization such that, upon reconstitution, they form a complete mixture of each component in the appropriate ratio ready for use in an assay. In addition, the kits of the present disclosure may include a reconstitution reagent for reconstituting the lyophilized reagent. In certain preferred kits for amplifying target nucleic acids from T. pallidum, the enzyme, nucleotide triphosphates, and cofactors required for the enzyme are provided as a single lyophilized reagent that, when reconstituted, forms a reagent suitable for use in the present amplification method. In these kits, lyophilized primer reagents may also be provided. In other preferred kits, lyophilized probe reagents are provided. Typical packaging materials will include solid matrices such as glass, plastic, paper, foil, microparticles, etc. that can hold the hybridization assay probes, capture probes, and / or amplification primers of the present disclosure within fixed limits. Thus, for example, packaging materials may include vials (e.g., glass or plastic) that are used to contain sub-milligram (e.g., picogram or nanogram) amounts of the contemplated probes or primers, or they may be microtiter plate wells to which the probes or primers of the present disclosure are operably attached, i.e., bound, so that they can participate in the amplification and / or detection methods of the present disclosure.

[0168] The instructions will typically indicate the reagents and / or concentrations of the reagents, as well as at least one assay method parameter (which may be, for example, the relative amount of reagent to use per volume of sample). In addition, details such as maintenance, duration, temperature, and buffer conditions may also be included.

[0169] As indicated above, the kits of the present disclosure may include any of the hybridization assay probes, capture probes, and / or amplification primers described herein for use in amplifying and / or determining the presence or amount of T. pallidum in a test sample, whether provided individually or in one of the combinations disclosed above.

[0170] Examples are provided below to illustrate different aspects and embodiments of the present disclosure. Those skilled in the art will understand that these examples are not intended to limit the present disclosure to the specific embodiments described therein. EXAMPLES

[0171] The disclosed technology is exemplified using a real-time transcription-mediated amplification (TMA) reaction format, and a dual-labeled molecular torch hybridization probe is used to detect T. pallidum nucleic acid amplification products. All of the hybridization assay probes described below, as well as capture probes, primers, and promoter-primers, are synthesized using standard phosphoramidite chemistry and standard procedures well known in the art. See, for example, Caruthers et al., Methods in Enzymol., 154:287 (1987). Synthesis was performed using an Expedite™ 8909 Nucleic Acid Synthesizer (Applied Biosystems; Foster City, CA).

[0172] The system developed to amplify and detect ribosomal nucleic acid of T. pallidum included probes, primers, capture oligonucleotides, and combinations thereof. In particular, a single bacterial cell contains at least about 1,000 copies of 23S rRNA. Therefore, results showing the detectability of 1,000 or less copies of 23S target nucleic acid would be consistent with the procedure being able to detect a single bacterial cell. Details are provided in the following examples.

[0173] Example 1 describes screening of oligonucleotides in real-time TMA reactions that amplified and detected the 23s ribosomal nucleic acid of T. pallidum. Advantageously, the nucleic acid sequence of T. pallidum was detected without also detecting the nucleic acid sequence of the closely related bacterium T. denticola.

[0174] Example 1 Screening of oligonucleotide combinations specific for 23s ribosomal nucleic acid detection The in vitro transcripts served as target nucleic acids containing ribosomal RNA sequences in the screening procedure. A DNA insert encoding a portion of the T. pallidum 23S ribosomal nucleic acid sequence was ligated into a plasmid cloning vector downstream of a T7 promoter and grown in a bacterial host using standard laboratory procedures. The purified plasmid was linearized by restriction enzyme digestion and then used as a template for T7 RNA polymerase to produce T. pallidum in vitro transcripts (IVTs), which were quantified by spectrophotometry. The T. pallidum IVTs contained the sequence of SEQ ID NO:1. A parallel procedure was used to prepare a plasmid cloning vector containing a DNA insert encoding a portion of the T. denticola 23S ribosomal nucleic acid sequence downstream of a T7 promoter. Again, the plasmid was grown in a bacterial host, purified, linearized by restriction enzyme digestion, and used to produce T. denticola IVTs, which were also quantified by spectrophotometry. The T. denticola IVTs contained the sequence of SEQ ID NO:2.

[0175] Oligonucleotide primer and probe combinations were screened for their ability to amplify and specifically detect nucleic acid sequences of T. pallidum. Table 1 shows the oligonucleotide combinations used in this procedure. [Table 1]

[0176] Real-time monitoring of isothermal nucleic acid amplification reactions was performed using a temperature-controlled MX3005p instrument (Stratagene, La Jolla, CA). As is well known to those skilled in the art, reactions were performed in individual wells of a multi-well plate, with each well containing 65 μl of amplification reagents including a pH-buffered mixture of ribonucleotide triphosphates, deoxyribonucleotide triphosphates, salts, and cofactors to perform the TMA reaction. The reactions further contained primers and molecular torch hybridization probes, as shown in Table 1. Individual wells were then filled with 1x10 5 of either T. pallidum IVT or T. denticola IVT to serve as template or target for the amplification reaction. 6Each well received a 10 μl aliquot containing a copy of each well. All reactions were set up in duplicate. The multi-well plate was first incubated at 60° C. for 5 minutes to allow hybridization of the primers to the IVT, and then equilibrated to approximately 43° C. The multi-well plate was then transferred to an EPPENDORF THERMOMIXER® (Eppendorf North America, Westbury, NY) set at 44° C. Next, each reaction well received a 25 μl aliquot of enzyme reagent containing a pH buffered mixture of Moloney Murine Leukemia Virus ("MMLV") reverse transcriptase and T7 RNA polymerase, also as is well known to those skilled in the art. The plate was sealed with an adhesive cover and gently shaken for 1 minute before being transferred to a real-time instrument set to incubate at 42° C. The fluorescent signal from the molecular torch (measured in relative fluorescent units (RFU)) was detected at regular time intervals. A threshold-based TTime value, which serves as an indicator of the amount of amplicon synthesized, was determined from the monitored fluorescent signal substantially according to the method disclosed by Light et al. in US Pat. No. 8,615,368.

