Lipid comprising docosapentaenoic acid

Abstract

To provide extracted plant lipid or microbial lipid comprising docosapentaenoic acid (DPA), and processes for producing the extracted lipid.SOLUTION: Provided is extracted plant lipid or microbial lipid, comprising fatty acids in an esterified form, the fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids which comprise linoleic acid (LA), ω3 fatty acids which comprise α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a lipid containing docosapentaenoic acid obtained from a plant cell or a microbial cell, and and methods for producing and using said lipids. [Background technology]

[0002] Omega-3 long-chain polyunsaturated fatty acids (LC-PUFAs) are important for human and animal health. These fatty acids are now widely recognized as compounds that can be obtained from dietary sources or Linoleic acid (LA, 18:2ω6), both of which are considered dietary essential fatty acids or by conversion of alpha-linolenic acid (ALA, 18:3ω3) fatty acid. Humans and many other vertebrate animals are unable to convert LA or ALA obtained from plant sources to C22. However, this conversion reaction occurs very slowly. Furthermore, most of modern society Instead of the usual ratio of 4:1 or less for omega-6:omega-3 fatty acids, at least 90% polyvalent Eating an unbalanced diet with omega-6 polyunsaturated fatty acids (PUFAs) (Trautwein, 2001). Eicosapentaenoic acid (EPA) for humans , 20:5ω3), docosapentaenoic acid (DPA), and docosahexaenoic acid (DHA, Most of the immediate dietary sources of LC-PUFAs, such as 22:6ω3, come from fish or fish oil. Therefore, health experts recommend that the human diet not contain fish that contain significant levels of LC-PUFAs. Increasingly, fish-derived LC-PUFA oils are being used in foods that contain, for example, It is included in food and infant formula. However, the decline of the global and national fishing industry Because of this, there is a need for alternative sources of these beneficial health-promoting oils.

[0003] In contrast to animals, flowering plants contain polyunsaturated fatty acids with chain lengths longer than 18 carbons. In particular, crop and horticultural plants, along with other angiosperms, do not have the ability to synthesize ALA from The more EPA, docosapentaenoic acid (DPA, 22:5ω3) and DHA that are derived They do not have the enzymes necessary to synthesize long-chain omega-3 fatty acids. Galls produce substantial amounts of LC-PUFAs and therefore provide an alternative source of these compounds. It is the engineering of crops that we provide. Summary of the Invention

[0004] LC-PUFA biosynthesis pathway The biosynthesis of LC-PUFAs in organisms such as microalgae, mosses, and fungi usually involves a series of acids. The EPA-producing enzymes in these organisms are catalyzed by a phosphate-dependent desaturation and elongation reaction (Figure 1). The most common pathways are Δ6-desaturation, Δ6-elongation, and Δ5-desaturation. The most common pathway is the Δ6-desaturation pathway, whereas the less common pathway is Δ9-elongation, Δ8-desaturation and Δ5-desaturation (Δ9-desaturation pathway) These successive desaturation and elongation reactions are shown in the upper left part of Figure 1. The end product is the ω6 fatty acid substrate LA(ω6) shown in the formula or EPA shown in the lower right of Figure 1. It can start with either the ω3 substrate ALA(ω3). If the initial Δ6-desaturation reaction is If the LC-PUFA product of the series of three enzymes occurs on the ω-6 substrate LA, the ω-6 lipid The LC-PUFA synthesis organisms are arachidonic acid (ARA, 20:4ω6). The conversion of EPA to ω3-desaturase is shown as the Δ17-desaturase step in Figure 1. ω3-desaturase can be used to convert ω6 fatty acids to ω3 fatty acids. Several members of the Milli family can act on a variety of substrates ranging from LA to ARA. Plant ω3-desaturases often catalyze the Δ15-desaturation of LA to ALA. whereas fungal and yeast ω3-desaturases specifically catalyze the conversion of ARA to E. It may be specific for the Δ17-desaturation reaction to PA (Pereira et al., 200 4a; Zank et al., 2005) convert a wide range of ω6 substrates to their corresponding ω3 products. Several reports have suggested that there may be nonspecific ω3-desaturases that can (Zhang et al., 2008).

[0005] The conversion of EPA to DHA in these organisms occurs via the Δ5-elongation reaction of EPA. This produces DPA, which is then converted to DHA by a Δ4-desaturation reaction (Figure 1). In contrast, mammals catalyze DPA DH through three separate reactions that are independent of Δ4-desaturase. A is converted to the so-called “Sprecher” pathway (Sprecher et al., 1995).

[0006] Plants, mosses, microalgae, and nematodes (Caenorhabditis elegans The front-end desaturases commonly found in lower animals, such as phosphatidylcholine, It predominantly accepts phospholipid (PC) substrates at the sn-2 position and esterified fatty acid substrates. These desaturases are involved in the synthesis of acyl-PC, lipid-binding, and front-end desaturases. In contrast, the higher animal frontoes are known as Generally, aldehyde desaturases convert fatty acid substrates into acyl-C, where the fatty acid substrate is bound to CoA rather than PC. Some microalgae, such as Desaturas niger, accept the oA substrate (Domergue et al., 2005). One plant desaturase and one plant desaturase use fatty acid substrates esterified with CoA. It is known that (Table 2).

[0007] Each PUFA elongation reaction consists of four steps catalyzed by a multicomponent protein complex: First, as a result of the condensation reaction, a 2C unit is added from malonyl-CoA to the fatty acid, forming a β-ketoacid. This is then reduced by NADPH and then dehydrated. This intermediate is finally reduced twice to give the elongated fatty acid. The condensation steps of these four reactions are generally substrate specific, whereas the other steps are not. In fact, the natural plant elongation mechanism is thought to play a role in the elongation of non-natural PUFA substrates. Although the efficiency of the natural plant elongation machinery may be low, PUFA-specific condensing enzymes (usually called “elongating enzymes”) This means that the PUFA provided by the introduction of the enzyme "Aminase" can be extended. In 2007, the identification and characterization of yeast elongation cycle dehydratases was reported. has been shown to be effective in preventing aging (Denic and Weissman, 2007).

[0008] While elongation reactions occur on substrates in the acyl-CoA pool, in plants, mosses and PUFA desaturation in plants and microalgae preferentially targets fatty acid substrates in the acyl-PC pool. The transfer of acyl-CoA fatty acids to the PC carrier occurs naturally via lysophosphatidylcholine. While acyl-PC is catalyzed by phenylalanine acyltransferase (LPCAT), The transfer of fatty acids to the CoA carrier occurs via phospholipase (PLA) (Singh et al. , 2005).

[0009] Engineering of LC-PUFAs Most LC-PUFA metabolic engineering has been carried out using the aerobic Δ6-desaturation / elongation pathway. The biosynthesis of γ-linolenic acid (GLA, 18:3ω6) in tobacco is initiated by cyanobacteria. Cyanobacterium Synechocystis s) was first reported in 1996 (Reddy and T Homas, 1996). More recently, GLA has been found in safflower (73% GLA in seed oil). %, WO2006 / 127789) and soybean (GLA 28%; Sato et al., 2004) The production of LC-PUFAs such as EPA and DHA has been associated with Due to the large number of saturation and elongation steps, the engineering is more complicated. A production was first reported by Qi et al. (2004) and was reported in Isochrysis galbana (Iso chrysis galbana) Δ9-elongase, Euglena gracilis (E Δ8-desaturase from Mortierella uglena gracilis and Mortierella alpi A gene encoding Δ5-desaturase from Mortierella alpina The offspring were then introduced into Arabidopsis with yields of up to 3% EPA. This study was followed by Abbadi et al. (2004) who also investigated the Δ6-desaturase and Δ6-elongase from Mitrella patens Phaeodactylum tricornutum Using the gene encoding the Δ5-desaturase of the α-aminobutyric acid ... (α-aminobutyric acid), we were able to increase EPA to 0.8% in flaxseed. reported production in

[0010] The first report of DHA production described the production of 3% DHA in soybean germ (W O04 / 017467, but instead of seeds, it was Saprolegnia diculina (Sap rolegnia diclina) Δ6-desaturase, Mortierella alpina (Mortierella alpina) Δ6-desaturase, Mortierella alpina Lupin (Mortierella alpina) Δ5-desaturase, Saprolegni Saprolegnia diclina Δ4-desaturase, Saprolegnia diclina Δ17-Desachi Urase, Mortierella alpina Δ6- Elongase and Pavlova lutheri Δ5-elongase The largest increase in EPA in the germ line was due to the introduction of a gene encoding DHA-encoding enzyme. The level was 19.6%, indicating that the conversion efficiency of EPA to DHA was small (WO 2004 / 071467). This discovery was made in the zebrafish (Danio rerio). Δ5 / 6-desaturase, Caenorhabditis elegans Δ 6-elongase, and Pavlova salina Δ5-elongase Arabidopsis The production of EPA 3% and DHA 0.5% in the is reported by Robert et al. (200 5) reported that the phenotype of Piscirium spp. Pythium irregulare Δ6-elongase, slough Thraustochytrid Δ5-desaturase, Phycomyces patens Physcomitrella patens Δ6-elongase, Kinsen Calendula officianalis Δ12-desaturase, slough Thraustochytrid Δ5-elongase, Phytophthora Phytophthora infestans Δ17-Desachi Durase, rainbow trout (Oncorhyncus mykiss) LC-PUFA elongase Δ4-desaturase, Thraustochytrid Δ4-desaturase and Thraustochytrid LPCAT was used to In Brassica juncea, ARA is 25%, EPA is 15%, and DHA 1.5% (Wu et al., 2005). A review of attempts to produce oilseed crops that can 0) and Ruiz-Lopez et al. (2012). As shown by Pez et al. (2012), DHA production in transgenic plants The results to date have not come close to the levels seen with fish oil. Recently, Petrie et al. (2012) reported that Arabidopsis thaliana reported that approximately 15% of DHA was produced in the seeds of B. haliana and published in WO2013 / 18 5184 reported the production of certain seed oils having between 7% and 20% DHA. However, there have been no reports of the production of vegetable oils with more than 20% DHA.

[0011] There have been no reports of the production of DPA in recombinant cells to significant levels without the concomitant production of DHA. Indeed, the present inventors have not found any publicly available method for producing DPA in recombinant cells without producing DHA. I don't know the inspiration or motivation behind it.

[0012] Therefore, the LC-PUFAs in recombinant cells, especially those like DPA in the seeds of oilseed plants, There remains a need for more efficient production.

[0013] Summary of the Invention Most organisms are unable to produce oils with more than 1-2% DPA. Therefore, the option of producing DPA on a large scale from natural sources is, if at all, The inventors have found that it has a much higher level of DPA than natural sources. Methods and plants for producing lipids have been identified.

[0014] In a first aspect, the present invention provides a method for the preparation of a fatty acid, comprising the steps of: omega-6 fatty acids, including linoleic acid (LA), and omega-3 fatty acids, including alpha-linolenic acid (ALA) and optionally stearidonic acid (SDA), eicosapentaenoic acid (EPA) Contains one or more of the following: docosapentaenoic acid (DPA) and eicosatetraenoic acid (ETA) and wherein the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 35%. The present invention provides an extracted lipid, preferably an extracted plant lipid or an extracted microbial lipid, which is in the range of 0.1 to 1.5 μg / kg. In a similar embodiment, the level of DPA in the total fatty acid content of the extracted lipid is about 7%. , about 8%, about 9%, about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, about 30%, between about 7% and about 28%, and about 7% to about 25% Between about 10% and 35% Between about 10% and about 30% Between about 10% and about 25% , between about 10% and about 22%, between about 14% and 35%, between about 16% and 35%, and about 1 Between 6% and about 30%, between about 16% and about 25%, or between about 16% and about 22% be.

[0015] In an embodiment of the above aspect, DHA is less than 2% or 0% of the total fatty acid content of the extracted lipid. 0.5% or less, and more preferably, not present in the total fatty acid content of the lipid. .

[0016] In another aspect, the present invention provides an esterified form of docosapentaenoic acid (DPA). The present invention provides an extracted lipid, preferably an extracted plant lipid or an extracted microbial lipid, comprising a fatty acid of At least 35% of DPA esterified in the form of triacylglycerol (TAG) In an embodiment, the extracted lipid is esterified at the sn-2 position of the TAG. Omega-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), alpha-linolenic acid (A LA), and optionally stearidonic acid (S DA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA) (ii) at least about 40%, at least about 45%, at least or between about 48%, between 35% and about 60%, or between 35% and about 50% triacylglycerol. DPA esterified in the form of cerol (TAG) is esterified at the sn-2 position of the TAG. and (iii) the level of DPA in the total fatty acid content of the extracted lipid. between about 1% and 35%, or between about 7% and 35%, or between about 20.1% and 35% The present invention may be further characterized by one or more or all of the following: In the present study, the level of DPA in the total fatty acid content of the extracted lipids was about 7%, about 8%, about 9%. , about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24%, about 26% , about 28%, about 30%, between about 7% and about 28%, between about 7% and about 25%, about 10% between about 10% and about 35%, between about 10% and about 30%, between about 10% and about 25%, between about 10% and about Between 22%, Between about 14% and 35%, Between about 16% and 35%, Between about 16% and about 30% Between about 16% and about 25%, or between about 16% and about 22%. In embodiments, the extracted lipids comprise (i) and (ii), (i) and (iii), or (ii). and (iii), more preferably characterized by all of (i), (ii) and (iii). Preferably, the extracted lipids have a total fat content of between about 2% and 16%. The palmitic acid level in the acid content and, if present, the extract is less than 1%. Further characterization was performed by the level of myristic acid (C14:0) in the total fatty acid content of the lipids. can be done.

[0017] Embodiments of each of the above aspects are described in further detail below. Any feature of the described embodiments that is broader than the corresponding feature of the above aspect is also included in the This does not apply to the above aspects.

[0018] In embodiments, the extracted lipids have the following characteristics: i) the level of palmitic acid in the total fatty acid content of the extracted lipids is between about 2% and 18% between about 2% and 16%, between about 2% and 15%, or between about 3% and 10% To do so, ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids is less than 6%, less than 3%, less than 2%, less than 1%, or about 0.1%; iii) the level of oleic acid in the total fatty acid content of the extracted lipid is from about 1% to about 3% Between 0%, between about 3% and about 30%, between about 6% and about 30%, between about 1% and about 20% , between about 30% and about 60%, between about 45% and about 60%, about 30%, or between about 15% and about 3 Between 0% and iv) The level of linoleic acid (LA) in the total fatty acid content of the extracted lipids is about 4% to about 10%. between about 4% and about 20%, between about 4% and about 17%, or between about 5% and about 35%, Between about 10% v) The level of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is about 4 between about 7% and about 40%, between about 10% and about 35%, between about 20% and between about 35%, between about 4% and about 16%, or between about 2% and about 16%, vi) The level of gamma-linolenic acid (GLA) in the total fatty acid content of the extracted lipid is 4 %, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, 0.05% to about 7% between 0.05% and 4%, between 0.05% and about 3%, or between 0.05% and about 2% % between vii) The level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipids Less than about 10%, less than about 8%, less than about 7%, less than about 6%, less than about 4%, less than about 3%, less than about 0. Between about 0.05% and about 7%, Between about 0.05% and about 6%, Between about 0.05% and about 4%, Between 0.05% and about 3%, between about 0.05% and about 10%, or between about 0.05% and about Between 2% viii) The level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipid The bell is less than about 6%, less than about 5%, less than about 4%, less than about 1%, less than about 0.5%, and less than 0.05%. % to about 6%, 0.05% to about 5%, 0.05% to about 4%, 0.05% between about 3% and about 0.05% and about 2%; ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipids is less than 4%, less than about 2%, less than about 1%, between 0.05% and 4%, and between 0.05% and 3%. or between 0.05% and about 2%, or between 0.05% and about 1%; x) The level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted lipid , between 4% and 15%, less than 4%, less than about 3%, less than about 2%, between 0.05% and 10% , between 0.05% and 5%, between 0.05% and about 3%, or between 0.05% and about 2% Between xi) The lipid contains ω6-docosapentaenoic acid (22:5) in its fatty acid content. Δ4,7 ,10,13,16 ) xii) The lipid contains less than 0.1% ω6-docosapentaenoic acid (ω6-DDA) in its fatty acid content. 22:5 Δ4,7,10,13,16 ) xiii) the lipid has less than 0.1% of one or more or all SDs in its fatty acid content; A, EPA and ETA included; xiv) the total saturated fatty acid level in the total fatty acid content of the extracted lipid is from about 4% to about 2 between about 5%, between about 4% and about 20%, between about 6% and about 20%, or between about 6% and about 12 % between xv) the total monounsaturated fatty acid level in the total fatty acid content of the extracted lipid is from about 4% to Between about 40%, between about 4% and about 35%, between about 8% and about 25%, between 8% and about 22% between about 15% and about 40%, or between about 15% and about 35%, xvi) the total polyunsaturated fatty acid level in the total fatty acid content of the extracted lipid is about 20% Between 30% and 75%, Between about 50% and about 75%, About 60%, About 6 5%, about 70%, about 75%, or between about 60% and about 75%; xvii) the total omega-6 fatty acid level in the total fatty acid content of the extracted lipid is between about 35% and Between about 50%, between about 20% and about 35%, between about 6% and about 20%, less than 20%, about 1 Less than 6%, less than about 10%, between about 1% and about 16%, between about 2% and about 10%, or about Between 4% and approximately 10% xviii) The level of new omega-6 fatty acids in the total fatty acid content of the extracted lipid is less than about 10%. Full, Less than about 8%, Less than about 6%, Less than 4%, Between about 1% and about 20%, Between about 1% and about 10% between 0.5% and about 8%, or between 0.5% and 4%; xix) the total omega-3 fatty acid level in the total fatty acid content of the extracted lipid is between 36% and about 6 Between 5%, between 36% and about 70%, between 40% and about 60%, about 30% to about 60% Between about 35% and about 60% Between about 40% and about 65% Between about 30% and about 65% Between about 35% and about 65%, about 35%, about 40%, about 45%, about 50%, about 55%, about 6 0%, about 65% or about 70%; xx) the level of new omega-3 fatty acids in the total fatty acid content of the extracted lipids is between 21% and about 45% %, between 21% and about 35%, between about 23% and about 35%, between about 25% and about 35% Between about 27% and about 35%, Between about 23% and about 25%, About 27%, About 30%, About 3 5%, about 40% or about 45%; xxi) the ratio of total ω6 fatty acids to total ω3 fatty acids in the total fatty acid content of the extracted lipid is about Between 1.0 and about 3.0, between about 0.1 and about 1, between about 0.1 and about 0.5, about 0.5 Less than 0, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, about 1.0 less than, less than about 0.1, from about 0.10 to about 0.4, or about 0.2; xxii) The ratio of new ω6 fatty acids to new ω3 fatty acids in the total fatty acid content of the extracted lipid is Between about 1.0 and about 3.0, between about 0.02 and about 0.1, between about 0.1 and about 1, about 0 Between .1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, about 0.20 less than about 0.15, about 0.02, about 0.05, about 0.1, about 0.2 or about 1.0 There is, xxiii) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least about 80%, between about 60% and about 98%, between about 70% and about 95%, or about 75% The conversion efficiency of oleic acid to LA by Δ12-desaturase was between 10% and 90%. Based on, xxiv) the fatty acid composition of the lipid is at least about 30%, at least about 40%, about 50%, at least about 60%, at least about 70%, between about 30% and about 70%, Between about 35% and about 60%, or between about 50% and about 70%, of Δ6-desaturase Based on the conversion efficiency of ALA to SDA by xxv) the fatty acid composition of the lipid is at least about 60%, at least about 70%, about 75%, between about 60% and about 95%, between about 70% and about 88%, or between about 75% and Based on the efficiency of conversion of SDA to ETA acid by Δ6-elongase, which ranged from 0.1 to 85%, and, xxvi) The fatty acid composition of the lipid is at least about 60%, at least about 70%, About 75%, between about 60% and about 99%, between about 70% and about 99%, or about 75% Based on the efficiency of conversion of ETA to EPA by Δ5-desaturase between about 98% and about 99% thing, xxvii) the fatty acid composition of the lipid is at least about 80%, at least about 85%, At least about 90%, between about 50% and about 99%, between about 85% and about 99%, between about 50% and Between about 95%, or between about 85% and about 95% of EPA by Δ5-elongase Based on conversion efficiency to DPA, xxviii) the fatty acid composition of the lipid is at least about 10%, at least about 15%, at least about 20%, at least about 25%, about 20%, about 25%, about 30%, about 10% to Between about 50%, between about 10% and about 30%, between about 10% and about 25%, or between about 20% Based on the conversion efficiency of oleic acid to DPA between 0.1 and 30%, xxix) the fatty acid composition of the lipid is at least about 15%, at least about 20%, At least about 22%, at least about 25%, at least about 30%, at least about 40%, at least about 25 %, about 30%, about 35%, about 40%, about 45%, about 50%, between about 15% and about 50%, Conversion of LA to DPA between about 20% and about 40%, or between about 20% and about 30% Based on efficiency, xxx) the fatty acid composition of the lipid is at least about 17%, at least about 22%, at least At least about 24%, at least about 30%, about 30%, about 35%, about 40%, about 45%, about 50% , about 55%, about 60%, between about 22% and about 70%, between about 17% and about 55%, about 22 % to about 40%, or about 24% to about 40% ALA to DPA conversion efficiency Based on xxxi) The total fatty acids in the extracted lipids are less than 1.5% C20:1, less than 1% C20:2, :1 or about 1% C20:1; xxxii) the triacylglycerol (TAG) content of the lipid is at least about 70 %, at least about 80%, at least about 90%, at least about 95%, about 70% to about 9 9%, or between about 90% and about 99%; xxxiii) The lipid comprises diacylglycerol (DAG), preferably DAG includes DPA, xxxiv) the lipid is less than about 10%, less than about 5%, less than about 1%, or less than about 0.001% to about 5% free (non-esterified) fatty acids and / or phospholipids, or does not include it in any way; xxxv) at least 70% of the DPA is esterified in the form of TAG, at least 7 2% or at least 80% are at the sn-1 or sn-3 positions of the TAG, xxxvi) The most abundant DPA-containing TAG species in the lipids is DPA / 18:3 / 18:3 (TAG 58:12), and the lipid is triDPA TAG (TAG 66:18 ), and xxxvii) the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8% %, about 9%, about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24% , about 26%, about 28%, about 31%, between about 7% and about 31%, between about 7% and about 28%, Between about 10% and about 35%, Between about 10% and about 30%, Between about 10% and about 25%, About Between 10% and about 22%, Between about 14% and about 35%, Between about 16% and about 35%, About 1 Between 6% and about 30%, between about 16% and about 25%, or between about 16% and about 22% and optionally the DHA level is less than 0.5% of the total fatty acid content of the extracted lipid. thing has one or more of the following.

[0019] In another embodiment, the extracted lipids have the following characteristics: i) the level of palmitic acid in the total fatty acid content of the extracted plant lipids is between 2% and 15% % between ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted plant lipids is approximately 0.1%. iii) the level of oleic acid in the total fatty acid content of the extracted plant lipids is between 1% and 3%; Between 0% and iv) The level of linoleic acid (LA) in the total fatty acid content of the extracted plant lipids is 4%. between 20% and v) The level of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted plant lipids is Between 4% and 40% vi) The level of gamma-linolenic acid (GLA) in the total fatty acid content of the extracted plant lipids , between 0.05% and 7%; vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted plant lipids is between 0.05% and 10%, viii) Eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted plant lipids The level of is less than 6%. ix) The level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted plant lipids. The bell is less than 4%. x) the extracted plant lipids have less than 0.1% ω6-docosapentaenoic acid in their fatty acid content; Acid (22:5 Δ4,7,10,13,16 ) xi) the level of new omega-6 fatty acids in the total fatty acid content of the extracted plant lipids is less than 10% That is, xii) The ratio of total omega-6 fatty acids to total omega-3 fatty acids in the fatty acid content of the extracted plant lipids is 1. be between 0 and 3.0 or between 0.1 and 1, xiii) the ratio of new omega-6 fatty acids to new omega-3 fatty acids in the fatty acid content of the extracted plant lipids is 1 Between 0.0 and 3.0, or between 0.02 and 0.1, or between 0.1 and 1 and, xiv) The fatty acid composition of the extracted plant lipids is at least 10% oleic acid to DPA. Based on the conversion efficiency of xv) The fatty acid composition of the extracted plant lipids has a conversion efficiency of at least 15% of LA to DPA. Based on the rate, xvi) The fatty acid composition of the extracted plant lipids contains at least 17% of ALA converted to DPA. Based on conversion efficiency, xvii) the total fatty acids in the extracted plant lipids are less than 1.5% C20:1; and Beauty xviii) The triacylglycerol (TAG) content in the extracted plant lipids is at least 70% and may be characterized by one or more of the following features: xix) The extracted plant lipids contain diacylglycerol (DAG) including DPA. , xx) The extracted plant lipids contain less than 10% free (non-esterified) fatty acids and / or phosphorus. Containing or essentially free of lipids; xxi) At least 70% of the DPA esterified in the form of TAG is being the n-1 or sn-3 position; xxii) The most abundant DPA-containing TAG species in the extracted plant lipids is DPA / 18:3 / 18:3 (TAG58:12), and xxiii) the extracted plant lipids contain tri-DPA TAG (TAG66:18); has one or more of the following.

[0020] In an embodiment, the total fatty acid content of the extracted plant lipids is preferably 0.1 to 1.0% by weight, more preferably 0.1 to 1.0% by weight. A) levels are between 0.05% and 10%.

[0021] In a further embodiment, the level of DHA in the total fatty acid content of the extracted plant lipids is Less than 2%, preferably less than 1%, or between 0.1% and 2%, more preferably undetectable Preferably, the plant, or a part thereof, such as a seed, or the microbial cell is a Δ Δ4-desaturase-encoding polynucleotide or In another embodiment, the extracted lipid is in the form of an oil. At least about 90% by weight, at least about 95% by weight, at least about 98% by weight Or between about 95% and about 98% by weight of the oil is lipid.

[0022] Preferably, the extracted lipids are derived from Brassica seed oil or Camelina sativa. It is a lipid found in the seed oil of Camelina sativa.

[0023] In a preferred embodiment of the first aspect, the lipid or oil, preferably a seed oil, is More preferably, the seed oil of Brassica napus or Camelina sativa is It has the following characteristics: In the total fatty acid content of the lipid or oil, the DPA level is about 7 % to 30% or about 7% to 35%, and palmitic acid levels are about 2% to The myristic acid level is less than 1% and the oleic acid level is between about 1% and about 16%. Between about 1% and about 30%, LA levels are between about 4% and 35%, and ALA is The total saturated fatty acid level in the total fatty acid content of the extracted lipid is about 4% to about 25%. and the ratio of total omega-6 fatty acids to total omega-3 fatty acids in the fatty acid content of the extracted lipids was between 0. The triacylglycerol (TAG) content of the lipids ranges from about 0.5 to about 3.0. At least about 70%, and optionally the lipid may be essentially free of cholesterol. and / or the lipid comprises tri-DPA TAG (TAG66:15). Alternatively, the lipid or oil, preferably a seed oil, has one or more or all of the following characteristics: At least 70% of the DPA is in the form of triacylglycerol (TAG). It is esterified at the sn-1 or sn-3 position and ALA accounts for 4% of the total fatty acid content. and / or the GLA level is between 10% and 40% of the total fat. The fatty acid content is less than 4%, the SDA level is between 0.05% and about 10%, TA levels are less than about 4% and EPA levels are between 0.05% and about 10%. The total monounsaturated fatty acid level in the total fatty acid content of the extracted lipids is about 4% to about 35%. and the total polyunsaturated fatty acid level in the total fatty acid content of the extracted lipids is between about 20%. and about 75% of the total fatty acid content of the extracted lipids is new ω-6 fatty acids: new ω-3 fatty acids. The acid ratio is between about 0.03 and about 3.0, preferably less than about 0.50, and the lipid Fatty acid composition: At least about 60% of oleic acid converted to LA by Δ12-desaturase Conversion efficiency of at least about 60% of SDA to ETA by Δ6-elongase The efficiency of oleic acid to DPA by Δ5-elongase ranged from about 50% to about 95%. Conversion efficiency based on a conversion efficiency of at least about 10% of oleic acid to DPA. Or, at least 81% of DPA is located at the sn-1 position of triacylglycerol (TAG). or esterified at the sn-3 position.

[0024] In another preferred embodiment of the second aspect, the lipid or oil, preferably a seed oil, is more preferably, Brassica seed oil or Camelina sativa seed oil containing DPA. The oil has the following characteristics: the total fatty acid content of the lipid or oil is higher than that of palmitoyl palmitate; The lactic acid level is between about 2% and about 16%, and the myristic acid level is less than 1%. The oleic acid level is between about 1% and about 30%, and the LA level is between about 4% and 30%. 5%, ALA is present and the total saturated fatty acid level in the total fatty acid content of the extracted lipids is The total omega-6 fatty acids in the fatty acid content of the extracted lipids ranges from about 4% to about 25%: The ratio of total omega-3 fatty acids is between 0.05 and about 3.0, and the triacylglycerol content of lipids is The (TAG) content is at least about 70%, and optionally the lipid is tri-DPA. It may contain TAG (TAG66:15), in the form of triacylglycerol (TAG) At least 35% of the DPA esterified at the sn-2 position of the TAG is esterified at the sn-2 position of the TAG. More preferably, the lipid or oil, preferably a seed oil, additionally comprises: ALA accounts for between 4% and 40% of the total fatty acid content. and / or the level of GLA is 4% of the total fatty acid content. The SDA level is between 0.05% and about 10%, and the ETA level is about 4 %, and the EPA level is between 0.05% and about 10% of the total fat of the extracted lipid. The level of total monounsaturated fatty acids in the acid content is between about 4% and about 35%, The level of total polyunsaturated fatty acids in the total fatty acid content of lipids ranges from about 20% to about 75% The ratio of new ω6 fatty acids to new ω3 fatty acids in the fatty acid content of the extracted lipid is about 0.03 to between about 0.50 and about 3.0, preferably less than about 0.50, and the fatty acid composition of the lipid is at least: The conversion efficiency of oleic acid to LA by Δ12-desaturase was about 60%. The conversion efficiency of SDA to ETA by Δ6-elongase was about 60%, and the conversion efficiency was about 50% to about 95% efficiency of EPA to DPA by Δ5-elongase, at least about 1 Based on 0% oleic acid to DPA conversion efficiency.

[0025] In relation to the extracted lipid or oil of the present invention, in one embodiment, the extracted lipid or oil The levels of DPA in the extract were determined based on the DPA levels in the lipids or oils of the plant parts or microorganisms prior to extraction. In other words, the level of the other extracts is not increased or is substantially the same. No treatment increases the levels of DPA in lipids or oils compared to fatty acids. When such is the case, the lipid or oil may be subsequently treated, by fractionation or other methods, to , the fatty acid composition may be varied.

[0026] In another preferred embodiment, a lipid or oil, preferably a seed oil, more preferably Often, oils containing mustard oil, canola oil, or camelina sativa seed oil are used. Brassica seed oil has the following characteristics: Total lipids or oil The DPA level in fatty acid content ranges from about 7% to 35%, and the palmitic acid level The myristic acid level is between about 2% and about 16%, and the myristic acid level is less than about 6%, preferably less than 1 %, the oleic acid level is between about 1% and about 30%, and the LA level is about 4% to about 35%, ALA is present, and SDA levels are about 0.05% to about 1 0%, ETA levels are less than about 6%, and EPA levels are between about 0.05% and DHA is found in lipids or oils, preferably in lipids or oils. Preferably, DHA, if present, is not detectable in lipids or oils. Present at levels less than 2% of the total fatty acid content of the oil, or less than 0.5%, More preferably, it is not present in the total fatty acid content of the lipid or oil. may be essentially free of cholesterol and / or the lipid may be tri-DPA T More preferably, it may contain lipids or oils, preferably Typically, the seed oil further has one or more or all of the following characteristics: % of DPA is esterified at the sn-1 or sn-3 positions of triacylglycerol (TAG). ALA is present at levels between 4% and 40% of the total fatty acid content. GLA is present and / or the GLA level is less than 4% of the total fatty acid content, SD A levels are between 0.05% and about 10%, and ETA levels are less than about 4%; EPA levels ranged from 0.05% to approximately 10% of the total fatty acid content of the extracted lipids. The total monounsaturated fatty acid levels in the extracted lipids ranged from about 4% to about 35%, and the total fatty acid content of the extracted lipids was about 1.0 to 1.5%. The total polyunsaturated fatty acid level in the extract is between about 20% and about 75%. The ratio of new omega-6 fatty acids to new omega-3 fatty acids in the total fatty acid content of and preferably less than about 0.50, and the fatty acid composition of the lipid is: at least about 60% The efficiency of conversion of oleic acid to LA by Δ12-desaturase is at least about 60%. The efficiency of conversion of SDA to ETA by Δ6-elongase ranged from about 50% to about 95%. The efficiency of conversion of EPA to DPA by Δ5-elongase was at least about 10% of that of oleic acid. Based on the conversion efficiency of triphosphate to DPA. In an embodiment, at least 81% of the DPA is It is esterified at the sn-1 or sn-3 position of acylglycerol (TAG). Alternatively, at least 35% of the DPA esterified in the form of TAG is s It is esterified at the n-2 position.

[0027] In a further embodiment, the extracted lipid of the present invention comprises one or more sterols, preferably Further included are plant sterols.

[0028] In another embodiment, the extracted lipid is in the form of an oil and is less than about 10 mg lipid per gram of oil. of sterols, less than about 7 mg of sterols per gram of oil, less than about 1 mg of sterols per gram of oil Between .5mg and about 10mg of sterols per gram of oil, or about 1.5mg to Contains approximately 7 mg of sterols.

[0029] Examples of possible sterols in the extracted lipid include, but are not limited to, one or more or all campestrol / 24-methylcholesterol, Δ5-stigmasterol ol, ebricol, β-sitosterol / 24-ethylcholesterol, Δ5-avena Sterol / isofucosterol, Δ7-stigmasterol / stigmast-7-ene -3β-ol, and Δ7-avenasterol.

[0030] In an embodiment, the plant species is one listed in Table 11, such as canola, The levels of terols are approximately the same as those listed in Table 11 for that particular plant species. The plant species are Brassica napus, Brassica juncea, and Brassica napus. a) or Cannabis sativa (C. sativa), each of which may be a wild type Found in Brassica napus, Brassica napus or Cannabis sativa extract oil The levels of sterols per unit area are included.

[0031] In an embodiment, the extracted plant lipids contain one or more or all campesterol / 24-methyl 5-stigmasterol, 5-cholesterol, 5-sitosterol, 5-sitosterol / 2 4-Ethylcholesterol, Δ5-avenasterol / isofucosterol, Δ7-stearic acid Gumasterol / stigmast-7-en-3β-ol and Δ7-avenasterol or has essentially the same sterol content as wild-type canola oil.

[0032] In an embodiment, the extracted lipids are selected from wild type canola oil, mustard oil or cannabis oil. It has essentially the same sterol content as S. sativa oil.

[0033] In embodiments, the extracted lipids contain less than about 0.5 mg of cholesterol, oleic acid, or oleic acid per gram of oil. Less than 0.25 mg of cholesterol per gram of oil, from 0 mg to Between 0.5 mg of cholesterol, or about 0 mg to about 0.25 mg per gram of oil or essentially free of cholesterol.

