combination

JP2025065346A5Active Publication Date: 2025-11-27BIRDIE BIOPHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025018420
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2014-09-01
Filing Date
2025-02-06
Publication Date
2025-11-27
Estimated Expiration
2035-07-08

AI Technical Summary

Technical Problem

Current therapeutic monoclonal antibody drugs face challenges such as antibody immunogenicity, long-term tolerance of tumor targets, and the limitations of single pathway blockade, leading to difficulties in achieving long-term effective inhibition and death of tumor cells.

Method used

A combination therapy comprising an effective amount of a PD-L/PD-1 Axis antagonist, such as a PD-1 or PD-L1 binding antagonist, in conjunction with an immunotherapeutic agent capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, to enhance immune-mediated killing of tumor cells.

Benefits of technology

The combination therapy achieves persistent anti-tumor responses and potentially long-term remission by overcoming the limitations of single-agent therapies and enhancing immune activation against cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

To provide methods for treating cancer using combination of therapeutic agents and combination therapies.SOLUTION: Disclosed is a combination comprising: (i) a pharmaceutical composition comprising a mixture of 1) an effective amount of an anti-PD-1 antibody and 2) one or more pharmaceutically acceptable carrier, excipient or diluent, and (ii) a pharmaceutical composition comprising a mixture of 1) an effective amount of immunotherapeutic capable of activating human plasmacytoid dendritic cell, myeloid dendritic cell or NK cell or a combination thereof, and 2) one or more pharmaceutically acceptable carrier, excipient or diluent, where the immunotherapeutic is 4-amino-2-(ethoxy)-a,a-dimethyl-1H-imidazo [4,5-c]quinoline-1-ethanol (Requisimod).SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to Chinese Patent Application No. 20140325480.9, filed on July 9, 2014, and Chinese Patent Application No. 201410440824.0, filed on September 1, 2014, the entire disclosures of which are incorporated herein by reference in their entireties.

[0002] FIELD OF THEINVENTION The present invention relates to therapeutic combinations and methods of treating cancer using combination therapy. [Background technology]

[0003] Therapeutic antibodies have been used in clinical applications for over 20 years. Currently, there are 15 antitumor antibody drugs in the clinic, including Rituxan (1997), Herceptin (1998), Mylotarg (2000), Campath (2001), Zevalin (2002), Bexxer (2003), Avastin (2004), Erbitux (2004), Vectibix (2006), Arzerra (2009); Benlysta (2011); Yervoy (2011), Adcetris (2011), Perjeta (2012), and Kadcyla (2013). These antibodies mainly target four molecules: EGFR, Her2, CD20, and VEGF.

[0004] In general, therapeutic antibodies kill tumor cells through three mechanisms (Non-Patent Document 1): (1) direct antibody action, i.e., blocking or agonist activity of ligand / receptor signaling, induction of apoptosis, and delivery of drugs or cytotoxic drugs. Antibody receptor activation activity can generate direct tumor cell killing effects. For example, some antibodies can bind to receptors on the surface of tumor cells, activate the receptors, and result in apoptosis (e.g., in mitochondria). Antibodies can also mediate tumor cell killing through receptor antagonist activity. For example, certain antibodies can bind to cell surface receptors and block dimerization, kinase activation, and downstream signaling, thereby inhibiting proliferation and promoting apoptosis. Antibody binding to enzymes can result in neutralization, signal suppression, and cell death. (2) through immune-mediated cell killing mechanisms, including complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), T-cell function modulation, etc. Immune-mediated killing of tumor cells can be achieved by the following methods: induction of phagocytosis, complement activation, antibody-dependent cell-mediated cytotoxicity, genetically modified T cells targeted to tumors by single-chain variable fragments (scFv), activation of T cells by antibody-mediated antigen cross-presentation to dendritic cells, inhibition of T cell inhibitory receptors such as cytotoxic T lymphocyte-associated antigen 4 (CTLA4). Among these, the Fc portion of the antibody features is particularly important for CDC- and ADCC-mediated tumor cell killing effects. (3) Specific effects of antibodies on tumor vasculature and matrix through the capture of vascular receptor antagonists or ligands, inducing ablation of blood vessels and stromal cells, including stromal cell inhibition, delivery of toxins to stromal cells, and delivery of toxins to the vasculature (Non-Patent Document 1).

[0005] Therapeutic monoclonal antibody drugs have advanced the research and development of anti-cancer drugs.However, there are still some problems that need further research to solve, such as antibody immunogenicity, the tolerance of long-term use of tumor targeting, and the long-term effect of simple single blockade of signal transduction pathway.In summary, the majority of antibodies have difficulty in achieving long-term effective inhibition and killing of tumor cells.

[0006] Antibody-drug conjugates combine targeting function with small molecule drugs with specific pharmacokinetics. The structure of antibody-drug conjugates is the attachment of a monoclonal antibody with targeting function to a compound with specific pharmacological properties. This technology requires that a therapeutic antibody with binding specificity to a target is conjugated with a molecule with a therapeutic effect or other function, such as a cytotoxin. Many factors affect the effect of this type of antibody, such as the endocytosis of the conjugated antibody, the stability of the conjugate, and the release and killing activity of the toxin.

[0007] Antibody-drug conjugates have direct and indirect anti-cancer effects. Antibodies can block or activate ligand / receptor signaling, induce apoptosis, and simultaneously present or deliver payload drugs (e.g., drugs, toxins, small interfering RNA, or radioisotopes) directly or indirectly to tumor cells. Therapeutic antibody-drug conjugates utilize the dual properties of antibodies and conjugated drugs, the first being the binding function of specifically binding to target molecules, the second being the tumor cell killing function of the antibody itself, and the third being the specific effect of the conjugated drug. Current antibody-drug conjugate drugs are limited in how to directly kill tumor cells. However, due to the strict requirements of antibodies, linker molecules, toxin molecules, and technology in conjugation, as well as the limitations on carrying toxins into tumor microenvironment molecules, there are still some difficulties in actual clinical research. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Scott AM, Wolchok JD, Old LJ. Antibody therapy of cancer. Nat Rev Cancer. (2012), 12:278-87 [Non-Patent Document 2] Scott AM,Wolchok JD,Old LJ.Antibody therapy of cancer.Nat Rev Cancer.2012,12(4):278-87 Summary of the Invention [Means for solving the problem]

[0009] In one aspect, the invention provides a combination comprising (i) an effective amount of a PD-L / PD-1 Axis antagonist, and (ii) an effective amount of an immunotherapeutic capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof.

[0010] In some embodiments, the PD-L / PD-1 axis antagonist is selected from the group consisting of a PD-1 binding antagonist, a PD-L1 binding antagonist, and a PD-L2 binding antagonist.

[0011] In some embodiments, the PD-L / PD-1 axis antagonist is a PD-1 binding antagonist.

[0012] In some embodiments, the PD-1 binding antagonist inhibits binding of PD-1 to its ligand binding partner.

[0013] In some embodiments, the PD-1 binding antagonist inhibits binding of PD-1 to PD-L1.

[0014] In some embodiments, the PD-1 binding antagonist inhibits binding of PD-1 to PD-L2.

[0015] In some embodiments, the PD-1 binding antagonist inhibits binding of PD-1 to both PD-L1 and PD-L2.

[0016] In some embodiments, the PD-1 binding antagonist is an antibody such as MDX-1106, Merck 3745, CT-011, AMP-224, or AMP-514.

[0017] In some embodiments, the PD-L / PD-1 axis antagonist is a PD-L1 binding antagonist.

[0018] In some embodiments, the PD-L1 binding antagonist inhibits binding of PD-L1 to PD-1.

[0019] In some embodiments, the PD-L1 binding antagonist inhibits binding of PD-L1 to B7-1.

[0020] In some embodiments, the PD-L1 binding antagonist inhibits binding of PD-L1 to both PD-1 and B7-1.

[0021] In some embodiments, the PD-L1 binding antagonist is an antibody, such as one selected from the group consisting of YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and MSB0010718C.

[0022] In some embodiments, the PD-L / PD-1 axis antagonist is a PD-L2 binding antagonist.

[0023] In some embodiments, the PD-L2 binding antagonist is an antibody.

[0024] In some embodiments, the PD-L2 binding antagonist is an immunoadhesin.

[0025] In some embodiments, the treatment provides a sustained response in the individual after treatment is stopped.

[0026] In some embodiments, the immunotherapeutic agents are administered continuously, intermittently.

[0027] In some embodiments, the immunotherapeutic agent is administered prior to the PD-L / PD-1 axis antagonist.

[0028] In some embodiments, the immunotherapeutic agent is administered simultaneously with the PD-L / PD-1 axis antagonist.

[0029] In some embodiments, the immunotherapeutic agent is administered after the PD-L / PD-1 axis antagonist.

[0030] In some embodiments, the individual has colorectal cancer, melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, pancreatic cancer, hematological malignancies, or renal cell carcinoma.

[0031] In some embodiments, the PD-L / PD-1 Axis antagonist is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intrapleurally, by implantation, by inhalation, intrathecally, intracerebroventricularly, or intranasally.

[0032] In some embodiments, the immunotherapeutic agent may specifically bind to human TLR7 and / or TLR8.

[0033] In some embodiments, the immunotherapeutic agent comprises (a) a single-stranded RNA (ssRNA), preferably ORN02, ORN06, ssPoly(U), ssRNA40, ssRNA41, ssRNA-DR, or Poly(dT), or (b) a receptor ligand analog, preferably CL075, CL097, CL264, CL307, Gardiquimod, Loxoribine, Imiquimod, or Resiquimod.

[0034] In some embodiments, the immunotherapeutic agent is a compound of any one of Formulas (I) through (XIXb), or a pharma- ceutically acceptable salt or solvate thereof.

[0035] In some embodiments, the immunotherapeutic agent has the structure of Formula (I): [ka] wherein the dashed line represents a bond or the absence of a bond; X is S or -NR1, R1 is -W0-W1-W2-W3-W4, W0 is a bond, alkyl, alkenyl, alkynyl, alkoxy, or -alkyl-S-alkyl--; W1 is a bond, --O--, or --NR2--, where R2 is hydrogen, alkyl, or alkenyl; W2 is a bond, --O--, --C(O)--, --C(S)--, or -S(O)2--; W3 is a bond, --NR3--, where R3 is hydrogen, alkyl, or alkenyl; W4 is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl, or heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --alkyl- ... optionally substituted with one or more substituents selected from the group consisting of (O)-R, --alkyl-C(O)-O-R, --C(O)-O-R, --S-R, --S(O)2-R, --NH-S(O)2-R, --alkyl-S-R, --alkyl-S(O)2-R, --NHR, --NR4R, --NH-alkyl-R, halogen, --CN, --NO2, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl; Z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which can be optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halogen, cyano, nitro, --N(R5), --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --OC(O)-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl; R is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, or heterocyclyl, each of which is selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl- optionally substituted with one or more substituents selected from the group consisting of C(O)-O-R, --C(O)-O-R, --OC(O)-R, --S-R, --C(O)-S-R, --SC(O)-R, --S(O)2-R, --NH-S(O)2-R, --alkyl-S-R, --alkyl-S(O)2-R, --NHR, --NR4R, --NH-alkyl-R, halogen, --CN, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl; n is 0, 1, 2, 3, or 4; Y is -NR6R7, -CR6R7R8, or -alkyl-NH2, each of which can be optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, --NH2, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl; wherein R6, R7, and R8 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or -alkyl-OC(O)-R9, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl; and X and Z together may optionally form a (5-9) membered ring.

[0036] In some embodiments, the immunotherapeutic agent is selected from the group consisting of 2-propylthiazolo[4,5-c]quinolin-4-amine, 1-(2-methylpropyl)-1H-imidazo[4,5-c]quinolin-4-amine, 4-amino-2-(ethoxymethyl)-a,a-di-methyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-(4-amino-2-ethylaminomethylimidazo-[4,5-c]quinolin-1-yl)-2-methylpropan-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinolin-1-yl] N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyl]-2-(ethoxymethyl)-1H-imidazo[4,5-c][1,5]naphthyl]-2-(methoxyethyl)-1H-imidazo[4,5-c]quinolin-4-amine; N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyl]-2-(methoxyethyl)-1H-imidazo[4,5-c][1,5]naphthyl]-2-(ethoxymethyl) ... N-(2-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridin-1-yl)ethyl)-2-amino-4-methylpentanamide, N-(2-{2-[4-amino-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinolin-1-yl]ethoxy}ethyl)-n'-phenylurea, 1-(2-amino-2-methylpropyl)-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-4-amine, 1-{4-[(3,5-dic phenyl)sulfonyl]butyl}-2-ethyl-1H-imidazo[4,5-c]quinolin-4-amine, N-(2-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-1-yl]ethoxy}ethyl)-n'-cyclohexylurea, N-{3-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-1-yl]propyl}-n'-(3-cyanophenyl)thiourea, N-[3-(4-amino-2-butyl-1H-imidazo[4,5-c]quinolin-1-yl)-2,2-Dimethylpropyl]benzamide, 2-butyl-1-[3-(methylsulfonyl)propyl]-1H-imidazo[4,5-c]quinolin-4-amine, N-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-1-yl]-1,1-dimethylethyl}-2-ethoxyacetamide, 1-[4-amino-2-ethoxymethyl-7-(pyridin-4-yl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, 1-[4-amino-2-(ethoxymethyl)- 7-(pyridin-3-yl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, N-{3-[4-amino-1-(2-hydroxy-2-methylpropyl)-2-(methoxyethyl)-1H-imidazo[4,5-c]quinolin-7-yl]phenyl}methanesulfonamide, 1-[4-amino-7-(5-hydroxymethylpyridin-3-yl)-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, 3-[4-amino-2- (Ethoxymethyl)-7-(pyridin-3-yl)-1H-imidazo[4,5-c]quinolin-1-yl]propane-1,2-diol, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinolin-1-yl)-1,1-dimethylethyl]-3-propylurea, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinolin-1-yl)-1,1-dimethylethyl]-3-cyclopentylurea, 1-[(2,2-dimethyl-1,3-dioxolan-4-yl)methyl]-2-( ethoxymethyl)-7-(4-hydroxymethylphenyl)-1H-imidazo[4,5-c]quinolin-4-amine, 4-[4-amino-2-ethoxymethyl-1-(2-hydroxy-2-methylpropyl)-1H-imidazo[4,5-c]quinolin-7-yl]-N-methoxy-N-methylbenzamide, 2-ethoxymethyl-N1-isopropyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1,4-diamine, 1-[4-amino-2-ethyl-7-(pyridin-4-yl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinolin-1-yl)butyl]methanesulfonamide, and N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridin-1-yl)butyl]-n'-cyclohexylurea.

[0037] In some embodiments, the immunotherapeutic agent has the structure of formula (II): [ka] wherein V is -NR6R7, where each of R6 and R7 is independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or -alkyl-OC(O)-R9, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl; R 10 and R 11 is independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl, or cycloalkyl, each of which is optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, halogen, --N(R5), --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl.

[0038] In some embodiments, the therapeutic combination or pharmaceutical composition of the present invention further comprises an effective amount of an additional therapeutic agent, such as an anti-cancer agent.

[0039] In some embodiments, the anti-cancer agent is an antimetabolite, an inhibitor of topoisomerase I and II, an alkylating agent, a microtubule inhibitor, an antiandrogen, a GNRh modulator, or a mixture thereof.

[0040] In some embodiments, the additional therapeutic agent is a chemotherapeutic agent selected from the group consisting of tamoxifen, raloxifene, anastrozole, exemestane, letrozole, imatanib, paclitaxel, cyclophosphamide, lovastatin, minosine, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide, etoposide, gemcitabine, epothilone, vinorelbine, camptothecin, daunorubicin, actinomycin D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin.

[0041] In another aspect, the present invention provides a method for treating a disease condition in a subject in need thereof, comprising administering to the subject a therapeutic combination or pharmaceutical composition provided herein.

[0042] In some embodiments, the disease condition is a tumor. In some embodiments, the disease condition comprises abnormal cell proliferation.

[0043] In some embodiments, the abnormal cell growth comprises a precancerous lesion, hi some embodiments, the abnormal cell growth is of cancer cells.

[0044] In some embodiments, the cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.