[0177] The results of the procedure shown in Figures 1A-1F identified several viable oligo systems that detected target nucleic acids in T. pallidum but not in T. denticola.

[0178] Example 2 describes another approach for detecting T. pallidum nucleic acid. Here, the target nucleic acid is amplified using a "biphasic" reaction mechanism, with linear and exponential amplification steps separated in time. The essential features of this technique are described in U.S. Patent No. 10,196,674, the entire disclosure of which is incorporated herein by reference. In particular, the use of biphasic amplification technique has improved the sensitivity of T. pallidum nucleic acid detection.

[0179] Example 2 Amplification and detection using a biphasic amplification procedure The biphasic amplification procedure used a phase 1 linear amplification reaction and a phase 2 exponential amplification reaction. This procedure used the primer and probe combinations of systems S5 and S7. The phase 1 amplification reaction began with a target capture step in which pre-amplification hybrid complexes, each containing a T7 promoter-primer hybridized to its complementary T. pallidum target nucleic acid, were captured on solid-supported magnetic beads. The target capture reaction included a 400 μl volume of pH-buffered lithium lauryl sulfate (LLS) detergent solution, a known copy level of T. pallidum IVT, one of the T7 promoter-primers (SEQ ID NO: 11 for S5, and SEQ ID NO: 12 for S7), magnetic beads that allow capture or immobilization of the IVT and any hybridized T7 promoter-primers (i.e., pre-amplification hybrids), and a target capture oligo (SEQ ID NO: 37 for both S5 and S7) that facilitates immobilization or capture of the pre-amplification hybrids to the magnetic beads. The target capture oligonucleotide (TCO) in this example serves to bridge the bead-immobilized oligonucleotide (i.e., oligo(dT)) and the IVT, but other options are also available for sequence-specific capture of the IVT directly onto beads displaying a capture oligonucleotide complementary to the IVT. The target capture step allowed for the formation and capture of pre-amplification hybrids formed in the reaction mixture. Isolation and washing of the magnetic beads was facilitated by the use of an automated magnetic particle processor. This procedure resulted in isolated pre-amplification hybrids that were depleted or substantially free of unhybridized T7 promoter-primer. The isolated pre-amplification hybrids were incubated with pH buffer, ribonucleotide triphosphates, deoxyribonucleotide triphosphates, salts, cofactors, MMLV reverse transcriptase and T7 RNA polymerase enzymes, and a non-T7 primer (SEQ ID NO:18), but no additional T7 promoter-primers other than those included in the pre-amplification hybrids were added. The cDNA strands were created by extension of the T7 primers of the pre-amplification hybrids during the first phase reaction. The RNase H activity of MMLV reverse transcriptase digested the RNA strand that served as a template for cDNA synthesis.The non-T7 primers present in the reaction mixture hybridized to the complementary cDNA and were extended to produce double-stranded DNA with a T7 promoter sequence. The T7 RNA polymerase in the reaction mixture then synthesized transcripts from the double-stranded template. These transcripts hybridized to the non-T7 primers that were also included in the reaction mixture and were then extended by reverse transcriptase. Again, the RNA template strand was degraded by the RNase H activity of MMLV reverse transcriptase. The result of these steps was the accumulation in the phase 1 reaction mixture of a promoterless cDNA strand with the same sequence orientation or polarity as the IVT target strand.

[0180] The exponential phase amplification reaction was initiated by adding the T7 promoter-primer (SEQ ID NO: 11 for S5, and SEQ ID NO: 12 for S7) and the molecular torch hybridization probe (SEQ ID NO: 32 for S5, and SEQ ID NO: 33 for S7) to the first phase reaction mixture. In this exemplary procedure, the added T7 promoter-primer was the same as that used during the target capture step (i.e., a component of the preamplification hybrid). Alternatively, other T7 promoter-primers could have been used. RNA transcripts produced as amplification products during the exponential phase amplification reaction hybridized to the molecular torch hybridization probe as the reaction proceeded, and the resulting complex was detected by fluorescence emission as a function of reaction time. General aspects of the biphasic amplification technique are disclosed by Nelson et al. in U.S. Pat. No. 10,196,674.

[0181] The results of this procedure, shown in Figures 2A-2B, confirmed that both System 5 and System 7 performed well using a biphasic amplification and detection format. System 5 showed a very well shaped running curve, even with as little as 10 copies / ml of IVT.