[0034] In a further embodiment, the lipid is an oil, preferably an oil seed oil. Examples of suitable oils include, but are not limited to, canola oil or caramel oil. Brassica sp. oils such as China oil, Gossypium ium hirsutum) oil, flax (Linum usitatissimum) Oil, Helianthus sp. Oil, Safflower (Cart hamus tinctorius) oil, soybean (Glycine max) oil , corn (Zea mays) oil, Arabidopsis (Arabidopsis thaliana) oil, Sorghum bicolor oil, Sorghum vulgare oil, oat (Avena sativ a) Oil, Trifolium sp. oil, oil of the guinea pig Elaesis guineenis oil, Nicotiana benthamiana oil ana benthamiana oil, barley (Hordeum vulgare) ) oil, Lupinus angustifolius oil, Rice (Oryza sativa) oil, African rice (Oryza glaberr ima) oil, Camelina sativa oil, Cran Crambe abyssinica oil, Giant miscanthus Miscanthus x giganteus oil, or Miscanthus anthus sinensis oil. More preferably, the oil is Brassica sp. Oil, Camelina sativa sativa) oil or Glycine max (soybean) In an embodiment, the lipid is Brassica napus ( s) Brassica oil or mustard (Brassica juncea) oil (Brassica sp.) oil, cotton (Gossypium hirsutum) Oil, Linum usitatissimum oil, Helianthus (H elianthus sp.) oil, safflower (Carthamus tinctor ius) oil, soybean (Glycine max) oil, corn (Zea mays) oil Elaesis guineenis oil, Nicotiana benthamiana oil, green onion Lupinus angustifolius oil, Camelina sativa (C amelina sativa oil, Crambe abyssinica sinica) oil, Giant Miscanthus (Miscanthus x giganteus) anteus) oil, or Miscanthus sinensis oil In a further embodiment, the oil comprises or is canola oil, mustard oil. B.juncea oil, soybean (Glycine max) oil, camelina Camelina sativa oil or Arabidopsis thaliana oil In another embodiment, the oil is Scyllium thaliana (Ophiopogon) oil. A. thaliana oil and / or Camelina sativa (C. sa In an embodiment, the vegetable oil is a vegetable oil other than G. max ( In an embodiment, the oil is an oil other than soybean oil. from plants grown under standard conditions listed above, or from plants grown under standard conditions in the field or in a greenhouse. I got it.

[0035] In a further aspect, the present invention provides a method for producing a method for treating a cancer cell comprising the steps of: i) lipid-containing plant parts, preferably lipid-containing Brassica seeds or Camelina obtaining seeds or microbial cells of Tiva, wherein the lipids are in an esterified form; Contains fatty acids, the fatty acids being omega-6 fats containing oleic acid, palmitic acid, and linoleic acid (LA). Fatty acids, including omega-3 fatty acids, alpha-linolenic acid (ALA), and docosapentaenoic acid (DPA) and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (E PA), and eicosatetraenoic acid (ETA), The level of DPA in the total fatty acid content of the lipid of the portion is between about 7% and 35%. Process, and ii) extracting lipids from the plant parts or microbial cells, comprising: wherein the level of DPA in the fatty acid content is between about 7% and 35%; In one embodiment, the method for producing an extracted plant or microbial lipid comprises: The level of DPA in the total fatty acid content of dietary lipids is between about 7% and 20% or 20. In one embodiment, the level of DPA is between 7% and 20%. or between 20.1% and 30%, preferably between 20.1% and 35%, more preferably or between 30% and 35%. In one embodiment, the total fatty acid content of the extracted lipids is The level of DPA in the Preferably, it is between 11% and 20%, or between 12% and 20%.

[0036] In an embodiment of the above aspect, the present invention provides a method for producing a method for treating a cancer cell comprising: i) lipid-containing plant parts, preferably Brassica seeds or Camelina sativa seeds A process for obtaining lipids or microbial cells, the lipids containing fatty acids in esterified form. The lipids are mainly composed of omega-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), alpha - omega-3 fatty acids including linoleic acid (ALA) and docosapentaenoic acid (DPA), as well as sucrose Thearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), (i) the total fatty acid content of the extracted lipid; DPA levels in the range of 7% to 30%, or 7% to 35%, preferably 30% (ii) the palmitic acid content of the extracted lipid is between 35% and 40% of the total fatty acid content of the extracted lipid; (iii) the milligram of the total fatty acid content of the extracted lipid is between 2% and 16%; (iv) the extract has a stearic acid (C14:0) level of less than 6%, preferably less than 1%; (v) the oleic acid level in the total fatty acid content of the lipid is between 1% and 30%; Linoleic acid (LA) levels in the total fatty acid content of the extracted lipids ranged from 4% to 35%. (vi) the amount of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is between 4% and 40% or less of eicosatrienoic acid in the total fatty acid content of the extracted lipid; (viii) the total fatty acid content of the extracted lipid is less than 4%; (ix) the total saturated fatty acid level of the extracted lipid is between 4% and 25%; (x) the ratio of total omega-6 fatty acids to total omega-3 fatty acids in the lipid is between 0.05 and 1; (xi) the triacylglycerol (TAG) content of T is at least 70%; At least 70% of the DPA esterified in the form of AG is at the sn-1 position of the TAG or sn-3 position, and ii) extracting lipids from said plant parts wherein the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 30%. or between 7% and 35%, preferably between 30% and 35%, of extracted plant lipids or provides a method for producing microbial lipids. Preferably, the lipids are esterified in the form of TAG. At least 81% or at least 90% of A are at the sn-1 or sn-3 positions of the TAG. It is ranked th.

[0037] In another aspect, the present invention provides a method for producing a composition comprising: i) a lipid-containing cell, preferably a plant part or a microbial cell comprising a lipid-containing cell, More preferably, the method comprises obtaining seeds of the genus Brassica or seeds of Camelina sativa, The lipids contain fatty acids in an esterified form, the fatty acids being docosapentaenoic acid (DPPA). A) containing at least 3 esterified in the form of triacylglycerol (TAG) 5% of the DPA is esterified at the sn-2 position of the TAG; and ii) extracting lipids from the cells The form of triacylglycerol (TAG) in the total fatty acid content of the extracted lipid. At least 35% of the DPA esterified at the sn-2 position of the TAG is esterified at the sn-2 position of the TAG. In an embodiment, the extracted lipid produced by the method is The lipids were classified as follows: (i) ω-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA); Contains one or more or all of the omega-3 fatty acids, including linoleic acid (ALA), and optionally, Sodium arylidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid ( (ii) at least about 40%, at least about 4 5%, at least about 48%, between 35% and about 60%, or between 35% and about 50% DPA esterified in the form of triacylglycerol (TAG) is (iii) the total fatty acid content of the extracted lipid is esterified at the 2-position; DPA levels between about 1% and 35%, or between about 7% and 35%, or about 20.1 % to 35%. In such embodiments, the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8%, about 9%, about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24 %, about 26%, about 28%, about 30%, between about 7% and about 28%, between about 7% and about 25% , between about 10% and about 35%, between about 10% and about 30%, between about 10% and about 25%, Between about 10% and about 22%, Between about 14% and about 35%, Between about 16% and about 35%, About Between 16% and about 30%, between about 16% and about 25%, or between about 16% and about 22% In a preferred embodiment, the extracted lipids are: (i) and (ii), (i) and (ii i) or (ii) and (iii), more preferably (i), (ii) and (iii). Preferably, the extracted lipids are between about 2% and 16%. The palmitic acid level in the total fatty acid content of the extracted lipid, and, if present, % of the total fatty acid content of the extracted lipids. can be further characterized.

[0038] In an embodiment of the above aspect, the present invention provides a method for producing a method for treating a cancer cell comprising: i) lipid-containing cells, preferably lipid-containing plant parts or microbial cells More preferably, a step of obtaining seeds of the genus Brassica or seeds of Camelina sativa. The lipids contain fatty acids in esterified form, the fatty acids being docosapentaenoic acid (D PA), omega-6 fatty acids including oleic acid, palmitic acid, and linoleic acid (LA), alpha- Omega-3 fatty acids, including linoleic acid (ALA), stearidonic acid (SDA), and eicosapentaenoic acid (ESA) It also contains one or more of the following: pentanoic acid (EPA), eicosatetraenoic acid (ETA), (i) the palmitic acid level in the total fatty acid content of the extracted lipid is between 2% and 16%; (ii) the ratio of myristic acid (C14:0) in the total fatty acid content of the extracted lipid is between (iii) the oleic acid level in the total fatty acid content of the extracted lipid is less than 1%; (iv) the linoleic acid content of the extracted lipid is between 1% and 30%; and (v) the total fatty acid content of the extracted lipids is between 4% and 35%. (vi) the total fat content of the extracted lipid is between 4% and 40%. (vii) the eicosatrienoic acid (ETrA) level in the fatty acid content is less than 4%; ) the total saturated fatty acid level in the total fatty acid content of the extracted lipid is between 4% and 25%; (viii) the ratio of total ω6 fatty acids:total ω3 fatty acids in the total fatty acid content of the extracted lipid is (ix) the triacylglycerol (TAG) content of the lipid is between 0.05 and 1; and (x) is in the form of triacylglycerol (TAG), At least 35% of the esterified DPA is esterified at the sn-2 position of the TAG. ,and ii) extracting lipids from said plant parts The form of triacylglycerol (TAG) in the total fatty acid content of the extracted lipid. At least 35% of the DPA esterified at the sn-2 position of the TAG is esterified at the sn-2 position of the TAG. The present invention provides a method for producing extracted lipids, the method comprising the steps of:

[0039] The step of obtaining the plant part or microbial cell may be carried out by extracting the plant part, preferably the microbial cell, from a plant which produces the plant part. Preferably, harvesting the seeds, recovering the microbial cells from a culture of such cells, and purchases or imports the plant parts or microbial cells from a manufacturer or supplier. The method may include obtaining lipids in a plant part or microbial cell sample, or The method may include determining the fatty acid composition of the extracted lipids.

[0040] In a preferred embodiment, the extracted lipids obtained by the method of the present invention are, where applicable, As defined herein, for example one or more of the above defined in relation to the first two aspects. It has the following characteristics.

[0041] The above aspects of the present invention will now be described in further detail. Any described embodiment that is broader than the corresponding feature of the above aspect may be modified in any manner that is broader than the corresponding feature of the above aspect. Does not apply to.

[0042] In an embodiment, the plant part is a seed, preferably an oil seed. Examples of such seeds include , including but not limited to, Brassica sp., Gossypium pium hirsutum), flax (Linum usitatissimum), flax (Linum usitatissimum), Helianthus sp., Carthamus ti nctorius), soybean (Glycine max), corn (Zea mays) ys), Arabidopsis thaliana, sorghum (S orghum bicolor), Sorghum vulgare, En Avena sativa, Trifolium sp. , Elaesis guineenis, Nicotiana benthamiana (N icotiana benthamiana), barley (Hordeum vulga) re), blue-flowered lupin (Lupinus angustifolius), rice (O ryza sativa), African rice (Oryza glaberrima), turtle Camelina sativa, or Crambea abyssinica mbe abyssinica, preferably Brassica sp. ) seeds, Camelina sativa (C. sativa) seeds or G.max (soybean) seeds of Brassica napus, mustard, and more preferably The seeds of B. juncea or C. sativa are In an embodiment, the plant part is a seed, preferably a seed of Brassica napus (Brassica napus). oilseed rape (Brassica napus) or mustard (Brassica juncea) Brassica sp., Gossypium hirsutum, Linum usitatissimum, Helianthus us sp.), safflower (Carthamus tinctorius), soybean (G lycine max), corn (Zea mays), oil palm (El aesis guineenis, Nicotiana benthamiana thamiana), Lupinus angustifolius ), Camelina sativa, or Cranberry Abyssinica (Crambe abyssinica), preferably Brassica napus (Brassica napus) ica napus), mustard (B juncea) or camelina sativa (C. In an embodiment, the seed is an oil seed, such as a canola seed. , mustard seeds, soybean seeds, Camelina sativa seeds Arabidopsis thaliana seeds. In an alternative embodiment, the seed is an A. thaliana seed and / or Or a seed other than a seed of Camelina sativa (C. sativa). In some embodiments, the seed is a seed other than a soybean seed. In some embodiments, the plant part is Brassica napus (B The plant part is preferably a Brassica sp. seed or are seeds of Camelina sativa. In an embodiment, the seeds are, for example, those described in Example 1. Obtained from plants grown under standard conditions or from plants grown under standard conditions in the field or in a greenhouse Ta.

[0043] In another embodiment, the seeds have at least about 18 mg, at least about 2 mg, per gram of seed. 2 mg, at least about 26 mg, between about 18 mg and about 100 mg, between about 22 mg and about 7 0 mg, about 80 mg, about 30 mg to about 80 mg, or about 24 mg to about 50 mg Contains between 100 mg of DPA.

[0044] In a further embodiment, the plant part, such as a seed, comprises the following set of enzymes: i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene longase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ 6-elongase and Δ5-elongase, iv) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Enzymes, Δ6-desaturases, Δ5-desaturases, Δ6-elongases and Δ5- Elongase, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ 5-elongase, Each polynucleotide comprises an exogenous polynucleotide encoding one of the following: and one or more promoters capable of inducing expression of said polynucleotide in a cell of Possibly linked.

[0045] In a further embodiment, the plant part, such as a seed, or the recombinant cell, such as a microbial cell, is The following set of disjoints; i) ω3-desaturase and / or Δ15-desaturase, Δ6-desaturase Δ5-desaturase, Δ6-elongase and Δ5-elongase, ii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5 -Elongase, iv) ω3-desaturase and / or Δ15-desaturase, Δ8-desaturase Δ5-desaturase, Δ9-elongase and Δ5-elongase, v) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9- Elongase and Δ5-elongase, vi) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Enzymes, Δ8-desaturases, Δ5-desaturases, Δ9-elongases and Δ5- Elongated gauze Each polynucleotide comprises an exogenous polynucleotide encoding one of the following: or one or more promoters capable of inducing expression of said polynucleotide in the cell. The antibody is operably linked to the target.

[0046] In an embodiment, if the plant part or cell contains lipids that contain fatty acids in esterified form, The fatty acid comprises docosapentaenoic acid (DPA), and the triacylglycerol (T At least 35% DPA and / or DHA (if present) esterified in the form of DPA and / or DHA (AG). If the TAG is esterified at the sn-2 position, the plant part such as a seed may be The recombinant cells, such as bacteria or microbial cells, can be used to produce 1-acyl-glycerol-3-phosphate acyl The polynucleotide comprises an exogenous polynucleotide encoding a transferase (LPAAT), The nucleotide is capable of inducing expression of the polynucleotide in the cell or cells of the plant part. In a further embodiment, the cell is operably linked to one or more promoters which The vesicle contains the following set of enzymes: i) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-eron gauze, and Δ5-elongase, ii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene longase, and Δ5-elongase, iii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase, and Δ5-elongase, iv) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase Ngauze, v) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-eron gauze, and Δ5-elongase, vi) 1-Acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase, and Δ5-elongase, vii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9- elongase, and Δ5-elongase, viii) 1-acyl-glycerol-3-phosphate acyltransferase (LPA AT), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5 -Elongase, Each polynucleotide comprises an exogenous polynucleotide encoding one of the following: operably linked to one or more promoters capable of directing expression of said polynucleotide Preferably, the LPAAT is a C22 polyunsaturated fatty acid such as DPA-CoA. A leu-CoA substrate can be used.

[0047] Preferably, the plant part or part thereof, such as a seed, or the microbial cell is does not have a polynucleotide encoding a Δ4-desaturase or It does not have a tRNAase polypeptide.

[0048] In an embodiment, the Δ12-desaturase is an ω3-desaturase and / or a Δ15 -desaturase activity, i.e., the activity is provided by one polypeptide. Alternatively, the Δ12-desaturase does not have ω3-desaturase activity, and It has no Δ15-desaturase activity, i.e., Δ12-desaturase is not ω3- A polypeptide having desaturase activity and / or a Δ15-desaturase and another polypeptide having It is a lipid peptide.

[0049] In a further embodiment, the plant part, such as a seed, or the recombinant cell, such as a microbial cell, comprises: Features below; i) Δ12-desaturase is at least about 60%, at least about 70%, about 80%, between about 60% and about 95%, between about 70% and about 90%, or about 75% in one or more of the plant parts or recombinant cells with an efficiency of between about 85% and about 95%. Converting oleic acid to linoleic acid ii) ω3-desaturase is at least about 65%, at least about 75%, about 85%, between about 65% and about 95%, between about 75% and about 91%, or between about 80% and in one or more of the plant parts or recombinant cells with an efficiency of between about 91% and about 91%. Converting omega-6 fatty acids to omega-3 fatty acids iii) Δ6-desaturase is at least about 20%, at least about 30%, At least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 30 % to about 70%, between about 35% to about 60%, or between about 50% to about 70% and converting ALA to SDA in one or more of the cells of the plant part or in a recombinant cell at a rate of To exchange, iv) Δ6-desaturase is less than about 5%, less than about 2.5%, less than about 1%, or less than about 0.1%. % to about 5%, about 0.5% to about 2.5%, or about 0.5% to about 1% and, in one or more of the plant parts, in the cells or in the recombinant cells, Converting it to linoleic acid v) Δ6-elongase is at least about 60%, at least about 70%, at least about 75%, between about 60% and about 95%, between about 70% and about 80%, or between about 75% and about 80% efficiency in one or more of the plant parts or recombinant cells. Converting A to ETA, vi) Δ5-desaturase is at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, between about 60% and about 95%, between 70% and about 95%, or between about 75% and about 95%, of one or more of said plants. converting ETA to EPA in a cell or recombinant cell; vii) Δ5-elongase is at least about 80%, at least about 85%, at approximately 90%, between approximately 50% and approximately 90%, or between approximately 85% and approximately 95% efficiency. and converting EPA to DPA in the cells or recombinant cells of said plant parts. and, ix) converting oleic acid into DPA in one or more cells or recombinant cells of said plant parts; The efficiency of conversion to At least about 25%, about 20%, about 25%, about 30%, between about 10% and about 50%, about 10 % to about 30%, or about 10% to about 25%, or about 20% to about 30% Between x) converting LA to DPA in one or more of the cells of said plant parts or in recombinant cells; At least about 15%, at least about 20%, at least about 22%, At least about 25%, at least about 30%, about 25%, about 30%, about 35%, about 15% to about 50% %, between about 20% and about 40%, or between about 20% and about 30%; xi) converting ALA to DPA in one or more of said plant parts or in a recombinant cell; The efficiency of conversion is at least about 17%, at least about 22%, at least about 24%, At most about 30%, about 30%, about 35%, about 40%, between about 17% and about 55%, about 22% between about 24% and about 35%, or between about 24% and about 35%; xi) one or more of the cells or recombinant cells of the plant part express the exogenous polynucleotide. At least about 25%, at least about 30%, about 25% to about 40% higher than the corresponding cells not containing %, or between about 27.5% and about 37.5% high in omega-3 fatty acids; xii) Δ6-desaturase is more efficient at converting α-linolenic acid (A) to linoleic acid (LA). LA) to be preferentially desaturated; xiii) the Δ6-elongase also has Δ9-elongase activity; xiv) the Δ12-desaturase also has Δ15-desaturase activity; xv) the Δ6-desaturase also has Δ8-desaturase activity; xvi) the Δ8-desaturase also has Δ6-desaturase activity or having no desaturase activity; xvii) Δ15-desaturase also has ω3-desaturase activity towards GLA. To do, xviii) ω3-desaturase also has Δ15-desaturase activity towards LA To do, xix) ω3-desaturase desaturates both LA and / or GLA. , xx) ω3-desaturase preferentially desaturates GLA compared to LA; xxi) one or more or all of the desaturases, preferably Δ6-desaturases, and and / or Δ5-desaturase prefers the acyl-CoA substrate to the corresponding acyl-PC substrate. 4. High activity against xxii) Δ6-desaturase has a higher activity for ALA than for LA as a fatty acid substrate. having low Δ6-desaturase activity; xxiii) Δ6-desaturase binds to the Sn-2 position of PC as a fatty acid substrate. ALA-CoA as a fatty acid substrate has a higher Δ6-desaturase activity than ALA-CoA. having enzyme activity; xxiv) Δ6-desaturase has a higher affinity for ALA as a substrate compared to LA. At least about 2-fold higher Δ6-desaturase activity, at least 3-fold higher activity, at least having 4-fold greater activity, or at least 5-fold greater activity; xxv) Δ6-desaturase binds A to the sn-2 position of PC as a fatty acid substrate. It has higher activity against ALA-CoA as a fatty acid substrate than against LA. xxvi) Δ6-desaturase bound to the sn-2 position of PC as a fatty acid substrate At least about 5 times higher for ALA-CoA as a fatty acid substrate than for ALA having low or at least 10-fold higher Δ6-desaturase activity; xxvii) the desaturase is a front-end desaturase; and xxviii) Δ6-desaturase does not produce detectable Δ5-desaturase for ETA. No enzyme activity has one or more or all of the following.

[0050] In a further embodiment, the seeds, preferably seeds of Brassica napus or Camelina sativa, The plant part, such as a seed, or the recombinant cell, such as a microbial cell, may have one or more of the following characteristics: Has everything. i) the Δ12-desaturase has the amino acid sequence as provided in SEQ ID NO:4, A biologically active fragment or a polypeptide having an amino acid sequence at least 50% identical to SEQ ID NO:4. To ii) the ω3-desaturase has an amino acid sequence as provided in SEQ ID NO:6, A biologically active fragment or a polypeptide that contains an amino acid sequence that is at least 50% identical to SEQ ID NO:6. To iii) the Δ6-desaturase has an amino acid sequence as provided in SEQ ID NO:9; or a biologically active fragment of SEQ ID NO:9 having an amino acid sequence at least 50% identical to SEQ ID NO:9. Including, iv) Δ6-elongase has the amino acid sequence provided in SEQ ID NO: 16, SEQ ID NO: 17 or a biologically active fragment thereof, such as SEQ ID NO: 16 and / or SEQ ID NO: 17, comprising an amino acid sequence at least 50% identical to v) the Δ5-desaturase has the amino acid sequence as provided in SEQ ID NO: 20; Biologically active fragments or sequences having an amino acid sequence at least 50% identical to SEQ ID NO:20. Including, and vi) the Δ5-elongase has the amino acid sequence as provided in SEQ ID NO: 25, Biologically active fragments or sequences having an amino acid sequence at least 50% identical to SEQ ID NO:25. Including.

[0051] In embodiments, a plant part, such as a seed, or a recombinant cell, such as a microbial cell, is DGAT, monoacylglycerol acyltransferase glycerol-3-phosphate acyltransferase (MGAT), PAT), 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), preferably using a C22 polyunsaturated fatty acyl-CoA substrate such as DPA-CoA. LPAAT, acyl-CoA:lysophosphatidylcholine acyltransferase, can be used phospholipase (LPCAT), phospholipase A2 (PLA2), phospholipase C (PLC), Phospholipase D (PLD), CDP-choline diacylglycerol choline phosphotran Phosphatidylcholine diacylglycerol acyltransferase (CPT), phosphatidylcholine:diacylglycerolcholinephosphotransferase (PDAT), acyl-CoA synthase (ACS), or both Further included are exogenous polynucleotides encoding the above combinations.

[0052] In another embodiment, the plant part, such as a seed, or the recombinant cell, such as a microbial cell, is 1, DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA2, PLC, PL D, CPT, PDAT, FATB, and other thioesterases, or Δ12-desaturases and a combination of two or more thereof. and / or down-regulating activity of the introduced mutant or exogenous polynucleotide. Including

[0053] In a further embodiment, at least one, or preferably all, of the promoters is a In embodiments, at least one or all of the promoters are The nucleotide sequence of the ... These were obtained from seed storage protein genes, such as the gene encoding linrinin.

[0054] In another embodiment, expression of an exogenous polynucleotide encoding a Δ5-elongase is The inducing promoter is a promoter that expresses Δ12-desaturase and ω3-desaturase. A plant, such as a microbial cell, prior to inducing expression of an exogenous polynucleotide encoding an enzyme. or initiating or peaking expression of the polynucleotide in the developing seed of the recombinant cell. to.

[0055] In a further embodiment, the exogenous polynucleotide is expressed in a cell of a plant part or a microbial cell. A DNA molecule, preferably a T-DNA molecule, integrated into the genome of a recombinant cell such as covalently linked and preferably integrated into the genome of the cells of the plant part or the recombinant cell The number of such DNA molecules is 1 or less, 2 or less, or 2 or 3. This is the case.

[0056] In yet another embodiment, the plant parts are Δ6- at least two different exogenous polynucleotides each encoding a desaturase .

[0057] In a further embodiment, the total oil content of the plant part comprising the exogenous polynucleotide is at least about 100% of the total oil content of the corresponding plant part that does not contain the exogenous polynucleotide. 40%, at least about 50%, at least about 60%, at least about 70%, from about 50% Between about 80%, or between about 80% and about 100%. A seed containing an exogenous polynucleotide is a seed that is genetically identical to a corresponding seed that does not contain the exogenous polynucleotide. At least about 40%, at least about 50%, at least about 60%, at least about 70% of the amount %, between about 50% and about 80%, or between about 80% and about 100%.

[0058] In another embodiment, the lipid is in the form of an oil, preferably a seed oil from an oil seed. at least about 90% by weight, at least about 95% by weight, at least about 98% by weight, Or, between about 95% and about 98% by weight of the lipids are triacylglycerols.

[0059] In a further embodiment, the method comprises determining the level of DPA as a percentage of the total fatty acid content. For example, the treatment may involve treating lipids to produce free fatty acids. This includes the hydrolysis of esterified fatty acids for the purpose of glycerol synthesis, or transesterification. A lipid such as an oil is treated by converting fatty acids in the oil into alkyl esters such as methyl or ethyl esters. It may then be converted to a fatty acid ester, which is then enriched in DPA lipids or oils. In an embodiment, the fatty acid composition of the lipids after such treatment is at least 40% , at least 50%, at least 60%, at least 70%, at least 80%, or In one embodiment, the total fatty acid content after treatment contains at least 90% DPA. HA levels are less than 2.0% or less than 0.5%, preferably no detectable levels in the lipids. I can't.

[0060] Lipids or oils containing lipids, e.g., free fatty acids or alkyl esters, may also be used. are provided and produced using the methods of the present invention.

[0061] In another aspect, the present invention provides a method for producing methyl or ethyl esters of polyunsaturated fatty acids. The present invention provides a method for extracting plant lipids, the method comprising the steps of: and reacting the extracted vegetable oils with methanol or ethanol, respectively. The protein contains fatty acids esterified in the form of TAG, the fatty acids being oleic acid, palmitic acid, and the like. omega-6 fatty acids, including linoleic acid (LA), and omega-3 fatty acids, including alpha-linolenic acid (ALA) fatty acids, and docosapentaenoic acid (DPA), and optionally stearidonic acid (SDA ), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA) or more, and the DPA level in the total fatty acid content of the extracted lipid may be about 7% to 3%. Between 5%, preferably between 20.1% and 30%, or between 20.1% and 35% thereby producing methyl or ethyl esters of polyunsaturated fatty acids.

[0062] In another aspect, the present invention provides a method for the preparation of a methyl or ethyl ester of docosapentaenoic acid (DPA). The present invention provides a method for producing ethanol from extracting plant oil, the method comprising the steps of: This involves reacting triacylglycerols (TAGs) in the matrix or during the extraction process. The extracted plant lipids contain fatty acids in an esterified form, the fatty acids being docosapentaenoic acid. The TAG comprises at least 35% of DPA esterified in the form of TAG. It is esterified at the sn-2 position of AG, thereby forming the methyl or produces ethyl esters

[0063] In a preferred embodiment, the lipid used in the method of the above two aspects is the extracted lipid of the present invention. or with respect to the oil, having one or more of the characteristics defined herein.

[0064] In another aspect, the present invention provides a method for producing a composition comprising: a) lipids that contain fatty acids in esterified form, and b) The following set of enzymes; i) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Enzymes, Δ6-desaturases, Δ5-desaturases, Δ6-elongases and Δ5- Elongase, ii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5 -Elongated iii) ω3-desaturase and / or Δ15-desaturase, Δ6-desaturase Δ5-desaturase, Δ6-elongase and Δ5-elongase, or iv) ω3-desaturase and / or Δ15-desaturase, Δ8-desaturase Enzymes, Δ5-desaturases, Δ9-elongases and Δ5-elongases An exogenous polynucleotide encoding one of Including, Each polynucleotide is capable of directing expression of said polynucleotide in developing seeds of said plant. one or more seed-specific promoters capable of expressing said polynucleotides in said microbial cell; operably linked to one or more seed-specific promoters capable of directing expression of the otide The fatty acids are omega-6 fats, including oleic acid, palmitic acid, and linoleic acid (LA). Omega-3 fatty acids, including gamma-linolenic acid (GLA) and alpha-linolenic acid (ALA) Contains fatty acids, stearidonic acid (SDA) and docosapentaenoic acid (DPA), in some cases Therefore, eicosapentaenoic acid (EPA) and / or eicosatetraenoic acid (ETA) ) and the DP in the total fatty acid content of the lipids of the seeds or microbial cells. A level between 7% and 35% Oilseed plants or parts thereof such as seeds, preferably oilseeds containing lipids in their seeds. A Camelina sativa plant or a Camelina sativa plant, or a microbial cell, is provided. In an embodiment, DHA is less than 2% of the total fatty acid content of the lipids of the seeds and extracted lipids; or Present at levels less than 0.5%, and more preferably undetectable in the total fatty acid content of the lipids. stomach.

[0065] In another aspect, the present invention provides a method for producing a composition comprising: a) fatty acids in esterified form, said fatty acids being docosapentaenoic acid (DP A) containing at least 3 esterified in the form of triacylglycerol (TAG) 5% DPA, the fatty acid esterified at the sn-2 position of the TAG, and b) an exogenous polynucleotide encoding one of the following sets of enzymes: i) 1-Acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ero ligase, and Δ5-elongase, ii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase, and Δ5-elongase, iii) 1-acyl-glycerol-3-phosphate acyltransferase (LPA AT), Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase, and Δ5-elongase, iv) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase Longase, v) 1-Acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-ero ligase, and Δ5-elongase, vi) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9- elongase, and Δ5-elongase, vii) 1-acyl-glycerol-3-phosphate acyltransferase (LPA AT), Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase, and Δ5-elongase, viii) 1-acyl-glycerol-3-phosphate acyltransferase (LP AAT), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ 5-elongase, A cell, preferably a cell or seed in or from a plant, such as an oilseed plant. or preferably a Brassica napus or Camelina sativa plant. and providing an oil plant or part thereof, or a microbial cell, each of said polynucleotides comprising said Operable with one or more promoters capable of inducing expression of said polynucleotide in a cell. Preferably, LPAAT is linked to a C22 polyunsaturated cofactor such as DPA-CoA. Ability to use fatty acyl-CoA substrates and levels of DPA in the total fatty acid content of extracted lipids between about 1% and 35%, or between about 7% and 35%, or between about 20.1% and 3 In an embodiment, the esterified form is triacylglycerol (TAG). at least about 40%, at least about 45%, at least about 48%, 35% to about Between 60% and 35% to about 50% of the DPA is esterified at the sn-2 position of TAG. It has been turned into

[0066] In a preferred embodiment of each of the above two aspects, the Δ15-desaturase is a fungal Δ 15-desaturase, and ω3-desaturase is a fungal ω3-desaturase. be.

[0067] In a preferred embodiment, the oil plant, microbial cell or cells of the invention, where applicable, As defined herein, for example, the extracted plant lipids, the extracted microbial lipids or the method for their production are related The compound has one or more of the characteristics as defined above.

[0068] Examples of oilseed plants include, but are not limited to, Brassica sp.), cotton (Gossypium hirsutum), flax (Linum usi tatissimum), Helianthus sp., safflower (Carthamus tinctorius), soybean (Glycine max), Maize (Zea mays), Arabidopsis thaliana (Arabidopsis thaliana) liana), Sorghum bicolor, Sorghum m vulgare), oat (Avena sativa), Trifolium spp. rifolium sp.), Guinea oil palm (Elaesis guineenis ), Nicotiana benthamiana, barley ( Hordeum vulgare), Lupinus agust ifolius), rice (Oryza sativa), African rice (Oryza g laberrima, Camelina sativa, or Crambe abyssinica is an example of an embodiment of the present invention. The plant is a Brassica sp. plant, Camelina sativa (C. sativa plants or Glycine max (G. max) (soybean) plants. In an embodiment, the oilseed plant is Brassica napus, B. juncea, Soybean (Glycine max), Camelina sativa (Camelina sativa) a) or Arabidopsis thaliana plants. In an alternative embodiment, the oilseed plant is Arabidopsis thaliana or and / or Camelina sativa (C. sativa). The seed plant is a plant other than G. max (soybean). The plant is preferably a plant of the genus Brassica. or Camelina sativa. In an embodiment, the oilseed plant is, for example, the oilseed plant described in Example 1. The plants were grown in the field or in a greenhouse under standard conditions as described above.

[0069] In an embodiment, the method of the invention is used in a cell or plant or One or more desaturases present in the plant part can use acyl-CoA substrates. In a preferred embodiment, Δ6-desaturase, Δ5-desaturase and Δ8- The desaturase, if present, is capable of using an acyl-CoA substrate and is preferred. i) Δ6-desaturase and Δ5-desaturase or ii) Δ5-desaturase Each of the Δ8-desaturase and Δ8-desaturase can use an acyl-CoA substrate. In an embodiment, the Δ12-desaturase and / or the ω3-desaturase is an acyl- A CoA substrate can be used. The acyl-CoA substrate is preferably a Δ6-desaturase. ALA-CoA is required for Δ5-desaturase, ETA-CoA for Δ8-desaturase, and Δ12-desaturase requires ETrA-CoA, Δ12-desaturase requires oleoyl-CoA, ω3-desaturase has LA-CoA, GLA-CoA, and ARA-CoA. There is at least one of them.

[0070] In an embodiment, the harvested seeds of the plant have at least about 28 mg / gram of seed, Preferably, at least about 32 mg per gram of seed, at least about 32 mg per gram of seed about 36 mg, at least about 40 mg per gram of seed, more preferably at least about 40 mg per gram of seed at least about 44 mg or at least 48 mg per gram of seed Approximately 80 mg, or between about 30 mg and about 80 mg of DPA per gram of seed Yes.

[0071] In a further aspect, the present invention provides a Brassica napus L. plant capable of producing seeds containing DPA. Brassica napus), mustard (B. juncea) or camelina sativa and a C. sativa plant, the mature harvested seeds of which are seed 1. At least about 28 mg per gram, preferably at least about 32 mg per gram of seed mg per gram of seed, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed mg per gram of seed, more preferably at least about 44 mg or at least 48 mg per gram of seed. mg, at least about 80 mg per gram of seed, or about 30 mg per gram of seed to about 80 mg DPA.

[0072] In another aspect, the present invention relates to a method for the preparation of a nucleic acid molecule of the present invention comprising an exogenous polynucleotide as defined herein. A plant cell of a plant is provided.

[0073] Features include: i) derived from the plant of the present invention; ii) comprising a lipid as defined herein; or iii) plant parts that can be used in the methods of the present invention, preferably Also provided are recombinant cells, such as seeds, or microbial cells.