[0045] In some embodiments, the amount of immunotherapeutic agent is: (1) Induction of IFN-α in enriched human blood DCs, (2) inducing TNF-α in enriched human blood DCs; and / or (3) Induction of IL-12-α in enriched human blood DCs It is a quantity that can be achieved.

[0046] In some embodiments, the methods include administering to the subject an oral formulation comprising an immunotherapeutic agent (e.g., R848 and analogs thereof) at a dose of between about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or 0.01 mg / kg to about 0.02 mg / kg twice weekly.

[0047] In some embodiments, the methods include administering to the subject an oral formulation comprising an immunotherapeutic agent (e.g., R848 and analogs thereof) at a dose of about 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or 0.01 mg / kg or less twice weekly.

[0048] In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunotherapeutic agent (e.g., R848 and analogs thereof) at a dose of between about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or 0.006 mg / kg to about 0.015 mg / kg every week. In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunotherapeutic agent (e.g., R848 and analogs thereof) at a dose of between about 0.0008 mg / kg to about 0.0067 mg / kg every week.

[0049] In some embodiments, the methods comprise administering to the subject an intravenous formulation comprising the immunotherapeutic agent at a dose of about 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or 0.006 mg / kg or less to about 0.007 mg / kg weekly.

[0050] In some embodiments, the immunotherapeutic agent in the subject has a local concentration of between about 0.005 μg / ml and about 12 μg / ml.

[0051] In some embodiments, the immunotherapeutic agent in the subject has a local concentration of between about 0.05 μg / ml, 0.1 μg / ml, 0.15 μg / ml, 0.2 μg / ml, 0.3 μg / ml, or 0.4 μg / ml to about 0.5 μg / ml.

[0052] In a further aspect, the present invention provides kits comprising the therapeutic combinations provided herein, and optionally, instructions.

[0053] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings, in which: [Brief description of the drawings]

[0054] [Figure 1] Figure 1 shows the effect of anti-PDL1 mAb treatment on SCCVII tumor growth. SCCVII tumors were inoculated as described in Materials and Methods. Tumor-inoculated mice received intraperitoneal injections of anti-PDL1 mAb (200 μg / mouse) in combination with control rat immunoglobulin or TLRL three times a week. The mean tumor volume ± standard deviation was determined in each group of 5 to 8 mice. [Diagram 2]Figure 2 shows the effect of anti-PDL1 mAb treatment on CT26 tumor growth. CT26 tumors were inoculated as described in Materials and Methods. Tumor-inoculated mice received intraperitoneal injections of anti-PDL1 mAb (200 μg / mouse) in combination with control rat immunoglobulin or TLRL three times a week. The mean tumor volume ± standard deviation was determined in each group of 5 to 8 mice. [Figure 3A] Figure 3A shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations in a 37°C incubator for 20 to 22 hours. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. A: TLRL induced IFN-α expression in enriched human blood DCs (CD3+ / CD19+ / CD14+ / CD16+) from donor 1. [Figure 3B] Figure 3B shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations for 20 to 22 hours in a 37°C incubator. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. B: TLRL induced IFN-α expression in enriched human blood DCs in experiment #2 from donor 2. [Figure 3C]Figure 3C shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations for 20 to 22 hours in a 37°C incubator. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. C: TLRL induced TNF-α expression in enriched human blood DCs in experiment #2 from donor 2. [Figure 3D] Figure 3D shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations in a 37°C incubator for 20 to 22 hours. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. D: TLRL induced IL-12 expression in enriched human blood DCs in experiment #2 from donor 2. [Figure 3E] Figure 3E shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations for 20 to 22 hours in a 37°C incubator. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. E: TLRL induced IFN-α expression in enriched human blood DCs in experiment #3 from donor 3. [Figure 3F]Figure 3F shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations for 20 to 22 hours in a 37°C incubator. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. F: TLRL induced TNF-α expression in enriched human blood DCs in experiment #3 from donor 3. [Figure 3G] Figure 3G shows the analysis of cytokines by enriched human DCs from three healthy donors. Enriched human DCs were implanted in 96-well plates and directly cultured with allogeneic untreated (medium) or treated TLRL at different concentrations for 20 to 22 hours in a 37°C incubator. Supernatants were collected and analyzed for human IFN-α, IL-20 (p70) and TNF-α by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed. G: TLRL induced IL-12 expression in enriched human blood DCs in experiment #3 from donor 3. [Figure 4A] Figure 4A shows the expression of IFN-inducible genes in mouse PBMCs after TLRL injection. RNA was isolated from PBMCs cryopreserved in TRIzol reagent at variable time points, and the relative expression of IFN-inducible genes was determined by quantitative RT-PCR. The MX2 gene was detected over a time course of 5 hours after TLRL injection (4A). Values ​​indicate the mRNA expression of IFN-inducible genes shown relative to the housekeeping gene actin. Bar graphs represent data from 3 individual animals. **P<0.01, ***P<0.001. [Figure 4B]Figure 4B shows the expression of IFN-inducible genes in mouse PBMCs after TLRL infusion. RNA was isolated from PBMCs cryopreserved in TRIzol reagent at variable time points, and the relative expression of IFN-inducible genes was determined by quantitative RT-PCR. MX2 and ISG15 genes were measured at various doses of TLRL 2 hours after infusion (4B). Values ​​indicate mRNA expression of IFN-inducible genes shown relative to the housekeeping gene actin. Bar graphs represent data from 3 individual animals. **P<0.01, ***P<0.001. [Figure 4C] FIG. 4C shows expression of IFN-inducible genes in mouse PBMCs after TRLR injection. RNA was isolated from PBMCs cryopreserved in TRIzol reagent at various time points, and the relative expression of IFN-inducible genes was determined by quantitative RT-PCR. Values ​​indicate mRNA expression of IFN-inducible genes shown relative to the housekeeping gene actin. Bar graphs represent data from 3 individual animals. **P<0.01, ***P<0.001. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0055] Some aspects of the present invention are described below with reference to examples of applications for illustration. It should be understood that numerous specific details, relationships, and methods are described to provide a thorough understanding of the present invention. However, one skilled in the art will readily recognize that the present invention can be practiced without one or more of the specific details, or with other methods. The present invention is not limited to the illustrated order of acts or events, and some acts may occur in different orders and / or simultaneously with other acts or events.

[0056] Furthermore, not all illustrated acts or events are required to implement the methodologies in accordance with the present invention.

[0057] The terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting of the present invention. As used herein, the singular forms "a," "an," and "the" are also intended to include the plural forms unless the context clearly dictates otherwise. Furthermore, to the extent the terms "including," "includes," "having," "has," "with," or variations thereof are used in any of the detailed description and / or claims, such terms are intended to be inclusive in a manner similar to the term "comprising."

[0058] The term "about" or "approximately" means within an acceptable error range of a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, according to the practice of the art. Alternatively, "about" can mean within a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude of a value, preferably within 5-fold, more preferably within 2-fold. When a particular value is described in the application and claims, "about" meaning within an acceptable error range of the particular value should be assumed, unless otherwise stated.

[0059] I. Definitions and Abbreviations Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and in laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are those well known and commonly used in the art. Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures are generally performed according to conventional methods in the art and various general references provided throughout this document. The nomenclature used herein and in laboratory procedures in analytical chemistry and organic synthesis described below are those well known and commonly used in the art. Standard techniques, or modifications thereof, are used for chemical synthesis and chemical analysis.

[0060] The term “alkyl,” by itself or as part of another substituent, means, unless otherwise stated, straight-chain, branched-chain or cyclic hydrocarbon radicals, or combinations thereof, which may be fully saturated, mono- or polyunsaturated, and have the specified number of carbon atoms (i.e., C1-C6). 10means 1-10 carbons) divalent and polyvalent radicals. Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, and the like, such as homologs and isomers of n-pentyl, n-hexyl, n-heptyl, and n-octyl. Unsaturated alkyl groups are groups that have one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers. The term "alkyl," unless otherwise noted, is also meant to include those derivatives of alkyl defined in more detail below, such as "heteroalkyl." Alkyl groups that are limited to hydrocarbon groups are referred to as "homoalkyl."

[0061] The term "alkylene" by itself or as part of another substituent means a divalent radical derived from an alkane, exemplified, but not limited to, by -CH2CH2CH2CH2-, and further including those groups described below as "heteroalkylene." Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present invention. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, generally having 8 or fewer carbon atoms.

[0062] The terms "alkoxy," "alkylamino," and "alkylthio" (or thioalkoxy) are used in their conventional sense to refer to an alkyl group attached to the remainder of the molecule through an oxygen atom, an amino group, or a sulfur atom, respectively.

[0063] "Heteroalkyl," by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain or cyclic hydrocarbon radical, or combinations thereof, consisting of the stated number of carbon atoms and at least one heteroatom selected from the group consisting of O, N, Si, and S, where the nitrogen and sulfur atoms may be optionally oxidized and the nitrogen heteroatom may be optionally quaternized. The heteroatom(s) O, N, and S, and Si may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to, -CH-CH-O-CH, -CH-CH-NH-CH, -CH-CH-N(CH)-CH, -CH-S-CH-CH, -CH-CH, -S(O)-CH, -CH-CH-S(O)-CH, -CH=CH-O-CH, -Si(CH), -CH-CH=N-OCH, and -CH=CH-N(CH). Up to two heteroatoms may be consecutive, such as, for example, -CH-NH-OCH and -CH-O-Si(CH). Similarly, the term "heteroalkylene" by itself or as part of another substituent means a divalent radical derived from a heteroalkyl, exemplified by, but not limited to, -CH-CH-S-CH-CH- and -CH-S-CH-CH-NH-CH-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula: -C(O)R'- represents both -C(O)R'- and -R'C(O)-.

[0064] Generally, the "acyl substituent" is also selected from the groups described above. As used herein, "acyl substituent" means a group that is attached to satisfy the valence of the carbonyl carbon that is attached directly or indirectly to the polycyclic nucleus of the compounds of this invention.

[0065] The terms "cycloalkyl" and "heterocycloalkyl", by themselves or in combination with other terms, represent, unless otherwise stated, cyclic versions of "alkyl" and "heteroalkyl", respectively. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and the like.

[0066] The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as "haloalkyl" are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(C1-C4)alkyl" is meant to include, but is not limited to, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.

[0067] As used herein, the term "haloalkyl" refers to an alkyl as defined herein substituted with one or more halo groups as described herein. Preferably, the haloalkyl can be a monohaloalkyl, dihaloalkyl, or polyhaloalkyl, including perhaloalkyl. Monohaloalkyl can have one iodo, bromo, chloro, or fluoro in the alkyl group. Dihaloalkyl and polyhaloalkyl can have two or more of the same halo atoms or a combination of different halo groups in the alkyl group. Preferably, polyhaloalkyl contains up to 12, 10, or 8, or 6, or 4, or 3, or 2 halo groups. Non-limiting examples of haloalkyl include fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, dichioromethyl, trichloromethyl, pentafluoroethyl, heptafluoropropyl, difluorochloromethyl, dichiorofluoromethyl, difluoroethyl, difluoropropyl, dichloroethyl, and dichloropropyl. Perhaloalkyl refers to an alkyl where all hydrogen atoms have been replaced with halo atoms.

[0068] As used herein, the term "heteroaryl" refers to a 5-14 membered monocyclic or bicyclic or fused polycyclic ring system having from 1 to 8 heteroatoms selected from N, O, S or Se. Preferably, the heteroaryl is a 5-10 membered ring system. Exemplary heteroaryl groups include 2- or 3-thienyl, 2- or 3-furyl, 2- or 3-pyrrolyl, 2-, 4-, or 5-imidazolyl, 3-, 4-, or 5-pyrazolyl, 2-, 4-, or 5-thiazolyl, 3-, 4-, or 5-isothiazolyl, 2-, 4-, or 5-oxazolyl, 3-, 4-, or 5-isoxazolyl, 3- or 5-1,2,4-triazolyl, 4- or 5-1,2,3-triazolyl, tetrazolyl, 2-, 3-, or 4-pyridyl, 3- or 4-pyridazinyl, 3-, 4-, or 5-pyrazinyl, 2-pyrazinyl, 2-, 4-, or 5-pyrimidinyl.

[0069] The term "heteroaryl" also refers to a group in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocycloalkyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include 1-, 2-, 3-, 5-, 6-, 7-, or 8-indolizinyl, 1-, 3-, 4-, 5-, 6-, or 7-isoindolyl, 2-, 3-, 4-, 5-, 6-, or 7-indolyl, 2-, 3-, 4-, 5-, 6-, or 7-indazolyl, 2-, 4-, 5-, 6-, 7-, or 8-purinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, or 9-quinolizinyl, 2-, 3-, 4-, 5-, 6-, 7-, or 8-quinolyl, 1- ... -, 3-, 4-, 5-, 6-, 7-, or 8-isoquinoliyl; 1-, 4-, 5-, 6-, 7-, or 8-phthalazinyl; 2-, 3-, 4-, 5-, or 6-naphthyridinyl; 2-, 3-, 5-, 6-, 7-, or 8-quinazolinyl; 3-, 4-, 5-, 6-, 7-, or 8-cinnolinyl; 2-, 4-, 6-, or 7-pteridinyl; 1-, 2-, 3-, 4-, 5-, 6-, 7-, or 8-carbazolyl; -, 6-, 7-, or 8-carbazolyl; 1-, 3-, 4-, 5-, 6-, 7-, 8-, or 9-carbolinyl; 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-, or 10-phenanthridinyl; 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, or 9-acridinyl; 1-, 2-, 4-, 5-, 6-, 7-, 8-, or 9-perimidinyl; 2-, 3-, 4-, 5-, 6-, 8-, 9-, or 10-phenanthrolinyl; 1-, 2-, 3-, 4-, 6-, 7-, or 8- , or 9-phenazinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-, or 10-phenothiazinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-, or 10-phenoxazinyl, 2-, 3-, 4-, 5-, or 6-, or 1-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-benzoisoquinolinyl, 2-, 3-, 4-, or 5-thieno[2,3-b]furanyl, 2-, 3-, 5-, 6-, 7-, 8-, 9-, 10-, or 11-7H-pyrazino[2,3-c]carbazolyl, 2-, 3-, 5-, 6-, or 7-2H-furo[3,2-b]-pyranyl, 2-, 3-, 4-, 5-, 7-, or 8-5H-pyrido[2,3-d]-o-oxazinyl, 1-, 3-, or 5-1H-pyrazolo[4,3-d]-oxazolyl, 2-, 4-, or 54H-imidazo[4,5-d]thiazolyl, 2-, 3-, 5-, or 8-pyrazino[2,3-d]pyridazinyl; 2-, 3-, 5-, or 6-imidazo[2,1-b]thiazolyl; 1-, 3-, 6-, 7-, 8-, or 9-furo[3,4-c]cinnolinyl; 1-, 2-, 3-, 4-, 5-, 6-, 8-, 9-, 10, or 11-4H-pyrido[2,3-c]cal Examples of the aryl group include, but are not limited to, bazolyl, 2-, 3-, 6-, or 7-imidazo[1,2-b][1,2,4]triazinyl, 7-benzo[b]thienyl, 2-, 4-, 5-, 6-, or 7-benzoxazolyl, 2-, 4-, 5-, 6-, or 7-benzimidazolyl, 2-, 4-, 4-, 5-, 6-, or 7-benzothiazolyl, 1-, 2-, 4-, 5-, 6-, 7-, 8-, or 9-benzoxapinyl, 2-, 4-, 5-, 6-, 7-, or 8-benzoxazinyl, 1-, 2-, 3-, 5-, 6-, 7-, 8-, 9-, 10-, or 11-1H-pyrrolo[1,2-b][2]benzoazapinyl. Exemplary fused heteroaryl groups include, but are not limited to, 2-, 3-, 4-, 5-, 6-, 7-, or 8-quinolinyl, 1-, 3-, 4-, 5-, 6-, 7-, or 8-isoquinolinyl, 2-, 3-, 4-, 5-, 6-, or 7-indolyl, 2-, 3-, 4-, 5-, 6-, or 7-benzo[b]thienyl, 2-, 4-, 5-, 6-, or 7-benzoxazolyl, 2-, 4-, 5-, 6-, or 7-benzimidazolyl, and 2-, 4-, 5-, 6-, or 7-benzothiazolyl.