[0182] Example 3 describes a set of procedures used to demonstrate the sensitivity and specificity of an exemplary assay for detecting T. pallidum nucleic acids. The procedures combined small and variable amounts of T. pallidum IVT with large, fixed amounts of closely related but non-targeted T. denticola IVT. The mixture was subjected to target capture and biphasic amplification and detection. System S5 oligonucleotides were used in this demonstration.

[0183] Example 3 Testing Assay Sensitivity and Specificity Using IVT The biphasic amplification and detection procedure of Example 2 using primer and probe oligonucleotides of System S5 was essentially followed to demonstrate the sensitivity and specificity of the assay. The amount and identity of the target nucleic acid served as variables. Individual target capture reactions contained either (1) 10 copies / ml, 30 copies / ml, 100 copies / ml, or 300 copies / ml of T. pallidum IVT to establish a baseline for comparison, or (2) 0 copies / ml of T. pallidum IVT and 1×10 6 copies / ml of T. denticola, 30 copies / ml of T. pallidum IVT and 1 × 10 6 copies / ml of T. denticola or 100 copies / ml of T. pallidum IVT and 1 × 10 6 aliquots of either T. denticola at 1000 copies / ml were spiked in. Phase 1 linear and phase 2 exponential amplification reactions were performed as described in the previous examples.

[0184] The results of the procedure shown in Figures 3A-3B confirmed that the T. pallidum assay was highly specific for T. pallidum target nucleic acids and was not substantially compromised by the presence of large amounts of closely related non-target nucleic acids. Figure 3A shows a well-formed run curve that represents detection of T. pallidum amplification products even at levels of 10 copies / ml. Thus, the assay was highly sensitive. Figure 3B showed that T. pallidum amplification products were readily detectable at 300 copies / ml or 30 copies / ml in the presence of high levels of T. denticola non-target nucleic acids. Furthermore, no amplification products of T. denticola target nucleic acids were detectable. Thus, the assay was both sensitive and specific.

[0185] Example 4 shows the procedure used to investigate the specificity and sensitivity of the T. pallidum assay using cells instead of IVT. Assay sensitivity was determined using curve fitting analysis of positive results obtained using known numbers of whole T. pallidum organisms.

[0186] Example 4 Testing assay sensitivity using T. pallidum cells The real-time TMA assay of Example 3 was used to capture, amplify and detect 23S rRNA of T. pallidum for sensitivity testing using T. pallidum cells as a source of target nucleic acid. Samples were processed and amplification and detection reactions were performed using a commercially available Panther® automated nucleic acid testing instrument (Hologic, Inc., San Diego, CA). Serial dilutions of dark-field quantified T. pallidum organisms at the levels shown in Table 2 were processed in replicates of 10, and positive detection was determined by the combination of the minimum fluorescent signal reading and the maximum time required to reach a given level of amplification. More specifically, positive was determined as a background-subtracted RFU (relative fluorescent unit) of at least 1.0, and a Ttime measurement of 53 minutes or less. The results of the procedure are presented in Table 2. [Table 2]

[0187] Statistical analysis of the results presented in Table 2 showed that using the disclosed assay there was a 50% chance of detecting a minimum of 0.27 organisms and a 95% chance of detecting a minimum of 1.36 organisms.

[0188] Example 5 describes a procedure that demonstrates how the assays of the previous examples can be used to detect nucleic acids from T. pallidum without also detecting nucleic acids from a variety of other organisms.

[0189] Example 5 Testing assay specificity using bacterial cells The specificity of the T. pallidum assay using a collection of non-target organisms as a source of amplifiable nucleic acid was investigated following a biphasic amplification and detection procedure essentially as described in Example 4. A pooled set of panels containing known amounts of non-target organisms is shown in Table 3. As described above, the lysis and target capture reagent combination included a pH buffer, lithium lauryl sulfate surfactant, and magnetic beads displaying surface-immobilized oligonucleotides to aid in the capture of nucleic acid. In this case, the surface-immobilized oligonucleotides included oligo(dT), and the target capture reagent further included a T7 promoter-primer comprising a target capture oligonucleotide of SEQ ID NO: 37 and a target hybridizing sequence of SEQ ID NO: 7 (e.g., SEQ ID NO: 11). The beads with the captured complexes containing the target nucleic acid and hybridized primers were washed and then combined with an amplification reagent comprising deoxyribonucleotide triphosphates, ribonucleotide triphosphates, MMLV reverse transcriptase, T7 RNA polymerase, salts and cofactors, and a non-T7 primer having a sequence of SEQ ID NO: 18 to initiate linear phase amplification. After an initial incubation period, the reaction mixture was combined with an aliquot of reagent containing a molecular torch having the sequence of SEQ ID NO: 32, and a T7 promoter-primer to initiate an exponential phase amplification reaction. In this case, the added T7 promoter was the same as that contained in the target capture reagent (SEQ ID NO: 11), a matter of convenient choice. It is possible that a different T7 promoter-primer could have been used for the same purpose.

[0190] The results shown in Table 3 advantageously demonstrated that the T. pallidum assay is highly specific for the detection of T. pallidum nucleic acid. As shown in the table, nucleic acid sequences characteristic of T. pallidum were detected at 100% positive levels using test samples with an IVT of only 30 copies / ml. In the presence of potentially cross-reacting non-target organisms and the absence of T. pallidum target, the positive rate was 0%. Interference testing of low titer T. pallidum RNA (30 copies / ml) showed 100% positivity. The performance of the assay was not affected by non-target organisms. [Table 3]

[0191] It is to be understood that both the foregoing summary and detailed description are exemplary and explanatory only and are not intended to limit the present teachings. To the extent that any material incorporated by reference conflicts with the explicit content of this disclosure, the explicit content shall control.