[0074] In yet another aspect, the present invention provides a method for the preparation of a medicament for use in a pharmaceutical composition comprising administering to said patient an amount of DPA and between about 4% and about 15% by weight of a medicament for use in a pharmaceutical composition ... More preferably, between about 6% and about 8% by weight or between about 4% and about 8% by weight. The main product is Brassica napus (Brassica napus L.) which is harvested at maturity and contains about 4% to about 6% moisture by weight. rassica napus), mustard (B. juncea) or camelina sativa The present invention provides Camelina sativa seeds, the DPA content of which is At least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed g, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed g, more preferably at least about 44 mg per gram of seed or at least about 48 mg per gram of seed, about 80 mg per gram of seed, or about Between 30mg and about 80mg.

[0075] In an embodiment, the cell of the invention, the oilseed plant of the invention, the Brassica napus (B rassica napus), mustard (B. juncea) or camelina sativa The Camelina sativa plant, the plant part of the invention, or the seed of the invention. can be used to produce extracted lipids having one or more or all of the characteristics defined herein. Cut.

[0076] Moreover, in a further aspect, the present invention provides a method for producing an extracted lipid of the present invention. A method for producing a plant or cell is provided, the method comprising: a) one or more plant parts, such as seeds, from a plurality of plants or recombinant cells, such as microbial cells The levels of DPA in lipids produced by recombinant cells, such as microbial cells, were assayed. a) each recombinant cell, such as a plant or microbial cell, is capable of expressing the following set of enzymes: ; i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene longase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ 6-elongase and Δ5-elongase, iv) Δ12-desaturase, ω3-desaturase or Δ15-desaturase , Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase Longase, ix) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- Elongase and Δ5-elongase, x) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase and Δ5-elongase, or xi) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, and one or more exogenous polynucleotides encoding one of the following: Each polynucleotide is a polypeptide that is capable of expressing itself in a plant part or a recombinant cell. operably linked to one or more promoters capable of inducing and b) one or more of its parts can be used to produce the extracted plant lipids or recombinant cell lipids of the invention; identifying a plant or recombinant cell from a plurality of plants or recombinant cells capable of producing the plant or recombinant cell; c) optionally, generating progeny from said identified plant or recombinant cell, or a seed derived therefrom; Producing plants or recombinant cells Includes:

[0077] In embodiments, the plant or recombinant cell comprises a gene encoding an LPAAT as defined herein. It further comprises an exogenous polynucleotide.

[0078] Preferably, the progeny plant is at least a second or third offspring derived from the identified plant. generation, and preferably homozygous for one or more polynucleotides. Preferably, the one or more polynucleotides are expressed in the progeny at only one insertion locus. That is, the present invention relates to a method for producing plants or seeds from a plurality of transformed candidate plants or seeds. provides a method which can be used as a screening method for identifying the seeds, The identified plants or their progeny preferably produce the lipids of the present invention in their seeds. Such plants or progeny plants or seeds thereof may be used in accordance with the present invention, particularly those having specific DPA levels. The cells are selected for if they produce a lipid of the invention, or are not selected for if they do not produce a lipid of the invention.

[0079] In an embodiment, the cell is a microbial cell as defined herein, or a cell such as a plant or part thereof. The foreign polypeptide present in the cell is expressed as a polypeptide that is expressed by the genome of the cell, plant or plant part, such as a seed. Preferably, the exogenous polynucleotide is stably integrated into one of the genomes. stably integrated into the genome of the cell, plant or plant part, such as a seed, at the locus More preferably, the plant, plant part or The seeds are said to lack any exogenous polynucleotide other than one or more T-DNA molecules. The exogenous vector sequence is further characterized in that it is a genome-wide vector other than the T-DNA sequence. It is not incorporated into the Nomu.

[0080] In an embodiment, prior to step a), the method further comprises the step of: The method includes introducing the antibody into one or more cells of a subject.

[0081] Plants produced using the methods of the invention, and seeds of such plants, are also provided.

[0082] In an embodiment, the plants of the present invention are capable of both male and female reproduction, and preferably are capable of reproduction in the corresponding fields. Both sexes are at least 70% or preferably approximately the same as the live plant. In an embodiment, the plant produced from the plant of the invention or the seed of the invention has a fertility level of The pollen produced by the plants was 90-10% viable as determined by staining with a viability stain. For example, pollen viability may be assessed as described in Example 1. .

[0083] In another aspect, the present invention provides a method for producing a seed, the method comprising: a) preferably a collection of at least 1000 or 2000 or 3000 such plants; At least 1 hectare or 2 hectares of cultivated land as a combined part or planted at standard planting density 1000 to 3000 hectares of land, or in a greenhouse under standard conditions, growing a plant which produces a plant part of the invention or which produces a seed of the invention; b) harvesting seeds from said one or more plants; and c) Optionally, extracting lipids from the seeds, preferably at least 60 kg or produce oil with a total DPA yield of 70 kg or 80 kg DPA / hectare. thing Includes.

[0084] In an embodiment, the plant, plant cell, plant part or seed, or recombinant cell of the present invention is has the following features: i) the oil is as defined herein; or ii) the plant parts or seeds or recombinant cells can be used in the methods of the invention. has one or more of the following.

[0085] For example, the seeds can be used to produce plants of the invention. It may be grown in the field or in a greenhouse under standard conditions as described in 1.

[0086] In a further aspect, the present invention relates to a method for producing a cell of the invention, an oil seed of the invention, The present invention relates to the Brassica sp. ica napus), mustard (B. juncea), soybean (G. max) or The Camelina sativa plant, the plant parts of the present invention, or a plant, plant cell, plant part or seed of the present invention. or a lipid or oil obtained therefrom. By purifying, nucleic acids (DNA and / or RNA), proteins and / or carbohydrates, To remove contaminants such as pigments like chlorophyll. To purify lipids or oils, e.g. For example, the proportion of TAGs can be enriched by removing free fatty acids (FFAs) or phospholipids.

[0087] In an embodiment, the lipid or oil is obtained by extracting oil from an oil seed. Examples of oils from oilseeds include, but are not limited to, canola oil (Brassica napus) and oleaginous oil (Brassica napus). ica napus, Brassica rapa ssp), mustard oil (Bra ssica juncea), other brassica oils, sunflower oil (Helianth us annus), linseed oil (Linum usitatissimum), Glycine max oil, safflower oil (Carthamus tinctorius) torius), corn oil (Zea mays), tobacco oil (Nicot iana tabacum), peanut oil (Arachis hypogaea) , palm oil, cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), Avocado oil (Persea american a), olive oil (Olea europaea), cashew oil (Anacar dium occidentale, Macadamia oil (Macadamia int ergrifolia), almond oil (Prunus amygdalus), or Arabidopsis seed oil (Arabidopsis thaliana). can be.

[0088] In an embodiment, the cells (recombinant cells) of or used in the present invention are suitable for fermentation. Microbial cells, such as desired cells, preferably to a level of at least 25% by weight. A preferred fermentation method is a method for producing oleaginous microbial cells capable of accumulating acylglycerol. The anaerobic fermentation process is well known in the art. Suitable fermentation cells, usually microorganisms, are It is fermentable, i.e., it can directly or indirectly ferment sugars such as glucose or maltose. Examples of microorganisms that ferment include fungal organisms such as yeast. As used herein, "yeast" refers to the genus Saccharomyces. myces spp., Saccharomyces cerevisiae cerevisiae, Saccharomyces carlsbergensis yces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp. spp.), Hansenula spp., Trichoderma spp. choderma spp., Lipomyces starkeyi rkey), and preferably alkane-utilizing yeast (Yarrowia lipolytica ica) is an example.

[0089] In a further aspect, the present invention relates to a method for producing a cell of the invention, an oil seed of the invention, The present invention relates to the Brassica sp. ica napus), mustard (B. juncea), soybean (G. max) or The Camelina sativa plant, the plant parts of the present invention, or a plant, plant cell, plant part or seed of the present invention. or a fatty acid obtained therefrom. Preferably, the fatty acid is DPA. The fatty acid may be a mixture of fatty acids having a fatty acid composition as described herein, or a fatty acid, preferably Preferably, the DPA comprises at least 40% or at least 90% of the fatty acid content of the mixture. In embodiments, the fatty acids are not esterified. Alternatively, the fatty acid may be esterified, for example to a methyl, ethyl, propyl, or butyl group. It has been done.

[0090] Seed meal obtained from the seed of the present invention or from the plant of the present invention Preferred seed meals include, but are not limited to, arabic seed meals. Rana genus (Brassica sp.), Brassica napus s), mustard (B. juncea), soybean (Glycine max) seed meal In an embodiment, the seed meal comprises an exogenous polynucleotide as defined herein. In a preferred embodiment, the seed meal comprises a nucleotide and / or a genetic construct. , seed meal is obtained, but most lipids or oils are extracted at low levels (e.g. The seed retains some of the lipids or oils produced within the seed, which are less than 2% by weight. The food meal may be used as an ingredient in animal feed or food products.

[0091] In another aspect, the present invention provides one or more of the lipids or oils of the present invention, the fatty acids of the present invention, the The cells according to the invention, the oilseed plants according to the invention, the Brassica spp. p.), rapeseed (Brassica napus), mustard (B. juncea) cea), soybean (Glycine max) or camelina sativa (Cameli na sativa plant, the plant part of the invention, the seed of the invention, or the seed meal of the invention. In an embodiment, the composition is for use in a pharmaceutical, food or agricultural application. as a seed treatment compound, fertilizer, another food or feed ingredient, or added protein or Contains a suitable carrier for vitamins.

[0092] One or more of the lipids or oils of the invention, the fatty acids of the invention, the cells of the invention, The oilseed plant of the present invention, Brassica sp., (Brassica napus), mustard (B. juncea), soybean (Gly cine. max) or Camelina sativa plant , a plant part of the invention, a seed of the invention, or a seed meal of the invention, or a composition of the invention. Also provided are feeds, cosmetics or chemicals containing the lipids of the present invention. It is an infant formula that contains oil.

[0093] In another aspect, the present invention provides a method for producing a feed, preferably an infant formula, said method comprising the steps of: The method comprises the step of: providing one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell of the invention, the The oilseed plant of the present invention, the Brassica sp. of the present invention, Rana (Brassica napus), mustard (B. juncea), soybean (G lycine. max) or Camelina sativa A plant, a plant part of the invention, a seed of the invention, or a seed meal of the invention, or a plant of the invention The method includes mixing the composition with at least one other food ingredient. , baking, extruding, emulsifying or otherwise formulating feed, or packaging feed, or in samples The method may include a step of analyzing the amount of lipid or oil in the sample.

[0094] In another aspect, the present invention provides a method for treating a condition that would benefit from a PUFA, preferably DPA. The present invention provides a method for treating or preventing a disease comprising administering to a subject one or more lipids or oils of the present invention, The fatty acid according to the invention, the cell according to the invention, the oilseed plant according to the invention, the Brassica spp. rassica sp.), Brassica napus, Kara China (B. juncea), soybean (Glycine max) or camelina sativa The Camelina sativa plant, the plant parts of the invention, the seeds of the invention, and comprises administering a seed meal of the invention, a composition of the invention, or a feed of the invention. In a preferred embodiment, the PUFA is administered in the form of a pharmaceutical composition comprising an ethyl ester of the PUFA. The subject can be a human or a non-human animal.

[0095] Examples of conditions that may benefit from PUFAs include, but are not limited to, serum triglycerides, Increased serum cholesterol levels, including elevated triglyceride levels and elevated LDL cholesterol levels, Cardiac regulation, angiogenesis, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, Rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, fetal alcohol syndrome, attention deficit hyperactivity disorder Disorders, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenol Cognitive impairment, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease Pulmonary obstruction, ulcerative colitis, restenosis after angioplasty, eczema, hypertension, platelet aggregation, gastrointestinal outflow blood, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue after viral infection or eye Diseases include:

[0096] One or more of the lipids or oils of the invention, the fatty acids of the invention, the cells of the invention, The oilseed plant of the present invention, Brassica sp., (Brassica napus), mustard (B. juncea), soybean (Gly cine. max) or Camelina sativa plant , the plant part of the invention, the seed of the invention, the seed meal of the invention, the composition of the invention, or or the feed of the present invention is administered to a subject having a disease state which would benefit from a PUFA, preferably DPA. The use of the invention in the manufacture of a therapeutic or prophylactic medicament is also provided.

[0097] The pharmaceutical preparation comprises a pharmaceutical composition comprising the oil of the present invention pharma- ceutical acceptable salt thereof for the treatment of the conditions described herein. The method may include first refining the oil and / or mixing it with a suitable carrier. The oil may be transesterified and / or fractionated to increase the level of DPA. In certain embodiments, the method includes using a lipid or oil, such as canola oil. The oil is treated to convert the fatty acids in the oil into alkyl esters such as methyl or ethyl. Further processing, such as fractionation or distillation, may be carried out to enrich the lipids or oils for DPA. In a preferred embodiment, the pharmaceutical agent is an ethyl ester of DPA. In an even more preferred embodiment, the level of the ethyl ester of DPA in the pharmaceutical preparation is The bell is between 30% and 50%, or at least 80%, or at least 85%, or or at least about 90%, or at least about 95% of the total fat in the drug. Ethyl esters of EPA with an acid content between 30% and 50% or at least 90% Such medicaments may be administered to humans or animals for the treatment of the conditions described herein. Suitable for administration to a subject.

[0098] In another aspect, the present invention provides a method for obtaining the seeds of the present invention and cultivating the obtained seeds for financial gain. The present invention provides a method for trading seeds, the method including trading seeds for the purpose of

[0099] In an embodiment, obtaining the seed comprises cultivating a plant of the invention and / or cultivating said plant. This includes harvesting seeds from

[0100] In another embodiment, obtaining the seeds includes placing the seeds in a container and / or Further includes storing the offspring.

[0101] In a further embodiment, obtaining the seeds further comprises transporting the seeds to a different location. Included.

[0102] In yet another embodiment, the method further comprises transporting the seeds to a different location after trading the seeds. The present invention further includes:

[0103] In a further embodiment, the transaction is carried out using electronic means, such as a computer. do.

[0104] Yet in a further aspect, the present invention provides a method for producing a method for treating a pulmonary arthritis, comprising: a) wrapping, uprooting and / or harvesting the above-ground parts of plants containing the seeds of the invention; b) threshing and / or winnowing the plant parts to separate the seeds from the remainder of the plant parts; , and c) sieving and / or sorting the seeds separated in step b) and and filling the separated seeds into a storage box, thereby producing a seed box. A method of manufacture is provided.

[0105] In an embodiment, where relevant, a lipid or oil of the present invention or useful in the present invention, preferably Preferably, the seed oil has a fat level similar to that provided in the tables in the Examples section. It has a

[0106] Any embodiment herein may be used interchangeably with any other embodiment unless expressly stated otherwise. The standards should be applied with modifications where necessary.

[0107] The present invention is not limited to the specific embodiments described herein, which are intended for illustrative purposes only. Functionally equivalent products, compositions and methods are not limited in scope by any of the methods described herein. As such, are clearly within the scope of the present invention.

[0108] Throughout this specification, unless expressly stated otherwise or the context requires otherwise, A reference to a step, composition of matter, group of steps or group of compositions of matter is intended to include both one and multiple. (i.e., one or more of) these steps, compositions of matter, groups of steps or compositions of matter It should be construed to encompass a group.

[0109] The invention will now be described by way of the following non-limiting examples and with reference to the accompanying figures. [Brief description of the drawings]

[0110] [Figure 1] Aerobic DPA biosynthesis pathway. [Diagram 2]Map of the T-DNA insertion region between the left and right borders of pJP3416-GA7. RB indicates the right border; LB indicates the left border, TER indicates the transcription terminator / polyadenylation region, and PRO indicates the promoter; the coding region is indicated above the arrow, and the promoter and terminator are indicated below the arrow. Micpu-Δ6D is Micromonas pusilla Δ6-desaturase; Pyrco-Δ6E is Pyramimonas cordata Δ6-elongase; Pavsa-Δ5D is Pavlova salina Δ5-desaturase; Picpa-ω3D is Pichia pastoris ω3-desaturase; Pavsa-Δ4D is P. salina Δ4-desaturase; Lackl-Δ12D is Lachancea kluyveri Δ12-desaturase, and Pyrco-Δ5E is Pyramimonas cordata Δ5-elongase. NOS is the Agrobacterium tumefaciens novaline synthetic transcription terminator / polyadenylation region; FP1 is the Brassica napus truncated napin promoter; FAE1 is the Arabidopsis thaliana FAE1 promoter; Lectin is the Glycine max lectin transcription terminator / polyadenylation region; Cnl1 and Cnl2 are the Linum usitatissimum conlinin 1 or conlinin 2 promoter or terminator; MAR is the Nicotiana tabacum Rb7 matrix binding region. [Diagram 3] (A) is the structure of a basic plant sterol, with ring and side chain numbers. (B) is the chemical structure of some plant sterols. [Figure 4]Map of the T-DNA insertion region between the left and right borders of pJP3662. RB indicates the right border. LB indicates the left border. TER, transcription terminator / polyadenylation region. PRO, promoter. The coding region is indicated above the arrow, and the promoter and terminator are indicated below the arrow. Micpu-Δ6D, Δ6-desaturase from Micromonas pusilla. Pyrco-Δ6E, Δ6-elongase from Pyramimonas cordata. Pavsa-Δ5D, Δ5-desaturase from Pavlova salina. Picpa-ω3D, ω3-desaturase from Pichia pastoris. Lackl-Δ12D, Δ12-desaturase from Lachancea kluyveri. Pyrco-Δ5E, Δ5-elongase from Pyramimonas cordata. NOS, nopaline synthase transcription terminator / polyadenylation region from Agrobacterium tumefaciens. FP1, truncated napin promoter from Brassica napus. FAE1, FAE1 promoter from Arabidopsis thaliana. Lectin, Glycine max lectin transcription terminator / polyadenylation region. Cnl1, conlinin 1 promoter or terminator from Linum usitatissimum. MAR indicates the Rb7 matrix attachment region from tobacco (Nicotiana tabacum).

[0111] Array table key SEQ ID NO:1 - pJP3416-GA7 nucleotide sequence. SEQ ID NO:2 - pGA7-mod_B nucleotide sequence. SEQ ID NO:3 - Plant Lachancea Kluyveri ) Codon-optimized open reading frame for expression of Δ12 desaturase. SEQ ID NO:4 - Lachancea Kluyveri Δ1 2 Desaturase. SEQ ID NO:5 - Pichia pastoris ω3 desalination Codon-optimized open reading frame for expression of turases. SEQ ID NO:6 - Pichia pastoris ω3 desaturase -ze. SEQ ID NO:7 - Micromonas pusilla Δ6 - an open reading frame encoding a desaturase. SEQ ID NO:8 - Micromonas pusilla in plants ) Codon-optimized open reading frame for expression of Δ6-desaturase. SEQ ID NO:9 - Micromonas pusilla Δ6 -Desaturase. SEQ ID NO:10 - Ostreococcus lucimarinus cimarinus) Δ6-desaturase-encoding open reading frame . SEQ ID NO:11 - Plant Ostreococcus lucimarinus Codon-optimized open reading frame for expression of L. lucimarinus Δ6-desaturase Ing frame. SEQ ID NO:12 - Ostreococcus lucimarinus cimarinus) Δ6-desaturase. SEQ ID NO:13 - Ostreococcus tauri ) Δ6-desaturase. SEQ ID NO:14 - Pyramimonas cordata An open reading frame encoding a Δ6-elongase. SEQ ID NO:15 - Plant Pyramimonas corda ta) Codon-optimized open reading frame (3' end) for expression of Δ6-elongase (which is truncated at the ends and encodes a functional elongase). SEQ ID NO:16 - Pyramimonas cordata Δ6-desaturase. SEQ ID NO:17 - Truncated Pyramimonas cordata ta) Δ6-desaturase. SEQ ID NO:18 - Pavlova salina Δ5-desaturase An open reading frame encoding the enzyme. SEQ ID NO:19 - Plant Pavlova salina Δ5-desa Codon-optimized open reading frame for expression of turases. SEQ ID NO:20 - Pavlova salina Δ5-desaturase -ze. SEQ ID NO:21 - Pyramimonas cordata An open reading frame encoding a Δ5-desaturase. SEQ ID NO:22 - Pyramimonas cordata Δ5-desaturase. SEQ ID NO:23 - Pyramimonas cordata An open reading frame encoding a Δ5-elongase. SEQ ID NO:24 - Plant Pyramimonas corda ta) Codon-optimized open reading frame for expression of the Δ5-elongase. SEQ ID NO:25 - Pyramimonas cordata Δ5-elongase. SEQ ID NO:26 - Pavlova salina Δ4-desaturase An open reading frame encoding the enzyme. SEQ ID NO:27 - Plant Pavlova salina Δ4-desa Codon-optimized open reading frame for expression of turases. SEQ ID NO:28 - Pavlova salina Δ4-desaturase -ze. SEQ ID NO:29 - Isochrysis galbana Δ 9-Elongase. SEQ ID NO:30 - Plant Emiliania huxleyi i) A codon-optimized open reading frame for expression of the Δ9-elongase. SEQ ID NO:31 - Emiliania huxleyi C CMP1516Δ9-elongase. SEQ ID NO:32 - Pavlova pinguis Δ9-Elongat An open reading frame encoding the enzyme. SEQ ID NO:33 - Pavlova pinguis Δ9-Elongat -ze. SEQ ID NO:34 - Pavlova salina Δ9-Elongator An open reading frame encoding . SEQ ID NO:35 - Pavlova salina Δ9-Elongator Z. SEQ ID NO:36 - Pavlova salina Δ8-desaturase An open reading frame encoding the enzyme. SEQ ID NO:37 - Pavlova salina Δ8-desaturase -ze. SEQ ID NO:38-V2 viral suppressor. SEQ ID NO:39 - Open reading frame encoding V2 viral suppressor . SEQ ID NO:40 - Arabidopsis thaliana LPA AT2. SEQ ID NO:41 - Limnanthes alba LPAAT . SEQ ID NO:42 - Saccharomyces cerevisiae visiae)LPAAT. SEQ ID NO:43 - Micromonas pusilla L PAAT. SEQ ID NO:44 - Mortierella alpina LPAAT. SEQ ID NO:45 - Bracisa napus LPAAT. SEQ ID NO:46 - Brassica napus LPAAT. SEQ ID NO:47 - Phytophthora infestans estans) ω3-desaturase. SEQ ID NO:48 - Thalassiosira pseudonana donana) ω3-desaturase. SEQ ID NO:49 - Pythium irregulare ω3-desaturase. SEQ ID NOs: 50-58 - oligonucleotide primers / probes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0112] General Methods and Definitions Unless otherwise specified, all technical and scientific terms used herein are understood to be of ordinary skill in the art. (e.g., cell culture, molecular genetics, fatty acid synthesis, transgenic plants, recombinant cells, shall be understood to have the same meaning as commonly understood by the arts of protein chemistry and biochemistry. It is.

[0113] Unless otherwise indicated, the protein, cell culture, and immunological techniques utilized in the present invention are within the skill of the art. This technique is a standard method well known to those skilled in the art. l Guide to Molecular Cloning,John Wiley and Sons (1984), J. Sambrook et al., Molecu lar Cloning:A Laboratory Manual,Cold Spr. ing Harbor Laboratory Press (1989),TA Brown(editor),Essential Molecular Biolog y:A Practical Approach,Volumes 1 and 2,I RL Press (1991),DMGlover and BD.Hame s (editors), DNA Cloning: A Practical Appr. oach, Volumes 1-4, IRL Press (1995 and 199 6),FMAusubel et al.(editors),Current P rotocols in Molecular Biology,Greene Pub .Associates and Wiley-Interscience (1988 ,including all updates until present),Ed Harlow and David Lane (editors), Antibod ies:A Laboratory Manual,Cold Spring Harb our Laboratory,(1988),and JEColigan et al.(editors),Current Protocols in Immun ology, John Wiley & Sons (including all current editions), etc. The following is described and explained based on the references in the material.

[0114] The term "and / or," e.g., "X and / or Y" means "X and Y" or " It should be understood to mean either "X or Y" and not both or either. This is understood to explicitly support taste.

[0115] As used herein, the term "about" refers to an indicated value, unless otherwise stated. ±10%, more preferably ±5%, more preferably ±1% of

[0116] Throughout this specification, the words "comprise" or "comprises" are used interchangeably. Conversions such as "rises" or "comprising" refer to The term "group of elements, integers or steps" includes any of the above elements, integers or steps, but may include other elements, It is understood that the term does not mean to exclude any integer or step, or any group of elements, integers or steps. It will be solved.

[0117] Selected Definitions As used herein, the terms "extracted plant lipid" and "isolated plant lipid" refer to, e.g., , refers to a lipid composition extracted from a plant or a part thereof, such as a seed, for example, by squeezing. The extracted lipids may be, for example, relatively crude compositions obtained by squeezing plant seeds, or may be extracted from plant seeds. One or more, if not all, of water, nucleic acids, proteins, and carbohydrates from the product material If the purifying agent is not present, it may be possible to obtain a purer composition with most of the purifying agent removed. Examples of purification methods are described below. In embodiments, the extracted or isolated plant lipid comprises at least about 60% by weight of the composition, at least about 10% by weight of the composition. At least about 70% by weight, at least about 80% by weight, at least about 90% by weight, or at least The lipids may be solid or liquid at room temperature. In an embodiment, the extract of the present invention may be a liquid, and when liquid, it is considered to be an oil. Blending lipids with other lipids, such as DPA produced from another source (e.g., DPA from fish oil) In an embodiment, after extraction, oleic acid for DPA, palmitic acid for DPA, oleic acid, linoleic acid for DPA, and total omega-6 fatty acids: total omega-3 fatty acids or All ratios were not significantly altered when compared to those in untreated seeds or cells (e.g. For example, a change of 10% or 5% or less. In another embodiment, the extracted plant lipids are The ratios of oleic acid to DPA and palmitic acid to DPA were higher than those in the control or cells. oleic acid, linoleic acid for DPA, and total omega-6 fatty acids: total omega-3 fatty acids or The extract was not subjected to any process such as hydrogenation or fractionation that may change the ratio of all the extracts. When the lipids are contained in the oil, the oil further contains non-fatty acid molecules such as sterols. may be included in the

[0118] As used herein, the terms "extracted vegetable oil" and "isolated vegetable oil" refer to the process of extracting vegetable oil. refers to a substance or composition that contains plant lipids or isolated plant lipids and is liquid at room temperature. The oil is obtained from the plant or its parts, such as the seeds. The extracted or isolated oil is , for example, relatively crude compositions obtained by squeezing plant seeds, or water derived from plant material. Most, if not all, of one or more of each of: nucleic acids, proteins, and carbohydrates The composition may be a purer composition, with the exception of lipids, lipids, and the like. The composition may be lipid or non-lipid. In an embodiment, the oil comprises at least about 60% by weight of the oil. At least about 70% by weight, at least about 80% by weight, at least about 90% by weight, or at least In an embodiment, the extracted oil of the present invention contains about 95% by weight (w / w) of extracted plant lipids. , and by combining it with another oil such as DPA produced from another source (e.g. DPA from fish oil). In an embodiment, after extraction, oleic acid to DPA, palmitic acid to DPA Acid, linoleic acid for DPA, and one or more of the total omega-6: total omega-3 fatty acids did not change significantly when compared to the ratios in untreated seeds or cells (e.g. In another embodiment, the extracted plant oil is added to untreated seeds. or the ratios in cells, oleic acid to DPA, palmitic acid to DPA linoleic acid, DPA, and total omega-6 fatty acids: total omega-3 fatty acids or total The extract of the present invention was not subjected to any process such as hydrogenation or fractionation that may change the ratio of the total amount of the extract. The oil may also contain non-fatty acid molecules such as sterols.

[0119] As used herein, the terms "extracted microbial lipids" or "extracted microbial oils" and the like refer to The main difference is that they are derived from lipids or oils, and are referred to by the corresponding terms "extracted plant" and "extracted vegetable oil", respectively. "Vegetable lipids" and "extracted vegetable oils."

[0120] As used herein, "oil" refers to a composition that contains primarily lipids and is liquid at room temperature. For example, the oil of the present invention preferably contains at least 75% by weight of at least At least 80%, at least 85% or at least 90% by weight of lipids. Refined oils are those that contain at least 90% by weight of triacylglycerol (TA) of the lipids in the oil. G), diacylglycerol (DAG), free fatty acids (FFA), phospholipids and sucrose. Minor components of the oil, such as terols, may be present as described herein.

[0121] As used herein, the term "fatty acid" refers to a long-chain aliphatic terminal fatty acid that may be saturated or unsaturated. It refers to a carboxylic acid (or organic acid) that often has a terminal end. Usually, fatty acids are short in length. More preferably, the carbon-carbon bond is at least 8 carbon atoms in length, and more preferably, at least 12 carbons in length. Preferred fatty acids of the present invention have a chain length of 18 to 22 carbon atoms (C18, C20, C 22 fatty acids), more preferably 20 to 22 carbon atoms (C20, C22) and most preferably Preferably, the carbon chain has 22 carbon atoms (C22). Most naturally occurring fatty acids have Since the biosynthesis of acetylcholine involves acetate, which has two carbon atoms, Fatty acids may be free (non-esterified) or in the form of triglycerides, diacylglycerides, monoglycerides, Noacylglycerides, acyl-CoA (thioester) bonds or other conjugates The fatty acids may be in esterified form. ethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidyl Esterified as phospholipids such as inositol or diphosphatidylglycerol In an embodiment, the fatty acid may be, for example, a methyl or methyl C20 or C22 PUFA. The fatty acids are preferably esterified with a methyl or ethyl group, such as the ethyl ester. EPA, or DPA, or EPA, DPA and DHA, or EPA and DPA The aryl or ethyl ester.

[0122] "Saturated fatty acids" do not contain any double bonds or other functional groups in the chain. The idea is that every carbon (apart from the carboxylic acid [-COOH] group) contains as many hydrogens as possible. In other words, the omega (ω) end represents three hydrogens (-CH3 -), and each carbon in the chain contains two hydrogens (-CH2-).

[0123] An "unsaturated fatty acid" is one in which there are more than one alkene functional group present on the chain, with each alkene at one position on the chain. The double bond "-CH2-CH2-" part is replaced with the double bond "-CH=CH-" part (i.e., another carbon atom). Similar to saturated fatty acids, except that they are replaced by cyclic esters (carbons double-bonded to carbon atoms) The two adjacent carbon atoms in the chain that are attached to either side of the double bond can be cis or In an embodiment, the lipid may be in a trans or cis configuration. Or the oil or the present invention has less than 1% of carbon-carbon double bonds in the trans configuration. The fatty acid composition includes fatty acids (trans fatty acids).

[0124] As used herein, the term "monounsaturated fatty acid" refers to a fatty acid having at least one unsaturated amino acid in its carbon chain. A fatty acid containing 12 carbon atoms and only one alkene group (carbon-carbon double bond) in the chain. As used herein, the term "polyunsaturated fatty acid" or "PUFA" refers to At least 12 carbon atoms in the carbon chain and at least two alkene groups (carbon- It represents a fatty acid that contains a carbon double bond.

[0125] As used herein, the term "long chain polyunsaturated fatty acids" or "LC-PUFAs" refers to The term refers to a group having at least 20 carbon atoms in its carbon chain and at least two carbon-carbon dimers in the chain. As used herein, it refers to fatty acids that contain double bonds and therefore includes VLC-PUFAs. The term "very long chain polyunsaturated fatty acid" or "VLC-PUFA" refers to a fatty acid that has a medium to low carbon chain length. A fatty acid containing at least 22 carbon atoms and at least 3 carbon-carbon double bonds in the chain. Usually, the number of carbon atoms in the fatty acid chain represents an unbranched carbon chain. If the main chain is branched, the number of carbon atoms excludes those of the side chain groups. The long chain polyunsaturated fatty acid is an omega-3 fatty acid, i.e., The third carbon-carbon bond has desaturation (a carbon-carbon double bond). In one embodiment, the long chain polyunsaturated fatty acid is an omega-6 fatty acid, i.e., the methyl end of the fatty acid. It has desaturation (carbon-carbon double bond) at the sixth carbon-carbon bond. In one embodiment, the long chain polyunsaturated fatty acid is arachidonic acid (ARA, 20:4Δ5,8, 11, 14;ω6), eicosatetraenoic acid (ETA, 20:4Δ8, 11, 14, 17 ;ω3), eicosapentaenoic acid (EPA, 20:5Δ5, 8, 11, 14, 17;ω3 ), docosapentaenoic acid (DPA, 22:5Δ7, 10, 13, 16, 19;ω3), or docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19;ω3) The LC-PUFA is selected from the group consisting of dihomo-gamma-linoleic acid (DGLA) or or eicosatrienoic acid (ETrA, 20:3Δ11, 14, 17;ω3). The LC-PUFAs produced according to the present invention may be any or all of the above mixtures. and may contain other LC-PUFAs or derivatives of any of these LC-PUFAs. It will be readily apparent that the omega-3 fatty acid may be at least DPA, or DPA and DHA, or EPA, DPA and DHA, or EPA and DPA. In embodiments, DPA is about 7% to 30% or 35%, and DHA is absent or, if present, less than 2.0%. Preferably, it is present at a level of less than 1.0%, more preferably less than 0.5%, and most preferably or is absent or undetectable. This is due to the absence of Δ4-desaturase in the cells. In an embodiment, the DPA level is greater than the EPA level, More preferably, the levels of each of EPA and DHA are greater, and most preferably, EPA and and DHA combined. In this embodiment, DHA may be absent, If present, it is present at a level of less than 0.5% of the total fatty acid composition.

[0126] Additionally, as used herein, "long chain polyunsaturated fatty acids" (LC-PUFAs) and "Very long chain polyunsaturated fatty acids" (VLC-PUFAs) are either free (non-esterified) or Triglycerides (triacylglycerols), diacylglycerides, monoacylglycerides Fatty acids in esterified form, such as esters, acyl-CoA conjugates, or other conjugates In triglycerides, LC-PUFAs or VLC-PUFAs such as DPA are It may be esterified at the sn-1 / 3 or sn-2 positions, or the triglyceride may be esterified at the sn-1 / 3 or sn-2 positions. The lysylates are selected from two or three acyl groups of LC-PUFA and VLC-PUFA. For example, triglycerides may contain two acyl groups at the sn-1 and sn-3 positions. Both may contain DPA. The fatty acid may be phosphatidylcholine (PC), phosphatidylcholine (PC), Phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, As phospholipids such as sphatidylinositol or diphosphatidylglycerol forms Thus, LC-PUFAs can be incorporated into cellular lipids or into cells, tissues, or may be present as a mixture in the form of refined oils or lipids extracted from organisms. In an embodiment, the present invention relates to at least said triacylglycerol comprising an LC-PUFA. The remainder being present as other forms of lipids, such as those mentioned, including at least 75% or at least 85% triacylglycerol. Subsequently, for example, by hydrolysis with a strong base to release the free fatty acids, or It may be further purified or processed by transesterification, distillation, and the like.

[0127] As used herein, "total omega-6 fatty acids" or "total omega-6 fatty acid content" and the like refer to Optionally, expressed as a percentage of the total fatty acid content, extracted lipids, oils, recombinant cells All esterified and non-esterified omega-6 fatty acids in the cells, plant parts or seeds These omega-6 fatty acids are LA, GLA, D Contains GLA, ARA, EDA and omega-6-DPA, and contains omega-3 and monounsaturated fatty acids The omega-6 fatty acids present in the plants, seeds or oils of the present invention are all polyunsaturated. It is classified as a polyunsaturated fatty acid (PUFA).