[0070] As used herein, the term "heterocyclyl" or "heterocyclo" refers to an optionally substituted, fully saturated or unsaturated, aromatic or non-aromatic ring group, for example, a 4- to 7-membered monocyclic, 7- to 12-membered bicyclic, or 10- to 15-membered tricyclic ring system, which has at least one heteroatom in at least one carbon atom-containing ring. Each ring of the heteroatom-containing heterocyclic group can have 1, 2, or 3 heteroatoms selected from nitrogen, oxygen, and sulfur atoms, where the nitrogen and sulfur heteroatoms can also be optionally oxidized. The heterocyclic group can be attached at a heteroatom or carbon atom.

[0071] Exemplary monocyclic heterocyclic groups include pyrrolidinyl, pyrrolyl, pyrazolyl, oxetanyl, pyrazolinyl, imidazolyl, imidazolinyl, imidazolidinyl, triazolyl, oxazolyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolyl, thiadiazolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, furyl, tetrahydrofuryl, thienyl, oxadiazolyl, piperidinyl, piperazinyl, 2-oxopiperaz ... These include isopiperidinyl, 2-oxopyrrolodinyl, 2-oxoazepinyl, azepinyl, 4-piperidonyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, tetrahydropyranyl, morpholinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiamorpholinyl sulfone, 1,3-dioxolane, and tetrahydro-1,1-dioxothienyl, 1,1,4-trioxo-1,2,5-thiadiazolidin-2-yl.

[0072] Exemplary bicyclic heterocyclic groups include indolyl, dihydroindolyl, benzothiazolyl, benzoxazinyl, benzoxazolyl, benzothienyl, benzothiazinyl, quinuclidinyl, quinolinyl, tetrahydroquinolinyl, decahydroquinolyl, isoquinolinyl, tetrahydroisoquinolyl, decahydroisoquinolyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuryl, chromonyl, coumarinyl, benzylidene, benzoquinolyl ... These include zopyranyl, cinnolinyl, quinoxalinyl, indazolyl, pyrrolopyridyl, furopyridinyl (e.g., furo[2,3-c]pyridinyl, furo[3,2-b]pyridinyl] or furo[2,3-b]pyridinyl), dihydroisoindolyl, 1,3-dioxo-1,3-dihydroisoindol-2-yl, dihydroquinazolinyl (e.g., 3,4-dihydro-4-oxo-quinazolinyl), phthalazinyl, and the like.

[0073] Exemplary tricyclic heterocyclic groups include carbazolyl, dibenzazepinyl, dithienoazepinyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, phenoxazinyl, phenothiazinyl, xanthenyl, carbolinyl, and the like.

[0074] "Heterocyclyl" further refers to a heterocyclic group, as defined herein, substituted with one, two or three substituents selected from the group consisting of: (a) alkyl, (b) hydroxy (or protected hydroxy), (c)Haro, (d) oxo, i.e., =O; (e) amino, alkylamino or dialkylamino, (f) alkoxy, (g) cycloalkyl, (h) carboxy, (i) heterocyclooxy, where heterocyclooxy denotes a heterocyclic group attached through an oxygen bridge; (j) alkyl-OC(O)-, (k) mercapto, (l) nitro, (m) Cyano, (n) sulfamoyl or sulfonamide, (o) aryl, (p) alkyl-C(O)-O-, (q) aryl-C(O)—O—, (r) aryl-S-, (s) aryloxy, (t) alkyl-S--, (u) formyl, i.e., HC(O)--, (v) carbamoyl, (w) aryl-alkyl--, and (x) Aryl substituted with alkyl, cycloalkyl, alkoxy, hydroxy, amino, alkyl-C(O)—NH—, alkylamino, dialkylamino or halogen.

[0075] As used herein, the term "alkenyl" refers to a straight or branched chain hydrocarbon group having from 2 to 20 carbon atoms and containing at least one double bond. Alkenyl groups preferably have from about 2 to 8 carbon atoms.

[0076] The term "aryl", unless otherwise stated, means a polyunsaturated, aromatic, hydrocarbon substituent, which may be monocyclic or polycyclic (preferably 1-3 rings), which are fused together or covalently linked. The term "heteroaryl" means an aryl group (or ring) containing 1-4 heteroatoms selected from N, O, and S, where the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2- Thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below.

[0077] For brevity, the term "aryl" when used in combination with other terms (e.g., aryloxy, arylthioxy, arylalkyl) includes both aryl and heteroaryl rings as defined above. Thus, the term "arylalkyl" is intended to include radicals in which an aryl group is attached to an alkyl group that contains an alkyl group in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(1-naphthyloxy)propyl, etc.) (e.g., benzyl, phenethyl, pyridylmethyl, etc.).

[0078] Each of the above terms (e.g., "alkyl," "heteroalkyl," "aryl" and "heteroaryl") includes both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.

[0079] Substituents for the alkyl and heteroalkyl radicals (including groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are commonly referred to as "alkyl substituents" and "heteroalkyl substituents," respectively, and include: -OR', ═O, ═NR', ═N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -COR', -CONR' R" can be one or more of a variety of groups selected from, but not limited to, R", -OC(O)NR'R", -NR"C(O)R', -NR'-C(O)NR''R'", -NR''C(O)2R', -NR-C(NR'R''R''')=NR''", -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', -NRSO2R', -CN, and -NO2, where the number ranges from zero to (2m'+1), and m' is the total number of carbon atoms in such radical. R', R'', R''', and R'''' each preferably independently represent hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, e.g., aryl substituted with one to three halogens, substituted or unsubstituted alkyl, alkoxy, or thioalkoxy groups, or arylalkyl groups. When a compound of the invention includes more than one R group, for example, each R group is independently selected, as are each R', R'', R''', and R'''' when more than one of these groups is present. When R' and R'' are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, but not limited to, -NR'R'' is intended to include 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term "alkyl" is intended to include groups that include carbon atoms bonded to groups other than hydrogen groups, such as haloalkyl (e.g., -CF3 and -CH2CF3), and acyl (e.g., -C(O)CH3, -C(O)CF3, -C(O)CHOCH3, etc.).

[0080] Similar to the substituents described for the alkyl radicals, the aryl and heteroaryl substituents, which are commonly referred to as "aryl substituents" and "heteroaryl substituents," respectively, vary and include, for example: halogen, -OR', ═O, ═NR', ═N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -COR', -CONR'R'', -OC(O)NR'R'' , -NR''C(O)R', -NR'-C(O)NR''R''', -NR''C(O)2R', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', -NRSO2R', -CN and -NO2, -R', -N3, -CH(Ph)2, fluoro(C1-C4)alkoxy and fluoro(C1-C4)alkyl, where the number ranges from zero to the total number of open valences on the aromatic ring system, and R', R'', R''', and R'''' are preferably independently selected from hydrogen, (C1-C8)alkyl and heteroalkyl, unsubstituted aryl and heteroaryl, (unsubstituted aryl)-(C1-C4)alkyl, and (unsubstituted aryl)oxy-(C1-C4)alkyl. When a compound of the invention contains more than one R group, for example, each R group is independently selected, as are each R', R'', R''', and R'''' groups when more than one of these groups is present.

[0081] Two of the aryl substituents on adjacent atoms of the aryl or heteroaryl ring are optionally represented by the formula -TC(O)-(CRR') q -U-, where T and U are independently -NR-, -O-, -CRR'-, or a single bond, and q is an integer from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring are optionally replaced by a substituent of the formula -A-(CH2) rA and B are independently -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'-, or a single bond, and r is an integer from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -(CRR') s -X-(CR''R''') d -, where s and d are independently integers from 0 to 3, and X is -O-, -NR'-, -S-, -S(O)-, -S(O)2-, or -S(O)2NR'-. The substituents R, R', R'', and R''' are preferably independently selected from hydrogen or substituted or unsubstituted (C1-C6) alkyl.

[0082] As used herein, the term "heteroatom" includes oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).

[0083] As used herein, the term "aryloxy" refers to both an --O-aryl and an --O-heteroaryl group, where aryl and heteroaryl are defined herein.

[0084] As used herein, the term "pharmaceutically acceptable salts" refers to salts that retain the biological effectiveness and properties of the compounds of the invention, which are not biologically or otherwise undesirable. In many cases, the compounds of the invention are capable of forming acid and / or base salts due to the presence of amino and / or carboxyl groups or groups similar thereto (e.g., phenol or hydroxamic acid). Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like; particularly preferred are ammonium, potassium, sodium, calcium, and magnesium salts. Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like, specifically, for example, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound, a basic or acidic moiety, by conventional chemical methods. In general, such salts can be prepared by reacting the free acid form of these compounds with a stoichiometric amount of a suitable base (e.g., Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, and the like) or by reacting the free base form of these compounds with a stoichiometric amount of a suitable acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two.Generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred, where practicable. Lists of additional suitable salts can be found, for example, in Remington's Pharmaceutical Sciences, 20th Edition, Mack Publishing Company, Easton, Pa. (1985), which is incorporated herein by reference.

[0085] As used herein, the term "pharmaceutical acceptable carriers / excipients" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonicity agents, absorption retardants, salts, drugs, drug stabilizers, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, such materials and combinations thereof, which will be well known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Edition. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is not incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

[0086] As used herein, the term "subject" refers to an animal. Preferably, the animal is a mammal. The subject also refers to, for example, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds, etc. In a preferred embodiment, the subject is a human.

[0087] As used herein, the term "therapeutic combination" or "combination" refers to a combination of one or more active drug substances, i.e., compounds that have therapeutic utility. Typically, each such compound in the therapeutic combination of the present invention will be present in a pharmaceutical composition that includes the compound and a pharma- ceutically acceptable carrier. The compounds in the therapeutic combination of the present invention can be administered simultaneously or separately as part of a regimen.

[0088] II. Composition In general, the present invention provides a combination of therapeutic agents, pharmaceutical compositions, and methods for treating cancer using combination therapy. More specifically, a combination of immunotherapy agents (e.g., using Toll-like receptor ligands "TLRL" that activate DC in innate immunity and link adaptive immunity) and targeted therapy (e.g., PD-L / PD-1 Axis antagonists) is used to treat cancers such as gastric cancer and lung cancer.

[0089] In one aspect, the invention provides a combination of therapeutic agents, or a pharmaceutical composition, comprising: (i) an effective amount of a PD-L / PD-1 Axis antagonist; (ii) an effective amount of an immunotherapeutic agent capable of activating human dendritic cells, NK cells, monocytes, macrophages, or tumor cells, or a combination thereof; and, optionally, (iii) one or more pharma- ceutically acceptable carriers.

[0090] The combination of therapeutic agents can be provided in a single pharmaceutical composition so that both the targeted therapy and the immunotherapy can be administered together.In an alternative embodiment, the combination of therapeutic agents can be provided using two or more pharmaceutical compositions.In such an embodiment, the targeted therapy is provided in one pharmaceutical composition, and the immunotherapy is provided in a second pharmaceutical composition, and the two compounds can be administered separately, for example, at different times, by different administration routes, etc.Therefore, it can also be possible to provide the targeted therapy and the immunotherapy in different administration regimes.

[0091] Unless otherwise indicated, a reference to a compound includes the compound in any pharma- ceutically acceptable form, including any isomers (e.g., diastereomers or enantiomers), salts, solvates, polymorphs, etc. In particular, if a compound is optically active, a reference to the compound includes each of the compound's enantiomers as well as racemic mixtures of the enantiomers.

[0092] Generally, the targeted therapeutic agent and the immunotherapeutic agent are not linked to one another, for example, by a covalent linker.

[0093] A. PD-L / PD-1 axis antagonist Generally, the combinations provided herein include an entity, such as a PD-L / PD-1 Axis antagonist, that can specifically bind to a particular target, such as PD-L1, PD-L2, or PD-1. The entity can specifically or preferentially bind to PD-L1, PD-L2, or PD-1 over a non-target.

[0094] As used herein, "specifically binds" or "preferentially binds" means that the binding between two binding partners (e.g., between a targeting moiety and its binding partner) is selective for the two binding partners and can be distinguished from undesired or non-specific interactions. For example, the ability of an antigen-binding moiety to bind to a particular antigenic determinant can be measured through either enzyme-linked immunosorbent assay (ELISA) or other techniques well known to those skilled in the art, such as surface plasmon resonance techniques (analyzed by a BIAcore instrument) (Liljeblad et al., Glyco J 17, 323-329 (2000)), and traditional binding assays (Heeley, Endocr Res 28, 217-229 (2002)). The terms "anti-[antigen] antibody" and "antibody that binds to [antigen]" refer to an antibody that can bind to its respective antigen with sufficient affinity such that the antibody is useful as a diagnostic and / or therapeutic agent targeting the antigen. In some embodiments, the extent of binding of anti-[antigen] antibodies to unrelated proteins is less than about 10% of the binding of the antibodies to the antigen, e.g., as measured by radioimmunoassay (RIA). In some embodiments, antibodies that bind to [antigen] are less than 1 μM, less than 100 nM, less than 10 nM, less than 1 nM, less than 0.1 nM, less than 0.01 nM, or less than 0.001 nM (e.g., 10 -8 M or less, e.g. 10 -8 M~10 -13 M, for example 10 -9 M~10 -13 It is to be understood that the above definition is also applicable to antigen-binding moieties that bind to an antigen.

[0095] As used herein, a "PD-L / PD-1 axis antagonist" refers to a molecule that inhibits the interaction of a PD-L / PD-1 axis binding partner with one or more of the PD-L / PD-1 axis binding partners, such that impaired T cell function resulting from signaling on the PD-L / PD-1 signaling axis is eliminated, resulting in restoration or enhancement of T cell function (e.g., proliferation, cytokine production, target cell killing). As described herein, PD-L / PD-1 axis antagonists include PD-1 binding antagonists, PD-L1 binding antagonists, and PD-L2 binding antagonists.

[0096] As used herein, a "PD-1 binding antagonist" refers to a molecule that reduces, masks, inhibits, abolishes, or prevents signaling resulting from the interaction of PD-1 with one or more PD-1 binding partners, such as PD-L1, PD-L2. In some embodiments, a PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its binding partners. In certain aspects, a PD-1 binding antagonist inhibits the binding of PD-1 to PD-L1 and / or PD-L2. For example, PD-1 binding antagonists include anti-PD-1 antibodies, antigen-binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides, and other molecules that reduce, mask, inhibit, abolish, or prevent signaling resulting from the interaction of PD-1 with PD-L1 and / or PD-L2. In one embodiment, the PD-1 binding antagonist reduces negative costimulatory signaling mediated by or through cell surface proteins expressed in T lymphocytes mediating signaling through PD-1 such that dysfunctional T cells become less dysfunctional (e.g., increase effector response to antigen recognition). In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody. In a particular aspect, the PD-1 binding antagonist is MDX-1106, as described herein. In another particular aspect, the PD-1 binding antagonist is Merck 3745, as described herein. In another particular aspect, the PD-1 binding antagonist is CT-011, as described herein.

[0097] As used herein, a "PD-L1 binding antagonist" refers to a molecule that reduces, masks, inhibits, abolishes, or prevents signaling resulting from the interaction of PD-L1 with any of PD-L1's binding partners, such as PD-1, B7-1. In some embodiments, a PD-L1 binding antagonist is a molecule that inhibits the binding of PD-L1 with its binding partner. In certain aspects, a PD-L1 binding antagonist inhibits the binding of PD-L1 to PD-1 and / or B7-1. In some embodiments, PD-L1 binding antagonists include anti-PD-L1 antibodies, antigen-binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides, and other molecules that reduce, mask, inhibit, abolish, or prevent signaling resulting from PD-L1's interaction with one or more PD-L1's binding partners, such as PD-1, B7-1. In one embodiment, the PD-L1 binding antagonist reduces negative costimulatory signaling mediated by or through cell surface proteins expressed in T lymphocytes mediating signaling through PD-L1 such that dysfunctional T cells become less dysfunctional (e.g., increase effector response to antigen recognition). In some embodiments, the PD-L1 binding antagonist is an anti-PD-L1 antibody. In some particular aspects, the anti-PD-L1 antibody is YW243.55.S70 as described herein. In another particular aspect, the anti-PD-L1 antibody is MDX-1105 as described herein. In yet another particular aspect, the anti-PD-L1 antibody is MPDL3280A as described herein.