[0192] While the present disclosure has been described and illustrated in some detail with reference to certain illustrative embodiments including various combinations and subcombinations of features, those skilled in the art will readily appreciate other embodiments and variations and modifications thereof that are encompassed within the scope of the present disclosure. Moreover, the description of such embodiments, combinations, and subcombinations is not intended to convey that the present disclosure requires features or combinations of features other than those expressly recited in the claims. Accordingly, the present disclosure is deemed to include all modifications and variations that are encompassed within the spirit and scope of the following numbered embodiments.

[0193] Numbered embodiments Example 1 is an oligonucleotide hybridization probe for detecting nucleic acids of T. pallidum, A target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, It is an oligonucleotide hybridization probe that is a maximum of 47 bases in length.

[0194] Embodiment 2 is an oligonucleotide hybridization probe according to embodiment 1, further comprising a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

[0195] Embodiment 3 further comprises a non-nucleotidic linker and a pair of interacting labels, The oligonucleotide hybridization probe of embodiment 1 is a molecular torch hybridization probe.

[0196] Embodiment 4 is an oligonucleotide hybridization probe according to embodiment 3, wherein the pair of interactive labels comprises a fluorophore moiety and a quencher moiety.

[0197] Embodiment 5 is the oligonucleotide hybridization probe of embodiment 3 or 4, wherein the non-nucleotidic linker is a C9 linker.

[0198] Embodiment 6 is an oligonucleotide hybridization probe according to any one of embodiments 1 to 5, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27, each of which sequences allows for the substitution of RNA and DNA equivalent bases.

[0199] Embodiment 7 is an oligonucleotide hybridization probe according to any one of embodiments 1 to 5, wherein the target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 is a target hybridizing sequence of 13 to 22 consecutive bases of SEQ ID NO: 21 or its complement, allowing for the substitution of RNA and DNA equivalent bases.

[0200] Embodiment 8 is an oligonucleotide hybridization probe according to embodiment 7, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27, each of which allows for the substitution of RNA and DNA equivalent bases.

[0201] Embodiment 9 is an oligonucleotide hybridization probe according to any one of embodiments 1 or 3-8, further comprising at least one nucleotide analogue comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

[0202] Embodiment 10 is a primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence, comprising: a first primer comprising a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5; a first primer, the first primer being up to 50 bases in length; a second primer comprising a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15; the second primer is up to 50 bases in length; At least one of the first and second primers is a primer set further comprising a phage promoter sequence linked upstream of the respective target hybridizing sequence.

[0203] Embodiment 11 is the primer set according to embodiment 10, wherein the first primer comprises the phage promoter sequence linked upstream of the first target hybridizing sequence.

[0204] Embodiment 12 is the primer set according to embodiment 11, wherein the phage promoter sequence comprises a T7 promoter sequence.

[0205] Embodiment 13 is the primer set according to any one of embodiments 10 to 12, wherein the target hybridizing sequence of the first primer ends with SEQ ID NO:7 at its 3' end.

[0206] Embodiment 14 is the primer set according to any one of embodiments 10 to 13, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:8.

[0207] Embodiment 15 is the primer set according to any one of embodiments 10 to 12, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.

[0208] Embodiment 16 is the primer set according to any one of embodiments 10 to 12, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0209] Embodiment 17 is the primer set according to any one of embodiments 10 to 16, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13.

[0210] Embodiment 18 is the primer set according to any one of embodiments 10 to 17, wherein the target hybridizing sequence of the second primer is SEQ ID NO:16.

[0211] Embodiment 19 is the primer set according to any one of embodiments 10 to 17, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:14.

[0212] Embodiment 20 is the primer set of embodiment 19, wherein the target hybridizing sequence of the second primer is SEQ ID NO:17 or SEQ ID NO:16.

[0213] Embodiment 21 is the primer set according to any one of embodiments 10 to 17, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:15.

[0214] Embodiment 22 is the primer set of embodiment 21, wherein the target hybridizing sequence of the second primer is SEQ ID NO:18 or SEQ ID NO:17.

[0215] Embodiment 23 is the primer set according to any one of embodiments 10 to 12, wherein the first primer is SEQ ID NO:11 and the second primer is SEQ ID NO:18.

[0216] Embodiment 24 is the primer set according to any one of embodiments 10 to 12, wherein the first primer is SEQ ID NO:12 and the second primer is SEQ ID NO:18.

[0217] Embodiment 25 is a method for determining whether a sample contains nucleic acid of T. pallidum, the method comprising: (a) contacting the sample with a set of primers; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the set of primers in an in vitro nucleic acid amplification reaction, whereby, if the sample contains T. pallidum nucleic acid, an amplification product is produced; (c) detecting any of the amplification products produced in step (b) using a detectably labeled oligonucleotide hybridization probe; (d) determining from the result of step (c) whether the amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid. Embodiment 26 is the method for determining whether the detectably labeled hybridization probe comprises: A target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, 26. The method of embodiment 25, wherein the oligonucleotide hybridization probe is up to 47 bases in length.