[0128] As used herein, the term "new ω6 fatty acid" or "new ω6 fatty acid content" refers to a state Optionally, expressed as a percentage of the total fatty acid content, extracted lipids, oils, recombinant cells Removal of esterified and non-esterified LA in cells, plant parts or seeds These new ω-6 fatty acids represent the sum of all the ω-6 fatty acids that were introduced into the cells. Expression of the construct (exogenous polynucleotide) results in the production of the cells, plants, plant parts and Fatty acids produced in the seeds, if present, include GLA, DGLA, ARA, Contains EDA and omega-6-DPA, but does not contain LA, omega-3 or monounsaturated fatty acids Illustrative total ω6 fatty acid content and novel ω6 fatty acid content were determined as described in Example 1. The fatty acids in the sample are determined by converting them to FAMEs and analyzing them by GC.

[0129] As used herein, "total omega-3 fatty acids" or "total omega-3 fatty acid content" and the like refer to Optionally, expressed as a percentage of the total fatty acid content, extracted lipids, oils, recombinant cells All esterified and non-esterified omega-3 fatty acids in the cells, plant parts or seeds These omega-3 fatty acids are ALA, SDA, and Contains ETrA, ETA, EPA, DPA and DHA, omega-6 fatty acids and monounsaturated fatty acids All omega-3 fatty acids present in the plants, seeds or oils of the present invention are polyunsaturated fatty acids. It is classified as a saturated fatty acid (PUFA).

[0130] As used herein, the term "new omega-3 fatty acid" or "new omega-3 fatty acid content" refers to a state Optionally, expressed as a percentage of the total fatty acid content, extracted lipids, oils, recombinant cells Esterified and non-esterified ALA in cells, plant parts or seeds These new ω-3 fatty acids represent the sum of all ω-3 fatty acids except for the ω-3 fatty acids introduced into the cells. The expression of a genetic construct (exogenous polynucleotide) results in the production of cells, plants, plant parts and and omega-3 fatty acids produced in the seeds, including SDA, EtrA, and E Contains TA, EPA, DPA and DHA, but also ALA and omega-6 and monounsaturated fatty acids Illustrative total omega-3 fatty acid content and novel omega-3 fatty acid content are described in Example 1. As shown in the figure, the fatty acids in the sample are converted to FAMEs and analyzed by GC. do.

[0131] As will be appreciated by those skilled in the art, "obtaining a plant part" as a step in the method of the present invention means that the method The method may further comprise the steps of: harvesting one or more plant parts for use; harvesting the plant parts using a mechanical harvester; from a plant, such as by using a In another example, obtaining the plant part includes harvesting the plant part. The purpose of the experiment may be to obtain the plant from someone else who has done so.

[0132] Desaturases, elongases and acyltransferases that may be used in the present invention The enzyme proteins and the genes encoding them are those known in the art or their homologues. The gene and encoded protein sizes are either log or derivative. Examples of desaccharomyces cerevisiae that are known to be involved in LC-PUFA biosynthesis are listed in Table 1. All of the desaturase enzymes belong to the group of so-called "front-end" desaturases. The protein or combination of proteins is preferably selected from the group consisting of SEQ ID NOs: 1 and 2 provided herein. It is encoded by a genetic construct.

[0133] As used herein, the term "front-end desaturase" refers to three highly together with a typical fatty acid desaturase domain containing a conserved histidine box. Structurally characterized by the presence of an N-terminal cytochrome b5 domain, A member of a class of enzymes that introduce double bonds between the carboxylic acid group of the carboxyl chain and existing unsaturation. represents (Napier et al., 1997).

[0134] The activity of any elongase or desaturase for use in the present invention can be determined by, for example, For example, in a cell, such as a plant cell, or preferably in a somatic embryo or a transgenic explant. In the organism, a gene encoding the enzyme is expressed, and the cell, embryo or plant does not express the enzyme. have an enhanced ability to produce LC-PUFAs compared to comparable cells, embryos or plants This can be tested by determining whether

[0135] In one embodiment, one or more desaturases and / or The elongase can be purified from microalgae, i.e., a polypeptide that can be purified from microalgae. The amino acid sequence is identical to that of the tid.

[0136] While certain enzymes are specifically described herein as "bifunctional," such terms may also be used interchangeably. The absence of a specific enzyme does not necessarily mean that it has any activity other than that specifically defined. That doesn't mean. [Table 1] TIFF2025063027000002.tif255170TIFF2025063027000003.tif255170TIFF2025063027000004.tif255170TIFF2025063027000005.tif25517 0TIFF2025063027000006.tif255170TIFF2025063027000007.tif255170TIFF2025063027000008.tif255170TIFF2025063027000009.tif25276 As used herein, the term "desaturase" refers to, for example, an acyl-CoA esterase. The carbon-carbon double bond is added to the acyl group of the fatty acid substrate, which is usually in the esterified form, such as esters. It represents an enzyme that can be introduced. It adds an acyl group to a phospholipid such as phosphatidylcholine (PC), or to an acyl carrier protein (ACP), or in a preferred embodiment, to CoA Desaturases can therefore generally be divided into three groups: In one embodiment, the desaturase is a front-end desaturase.

[0137] As used herein, a "Δ4-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylate at the terminal end of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the fourth carbon-carbon bond. "Δ4-desaturase" refers to a protein that can convert DPA to DHA. Preferably, the "Δ4-desaturase" is capable of converting DPA-CoA to D It is capable of converting HA-CoA, i.e., it is an acyl-CoA desaturase. In the present embodiment, a "Δ4-desaturase" is a desaturase that catalyzes the synthesis of a D-esterified carboxylate at the sn-2 position of PC. Preferably, the Δ4-desaturase is capable of converting DPA to DHA-PC. It has greater activity against DPA-CoA than against -PC. The resulting desaturation step is catalyzed by Δ4-desaturase in non-mammalian organisms, The gene encoding this enzyme was identified in the freshwater protist Euglena gracilis. ilis and the marine species Thraustochytrium s p.) (Qiu et al., 2001; Meyer et al., 2003). In one embodiment, the Δ4-desaturase is a Δ4-desaturase having an amino acid sequence of SEQ ID NO:28, or Thraustochytrium sp. Δ4-desaturase ze, a biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO:28. In an embodiment, the total extractable fatty acid content is 5% to 35% DPA. The present invention relates to a plant, plant part (part) or plant material for use in the present invention, which produces a high level of DPA. seeds, etc.) or cells do not contain a gene encoding a functional Δ4-desaturase.

[0138] As used herein, a "Δ5-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylate at the terminal end of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the fifth carbon-carbon bond. In an embodiment, the fatty acid substrate is ETA and the enzyme produces EPA. Preferably, the "Δ5-desaturase" converts ETA-CoA to EPA-CoA. In an embodiment, the enzyme is a "Δ5- "Desaturase" can convert ETA esterified at the sn-2 position of PC. Preferably, the Δ5-desaturase is more effective at catalyzing ETA-CoA than ETA-PC. Examples of Δ5-desaturases are described by Ruiz-Lopez et al. 2012) and Petrie et al. (2010a) and are listed in Table 1 herein. In one embodiment, the Δ5-desaturase comprises an amino acid sequence having the sequence of SEQ ID NO:20: A biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO:20. In another embodiment, the Δ5-desaturase comprises an amino acid sequence having the sequence of SEQ ID NO:22. or a biologically active fragment thereof, or an amino acid having at least 53% identity to SEQ ID NO:22. In another embodiment, the Δ5-desaturase is from the genus Thraustochytrium. Thraustochytrium sp. or Emiliania huxleyi (Emi It comes from the species Liania huxleyi.

[0139] As used herein, a "Δ6-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylate at the terminal end of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the sixth carbon-carbon bond. In an embodiment, the fatty acid substrate is ALA and the enzyme produces SDA. Preferably, the "Δ6-desaturase" converts ALA-CoA to SDA-CoA. In one embodiment, the enzyme is a "Δ6- "Alanine desaturase" can convert ALA esterified at the sn-2 position of PC. Preferably, the Δ6-desaturase is more effective in catalyzing ALA-CoA than ALA-PC. Δ6-desaturase has high activity against Δ5-desaturase. and the Δ5-desaturase activity for ALA is greater than the Δ5-desaturase activity for ETA. As long as it has 6-desaturase activity, it is called a Δ5 / Δ6-bifunctional desaturase. Examples of Δ6-desaturases are described by Ruiz-Lopez et al. (2012) and Petri (2010a) and are listed in Table 1 herein. The enzyme is from Micromonas pusilla, Pythium Pythium irregulare or Ostreococcus tau It is derived from Ostreococcus taurii.

[0140] In embodiments, the Δ6-desaturase is capable of: i) consuming linoleic acid ( α-linolenic acid (ALA, 18:3Δ9,12,,ω6) ii) greater Δ6 desaturase activity for PC as a fatty acid substrate; ALA bound to the sn-2 position is more effective as a fatty acid substrate than ALA-CoA. and iii) Δ8-desaturase activity towards ETrA. and preferably in a plant cell, having at least two, and preferably all three, of the Such Δ6-desaturases are further characterized by:

[0141] In embodiments, the Δ6-desaturase has a higher activity towards an ω3 substrate than towards the corresponding ω6 substrate. and have a specific activity when expressed from an exogenous polynucleotide in a recombinant cell, such as a plant cell. At least 30%, more preferably at least 40%, or most preferably at least at least 50%, or at least 35% efficient when expressed in yeast cells. In contrast, octadecatetraenoic acid (stearidonic acid, SDA, 18:4Δ6,9,12 In one embodiment, the Δ6-deoxyribonucleic acid (ALA) has activity to produce Δ6-deoxyribonucleic acid (Δ6-deoxyribonucleic acid). Saturase has higher activity towards ALA than LA as a fatty acid substrate, e.g. In another embodiment, both have approximately two-fold higher Δ6-desaturase activity. The enzyme reacts with ALA bound to the sn-2 position of PC as a fatty acid substrate and converts the fatty acid group High activity against ALA-CoA as a substrate, e.g., at least about 5-fold higher Δ6-desaturase activity In a further embodiment, the Δ6 -desaturase catalyzes the synthesis of fatty acid substrates ALA-CoA and ALA bound to the sn-2 position of PC. It has activity against both. [Table 2]

[0142] In one embodiment, the Δ6-desaturase is capable of detecting Δ5-desaturase activity in response to ETA. In another embodiment, the Δ6-desaturase has no saturase activity. , amino acids having the sequence of SEQ ID NO: 12 or SEQ ID NO: 13, biologically active fragments thereof or an amino acid sequence at least 77% identical to SEQ ID NO:9, SEQ ID NO:12 or SEQ ID NO:13. In another embodiment, the Δ6-desaturase comprises the amino acid sequence of SEQ ID NO: 12 or 13, or a biologically active fragment thereof, or SEQ ID NO: 12 or or SEQ ID NO: 13. The Δ6-desaturase may also have Δ8-desaturase activity.

[0143] As used herein, a "Δ8-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylate terminal carboxyl group of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the eighth carbon-carbon bond of The protein Δ8-desaturase is capable of converting at least ETrA to ETA. Preferably, the Δ8-desaturase transcribes ETrA-CoA to ETA-CoA. In an embodiment, the Δ8- The desaturase can convert ETrA esterified at the sn-2 position of PC. Preferably, the Δ8-desaturase is more selective for ETrA-C than for EtrA-PC. Δ8-desaturase has high activity against oA. It may also have Δ6-desaturase activity for ETrA, which is greater than the Δ6-desaturase activity for ALA. As long as it has the Δ8-desaturase activity required for the synthesis of a Δ6 / Δ8 bifunctional desaturase, it is called a Δ6 / Δ8 bifunctional desaturase. Examples of Δ8-desaturases are listed in Table 1. In one embodiment, The saturase may be an amino acid sequence having the sequence of SEQ ID NO: 37, a biologically active fragment thereof, or or an amino acid sequence that is at least 80% identical to SEQ ID NO:37.

[0144] As used herein, an "ω3-desaturase" refers to an enzyme that catalyzes the synthesis of methyl-terminated fatty acid substrates. A desaturase reaction that introduces a carbon-carbon double bond into the third carbon-carbon bond Therefore, ω3-desaturase converts LA to ALA and GLA to SDA (total glycerol). C18 fatty acids), or DGLA to ETA and / or ARA to EPA (C20 fatty acids) Several ω3-desaturases (group I) are found in plants and It is only active against C18 substrates such as bacterial ω3-desaturases. This ω3-desaturase is also a Δ15-desaturase. The enzymes were either inactive (group II) or active (group III) on the C18 substrate. Type III), which has activity towards C20 substrates. Such ω3-desaturases are A preferred ω3-desaturase is also a 17-desaturase. (Pichia pastoris) ω3-desaturase (SEQ ID NO: 6), A group that converts ALA to GLA to SDA, DGLA to ETA, and ARA to EPA. Examples of ω3-desaturases include those described by Pereira et al. (2004). a) (Saprolegnia diclina ω3- desaturase, group II), Horiguchi et al. (1998), Berberi (1998) and Spychalla et al. (1997) (Caenorhabditis elegans C. elegans ω3-desaturase, group III) In a preferred embodiment, the ω3-desaturase is a fungal ω3-desaturase. As used herein, a "fungal ω3-desaturase" refers to an oomycete ω3-desaturase. of fungal origin, including variants thereof with amino acid sequences at least 95% identical The genes encoding many ω3-desaturases are listed in, e.g., For example, Phytophthora infestans s) (Accession No. CAJ30870, WO2005083053; SEQ ID NO: 47), Sapro Saprolegnia diclina (Accession No. AAR2 0444, Pereira et al., 2004a and US7211656), Pythium ileum Pythium irregulare (WO2008022963, Group II; SEQ ID NO: 49), Mortierella alpina (Mortierella alpi na) (Sakuradani et al., 2005; Accession No. BAD91495; WO2006 019192), Thalassiosira pseudonana (Thalassiosira pse udonana) (Armbrust et al., 2004; accession no. XP_002291057 ; WO2005012316, SEQ ID NO: 48), Lachancea kluyveri (Lachan cea kluyveri (Saccharomyces kluyveri) es kluyveri; Oura et al., 2004; Accession No. AB1186 63) have been isolated from fungal sources. Xue et al. (2012) reported that C20 substrates were preferred. The oomycete Pythium aphanide can efficiently convert ω6 fatty acid substrates to the corresponding ω3 fatty acids. Pythium aphanidermatum, Phytophthora soja Phytophthora sojae and Phytophthora ramorum ophthora ramorum), i.e. That is, they have stronger Δ17-desaturase activity than Δ15-desaturase activity. These enzymes lacked Δ12-desaturase activity but could tolerate acyl esters as substrates. Both fatty acids from the -CoA and phospholipid fractions can be used.

[0145] In a more preferred embodiment, the fungal ω3-desaturase is derived from Pichia pastoris (Pi chia pastoris ω3-desaturase / Δ15-desaturase (Zha ng et al., 2008; Accession No. EF116884; SEQ ID NO: 6), or at least 95% are identical polypeptides.

[0146] In an embodiment, the ω3-desaturase is ARA to EPA, DGLA to ETA, G LA to SDA, ARA to EPA and DGLA to ETA, ARA to EPA and G At least one of the three options is available: LA to SDA or all three. .

[0147] In one embodiment, the ω3-desaturase has at least three carbon-carbon double bonds. and having Δ17-desaturase activity on a C20 fatty acid, preferably ARA. In another embodiment, the ω3-desaturase is a C1 desaturase having three carbon-carbon double bonds. 8 fatty acids, preferably GLA. , both activities are present.

[0148] As used herein, a "Δ12-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylic acid terminal of a fatty acid substrate. A desaturase reaction that introduces a carbon-carbon double bond into the 12th carbon-carbon bond from the end Δ12-desaturase usually refers to a protein that catalyzes the synthesis of oleoyl-phosphatidyl esters. Either choline or oleoyl-CoA was added to linoleoyl-phosphatidylcholine, respectively. converting it to linoleoyl-CoA (18:1-PC) or linoleoyl-CoA (18:1-CoA) The subclass that uses PC-linked substrates is called the phospholipid-dependent Δ12-desaturases. The latter subclass is called acyl-CoA-dependent Δ12-desaturases. Plant and fungal Δ12-desaturases are generally a subclass of the former, whereas animal Δ12-desaturases are a subclass of the latter, as described, for example, by Zhou et al. (2008) The Δ12-desaturase is encoded by a gene cloned from an insect. Many other Δ12-desaturase sequences were readily identified by searching sequence databases. can.

[0149] As used herein, a "Δ15-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylic acid terminal end of a fatty acid substrate. A desaturase reaction that introduces a carbon-carbon double bond to the 15th carbon-carbon bond from the end Numerous genes encoding Δ15-desaturases are known from plants and It has been cloned from a fungal species. For example, US5952544 is a plant Δ15-desaturase These enzymes are expressed in plant Δ15- It contains the amino acid motif characteristic of desaturases. They described the gene encoding FAD3, which is a Δ15-desaturase that is also involved in the synthesis of Δ15-desaturases. The enzyme sequences can be readily identified by searching sequence databases.

[0150] As used herein, a "Δ17-desaturase" refers to an enzyme that catalyzes the synthesis of a carboxylic acid terminal end of a fatty acid substrate. A desaturase reaction that introduces a carbon-carbon double bond to the 17th carbon-carbon bond from the end Δ17-desaturase is a protein that acts on a C20 substrate to produce an ω3 bond. If it also introduces desaturation, it is also considered an ω3-desaturase.

[0151] In a preferred embodiment, the Δ12-desaturase and / or the Δ15-desaturase is a fungal Δ12-desaturase or a fungal Δ15-desaturase. When used, "fungal Δ12-desaturase" or "fungal Δ15-desaturase" The amino acid sequence of the mutant is at least 95% identical to that of the fungal origin, including that of the oomycete origin. The term represents a Δ12-desaturase or a Δ15-desaturase derived from a mutant. Genes encoding saturases have been isolated from fungal sources. Δ12-deoxyglucose (Saprolegnia diclina) WO2009016202 describes saturases. a robusta, Laccaria bicolor, Lottia gigant ea, Microcoleus chthonoplastes, Monosiga b revicollis, Mycosphaerella fijiensis, Myco spaerella graminicola, Naegleria gruben, N ectria haematococca, Nematostella vectens is, Phycomyces blakesleeanus, Trichoderma resii, Physcomitrella patens, Postia place nta, Selaginella moellendorffii and Microdoc describes a fungal desaturase from Hium nivale. 12316 is a Δ1 WO2003 / 099216 describes 2-desaturases. spora crassa, Aspergillus nidulans, Botryt Fungal Δ isolated from Is cinerea and Mortierella alpina. The genes encoding Δ12-desaturase and Δ15-desaturase are described. WO2007133425 discloses Saccharomyces kluyveri, Mortierella alpina, Aspergillus nidulans, Neurospora crassa, Fusarium graminearum, F usarium moniliforme and Magnaporthe grisea The present application describes a fungal Δ15-desaturase isolated from Turase is derived from Phytophthora sojae (Ruiz-L opez et al., 2012).

[0152] Fungal Δ12-desaturases, and another subclass of fungal Δ15-desaturases, are Bifunctional fungal Δ12 / Δ15-desaturases. The genes encoding them are: Fusarium monoliforme (accession number DQ272516, Damude et al., 2006), Acanthamoeba castellanii (Acanthamoeba cas tellanii) (Accession number EF017656, Sayanova et al., 2006), -Perkinsus marinus (WO20070425 10), Claviceps purpurea (accession no. No. EF536898, Meesapyodsuk et al., 2007) and Coprinus cinere Coprinus cinereus (accession number AF269266, Zhang et al., 2007).

[0153] In another embodiment, the ω3-desaturase has at least some activity and is preferred. or have greater activity towards acyl-CoA substrates than the corresponding acyl-PC substrates. As used herein, a "corresponding acyl-PC substrate" refers to a substrate in which a fatty acid is substituted with the acyl-C The same fatty acid in the oA substrate, phosphatidylcholine (PC), is esterified at the sn-2 position. For example, the acyl-CoA substrate may be ARA-CoA. and the corresponding acyl-PC substrate is sn-2ARA-PC. Preferably, the ω3-desaturase is a serotype that is at least two times greater than the ω3-desaturase. and the corresponding acyl-PC substrates of C18 Examples of such ω3-desaturases are Among the cloned fungal desaturases known are:

[0154] In a further embodiment, the ω3-desaturase has the amino acid sequence of SEQ ID NO:6. , a biologically active fragment thereof, or at least 60% identical to SEQ ID NO:6, or an amino acid sequence that is at least 90% or at least 95% identical to SEQ ID NO:6. include.

[0155] In yet further embodiments, the desaturase for use in the present invention is It has greater activity towards acyl-CoA substrates than towards acyl-PC substrates. In certain embodiments, the desaturases for use in the invention are capable of converting a corresponding acyl-CoA substrate to It has high activity against acyl-PC substrates, but some activity against both substrates. As mentioned above, a "corresponding acyl-PC substrate" is one in which a fatty acid is attached to the acyl-CoA group. Esterified at the sn-2 position of phosphatidylcholine (PC) with the same fatty acid as in the substrate. In embodiments, the greater activity is at least two times as great. In embodiments, the desaturase is a Δ5 or Δ6-desaturase, or an ω3 -desaturases, examples of which include, but are not limited to, those listed in Table 2. The desaturase can be determined by which substrate it acts on, e.g., acyl-CoA or acyl To test the ruthenium-PC substrate, Domergue et al. (2003 and 2005) The assay can be carried out in the yeast cells described. When an elongase catalyzes the elongation of the product of the desaturase, the elongase is less When both have an enzymatic conversion efficiency in a plant cell of about 90%, the acyl desaturase is Based on this, the ability of the GA7 construct (Example 2, FIG. 2 and SEQ ID NO: 1) to utilize α-CoA as a substrate can be predicted. Δ5-desaturase expressed from Δ5-aminobutyric acid (see column no. 1) and its mutants (Example 3) Δ4-desaturase and Δ4-desaturase react with their respective acyl-CoA substrates, ETA-CoA A and DPA-CoA can be desaturated.

[0156] Elongated gauze Fatty acid elongation consists of four steps: condensation, reduction, dehydration, and a second reduction. Biochemical evidence suggests that, in the context of the present invention, "elongase" refers to an enzyme that acts under appropriate physiological conditions. Below, the polypeptide that catalyzes the condensation step in the presence of other members of the elongation complex. Intracellular heterologous expression of only the condensation component ("elongase") of the protein complex or homologous expression Expression has been shown to be necessary for the elongation of each acyl chain. The engineered elongase can successfully replenish the reducing and dehydrating activities from the transgenic host. The acyl elongation is successfully performed. The characteristics of the elongation reaction depending on the chain length and degree of unsaturation of the fatty acid substrate are The isomerism is believed to belong to the condensation component. This component is also thought to be rate-limiting in the elongation reaction. can be.

[0157] As used herein, a "Δ5-elongase" refers to an enzyme that at least converts EPA to DPA. Examples of Δ5-elongases include those disclosed in WO2005 / 103253. In one embodiment, the Δ5-elongase has the following activity against EPA: At least 60%, more preferably at least 65%, more preferably at least 70% , and most preferably has the activity to produce DPA with at least 80% or 90% efficiency. In a further embodiment, the Δ5-elongase has the amino acid sequence of SEQ ID NO: 25, A bioactive fragment or an amino acid sequence that is at least 47% identical to SEQ ID NO:25. In a further embodiment, the Δ6-elongase is derived from Ostreococcus tauri (O streococcus taurii) or Ostreococcus lucimarinus ( Ostreococcus lucimarinus (US2010 / 08) 8776).

[0158] As used herein, a "Δ6-elongase" refers to an enzyme that at least converts SDA to ETA. Examples of Δ6-elongases include those listed in Table 1. In one embodiment, the Δ6-elongase comprises an amino acid sequence having the sequence of SEQ ID NO: 16, or a biologically active fragment of SEQ ID NO: 16 or SEQ ID NO: 17, comprises an amino acid sequence that is at least 55% identical to one or both of SEQ ID NO:17. In an embodiment, the Δ6-elongase is derived from Physcomitrella patens. rella patens) (Zank et al., 2002; Accession No. AF428243) Thalassiosira pseudonana (Ruiz-Lopez et al., 2013) 12) Origin.

[0159] As used herein, a "Δ9-elongase" refers to an enzyme that converts ALA to ETrA at least once. Examples of Δ9-elongases include those listed in Table 1. In one embodiment, the Δ9-elongase comprises an amino acid sequence having the sequence of SEQ ID NO:29: A biologically active fragment thereof, or an amino acid that is at least 80% identical to SEQ ID NO:29. In another embodiment, the Δ9-elongase comprises an agonist having the sequence of SEQ ID NO:31. amino acid, a biologically active fragment thereof, or at least 81% identical to SEQ ID NO:31. In another embodiment, the Δ9-elongase comprises the amino acid sequence of SEQ ID NO:33. or a biologically active fragment thereof, or a sequence having at least 50% identity with SEQ ID NO:33. In another embodiment, the Δ9-elongase comprises an amino acid sequence which is identical to SEQ ID NO:35. or a biologically active fragment thereof, or a combination of SEQ ID NO: 35 and at least In a further embodiment, the Δ9-elongase comprises an amino acid sequence that is 50% identical to They have greater activity towards ω6 substrates than the corresponding ω3 substrates, or vice versa.

[0160] As used herein, "a compound that has greater activity towards an ω6 substrate than towards the corresponding ω3 substrate" means a compound that has greater activity towards an ω6 substrate than towards the corresponding ω3 substrate. The term "activates" refers to the relative activity of the enzymes on different substrates compared to the activity of ω-3 desaturase. Preferably, the ω6 substrate is LA and the ω3 substrate is ALA.

[0161] The elongase having Δ6-elongase and Δ9-elongase activity is at least (i) SDA can be converted to ETA, and (ii) ALA can be converted to ETrA, and Δ9- In one embodiment, the elongase activity of the Δ6- Longase has at least 50%, more preferably at least 60%, activity against SDA. Conversion efficiency to produce ETA and / or ALA is at least 6%, preferably Preferably, the conversion efficiency to produce ETrA is at least 9%. The elongase has at least about 6.5-fold greater Δ6-elongase activity than Δ9-elongase activity. In a further embodiment, the elongase has detectable Δ5-elongase activity. It has no longase activity.

[0162] Other enzymes into a recombinant cell, such as a microbial cell, or into a transgenic plant or part thereof. The introduced gene may also encode an LPAAT. Phosphatidic acid acyltransferase or acyl-CoA-lysophosphatidic acid acyltransferase 1-Acylglycerol-3-phosphate acyltransferase, also known as 1-acylglycerol-3-phosphate acyltransferase The term "lipopolyacyltransferase" (LPAAT) is used to describe the enzyme that regulates the synthesis of sn-1-acylglycerol-3-phosphate acylase (SN-1-APAAT). Phosphatidic acid (sn-1G-3-P) is acylated at the sn-2 position to produce phosphatidic acid (PA). Therefore, the term "1-acyl-glycerol-3-phosphate acylate" refers to the protein that is produced. The term "transferase activity" refers to the ability of the enzyme to catalyze the synthesis of the sn-1 G-3-P at the sn-2 position. The preferred LPAAT is Polyunsaturated C22 acyl groups are converted to LP using polyunsaturated C22 acyl-CoA as a substrate. A is capable of transferring to the sn-2 position of A to produce PA. The unsaturated C22 acyl-CoA is DPA-CoA. 6 and can be tested as described therein. In an embodiment, useful LPs of the present invention AAT is an amino acid sequence having any one of SEQ ID NOs: 40 to 46, and its biological activity. fragment, or any one or more of SEQ ID NOs: 40 to 46, In another embodiment, the LPAAT comprises an amino acid sequence comprising any one of SEQ ID NOs: 44. In a preferred embodiment, the amino acid sequence of LPAATs useful in the present invention can use a dihydrol-CoA substrate, preferably DPA-CoA. The present invention relates to an amino acid sequence having any one of SEQ ID NOs: 41, 42 and 44, and its biological activity. A fragment of any one or more of SEQ ID NOs: 41, 42 and 44 and at least 40 In a preferred embodiment, the C22 polyunsaturated fatty acyl LPAATs useful in the present invention can use a -CoA substrate, preferably DPA-CoA. , an amino acid having any one of the sequences of SEQ ID NO: 41 or 42, its biological activity flag ment, or any one or more of SEQ ID NOs: 41 or 42, In an embodiment, the LPAAT preferably comprises an amino acid sequence comprising Mortierella alpina (Mortierella alp a) LPAAT, or DPA-CoA as a substrate, converts DPA to LPA. It is another LPAAT that can transfer and generate PA with DPA at the sn-2 position.

[0163] Introduce into recombinant cells, transgenic cells, transgenic plants or parts thereof The introduced transgene may also encode a DGAT. glycerol acyltransferase (EC 2.3.1.20; DGAT) The term refers to the transfer of a fatty acyl group from acyl-CoA to a diacylglycerol substrate to form a triacylglycerol. Thus, "diacylglycerol acyl" refers to a protein that produces diacylglycerol. The term "transferase activity" refers to the enzyme that transfers acyl-CoA to diacylglycerol. These genes are DGAT1 and DGAT2, which are involved in the production of triacylglycerol. There are three known types of DGAT, designated DGAT1, DGAT2, DGAT3, and DGAT4. DGAT2 usually has 2 transmembrane domains. DGAT1 polypeptides are generally soluble, whereas DGAT3 polypeptides are generally soluble. Aspergillus fumigatus ) (Accession No. XP_755172), Arabidopsis thaliana (Arabidopsis thaliana liana)(CAB44774), Ricinus communis( AAR11479), Vernicia fordii (ABC94 472), Vernonia galamensis (A BV21945, ABV21946), Euonymus alatus ( AAV31083), Caenorhabditis elegans (AAF 82410), Norway rat (Rattus norvegicus) (NP_44588 9), Homo sapiens (NP_036211), and The polypeptide encoded by the mutant and / or mutant DGAT1 gene of Examples of DGAT2 polypeptides include those derived from Arabidopsis thaliana ( sis thaliana) (Accession No. NP_566952), Ricinus communis s communis)(AAY16324), Vernicia f ordii)(ABC94474), Mortierella lamaniana (Mortierella la ramanniana)(AAK84179), Homo sapiens piens)(Q96PD7, Q58HT5), cattle (Bos taurus)(Q70 VD8), Mus musculus (AAK84175), Micromouse Micromonas CCMP1545, and its mutants and / or explants The polypeptide encoded by the DGAT2 gene of a natural mutant is also included. Examples of polypeptides include those derived from peanuts (Arachis hypogaea, Saha (2006) and its variants and / or mutants of the DGAT3 gene Examples of such polypeptides include those that are

[0164] Polypeptides / Peptides The terms "polypeptide" and "protein" are generally used interchangeably.

[0165] A polypeptide or a classification of a polypeptide is determined by its amino acid sequence relative to a reference amino acid sequence. The degree of identity (percent identity) of sequences or the degree of identity of one reference amino acid sequence to another A target amino acid sequence can be defined as a sequence having a greater percent identity to a reference amino acid sequence. The percent identity of a polypeptide to a sequence is typically calculated using a gap creation penalty of 5, and GAP analysis (N Eedleman and Wunsch, 1970; GCG program). The query sequence must be at least 15 amino acids long, and the GAP analysis must be at least 15 Align two sequences across a region of amino acids. More preferably, the query sequence is At least 50 amino acids in length, and the GAP analysis spans a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids long. The GAP analysis aligns two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length. Thus, GAP analysis aligns two sequences over a region of at least 250 amino acids. More preferably, the GAP analysis aligns the two sequences over their entire length. A class of peptides or polypeptides may have the same enzymatic activity as a reference polypeptide, It may have a different activity or no activity. is at least 10%, at least 50%, at least 75% or has at least 90% enzyme activity.

[0166] As used herein, a "biologically active" fragment includes, for example, a desaturase and and / or a definition of a full-length reference polypeptide having elongase activity or other enzymatic activity. As used herein, a polypeptide is a portion of a polypeptide as defined herein that retains the desired activity. When used herein, a biologically active fragment excludes the full-length polypeptide. The components can be any size moiety so long as they maintain the defined activity. Preferably, the biologically active fragment comprises at least 10% of the full-length protein. The antibody may retain at least 50%, at least 75% or at least 90% activity.

[0167] For a defined polypeptide or enzyme, higher identities than those provided herein It will be understood that the percentage figures include preferred embodiments. If possible, the polypeptide / enzyme should be compared with the relevant designated sequence number in terms of the minimum percent identity figure. and at least 60%, more preferably 65%, more preferably 70%, more preferably is 75%, more preferably 76%, more preferably 80%, more preferably 85%, Preferably 90%, more preferably 91%, more preferably 92%, more preferably 93% %, more preferably 94%, more preferably 95%, more preferably 96%, more preferably At least 97%, more preferably 98%, more preferably 99%, more preferably 99.1% , more preferably 99.2%, more preferably 99.3%, more preferably 99.4%, More preferably, 99.5%, more preferably, 99.6%, more preferably, 99.7%, More preferably, the amino acid sequence is 99.8%, and even more preferably, 99.9% identical. It is preferable to

[0168] Amino acid sequence variants / mutants of the polypeptides defined herein are referred to herein as By introducing appropriate nucleotide changes into the defined nucleic acid, or Such variants / mutants can be prepared by in vitro synthesis of the tides. The amino acid sequence may be modified by a deletion, insertion or substitution of a residue within the amino acid sequence. Combinations can be performed to arrive at the final construct, provided that the final peptide construct has the desired enzymatic activity. It has sexuality.

[0169] Mutant (altered) peptides can be prepared using any technique known in the art. For example, the polynucleotides defined herein can be subjected to in vitro mutagenesis. Induction or DNA shuffling, as extensively described by Harayama (1998) Mutations / altered DNA derived products can be produced using the techniques described herein. and they can be readily screened for, for example, desaturases or erodes using the techniques described above. It is possible to determine whether the protein has enzyme activity.

[0170] In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation are determined by the modification. The site of the mutation will depend on the characteristics to be modified. For example, (1) first, a conservative amino acid sequence is selected. Substitution by selection of an acid, then by selection of more radicals depending on the results obtained, (2) by deleting the target residue, or (3) by inserting another residue adjacent to that position. These can be modified individually or sequentially.

[0171] The deletion of the amino acid sequence generally is about 1 to 15 residues, more preferably about 1 to 10 residues. Typically, it ranges from about 1 to 5 adjacent residues.

[0172] Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and The most attractive sites for substitutional mutagenesis are: These sites include those that are not conserved among naturally occurring desaturases or elongases. The positions are preferably substituted in a relatively conservative manner to maintain enzymatic activity. Suitable conservative substitutions are shown in Table 3 under the heading "Illustrative Substitutions."