[0098] By "PD-L2 binding antagonist" herein is meant a molecule that reduces, masks, inhibits, abolishes, or prevents signaling resulting from the interaction of PD-L2 with one or more binding partners of PD-L2, such as PD-1. In some embodiments, a PD-L2 binding antagonist is a molecule that inhibits the binding of PD-L2 to its binding partner. In certain aspects, a PD-L2 binding antagonist inhibits the binding of PD-L2 to PD-1. In some embodiments, PD-L2 antagonists include anti-PD-L2 antibodies, antigen-binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides, and other molecules that reduce, mask, inhibit, abolish, or prevent signaling resulting from the interaction of PD-L2 with one or more binding partners of PD-L2, such as PD-1. In one embodiment, the PD-L2 binding antagonist reduces negative costimulatory signaling mediated by or through a cell surface protein expressed on T lymphocytes mediates signaling through PD-L2, such that dysfunctional T cells become less dysfunctional (e.g., increase effector responses to antigen recognition). In some embodiments, the PD-L2 binding antagonist is an immunoadhesin.

[0099] antibody In some embodiments, the targeted therapeutic comprises an antibody, or a functional fragment thereof.

[0100] By "immunoglobulin" or "antibody" herein is meant a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombination processes) immunoglobulin molecule (e.g., an IgG antibody), or an immunologically active (i.e., specifically binding) portion of an immunoglobulin molecule, such as an antibody fragment. Antibodies or antibody fragments may be conjugated or otherwise derivatized within the scope of the claimed subject matter. Such antibodies include IgG1, IgG2a, IgG3, IgG4 (and IgG4 subforms), and IgA isotypes.

[0101] The term "antibody" herein is used in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity and contain an Fc region or a region equivalent to an Fc region of an immunoglobulin. The terms "full-length antibody," "intact antibody," and "whole antibody" are used interchangeably herein and refer to an antibody having a heavy chain having a structure substantially similar to a native antibody structure or containing an Fc region as defined herein.

[0102] As used herein, "native antibody" refers to naturally occurring immunoglobulin molecules with various structures. For example, native IgG antibodies are heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light chains and two identical heavy chains that are disulfide-bonded. From the N- to C-terminus, each heavy chain has a variable region (VH), also called the variable heavy domain or heavy chain variable domain, followed by three constant domains (CHI, CH2, and CH3), also called the heavy chain constant region. Similarly, from the N- to C-terminus, each light chain has a variable region (VL), also called the variable light domain or light chain variable domain, followed by a constant light (CL) domain, also called the light chain constant region. The light chain of an antibody may be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain.

[0103] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv), single domain antibodies, and multispecific antibodies formed from antibody fragments. For a review of certain antibody fragments, see, e.g., Hudson et al., Nat Med 9,129-134 (2003). For a review of scFv fragments, see, e.g., Pliickthun, in The Pharmacology of Monoclonal Antibodies, 113th Edition, Rosenburg and Moore, Eds., Springer-Verlag, New York, pp. 269-315 (1994); see also WO 93 / 16185; and U.S. Pat. Nos. 5,571,894 and 5,587,458. For a discussion of Fab and F(ab')2 fragments that contain recycled receptor-binding epitope residues and have increased in vivo half-lives, see U.S. Pat. No. 5,869,046. Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, e.g., EP 404,097; WO 1993 / 01161; Hudson et al., Nat Med 9, 129-134 (2003); and Hollinger et al., Proc Natl Acad Sci USA 90, 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al., Nat Med 9, 129-134 (2003). Single domain antibodies are antibody fragments that contain all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain embodiments, single domain antibodies are human single domain antibodies (Domantis, Inc., Waltham, Massachusetts; see, e.g., U.S. Pat. No. 6,248,516 B1).Antibody fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies and production by recombinant host cells (e.g., E. coli or phages), as described herein.

[0104] As used herein, the term "antigen-binding domain" refers to a portion of an antibody that comprises an area that specifically binds to and is complementary to part or all of an antigen. An antigen-binding domain may be provided, for example, by one or more antibody variable domains (also called antibody variable regions). Specifically, an antigen-binding domain comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).

[0105] As used herein, "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable domains of the heavy and light chains of native antibodies (VH and VL, respectively) generally have a similar structure, with each domain containing four conserved framework regions (FR) and three hypervariable regions (HVR). See, for example, Kindt et al., Kuby Immunology, 6th Edition, WH Freeman and Co., page 91 (2007). A single VH or VL domain may be sufficient to confer antigen-binding specificity.

[0106] As used herein, "hypervariable region" or "HVR" refers to each region of an antibody variable domain that is hypervariable in sequence and / or forms structurally defined loops ("hypervariable loops"). Typically, native four-chain antibodies contain six HVRs, three in the VH (HI, H2, H3) and three in the VL (LI, L2, L3). HVRs typically contain amino acid residues from the hypervariable loops and / or from the complementarity determining regions (CDRs), the latter being those with the highest sequence variability and / or involved in antigen recognition. With the exception of CDR1 in VH, CDRs typically contain the amino acid residues that form the hypervariable loops. Hypervariable regions (HVRs) are also referred to as "complementarity determining regions" (CDRs), and these terms are used interchangeably herein when referring to the portions of the variable regions that form the antigen binding region. The specific regions are described by Kabat et al., USDept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and Chothia et al., J Mol Biol 196:901-917 (1987), and the definitions include overlapping or subsets of amino acid residues when compared with each other. In any event, application of either definition to refer to the CDRs of an antibody or variants thereof is intended to be within the scope of the terms defined and used herein. The exact number of residues encompassing a particular CDR will vary depending on the sequence and size of the CDR. One skilled in the art can routinely determine which residues comprise a particular CDR given the variable region amino acid sequence of an antibody.

[0107] The antibody of the invention can be a chimeric antibody, a humanized antibody, a human antibody, or an antibody fusion protein.

[0108] As used herein, a "chimeric antibody" refers to a recombinant protein that contains the variable domains of both the heavy and light antibody chains that comprise the complementarity determining regions (CDRs) of an antibody derived from one species, preferably a rodent antibody, more preferably a murine antibody, while the constant domains of the antibody molecule are derived from those of a human antibody. For veterinary applications, the constant domains of the chimeric antibody may be derived from those of other species, such as subhuman primates, cats, or dogs.

[0109] As used herein, a "humanized antibody" refers to a recombinant protein in which the CDRs from an antibody from one species, e.g., a rodent antibody, are transferred from the heavy and light variable chains of the rodent antibody to human heavy and light variable domains. The constant domains of the antibody molecule are derived from those of a human antibody. In some embodiments, certain residues in the framework regions of the humanized antibody, particularly those that contact or are close to the CDR sequences, may be modified, e.g., replaced with the corresponding residues from the original rodent, subhuman primate, or other antibody.

[0110] As used herein, "human antibody" refers to antibodies obtained, for example, from transgenic mice that have been "engineered" to produce specific human antibodies in response to antigenic challenge. In this technique, elements of human heavy and light chain loci are introduced into strains of mice derived from embryonic stem cell lines that contain targeted disruptions of endogenous heavy and light chain loci. The transgenic mice are capable of synthesizing human antibodies specific to human antigens and can be used to produce human antibody-secreting hybridomas. Methods for obtaining human antibodies from transgenic mice are described in Green et al., Nature Genet. 7:13 (1994), Lonberg et al., Nature 368:856 (1994), and Taylor et al., Int. Immun. 6:579 (1994). Fully human antibodies can also be constructed by gene or chromosomal transfection methods, as well as phage display techniques, all of which are known in the art. See, e.g., McCafferty et al., Nature 348:552-553 (1990) for the production of human antibodies and fragments thereof in vitro from immunoglobulin variable domain gene repertoires from unimmunized donors. In this technique, antibody variable domain genes are cloned in frame into either a major or a minor coat protein gene of a filamentous bacteriophage and displayed on the surface of the phage particle as functional antibody fragments. Because the filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. In this way, the phage mimics some of the properties of B cells. Phage display can be performed in a variety of formats, for reviews of which see, e.g., Johnson and Chiswell, Current Opinion in Structural Biology 3:5564-571 (1993). Human antibodies can also be generated by in vitro activated B cells. See US Pat. Nos. 5,567,610 and 5,229,275, which are incorporated by reference in their entireties.

[0111] As used herein, "antibody fusion protein" refers to a recombinantly produced antigen-binding molecule in which two or more of the same or different natural antibodies, single-chain antibodies, or antibody fragment segments with the same or different specificities are linked. A fusion protein contains at least one specific binding site. The valency of a fusion protein indicates the total number of binding arms or sites that the fusion protein has for an antigen(s) or epitope(s), i.e., monovalent, bivalent, trivalent, or multivalent. The multivalency of an antibody fusion protein means that it can utilize multiple interactions in binding to an antigen, thus increasing the avidity of the antigen or binding to different antigens. Specificity indicates how many different types of antigens or epitopes the antibody fusion protein can bind to, i.e., monospecific, bispecific, trispecific, multispecific. Using these definitions, a natural antibody, e.g., IgG, is bivalent because it has two binding arms, but is monospecific because it binds to one type of antigen or epitope. A monospecific, multivalent fusion protein has more than one binding site for the same antigen or epitope. For example, a monospecific diabody is a fusion protein with two binding sites that react with the same antigen. Fusion proteins can contain multivalent or multispecific combinations of different antibody components or multiple copies of the same antibody component. Fusion proteins can additionally contain a therapeutic agent.

[0112] In some embodiments, the targeting moiety comprises a probody, such as those described in U.S. Pat. Nos. 8,518,404, 8,513,390, and U.S. Patent Application Publication Nos. 2012 / 0237977, 2012 / 0149061, and 2013 / 0150558, which are incorporated by reference in their entireties.

[0113] Pro-antibodies are monoclonal antibodies that are selectively activated within the cancer microenvironment, focusing the activity of therapeutic antibodies to the tumor and sparing healthy tissue.

[0114] Generally, a porbody comprises at least an antibody or antibody fragment thereof (collectively referred to as "AB") capable of specifically binding to a target, where the AB is modified with a masking moiety (MM). When the AB is modified with a MM and in the presence of a target, the specific binding of the AB to the target is reduced or inhibited compared to the specific binding of the AB not modified with a MM or the specific binding of the parent AB to the target. The dissociation constant (Kd) of the MM for the AB is generally greater than the Kd of the AB to the target. When the AB is modified with a MM and in the presence of a target, the specific binding of the AB to the target can be reduced or inhibited compared to the specific binding of the AB not modified with a MM or the specific binding of the parent AB to the target. When the AB is bound to or modified with a MM, the MM can "mask" or reduce or inhibit the specific binding of the AB to its target. When the AB is bound to or modified with a MM, such binding or modification can affect a conformational change that reduces or inhibits the ability of the AB to specifically bind to its target.

[0115] In some embodiments, the pro-antibody is an activatable antibody (AA) where the AB modified with a MM can further comprise one or more cleavable moieties (CM). Such an AA presents an activatable / switchable bond to the target of the AB. An AA generally comprises an antibody or antibody fragment (AB) modified with or bound to a masking moiety (MM) and a modifiable or cleavable moiety (CM). In some embodiments, the CM contains an amino acid sequence that serves as a substrate for a protease of interest. In other embodiments, the CM provides a cysteine-cysteine ​​disulfide bond that is cleavable by reduction. In yet other embodiments, the CM provides a photolytic substrate that is activatable by photolysis.

[0116] The CM and AB of the AA can be selected such that the AB represents a binding portion of the target of interest, and the CM represents a substrate for a protease that co-localizes with the target at a treatment site in a subject. Alternatively or additionally, the CM is a cysteine-cysteine ​​disulfide bond that is cleavable as a result of reduction of this disulfide bond. The AA contains at least one of a protease-cleavable CM or a cysteine-cysteine ​​disulfide bond, and in some embodiments includes both types of CM. The AA can alternatively or additionally include a light-sensitive substrate that can be activated by a light source. The AAs disclosed herein find particular use, for example, when a protease capable of cleaving a site in the CM is present in a target-containing tissue at a treatment site (e.g., a diseased tissue, e.g., for therapeutic or diagnostic treatment) at a relatively higher level than in a tissue at a non-treatment site (e.g., a healthy tissue). The AAs disclosed herein also find particular use when, for example, a reducing agent capable of reducing a site in the CM is present in the target-containing tissue of a treatment or diagnosis site at a relatively higher level than in the tissue of a non-treatment, non-diagnostic site. The AAs disclosed herein also find particular use when a light source, for example, by a laser, capable of photolyzing a site in the CM is introduced into the target-containing tissue of a treatment or diagnosis site.

[0117] In some embodiments, the AA can provide a reduction in toxic and / or adverse side effects that may result from binding of the AB at a non-treatment site if the AB were not masked or inhibited from binding its target. If the AA contains a CM that is cleavable by a reducing agent that promotes reduction of disulfide bonds, the AB of such an AA can be selected to take advantage of the activation of the AB when the target of interest may be present at a desired treatment site characterized by elevated levels of the reducing agent, such that the environment is at a higher reduction potential, for example, than the environment at the non-treatment site.

[0118] In general, an AA can be designed by selecting an AB of interest and constructing the remainder of the AA such that, when conformationally constrained, the MM provides for masking of the AB or reducing binding of the AB to its target. Structural design requirements should be considered to provide this functional property.

[0119] Anti-PD-1 antibody In some embodiments, the TM is a monoclonal anti-PD-1 antibody.

[0120] Programmed death-1 ("PD-1") is a receptor for PD-L1 (also known as CD274, B7-H1 or B7-DC). PD-1 is an approximately 31 kD type 1 membrane protein that is a member of the extended CD28 / CTLA4 family of T cell regulators (Ishida, Y. et al. (1992) EMBO J. 11:3887-3895; U.S. Patent Application Publication Nos. 2007 / 0202100, 2008 / 0311117, 2009 / 00110667; U.S. Patent Nos. 6,808,710, 7,101,550, 7,488,802, 7,635,757, 7,722,868; WO 01 / 14557). Compared to CTLA4, PD-1 negatively regulates immune responses more broadly.

[0121] PD-1 is expressed on activated T cells, B cells, and monocytes (Agata, Y. et al. (1996) Int. Immunol. 8(5):765-772;Yamazaki, T. et al. (2002 J. Immunol. 169:5538-5545) and at low levels in natural killer (NK) T cells (Nishimura, H. et al. (2000) J. Exp. Med. 191:891-898;Martin-Orozco, N. et al. (2007), Semin. Cancer Biol. 17(4):288-298).

[0122] The extracellular region of PD-1 consists of a single immunoglobulin (Ig) V domain that is 23% identical to the equivalent domain in CTLA4 (Martin-Orozco, N. et al. (2007) Semin. Cancer Biol. 17(4):288-298). The extracellular IgV domain precedes the transmembrane region and the intracellular tail. The intracellular tail contains two phosphorylation sites located in an immunoreceptor tyrosine-based inhibitory motif and an immunoreceptor tyrosine-based switch motif, suggesting that PD-1 negatively regulates TCR signaling (Ishida, Y. et al. (1992 EMBO J. 11:3887-3895; Blank, C. et al. (Epub 2006 Dec. 29) Immunol. Immunother. 56(5):739-745).

[0123] Antibodies capable of immunospecifically binding to mouse PD-1 have been reported (see, e.g., Agata, T. et al. (1996) Int. Immunol. 8(5):765-772).

[0124] Anti-PD-1 antibodies bind to PD-1, enhance T cell function, and upregulate cell-mediated immune responses, and are used to treat diseases of T cell dysfunction, such as tumor immunity.

[0125] In some embodiments, the anti-PD-1 antibody is MK-3475 (formerly lambrolizumab, Merck), AMP-514, AMP-224 (MedImmune / AstraZeneca), BMS-936558 (MDX-1106, Bristol-Myers Squibb), or CT-011 (Curetech).

[0126] Pembrolizumab (MK-3475) is a humanized monoclonal anti-PD-1 antibody designed to reactivate antitumor immunity. Pembrolizumab affects dual ligand blockade of the PD-1 pathway by inhibiting the interaction of PD-1 on T cells with its ligands PD-L1 and PD-L2.