[0218] Embodiment 27 is the method of embodiment 26, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising a non-nucleotide linker and a pair of interactive labels.

[0219] Embodiment 28 is the method of embodiment 27, wherein the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher.

[0220] Embodiment 29 is the method of embodiment 27, wherein the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker positioned at one end of the target hybridizing sequence.

[0221] Embodiment 30 is the method of embodiment 26, wherein the detectably labeled hybridization probe further comprises each of a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

[0222] Embodiment 31 is a method for detecting a nucleic acid sequence comprising the steps of: the first primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3; the second primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO: 13; 27. The method of embodiment 26, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence.

[0223] Embodiment 32 is the method according to any one of embodiments 25 to 31, wherein steps (a) and (b) are performed simultaneously, and said amplification reaction is a real-time amplification reaction.

[0224] Embodiment 33 is a method according to any one of embodiments 25 to 32, wherein the amplification product detected in step (c) is an RNA amplicon of the opposite sense to the 23S rRNA of T. pallidum.

[0225] Embodiment 34 is a reaction mixture for detecting T. pallidum nucleic acid that may be present in a test sample, comprising: The test sample, An oligonucleotide primer set comprising a first primer and a second primer, The first primer comprises a base sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3; The second primer comprises an oligonucleotide primer set that contains a base sequence complementary to an extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction; and a detectably labeled hybridization probe, the hybridization probe comprising a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction performed using the oligonucleotide primer set and a template comprising the base sequence of SEQ ID NO:1.

[0226] Embodiment 35 is the reaction mixture of embodiment 34, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising each of a fluorophore, a quencher, and a non-nucleotidic linker.

[0227] Embodiment 36 is the reaction mixture of embodiment 34, wherein the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution.

[0228] Embodiment 37 is a reaction mixture according to any one of embodiments 34 to 36, wherein the base sequence complementary to the amplicon allows for the substitution of RNA and DNA equivalent bases and is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27.

[0229] Embodiment 38 is a reaction mixture according to any one of embodiments 34 to 36, wherein the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:7, and SEQ ID NO:6.

[0230] Embodiment 39 is a reaction mixture according to any one of embodiments 34 to 38, wherein the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO:3.

[0231] Embodiment 40” is the reaction mixture of embodiment 39, wherein the promoter sequence is a T7 promoter sequence.

[0232] Embodiment 41 is the reaction mixture of any one of embodiments 34 to 40, wherein the second primer is up to 50 bases in length and comprises at least 17 contiguous bases of SEQ ID NO:13.

[0233] Embodiment 42 is the reaction mixture of any one of embodiments 34 to 41, wherein the second primer comprises a 3' end selected from the group consisting of SEQ ID NO:18, SEQ ID NO:17, and SEQ ID NO:16.

[0234] Embodiment 43 is a reaction mixture described in any one of embodiments 34 to 42, wherein the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum.

[0235] Embodiment 44 is the reaction mixture of embodiment 43, wherein the reaction mixture comprises the RNA amplicon hybridized to the molecular torch hybridization probe.

[0236] Embodiment 45 is the reaction mixture of any one of embodiments 34 to 44, wherein the nucleic acid amplification reaction is a transcription-associated amplification reaction.

[0237] Embodiment 46 is the reaction mixture of embodiment 45, wherein the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction.

[0238] Embodiment 47 is a kit of reagents for detecting nucleic acids of T. pallidum, comprising: A set of oligonucleotide primers comprising: a first primer of the set comprising a target-hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3; a set of oligonucleotide primers, wherein a second primer of the set comprises a target-hybridizing sequence that is complementary to the extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction; a molecular torch hybridization probe, the molecular torch hybridization probe being up to 50 bases in length and comprising a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, and further comprising each of a fluorophore moiety, a quencher moiety, a non-nucleotidic linker, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution; and one or more reagents for carrying out an in vitro nucleic acid amplification reaction using the set of primers.

[0239] Embodiment 48 is the kit described in embodiment 47, wherein the target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement is a target hybridizing sequence of 13 to 22 consecutive bases of SEQ ID NO: 21 or its complement.

[0240] Embodiment 49 is the kit of embodiment 47 or 48, wherein the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27.

[0241] Embodiment 50 is a kit described in any one of embodiments 47 to 49, wherein the target hybridization sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27.

[0242] Embodiment 51 is the kit according to any one of embodiments 47 to 50, wherein each of the first and second primers is up to 50 bases in length.

[0243] Embodiment 52 is the kit according to any one of embodiments 47 to 51, wherein a phage promoter sequence is bound upstream of the target hybridizing sequence of the first primer.

[0244] Embodiment 53 is a kit according to embodiment 52, wherein the phage promoter sequence is a T7 promoter sequence.

[0245] Embodiment 54 is the kit according to any one of embodiments 47 to 53, wherein the target hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7.

[0246] Embodiment 55 is the kit according to any one of embodiments 47 to 54, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:8.

[0247] Embodiment 56 is a kit according to any one of embodiments 47 to 53, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0248] Embodiment 57 is the kit of any one of embodiments 47 to 56, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12.

[0249] Embodiment 58 is the kit according to any one of embodiments 47 to 57, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13.

[0250] Embodiment 59 is a kit according to any one of embodiments 47 to 58, wherein the one or more reagents include each of a reverse transcriptase and a T7 RNA polymerase.