[0173] In a preferred embodiment, the mutant / altered polypeptide has a or have only conservative amino acid changes, or have one or two or three or four The details of the conservative amino acid changes are shown in Table 3. As will be appreciated, such small changes can be made to the polypeptide when expressed in recombinant cells. The activity is not altered and is reasonably predictable. [Table 3]

[0174] Polynucleotides The present invention relates to chimeric genes, e.g., genes, isolated polynucleotides, T-DNA molecules, and the like. The use of the polynucleotide, which may be a gene construct, or a chimeric DNA, is also provided. The nucleic acids may be DNA or RNA of genomic or synthetic origin, double- or single-stranded. and may be a carbohydrate, lipid, protein, or The term "polynucleotide" as used herein may be used interchangeably with "polynucleotide" or "polynucleotides ...". is used interchangeably with the term "nucleic acid molecule."

[0175] In embodiments, the polynucleotide is non-naturally occurring. Examples of non-naturally occurring polynucleotides include may be, but is not limited to, mutated (such as using the methods described herein), and the open reading frames encoding the proteins are not related in nature A polynucleotide that is operably linked to a promoter (such as the constructs described herein). Examples include:

[0176] As used herein, the term "gene" should be considered broadly and includes any gene that is transcribed. The deoxyribonucleotide sequence containing the region and, if translated, the structural gene and for a distance of at least about 2 kb on either end: It contains sequences adjacent to the coding region on both the 5' and 3' ends and is involved in the expression of the gene. In this regard, genes are expressed by a number of control signals, such as promoters, enhancers, and termination signals. and / or a polyadenylation signal naturally associated with a given gene, or In the case of "chimeric genes", heterologous regulatory signals are included. The sequences that are located 5' and present on the mRNA are called 5' untranslated sequences. Sequences that are located 3' or downstream of the coding region and that are present on the mRNA are called 3' untranslated sequences. The term "gene" encompasses both cDNA and genomic versions of a gene. A genomic body or clone may contain "introns" or "intervening regions" or "intervening sequences." Introns are sequences that encode nuclear RNA that contain coding regions that can be interrupted by non-coding sequences called introns. Introns are segments of a gene that are transcribed into RNA (hnRNA). Introns may be removed or "deleted" from the nuclear or primary transcript. thus, introns are inserted into the messenger RNA (mRNA) transcript. During translation, mRNA determines the sequence or order of amino acids in a nascent polypeptide. The term "gene" refers to any or all of the proteins described herein. A synthetic or fusion molecule encoding a portion and a complementary nucleotide sequence to any one of the above. Includes code sequences.

[0177] As used herein, "chimeric DNA" or "chimeric gene construct" or similar. A "DNA construct" refers to a DNA molecule that is not a naturally occurring DNA molecule in its natural location, and is used herein as a "DNA construct." Typically, chimeric DNA or genes are naturally occurring, operably linked together. No homologous regulatory and transcriptional or protein sequences were found, i.e., non-homologous to each other Thus, chimeric DNA or genes are preparations from different sources. The segmental and coding sequences, or sequences derived from the same source but arranged differently than found in nature. It may include regulatory and coding sequences located therein.

[0178] "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. As used herein, a "recombinant nucleic acid molecule," "recombinant polynucleotide," or variants thereof, is refers to a nucleic acid molecule constructed or modified by recombinant DNA technology. "Exogenous polynucleotide" or "exogenous polynucleotide" or "heterologous polynucleotide" refers to a nucleic acid that has been introduced into the genome of a cell by experimental manipulation. Foreign or exogenous genes are non-naturally occurring genes. a gene inserted into a natural organism, a native gene introduced into a new location within its natural host, or A "transgene" is a gene that is introduced into a genome by a transformation method. The terms "genetically modified," "transgenic," and variations thereof are used in The introduction of genes into cells by transformation or transduction; the sudden introduction of genes in cells Mutating and the genes within the cells or organisms in which these actions have occurred or their descendants As used herein, a "genomic region" includes altering or modulating the regulation of The transgene or group of transgenes (also referred to herein as a cluster) is introduced into the cell or represents the position in the genome where it was inserted into its ancestor. Such regions are It includes only nucleotides that have been incorporated by human intervention, such as by a method.

[0179] The term "exogenous" in reference to a polynucleotide refers to an altered form of the polynucleotide compared to its natural state. In one embodiment, the cell is A cell that does not naturally contain the polynucleotide. However, the cell may contain the encoded The cells contained a non-endogenous polynucleotide resulting in altered production of the polypeptide. The exogenous polynucleotide may be present in a transgenic (recombinant) cell or in a If the polynucleotide is not separated from other components of the cell-free expression system, such cells may be used. produced in cells or in a cell-free system that has been subsequently purified away from at least some other components An exogenous polynucleotide (nucleic acid) is a naturally occurring nucleoside. It may be a contiguous stretch of tides or may be joined together to form a single Nucleotides from different sources (natural and / or synthetic) that produce single-stranded polynucleotides. Typically, such a chimeric polynucleotide comprises two or more adjacent stretches of the target gene. Operable with a suitable promoter to drive transcription of the open reading frame in a cell The nucleic acid sequence of the present invention comprises at least an open reading frame encoding a polypeptide linked to

[0180] With respect to the defined polynucleotides, features of % identity higher than those stated above are preferred. It will be appreciated that this includes embodiments that are similar to the above. Thus, where applicable, In terms of the identity percentage figures, the polynucleotide has at least 6 identical sequences to the associated designated SEQ ID NO. 0%, more preferably 65%, more preferably 70%, more preferably 75%, more preferably or 80%, more preferably 85%, more preferably 90%, more preferably 91%, More preferably 92%, more preferably 93%, more preferably 94%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98%, more preferably Preferably 99%, more preferably 99.1%, more preferably 99.2%, and even more preferably is 99.3%, more preferably 99.4%, more preferably 99.5%, more preferably 99.6%, more preferably 99.7%, more preferably 99.8%, even more preferably It is preferred that the polynucleotide sequences contained therein are at least 99.9% identical.

[0181] A polynucleotide may contain deletions, insertions, or deletions of nucleotide residues when compared to the native molecule. may have one or more mutations that are substitutions. Polynucleotides may be naturally occurring (i.e., isolated from a natural source) or synthetic (e.g., prepared by the methods described above). Either by site-directed mutagenesis or DNA shuffling of the Thus, the polynucleotide may be of either natural or recombinant origin. It is apparent that preferred polynucleotides can be used in plant cell It has a coding region that is codon-optimized for translation within the

[0182] Recombinant Vectors Recombinant expression is used to produce recombinant cells, or plants or plant parts of the invention. The recombinant vector can be used to express a heterologous polynucleotide sequence, i.e., A polynucleotide as defined herein derived from a species other than the species from which the oligonucleotide molecule is derived. The vector contains a polynucleotide sequence that is not found in nature adjacent to the RNAi molecule. They can be either A or DNA and are usually plasmids. Plasmid vectors are , usually an expression cassette in a prokaryotic cell, e.g., a pUC-derived vector, a pSK-derived vector , pGEM derived vector, pSP derived vector, pBS derived vector, or preferably Easily select, amplify, and transform binary vectors containing one or more T-DNA regions. The additional nucleic acid sequence provides for autonomous replication of the vector. an origin of replication, preferably a selectable marker gene encoding antibacterial or herbicide resistance; Provide multiple sites for inserting genes encoded within a gene, nucleic acid sequence, or nucleic acid construct. Unique multiple cloning site and facilitates transformation of prokaryotic and eukaryotic cells, especially plants The recombinant vector preferably comprises a sequence that encodes a chimeric gene construct as defined herein. In combination with the construct, more than one polynucleotide as defined herein, e.g., three Each of the polynucleotides may comprise one, four, five or six of the polynucleotides defined herein. The polynucleotide is operably linked to an expression control sequence operable in a cell of interest. Preferably, the expression control sequence includes or is entirely a heterologous promoter. That is, they are heterologous with respect to the coding regions that they control. More than one polynucleotide, e.g., three, four, five, or six polynucleotides. Preferably, seven or eight polynucleotides each encoding a different polypeptide are used. The genes are preferably covalently linked in one recombinant vector within one T-DNA molecule. and then introducing the resulting vector as a single molecule into a cell to produce a recombinant cell according to the invention; Preferably, the gene is integrated into the genome of a recombinant cell, e.g., a transgenic plant. The integration into the genome may be in the nuclear genome or in the plastid genome of the transgenic plant. It may be integration into the genome, whereby the polynucleotide so linked , will be inherited together as a single locus in the progeny of the recombinant cell or plant. A host or plant may contain two or more such recombinant vectors, each of which may be, for example, For example, multiple recombinant vectors each containing three, four, five or six polynucleotides. It contains a number of polynucleotides.

[0183] As used herein, "operably linked" refers to the binding of two or more nucleic acids (e.g., DNA) Represents the functional relationship between segments. Usually a transcriptional regulatory element for a transcribed sequence. The functional relationship of a promoter to a gene. For example, a promoter is required if A polynucleotide as defined herein is considered to be a polypeptide that stimulates or modulates transcription of a coding sequence of a polypeptide. Generally, it is operably linked to a transcription sequence. A promoter transcriptional regulatory element is physically adjacent to a transcribed sequence, i.e., However, some transcriptional regulatory elements, such as enhancers, are cis-acting. The transcription factors are located physically adjacent or in close proximity to the coding sequences whose transcription they promote. There's no need to be.

[0184] When multiple promoters are present, each promoter may be independently selected from the same or different Preferably, at least three of the six different promoter sequences are used. can be used in recombinant vectors to control the expression of exogenous polynucleotides. do.

[0185] A recombinant molecule, such as a chimeric DNA or gene construct, (a) encodes a single peptide sequence; and the expressed polypeptide as defined herein produces or Localization of the expressed polypeptide, e.g., of the polypeptide in the endoplasmic reticulum (ER) within the cell. (b) one or more secretion signals that provide for retention of the nucleic acid as a fusion protein; It may also include a fusion sequence that results in expression of a molecule. Any signal sequence capable of inducing the secretion or localization of the polypeptide defined herein. A recombinant molecule includes a nucleic acid sequence surrounding and / or comprising a nucleic acid molecule as defined herein. and / or intervening and / or untranslated sequences.

[0186] To facilitate identification of transformants, the nucleic acid construct may be Selectable as, or in addition to, an exogenous polynucleotide or preferably contains a screenable marker gene. The marker gene confers a different phenotype to cells expressing the marker gene, and thus, such a transformation The term "gene" refers to a gene that allows transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene is a gene that is capable of inducing the production of a selective agent (e.g., a herbicide, an antifungal agent, radiation, heat, or "selection" based on resistance to other treatments that damage untransformed cells Screenable marker genes (or reporter genes) by observation or testing, i.e., "screening" (e.g., β-glucuronidazole tyrosine kinase, luciferase, GFP or other enzymatic activities not present in untransformed cells. Marker genes and nucleotide sequences of interest The actual selection of the marker is performed by associating it with the cell of choice, such as a plant cell. As long as the combination is functional (i.e., selective), it is not critical.

[0187] Examples of selectable markers are ampicillin, chloramphenicol or tetracycline. A marker that confers resistance to phosphorus, and preferably resistance to an antibacterial agent, such as resistance to kanamycin. Illustrative selectable markers for selection of transformants include, but are not limited to, but the hyg gene, which encodes resistance to hygromycin B; kanamycin, paromomycin , neomycin phosphotransferase (nptII) that confers resistance to G418 genes conferring resistance to glutathione-inducing herbicides, such as those described in EP 256223; rat liver glutathione S-transferase; when overexpressed, e.g., WO87 / 05327, and other glutamine synthetase inhibitors such as phosphinothricin. resistance to the selective agent phosphinothricin described in EP 275957. Streptomyces viridochromogenes ochromogenes acetyltransferase genes, e.g., Hinch Confers resistance to N-phosphonomethylglycine, as described by ee et al. (1988). Genes encoding 5-enolshikimate-3-phosphate synthase (EPSPS) or preferably resistance to bialaphos, e.g. as described in WO91 / 02071. An example is the bar gene which confers

[0188] Preferably, the nucleic acid construct is stably integrated into the genome of a cell, such as a plant cell. The nucleic acid may also contain appropriate elements that allow the molecule to be integrated into a genome. Preferably, the left and right border sequences of the T-DNA molecule or construct are integrated into the chromosome of the cell. Place the gene expression vector into a suitable vector that can be loaded into the target cell.

[0189] Expression As used herein, an expression vector refers to a vector that is capable of transforming a host cell and expressing one or more It is a DNA vector capable of influencing the expression of a specific polynucleotide molecule of The expression vector of the present invention is capable of expressing genes in recombinant cells, such as plant cells or microbial cells. The expression vector useful in the present invention includes a transcription control sequence, a translation control sequence, a replication initiator sequence, and a transcription factor. Compatible with origin and recombinant cells and controls the expression of the polynucleotide molecules of the present invention. In particular, the polynucleotides or vectors useful in the present invention include The target contains a transcription control sequence, which controls the initiation, elongation, and termination of transcription. In particular, important transcription control sequences include promoter and enhancer sequences. Suitable transcription control sequences include those that control the initiation of transcription. Any transcription control sequence that can function in the cell may be used. The choice of regulatory sequence used depends on the subject Such regulatory sequences depend on the target organism, such as a plant and / or an organ or tissue, in which they are to be expressed. They may be obtained from eukaryotic organisms, such as plants or plant viruses, or may be chemically synthesized. A variety of such transcription control sequences are known to those skilled in the art. In particular, preferred transcription control sequences include Either constantly or depending on the use of the plant or its parts, specific stages and / or tissues Either is an active promoter that directs transcription in plants.

[0190] Several vectors suitable for stable transfection of plant cells or for establishing transgenic plants are available. Some vectors are described, for example, in Pouwels et al., Cloning Vectors: Laboratory Manual, 1985, supp. 1987;Weiss bach and Weissbach, Methods for Plant Molecules lar Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Generally, plant expression The vector may include, for example, 5' and 3' regulatory sequences and a transcriptional control sequence for a dominant selectable marker. The plant expression vector may include one or more of the following cloned plant genes: Transregulatory regions (e.g., inducible or constitutive, environmentally regulated or developmentally regulated, or or regulatory regions that control cell- or tissue-specific expression), transcription initiation sites, ribosomal tyrosine binding sites, RNA processing signals, transcription termination sites, and / or polyadenylation It may also include a signal.

[0191] Several constitutive promoters active in plant cells have been described. Suitable promoters include, but are not limited to, cauliflower mosaic virus (Ca MV) 35S promoter, Figwort mosaic virus (FMV) 35S, and rib Light-inducible promoter from the small subunit of cellulose-1,5-bisphosphate carboxylase Examples include:

[0192] For the purpose of expression of source tissues of a plant, such as leaves, seeds, roots or stems, the promoters utilized in the present invention are It is preferred that the promoter have relatively high expression in these specific tissues. are well known in the art. Various plant gene promoters that are regulated in response to the Alternatively, it may be advantageous to use organ-specific promoters.

[0193] As used herein, the term "seed-specific promoter" or variations thereof refers to a promoter that is Preferentially, when compared to other plant tissues, plants, preferably Brassica ca sp.), Camelina sativa or soybean ( The present invention represents a promoter that directs gene transcription in developing seeds of G. max plants. In the present study, a seed-specific promoter was detected in the developing seeds of a plant, compared to the leaves and / or stems of the plant. It is expressed at least five-fold more strongly in the developing seed embryo than in other plant tissues. Preferably, the promoter alone is selectively activated to selectively activate the gene of interest in the developing seed. and / or expression of the gene of interest in other parts of the plant, such as the leaves. Not detectable by either immunoblot analysis or RT-PCR. During seed growth and development, especially during the synthesis phase and accumulation of storage compounds in the seed, Such promoters drive expression in the entire plant storage organ or in the seed coat, or Only the part thereof, such as the cotyledons, preferably the embryo in the seed of a dicotyledonous plant, or the seed of a monocotyledonous plant It can drive gene expression in the endosperm or aleurone layer of the offspring.

[0194] Preferred promoters for seed-specific expression include i) fatty acid desaturase and Genes encoding enzymes involved in fatty acid biosynthesis and accumulation in seeds, such as glyceryl esterase and elongase ii) promoters from genes encoding seed storage proteins - and iii) genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds. Suitable seed-specific promoters include those derived from the Brassica napus gene. promoter (US5,608,152), broad bean USP promoter (Bauml ein et al., 1991), Arabidopsis oleosin (Arabidopsis oleosin osin) promoter (WO98 / 45461), Phaseolus vulgaris (Pha seolus vulgaris phaseolin promoter (US5,504,200 ), the Brassica Bce4 promoter (WO91 / 13980) or the regrowth promoter from broad bean The LeB4 promoter (Baumlein et al., 1992) and maize and barley Promoters that confer seed-specific expression in monocotyledonous plants such as barley, wheat, rye, and rice Suitable notable promoters include the barley lpt2 or lpt1 gene promoters. ROMOTOR (WO95 / 15389 and WO95 / 23230) or WO99 / 168 90 (barley hordein gene, rice glutelin gene, rice Lysine gene, rice prolamin gene, wheat gliadin gene, wheat glutelin gene , corn zein gene, oat glutelin gene, sorghum cilin (ka The promoters from the sirin gene and the rye secalin gene are also included. Broun et al. (1998), Potenza et al. (2004), and US20 Examples include those described in US20030159173 and US20070192902. In an embodiment, the seed-specific promoter is preferentially located in a defined region of the plant, such as the embryo, cotyledon, or endosperm. Examples of such specific promoters include, but are not limited to, However, the FP1 promoter (Ellerstrom et al., 1996), pea leg Min promoter (Perrin et al., 2000), bean phytohemagglutonin promoter (Perrin et al., 2000), a conjugation of genes encoding flax 2S storage proteins nin1 and conrinin2 promoters (Cheng et al., 2010), Arabidopsis (A The promoter of the FAE1 gene from rabidopsis thaliana, The globulin-like protein gene Bn from Brassica napus GLP promoter, peroxidase from flax (Linum usitatissimum) An example is the LPXR promoter of the ciledoxin gene.

[0195] The 5' non-translated leader sequence may be used to express heterologous gene sequences of the polynucleotides of the present invention. The promoter selected for the purpose can be derived from, or preferably, the coding sequence for the enzyme to be produced. The region is heterologous and can be specifically selected to enhance translation of the mRNA, if desired. For a review of optimal expression of transgenes, see Koziel et al. (1996). The 5' non-translated region is expressed in plant viral RNA (e.g., tobacco mosaic virus, tobacco Coetch virus, corn dwarf mosaic virus, alfalfa mosaic virus From the appropriate eukaryotic genes, plant genes (wheat and maize chlorophyll a β-binding protein gene leader) or from a synthetic gene sequence. The present invention relates to a method for producing a 5' non-translated sequence comprising the steps of: The present invention is not limited to the construction of a leader sequence, but may be modified to remove the leader sequence from an unrelated promoter or coding sequence. Leader sequences useful in the context of the present invention include the maize Hsp70 leader. - (US5,362,865 and US5,859,347), and TMV omega element Includes

[0196] The transcription termination is performed by operably linking the 3′-terminal end of the target polynucleotide to the chimeric vector. The 3' non-translated region of the recombinant DNA molecule is Polyadenylation, which functions to cause the addition of adenylate nucleotides to the 3' end of RNA The 3' untranslated regions are obtained from various genes expressed in plant cells. Nopaline synthase 3' untranslated region, pea small subunit rubis The 3' untranslated region from the co gene is a member of the soybean 7S seed storage protein gene or the amplexicaule gene. The 3' untranslated region from the linin gene is commonly used for this purpose. The 3' transcribed untranslated region contains a polyadenylation signal from the Um tumor-inducing (Ti) plasmid. The area is also appropriate.

[0197] Recombinant DNA technology can be used to, for example, increase the number of copies of polynucleotide molecules in a host cell, The efficiency with which polynucleotide molecules are transcribed, the efficiency with which the resulting transcription products are translated, and To improve expression of transformed polynucleotide molecules by manipulating the efficiency of post-modification Recombinants useful for increasing expression of the polynucleotide molecules defined herein. Techniques include, but are not limited to, staining of one or more host cells with polynucleotide molecules. integration into the body, addition of stable sequences to mRNA, replacement or modification of transcription control signals (e.g. (e.g., promoters, operators, enhancers), replacement or modification of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), and host cell codon usage These include modification of polynucleotide molecules to accommodate the nucleotide sequence, and deletion of sequences that destabilize transcription. Can be obtained.

[0198] Transgenic plants As used herein as a noun, the term "plant" refers to the entire plant, but the adjective When used as a marker, for example, a plant organ (e.g., leaf, stem, root, flower), a single cell (e.g., Present in, obtained from, or derived from a plant, e.g., pollen, seeds, or plant cells The term "plant part" refers to a substance related to a plant. The term "plant part" refers to a substance related to a plant that is capable of producing the lipids according to the present invention. For example, leaves or stems, roots, floral organs or flower structures, pollen, seeds, embryos, etc. Seed parts such as endosperm, scutellum or seed coat, plant tissues such as vascular tissue, and their microorganisms. Refers to all plant parts that contain plant DNA, including plant structures such as buds and progeny.

[0199] Generally, "transgenic plants," "genetically modified plants," or variations thereof A genetic construct that is not found in wild-type plants of the same species, variety, or cultivar (a "transgenic" plant) is a A transgenic plant as defined in the context of the present invention refers to a plant that contains a recombinant 2. Genetically modifying a plant or plant organ as defined herein using techniques to A plant or its progeny that produces the desired lipid or at least one polypeptide. Transgenic plant cells and transgenic plant parts are defined by the corresponding meanings. As used herein, a "transgene" is a gene that is commonly used in the art of biotechnology. has its usual meaning, produced or modified by recombinant DNA or RNA technology, and is contained within a plant cell A transgene includes a genetic sequence that is introduced into a cell other than a plant cell. the same species, variety or cultivar as the plant cell from which it was introduced or from a different species, variety or cultivar, or from which it was derived The transgene typically comprises a genetic sequence derived from a plant cell, which may be a plant, variety or cultivar. The gene is introduced into the cells of plants or the like by human manipulation, such as transformation. Either method may be used, as would be recognized by one of skill in the art.

[0200] The terms "seed" and "grain" are used interchangeably herein. "Grain" refers to the plant that is harvested. Mature grain such as grain that has been harvested or that is still on the plant but ready for harvest It refers to grain that has been absorbed or sprouted, depending on the context. Mature grain or The seeds usually have a moisture content of less than about 18-20%, preferably less than 10%. Brassica seeds, such as Brassica seeds, typically have a corn content of about 4-8% or 6-8%, preferably 10-20%, at maturity. As used herein, "developing seeds" refers to seeds that have a moisture content of about 4% to about 6%. Refers to seeds found within the reproductive structures of a plant before, usually after fertilization or flowering, but which are removed separately from the plant. It may also refer to such seeds that have been released and are not yet mature.

[0201] As used herein, the terms "obtaining a plant part" or "obtaining a seed" refer to The plant parts are extracted from plants in the field or in containment such as greenhouses or growth chambers. The method includes harvesting the plant parts or seeds, or purchasing the plant parts or seeds from a supplier. refers to any means of obtaining plant parts or seeds by, respectively, receiving or transferring Standard growing conditions at room temperature are natural sunlight, a daytime temperature of 22-24°C and a temperature of 16-18°C. The seeds are suitable for coloring, i.e., for germinating or producing progeny plants. or have been treated so that they can no longer germinate, e.g. food or feed or crushed, ground or milled seeds useful for feeding or for the extraction of lipids of the present invention. It is possible.

[0202] As used herein, the term "plant storage organ" refers to a plant that is capable of storing, for example, proteins, carbohydrates, etc. Part of a plant specialized to store energy in the form of carbohydrates, fatty acids and / or oils Examples of plant storage organs include seeds, fruits, tuberous roots, and tubers. The most important plant storage organ is the seed.

[0203] The plants or plant parts of the invention or for use in the invention are preferably phenotypically As used herein, the term "phenotypically normal" refers to a genetically modified The modified plant or plant organ, particularly when compared to an unmodified plant or plant organ, exhibits improved growth and fertility. It refers to storage organs such as seeds, tubers or fruits whose reproductive ability has not been significantly reduced. In this state, the phenotypically normal genetically modified plant or plant organ is A growth or development that is essentially the same as an isogenic plant or organ that does not contain nucleotides. Preferably, the biomass, growth rate, germination rate, storage organ size, The size, pollen viability, male and female fertility, seed size and / or number of viable seeds produced were determined under the same conditions. When grown under conditions such as high humidity, 90% or more of the plants do not contain the exogenous polynucleotide. Preferably, the pollen viability of the plant of the invention, or the plant produced from the seed of the invention, is higher than that of the corresponding The pollen viability of the wild-type plant is approximately 100%. However, there are some phenotypes, such as the ballerina phenotype of seedling leaves. It does not include characteristics of a plant that do not affect the usefulness of the plant for industrial purposes.

[0204] Plants provided by the present invention or contemplated for use in the practice of the present invention include monocotyledonous plants. In a preferred embodiment, the plant of the present invention is a plant of the same name. Foods (e.g., cereals and legumes, maize, wheat, potato, tapioca, rice, moro rice, foxtail millet, cassava, barley, or pea) or other legumes. The plants may be grown for the production of edible roots, tubers, leaves, stems, flowers or fruits. Plants of the present invention or useful in the present invention may be: Sorghum (Zea mays), Brassica napus (B rassica rapa ssp.), mustard (Brassica juncea) , flax (Linum usitatissimum), alfalfa (Medicag o sativa), rice (Oryza sativa), rye (Secale c erale), sorghum (Sorghum bicolour, Sorghum vul) gare) sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum) ), sweet potato (Lopmoea batatus), cassava (Manihot sculenta), coffee (Cofea spp.), coconut (Cocos nu cifera), pineapple (Anana comosus), citrus trees (citr is tree)(Citrus spp.), cocoa (Theobroma caca o), tea (Camellia senensis), banana (Musa spp.) abo Persea americana, fig (Ficus casica), Guava (Psidium guajava), Mango (Mangifer indica ), Olive (Olea europaea), Papaya (Carica papaya) ), cashew (Anacardium occidentale), macadamia (Mac Adamia intergrifolia, Almond (Prunus amygd.) alus), sugar beet (Beta vulgaris), oat, or wheat It may be wheat.

[0205] In a preferred embodiment, the plant is an angiosperm.

[0206] In an embodiment, the plant is an oilseed plant, preferably an oilseed crop. As used herein, the term "oilseed plant" refers to any plant grown for the commercial production of oil from the seeds of the plant. Oilseed plants are plant species used for the production of oilseed rape. ) (such as canola), corn, sunflower, soybean, moro The oilseed plant may be rice, flax (linseed) or sugar beet. Brassicas, cotton, peanuts, poppy, mustard, castor , Sesame, Sunflower, Safflower, Camelina, Crambe mbe) or a nut-producing plant. The plant may be an olive, oil palm or coconut plant. The present invention can be applied to horticultural plants such as coconuts, which produce high levels of oil in their fruits. The product includes lettuce, endive, or cabbage, broccoli, or cauliflower. The present invention is applicable to tobacco, cucurbits, carrots, strawberries, tomatoes, Or it may be applied to peppers.

[0207] In a further preferred embodiment, the method for producing the transgenic plants of the present invention is The non-transgenic plants to be treated preferably have, in particular in the seeds, i) less than 20%, less than 10% or less than 5% 18:2 fatty acids and / or ii) less than 10% or less than 5% 18:3 fats It produces an acidic oil.

[0208] In a preferred embodiment, the transgenic plant or part thereof is a plant whose progeny is a desired Each and every gene (exogenous gene) introduced (transgene) does not segregate for the phenotype. A transgenic plant is a plant that is a plant that is homologous to the introduced gene. The genes may be heterologous and preferably grown, for example, from hybrid seeds. The plants may be uniformly heterologous for the transgene, such as F1 progeny of the plants produced by It may provide advantages such as hybrid vigor that are well known in the art, or may be used in plant breeding or backcrossing. It can be used.

[0209] Where relevant, transgenic plants or parts thereof include, but are not limited to, Δ 6-desaturase, Δ9-elongase, Δ8-desaturase, Δ6-elongase , Δ5-desaturase, ω3-desaturase, Δ5-elongase, diacylglycerol LPAAT, Δ17-desaturase, Δ15-desaturase Enzymes involved in the production of LC-PUFAs, such as Δ12-desaturase and / or Δ12-desaturase Such a gene may also contain additional transgenes encoding proteins that have one or more of these activities. Examples of such enzymes are known in the art and include those described herein. So, transgenic plants are; a) Δ5-desaturase, Δ6-desaturase, Δ5-elongase, and Δ6- Elongase, b) Δ5-desaturase, Δ8-desaturase, Δ5-elongase, and Δ9- Elongase, c) Δ5-desaturase, Δ6-desaturase, Δ5-elongase, Δ6-erodate ligase, and Δ15-desaturase, d) Δ5-desaturase, Δ8-desaturase, Δ5-elongase, Δ9-elongase ligase, and Δ15-desaturase, e) Δ5-desaturase, Δ6-desaturase, Δ5-elongase, Δ6-erodate ligase, and Δ17-desaturase, f) Δ5-desaturase, Δ8-desaturase, Δ5-elongase, Δ9-elongase ligase, and Δ17-desaturase, g) ω3-desaturase or Δ15-desaturase, Δ6-desaturase, Δ 5-desaturase, Δ6-elongase and Δ5-elongase, h) ω3-desaturase or Δ15-desaturase, Δ8-desaturase, Δ 5-desaturase, Δ9-elongase and Δ5-elongase, i) a Δ12-desaturase, an ω3-desaturase or a Δ15-desaturase; Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase -ze, j) Δ12-desaturase, ω3-desaturase or Δ15-desaturase; Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase -ze, k) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-eron gauze, and Δ5-elongase, l) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ero ligase, and Δ5-elongase, m) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ero ligase, and Δ5-elongase, n) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase , Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, o) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-eron gauze, and Δ5-elongase, p) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-ero ligase, and Δ5-elongase, q) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-ero ligase, and Δ5-elongase, or r) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase , Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-elongase Ngauze, The present invention comprises at least a set of exogenous polynucleotides encoding the

[0210] In an embodiment, the exogenous polynucleotide is derived from Pythium irregulare. m irregulare) Δ6-elongase, Thraustochytrid (Thraus tochytrid Δ5-desaturase or Emiliana huxleyi (Emi liana huxleyi Δ5-desaturase, Physcomitrella patens (Physcomitrella patens) mitrella patens Δ6-elongase, Thraustochytrid (Thr austochytrid Δ5-elongase or Ostreococcus tauri (O streocccus taurii Δ5-elongase and Phytophthora inflammasome Phytophthora infestans ω3-desaturase Or Pythium irregulare ω3-desacchi The nucleic acid sequence encodes a set of polypeptides which are enzymes.

[0211] In an embodiment, the plant of the present invention or for use in the present invention is grown in a field, preferably in an essentially or at least 1 hectare or 2 hectares in area. It grows in populations of 000, 1,000,000 or 2,000,000 plants. Plant density can vary depending on plant species, plant variety, weather, soil conditions, fertilizer rates and other factors known in the art. For example, rapeseed usually requires 1.2 to 1.5 acres per hectare. The plants are grown at a planting density of 5 million plants. The plants are harvested and the plants are then cultured as known in the art. swathing, plucking and / or reaping, then threshing and / or winnowing the plant material to separate it from the remaining plant parts, which are often in the form of chaff; Alternatively, the seeds may be separated from the corn in a single treatment, e.g., in a combine harvester. Harvesting machines may be used to harvest from plants in fields.

[0212] Plant transformation Transgenic plants were grown according to the method described by A. Slater et al., Plant Biotechnol. ogy-The Genetic Manipulation of Plants,O xford University Press (2003), and P. Christo u and H. Klee, Handbook of Plant Biotechno logy, John Wiley and Sons (2004) These can be produced using techniques known in the art, such as those described above.

[0213] As used herein, "stably transforming," "stably transformed," and and their variants grow in progeny cells during cell division without the need for active selection for their presence. The term "intracellular nucleic acid" refers to the incorporation of an exogenous nucleic acid molecule into the genome of a cell so that the exogenous nucleic acid molecule is transferred to the cell. Confirmed transformants or their progeny were analyzed by Southern blot or genomic DNA analysis. Any method known in the art, such as in situ hybridization of NA Preferably, plant transformation is carried out as described in the Examples herein. do.

[0214] Agrobacterium-mediated transfer allows for the transient or stable expression of DNA in the genome of plant cells. For integration, either whole plant tissue or plant organs or cells in explants in tissue culture This allows the transfer of DNA into plant cells in a broad range of applications. The Agrobacterium-mediated plant integration vector for introducing DNA into plant cells. The use of vectors involves the use of Agrobacterium or other bacteria capable of introducing DNA into plant cells. These include the floral dip method, which is well known in the art (see, e.g., US517701 0, US5104310, US5004863 or US5159135). The DNA region that is transferred to the plant is delimited by border sequences, and the intervening DNA (T-DNA) is usually In addition, the integration of T-DNA is relatively precise with little re-transposition. These plant varieties for which Agrobacterium-mediated transformation is efficient are In the present study, the facile and defined nature of gene transfer makes it the method of choice. Agrobacterium transformation vectors allow for convenient manipulation as described. It can replicate not only in Escherichia coli but also in Escherichia coli (Klee et al., In:Plant DNA I nfectious Agents, Hohn and Schell, eds., Sp. Ringer-Verlag, New York, pp.179~203(1985)) .

[0215] Acceleration methods that can be used include, for example, particle bombardment. One example of a method for delivering molecules into plant cells is particle bombardment. This method is described by Yang et al. .Particle Bombardment Technology for Gen e Transfer.Oxford Press,Oxford,England(1 This is outlined in the paper by 994. Non-biological particles (microparticle ejecta) are coated with nucleic acid and propelled by the propulsion force. Illustrative particles include those made of tungsten, platinum, etc. In addition to being an efficient means of reproducibly transforming monocotyledonous plants, A particular advantage of particle bombardment is that it does not require isolation of protoplasts or susceptibility to Agrobacterium infection. This is unnecessary.

[0216] In another alternative embodiment, the plastids can be stably transformed. The methods disclosed for transformation of the vector include those that include a selectable marker and introduce the DNA into a homologous vector. and particle gun delivery of DNA to target the plastid genome via recombination. (US5,451,513, US5,545,818, US5,877,402, US5 , 932479, and WO99 / 05265).

[0217] Other methods of cell transformation may also be used, including but not limited to direct DNA transfer into pollen. by direct injection of DNA into the reproductive organs of plants or by injecting DNA into the cells of immature embryos. DNA can be introduced into plants by direct injection of β-lactamase and then rehydrating the desiccated embryos. The following points can be mentioned.

[0218] Regeneration of plants from a single plant protoplast transformation or from various transformed explants The growth, development and cultivation of these plants are well known in the art (Weissbach et al., In:Met. hods for Plant Molecular Biology,Academi Press, San Diego, Calif., (1988). The development process includes a selection step for transformed cells, a process that involves the normal stages of embryo development through the established plantlet stage. The process usually involves culturing these individualized cells to produce transgenic embryos and seeds. The resulting transgenic rooted shoots are then grown in a suitable plant growth medium such as soil. Cultivate in a medium.

[0219] Development of plants containing foreign or exogenous genes Methods for the regeneration of plants are well known in the art. Preferably, the regenerated plants are transformed with a homologous transgene. Alternatively, pollen from the regenerated plants can be used in agronomy. Conversely, the present invention provides a method for the preparation of a method for the preparation of a plant containing a desired exogenous nucleic acid. Transgenic plants of the invention are cultivated using methods well known to those skilled in the art. Transgenic plants of the invention containing a nucleic acid are cultured using methods well known to those of skill in the art.