[0127] In some embodiments, the anti-PD-1 antibody is one of the antibodies disclosed in U.S. Pat. Nos. 8,354,509 and 8,168,757, the disclosures of which are incorporated by reference in their entireties.

[0128] Nivolumab (also known as BMS-936558 or MDX1106) is a fully human IgG4 monoclonal antibody developed by Bristol-Myers Squibb for the treatment of cancer.

[0129] In some embodiments, the anti-PD-1 antibody is one of the antibodies disclosed in WO 2004 / 056875, U.S. Pat. No. 7,488,802, and U.S. Pat. No. 8,008,449, the disclosures of which are incorporated by reference in their entireties.

[0130] AMP-514 and AMP-224 are anti-programmed cell death 1 (PD-1) monoclonal antibodies (mAbs) developed by Amplimmune, which was acquired by MedImmune.

[0131] In some embodiments, the anti-PD-1 antibody is one of the antibodies disclosed in U.S. Patent Application Publication No. 2014 / 0044738, the disclosure of which is incorporated by reference in its entirety.

[0132] In some embodiments, the six CDRs are (A) the three light chain and three heavy chain CDRs of anti-PD-1 antibody 1E3; (B) the three light chain and three heavy chain CDRs of anti-PD-1 antibody 1E8; or (C) the three light chain and three heavy chain CDRs of anti-PD-1 antibody 1H3.

[0133] Pidilizumab (CT-011) is an anti-PD-1 monoclonal antibody developed by Israel-based Curetech Ltd.

[0134] In some embodiments, the anti-PD-1 antibody is one of the antibodies described in U.S. Patent Application Publication Nos. 2008 / 0025980 and 2013 / 0022595, the disclosures of which are incorporated by reference in their entireties.

[0135] Anti-PD-L1 antibody In some embodiments, the TM is a monoclonal anti-PD-L1 antibody.

[0136] Programmed cell death 1 ligand 1 (PD-L1, also known as CD274 and B7-H1) is a ligand for PD-1 found on activated T cells, B cells, myeloid cells and macrophages. There are two endogenous ligands for PD-1, PD-L1 and PD-L2, but antitumor therapeutics have focused on anti-PD-L1 antibodies. The complex of PD-1 and PD-L1 inhibits the proliferation of CD8+ T cells and reduces the immune response (Topalian et al., 2012, N Engl J Med 366:2443-54; Brahmer et al., 2012, N Eng J Med, 366:2455-65). Anti-PD-L1 antibodies are being used to treat non-small cell lung cancer, melanoma, colorectal cancer, renal cell carcinoma, pancreatic cancer, gastric cancer, ovarian cancer, breast cancer and hematological malignancies (Brahmer et al., N Eng J Med 366:2455-65; Ott et al., 2013, Clin Cancer Res 19:5300-9; Radvanyi et al., 2013, Clin Cancer Res 19:5541; Menzies & Long, 2013, Ther Adv Med Oncol 5:278-85; Berger et al., 2008, Clin Cancer Res 14:13044-51). PD-L1 is a member of the B7 family expressed on many cell types, including APCs and activated T cells (Yamazaki et al. (2002) J. Immunol. 169:5538). PD-L1 binds to both PD-1 and B7-1. Both the binding of T cell-expressed B7-1 by PD-L1 and the binding of T cell-expressed PD-L1 by B7-1 result in T cell inhibition (Butte et al. (2007) Immunity 27: 111). Also, like other B7 family members, PD-L1 can provide costimulatory signals to T cells (Subudhi et al. (2004) J. Clin. Invest. 113:694; Tamura et al. (2001) Blood 97:1809).

[0137] As used herein, unless otherwise specified, "PD-L1" is meant to include any variant or isoform naturally expressed by a cell and / or fragments thereof that have at least one biological activity of the full-length polypeptide. Furthermore, the term "PD-L1" includes PD-L1 (Freeman et al. (2000) J. Exp. Med. 29:1027) and any variant or isoform naturally expressed by a cell, and / or fragments thereof that have at least one biological activity of the full-length polypeptide. For example, PD-L1 sequences from different species, including humans, are well known in the art (see, e.g., Chen et al., U.S. Pat. No. 6,803,192, which discloses sequences of human and mouse PD-L1; Wood et al., U.S. Pat. No. 7,105,328, which discloses human PD-L1 sequences, both of which are incorporated herein by reference in their entireties).

[0138] Anti-PD-L1 antibodies bind to PD-L1, enhance T cell function, upregulate cellular immune responses, and are used to treat T cell dysfunction diseases such as tumor immunity.

[0139] In some embodiments, the anti-PD-L1 antibodies are MPDL3280A and YW243.55.S70 (Genentech / Roche), MEDI-4736 (MedImmune / AstraZeneca), BMS-936559 (MDX-1105, Bristol-Myers Squibb), and MSB0010718C (EMD Serono / Merck KGaA).

[0140] MPDL3280A (Genentech) is an engineered anti-PD-L1 antibody designed to target PD-L1 expressed on tumor cells and tumor-infiltrating immune cells. MPDL3280A is engineered to prevent PD-L1 from binding to PD-1 and B7.1. This blockade of PD-L1 allows activation of T cells, restoring their ability to detect and attack tumor cells. MPDL3280A contains an engineered fragment crystallizable (Fc) domain designed to minimize antibody-dependent cellular cytotoxicity (ADCC) to optimize efficacy and safety.

[0141] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in U.S. Patent No. 7,943,743, the disclosure of which is incorporated by reference in its entirety.

[0142] BMS-936559 (MDX-1105, Bristol-Myers Squibb) is a fully human IgG4 anti-PD-L1 mAb that inhibits binding of the PD-L1 ligand to both PD-1 and CD80.

[0143] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in U.S. Patent No. 7,943,743, the disclosure of which is incorporated by reference in its entirety.

[0144] MSB0010718C (Merck KGaA EMD Serono) is a fully human IgG1 monoclonal antibody that binds to PD-L1.

[0145] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in WO 2013 / 079174, the disclosure of which is incorporated by reference in its entirety.

[0146] MEDI4736 (MedImmune / AstraZeneca) is a human IgG1 antibody that specifically binds to PD-L1 and prevents binding to PD-1 and CD80.

[0147] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in WO 2011 / 066389 and U.S. Patent No. 8,779,108, the disclosures of which are incorporated by reference in their entireties.

[0148] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in U.S. Patent No. 8,552,154, the disclosure of which is incorporated by reference in its entirety.

[0149] In some embodiments, the targeting moiety comprises a Fab, Fab', F(ab')2, single domain antibody, T and Ab dimer, Fv, scFv, dsFv, ds-scFv, Fd, linear antibody, minibody, diabody, bispecific antibody fragment, bibody, tribody, sc-diabody, kappa(lambda) body, BiTE, DVD-Ig, SIP, SMIP, DART, or antibody analog comprising one or more CDRs.

[0150] PD-L / PD-1 Axis Antagonists Containing Targeting Moieties In some embodiments, the PD-L / PD-1 Axis antagonist is a targeted therapy that includes a targeting moiety, such as an ADC.

[0151] By "targeting moiety (TM)" or "targeting agent" herein is meant a molecule, complex, or aggregate that specifically or selectively binds to a target molecule, cell, particle, tissue, or aggregate, generally referred to as a "target" or "marker," which are further discussed herein.

[0152] In some embodiments, the targeting moiety comprises an immunoglobulin, a protein, a peptide, a small molecule, a nanoparticle, or a nucleic acid.

[0153] Exemplary targeting agents, such as antibodies (e.g., chimeric, humanized, and human), ligands for receptors, lectins, and polysaccharides, and substrates for certain enzymes, are recognized in the art and are useful, without limitation, in the practice of the present invention. Other targeting agents include classes of compounds that do not contain a specific molecular recognition motif, but include nanoparticles, macromolecules such as poly(ethylene glycol), polysaccharides, and polyamino acids, which add molecular weight to the activating moiety. The added molecular weight affects the pharmacokinetics, e.g., serum half-life, of the activating moiety.

[0154] In some embodiments, the targeting moiety is an antibody, an antibody fragment, a bispecific antibody, or other antibody-based molecule or compound. However, other examples of targeting moieties are known in the art and may be used, such as, for example, aptamers, avimers, receptor-binding ligands, nucleic acids, biotin-avidin binding pairs, binding peptides, or proteins. The terms "targeting moiety" and "binding moiety" are used interchangeably herein.

[0155] As used herein, a "target" or "marker" refers to any entity that can specifically bind to a particular target moiety. In some embodiments, a target is specifically associated with one or more particular cell or tissue types. In some embodiments, a target is specifically associated with one or more particular disease states. In some embodiments, a target is specifically associated with one or more particular developmental stages. For example, a cell type specific marker is typically expressed at a level at least 2-fold greater in that cell type than in a reference population of cells. In some embodiments, a cell type specific marker is present at a level at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 50-fold, at least 100-fold, or at least 1,000-fold greater than its average expression in a reference population. Detection or measurement of a cell type specific marker may allow one to distinguish a cell type(s) of interest from many, most, or all other types of cells. In some embodiments, a target can include proteins, carbohydrates, lipids, and / or nucleic acids, as described herein.

[0156] A substance is considered to be "targeted" for purposes described herein if it specifically binds to a nucleic acid targeting moiety. In some embodiments, the nucleic acid targeting moiety specifically binds to the target under stringent conditions. A complex or compound of the invention that includes a targeting moiety is considered to be "targeted" if the targeting moiety specifically binds to the target, thereby delivering the entire complex or compound composition to a particular organ, tissue, cell, extracellular matrix component, and / or intracellular compartment. In some embodiments, the target can include a protein, carbohydrate, lipid, and / or nucleic acid, as described herein.

[0157] In certain embodiments, the compounds of the present invention comprise a targeting moiety that specifically binds to one or more targets (e.g., antigens) associated with an organ, tissue, cell, extracellular matrix component, and / or intracellular compartment. In some embodiments, the compounds of the present invention comprise a targeting moiety that specifically binds to a target associated with a particular organ or organ system. In some embodiments, the compounds of the present invention comprise a nuclear targeting moiety that specifically binds to one or more intracellular targets (e.g., organelles, intracellular proteins). In some embodiments, the compounds of the present invention comprise a targeting moiety that specifically binds to a target associated with a diseased organ, tissue, cell, extracellular matrix component, and / or intracellular compartment. In some embodiments, the compounds of the present invention comprise a targeting moiety that specifically binds to a target associated with a particular cell type (e.g., endothelial cells, cancer cells, malignant cells, prostate cancer cells, etc.).

[0158] In some embodiments, compounds of the present invention comprise a targeting moiety that binds to a target that is specific for one or more particular tissue types (e.g., liver tissue vs. prostate tissue). In some embodiments, compounds of the present invention comprise a targeting moiety that binds to a target that is specific for one or more particular cell types (e.g., T cells vs. B cells). In some embodiments, compounds of the present invention comprise a targeting moiety that binds to a target that is specific for one or more particular disease states (e.g., tumor cells vs. healthy cells). In some embodiments, compounds of the present invention comprise a targeting moiety that binds to a target that is specific for one or more particular developmental stages (e.g., liver cells vs. differentiated cells).

[0159] In some embodiments, the target may be a marker that is exclusively or primarily associated with one or several cell types, with one or several diseases, and / or with one or several developmental stages. A cell type specific marker is typically expressed at a level at least two-fold greater in that cell type than in a reference population of cells, which may consist of, for example, a mixture containing approximately equal amounts of cells from multiple (e.g., 5-10 or more) different tissues or organs. In some embodiments, a cell type specific marker is present at a level that is at least three-fold, at least four-fold, at least five-fold, at least six-fold, at least seven-fold, at least eight-fold, at least nine-fold, at least ten-fold, at least fifty-fold, at least one hundred-fold, or at least one thousand-fold greater than its average expression in the reference population. Detection or measurement of a cell type specific marker may allow one to distinguish the cell type(s) of interest from many, most, or all other types of cells.

[0160] In some embodiments, the targets include proteins, carbohydrates, lipids, and / or nucleic acids. In some embodiments, the targets include proteins and / or characteristic portions thereof, such as tumor markers, integrins, cell surface receptors, transmembrane proteins, intracellular proteins, ion channels, membrane transporter proteins, enzymes, antibodies, chimeric proteins, glycoproteins, and the like. In some embodiments, the targets include carbohydrates and / or characteristic portions thereof, such as glycoproteins, sugars (e.g., monosaccharides, disaccharides, polysaccharides), glycocalyx (i.e., the carbohydrate-rich marginal zone on the outer surface of most eukaryotic cells), and the like. In some embodiments, the targets include lipids and / or characteristic portions thereof, such as oils, fatty acids, glycerides, hormones, steroids (e.g., cholesterol, bile acids), vitamins (e.g., vitamin E), phospholipids, sphingolipids, lipoproteins, and the like. In some embodiments, the targets include nucleic acids and / or characteristic portions thereof, such as DNA nucleic acids; RNA nucleic acids; modified DNA nucleic acids; modified RNA nucleic acids; nucleic acids including any combination of DNA, RNA, modified DNA, and modified RNA.

[0161] Many markers are known in the art. Typical markers include cell surface proteins, such as receptors. Exemplary receptors include, but are not limited to, transferrin receptors; LDL receptors; growth factor receptors, such as epidermal growth factor receptor family members (e.g., EGFR, Her2, Her3, Her4) or vascular endothelial growth factor receptors, cytokine receptors, cell adhesion molecules, integrins, selectins, and CD molecules. Markers can be molecules that are present exclusively or in higher amounts on malignant cells, such as tumor antigens.

[0162] In some embodiments, the targeting moiety specifically or preferentially binds to tumor cells compared to non-tumor cells.

[0163] Binding of the targeting moiety to tumor cells can be determined using assays known in the art.

[0164] In some embodiments, the tumor cells are from a carcinoma, sarcoma, lymphoma, myeloma, or central nervous system cancer.

[0165] In some embodiments, the targeting moiety is capable of binding specifically or preferentially to a tumor antigen compared to a non-tumor antigen.

[0166] In certain embodiments, the target is a tumor marker. In some embodiments, the tumor marker is an antigen present in the tumor that is not present in normal organs, tissues, and / or cells. In some embodiments, the tumor marker is an antigen that is more prevalent in tumors than in normal organs, tissues, and / or cells. In some embodiments, the tumor marker is an antigen that is more prevalent in malignant cancer cells than in normal cells.

[0167] In some embodiments, the targeting moiety comprises folic acid or a derivative thereof.

[0168] In recent years, research on folic acid has made great progress. Folic acid is a small molecule vitamin required for cell division. Tumor cells divide abnormally and express many folate receptors (FRs) on the surface of tumor cells to capture enough folic acid to support cell division.

[0169] Data show that FR expression in tumor cells is 20-200 times higher than that in normal cells. The expression rate of FR in various malignant tumors is 82% in ovarian cancer, 66% in non-small cell lung cancer, 64% in renal cancer, 34% in colon cancer, and 29% in breast cancer (Xia W, Low PS. Late-targeted therapies for cancer. J Med Chem. 2010; 14; 53 (19): 6811-24). The expression rate of FA and the malignancy of epithelial tumor invasion and metastasis are positively correlated. FA enters cells through FR-mediated endocytosis, and FA forms FA complexes with drugs through its carboxyl group to enter cells. Under acidic conditions (pH value 5), FR dissociates from FA, and FA releases the drug into the cytoplasm.

[0170] Clinically, this system can be used to deliver drugs that selectively attack tumor cells. Folic acid has a small molecular weight, is non-immunogenic and highly stable, and is inexpensive to synthesize. More importantly, the chemical bond between the drug and the carrier is simple, so using FA as a targeting moiety to construct a drug delivery system has become an active field of cancer treatment research. EC145 (FA chemotherapy drug conjugate compound), which is currently in clinical trials, can effectively attack cancer cells (Pribble P and Edelman MJ. EC145: a novel targeted agent for adenocarcinoma of the lung. Expert Opin. Investig. Drugs (2012) 21: 755-761).

[0171] In some embodiments, the targeting moiety includes the extracellular domain (ECD) or soluble form of PD-1, PDL-1, CTLA4, CD47, BTLA, KIR, TIM3, 4-1BB, and LAG3, a full-length portion of the surface ligand amphiregulin, betacellulin, EGF, ephrin, epigen, epiregulin, IGF, neuregulin, TGF, TRAIL, or VEGF.