[0251] While various embodiments of the present disclosure have been shown and described in detail, it will be readily apparent to those skilled in the art that various modifications can be made therein without departing from the scope of the disclosure or the appended claims. In certain embodiments, for example, the following are provided: (Item 1) 1. An oligonucleotide hybridization probe for detecting T. pallidum nucleic acid, comprising: A target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, An oligonucleotide hybridization probe, wherein said oligonucleotide hybridization probe is up to 47 bases in length. (Item 2) 2. The oligonucleotide hybridization probe according to claim 1, further comprising a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution. (Item 3) further comprising a non-nucleotidic linker and a pair of interacting labels, 2. The oligonucleotide hybridization probe according to item 1, which is a molecular torch hybridization probe. (Item 4) 4. The oligonucleotide hybridization probe according to claim 3, wherein the pair of interactive labels comprises a fluorophore moiety and a quencher moiety. (Item 5) 5. The oligonucleotide hybridization probe according to claim 3 or 4, wherein the non-nucleotidic linker is a C9 linker. (Item 6) 6. The oligonucleotide hybridization probe according to any one of items 1 to 5, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, each of which sequences allows for the substitution of RNA and DNA equivalent bases. (Item 7) 6. The oligonucleotide hybridization probe according to any one of items 1 to 5, wherein the target hybridization sequence of at least 13 consecutive bases of SEQ ID NO: 19 is a target hybridization sequence of 13 to 22 consecutive bases of SEQ ID NO: 21 or its complement, allowing for the substitution of RNA and DNA equivalent bases. (Item 8) 8. The oligonucleotide hybridization probe according to item 7, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO: 26 and SEQ ID NO: 27, each of which allows for the substitution of RNA and DNA equivalent bases. (Item 9) 9. The oligonucleotide hybridization probe according to any one of items 1 or 3 to 8, further comprising at least one nucleotide analogue comprising a ribofuranosyl moiety having a 2'-O-methyl substitution. (Item 10) A primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence, comprising: a first primer comprising a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5; a first primer, the first primer being up to 50 bases in length; a second primer comprising a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15; a second primer, the second primer being up to 50 bases in length; A primer set, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence. (Item 11) 11. The primer set according to item 10, wherein the first primer comprises the phage promoter sequence linked upstream of a first target hybridizing sequence. (Item 12) 12. The primer set according to item 11, wherein the phage promoter sequence comprises a T7 promoter sequence. (Item 13) 13. The primer set according to any one of Items 10 to 12, wherein the target hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7. (Item 14) The target hybridizing sequence of the first primer is SEQ ID NO:7 and SEQ ID NO:8 14. The primer set according to any one of items 10 to 13, selected from the group consisting of: (Item 15) 13. The primer set according to any one of items 10 to 12, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. (Item 16) 13. The primer set according to any one of items 10 to 12, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. (Item 17) 17. The primer set according to any one of Items 10 to 16, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13. (Item 18) 18. The primer set according to any one of Items 10 to 17, wherein the target hybridizing sequence of the second primer is SEQ ID NO:16. (Item 19) 18. The primer set according to any one of Items 10 to 17, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:14. (Item 20) 20. The primer set of claim 19, wherein the target hybridizing sequence of the second primer is SEQ ID NO: 17 or SEQ ID NO: 16. (Item 21) 18. The primer set according to any one of Items 10 to 17, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:15. (Item 22) 22. The primer set of claim 21, wherein the target hybridizing sequence of the second primer is SEQ ID NO: 18 or SEQ ID NO: 17. (Item 23) 13. The primer set according to any one of Items 10 to 12, wherein the first primer is SEQ ID NO: 11 and the second primer is SEQ ID NO: 18. (Item 24) 13. The primer set according to any one of Items 10 to 12, wherein the first primer is SEQ ID NO: 12 and the second primer is SEQ ID NO: 18. (Item 25) 1. A method for determining whether a sample contains T. pallidum nucleic acid, the method comprising: (a) contacting the sample with a set of primers; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the set of primers in an in vitro nucleic acid amplification reaction, whereby, if the sample contains T. pallidum nucleic acid, an amplification product is produced; (c) detecting any of the amplification products produced in step (b) using a detectably labeled oligonucleotide hybridization probe; (d) determining from the result of step (c) whether an amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid. (Item 26) The detectably labeled hybridization probe comprises: At least 13 of SEQ ID NO: 19 allow for the substitution of RNA and DNA equivalent bases. a target hybridizing sequence of contiguous bases or its complement; a detectable label, 26. The method of claim 25, wherein the oligonucleotide hybridization probe is up to 47 bases in length. (Item 27) 27. The method of claim 26, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising a non-nucleotide linker and a pair of interactive labels. (Item 28) 28. The method of claim 27, wherein the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher. (Item 29) 28. The method of claim 27, wherein the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker positioned at one end of the target hybridizing sequence. (Item 30) 27. The