[0220] To confirm the presence of the introduced gene in transgenic cells and plants, PCR amplification or Southern blot analysis can be performed using methods known to those of skill in the art. The expression product of the transgene can be isolated in any of a variety of ways, depending on the nature of the product. These include Western blot and enzyme assays. Once the plants are obtained, they can be cultured to produce plant tissues or parts having the desired phenotype. The plant tissue or parts may be harvested and / or the seeds may be collected. Alternatively, additional plants containing tissues or parts having the desired characteristics may serve as a growth source.

[0221] Transgenic plants produced using Agrobacterium or other transformation methods Such transgenic plants are typically cultured in a single locus on one chromosome. It can be said that the gene is hemizygous. More preferably, the gene is Transgenic plants that are homozygous for the two additional genes, i.e. A homozygous transgenic plant is one gene at the same locus on each chromosome of a chromosome pair. The transgenic plants were then self-pollinated with hemizygous transgenic plants, and several seeds were produced. The desired gene can be identified by germination of the desired plant or plants and analysis of the resulting plants for the gene of interest.

[0222] Two different transgenes containing two independently segregating exogenous genes or loci Genetic plants can also be crossed (mated) to produce offspring that contain both sets of genes or loci. Self-pollination of suitable F1 progeny results in homozygous hybrids for both the foreign gene or locus. The method can be used to produce plants that are homozygous for the transgenic parent plant and for backcrossing with a non-transgenic plant. Outcrossing is also considered vegetative propagation. Others that are commonly used for different traits and crops For an explanation of breeding methods, see Fehr, In:Breeding Methods for C ultivar Development,Wilcox J.ed.,America n Society of Agronomy,Madison Wis.(1987) can be seen in.

[0223] Enhanced and stabilized expression of exogenous RNA levels Silencing Suppressors In an embodiment, the plant cell, plant or plant part is a plant comprising a silencing suppressor protein. The polypeptide comprises an exogenous polynucleotide encoding a protein.

[0224] Post-transcriptional gene silencing (PTGS) is a process that degrades cellular and viral mRNAs. Target S and stably or transiently transform with foreign (heterologous) or endogenous DNA. occurs in the introduced plant or fungus and accumulates RNA molecules with sequence similarity to the introduced nucleic acid. It is a nucleotide sequence-specific host defense mechanism that can result in a reduction in

[0225] Co-expression of a transgene of interest and a silencing suppressor induces transcriptional regulation of the transgene. It has been widely assumed that this would increase the levels of RNA present in the cell that is transcribed. While this has proven true for in vitro cells, significant side effects have been reported for many whole-cell transplants. More specifically, Mallory et al. (2002), Cha pman et al. (2004), Chen et al. (2004), Dunoyer et al. (2004), Z As described in Hang et al. (2006), Lewisey et al. (2007) and Meng et al. (2008) As described above, plant-expressed silencing suppressors are generally expressed under constitutive promoters. Often, they are phenotypically abnormal to such an extent that they are not useful for commercial production.

[0226] Recently, it has become possible to increase the levels of RNA molecules and / or to silence the levels of RNA molecules. By restricting expression of the suppressor to the seeds of the plant or its parts, It has been found that the compound can be stabilized over a long period of time (WO2010 / 057246). When silencing a gene, a "silencing suppressor protein" or SSP is specifically formed. Expression levels of different transgenes in plant cells over multiple generations of transformed plants A polypeptide that can be expressed in a plant cell to enhance the organism level. SPs are viral silencing suppressors or their mutants. Virus silencing suppressors are known in the art and include, but are not limited to, , P19, V2, P38, Pe-Po and RPV-P0. The virus silencing suppressor is an amino acid sequence having the sequence of SEQ ID NO: 38, An active fragment or a silencing fragment that is at least 50% identical to SEQ ID NO: 38. It contains an amino acid sequence that has activity as a repressor.

[0227] As used herein, "stable expression," "stably expressed," "stabilized expression" " and variations thereof, wherein the level of an RNA molecule encodes a silencing suppressor When compared to isogenic plants that do not contain the native polynucleotide, repeated generations, e.g. For example, the offspring may be cultured for at least three generations, at least five generations, or at least ten generations. However, the term does not apply to repeated generations. Therefore, some loss in RNA molecular level, when compared to the previous generation, e.g. However, we do not exclude the possibility of losses of more than 10%.

[0228] The suppressor may be selected from any source, e.g., plant, viral, mammalian, etc. The viruses from which the suppressor can be obtained, and the suppressors from each particular virus can be selected. List of repressor proteins (e.g., B2, P14, etc.) or coding region designations See WO2010 / 057246. Multiple copies of the suppressor may be used. Suppressors may be used together (e.g., in series).

[0229] RNA molecule Essentially, any RNA that is desired to be expressed in a plant seed can be silenced. The encoded polypeptide can be expressed in oil, starch, carbohydrates, or other may be related to the metabolism of compounds, nutrients, and other compounds, or may be related to proteins, peptides, fatty acids, Fats, waxes, oils, starches, sugars, carbohydrates, fragrances, odors, toxins, Rotenoids, hormones, polymers, flavonoids, storage proteins, phenolic acids alkaloids, lignins, tannins, cellulose, glycoproteins, glycolipids, Others, preferably, may be involved in the biosynthesis of TAG or in the synthesis of aggregates.

[0230] In particular examples, the plants produced are Brassica, e.g., Brassica napus or Castor bean. safflower, flax, cotton, soybean, camelina or corn It increased the levels of enzymes for oil production in plants such as oak.

[0231] Produced LC-PUFA levels LC-PUFA or multiple LC-PUFAs produced in recombinant cells or plant parts such as seeds The level of a particular LC-PUFA or related LC-PUFA combination is important. PUFAs, such as ω3LC-PUFAs or ω6LC-PUFAs, or VLC -total fatty acids, which may be PUFAs or other as may be determined by methods known in the art The levels may be expressed as a percentage of the dry weight of the recombinant cell-containing material. Percentage of LC-PUFA in a food, e.g., the percentage of the weight of the seed that is LC-PUFA The levels may be expressed as a percentage of LC-PUFA content, such as 1,2-dichloro-2,4-diphenyl-2,5-tetrahydrofuran (1,2,3,4-tetrafluoroethylene ...) per 100 ml of 100% LC-PUFA produced in oilseeds. The LC-PUFAs are more abundant in vegetables or grains that are not grown for oil production. The two are quite high in LC-PUFA content, and both have similar LC-PUFA compositions. However, both may be used as sources of LC-PUFA for human or animal consumption. will be recognized.

[0232] LC-PUFA levels may be determined by any method known in the art. In a preferred method, total lipids are extracted from cells, tissues or organisms and analyzed by gas chromatography. Prior to analysis by GC, fatty acids are converted to methyl esters. Such a technique is shown in Example 1. 1. Chromatographic peak positions were used to identify each specific fatty acid. The amount can be determined by the integrated area under each peak. Unless otherwise specified, the percentage of a particular fatty acid in a sample is expressed as a percentage of the total area of ​​the fatty acid in the chromatogram. The percent is determined from the area under the peak for this fatty acid, which is essentially a weight percent. The identity of the fatty acids can be confirmed by GC-MS. Total lipids are determined by the method of the art. The fractions may be separated by techniques known in the art to purify the fractions, such as the TAG fraction. For example, thin layer chromatography (TLC) can be performed on an analytical scale to identify the fatty acids of TAG. To determine the acid composition specifically, DAG, acyl-CoA or other lipids such as phospholipids The TAG may be separated from the fraction.

[0233] In one embodiment, the sum of the fatty acids ARA, EPA, DPA and DHA in the extracted lipid is between about 21% and about 40% of the total fatty acids in the cell. In a preferred embodiment, the total fatty acids in the cell are C20:1 or less. Possible TAGs include fatty acids at the levels indicated herein. The invention also encompasses each possible combination of features defined herein.

[0234] The level of LC-PUFA production in a recombinant cell, plant, or plant part, such as a seed, is determined as described herein. The specific activity of one or more produced fatty acids, also referred to herein as "conversion efficiency" or "enzyme efficiency", It may also be expressed as the percentage conversion of substrate fatty acids. This parameter is useful for determining the conversion of cells, plants, The fatty acid composition of lipids extracted from plant parts or seeds, i.e., one or more substrate fatty acids The LC-PUFA produced as a percentage of the total fatty acids (including all other fatty acids derived from it) The general formula for percent conversion is: 00x(percentage total of LC-PUFA produced and all products derived therefrom) / (substrate fatty acid and the percent sum of all products derived therefrom). Acid (e.g., OA, LA, ALA, SDA, ETA, or EPA) and DP derived from the substrate As a ratio of DPA level to the level of all products including A (total fatty acid content in lipids) The conversion percentage or conversion efficiency may be expressed as the percentage of It can represent a single enzymatic step, or part or entire pathway.

[0235] The specific conversion efficiency is calculated herein according to the formula: 1. OA to DPA=100x(DHA%+DPA%) / (OA, LA, GLA, D GLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DH % Sum of A). 2. LA to DPA=100x(DHA%+DPA) / (LA, GLA, DGLA, % Total ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA sum). 3. ALA to DPA=100x(DHA%+DPA%) / (ALA, SDA, ET (% sum of rA, ETA, EPA, DPA and DHA). 4. EPA to DPA = 100x(DHA%+DPA) / (EPA, DPA and DH % Sum of A). 5. DPA to DHA (Δ4-desaturase efficiency) = 100X(DHA%) / (D (% sum of PA and DHA). 6. Δ12-desaturase efficiency = 100x (LA, GLA, DGLA, ARA, E % Sum of DA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA) / (O A, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, E (% sum of PA, DPA and DHA). 7. ω3-desaturase efficiency = 100x (ALA, SDA, ETrA, ETA, EP A, DPA and DHA (% Sum) / (LA, GLA, DGLA, ARA, EDA, ALA , SDA, ETrA, ETA, EPA, DPA and DHA). 8. OA to ALA=100x(ALA, SDA, ETrA, ETA, EPA, DP % Sum of A and DHA) / (OA, LA, GLA, DGLA, ARA, EDA, ALA, (% sum of SDA, ETrA, ETA, EPA, DPA and DHA). 9. Δ6-desaturase efficiency (ω3 substrate ALA) = 100x(SDA, ETA, E % Sum of PA, DPA and DHA) / (ALA, SDA, ETrA, ETA, EPA, D % of PA and DHA 10. Δ6-elongase efficiency (ω3 substrate SDA) = 100x(ETA, EPA, D (% Sum of SDA, ETA, EPA, DPA and DHA) / (% Sum of SDA, ETA, EPA, DPA and DHA). 11. Δ5-desaturase efficiency (ω3 substrate ETA) = 100x (EPA, DPA and (% Sum of ETA, EPA, DPA and DHA) / (% Sum of ETA, EPA, DPA and DHA). 12. Δ5-elongase efficiency (ω3 substrate EPA) = 100x (DPA and DHA) %Sum) / (%Sum of EPA, DPA and DHA).

[0236] The fatty acid composition of the lipids of the present invention, preferably the seed oils, is: total omega-6 fatty acids: total omega-3 fatty acids or new omega-6 fatty acids: new omega-3 fatty acids, the proportion of omega-6 fatty acids in the total fatty acid content It is also characterized by the ratio of total omega-6 fatty acids to total omega-3 fatty acids. The terms fatty acid and new omega-3 fatty acid have the meanings defined herein. The method comprises the steps of: determining a fatty acid composition of lipids extracted from cells, plants, plant parts or seeds; It is desirable to have greater levels of omega-3 than omega-6 fatty acids in lipids, therefore Therefore, an ω6:ω3 ratio of less than 1.0 is preferred. A ratio of 0.0 indicates that no defined ω6 fatty acids are present. A ratio of 0.03 was obtained, indicating the absence of ω3-desaturated fatty acids. ze, in particular Pichia pastoris ω exemplified herein Δ, which has ω3 substrate preference together with fungal ω3-desaturases such as ω3-desaturase This can be achieved by using 6-desaturase in combination.

[0237] The yield of LC-PUFA per weight of seed was calculated based on the total oil content in the seed and the content of the oil. For example, if the oil content of canola seed is If approximately 40% (w / w) and approximately 12% of the total fatty acid content in the oil is DPA, The DPA content of the seeds is about 4.8% or about 48 mg per gram of seed. In terms of DPA content, canola seeds and Camelina sativa (Camelina s ativa seeds have a DPA content of about 84 mg per gram of seed. The invention relates to rapeseed (Brassica napus), mustard (B. juncea), and cea) and Camelina sativa plants, and seed grafts The plant contains at least about 80 mg or at least about 84 mg of DPA per unit weight. The obtained seeds are provided. The seeds are harvested mature seeds after drying (water content of 4 to 15%). The present invention relates to a method for obtaining seeds and extracting oil from the seeds. and a method for obtaining the oil comprising extracting the plant according to the invention from the plant. Also provided is a method of obtaining the seeds comprising harvesting the seeds from

[0238] The amount of DPA produced per hectare is also calculated if the seed yield per hectare is already For example, the amount of oil palm in Australia can be calculated if it is known or estimated. Brassica napus typically produces about 2.5 tonnes of seed per hectare and has an oil content of 40%. The yield of oil is about 1000 kg. At 20.1% DPA in total oil, This gives about 200 kg of DPA per hectare. If the oil content drops by 50%, This still gives you about 100kg DPA per hectare.

[0239] Evidence to date supports the finding that several desaturases expressed heterologously in yeast or plants These results suggest that the enzyme has relatively low activity in combination with some elongases. The ability to use the acyl-CoA form of fatty acids as substrates in LC-PUFA synthesis. This may be mitigated by providing a desaturase with the desired activity, which may be used in recombinant cells, particularly in plant cells. Particularly beneficial combinations for efficient DPA synthesis include, for example, For example, Micromonas pusilla Δ6-desaturase Δ6-desaturase with preference for ω3 acyl substrates, such as enzyme (SEQ ID NO: 9) or a variant thereof having at least 95% amino acid sequence identity, e.g., Pichia pastoris ω3-desaturase (SEQ ID NO: 6) and fungal ω3-desaturases.

[0240] As used herein, the term "essentially free" refers to a composition (e.g., a liquid or or oil) contains almost no specified components (e.g., less than about 0.5%, less than about 0.25%, It means that the amount of EDTA is less than 0.1%, or less than about 0.01%, or completely absent. So, "essentially free" means that the detection of specific fatty acids (ω6- Cosapentaenoic acid, etc.) were synthesized using gas chromatography as outlined in Example 1. This means that the device cannot detect the minutes.

[0241] In an embodiment, the extract of the invention (of the invention or for use in a process / method of the invention) lipid extracts, oil extracts, plants or parts of plants, such as seeds, feed, or the like according to the invention The composition of the total cis-6,9,12,15,18-heneicosapentaenoic acid (n-3 H PA) is not included.

[0242] Oil production Techniques routinely practiced in the art can be used to culture the cells, plants, seeds, etc. of the invention. It can be used to extract, process and analyze oils produced by plant seeds. is cooked, pressed and extracted to produce crude oil, which is then degummed and refined. Generally, seed crushing techniques are known in the art. For example, oilseeds are softened by spraying with water to a moisture content of, say, 8. 5%, and the smooth rollers are set with a gap of 0.23~0.27mm. Depending on the type of seed, it may not be necessary to add water before grinding. Heat inactivates enzymes, promotes further cell destruction, aggregates oil droplets, and disintegrates protein particles. All of these facilitate the extraction process.

[0243] In an embodiment, the majority of the seed oil is liberated by passing it through a screw press. The cake expelled from the screw press is then passed through a heat tracking column. traced column) and solvent extraction, e.g., with hexane; or The crude oil produced by the squeezing operation is poured into a settling tank with a grooved wire drainage top. The clarified oil is then passed through a plate to remove any solids that may have developed in the oil during the pressing operation. The remaining fine solid particles can be removed by passing it through a frame filter. If necessary, extraction treatment can be performed. The oil recovered from can be combined with the clarified oil to produce a blended crude oil.

[0244] Once the solvent is removed from the crude oil, the combined pressed and extracted portions are generally Conventional oil processing methods are used. As used herein, the term "combined with the lipid or oil of the present invention" refers to When used in conjunction, the term "purified" refers to an extracted lipid or oil. This means that the lipid / oil component is subjected to one or more processing steps to increase its purity. For example, The processing step may include one or more of the following: degumming, deodorizing, bleaching, drying and / or fractionation of the extracted oil. However, as used herein, "purified" means The term "fatty acid" refers to a process for the preparation of a fatty acid derivative of the present invention that increases the DPA content as a percentage of the total fatty acid content. Does not include transesterification or other processes that change the fatty acid composition of lipids or oils. In other words, the fatty acid composition of a refined lipid or oil is different from that of an unrefined lipid or oil. It is essentially the same as

[0245] Degumming Degumming is the initial step in oil refining and its main purpose is to remove approximately 1-2% of the total extracted lipids. The aim is to remove most of the phospholipids from the oil, which can be obtained by rinsing at 70-80°C. When about 2% water, which usually contains phosphoric acid, is added to the crude oil, it becomes associated with trace metals and pigments. Most of the phospholipids are separated. The insoluble material removed is mainly phospholipids and triacylglycerol. It is a mixture of concentrated phosphoric acid and glycerol, also known as lectin. The addition of phosphatides to the hydrated phosphatides results in degumming and converts non-hydratable phosphatides into hydratable phosphatides. The gum was then separated by centrifugation into a form that chelates the small amount of metals present. Separate it from the file.

[0246] Alkaline Refining Alkaline refining, sometimes called neutralization, is one of the refining methods for processing crude oils. This is usually done after degumming and before bleaching. After degumming, a sufficient amount of alkaline solution is added to the seed pulp. The oleoyl can be treated to titrate out all the fatty acids and phosphoric acids, thus removing the soaps formed. Suitable alkaline substances include sodium hydroxide, potassium hydroxide, sodium carbonate, Examples include lithium hydroxide, calcium hydroxide, calcium carbonate, and ammonium hydroxide. This method is usually carried out at room temperature and removes the free fatty acid moieties. The soap is removed by extraction into a solvent and the neutralized oil is washed with water. Any excess alkali in the oil may be neutralized with a suitable acid such as hydrochloric acid or sulfuric acid.

[0247] bleaching Decolorization can be achieved in the presence of bleaching earth (0.2-2.0%), in the absence of oxygen, with nitrogen or steam. Heat the oil at 90 to 120°C for 10 to 30 minutes by operating in a vacuum or vacuum. This step in oil processing removes unwanted pigments (carotenoids, chlorophyll, etc.). The method is designed to remove oxidative products, microorganisms, and other substances. It also removes minor metals, sulfur compounds and traces of soap.

[0248] Deodorization Deodorization is carried out by using oil and The seed oil is usually added at a rate of about 0.1 ml / min / 100 ml of seed oil. This is accomplished by introducing steam into the seed oil. After about 30 minutes of sparging, The oil is then cooled under vacuum. The seed oil is then transferred, usually to glass containers, before being stored in a refrigerator. This treatment improves the color of the seed oil and removes any volatiles or residuals. Removes most of the odorous compounds, including free fatty acids, monoacylglycerols, and oxidation products do.

[0249] Let's take it off Winterization is the process by which oils and fats are converted into solids (stearins) by crystallization at subambient temperatures. It is sometimes used in the commercial production of oil to separate the crude (sugar) and liquid (oleic) fractions. It was first applied to cottonseed oil, producing a product with no solids. It is commonly used to reduce the fatty acid content.

[0250] Transesterification As used herein, "transesterification" refers to the transfer of fatty acids within and between TAGs. This refers to the process of transferring a fatty acid to another alcohol to produce an ester. may first involve liberating the fatty acid from the TAG as a free fatty acid, or directly Capable of producing fatty acid esters, preferably fatty acid methyl esters or ethyl esters In the transesterification reaction of TAG with alcohols such as methanol or ethanol, The alkyl group of the alcohol forms an ester bond with the acyl group of the TAG (including DPA). When combined with preparative methods, transesterification can be used to modify the fatty acid composition of lipids. (Marangoni et al., 1995). Transesterification can be achieved by chemical (e.g., strong Either acid or base catalysis or enzymatic means can be used, the latter of which is to convert the fatty acids of the TAGs into may be position-specific (sn-1 / 3 or sn-2 specific) or more specific than others Using lipases with selectivity for some fatty acids (Speranza et al., 201 2) Fatty acid fractionation that increases the concentration of LC-PUFA in oils can be performed using techniques such as freeze crystallization, Complex formation using urea, molecular distillation, supercritical fluid extraction, countercurrent chromatography This can be done by any method known in the art, such as by precipitation and silver ion complexation. Complexation with urea helps to reduce the levels of saturated and monounsaturated fatty acids in the oil. Due to its simplicity and efficiency, it is the preferred method (Gamez et al., 2003). The TAGs in oils are often hydrolyzed under either acid or base catalyzed conditions. In the form of fatty acid esters, the fatty acids are split into their constituent fatty acids, thereby forming alkyl alkyl esters. The excess was then added to allow separation of the ester from the glycerol produced by lipase. At least 3 moles of alcohol (e.g., ethanol for ethyl esters) Then, react 1 mole of TAG with the aldehyde (ethanol or methanol for the methyl ester). These free fatty acids or fatty acid esters, whose fatty acid composition is usually not altered by processing, may be mixed with an ethanolic solution of urea for complexation. Saturated and monounsaturated fats The acid readily forms a complex with urea, crystallizes on cooling, and can then be removed by filtration. The non-urea complex fraction is thereby enriched in LC-PUFAs.

[0251] feed The present invention includes compositions that can be used as feed. For the purposes of the present invention, "feed" refers to (a) to nourish or store tissue or provide energy when taken up by and / or (b) to maintain, restore, or support adequate nutritional status or metabolic function. The feed of the present invention includes, for example, food or preparations for human or animal consumption. Nutritional compositions for infants and / or young children, such as infant formula and seedmeals of the present invention Examples of such products include:

[0252] The feed of the present invention may, for example, comprise the cell of the present invention, the plant of the present invention, the plant part of the present invention, the seeds, the extract of the invention, the product of the process of the invention, the product of the fermentation process of the invention, or a suitable The term "carrier" includes compositions with or without nutritional value. As the skilled artisan will recognize, the term is used in a broad sense to include any component that may be In addition, the carrier is used in the feed so as not to have a deleterious effect on the organism consuming the feed. The chemical must be suitable (or used in sufficiently low concentrations) for

[0253] The feed of the present invention can be produced by the use of the methods described herein, directly or indirectly by cells or plants. The composition may be a solid or liquid. In addition, the composition may contain edible macronutrients in amounts desired for a particular use. It may contain nutrients, proteins, carbohydrates, vitamins, and / or minerals. The amounts of these components may vary depending on whether the composition is for use by a normal individual or an individual suffering from a metabolic disorder, etc. It depends on whether it is intended for use by individuals with specialized needs such as Wax.

[0254] Examples of suitable carriers having nutritional value include, but are not limited to, edible fats. Examples of such edible fats include: Non-limiting examples include coconut oil, borage oil, fungal oil, Kuroshio oil, soybean oil, and Examples of such carbohydrates include glyceryl, glyceryl, and mono- and diglycerides. Examples of suitable carbohydrates include, but are not limited to: glucose, edible lactose, and hydrolyzed starch. Further examples of proteins that may be utilized in the nutritional compositions of the present invention include, but are not limited to, (not available) soy protein, electrodialyzed whey, electrodialyzed skim milk, milk whey, or hydrolysates of these proteins.

[0255] Regarding vitamins and minerals, the feed composition of the present invention may be supplemented with the following: Good: Calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron , copper, zinc, selenium, iodine, and vitamins A, E, D, C, and B complex. Other such vitamins and minerals may also be added.

[0256] The ingredients utilized in the feed compositions of the present invention may be semi-purified or purified raw materials. By purified or purified is meant purification of a natural substance or a substance prepared by de novo synthesis. Taste.

[0257] The feed composition of the present invention may be added to food even when dietary supplementation is not required. For example, the composition may be added to any of the following: margarine, modified butter, Cheese, milk, yogurt, chocolate, candy, snacks, salad oil, Added to any type of food, including cooking oils, cooking fats, meats, fish and vegetables good.

[0258] In addition, the fatty acids produced according to the present invention may be transformed to contain and express a gene of interest. The transformed host cells can be used to make them more desirable for human or animal consumption, animal resuscitators, egg Or it may be used as an animal nutritional supplement to alter milk fatty acid composition. Examples of animals include sheep, cows, horses, and poultry such as chickens.

[0259] Furthermore, the feed of the present invention can be used to feed, for example, fish or crustaceans, such as shrimp, for human or animal consumption. It can be used in aquaculture to increase fatty acid levels, the preferred fish being salmon.

[0260] Preferred feeds of the present invention can be used directly as food or feed for humans or other animals. Plants, seeds and other plant parts such as leaves and stems. For example, animals are grown in fields. They may eat such plants directly or be fed more measured amounts in controlled feeding. The present invention relates to the use of LC-PUFAs in foods to increase the levels of LC-PUFAs in humans or other animals. This includes the use of such plants and plant parts as

[0261] In an embodiment, the feed is an infant formula comprising the lipid or oil of the present invention. As used in the specification, "infant formula" means a formula that satisfies at least some of the nutritional requirements of an infant. "Infant" means a non-natural composition that meets the requirements of the Food and Drug Administration (FDA) for the treatment of infants from birth to 1 year of age. "Corrected Age" means a human subject of age between 0 and 12 months, including an infant of corrected age between 0 and 12 months. The phrase "age" refers to the infant's actual age minus the time the infant was premature. Age is the age the infant would be if born at full term. "Non-natural" means that the product does not occur in nature but is caused by human intervention. As used herein, the infant formula of the present invention means to be produced. is produced in pure human breast milk (Koletzko et al., 1988) and by non-human animals. Although not including pure milk, the infant formula of the present invention may contain, for example, whey protein or It may contain milk-derived components such as milk proteins or carbohydrates, such as lactose. The infant formula of the present invention is free of natural meats such as beef, marine meat, whale meat or fish. Although the infant formula of the present invention does not contain any of the components, e.g., proteins, derived from these sources. The infant formula of the present invention preferably contains 0.05% by weight of the total fatty acid content. The lipid composition will always contain the DPA-containing lipid of the present invention at a level of between about 0.5% by weight. As TAG, as phospholipids, or as non-esterified fatty acids, or The lipids or oils of the present invention may be present in a mixture. For example, those skilled in the art will recognize that DPA is disclosed in the following references: Added in addition to or instead of one or more of the polyunsaturated fatty acids listed WO2008 / 027991, US20150157048, US201 Generally, the methods described in US 20150148316 and US 5,094,382 are used. Thus, the infant formula of the present invention can be easily produced.

[0262] In one example, the infant formula contains DPA (i.e., the omega-3 fatty acid esters described herein). GA-3 DPA), optionally with prebiotics, in particular polydextrose (PD X) and galacto-oligosaccharides (GOS), lactoferrin from non-human sources, and other In some embodiments, the nutritional composition comprises a long chain polyunsaturated fatty acid (LC-PUFA). In one embodiment, the composition further comprises SDA and / or gamma-linolenic acid (GLA). Infant formulas should contain less than about 7 g / 100 kcal of fat or lipid source, more preferably The composition contains a fat or lipid source of about 3 g / 100 kcal to about 7 g / 100 kcal, In some cases, the fat or lipid source is at least about 0.5 g / 100 kcal, more preferably Preferably about 1.5g / 100kcal to about 7g / 100kcal; about 7g / 100kcal al or less protein source or protein equivalent source, more preferably about 1g / 100kc al-About 7 g / 100 kcal of protein source or protein equivalent source; and At most about 5g / 100kcal of carbohydrates, more preferably about 5g to about 25g / 100kcal l of carbohydrate. Infant formulas must: 1) contain at least about 10 mg / 100 kcal Lactoferrin, more preferably about 10 mg / 100 kcal to about 200 mg / 100 kcal cal lactoferrin; 2) about 0.1g / 100kcal to about 1g / 100kcal and 3) a prebiotic composition containing PDX and GOS; and At least about 5 mg / 100 kcal of additional LC-PUFA (i.e., LC-PUFA other than DPA) -PUFA), more preferably 5 mg / 100 kcal to about 75 mg / 100 kcal containing DHA / 100 kcal additional LC-PUFA, That's fine.

[0263] In an embodiment, the ratio of DPA:DHA in the total fatty acid content of the infant formula is 1 The ratio is between 2:3 and 2:1. EPA may be present but is preferably absent. If If present, the ratio of EPA:DPA in the total fatty acid content is preferably less than 1:2 The ratio is preferably less than 1:5. ARA may be absent, but is preferably present. Preferably, the ratio of ARA:DPA in the total fatty acid content is preferably between 1:3 and 2:1. Most preferably, the level of each LC-PUFA in the infant formula is between any These levels are similar to those found in human breast milk, which naturally varies with maternal age and It varies according to genetic predisposition, dietary intake, and nutritional status. See, et al. (1988). In a preferred embodiment, the infant formula contains a detectable level It does not contain Bell's heneicosapentaenoic acid (HPA, 21:5ω3).

[0264] For example, infant formula can be liquid, powder, gel, paste, solid, concentrated, or suspended. It can refer to liquid or ready-to-use enteral, oral, or infant formulas. .

[0265] Prebiotics useful in the present disclosure include polydextrose, polydextrose Powder, lactulose, lactosucrose, raffinose, gluco-oligosaccharides, inulin , fructo-oligosaccharides, isomalto-oligosaccharides, soybean oligosaccharides, lactosucrose, Sialyl-oligosaccharides, chito-oligosaccharides, manno-oligosaccharides, alibino-oligosaccharides, sialyl- Oligosaccharides, fuco-oligosaccharides, galacto-oligosaccharides, and gentio-oligosaccharides. stomach.

[0266] Lactoferrin may also be included in the nutritional compositions of the present disclosure. It is a single polypeptide chain of about 80 kD containing 1 to 4 glycans. The 3D structures of lactoferrins are very similar, but not identical. Each lactoferrin has an N-lobe. and C-lobes, which correspond to the N-terminal and C-lobes, respectively. This refers to the C-terminal portion.

[0267] Protein sources or protein equivalent sources include, for example, nonfat milk, whey protein, Zein, soy protein, protein hydrolysates, amino acids, and other proteins used in the field Bovine milk protein sources useful in the practice of the present disclosure include, but are not limited to, Not limited to, milk protein powder, milk protein concentrate, milk protein isolate, nonfat milk Milk solids, nonfat milk, skim milk powder, whey protein, whey protein isolate, whey tan Protein concentrate, sweet whey, acid whey, casein, acid casein, caseinates (e.g. (e.g. sodium caseinate, sodium calcium caseinate, calcium caseinate, etc.) and and any combination thereof.

[0268] Suitable carbohydrate sources include, for example, lactose, glucose, fructose, corn syrup, and the like. Rice syrup solids, maltodextrin, sucrose, starch, rice syrup solids, etc. The amount of carbohydrate component in the nutritional composition may be any of those used in the art. At most about 5g / 100kcal, and generally between about 5g and about 25g / 100kcal. In some embodiments, the amount of carbohydrate may vary between about 6 g and about 22 g / 100 kcal. In another embodiment, the amount of carbohydrate is between about 12 g and about 14 g / 100 cal. In some embodiments, corn syrup solids are preferred. Additionally, Hydrolyzed, partially hydrolyzed, and / or fully hydrolyzed carbohydrates However, due to their ease of digestion, they may be desirable for inclusion in nutritional compositions. Generally, hydrolyzed carbohydrates are less likely to contain allergenic epitopes. Non-limiting examples of carbohydrate substances suitable for use herein include corn. Hydrolyzed or intact milk from corn, tapioca, rice, or potato sources These include starches that are not waxy, natural or chemically modified, and in waxy or non-waxy forms. Non-limiting examples of suitable carbohydrates include hydrolyzed corn starch, maltose, and the like. Todextrin, maltose, corn syrup, dextrose, corn syrup solids , glucose, and various other glucose polymers, and combinations thereof. Other suitable carbohydrates include, but are not limited to, various hydrolyzed starches that have been characterized. Typical examples are sucrose, lactose, fructose, and high fructose corn syrup. Indigestible oligosaccharides, often referred to as glycerides, such as fructooligosaccharides , and combinations thereof.

[0269] Preferably, one or more vitamins and / or vitamins in amounts sufficient to provide the daily nutritional requirements of the subject. and / or minerals may be added to the infant formula. It is understood that such vitamin and mineral requirements vary based, for example, on the age of the child. The nutritional composition may optionally contain, but is not limited to, the following vitamins or their analogues: May contain one or more derivatives: Vitamin B1 (thiamine, thiamine pyrophosphate, TPP, thiamine Thiamine triphosphate, TTP, thiamine hydrochloride, thiamine nitrate), vitamin B2 (riboflavin bin, flavin mononucleotide, FMN, flavin adenine dinucleotide, FAD, Lactoflavin, ovoflavin), Vitamin B3 (niacin, nicotinic acid, nicotinic acid Niacinamide, Nicotinamide Adenine Dinucleotide, NAD, Nicotinic Acid Mononucleotide, NicMN, pyridine-3-carboxylic acid), Vitamin B3 precursor triphosphate Pyridoxine, Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine, pyridoxine hydrochloride) doxin), pantothenic acid (pantothenate, panthenol), folate (folic acid, folacin Vitamin B12 (cobalamin, methylcobalamin, deodorant, pteroylglutamic acid) Hydroxyadenosylcobalamin, Cyanocobalamin, Hydroxycobalamin, Adenosylcobalamin lamin), biotin, vitamin C (ascorbic acid), vitamin A (retinol, retinyl acetate) Retinyl, retinyl palmitate, retinyl esters with other long chain fatty acids, retinal , retinoic acid, retinol ester), vitamin D (calciferol, cholecalciferol Vitamin E (α-tocopherol, vitamin D3, 1,25-dihydroxyvitamin D), Tocopherol, α-tocopherol acetate, α-tocopherol succinate, α-tocopherol nicotinate ferol, α-tocopherol), Vitamin K (vitamin K1, phylloquinone, naphtho Quinone, Vitamin K2, Menaquinone-7, Vitamin K3, Menaquinone-4, Menadione, Menaquinone-8, Menaquinone-8H, Menaquinone-9, Menaquinone-9H, Menaquinone- 10, menaquinone-11, menaquinone-12, menaquinone-13), choline, inositol In addition, the nutritional composition may optionally comprise: may include, but is not limited to, one or more of the following minerals or their derivatives: boron, potassium, Calcium, calcium acetate, calcium gluconate, calcium chloride, calcium lactate, Calcium phosphate, calcium sulfate, chlorine, chromium, chromium chloride, chromium picronel Copper, copper sulfate, copper gluconate, copper sulfate, fluorine, iron, carbonyl iron, ferric iron, fumaric acid Ferrous iron, ferric phosphate, iron trituration, polysaccharide iron, iodine chlorine, iodine, magnesium, magnesium carbonate, magnesium hydroxide, magnesium oxide Magnesium stearate, magnesium sulfate, manganese, molybdenum, phosphorus, potassium Selenium, potassium phosphate, potassium iodide, potassium chloride, potassium acetate, selenium, sulfur Yellow, sodium, docusate sodium, sodium chloride, sodium selenate, moly Sodium butenate, zinc, zinc oxide, zinc sulfate, and mixtures thereof. Mineral compounds Non-limiting examples of derivatives of include salts, alkali salts, esters, and any mineral compounds. Chelates of the above minerals include calcium phosphate, glycerol phosphate, etc. Calcium, Sodium Citrate, Potassium Chloride, Potassium Phosphate, Magnesium Phosphate In the form of salts such as iron sulfate, zinc sulfate, copper sulfate, manganese sulfate, and sodium selenate Additional vitamins and minerals known in the art may be added to the nutritional composition. This may also be the case.