[0172] In some embodiments, the targeting moiety comprises a Fab, Fab', F(ab')2, single domain antibody, T and Ab dimer, Fv, scFv, dsFv, ds-scFv, Fd, linear antibody, minibody, diabody, bispecific antibody fragment, bibody, tribody, sc-diabody, kappa(lambda) body, BiTE, DVD-Ig, SIP, SMIP, DART, or an antibody analog comprising one or more CDRs.

[0173] In some embodiments, the targeting moiety is an antibody, or an antibody fragment, that is selected based on its specificity for an antigen expressed on a target cell or target site of interest. A wide variety of tumor-specific or other disease-specific antigens have been identified, and antibodies against these antigens have been used or proposed for use in treating such tumors or other diseases. Antibodies known in the art can be used with the compounds of the present invention, particularly for treating diseases with which the target antigen is associated. Examples of target antigens (and their associated diseases) that can be targeted by the antibody linker drug conjugates of the invention include CD2, CD19, CD20, CD22, CD27, CD33, CD37, CD38, CD40, CD44, CD47, CD52, CD56, CD70, CD79, CD137, 4-1BB, 5T4, AGS-5, AGS-16, angiopoietin 2, B7.1, B7.2, B7DC, B7H1, B7H2, B7H3, BT-062, BTLA, CAIX, carcinoembryonic antigen, CTLA4, Crypto, ED-B, ErbB1, ErbB2, ErbB3, ErbB4, EGFL7, EpCAM, EphA2, EphA3, EphB2, FAP, fibronectin, Examples of such receptors include folate receptor, ganglioside GM3, GD2, glucocorticoid-induced tumor necrosis factor receptor (GITR), gp100, gpA33, GPNMB, ICOS, IGF1R, integrin αν, integrin ανβ, KIR, LAG-3, Lewis Y, mesothelin, c-MET, MN carbonic anhydrase IX, MUC1, MUC16, nectin-4, NKGD2, NOTCH, OX40, OX40L, PD-1, PDL1, PSCA, PSMA, RANKL, ROR1, ROR2, SLC44A4, syndecan-1, TACI, TAG-72, tenascin, TIM3, TRAILR1, TRAILR2, VEGFR-1, VEGFR-2, and VEGFR-3.

[0174] In some embodiments, the targeting moiety comprises a particle (targeting particle), preferably a nanoparticle, optionally a targeted nanoparticle attached to a targeting molecule that can specifically or preferentially bind to the target. In some embodiments, the targeting particle itself directs the compound of the invention (e.g., by enrichment in tumor cells or tissues) where there is no additional targeting molecule attached.

[0175] As used herein, "nanoparticle" refers to any particle having a diameter less than 1000 nm. In some embodiments, the therapeutic agent and / or targeting molecule can be associated with the polymer matrix. In some embodiments, the targeting molecule can be covalently associated with the surface of the polymer matrix. In some embodiments, the covalent association is mediated by a linker. In some embodiments, the therapeutic agent can be associated with the surface of the polymer matrix, encapsulated within the polymer matrix, surrounded by the polymer matrix, and / or dispersed throughout the polymer matrix. U.S. Pat. No. 8,246,968, incorporated in its entirety.

[0176] In general, the nanoparticles of the present invention include any type of particle. Any particle can be used in accordance with the present invention. In some embodiments, the particles are biodegradable and biocompatible. In general, a biocompatible material is not toxic to cells. In some embodiments, a material is considered to be biocompatible if its addition to a cell results in cell death below a certain threshold. In some embodiments, a material is considered to be biocompatible if its addition to a cell does not induce adverse effects. Generally, a biodegradable material is one that undergoes degradation under physiological conditions over a therapeutically relevant period of time (e.g., weeks, months, or years). In some embodiments, a biodegradable material is a material that can be broken down by cellular mechanisms. In some embodiments, a biodegradable material is a material that can be broken down by chemical processes. In some embodiments, the particles are materials that are both biocompatible and biodegradable. In some embodiments, the particles are materials that are biocompatible but not biodegradable. In some embodiments, the particles are materials that are biodegradable but not biocompatible.

[0177] In some embodiments, the particles are sized larger than the renal excretion limit (e.g., particles having a diameter greater than 6 nm). In some embodiments, the particles are small enough to avoid clearance of the particles from the bloodstream by the liver (e.g., particles having a diameter less than 1000 nm). In general, the physiochemical characteristics of the particles should allow the targeted particles to circulate longer in the plasma by reducing renal excretion and liver clearance.

[0178] It is often desirable to use a population of particles that are relatively uniform in size, shape, and / or composition so that each particle has similar properties. For example, at least 80%, at least 90%, or at least 95% of the particles may have a diameter or maximum dimension that is within 5%, 10%, or 20% of the average diameter or maximum dimension. In some embodiments, the population of particles may be heterogeneous with respect to size, shape, and / or composition.

[0179] Zeta potential is a measure of the surface potential of a particle. In some embodiments, the particle has a zeta potential ranging between -50mV and +50mV. In some embodiments, the particle has a zeta potential ranging between -25mV and +25mV. In some embodiments, the particle has a zeta potential ranging between -10mV and +10mV. In some embodiments, the particle has a zeta potential ranging between -5mV and +5mV. In some embodiments, the particle has a zeta potential ranging between 0mV and +50mV. In some embodiments, the particle has a zeta potential ranging between 0mV and +25mV. In some embodiments, the particle has a zeta potential ranging between 0mV and +10mV. In some embodiments, the particle has a zeta potential ranging between 0mV and +5mV. In some embodiments, the particle has a zeta potential ranging between 0mV and +10mV. In some embodiments, the particle has a zeta potential ranging between 0mV and +5mV. In some embodiments, the particle has a zeta potential ranging between -50mV and 0mV. In some embodiments, the particles have a zeta potential ranging between -25 mV and 0 mV. In some embodiments, the particles have a zeta potential ranging between -10 mV and 0 mV. In some embodiments, the particles have a zeta potential ranging between -5 mV and 0 mV. In some embodiments, the particles have a substantially neutral zeta potential (i.e., approximately 0 mV).

[0180] A variety of different particles can be used in accordance with the present invention. In some embodiments, the particles are spherical or globular. In some embodiments, the particles are spherical or globular. In some embodiments, the particles are flat or plate-shaped. In some embodiments, the particles are cubic or cuboid. In some embodiments, the particles are oval or elliptical. In some embodiments, the particles are cylindrical, conical, or pyramidal.

[0181] In some embodiments, the particle is a microparticle (e.g., a microsphere). In general, "microparticle" refers to any particle having a diameter less than 1000 μm. In some embodiments, the particle is a picoparticle (e.g., picospheres). In general, "picoparticle" refers to any particle having a diameter less than 1 nm. In some embodiments, the particle is a liposome. In some embodiments, the particle is a micelle.

[0182] The particles can be solid or hollow and can include one or more layers (e.g., nanoshells, nanorings). In some embodiments, each layer has a unique composition and unique properties compared to the other layer(s). For example, the particles can have a core / shell structure, where the core is the first layer and the shell is the second layer. The particles can include multiple different layers. In some embodiments, the first layer can be substantially crosslinked, the second layer is substantially non-crosslinked, etc. In some embodiments, one, some, or all of the different layers can include one or more therapeutic or diagnostic agents to be delivered. In some embodiments, the first layer includes the agent to be delivered, the second layer does not include the agent to be delivered, etc. In some embodiments, each individual layer includes a different agent or set of agents to be delivered.

[0183] In some embodiments, the particle is porous, which means that the particle contains holes or channels that are typically small compared to the size of the particle.For example, the particle can be a porous silica particle, such as a mesoporous silica nanoparticle, or can have a mesoporous silica coating (Lin et al., 2005, J.Am.Chem.Soc., 17:4570).The particle can have pores ranging from about 1 nm to about 50 nm in diameter, such as about 1 to 20 nm in diameter.About 10% to 95% of the volume of the particle can be hollow within the pores or channels.

[0184] The particles may have a coating layer. The use of a biocompatible coating layer may be beneficial, for example, when the particles contain a material that is toxic to cells. Suitable coating materials include, but are not limited to, natural proteins such as bovine serum albumin (BSA), biocompatible hydrophilic polymers, such as polyethylene glycol (PEG) or PEG derivatives, phospholipids-(PEG), silica, lipids, polymers, carbohydrates such as dextran, other nanoparticles that can associate with the nanoparticles of the present invention, and the like. The coating may be applied or organized by various methods, such as immersion, using layer-by-layer adsorption techniques, self-assembly, conjugation, and the like. Self-assembly refers to the process of spontaneous organization into higher-order structures that relies on the natural attraction of components (e.g., molecules) to each other into higher-order structures. Typically, it occurs through the random movement of molecules and the formation of bonds based on size, shape, composition, or chemical properties.

[0185] Examples of polymers include polyalkylenes (e.g., polyethylene), polycarbonates (e.g., poly(1,3-dioxane-2-one)), polyanhydrides (e.g., poly(sebacic anhydride)), polyhydroxy acids (e.g., poly(β-hydroxyalkanoates)), polyfumarates, polycaprolactones, polyamides (e.g., polycaprolactam), polyacetals, polyethers, polyesters (e.g., polylactides, polyglycolides), poly(orthoesters), polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, and polyamines. In some embodiments, polymers according to the present invention include those approved for use in humans by the U.S. Food and Drug Administration (FDA) at 21 C.FR §177.2600, including, but not limited to, polyesters (e.g., polylactic acid, polyglycolic acid, poly(lactic-co-glycolic acid), polycaprolactone, polyvalerolactone, poly(1,3-dioxan-2-one)); polyanhydrides (e.g., poly(sebacic anhydride)); polyethers (e.g., polyethylene glycol); polyurethanes; polymethacrylates; polyacrylates; and polycyanoacrylates.

[0186] In some embodiments, the particles can be non-polymeric particles (e.g., metal particles, quantum dots, ceramic particles, polymers with inorganic materials, bone-derived materials, bone substitutes, viral particles, etc.). In some embodiments, the therapeutic or diagnostic agent to be delivered can be associated with the surface of such non-polymeric particles. In some embodiments, the non-polymeric particles are aggregates of non-polymeric components, such as aggregates of metal atoms (e.g., gold atoms). In some embodiments, the therapeutic or diagnostic agent to be delivered can be associated with the surface of the aggregates of non-polymeric components and / or can be encapsulated within, surrounded by, and / or dispersed throughout the aggregates of non-polymeric components.

[0187] Particles (e.g., nanoparticles, microparticles) can be prepared using any method known in the art. For example, particulate formulations can be formed by methods such as nanoprecipitation, flow focusing fluidic channel, spray drying, single and double emulsion solvent evaporation, solvent extraction, phase separation, milling, microemulsion processing, microfabrication, nanofabrication, sacrificial layers, simple and complex coacervation, and other methods known to those skilled in the art. Alternatively or additionally, aqueous and organic solvent synthesis of monodisperse semiconducting, conductive, magnetic, organic and other nanoparticles have been described (Pellegrino et al., 2005, Small, 1:48; Murray et al., 2000, Ann. Rev. Mat. Sci., 30:545; and Trindade et al., 2001, Chem. Mat., 13:3843).

[0188] Methods for making microparticles for delivery of encapsulated drugs have been described in the literature (see, e.g., Doubrow, ed., "Microcapsules and Nanoparticles in Medicine and Pharmacy," CRC Press, Boca Raton, 1992; Mathiowitz et al., 1987, J. Control. Release, 5:13; Mathiowitz et al., 1987, Reactive Polymers, δ:275, and Mathiowitz et al., 1988, J. Appl. Polymer Sci., 35:755).

[0189] In some embodiments, the targeting moiety comprises a nucleic acid targeting moiety.

[0190] In general, a nucleic acid targeting moiety is any polynucleotide that binds to an organ, tissue, cell, extracellular matrix component, and / or component associated with an intracellular compartment (the target).

[0191] In some embodiments, the nucleic acid targeting moiety is an aptamer.

[0192] Aptamers are polynucleotides that typically bind to specific target structures associated with specific organs, tissues, cells, extracellular matrix components, and / or intracellular compartments. In general, the targeting function of aptamers is based on the three-dimensional structure of the aptamer. In some embodiments, the binding of an aptamer to a target is typically mediated by interactions between the two-dimensional and / or three-dimensional structures of both the aptamer and the target. In some embodiments, the binding of an aptamer to a target is not based solely on the primary sequence of the aptamer, but depends on the three-dimensional structure(s) of the aptamer and / or the target. In some embodiments, aptamers bind to their targets via complementary Watson-Crick base pairing, which is interrupted by structures that disrupt base pairing (e.g., hairpin loops).

[0193] In some embodiments, the nucleic acid targeting moiety is a spiegelmer (PCT Publications WO 98 / 08856, WO 02 / 100442, and WO 06 / 117217). In general, spiegelmers are synthetic mirror image nucleic acids (i.e., mirror image aptamers) that can specifically bind to a target. Spiegelmers are characterized by structural features that make them insensitive to exo- and endo-nucleases.

[0194] One skilled in the art will recognize that any nucleic acid targeting moiety (e.g., aptamer or spiegelmer) capable of specifically binding to a target can be used in accordance with the present invention. In some embodiments, the nucleic acid targeting moiety used in accordance with the present invention can target a marker associated with a disease, disorder, and / or condition. In some embodiments, the nucleic acid targeting moiety used in accordance with the present invention can target a cancer-associated target. In some embodiments, the nucleic acid targeting moiety used in accordance with the present invention can target a tumor marker. Any type of cancer and / or any tumor marker can be targeted using a nucleic acid targeting moiety in accordance with the present invention. To give some examples, the nucleic acid targeting moiety can target a marker associated with prostate cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, endometrial cancer, ovarian cancer, bone cancer, esophageal cancer, liver cancer, gastric cancer, brain tumor, skin melanoma, and / or leukemia.

[0195] The nucleic acids of the present invention (including nucleic acid targeting moieties and / or functional RNAs to be delivered, such as RNAi-inducing entities, ribozymes, tRNAs, etc., described in more detail below) can be prepared according to any available technique, including, but not limited to, chemical synthesis, enzymatic synthesis, enzymatic or chemical cleavage of longer precursors, etc. Methods for synthesizing RNA are known in the art (see, for example, Gait, MJ (ed.) Oligonucleotide synthesis: a practical approach, Oxford [Oxfordshire], Washington, DC: IRL Press, 1984, and Herdewijn, P. (ed.) Oligonucleotide synthesis: methods and applications, Methods in molecular biology, v.288 (Clifton, NJ) Totowa, NJ: Humana Press, 2005).

[0196] The nucleic acids forming the nucleic acid targeting moiety may include naturally occurring nucleosides, modified nucleosides, naturally occurring nucleosides having a hydrocarbon linker (e.g., alkylene) or polyether linker (e.g., PEG linker) inserted between one or more nucleosides, modified nucleosides having a hydrocarbon or PEG linker inserted between one or more nucleosides, or combinations thereof. In some embodiments, the nucleosides or modified nucleotides of the nucleic acid targeting moiety may be replaced with a hydrocarbon linker or polyether linker, provided that the binding affinity and selectivity of the nucleic acid targeting moiety is not substantially reduced by the substitution (e.g., the dissociation constant of the nucleic acid targeting moiety for the target is about 1×10 -3 should not exceed M).

[0197] It will be understood by those skilled in the art that the nucleic acid of the present invention may contain only the types of nucleotides found in naturally occurring nucleic acids, or may alternatively contain one or more nucleotide analogs, or may have a structure that is otherwise different from that of naturally occurring nucleic acids. U.S. Patent Nos. 6,403,779, 6,399,754, 6,225,460, 6,127,533, 6,031,086, 6,005,087, 5,977,089, and references therein, disclose a wide variety of specific nucleotide analogs and modified forms that can be used. See Crooke, S. (ed.) Antisense Drug Technology: Principles, Strategies, and Applications (1st ed.) Marcel Dekker; ISBN: 0824705661; 1st ed. (2001) and references therein. For example, 2' modifications include halo, alkoxy, and allyloxy groups. In some embodiments, the 2'-OH group is replaced with a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is a C1-C6 alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I. Examples of modified linkages include phosphorothioate and 5'-N-phosphoramidite linkages.