method of claim 26, wherein the detectably labeled hybridization probe further comprises each of a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution. (Item 31) the set of primers in step (a) comprises a first primer and a second primer; the first primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3; the second primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO: 13; 27. The method of claim 26, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence. (Item 32) 32. The method according to any one of items 25 to 31, wherein steps (a) and (b) are carried out simultaneously, and the amplification reaction is a real-time amplification reaction. (Item 33) 33. The method according to any one of items 25 to 32, wherein the amplification product detected in step (c) is an RNA amplicon of opposite sense to the 23S rRNA of T. pallidum. (Item 34) 1. A reaction mixture for detecting T. pallidum nucleic acid that may be present in a test sample, comprising: The test sample; An oligonucleotide primer set comprising a first primer and a second primer, the first primer comprises a base sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3; an oligonucleotide primer set, wherein the second primer comprises a base sequence complementary to an extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction; a detectably labeled hybridization probe, the hybridization probe comprising a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction carried out using the oligonucleotide primer set and a template comprising the base sequence of SEQ ID NO:1; and a reaction probe. (Item 35) 35. The reaction mixture of claim 34, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising each of a fluorophore, a quencher, and a non-nucleotidic linker. (Item 36) 35. The reaction mixture of claim 34, wherein the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution. (Item 37) 37. The reaction mixture according to any one of items 34 to 36, wherein the base sequence complementary to the amplicon allows for the substitution of RNA and DNA equivalent bases and is selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27. (Item 38) 37. The reaction mixture according to any one of items 34 to 36, wherein the first primer comprises a 3'-end sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 7, and SEQ ID NO: 6. (Item 39) 39. The reaction mixture according to any one of items 34 to 38, wherein the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3. (Item 40) 40. The reaction mixture according to item 39, wherein the promoter sequence is a T7 promoter sequence. (Item 41) 41. The reaction mixture according to any one of items 34 to 40, wherein the second primer is up to 50 bases in length and comprises at least 17 consecutive bases of SEQ ID NO:13. (Item 42) 42. The reaction mixture according to any one of items 34 to 41, wherein the second primer comprises a 3' end selected from the group consisting of SEQ ID NO:18, SEQ ID NO:17, and SEQ ID NO:16. (Item 43) 43. The reaction mixture of any one of items 34 to 42, wherein the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum. (Item 44) 44. The reaction mixture of claim 43, wherein the reaction mixture comprises the RNA amplicon hybridized to the molecular torch hybridization probe. (Item 45) 45. The reaction mixture according to any one of items 34 to 44, wherein the nucleic acid amplification reaction is a transcription-associated amplification reaction. (Item 46) 46. ​​The reaction mixture of item 45, wherein the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction. (Item 47) A kit of reagents for detecting nucleic acids of T. pallidum, comprising: A set of oligonucleotide primers comprising: a first primer of the set comprises a target-hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3; The second primer of the set is a set of oligonucleotide primers comprising a target hybridizing sequence that is complementary to an extension product of the first primer when SEQ ID NO:1 is used as a template; a molecular torch hybridization probe, the molecular torch hybridization probe being up to 50 bases in length and comprising a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, and further comprising each of a fluorophore moiety, a quencher moiety, a non-nucleotidic linker, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution; and one or more reagents for performing an in vitro nucleic acid amplification reaction using the set of primers. (Item 48) 48. The kit according to item 47, wherein the target hybridizing sequence of at least 13 contiguous bases of SEQ ID NO: 19 or its complement is a target hybridizing sequence of 13 to 22 contiguous bases of SEQ ID NO: 21 or its complement. (Item 49) 50. The kit of claim 47 or 48, wherein the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27. (Item 50) 50. The kit according to any one of items 47 to 49, wherein the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27. (Item 51) 51. The kit according to any one of items 47 to 50, wherein each of the first and second primers is up to 50 bases in length. (Item 52) 52. The kit according to any one of Items 47 to 51, wherein a phage promoter sequence is bound upstream of the target hybridizing sequence of the first primer. (Item 53) 53. The kit according to item 52, wherein the phage promoter sequence is a T7 promoter sequence. (Item 54) 54. The kit according to any one of Items 47 to 53, wherein the target-hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7. (Item 55) 55. The kit according to any one of Items 47 to 54, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 8. (Item 56) 54. The kit according to any one of Items 47 to 53, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. (Item 57) 57. The kit according to any one of Items 47 to 56, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. (Item 58) 58. The kit according to any one of Items 47 to 57, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13. (Item 59) 59. The kit according to any one of items 47 to 58, wherein the one or more reagents comprise each of a reverse transcriptase and a T7 RNA polymerase.