[0270] In an embodiment, the infant formula of the invention or the infant formula made using the invention Milk powder does not include human or animal milk or extracts thereof that contain DPA.

[0271] In another embodiment, the level of omega-6 DPA in the total fatty acid content of the infant formula is The amount of iodine is less than 2%, preferably less than 1%, or between 0.1% and 2%, and more preferably More preferably, it is not included.

[0272] composition The present invention relates to compositions, in particular to one or more fatty acids and / or preferably ethyl groups of fatty acids. Also included are pharmaceutical compositions containing the oils produced using the methods of the present invention in the form of esters. Includes.

[0273] The pharmaceutical compositions may be prepared using any standard, well-known non-toxic pharma- ceutical acceptable carriers, excipients, or phosphate buffers. Saline solution, water, ethanol, polyols, vegetable oils, wetting agents or water / oil emulsions In combination with a vehicle such as an emulsion, one or more fatty acids and / or oils The composition may be either a liquid or a solid. For example, the composition may , tablets, capsules, ingestible liquids or powders, injections, or topical ointments or It may be in the form of a cream. Proper fluidity can be achieved by, for example, the required particle size in the case of a dispersion. The isotonicity can be maintained by using a surfactant such as sugar or sodium chloride. In addition to such inert diluents, the composition may also be provided with a wetting agent. Adjuvants such as sweetening, flavoring, and perfuming agents may also be included. .

[0274] In addition to the active compound, the suspending agent contains ethoxylated isostearyl alcohol, polyoxyethylene Ethylene sorbitol and sorbitan esters, crystalline cellulose, aluminum metahydrogen The material may include oxide, bentonite, agar, and tragacanth or a mixture of these materials. stomach.

[0275] Solid dosage forms such as tablets and capsules can be formulated using techniques well known in the art. For example, fatty acids produced according to the present invention may be added to acacia, corn starch or gelatin. disintegrating agents, such as potato starch or alginic acid, and stearic acid or or magnesium stearate, in combination with a lubricant. Tablets can be made with conventional tablet bases such as cornstarch. Capsules can be made with antioxidants and related The formulation is based on the incorporation of these excipients into gelatin capsules along with the associated fatty acids. Cut.

[0276] For intravenous administration, the fatty acids or derivatives thereof produced according to the present invention may be incorporated into commercial formulations. It may be incorporated.

[0277] Typical dosages of specific fatty acids range from 0.1 mg to 20 g (100 mg / day) taken 1 to 5 times daily. 00g), preferably in the range of about 10 mg to about 1, 2, 5, or 10 g per day. (taken in one or more doses). As is known in the art, a minimum of about 300 mg 100 mg / day of fatty acids, especially LC-PUFAs, are preferred. However, any amount of fatty acids is It is believed that this would be beneficial for elephants.

[0278] Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral (e.g., oral and rectal) For example, liquid preparations may be administered orally or rectally. The homogeneous mixture is mixed under sterile conditions with no addition of physiologically acceptable diluents, preservatives, buffers or sprays. It can be completely dispersed in water and mixed with a propellant to create a spray or inhalant.

[0279] The dosage of the composition to be administered to a patient may be determined by one skilled in the art and may take into account factors such as the weight of the patient, the age of the patient, , depending on the patient's overall health, the patient's medical history, the patient's immune status, etc.

[0280] In addition, the compositions of the present invention may be utilized for cosmetic purposes. The fatty acids produced according to the invention can be used as the sole "active" ingredient in cosmetic compositions. The cosmetic composition may be added to an already existing cosmetic composition so as to be convenient. EXAMPLES

[0281] Example 1. Materials and Methods Expression of genes in plant cells in a transient expression system The exogenous gene constructs were prepared as described in Voinnet et al. (2003) and Wood et al. (2009). The vectors were expressed in plant cells in a transient expression system essentially as described by .

[0282] Gas Chromatography (GC) Analysis of Fatty Acids 30m SGE-BPX70 column (70% cyanopropyl polysilphenylene-siloxane Xan, inner diameter 0.25 mm, film thickness 0.25 mm), FID, split / splitless Injector and Agilent Technologies 7693 Series Automated Agilent Technologies78 equipped with sampler and injector By gas chromatography using a 90A GC (Palo Alto, CA, USA). FAMEs were analyzed. Helium was used as the carrier gas. The oven temperature was 150°C. The samples were injected in split mode (ratio 50:1) at 37°C. After injection, the oven temperature was The temperature was held at 150°C for 1 min, then increased to 210°C at 3°C / min, and then increased again to 50°C / min. The temperature was raised to 240°C in 1.5 min and then held at 240°C for 1.4 min. External standard GLC-4 Based on the response of known amounts of Ag11 (Nucheck) and C17:0-ME internal standard, Ilent Technologies ChemStation Software (Rev Peaks were quantified using a HPLC-MS / MS ELISA Kit (B.04.03(16), Palo Alto, CA, USA). It has become.

[0283] Liquid chromatography-mass spectrometry (LC-MS) of lipids Twelve days after anthesis (daf), freeze-dried developed seeds and Tri-C1 as an internal quantitative standard Total lipids were extracted from mature seeds after addition of known amounts of 7:0-TAG per 5 mg dry matter. 10 mM butylated hydroxytoluene in tributanol:methanol (1:1 v / v) The extracted lipids were dissolved in 1 mL of water and analyzed using an Agilent 1200 series LC and 6410b Electrochromatography. Analysis was performed using Trospray ionization triple quadrupole LC-MS at a flow rate of 0.2 mL / min. Ascentis Express RP-Amide using a binary gradient The liquid was chromatographed using a column (50 mm x 2.1 mm, 2.7 μm, Supelco). The separation was performed by chromatographic method. The mobile phase was: A. 10 mM ammonium formate aqueous solution: Methanol A. 10 mM ammonium formate; B. 10 mM tetrahydrofuran (50:20:30 v / v / v); C. 10 mM ammonium formate; Aqueous solution of ammonium:methanol:tetrahydrofuran (5:20:75 v / v / v). The MRM list includes collision energy 30V and fragmentor 60V. V is used to determine the following major fatty acids: 16:0, 18:0, 18:1, 18:2, 18:3, 1 8:4, 20:1, 20:2, 20:3, 20:4, 20:5, 22:4, 22:5, 2 Based on 2:6. Precursor formed from neutral loss of 22:6 with ammonia Based on the ion and product ions, individual MRM TAGs were identified. TAG was quantified using a stearin external standard.

[0284] Lipid profiling using LC-MS Agilent 6410B electrospray ionization QQQ-MS (Agilent The system was equipped with an Agilent 1200 Series LC coupled to a 100-millimeter column (Panasonics, Palo Alto, California, USA). The total lipids extracted were analyzed using a binary gradient at a flow rate of 0.2 mL / min. Ascentis Express RP-Amide 50mm x 2.1mm, 2 0.7 μm HPLC column (Sigma-Aldrich, Castleton, Australia) Using a leech (Hill), 5 μL of each total lipid extract was injected and separated by chromatographic methods. The mobile phase was: A. 10 mM ammonium formate aqueous solution: methanol: tetrahydrofuran (5 0:20:30 v / v / v); B. 10 mM ammonium formate:methanol:tetrahydrofuran Trihydrofuran (5:20:75 v / v / v). Collision energy 30 V and flag The selection was performed by multiple reaction monitoring (MRM) using a mentation energy of 60V. Selected neutral lipids (TAG and DAG) and phospholipids (PC, PE, PI, PS, PA, P The following fatty acids were analyzed: 16:0 (palmitic acid), 18:0 (sucrose), 19:1 (sucrose), 19:2 (sucrose), 19:3 (sucrose), 19:4 (sucrose), 19:5 (sucrose), 19:6 (sucrose), 19:7 (sucrose), 19:8 (sucrose), 19:9 (sucrose), 19:1 (sucrose 18:1ω9 (oleic acid, OA), 18:2ω6 (linoleic acid, LA) , 18:3ω3 (α-linolenic acid, ALA), 18:4ω3 (stearidonic acid, SDA) , 20:1, 20:2, 20:3, 20:4ω3, 20:5ω3, 22:4ω3, 22: 5ω3 and 22:6ω3 target neutral lipids, while 0-3, 0-4, and 0- C with 5, 4-6 double bonds 16 , C 18 , C 20 and C 22 Phosphorus including chemical species Quality scanned.

[0285] 20:1, neutral loss of SDA, EPA and DHA combined with ammonia Individual MRM TAGs were identified based on precursor and product ions. TAG and DAG were determined using 50 μM tristearin and distearin as standard. Quantification was performed. 10 μM di-18:0-PC, di-17:0-PA, di-17:0-PE, 17:0-17:1-PG, di-18:1-PI and di-17:0-PS external standards (Av anti Polar Lipids, Alabaster, Alabama, USA) and PL Selected TAG, DAG and PL species were quantified using an Agilent 6520Q-T Further confirmation was performed by OF MS / MS.

[0286] Determination of seed fatty acid profile and oil content To determine the seed oil content, the seeds were dried in a desiccator for 24 hours and the seeds were then cooled to approximately 100°C. 4 mg was transferred into a 2 ml glass vial with a Teflon-lined screw cap. 0.05 mg of triheptadecanoin dissolved in 0.1 ml of toluene was used as the internal standard. was added to the ial.

[0287] The seed FAMEs were added to the vial containing the seed material by adding 1N HCl in methanol (Supe 0.7 ml of 100% CO was added, vortexed briefly, and incubated at 80°C for 2 hours. After cooling to room temperature, 0.3 ml of 0.9% NaCl (w / v) and 0.1 ml of xanthan was added to the vial and a Heidolph Vibramax 110 The FAMEs were collected in a 0.3 ml glass insert and mixed thoroughly for 10 min at RT. The samples were analyzed by GC equipped with a flame ionization detector (FID) as shown in Fig. 1.

[0288] The commercially available standard GLC-411 (NU-CHEK PREP, INC., USA) The peak areas of individual FAMEs were calculated based on the peak area response of known amounts of the same FAME. GLC-411 is a mixture of 31 fatty acids ( For fatty acids that were not present in the standard, we selected the most similar F The peak area response of the AME was used. For example, the peak area response of the FAME of 16:1d9 was used for 16:1d7, and the FAME response of C22:6 was used for C22:5. By comparison with the mass, the corrected area was used to calculate the mass of each FAME in the sample. The granules were stored primarily in the form of TAG, the weight of which was calculated based on the weight of FAME. Calculate the moles of each FAME and divide the total moles of FAME by 3 to determine the amount of glycerol The total moles of FAMEs were determined. Relationship: Wt% Oil = 100 x ((41 x Total FAMEs) (number of moles / 3) + (total number of grams of FAME - (15 x total number of moles of FAME))) / number of grams of seeds (formula where 41 and 15 are the molar weights of the glycerol moiety and the methyl group, respectively. The TAG was calculated as the sum of glycerol and fatty acyl moieties.

[0289] Analysis of sterol content of oil samples An aliquot of C24:0 monol was added as an internal standard to obtain approximately 10 mg of oil. The sample was saponified with 4 mL of 5% KOH in 80% MeOH and then The reaction mixture was cooled and then heated at 80°C for 2 hours in a capped glass tube. Add 2 mL of water and sterols are separated by shaking and vortexing in hexane:dichloromethane. The mixture was centrifuged and the sterols were extracted into 2 mL of chloromethane (4:1 v / v). The extract was removed and washed with 2 mL of Milli-Q water. The sterol extract was then shaken and centrifuged. The extract was evaporated in a stream of nitrogen gas and diluted with 200 mL of BSTFA. The sterols were silylated using 100% NaOH and heated at 80°C for 2 hours.

[0290] For GC / GC-MS analysis of sterols, the sterol-OTMSi derivatives were heated to 40°C. Then, the mixture was dried under a nitrogen gas flow on a heat block at 200°C, and then immediately before GC / GC-MS analysis. The mixture was then redissolved in chloroform or hexane. )-1 Fused silica capillary column (15m x 0.1mm (inner diameter), film thickness 0 .1μm), FID, split / splitless injector and Agilent Equipped with Technologies 7683B series autosampler and injector Agilent Technologies 6890A GC (California, USA) Sterol-OTMS was analyzed by gas chromatography (GC) using a 1000-milligram aliquot of 1000 ml of 100% ethanol. The derivatives were analyzed. The carrier gas was helium. The oven temperature was 120°C. The sample was injected in splitless mode. After injection, the oven temperature was increased to 270°C at 10°C / min. and finally ramped to 300°C at 5°C / min. Agilent Technology ogies ChemStation Software (Palo Alto, California, USA) Peaks were quantified using the GC method. GC results have an error of ±5% of the individual component areas.

[0291] Perform GC-mass spectrometry (GC-MS) analysis on the Finnigan Thermoquest GCQ GC=MS and Finnigan Thermo Electron Corp Both systems were equipped with an on-column injector and a T Hermoquest Xcalibur software (Austin, Texas, USA) Each GC was equipped with a capillary column of similar polarity to that described above. Using mass spectrometry data and based on reliable and laboratory standards, retention time data The individual components were identified by comparing the data. A network analysis was performed.

[0292] RT-PCR conditions 10 pmol (picomoles) of forward primer and 30 pmol of reverse primer, final MgSO4 up to 2.5 mM, 400 ng (nanograms) total RNA including buffer A 25 μL volume of Superscript 1 was prepared using the nucleotide components according to the manufacturer's instructions. The pt III One-Step RT-PCR system (Invitrogen) was used. Reverse transcription PCR (RT-PCR) amplification was routinely performed under the following conditions: typical temperature regime: 45°C reverse transcription for one cycle at 94°C for 30 min; then, one cycle at 94°C for 2 min; then 40 cycles of 94°C for 30 sec, 52°C for 30 sec, and 70°C for 1 min; After one cycle of 72°C for 2 min, the reaction mixture was cooled to 5°C.

[0293] Determining transgene copy number by digital PCR To determine the copy number of the transgene in the transgenic plants, digital This method was used to confirm that plants are transfected with the genetic constructs described herein. It should also be possible to use it to determine whether a person is genetically different from another person. Meters of leaf tissue were harvested from each individual plant and placed in collection microtubes (Qia The samples were then freeze-dried for 24-48 hours. A stainless steel ball bearing was added to each dried sample to allow for thawing. The tube was shaken in a Tissuelyser. Extraction buffer 375 μL (0.1 M Tris-HCl pH 8, 0.05M EDTA pH 8 and 1.25% SDS) were added to each tube. The mixture was then incubated at 65°C for 1 hour, and then cooled and diluted with 6M vinegar. 187 μL of ammonium chloride (4°C) was added to each tube with thorough mixing. The samples were then centrifuged at 3000 rpm for 30 minutes. The supernatant from each tube was then stored at room temperature for 5 min. in new microtubes each containing 220 μL of isopropanol for DNA precipitation for 1 min. The DNA was extracted by centrifuging the tubes at 3000 rpm for 30 minutes. The collected DNA pellet was washed with 320 μL of 70% ethanol, dried, and then added with 225 μL of water. The DNA was resuspended in 0.5% ethanol. Insoluble material was removed by centrifugation at 3000 rpm for 20 min. The cells were further pelleted and 150 μL of each supernatant was transferred to a 96-well plate for long-term storage.

[0294] DNA for transgene or cloning for efficient and quantitative digital PCR (ddPCR) To ensure that multiple copies of the DNA insert are physically separated, restriction enzyme digestion was performed prior to the amplification reaction. Therefore, an aliquot of the DNA preparation was diluted with 10x EcoRI buffer, 5 μl of DNA EcoRI and BamRI in a 20 μL volume using 4 units of each enzyme per L and sample. Digestion was carried out by incubation with HI at 37°C overnight.

[0295] The primers used in these PCR reactions were determined to be mutually exclusive between the reference and target gene primers. Ensure that such interactions are not expected to be a problem under the conditions of use. The reference genes used in the assay were , Brassica napus Hmg (high mobility group) present in one gene per Brassica napus genome genes (Weng et al., 2004). Because B. napus is an allotetraploid, In Brassica napus, four copies of the Hmg gene , i.e., there are two alleles of each of the two genes. The reference gene response is The following primer pairs and dual-labeled probes were used: sense primer, Can11 GCGAAGCACATCGAGTCA (SEQ ID NO:50); antisense primer, C an12 GGTTGAGGTGGTAGCTGAGG (SEQ ID NO:51); probe, H mg-P3 5'-Hex / TCTCTAC / zen / CCGTCTCACATGACG C / 3IABkFQ / -3' (SEQ ID NO: 52). The amplification product size was 73 bp.

[0296] The PPT selection marker gene was used to screen all transgenic plants. In one target gene amplification reaction that detected the region, the sense primer was Can17, AT ACAAGCACGGTGGATGG (SEQ ID NO:53); the antisense primer was Can18 TGGTCTAACAGGTCTAGGAGGA (SEQ ID NO:54); Pro The probe is PPT-P3 5'- / FAM / TGGCAAAGA / zen / GATTTCG AGCTTCCTGC / 3IABkFQ / -3' (SEQ ID NO: 55). The gene amplification product was 82 bp. Sometimes, a second target gene assay was performed to detect T-DNase. This second assay was performed in parallel to detect the partial insertion of A. Can23 CAAGCACCGTAGTAAGAGAGCA (SEQ ID NO: 56), The sense primer, Can24 CAGACAGCCTGAGGTTAGCA (sequence no. No.: 57); probe, D6des-P3 5'- / FAM / TCCCCACTT / ze n / CTTAGCGAAAGGAACGA / 3IABkFQ / -3' (SEQ ID NO: 58) The Δ6-desaturase gene region was detected using the The size was 89 bp. Reactions routinely used 2 μL of digested DNA preparation. Reaction composition: in a total volume of 25 μL, reference sense primer (10 pM), 1 μL; Antisense primer (10 pM), 1 μL; reference gene probe (10 pM), 0. 5 μL; target gene sense primer (10 pM), 1 μL; target gene antisense primer Primer (10 pM), 1 μL; target gene probe (10 pM), 0.5 μL; ddP CR reagent mix, 12.5 μL; water 5.5 μL.

[0297] Then, a QX100 droplet press was used to divide each sample into 20,000 nanoliter-sized droplets. All samples were processed and transferred to a 96-well PCR plate. This was done in an 8-well cartridge until 100% of the plate was plated. Using a heat sealer machine, heat seal with pierceable foil. The samples were then treated under the following reaction conditions: 95°C for 10 min, 2.5°C / then 94°C for 30 seconds with a ramp of 2.5°C / s for 39 cycles cycle; 61°C for 1 min with ramping at 2.5°C / sec; 98°C for 10 min, then After the DNA in the droplets was amplified, the plate was subjected to a two-color detection system. Each droplet was individually placed into a QX100 droplet reader for analysis (FAM or Hex The droplet digital PCR data was plotted on a fluorescence intensity graph for each sample. 1-D plot of droplets, or fluorescence (FAM) plotted against fluorescence (Hex) for each droplet. The software views each fluorophore in each sample either as a 2-D plot of the corresponding The number of positive and negative droplets was measured for each solution (FAM or Hex). The software determines the input, target DNA molecule concentration in units of copies / µL, and therefore positive The droplet fractions were fitted to a Poisson algorithm. Copy number variation was calculated using the formula: CNV= (A / B)*Nb (where A=target gene concentration, B=reference gene concentration, and Nb=4, The number of copies of the reference gene in the genome was used to calculate the genomic DNA fragment size.

[0298] Assessment of pollen viability Fluorescein diacetate (FDA) was dissolved in acetone at 2 mg / ml to prepare the original solution. Sucrose solution (0.5M) was added until saturation was reached, as indicated by the appearance of persistent white turbidity. FDA dilutions were prepared immediately prior to use by adding FDA stock solution dropwise to 2 ml.

[0299] Propidium iodide (PI) was dissolved in sterile distilled water at 1 mg / ml to obtain a stock solution. Just before use, 100 μl of the stock solution was added to 10 ml of sterile distilled water to prepare a working solution. To check the ratio of powder to non-viable pollen, PI and FDA stock solutions were mixed in a 2:3 ratio.

[0300] Transgenic and non-transgenic plants were grown under standard conditions in a greenhouse at 22±2°C with a 16-hour photoperiod per day. Wild-type rapeseed and mustard plants were grown. Mature flower buds ready to bloom the next day. The pollen of blooming flowers was stained with the FDA / PI mixture. and visualized using a Leica MZFLIII fluorescence microscope. GFP-2, 480 / A 510 nm long-pass emission filter with a 40 nm excitation filter (transmitting red and green light) Viable and non-viable pollen were detected using PI staining. They appeared red under the microscope, whereas viable pollen appeared bright green when stained with PI and FDA. .

[0301] Example 2. Transgenic plant in Camelina sativa seeds Stable expression of the nicked DHA pathway

[0302] The binary vector pJP3416-GA7 (see FIG. 2 and SEQ ID NO: 1) was Agrobacterium tumefaciens strain AGL1 and floral dilution for transformation Transformed Agrobacterium used to treat Camelina sativa flowering plants using the wrap method (Lu and Kang, 2008). Plant growth and maturation Then, the T1 seeds of the treated plants were harvested and sown in soil. The resulting plants were transformed with pJP3416 -GA7 is a transgenic line containing the bar selection marker gene in the T-DNA. To select for plants expressing this gene, the plants were spray-treated with the herbicide BASTA. The surviving herbicide-resistant T1 plants were self-pollinated and then grown to maturity. 2 seeds were harvested. Five transgenic plants were obtained, and all three of these were It contained T-DNA.

[0303] Lipids were extracted from a pool of approximately 20 seeds from each of the three plants containing the complete T-DNA. Two of the pooled samples contained very low, barely detectable levels of DHA. The third pool contained approximately 4.7% DHA. Lipids were extracted from 10 individual T2 seeds from each cultivar and the fatty acid composition was analyzed by GC. Individual seed fatty acid composition data for this transgenic line are also shown in Table 4. Total seed lipid profile The data collected from the files (Table 4) are shown in Table 5.

[0304] DHA was present in 6 of 10 individual seeds. Four other seeds contained no DHA. does not contain T-DNA, based on the hemizygous T-DNA insertion in the parent plant. The highest levels of DHA were found in the single seed extract. The lipids contained 9.0% DHA, while the total percentage of EPA, DPA and DHA was 1. The figure was 1.4%. [Table 4] TIFF2025063027000013.tif24788 [Table 5]

[0305] Homozygous seeds from this line were obtained at the T4 generation. In event FD5-46-18-110, which had an average of 7.3% DHA, the DHA was produced in the subsequent generation (T5). In particular, the stability of DHA was examined further. The prevalence was not stabilized until the T4 generation due to the presence of multiple transgenic loci. Despite this, the maximum DHA levels observed were found to be stable through the fifth generation. The T5 seed batches were also compared to the parent Camelina sativa with no obvious differences observed in germination efficiency or speed. The seeds were then germinated on in vitro MS medium. Generations (T6, T7, etc.) did not show a decrease in seed DHA levels. The nicked plants were fully fertile and the pollen had approximately 100% viability, just like wild-type plants. Analysis of the oil content of seeds containing different levels of DHA showed that Arabidopsis In contrast to the correlation seen in , no correlation was found between DHA levels and oil content. Ta.

[0306] In several further transgenic lines, DH of a single seed from an independent event was observed. The A content was over 12%. The transgenic:null ratio of these lines was approximately The ratio was found to be between 3:1 and 15:1. Representative lipids of the top DHA samples from each construct Analysis of the fatty acid profile did not detect any other new ω6 PUFAs, accounting for only 1.2–1.4%. In contrast, the new ω3 PUFA (SDA), ω3 LC-PUFA ( ETA, EPA, DPA, DHA) were 18% with a DHA level of 9.6% of the total fatty acid content. EPA was found to accumulate in the sucrose-derived fatty acids up to 0.5% of the total fatty acids. The Δ5-elongation efficiency was 93%, and the Δ6-elongation efficiency was 0.8%. The gating efficiency was 60%. Detected.

[0307] The observed separation ratio (approximately 3:1 to approximately 15:1) was due to one or, at most, two translocations. The transgenic locus produces DHA levels similar to those found in Camelina sativa fish oil. This indicates that the transgenic trait is essential for the stable expression of the introduced gene. This has important implications not only for sex but also for ease of reproduction.

[0308] The homozygous seeds were then spread across several greenhouses to generate a total of over 600 individual plants. Various methods were used, including Soxhlet, acetone and hexane extraction. Oil was extracted from the seeds.

[0309] To determine the positional distribution of ω3 LC-PUFAs in TAGs, transgenic camelina For Sativa seed oil, 13 C NMR site-specific analysis was performed. Approximately equal Events with EPA and DHA were selected to maximize the response to these fatty acids. , the ratio of sn-1,3 to sn-2 is 0.75:0.25 for EPA, and D For HA it is 0.86:0.14, whereas an unbiased distribution would be 0.66:0.33. That is, 75% of EPA and 86% of DHA were located at the sn-1,3 positions of TAG. This indicates that although EPA has a lower priority than DHA, both fatty acids are essential for the development of turtles. We showed that DHA is preferentially located at the sn-1,3 positions of the TAG of L. sativa. The finding that the 1st and 3rd positions were preferentially observed is in agreement with previous results reported in Arabidopsis seeds. The results were similar to those of (Petrie et al., 2012).

[0310] A few independent transgenic lines were obtained in the above transformation experiments, and further Linas sativa transformation was performed using the GA7-modB construct (Example 3). Many transformants were obtained and homozygous lines producing more than 20.1% DHA were identified.

[0311] Example 3. Modification pathway of T-DNA encoding DHA in plant seeds Improved DHA production levels in rapeseed exceeding the levels described in WO2013 / 185184 In order to improve the GA7-modB, pJP3416-GA7-modC, pJP3416-GA7-mo dD, pJP3416-GA7-modE and pJP3416-GA7-modF, The constructs were constructed as described in O2013 / 185184 and tested in transgenic plants. These binary vectors are variants of the pJP3416-GA7 construct, specifically, Δ Improvement of 6-desaturase and Δ6-elongase functions enhances DHA synthesis in plant seeds SDA has a relatively low activity compared to Δ5-elongase. In some seeds transformed with the GA7 construct, the Δ6-elongase efficiency was Among other modifications, two elongase gene loci were inserted into the T-DNA, It was observed that the

[0312] The two elongase coding sequences in pJP3416-GA7 were inserted into the Switching at these positions to replace the Pyramimonas cordata Δ5-elongase cassette To clone a new Pyramimonas cordata Δ6-enantiomer between the Sbf1 sites of pJP3416-GA7, pJP3416-GA7-molongase cassette was first cloned This construct was transformed into a microarray with the conlinin Cnl2 promoter (pLuCnl2). The FP1 promoter driving the Rhomonas pusilla Δ6-desaturase was replaced with p It was further modified to obtain JP3416-GA7-modB. This modification was done in an attempt to increase enzyme expression and, therefore, enzyme efficiency. The truncated napin promoter conferred higher expression of transgenes in Brassica napus There should be a possibility of obtaining

[0313] Eight transgenic pJP3416-GA7-modB Arabidopsis events and 15 transgenic pJP3416-GA7-modG Arabidopsis thaliana A total of 3.4% to 7% of pooled pJP3416-GA7-modB seeds were We observed between 0.2% DHA and 0.5% DHA in the pooled T2 pJP3416-GA7-modG strain. Between 0.6 and 4.1% DHA was observed in offspring. Some of the modB events were plated on selective media and the surviving seedlings were grown to the next generation. The offspring are analyzed for DHA content. Pooled T1 seeds are segregated for the transgene. The population represented a homozygous population of offspring plants that contained null segregants. The researchers expected that the results would increase DHA levels to 30% of the total fatty acid content in the seed oil. Other modified constructs have been transformed into Arabidopsis thaliana. Only a few Although we obtained several transformants, we did not obtain higher levels of DHA than the modB construct. There was no.

[0314] The pJP3416-GA7-modB construct was also used in cultivars Oscar and NX002, NX00 3. A series of breeding lines named NX005, NX050, NX052 and NX054 Transformed Brassica napus plants were used to generate 77 independent Oskar transformations. Transgenic plants (T0) and their seed oils due to the effect of the mutation in the FAD2 gene Breeding lines including 189 for NX005, a line with high oleic acid content in A total of 1558 transformed plants were obtained, including 1480 independent plants for the purpose of the present study. The T-DNA had low levels of LA and ALA as determined by digital PCR. Transgenic plants (Example 1) showing more than four copies of the Approximately 25% were culled by this criterion. Approximately 53% of the T0 transgenic plants were They have one or two copies of the T-DNA as determined by digital PCR. % had about 3 copies, and 24% had 4 or more copies. After pollination, approximately 450 transgenic lines were harvested and allowed to flower to avoid outcrossing. The T1 seeds were then bagged onto the medium-sized plants. Approximately 1-2% of the plant lines were either male or female sterile. As a result, they did not produce viable seeds and the T0 plants were culled.

[0315] Seed pools (20 T1 seeds in each poll) were analyzed for DHA levels in the pooled seed oil. The strains with the highest levels were selected. Lines with a DHA content of at least 2% of the total fatty acid content in the offspring were selected. % of the transgenic lines were selected in this manner; the other 85% were discarded. Some of the lines are CT132-5 (variety Oscar), CT133-15, -24, -63, They were named -77, -103, -129 and -130 (NX005). Selection of NX050 The lines are CT136-4, -8, -12, -17, -19, -25, -27, -49 and -51. 20 seeds of selected lines including CT132.5 and 11 seeds of CT133.15 The seeds were soaked and after 2 days, oil was extracted from half the cotyledons from each individual seed. The other half of the cotyledons were left and cultured on medium to maintain the unique progeny line. The acid composition was determined; the data are shown in Table 6 for CT132.5. The 20 seed sacs analyzed The DHA levels in 10 of these ranged from 7 to 20% of the total fatty acid content as determined by GC analysis. The other seeds contained less than 7% DHA and were It is possible that these plants contained partial (incomplete) copies of the T-DNA of the transgenic plants. Lines appeared to contain multiple transgene insertions that were not genetically linked. The seeds of the transgenic line CT133.15 contained DHA levels ranging from 0 to 5%. Seeds without DHA appeared to be null segregants. These data Therefore, the modB construct performs well for DHA production in canola seeds. Confirmed.

[0316] From the selected transgenic lines, 20 or 4 were obtained from each of several T1 plants after self-pollination. 0 individual seeds (T2 seeds) were individually tested for fatty acid composition. Seeds containing DHA at levels similar to those found in CT136-27- and CT136-28-DHA-containing seeds were identified (Table 7). 18-2 and CT136-27-18-19 were 21.2% and 22.7%, respectively. The total omega-3 fatty acid content in these seeds was 100% of the total fatty acid content. The ω6 content was approximately 60% in the control plant and less than 10% in the control plant. Or a set of 40 T2 seeds were tested for fatty acid composition. DH up to 34.3% Seeds containing A were identified, for example, in seed CT136-27-47-25 (Table 9). The fatty acid composition of the seed oil obtained from 136-27-47-25 is shown in Table 9. The composition is 34.3% DHA along with approximately 1.5% DPA, 0.6% EPA and 0.5% ETA. The SDA level was about 7.5%, ALA about 21.9%, and LA about 6. The new ω6 PUFA showed 1.1% GLA, but neither ω6-C20 nor -C22 No LC-PUFA was detected. Total saturated fatty acids: 9.6%; monounsaturated fatty acids, 12 0.5%; total PUFA, 75.2%; total ω6-PUFA (including LA), 7.2%; total ω3 -PUFA, 66.9%; total ω6:ω3 fatty acid ratio, 9.3:1; neo ω6: neo ω3 fatty acids The efficiency of each enzymatic step from oleic acid to DHA was: Δ12-desamylase, 37:1. Δ15 / ω3-desaturase, 90%; Δ15 / ω3-desaturase, 89%; Δ6-desaturase, 67%; Δ6-elongase, 83%; Δ5-desaturase, 99%; Δ5-elongase Δ4-desaturase, 98%; Δ4-desaturase, 96%. The overall efficiency of the conversion of oleic acid to DHA was The ratio of fatty acids in the seed oils was about 50%. Therefore, the range of fatty acids in the seed oils was 20.1–35%. Seeds that produce DHA in the 100% to 200% range contain between 20.1% and 30% DHA or 100% DHA of the total fatty acid content. The study included seeds containing between 30% and 35% DHA, and it was clear that these were the ones to be selected. Ta.

[0317] The oil content in some seeds ranged from about 44% in wild-type seeds to about 10% in DHA-producing seeds. The levels were reduced to about 31-39% in some cases, but were similar to wild-type levels in other DHA-producing seeds. I did.

[0318] Crossing various transgenic plant lines that produce DHA at levels of at least 10% in T2 seeds to produce F2 progeny homozygous for multiple T-DNA insertions. The F1 progeny were then self-pollinated. Seed oil from homozygous seeds was analyzed, and the contents of the seed oil were Up to 30% or 35% of the total fatty acid content is DHA.

[0319] In oils obtained from CT136-27-18-2 and CT136-27-18-19 The positional distribution of DHA on the glycerol backbone of the TAG molecule is as follows: 13 CN DHA preferentially binds at the sn-1,3 position. More than 70%, in fact more than 90%, of the DHA was at the sn-1,3 position. Ta.

[0320] In several further transgenic lines, DH of a single seed from an independent event was observed. The transgenic:null ratio of these lines was 1. The ratio of the two transgenic loci was approximately 3:1. The ratio of DHA to DHA in each construct was found to be 15:1, corresponding to the highest levels of DHA in each construct. The analysis of the representative fatty acid profile of the samples from these researchers showed that they did not contain any new ω6 PUFAs and had a fatty acid content of 1.2 to 1. Only 0.4% of GLA was detected. In contrast, the new ω-3 PUFA (SDA) and ω-3 LC- PUFA (ETA, EPA, DPA, DHA) was 18. 5%, compared with 25.8% for the modF construct and 21 for the modG construct. The DHA levels in the oils of these seeds were 9.6% and 9.9%, respectively. Δ6-desaturation was observed in the modF- and modG-forms at 12.4% and 11.5%, respectively. The results showed that the GA7-transformed seeds were significantly lower than the GA7-transformed seeds (32% vs. 47% and 43%). , which was found to result in a decrease in ALA in modF and modG compared to GA7. Another notable difference was the accumulation of EPA in modF seeds (compared to the other two transgenic plants). in nicked seeds (3.3% vs. 0.8%), which is higher than in GA7 and modG seeds (93% and 9 The lower Δ5-elongation observed in modF (80%) seeds compared to modF (4%). The slightly more active Δ6-desaturation actually increased the amount of SDA. However, there was a slight increase in Δ6-elongation in these seeds (66% vs. 60% and 6 DHA was detected in the polar seed lipid fraction of the GA7 line.