[0198] Nucleic acids containing a variety of different nucleotide analogs, modified backbones, or non-natural internucleoside linkages can be utilized in accordance with the present invention. The nucleic acids of the present invention can contain natural nucleosides (i.e., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) or modified nucleosides. Examples of modified nucleotides include base-modified nucleosides (e.g., aracytidine, inosine, isoguanosine, nebularine, pseudouridine, 2,6-diaminopurine, 2-aminopurine, 2-thiothymidine, 3-deaza-5-azacytidine, 2'-deoxyuridine, 3-nitrilpyrrole, 4-methylindole, 4-thiouridine, 4-thiothymidine, 2-aminoadenosine, 2-thiothymidine, 2-thiouridine, 5-bromocytidine, 5-iodouridine, inosine, 6-azauridine, 6-chloropurine, 7-deazaadenosine, 7-deazaguanosine, 8-azaadenosine, 8-azidoadenosine, benzimidazole, M1-methyladenosine, pyrrolo-pyrimidine, 2-amino-6-chloropurine, 7-deazaadenosine, 7-deazaguanosine, 8-azidoadenosine, benzimidazole, M1-methyladenosine, pyrrolo-pyrimidine, 2-amino-6-chloropurine, 7-deaza-pyridine, 7-deaza-pyridine, 8-azido-pyridine ... These include purines, 3-methyladenosine, 5-propynylcytidine, 5-propynyluridine, 5-bromouridine, 5-fluorouridine, 5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically or biologically modified bases (e.g., methylated bases), modified sugars (e.g., 2'-fluororibose, 2'-aminoribose, 2'-azidoribose, 2'-O-methylribose, L-enantiomer acid nucleosides arabinose, and hexose), modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages), and combinations thereof. Natural and modified nucleotide monomers for the chemical synthesis of nucleic acids are readily available. In some cases, nucleic acids containing such modifications exhibit improved properties compared to nucleic acids consisting only of naturally occurring nucleotides. In some embodiments, the nucleic acid modifications described herein are utilized to reduce and / or prevent digestion by nucleases (e.g., exonucleases, endonucleases, etc.).For example, the structure of the nucleic acid can be stabilized by including nucleotide analogues at the 3' end of one or both strands to reduce digestion.

[0199] Modified nucleic acids need not be uniformly modified along the entire length of the molecule. Different nucleotide modification forms and / or backbone structures may be present at various positions of the nucleic acid. One skilled in the art will understand that nucleotide analogs or other modification form(s) may be placed at any position(s) of the nucleic acid such that the function of the nucleic acid is not substantially affected. By way of example only, the modification form may be placed at any position of the nucleic acid targeting moiety such that the ability of the nucleic acid targeting moiety to specifically bind to the target is not substantially affected. The modified region may be at the 5'-end and / or 3'-end of one or both strands. For example, modified nucleic acid targeting moieties in which approximately 1-5 residues at either the 5'-end and / or 3'-end of both strands are nucleotide analogs and / or have backbone modifications have been used. The modification may be a 5'- or 3'-end modification. One or both nucleic acid strands may contain at least 50% unmodified nucleotides, at least 80% unmodified nucleotides, at least 90% unmodified nucleotides, or 100% unmodified nucleotides.

[0200] The nucleic acids of the present invention may include modifications to sugars, nucleosides, or internucleoside linkages, such as those described in, for example, US Patent Application Publication Nos. 2003 / 0175950, 2004 / 0192626, 2004 / 0092470, 2005 / 0020525, and 2005 / 0032733. The present invention encompasses the use of any nucleic acid with any one or more of the modifications described therein. For example, many terminal conjugates, such as lipids, such as cholesterol, lithocholic acid, aluric acid, or long alkyl branched chains, have been reported to improve cellular uptake. Analogs and modified forms can be tested, for example, using any suitable assay known in the art, to select those that result in, for example, improved delivery of therapeutic or diagnostic agents, improved specific binding of nucleic acid targeting moieties to targets, etc. In some embodiments, the nucleic acids of the present invention may include one or more non-natural nucleoside linkages. In some embodiments, one or more internal nucleotides at the 3' end, 5' end, or both the 3' and 5' ends of the nucleic acid targeting portion are inverted to obtain a linkage, such as a 3'-3' linkage or a 5'-5' linkage.

[0201] In some embodiments, the nucleic acids of the present invention are not synthetic, but are naturally occurring entities that have been isolated from their natural environment.

[0202] Any method can be used to design novel nucleic acid targeting moieties (see, e.g., U.S. Pat. Nos. 6,716,583, 6,465,189, 6,482,594, 6,458,543, 6,458,539, 6,376,190, 6,344,318, 6,242,246, 6,184,364, 6,001,577, 5,958,691, 5,874,218, 5,853,984, 5,843, (See U.S. Patent Application Publication Nos. 2005 / 0069910, 2004 / 0072234, 2004 / 0043923, 2003 / 0087301, 2003 / 0054360, and 2002 / 0064780.) The present invention provides methods for designing novel nucleic acid targeting moieties. The present invention further provides methods for isolating or identifying novel nucleic acid target moieties from a mixture of candidate nucleic acid target moieties.

[0203] Nucleic acid targeting moieties can be designed and / or identified to bind proteins, carbohydrates, lipids, and / or nucleic acids. In some embodiments, nucleic acid targeting moieties can be designed and / or identified for use in complexes of the invention that bind proteins and / or characteristic portions thereof, such as tumor markers, integrins, cell surface receptors, transmembrane proteins, intracellular proteins, ion channels, membrane transport proteins, enzymes, antibodies, chimeric proteins, etc. In some embodiments, nucleic acid targeting moieties can be designed and / or identified for use in complexes of the invention that bind carbohydrates and / or characteristic portions thereof, such as glycoproteins, sugars (e.g., monosaccharides, disaccharides, and polysaccharides), glycocalyx (i.e., the carbohydrate-rich marginal zone on the outer surface of most eukaryotic cells). In some embodiments, nucleic acid targeting moieties can be designed and / or identified for use in complexes of the invention that bind lipids and / or characteristic portions thereof, such as oils, saturated fatty acids, unsaturated fatty acids, glycerides, hormones, steroids (e.g., cholesterol, bile acids), vitamins (e.g., vitamin E), phospholipids, sphingolipids, lipoproteins, etc. In some embodiments, nucleic acid targeting moieties can be designed and / or identified for use in the complexes of the invention that bind to nucleic acids and / or distinctive portions thereof, such as DNA nucleic acids; RNA nucleic acids; modified DNA nucleic acids; modified RNA nucleic acids; nucleic acids including any combination of DNA, RNA, modified DNA, and modified RNA.

[0204] Nucleic acid targeting moieties (e.g., aptamers or spiegelmers) can be designed and / or identified using any available method. In some embodiments, nucleic acid targeting moieties are designed and / or identified by identifying nucleic acid targeting moieties from a candidate mixture of nucleic acids. Exponential enrichment of nucleic acids (SELEX) or variations thereof is a commonly used method for identifying nucleic acid targeting moieties that bind to a target from a candidate mixture of nucleic acids.

[0205] Nucleic acid targeting moieties that selectively bind to any target can be isolated by the SELEX process or variations thereof, provided that the target can be used as a target in the SELEX process.

[0206] B. Immunotherapeutic Agents Generally, the combinations and compositions of the invention include an immunotherapeutic agent.

[0207] As used herein, "immunotherapeutic agent" refers to a compound, molecule, or drug that can stimulate or enhance the body's immune system or tumor cells. Immunotherapeutic agents are used to treat disease by inducing, enhancing, or suppressing an immune response. Immunotherapeutic agents of the present invention are generally designed to elicit or enhance an immune response, rather than suppressing an immune response.

[0208] In general, the immunotherapeutic agent of the present invention acts directly or indirectly on Toll-like receptors, nucleotide-oligomerization domain-like receptors, RIG-I-like receptors, c-type lectin receptors, or cytoplasmic DNA sensors, or combinations thereof. In particular, the immunotherapeutic agent of the present invention can activate human plasmacytoid dendritic cells, myeloid dendritic cells, NK cells, or tumor cells, or combinations thereof.

[0209] In some embodiments, the immunotherapeutic agents of the invention activate human immune cells, including but not limited to dendritic cells, macrophages, monocytes, myeloid-derived suppressor cells, NK cells, B cells, T cells or tumor cells, or combinations thereof.

[0210] Dendritic cells are the most potent antigen-presenting cells. They play a key role in initiating both innate and adaptive immune responses. They also play a major role in inducing and maintaining immune tolerance.

[0211] As used herein, "dendritic cells" (DC) refers to a heterogeneous cell population that includes two major subtypes: myeloid DC (mDC) and plasmacytoid DC (pDC) (Steinman et al., 1979, J. Exp. Med., 149, 1-16). These two blood DC subsets were originally distinguished by their expression of CD11c (an integrin complement receptor) and CD123 (IL-3Rα). The pDC and mDC populations each make up between about 0.2 and about 0.6% of the PBMC population in humans.

[0212] As used herein, "pDC" refers to plasmacytoid dendritic cells, which represent a subtype of dendritic cells found in blood and peripheral lymphoid organs. These cells express surface markers CD123, BDCA-2 (CD303), and BDCA-4 (CD304), and HLA-DR, but not CD11c, CD14, CD3, CD20, or CD56, which distinguishes them from conventional dendritic cells, monocytes, T cells, B cells, and NK cells. As components of the innate immune system, these cells express intracellular Toll-like receptors 7 and 9, which allow for the detection of viral and bacterial nucleic acids, such as ssRNA or CpG DNA motifs. Upon stimulation and subsequent activation, these cells produce large amounts of type I interferons (mainly IFN-α and IFN-β) and type III interferons (e.g., IFN-λ), which are important pleiotropic antiviral compounds that mediate a wide range of effects. By producing a large number of type I interferons, cytokines and chemokines, plasmacytoid dendritic cells are involved in a wide range of innate and adaptive immune responses in the body. They can regulate NK cells, T cells, B cells and other cells involved in immune response strength, duration and response pattern, and therefore play a very important function in tumors, infections and autoimmune diseases (Liu YJ. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol. 2005; 23: 275-306. Gilliet M, Cao W, Liu YJ. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat Rev Immunol. 2008 Aug; 8 (8): 594-606).

[0213] As used herein, "mDC" refers to myeloid dendritic cells and refers to a subtype of circulating dendritic cells found in blood and peripheral lymphoid organs. These cells express surface markers CD11c, CD1a, HLA-DR, and either BDCA-1 (CD1c) or BDCA-3 (CD141). They do not express BDCA-2 or CD123, which distinguishes them from pDC. mDC also do not express CD3, CD20, or CD56. As components of the innate immune system, mDC express Toll-like receptors (TLRs), including TLR2, 3, 4, 5, 6, and 8, which allow for the detection of bacterial and viral components. Upon stimulation and subsequent activation, these cells are the most potent antigen-presenting cells, activating antigen-specific CD4 as well as CD8 T cells. In addition, mDC have the ability to produce large amounts of IL-12 and IL23, which is important for the induction of Th1- or Th17-cell-mediated immunity.

[0214] Studies have shown that many solid tumors, such as breast, head and neck, and ovarian cancers, have pDC infiltration (Treilleux I, Blay JY, Bendriss-Vermare N, et al. Dendritic cell infiltration and prognosis of early stage breast cancer. Clin Cancer Res 2004;10:7466-7474. Hartmann E, Wollenberg B, Rothenfusser S, et al. Identification and functional analysis of tumor-infiltrating plasmacytoid dendritic cells in head and neck cancer. Cancer Res 2003;63:6478-6487. Zou WP, Machelon V, Coulomb-L'Hermin A, et al. Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat Med 2001;7:1339-1346) and factors secreted by tumor cells inhibit DC maturation (Gabrilovich DI, Corak J, Ciernik IF, et al. Decreased antigen presentation by dendritic cells in patients with breast cancer. Clin Cancer Res 1997;3:483-490. Bell D, Chomarat P, Broyles D, et al. In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas. J Exp Med 1999;190:1417-1425.Menetrier-Caux C, Montmain G, Dieu MC et al., Inhibition of the differentiation of dendritic cells from CD34(+) progenitors by tumor cells: role of interleukin-6 and macrophage colony-stimulating factor. Blood 1998;92:4778-4791). These immature DC cells did not play a role in promoting antitumor immunity. In contrast, DCs within the tumor microenvironment promote tumor growth by inhibiting antitumor immunity and promoting angiogenesis. There is evidence that the Toll-like receptor 7 agonist imiquimod and the Toll-like receptor 9 agonist CpG drugs can stimulate pDCs within the tumor microenvironment and inhibit tumor progression (Dummer R, Urosevic M, Kempf W, et al. Imiquimod in basal cell carcinoma: how does it work? Br J Dermatol 2003;149:57-58. Miller RL, Gerster JF, Owens ML, et al. Imiquimod applied topically: a novel immune response modifier and new class of drug. Int J Immunopharmacol 1999;21:1-14. Hofmann MA, Kors C, Audring H, et al. Phase 1 evaluation of intralesionally injected TLR9-agonist PF-3512676 in patients with basal cell carcinoma or metastatic melanoma. J Immunother 2008;31:520-527). .

[0215] Natural killer (NK) cells are a type of cytotoxic lymphocyte that constitutes a major component of the immune system. NK cells are a subset of peripheral blood lymphocytes defined by expression of CD56 or CD16 and the absence of T cell receptor (CD3). They recognize and kill transformed cell lines without priming in an MHC-unrestricted manner. NK cells play a major role in the rejection of tumor and virus-infected cells. The process by which NK cells recognize target cells and deliver sufficient signals to cause target lysis is determined by a series of inhibitory and activating receptors on the cell surface. NK discrimination of self from altered self involves inhibitory receptor recognition of MHC-I molecules and non-MHC ligands like CD48 and Clr-1b. NK recognition of infected or damaged cells (altered self) is mediated by stress-induced ligands (e.g., MICA, MICB, Rae1, H60, Mult1) or virus-encoded ligands (e.g., m157, hemagglutinin) recognized by various activating receptors including NKG2D, Ly49H, and NKp46 / Ncr1.

[0216] NK cells represent the predominant lymphoid cell type in peripheral blood for several months after allogeneic or autologous stem cell transplantation and have a major role in immunity against pathogens during this period (Reittie et al., (1989) Blood 73:1351-1358; Lowdell et al., (1998) Bone Marrow Transplant 21:679-686). The role of NK cells in engraftment, graft-versus-host disease, anti-leukemic activity, and post-transplant infections is reviewed in Lowdell (2003) Transfusion Medicine 13:399-404.

[0217] Human NK cells mediate the lysis of tumor cells and virus-infected cells through natural cytotoxicity and antibody-dependent cellular cytotoxicity (ADCC).

[0218] Human NK cells are controlled by positive and negative cytolytic signals. Negative (inhibitory) signals are delivered by the C-lectin domain containing receptor CD94 / NKG2A and by several killer immunoglobulin-like receptors (KIRs). Regulation of NK lysis by inhibitory signals is known as the "loss of self" hypothesis, whereby certain HLA class I alleles expressed on the target cell surface ligate inhibitory receptors on NK cells. Downregulation of HLA molecules on tumor cells and some virus-infected cells (e.g., CMV) can lower this inhibition below the target threshold and make the target cell susceptible to NK cell-mediated lysis if it also carries NK priming and activating molecules. TLR7, TLR8, or TLR9 agonists activate both mDCs and pDCs to produce type I IFN and express costimulatory molecules such as GITR-ligand, which in turn can activate NK cells to produce IFN-g, potently promoting the killing function of NK cells.

[0219] Inhibitory receptors are divided into two groups: those of the Ig superfamily called killer immunoglobulin-like receptors (KIRs) and those of the lectin family NKG2, which dimerize with CD94 on the cell surface. KIRs have a two- or three-domain extracellular structure and bind to HLA-A, -B, or -C. The NKG2 / CD94 complex ligates HLA-E.