Claims

1. A primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence, comprising: a first primer comprising a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5; a first primer, the first primer being up to 50 bases in length; a second primer comprising a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15; a second primer, the second primer being up to 50 bases in length; A primer set, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence.

2. The primer set described in claim 1, wherein the first primer comprises a phage promoter sequence bound upstream of a first target hybridizing sequence.

3. The primer set described in claim 2, wherein the phage promoter sequence includes a T7 promoter sequence.

4. The primer set described in claim 2, wherein the target hybridizing sequence of the first primer has its 3' end ending with sequence number 7.

5. The primer set described in claim 2, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO:

8.

6. The primer set described in claim 1, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:

8.

7. The primer set described in claim 2, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO:

12.

8. The primer set described in claim 7, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:

13.

9. The primer set described in claim 8, wherein the target hybridizing sequence of the second primer is sequence number 16.

10. The primer set described in claim 2, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:

14.

11. The primer set described in claim 10, wherein the target hybridizing sequence of the second primer is sequence number 17 or sequence number 16.

12. The primer set described in claim 2, wherein the target hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:

15.

13. The primer set described in claim 12, wherein the target hybridizing sequence of the second primer is sequence number 18 or sequence number 17.

14. The primer set described in claim 2, wherein the first primer is sequence number 11 and the second primer is sequence number 18.

15. The primer set described in claim 2, wherein the first primer is sequence number 12 and the second primer is sequence number 18.

16. 1. A method for determining whether a sample contains T. pallidum nucleic acid, the method comprising: (a) contacting the sample with the primer set according to any one of claims 1 to 15; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the primer set in an in vitro nucleic acid amplification reaction, whereby, if the sample contains T. pallidum nucleic acid, an amplification product is produced; (c) detecting any of the amplification products produced in step (b) using a detectably labeled oligonucleotide hybridization probe; (d) determining from the result of step (c) whether an amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid.

17. The detectably labeled oligonucleotide hybridization probe of claim 1, A target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, allowing for the substitution of RNA and DNA equivalent bases; a detectable label, 17. The method of claim 16, wherein the oligonucleotide hybridization probe is a maximum of 47 bases in length.

18. 18. The method of claim 17, wherein the detectably labeled oligonucleotide hybridization probe is a molecular torch hybridization probe comprising a non-nucleotidic linker and a pair of interactive labels.

19. 20. The method of claim 18, wherein the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher.

20. 20. The method of claim 18, wherein the non-nucleotidic linker of the molecular torch hybridization probe is a C9 linker positioned at one end of the target hybridizing sequence.

21. 18. The method of claim 17, wherein the detectably labeled oligonucleotide hybridization probe further comprises each of a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

22. The method of claim 21, wherein the first primer comprises a target hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3; 18. The method of claim 17, wherein the second primer comprises a target-hybridizing sequence of at least 17 contiguous bases of SEQ ID NO:

13.

23. 23. The method of claim 22, wherein steps (a) and (b) are performed simultaneously, and the amplification reaction is a real-time amplification reaction.

24. 23. The method of claim 22, wherein the amplification product detected in step (c) is an RNA amplicon of opposite sense to the 23S rRNA of T. pallidum.

25. 1. A reaction mixture for detecting T. pallidum nucleic acid that may be present in a test sample, comprising: The test sample; A primer set according to any one of claims 1 to 15, a detectably labeled hybridization probe, the hybridization probe comprising a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction performed using the oligonucleotide primer set and a template comprising the base sequence of SEQ ID NO:

1.

26. 26. The reaction mixture of claim 25, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising each of a fluorophore, a quencher, and a non-nucleotidic linker.

27. 26. The reaction mixture of claim 25, wherein the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution.

28. 27. The reaction mixture of claim 26, wherein the base sequence complementary to the amplicon allows for the substitution of RNA and DNA equivalent bases and is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:

27.

29. 27. The reaction mixture of claim 26, wherein the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:7, and SEQ ID NO:

6.

30. 26. The reaction mixture of claim 25, wherein the first primer comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO:

3.

31. 31. The reaction mixture of claim 30, wherein the promoter sequence is a T7 promoter sequence.

32. 32. The reaction mixture of claim 31 , wherein the second primer comprises at least 17 consecutive bases of SEQ ID NO:

13.

33. 27. The reaction mixture of claim 26, wherein the second primer comprises a 3' end selected from the group consisting of SEQ ID NO:18, SEQ ID NO:17, and SEQ ID NO:

16.

34. 32. The reaction mixture of claim 31 , wherein the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum.

35. 35. The reaction mixture of claim 34, wherein the reaction mixture comprises the RNA amplicon hybridized to the molecular torch hybridization probe.

36. 32. The reaction mixture of claim 31 , wherein the nucleic acid amplification reaction is a transcription-associated amplification reaction.

37. 37. The reaction mixture of claim 36, wherein the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction.

38. A kit of reagents for detecting nucleic acids of T. pallidum, comprising: A primer set according to any one of claims 1 to 15, a molecular torch hybridization probe, the molecular torch hybridization probe being up to 50 bases in length and comprising a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, and further comprising each of a fluorophore moiety, a quencher moiety, a non-nucleotidic linker, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution; and one or more reagents for performing an in vitro nucleic acid amplification reaction using the primer set.

39. The kit of claim 38, wherein the target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO:19 or its complement is a target hybridizing sequence of 13 to 22 consecutive bases of SEQ ID NO:21 or its complement.

40. 39. The kit of claim 38, wherein the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:

27.

41. The kit of claim 38, wherein the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:

27.

42. 41. The kit of claim 40, wherein a phage promoter sequence is linked upstream of the target hybridizing sequence of the first primer.

43. 43. The kit of claim 42, wherein the phage promoter sequence is a T7 promoter sequence.

44. 43. The kit of claim 42, wherein the target hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:

7.

45. 43. The kit of claim 42, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:

8.

46. 39. The kit of claim 38, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:

8.

47. 39. The kit of claim 38, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:

12.

48. 39. The kit of claim 38, wherein the target hybridizing sequence of the second primer is 17 to 20 contiguous bases of SEQ ID NO:

13.

49. 39. The kit of claim 38, wherein the one or more reagents comprise each of a reverse transcriptase and a T7 RNA polymerase.

Images