[0321] 7. Brassica napus breeding line NX54 transformed with T-DNA of modB construct The fatty acid composition of lipids in the T1 seeds of 0 independent transgenic plants was analyzed. One of the transgenic plants contains DPA but no DHA in its seed oil. It was observed that the T1 seeds of this line (CT-137-2) were produced by the T1 promoter. The inventors have demonstrated that the corn sprouts produced approximately 4% DPA with no detectable DHA in the seeds. This indicates that spontaneous mutations have led to the development of Δ4-desaturases in that particular inserted T-DNA. We verified whether the inactivation of the enzyme gene was the cause by PCR analysis and DNA sequence analysis. The presence of a deletion was demonstrated in the GA7-modB T-DNA nucleotides 12988-15. A deletion of 317 was revealed (SEQ ID NO: 2). The deleted nucleotide is a Δ4-desaturase. The Linus Cnl2 promoter portion driving expression of the enzyme coding region and Δ 4-desaturase coding region itself, thereby forming a T-DNA containing the deletion. This explains why seeds transformed with did not produce DHA.

[0322] Approximately 50 T1 seeds from this transgenic line were germinated and one seed from each was The ripe cotyledons were analyzed for fatty acid composition in the remaining oil. Selected seedlings showing DPA were grown to maturity and T2 seeds were harvested. Pooled seed fat The acid composition is shown in Table 8, and more than 7% DPA was observed in these lines. It was made from B. napus DPA line CT-137-2 and is a fatty acid protease. A maximum of 13% DPA was detected in the mature seed samples collected. It was observed that

[0323] Oil from seeds containing approximately 10% DPA was treated with mild alkali to dehydrate fatty acids. I understood.

[0324] Another transgenic line designated B0003-514 showed approximately The results showed that the DPA content was 10-16%. The DPA content was 15.8%, the DHA content was 0.2-0.9%, and Seeds containing 0.1-2.5% EPA were selected. The T2 seed group was characterized by high DPA:medium DPA. The PA:DPA ratio was 1:2:1. These results suggest the existence of a single genetic locus for DPA production in the fenic lineage.

[0325] Oil was extracted from LC-PUFA-producing seed samples using a screw press. Seed meal was produced from the above.

[0326] Design of the structure While the focus of this study was on demonstrating the production of DHA and DPA in oilseed crop species, The results presented here were also of interest from a construct design perspective. First, the Δ6- and The switch in the Δ5-elongase coding region position allows for lower Δ5-elongation. This resulted in the intended profile change, with more EPA accumulated for the Δ6- A concomitant increase in elongation was observed, which did not result in lower SDA levels. This was due to the fact that the truncated napin promoter was driven by the more active amplexin 2 promoter. Substitution of the motor (FP1) as well as extracellular matrix in Micromonas pusilla Δ6-desaturase Δ6-desaturase expression cassette was added to modF-transformed seeds. The somewhat smaller increase in Δ6-desaturation observed with the modG construct was due to , resulting from the utilization of a highly expressed Δ5-elongase cassette in GA7. A switch in the position of the Δ5-elongase coding region results in greater Δ6-desaturation. Replacement of the FP1 promoter with the Cnl2 promoter resulted in did not decrease Δ5-elongase activity.

[0327] These data indicate that the modB, modF and modG constructs are compatible with Arabidopsis spp. and Like rapeseed, camelina has shown good results for DHA production in seeds.

[0328] In general, the inventors have determined that the efficiency of the rate-limiting enzyme activities in the DHA pathway is reduced in the single-copy T-DNA form. may be greater in multicopy T-DNA transformants compared to transgenic plants, or It has been reported that the expression of multiple genes encoding enzymes that can be restricted within the T-DNA can be increased by inserting multiple genes into the T-DNA. Evidence for the possible importance of multicopy transformants was obtained by transfecting GA7 constructs. The highest yielding DHA events were observed in the transformed Arabidopsis seeds, The multiple genes may be the same or, preferably, are different variants encoding the same polypeptide or have overlapping expression patterns. For example, even if the same protein is produced, Thus, increased expression should be achievable by expression of multiple Δ6-desaturase coding regions. In pJP3416-GA7-modF and pJP3416-GA7-modC, For example, there are two variants of the Micromonas pusilla Δ6-desaturase that act in different ways. The coding sequences were expressed by different codon usage and therefore different nucleotide sequence, reducing possible silencing or co-suppression effects but resulted in the production of the same protein. [Table 6] [Table 7] [Table 8] [Table 9]

[0329] Example 4. Analysis of TAGs in transgenic Arabidopsis seeds producing DHA The positional distribution of DHA on TAG in transgenic Arabidopsis seeds was measured by NMR. Total lipids were analyzed by hexane before transferring the ground seeds to a glass tube containing 10 mL of hexane. Extraction was performed from approximately 200 mg of seeds by first crushing the seeds under a microscope. The mixture was heated to about 55°C in a bath, then vortexed and centrifuged. The extracts were combined and rotary evaporated. The lipid extract was concentrated using a porator, and TAG in the lipid extract was extracted with 20 mL of 7% diethyl ether in hexane. The lipids were separated from the polar lipids by passage through a short silica column using a cyclohexane diluent. The acyl group position distribution on the purified TAG was quantitatively determined as previously described (Petrie et al., 2013). 010a and b).

[0330] Analysis showed that the majority of DHA in the total seed oil was located at the sn-1 / 3 position of TAG; This indicates that almost no ribonuclease was observed at the sn-2 position. :4 Δ5、8、11、14 ) 50% of transgenic canola oil sn-2 While the ARA-producing seeds were ranked in the top 10, only 33% were found to be within the range expected for random distribution. This was in contrast to TAG from (Petrie et al., 2012).

[0331] The total lipids of transgenic Arabidopsis seeds were analyzed using the major DHA-containing triacylglycerol The samples were also analyzed by triple quadrupole LC-MS to measure the cerol (TAG) species. The most abundant DHA-containing TAG species was DHA-18:3-18:3 (TAG58: 12; nomenclature that does not express positional distribution), and the second most abundant is DHA-18: 3-18:2 (TAg58:11). Tri-DHA TAG (TAG 66:18) were observed in total seed oils at low, but detectable, levels. The main DHA-containing TAG species are DHA-34:3 (TAG56:9) and DHA-36:3. (TAG58:9), DHA-36:4(TAG58:10), DHA-36:7(TA The two main D The HA-containing TAG species were further confirmed by Q-TOF MS / MS.

[0332] Example 5. Assay of sterol content and composition of oils Phytosterols from 12 plant oils purchased from commercial sources in Australia. with the O-trimethylsilyl ether (OTMSi-ether) derivative described in Example 1. The sterols were characterized by retention data, mass spectrometry, and GC-MS. The compounds were identified by torr analysis and comparison with literature and experimental standard mass spectral data. The stearate was quantified by using 5β(H)-cholan-24-ol as an internal standard. The basic phytosterol structure and chemical structure of the rol are shown in FIG.

[0333] The plant oils analyzed were: sesame (Sesamum indicum), olive (Oli ea europaea), sunflower (Helianthus annus), castor bean (R icinus communis, Brassica napus ), Safflower (Carthamus tinctorius), Peanut (Arach is hypogaea), flax (Linum usitatissimum) and daikon The relative abundances across all oil samples were In the reduction of phytosterols, the main phytosterols were: β-sitosterol (28% of the total sterol content); ~55%), Δ5-avenasterol (isofucosterol) (3-24%), Δ5-stigmasterol (2-33%), Δ5-stigmasterol (0.7-18%), Δ7- Stigmasterol (1-18%) and Δ7-avenasterol (0.1-5%) Several other minor sterols were identified, these being: cholesterol, brassica staphylococcus aureus, and cerebrospinal fluid. The four C29 C30:2 and two C30:2 sterols were also detected, but the identification of these minor components has yet to be completed. Further investigation is needed to determine whether the sterols are related to the glycerol metabolism. It was present in some of the oils, but due to its very low abundance, the mass spectra The intensity was not sufficient to identify the structure. [Table 10]

[0334] The sterol content, expressed as mg / g of oil in the reduced amounts, was: canola oil (6. 8mg / g), sesame oil (5.8mg / g), flaxseed oil (4.8~5.2mg / g) , sunflower oil (3.7-4.1mg / g), peanut oil (3.2mg / g), Safflower oil (3.0mg / g), soybean oil (3.0mg / g), olive oil (2.4mg / g), and castor oil (1.9mg / g). The total sterol content is shown in Table 11.

[0335] In all seed oil samples, the major phytosterol was generally β-sitosterol. (range 30-57% of the total sterol content). Other tumor sterols: Campes Δ5-stigmasterol (2-17%), Δ5-avenasterol (0.7-18%), Δ5-avenasterol The oil contains sterols (4-23%) and Δ7-stigmasterol (1-18%). Different oils have a wide range of profiles, some with entirely different properties. In the case of canola oil, campestrol was The other samples generally had the highest proportion of peanut oil (33.6%). For example, safflower oil had a relatively high percentage of Δ7 -stigmasterol (18%), whereas this sterol is present in sunflower oil at 9% They were characteristic for each species and therefore The sterol profile was then compared to that of a specific vegetable or plant. t) Assist in the identification of oils and check their authenticity or adulteration with other oils. Therefore, it can be used.

[0336] In each case, two samples of castor oil were prepared by cold pressing of the seeds and were not refined. The comparison was made between safflower and safflower, while the others were not cold pressed and refined. Although it was observed that the two sources of oil had similar sterol composition and total sterol content, rate and that processing and refining have little effect on these two parameters. The sterol content in the samples varied three-fold, from 1.9 mg / g to 6.8 mg / g. g range. Canola oil had the highest sterol content and castor oil had the lowest. The content was.

[0337] Example 6. Increased accumulation of DHA and DPA at the sn-2 position of TAG The pr...

Claims

1. The fatty acids include fatty acids in esterified form, said fatty acids being oleic acid, palmitic acid, lysine, glycerin, glycerol ... omega-6 fatty acids including oleic acid (LA), omega-3 fatty acids including alpha-linolenic acid (ALA), and dodecyl ester fatty acids including oleic acid (DOA). Contains cosapentaenoic acid (DPA), and optionally stearidonic acid (SDA), eicosapentaenoic acid (ESA), Contains one or more of pentaenoic acid (EPA) and eicosatetraenoic acid (ETA) and wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%. Extracted plant lipids or microbial lipids.

2. Features: i) the level of palmitic acid in the total fatty acid content of the extracted lipids is between about 2% and 15% %, or between about 3% and 10%; ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids , about 0.1%; iii) the level of oleic acid in the total fatty acid content of the extracted lipid is from about 1% to about 3% Between 0%, between about 3% and about 30%, between about 6% and about 30%, between about 1% and about 20% , between about 30% and about 60%, between about 45% and about 60%, about 30%, or between about 15% and about 3 Between 0% and iv) The level of linoleic acid (LA) in the total fatty acid content of the extracted lipids is about 4% to about 5%. between about 4% and about 20%, between about 4% and about 17%, or between about 5% and about 35%, ... Between about 10% v) The level of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is about 4 between about 7% and about 40%, between about 10% and about 35%, between about 20% and about between about 35%, between about 4% and about 16%, or between about 2% and about 16%; vi) the level of gamma-linolenic acid (GLA) in the total fatty acid content of the extracted lipids; Less than 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, 0.05% to 7% between 0.05% and 4%, between 0.05% and about 3%, or between 0.05% and about 2%. %. vii) The level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipids is Less than about 10%, less than about 8%, less than about 7%, less than about 6%, less than about 4%, less than about 3%, less than about 0. between about 0.05% and about 7%, between about 0.05% and about 6%, between about 0.05% and about 4%, Between 0.05% and about 3%, between about 0.05% and about 10%, or between about 0.05% and about Between 2% viii) The level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipid The bell is less than about 6%, less than about 5%, less than about 4%, less than about 1%, less than about 0.5%, less than 0.05%. % to about 6%, 0.05% to about 5%, 0.05% to about 4%, 0.05% between about 3%, or between about 0.05% and about 2%; ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipids is less than 4%, less than about 2%, less than about 1%, between 0.05% and 4%, and between 0.05% and 3%. or between 0.05% and about 2%, or between 0.05% and about 1%; x) The level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted lipid , between 4% and 15%, less than 4%, less than about 3%, less than about 2%, between 0.05% and 10% , between 0.05% and 5%, between 0.05% and about 3%, or between 0.05% and about 2% Between xi) if the level of DHA in the total fatty acid content of the extracted lipid is less than 2% or or between 0.05% and about 2%; xii) the lipid contains ω6-docosapentaenoic acid (22:5) in its fatty acid content Δ４， ７，１０，１３，１６ ) xiii) the lipid has less than 0.1% ω6-docosapentaenoic acid in its fatty acid content (22:5 Δ４，７，１０，１３，１６ ) xiv) the lipid has less than 0.1% of one or more or all SDA in its fatty acid content. , EPA and ETA; xv) the total saturated fatty acid level in the total fatty acid content of the extracted lipid is from about 4% to about 25% %, between about 4% and about 20%, between about 6% and about 20%, or between about 6% and about 12% Between xvi) the total monounsaturated fatty acid level in the total fatty acid content of the extracted lipid is about 4% to between about 4% and about 40%, between about 4% and about 35%, between about 8% and about 25%, between 8% and about 22% between about 15% and about 40%, or between about 15% and about 35%; xvii) the total polyunsaturated fatty acid level in the total fatty acid content of the extracted lipid is about 20 % to about 75%, between 30% and 75%, between about 50% and about 75%, about 60%, about 65%, about 70%, about 75%, or between about 60% and about 75%; xviii) the total ω6 fatty acid level in the total fatty acid content of the extracted lipid is between about 35% and between about 20% and about 50%, between about 20% and about 35%, between about 6% and about 20%, less than 20%, less than 16%, less than about 10%, between about 1% and about 16%, between about 2% and about 10%, or between about 4% and about 10%; xix) the level of new ω6 fatty acids in the total fatty acid content of the extracted lipid is less than about 10%; Less than about 8%, less than about 6%, less than 4%, between about 1% and about 20%, between about 1% and about 10% , between 0.5% and about 8%, or between 0.5% and 4%; xx) the total omega-3 fatty acid level in the total fatty acid content of the extracted lipid is between 36% and about 65% %, between 36% and about 70%, between 40% and about 60%, between about 30% and about 60% , between about 35% and about 60%, between 40% and about 65%, between about 30% and about 65%, Between 35% and about 65%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60% %, about 65% or about 70%; xxi) The level of new omega-3 fatty acids in the total fatty acid content of the extracted lipid is from 21% to about 4 Between 5%, between 21% and about 35%, between about 23% and about 35%, between about 25% and about 35% between about 27% and about 35%, between about 23% and about 25%, about 27%, about 30%, about 35%, about 40% or about 45%; xxii) the ratio of total ω6 fatty acids to total ω3 fatty acids in the total fatty acid content of the extracted lipid is Between about 1.0 and about 3.0, between about 0.1 and about 1, between about 0.1 and about 0.5, between about 0. Less than about 0.50, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, less than about 1. less than 0, less than about 0.1, from about 0.10 to about 0.4, or about 0.2; xxiii) The ratio of new ω6 fatty acids to new ω3 fatty acids in the total fatty acid content of the extracted lipid is , between about 1.0 and about 3.0, between about 0.02 and about 0.1, between about 0.1 and about 1, Between 0.1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, about 0.2 Less than 0, less than about 0.15, about 0.02, about 0.05, about 0.1, about 0.2 or about 1.0 That is, xxiv) the fatty acid composition of the lipid is at least about 60%, at least about 70%, about 80%, between about 60% and about 98%, between about 70% and about 95%, or about 75% Based on the efficiency of conversion of oleic acid to LA by Δ12-desaturase between about 90% and about 90% To build xxv) the fatty acid composition of the lipid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 30% and about 70%, Between 35% and about 60%, or between about 50% and about 70% Δ6-desaturase Based on the conversion efficiency of ALA to SDA by xxvi) the fatty acid composition of the lipid is at least about 60%, at least about 70%, about 75%, between about 60% and about 95%, between about 70% and about 88%, or about 75% Based on the efficiency of conversion of SDA to ETA acid by Δ6-elongase of between about 85% and about thing, xxvii) the fatty acid composition of the lipid is at least about 60%, at least about 70%, At least about 75%, between about 60% and about 99%, between about 70% and about 99%, or at least about 75%. Based on the efficiency of conversion of ETA to EPA by Δ5-desaturase between about 98% and about 99% To xxviii) the fatty acid composition of the lipid is at least about 80%, at least about 85%, at least about 90%, between about 50% and about 99%, between about 85% and about 99%, between about 50% and Between about 85% and about 95%, or between about 85% and about 95%, of EPA produced by Δ5-elongase Based on the conversion efficiency of 1,2-dichlorophenyl ether (DPAA) to DPA, xxix) the fatty acid composition of the lipid is at least about 10%, at least about 15%, at least about 20%, at least about 25%, about 20%, about 25%, about 30%, about 10% to about Between about 50%, between about 10% and about 30%, between about 10% and about 25%, or between about 20% and Based on an efficiency of conversion of oleic acid to DPA of about 30%; xxx) the fatty acid composition of the lipid is at least about 15%, at least about 20%, At least about 22%, at least about 25%, at least about 30%, at least about 40%, at least about 25% %, about 30%, about 35%, about 40%, about 45%, about 50%, between about 15% and about 50%, Conversion of LA to DPA between about 20% and about 40%, or between about 20% and about 30% Based on efficiency, xxxi) the fatty acid composition of the lipid is at least about 17%, at least about 22%, at least about 24%, at least about 30%, about 30%, about 35%, about 40%, about 45%, about 5 0%, about 55%, about 60%, between about 22% and about 70%, between about 17% and about 55%, about Conversion of ALA to DPA between 22% and about 40%, or between about 24% and about 40% Based on efficiency, xxxii) The total fatty acids in the extracted lipids are less than 1.5% C20:1, less than 1% C2 having a C20:1 of 0:1 or about 1%; xxxiii) the triacylglycerol (TAG) content of the lipid is at least about 7 0%, at least about 80%, at least about 90%, at least about 95%, about 70% to about 99%, or between about 90% and about 99%, xxxiv) the lipid comprises diacylglycerol (DAG), the DAG preferably containing a DPA; xxxv) the lipid is less than about 10%, less than about 5%, less than about 1%, or less than about 0.001% 5% to about 5% free (non-esterified) fatty acids and / or phospholipids, or does not include it in xxxvi) at least 70% of the DPA esterified in the form of TAG, at least 72% or at least 80% are at the sn-1 or sn-3 positions of the TAG 、 xxxvii) The most abundant DPA-containing TAG species in said lipids is DPA / 18:3 / 18:3 (TAG56:12), xxxviii) the lipid comprises triDPA TAG (TAG66:18); and xxxix) the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8% , about 9%, about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24%, About 26%, about 28%, about 31%, between about 7% and about 31%, between about 7% and about 28%, about Between about 10% and about 35%, between about 10% and about 30%, between about 10% and about 25%, about Between 0% and about 22%, Between about 14% and about 35%, Between about 16% and about 35%, Between about 16 % to about 30%, between about 16% to about 25%, or between about 16% to about 22%. and optionally, the DHA level is less than 0.5% of the total fatty acid content of the extracted lipid. and The lipid of claim 1, having one or more of the following:

3. The lipid is an oil, preferably an oil from an oilseed, more preferably The lipid is Brassica napus oil or mustard oil. Brassica sp., such as Brassica juncea oil .) oil, cotton (Gossypium hirsutum) oil, flax (Linum usitatissimum oil, Helianthus sp. .) oil, safflower (Carthamus tinctorius) oil, soybean ( Glycine max) oil, corn (Zea mays) oil, Guinea Elaesis guineenis oil, Nicotiana benthamiana oil otiana benthamiana oil, lupinus angustifolius oil, Camelina sativa va) Oil, Crambe abyssinica Oil, Giant Miscanthus (Miscanthus x giganteus) oil, or Miscanthus sinensis oil, A lipid according to any one of claims 1 or 2.

4. i) obtaining a plant part or a microbial cell containing lipids, said lipids being esterified The fatty acids are in a form selected from the group consisting of oleic acid, palmitic acid, linoleic acid (LA), ) containing omega-6 fatty acids, α-linolenic acid (ALA) containing omega-3 fatty acids, stearidonic acid (S DA), docosapentaenoic acid (DPA), and optionally one or more eicosapentaenoic enoic acid (EPA) and eicosatetraenoic acid (ETA), The level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%. Process, and ii) extracting lipids from said plant parts or microbial cells. wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%. A method for producing certain extracted plant or microbial lipids.

5. 4. The extracted lipids have one or more of the characteristics defined in claim 2 or claim 3. The method according to claim 4

6. The plant part is a seed, preferably a seed of Brassica napus ) or Brassica juncea ca sp.), cotton (Gossypium hirsutum), flax (Linum usitatissimum), Helianthus sp., Nibana (Carthamus tinctorius), soybean (Glycine ma x), corn (Zea mays), and oil palm (Elaesis gui neenis), Nicotiana benthamiana , Lupinus angustifolius, Camelina sativa Camelina sativa, or Crambe abyssinica byssinica, preferably Brassica napus ), mustard (B. juncea) or camelina sativa (C. sativa) 6. The method of claim 4 or 5, wherein the oilseed is an oilseed such as a seed.

7. The plant part or microbial cell is capable of producing the following set of enzymes: i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene longase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ Δ5-elongase and Δ6-elongase, iv) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ6-desaturases, Δ5-desaturases, Δ6-elongases and Δ5- Elongase, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ 5-elongase, ix) ω3-desaturase or Δ15-desaturase, Δ6-desaturase; Δ5-desaturase, Δ6-elongase and Δ5-elongase, or x) ω3-desaturase or Δ15-desaturase, Δ8-desaturase, Δ 5-Desaturase, Δ9-elongase and Δ5-elongase Each polynucleotide comprises an exogenous polynucleotide encoding one of the following: one or more polynucleotides capable of inducing expression of said polynucleotide in a cell or a microbial cell The method according to any one of claims 4 to 6, which is operably linked to a promoter.

8. The plant part or microbial cell has the following characteristics: i) the Δ12-desaturase is at least about 60%, at least about 70%, At least about 80%, between about 60% and about 95%, between about 70% and about 90%, or about 75%. % to about 85% efficiency in one or more cells of said plant part or microbial cell. Converting leic acid to linoleic acid ii) the ω3-desaturase is at least about 65%, at least about 75%, At least about 85%, between about 65% and about 95%, between about 75% and about 91%, or about 80%. % to about 91% efficiency in one or more cells of said plant part or microbial cell, Converting omega-6 fatty acids to omega-3 fatty acids iii) the Δ6-desaturase is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, Between 30% and about 70%, between about 35% and about 60%, or between about 50% and about 70% and converting ALA to SDA in one or more cells of said plant part or microbial cell with an efficiency of To do, iv) the Δ6-desaturase is less than about 5%, less than about 2.5%, less than about 1%, less than about 0 Between about 1% and about 5%, between about 0.5% and about 2.5%, or between about 0.5% and about 1% and converting linoleic acid to γ-linoleic acid in one or more cells of said plant part or microbial cell with an efficiency of 0.1-1.0%. Converting it to norenic acid v) the Δ6-elongase is at least about 60%, at least about 70%, about 75%, between about 60% and about 95%, between about 70% and about 80%, or between about 75% and about to about 80% efficiency in one or more of the plant parts or microbial cells. to ETAs, vi) the Δ5-desaturase is at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, between about 60% and about 95% , or between about 70% and about 95%, or between about 75% and about 95% efficiency, or converting ETA to EPA within one or more cells of the microbial cells; vii) the Δ5-elongase is at least about 80%, at least about 85%, at least about 90%, between about 50% and about 90%, or between about 85% and about 95% efficiency. converting EPA to DPA in one or more of said plant parts or microbial cells. 、 viii) converting oleic acid into DPA in one or more of the plant parts or microbial cells. The efficiency of conversion to At least about 25%, about 20%, about 25%, about 30%, between about 10% and about 50%, about 10% % to about 30%, or about 10% to about 25%, or about 20% to about 30% Between ix) converting LA to DPA in one or more cells of said plant part or microbial cell Efficiency is at least about 15%, at least about 20%, at least about 22%, at least about 25%, at least about 30%, about 25%, about 30%, about 35%, about 15% to about 50% between about 20% and about 40%, or between about 20% and about 30%; x) converting ALA to DPA in one or more cells of said plant part or microbial cell; Efficiency is at least about 17%, at least about 22%, at least about 24%, at least about 30%, about 30%, about 35%, about 40%, between about 17% and about 55%, between about 22% and about 3 between about 5%, or between about 24% and about 35%, xi) one or more cells of said plant part or microbial cell are at least about 25%, at least about 30%, about 25% to about 40%, or between about 27.5% and about 37.5% high in omega-3 fatty acids; xii) the Δ6-desaturase is capable of isolating α-linolenic acid (ALA) relative to linoleic acid (LA); preferentially desaturating (ALA); xiii) the Δ6-elongase also has Δ9-elongase activity; xiv) the Δ12-desaturase also has Δ15-desaturase activity; xv) the Δ6-desaturase also has Δ8-desaturase activity; xvi) the Δ8-desaturase also has Δ6-desaturase activity, or having no 6-desaturase activity; xvii) the Δ15-desaturase has ω3-desaturase activity on GLA Also having xviii) the ω3-desaturase has a Δ15-desaturase activity towards LA Also having xix) the ω3-desaturase desaturates both LA and / or GLA thing, xx) the ω3-desaturase preferentially desaturates GLA relative to LA; and, xxi) one or more or all of said desaturases convert the corresponding acyl-PC substrates to , having high activity against acyl-CoA substrates; xxii) the Δ6-desaturase has a higher affinity for ALA than LA as a fatty acid substrate; having high Δ6-desaturase activity; xxiii) The Δ6-desaturase binds to the Sn-2 position of PC as a fatty acid substrate. ALA-CoA as a fatty acid substrate has a higher Δ6-desaturase activity than combined ALA. having taturase activity; xxiv) the Δ6-desaturase has a higher activity against ALA as a substrate compared to LA At least about two-fold higher Δ6-desaturase activity, at least three-fold higher activity, have four times higher activity, or at least five times higher activity, xxv) The Δ6-desaturase binds to the sn-2 position of PC as a fatty acid substrate. It has higher activity against ALA-CoA as a fatty acid substrate than against ALA. and, xxvi) The Δ6-desaturase binds to the sn-2 position of PC as a fatty acid substrate. At least about 5% more efficient for ALA-CoA as a fatty acid substrate than for ALA-CoA. 2-fold higher Δ6-desaturase activity or at least 10-fold higher activity; xxvii) the desaturase is a front-end desaturase; and xxviii) the Δ6-desaturase has detectable Δ5-desaturase activity against ETA No urase activity 8. The method of claim 7, further comprising one or more or all of:

9. The plant part or microbial cell is capable of expressing diacylglycerol acyltransferase ( DGAT), monoacylglycerol acyltransferase (MGAT), glycerol glycerol-3-phosphate acyltransferase (GPAT), 1-acyl-glycerol- 3-phosphate acyltransferase (LPAAT), preferably DPA-CoA, etc. LPAAT that can use a C22 polyunsaturated fatty acyl-CoA substrate of: Lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A ２ (P.L.A. ２ ), phospholipase C (PLC), phospholipase D (PLD), CDP- Choline diacylglycerol choline phosphotransferase (CPT), phosphatidylcholine glyceryl acyltransferase (PDAT), phosphatidyl Choline:diacylglycerolcholinephosphotransferase (PDCT), acyl- CoA synthase (ACS), or a combination of two or more thereof.

9. The method of claim 7 or claim 8, further comprising leotide.

10. The exogenous polynucleotide is integrated into the genome of a cell of the plant part or microbial cell. covalently linked within the inserted DNA molecule, preferably a T-DNA molecule, The number of such DNA molecules integrated into the genome of a cell of the plant part or microbial cell is 1 Any one of claims 7 to 9, which is equal to or less than 2 or 3, or equal to or less than 2 or 3. The method according to claim 5.

11. the total oil content of said plant part or microbial cell containing said exogenous polynucleotide is the total oil of the corresponding plant part or microbial cell that does not contain the exogenous polynucleotide. At least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 50% and about 80%, or between about 80% and about 100%.

11. The method according to any one of claims 4 to 10.

12. The lipids are treated to increase the level of DPA as a percentage of the total fatty acid content. and said treating further comprises one or more of fractional distillation, distillation or methylation of DPA.

12. The process according to claim 4 to 11, comprising a transesterification reaction such as the formation of an ester or ethyl ester.

13. The method according to any one of claims 1 to 12.

13. An oilseed plant, or part thereof, or a microbial cell, which contains lipids in its seeds. 、 a) a lipid comprising fatty acids in an esterified form, and b) the following set of enzymes: i) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ6-desaturases, Δ5-desaturases, Δ6-elongases and Δ5- Elongase, ii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5 - Elongase iii) ω3-desaturase and / or Δ15-desaturase, Δ6-desaturase Δ5-desaturase, Δ6-elongase and Δ5-elongase, or iv) ω3-desaturase and / or Δ15-desaturase, Δ8-desaturase Enzymes, Δ5-desaturases, Δ9-elongases and Δ5-elongases An exogenous polynucleotide encoding one of Including, Each polynucleotide is capable of directing expression of said polynucleotide in developing seeds of said plant. or one or more seed-specific promoters capable of expressing said polynucleotides in said microbial cell. operably linked to one or more promoters capable of inducing expression of the nucleotide sequence of The fatty acids are omega-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), alpha-linoleic acid, and omega-2 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), Omega-3 fatty acids including norenic acid (ALA), stearidonic acid (SDA), and docosapentaenoic acid (DHA) diacylglycerol (DPA), and optionally eicosapentaenoic acid (EPA) and / or eicosatetraenoic acid (ETA), and the lipids of said seeds or microbial cells. the level of DPA in the total fatty acid content is between 7% and 35%; The oilseed plant, or part thereof, or microbial cell.

14. Brassica napus capable of producing seeds containing DPA ), B. juncea or Camelina sativa tiva plant, wherein the mature harvested seeds of said plant have a low at least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed At least about 36 mg per gram of seed, and at least about 40 mg per gram of seed, more preferably or at least about 44 mg or at least 48 mg per gram of seed, At least about 80 mg per ram, or from about 30 mg to about 80 mg per gram of seed The plant has a DPA content between.

15. 14. The plant cell of claim 13, comprising the exogenous polynucleotide.

16. Features: i) derived from a plant according to claim 13 or 14; ii) comprising a lipid according to any one of claims 1 to 3; iii) It can be used in the method according to any one of claims 4 to 12. A plant part, preferably a seed, or a microbial cell having one or more of the following:

17. DPA and between about 4% and about 15% by weight, preferably between about 6% and about 8% by weight or between about 4% and about 8% by weight moisture. Brassica napus, B. juncea or Camellia Camelina sativa seeds, comprising the DPA content of said seeds. at least about 28 mg per gram of seed, preferably at least about 10 mg per gram of seed at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, More preferably, at least about 40 mg per gram of seed or at least about 44 mg per gram of seed. At least about 48 mg per gram, about 80 mg per gram of seed, or The seeds have a content of between about 30 mg and about 80 mg per gram.

18. Use for producing the extracted plant lipid or extracted microbial lipid according to any one of claims 1 to 3.

2. A method for producing a plant or microbial cell capable of producing a microbial cell, the method comprising: a) one or more plant parts from a plurality of plants or microbial cells or produced by microbial cells Assaying the level of DPA in the lipids produced in each plant or microbial cell. but the following set of enzymes: i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene longase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ Δ5-elongase and Δ6-elongase, iv) Δ12-desaturase, ω3-desaturase or Δ15-desaturase , Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase Longase, ix) ω3-desaturase or Δ15-desaturase, Δ6-desaturase; Δ5-desaturase, Δ6-elongase and Δ5-elongase, or x) ω3-desaturase or Δ15-desaturase, Δ8-desaturase, Δ 5-Desaturase, Δ9-elongase and Δ5-elongase and one or more exogenous polynucleotides encoding one of the following: Each polynucleotide is a polypeptide that is capable of expressing said polynucleotide within a plant part or a microbial cell. The assay method includes the step of: operably linking the nucleic acid sequence to one or more promoters capable of inducing expression of the nucleic acid sequence; And, and b) extracting plant lipids or microorganisms according to any one of claims 1 to 3 from one or more of their parts; To obtain a plant or microbial cell from a plurality of plant or microbial cells that can be used for the production of biolipids, To determine c) optionally, progeny from said identified plant or microbial cell, or a seed derived therefrom. Producing plant or microbial cells The method comprising:

19. 1. A method for producing seeds, the method comprising: a) A collection of preferably at least 1000 or 2000 or 3000 such plants. At least 1 hectare or 2 hectares of cultivated land as a combined part or planted at standard planting density.

15. A plant according to claim 13 or 14, or a plant according to claim 13, in an area of ​​1000 m2 or 3 hectares.

17. Growing a plant that produces a plant part according to claim 16 or a seed according to claim 17. and, b) harvesting seeds from said one or more plants; and c) Optionally extracting lipids from said seeds, preferably to obtain at least 60 kg of lipids. or to produce oil with a total DPA yield of 70 kg or 80 kg DPA / hectare. thing The method comprising:

20. The following features: i) comprising an oil as defined in claim 2 or claim 3; and ii) the plant part or seed or microbial cell is a plant part or a seed or a microbial cell according to any one of claims 4 to 12 It can be used in the manner described The plant, plant cell, or plant part according to any one of claims 13 to 17, seeds or microbial cells.

21. The cell according to claim 15, the cell according to claim 16, 13. An oilseed plant according to claim 13. A microbial cell according to claim 13. A bacterium according to claim 14. Brassica napus, B. juncea or Turtle 17. A Camelina sativa plant, a plant part according to claim 16, or 18. A lipid or oil produced by or obtained from the seed of claim 17.

22. 18. A method for producing a plant comprising the steps of: obtaining a seed according to claim 17; or obtaining a plant according to claim 13 or 14. Seed meal that can be used.

23. One or more of the lipids or oils according to claim 21, the cells according to claim 15, and the A plant cell or a microbial cell according to claim 17, a seed according to claim 22, or a seed according to claim 23. A composition comprising domir.

24. One or more of the lipids or oils according to claim 21, the cells according to claim 15, the 20. The oilseed plant according to claim 14, the plant cell or the microbial cell according to claim 20, Brassica napus, mustard (B. juncea) or a Camelina sativa plant, as claimed in claim 20. A plant part, a seed according to claim 17, a seed meal according to claim 22 or a plant part according to claim 23. A livestock feed, cosmetic or chemical comprising the composition described above.

25. 1. A method for producing livestock feed, said method comprising: The lipid or oil according to any one of claims 1 to 3, the cell according to claim 15, 14. The oilseed plant of claim 13, the plant cell or microbial cell of claim 20, Brassica napus and mustard (B. julienne) according to 14 ncea or Camelina sativa plant, 20. A plant part according to claim 17. A seed meal according to claim 22.

24. The method of claim 23, comprising mixing the composition of claim 23.

26. Claims for the manufacture of a medicine for the treatment or prevention of a condition that would benefit from PUFAs. One or more lipids or oils according to any one of claims 1 to 3, and a cell according to claim 15.

21. A plant cell or microbial cell according to claim 20, a plant part according to claim 20, or a plant cell according to claim 1 24. Use of a seed according to claim 7, a seedmeal according to claim 22, or a composition according to claim 23.

Images