[0220] Inhibitory KIRs have up to four ITIM-containing intracellular domains, the best characterized being KIR2DL1, KIR2DL2, and KIR2DL3, which are known to bind HLA-C molecules. KIR2DL2 and KIR2DL3 bind HLA-C alleles of group 1, while KIR2DL1 binds alleles of group 2. Certain leukemia / lymphoma cells express both group 1 and 2 HLA-C alleles and are known to be resistant to NK-mediated cytolysis.

[0221] With regard to positive activation signals, ADCC is thought to be mediated through CD16, and numerous trigger receptors responsible for natural cytotoxicity have been identified, including CD2, CD38, CD69, NKRP-I, CD40, B7-2, NK-TR, NKp46, NKp30, and NKp44. In addition, several KIR molecules with short cytoplasmic tails are also stimulatory. These KIRs (KIR2DS1, KIR2DS2, and KIR2DS4) are known to bind to HLA-C; their extracellular domains are identical to their associated inhibitory KIRs. Activating KIRs lack ITIMs and instead associate with DAP12, resulting in NK cell activation. The mechanism of expression control of inhibitory versus activating KIRs remains unclear.

[0222] Several reports have described the expression of TLRs in mouse or human cancers or cancer cell lines. For example, TLR1-TLR6 are expressed by colon, lung, prostate, and melanoma mouse tumor cell lines (Huang B, et al. Toll-like receptors on tumor cells facilitate evasion of immune surveillance. Cancer Res. 2005;65(12):5009-5014), TLR3 is expressed in human breast cancer cells (Salaun B, Coste I, Rissoan MC, Lebecque SJ, Renno T. TLR3 can directly trigger apoptosis in human cancer cells. J Immunol. 2006;176(8):4894-4901), and hepatocellular carcinoma and gastric carcinoma cells express TLR2 and TLR4 (Huang B, et al. Listeria monocytogenes promotes tumor growth via tumor cell toll-like receptor 2 signaling. Cancer Res. 2005;65(12):5009-5014). Res. 2007;67(9):4346-4352), TLR9 (Droemann D et al. Human lung cancer cells express functionally active Toll-like receptor 9. Respir Res. 2005;6:1) and TLR4 (He W, Liu Q, Wang L, Chen W, Li N, Cao X. TLR4 signaling promotes immune escape of human lung cancer cells by inducing immunosuppressive cytokines and apoptosis resistance. Mol Immunol. 2007;44(11):2850-2859) are expressed by human lung cancer cells.TLR7 and TLR8 are found in human lung cancer tumor cells. Invest.2010;120(4):1285-1297).

[0223] TLRs are a family of proteins that sense microbial products and / or initiate adaptive immune responses. TLRs activate dendritic cells (DCs). TLRs are conserved membrane spanning molecules that contain an ectodomain of leucine-rich repeats, a transmembrane domain, and an intracellular TIR (Toll / Interleukin Receptor) domain. TLRs recognize unique structures within microbes, often referred to as "PAMPs" (pathogen-associated molecular patterns). Ligand binding to TLRs triggers a cascade of intracellular signaling pathways that induce the production of factors involved in inflammation and immunity.

[0224] In some embodiments, the immunotherapeutic agent is a TLR7 and / or TLR8 agonist. TLR7 and TLR8 are phylogenetically and structurally related. TLR7 is selectively expressed by human pDCs and B cells. TLR8 is predominantly expressed in mDCs, monocytes, macrophages, and myeloid suppressor cells. TLR7-specific agonists activate plasmacytoid DCs (pDCs) to produce large amounts of type 1 IFN and express high levels of costimulatory molecules that promote activation of T cells, NK cells, B cells, and mDCs. TLR8-specific agonists activate myeloid DCs, monocytes, macrophages, or myeloid-derived suppressor cells to produce large amounts of type 1 IFN, IL-12, and IL-23 and express high levels of MHC class I, MHC class II, and costimulatory molecules that promote activation of antigen-specific CD4 and CD8+ T cells.

[0225] In some embodiments, the immunotherapeutic agent is a TLR7 and / or TLR8 agonist represented by the structure of Formula (I), or a pharma- ceutically acceptable salt or solvate thereof. It is. [ka] wherein the dashed line represents a bond or the absence of a bond; X is S or -NR1, R1 is -W0-W1-W2-W3-W4, W0 is a bond, alkyl, alkenyl, alkynyl, alkoxy, or -alkyl-S-alkyl--; W1 is a bond, --O--, or --NR2--, where R2 is hydrogen, alkyl, or alkenyl; W2 is a bond, --O--, --C(O)--, --C(S)--, or --S(O)2-; W3 is a bond, --NR3--, where R3 is hydrogen, alkyl, or alkenyl; W4 is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl, or heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --alkyl- ... optionally substituted with one or more substituents selected from the group consisting of (O)-R, --alkyl-C(O)-O-R, --C(O)-O-R, --S-R, --S(O)2-R, --NH-S(O)2-R, --alkyl-S-R, --alkyl-S(O)2-R, --NHR, --NR4R, --NH-alkyl-R, halogen, --CN, --NO2, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl; Z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which can be optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halogen, cyano, nitro, --N(R5), --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --OC(O)-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl; R is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, or heterocyclyl, each of which is selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl- optionally substituted with one or more substituents selected from the group consisting of C(O)-O-R, --C(O)-O-R, --OC(O)-R, --S-R, --C(O)-S-R, --SC(O)-R, --S(O)2-R, --NH-S(O)2-R, --alkyl-S-R, --alkyl-S(O)2-R, --NHR, --NR4R, --NH-alkyl-R, halogen, --CN, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl; n is 0, 1, 2, 3, or 4; Y is -NR6R7, -CR6R7R8, or -alkyl-NH2, each of which can be optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, --NH2, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl; wherein R6, R7, and R8 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or -alkyl-OC(O)-R9, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl; X and Z together may optionally form a (5-9) membered ring.

[0226] In some embodiments, X in formula (I) is S.

[0227] In some embodiments, X in formula (I) is -NR1 and R1 is alkyl, --alkyl-W4, -alkyl-O-W4, --alkyl-NH-C(O)-W4, --alkoxy-NH-C(O)-W4, --alkyl-NH-C(O)-NH-W4, --alkoxy-NH-C(O)-NH-W4, --alkyl-S(O)2-W4, or --alkyl-NH-C(S)-W4, where W4 is as defined above.

[0228] In some embodiments, Z in formula (I) is hydrogen, alkyl, alkoxy, aryl, heteroaryl, haloalkyl, each of which is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyl, alkyl, aryl, heteroaryl, heterocyclyl, cyano, --alkoxy-alkyl, nitro, and --N(R5)2, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl.

[0229] In some embodiments, Y in formula (I) is -NH2, --alkyl-NH2, each of which is optionally substituted with 1 to 3 substituents selected from the group consisting of alkyl, alkoxy, alkenyl, and alkynyl.

[0230] In some embodiments, n in formula (I) is 1 or 2.

[0231] In some embodiments, R in formula (I) is aryl or heteroaryl, each of which is hydroxyl, alkoxy, --alkyl-hydroxyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --OC(O)-R4, --S-R4, --C(O)-S-R4, -S Optionally substituted with 1 to 3 substituents selected from the group consisting of C(O)-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, -NH-alkyl-R4, halogen, --CN, and -SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl.

[0232] In some embodiments, the immunotherapeutic agent is a TLR7 and / or TLR8 agonist selected from Table 2. The compounds of Table 2 are described and characterized in more detail in U.S. Pat. Nos. 4,689,338, 5,389,640, 5,226,575, 6,110,929, 6,194,425, 5,352,784, 6,331,539, 5,482,936, 6,451810, WO 2002 / 46192, WO 2002 / 46193, WO 2002 / 46194, U.S. Patent Application Publication No. 2004 / 0014779, and U.S. Patent Application Publication No. 2004 / 0162309. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9]

[0233] In some embodiments, preferably the immunotherapeutic agent is resiquimod or imiquimod.

[0234] In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and / or TLR8 agonist) represented by the structure of Formula (II), or a pharma- ceutically acceptable salt or solvate thereof. [ka] wherein V is -NR6R7, and each of R6 and R7 is independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or -alkyl-OC(O)-R9, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl; R 10 and R 11 is independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl, or cycloalkyl, each of which is optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, halogen, --N(R5), --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl.

[0235] In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and / or TLR8 agonist) represented by the structure of Formula (III). [ka] During the ceremony, [ka] is a double bond or a single bond, R2 and R3 are independently selected from H and lower alkyl, or R2 and R3 are linked to form a saturated carbocyclyl having a 3-7 membered ring, and R7 and R8 are [ka] and the others are hydrogen, and R4 is -NR c R d -OR 10 and R c and R d is lower alkyl, where the alkyl is optionally substituted with one or more -OH; R 10 is alkyl, where the alkyl is optionally substituted with one or more -OH, Z is C, and [ka] is a double bond or Z is N, and [ka] is a single bond, and R a and R b is H, alkyl, alkenyl, alkynyl and R e wherein the alkyl is optionally selected from the group consisting of one or more -OR 10 or R e is replaced by R e is selected from -NH2, -NH(alkyl), and -N(alkyl)2; [ka] is a double bond, R1 is absent, or [ka] When is a single bond, N1-R1 and R a or R b and R are linked to one of the two to form a saturated, partially unsaturated, or unsaturated heterocyclyl having a 5- to 7-membered ring,a or R b the other is hydrogen or absent, to accommodate ring unsaturation as necessary, and at least one of the following A-D applies: A) R7 is not hydrogen, B) R8 is not hydrogen and R a and R b at least one of N1-R1 and R1 is not hydrogen; C) Z is N; or d) N1-R1 and R1 are a or R b to form a saturated, partially unsaturated, or unsaturated heterocyclyl having a 5- to 7-membered ring. U.S. Patent Application Publication No. 2014 / 0088085 is incorporated by reference in its entirety.

[0236] In some embodiments, R7 of the compound of Formula (III) is [ka] Furthermore, R a and R b is not hydrogen in the compound of formula (III), or, for example, R a and R b one of the groups is alkyl and R a and R b The other of the formula (III) is hydrogen. e In a different embodiment, R a and R b are both alkyl, or R a and R b One of them is R e and R a and R b and the other is hydrogen. For example, R8 in formula (III) is not hydrogen.

[0237] In some alternative embodiments, N and R of formula (III) a or R b and R are linked to each other so as to form a saturated, partially unsaturated, or unsaturated heterocyclyl having a 5- to 7-membered ring, and R a or R bthe other is hydrogen or absent to accommodate ring unsaturation as required, where the ring is a 5-membered ring, or e.g. the ring is [ka] It is.

[0238] In some embodiments, at least one of R2 and R3 in the compound of formula (III) is not hydrogen, or, for example, R2 and R3 are linked to form a saturated carbocyclyl, where the saturated carbocyclyl is cyclopropyl. Alternatively, Z is N in the compound of formula (III).

[0239] In some embodiments, the TLR agonist or modulator has the structure of formula (IV): [ka] In the formula, R4 is -NR c R d AND -OR 10 Selected from R c and R d is lower alkyl, where the alkyl is optionally substituted with one or more -OH; R 10 is alkyl, where the alkyl is optionally substituted with one or more -OH; R f and R g is lower alkyl, or R f and R g together with the nitrogen atom to which they are attached form a saturated heterocyclyl ring having 4 to 6 members. For example, R f and R g together with the nitrogen atom to which they are attached form a saturated heterocyclyl ring, where the heterocyclyl ring is pyrrolidine.

[0240] In some embodiments, R4 of either Formula (III) or Formula (IV) is -OR 10 where R 10is alkyl or ethyl. In some embodiments, R4 of either Formula (III) or Formula (IV) is -NR c R d where both are alkyl or both are propyl. Further, in certain embodiments, R c or R d At least one of R is alkyl substituted with one -OH; c and R d At least one of [ka] and the remaining R c or R d is propyl.

[0241] In some alternative embodiments, the TLR is [ka] Alternatively, the compound is a compound selected from [ka] is selected from.

[0242] In some alternative embodiments, the TLR agonist is [ka] It is.

[0243] In some alternative embodiments, the TLR agonist is [ka] The compound is selected from the group consisting of:

[0244] In some alternative embodiments, the TLR agonist is [ka] It is.

[0245] In some alternative embodiments, the TLR agonist is [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] The compound is selected from the group consisting of:

[0246] In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and / or TLR8 agonist) represented by the structure of Formula (V), and metabolites, solvates, tautomers, and prodrugs thereof: [ka] During the ceremony, Y is CF2CF3, CF2CF2R 6 or an aryl or heteroaryl ring, wherein the aryl and heteroaryl rings are alkenyl, alkynyl, Br, CN, OH, NR 6 R 7 , C(=O)R 8 , N.R. 6 SO2R 7 , (C1-C6 alkyl)amino, R 6 OC(=O)CH=CH2-, SR 6 and SO2R 6wherein the aryl and heteroaryl rings are optionally further substituted with one or more groups independently selected from F, Cl, CF3, CF3O-, HCF2O-, alkyl, heteroalkyl, and ArO-; R 1 , R 3 and R 4 is independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, ClBr, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(^O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from Or, R 3 and R 4 together with the atoms to which they are attached form a saturated or partially unsaturated carbocyclyl ring, where the carbocyclyl ring is an alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 , 0C(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from R 2 and R 8 H, OR 6、 NR 6 R 7 , alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, F, Cl, Br5I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(^O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from R 5a , R 5b and R 5c are independently H, F, Cl, Br, I5OMe5CH3, CH2F5CHF2 or CF3, and R 6 and R 7 is independently selected from H alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , N.R.6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(^O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 6 and R 7 together with the atom to which they are attached form a saturated or partially unsaturated heterocyclyl ring, where the heterocyclyl ring is an alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 In certain embodiments, R 1 , R 3 and R 4 are each hydrogen. In certain embodiments, R 5a , R 5b and R 5c and are each hydrogen. WO 2007 / 024612 is incorporated by reference in its entirety.

[0247] In some embodiments of the compound of Formula (V), R 2 OR 6 In some embodiments, R 6is alkyl, e.g., (1-4C)alkyl. In certain embodiments, R 6 is ethyl.

[0248] In some embodiments of the compound of Formula (V), R 2 is NR 6 R 7 In some embodiments, R 6 and R 7 is independently H, alkyl, e.g., (1-6C)alkyl, or heteroalkyl, e.g., (1-4C)alkoxy(2-4C)alkyl. In certain embodiments, R 6 and R 7 is independently H, ethyl, propyl, or CH2CH2OCH3. In some embodiments of the compound of formula V, Y is aryl, e.g., phenyl. In some embodiments, aryl is C(=O)R 8 , for example, Para-R 8 In some embodiments, R 8 OR 6 , N.R. 6 R 7 or heterocycloalkyl. In some embodiments, R 6 and R 7 is independently H or alkyl, e.g., (1-6C)alkyl. In some other embodiments, R 6 and R 7 together with the nitrogen atom to which they are attached form a 4-6 membered azacycloalkyl ring, such as pyrrolidinyl. In some embodiments, Y is [ka]

[0249] In some embodiments of the compound of Formula (V), Y is CF2CF3.

[0250] In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR8 agonist) having the structure of formula (VI), including metabolites, solvates, tautomers, pharma- ceutically acceptable prodrugs, and salts thereof: [ka] During the ceremony, Z is H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, OR 6 or NR 6 R 7 wherein alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, ClBr, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups optionally selected from R 1 , R 2 , R 3 and R 4 are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, F, Cl, Br, I 、 CN, OR 6 , N.R. 6 R 7, C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 1 and R 2 together with the atoms to which they are attached form a saturated or partially unsaturated carbocyclyl ring, where the carbocyclyl ring is selected from the group consisting of alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 3 and R 4 are both oxo, Each R 5 is independently selected from H, F, Cl, Br, I, OMe, CH3, CH2F, CHF2, CF3, and CF2CF3; R 6 and R 7are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR, 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 6 and R 7 together with the atom to which they are attached form a saturated or partially unsaturated heterocyclyl ring, where the heterocyclyl ring is selected from the group consisting of alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and n is 0, 1, 2, 3 or 4. WO 2007 / 048402 is incorporated by reference in its entirety.

[0251] In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR8 agonist) having the structure of formula (VI), including metabolites, solvates, tautomers, pharma- ceutically acceptable salts, and prodrugs thereof: [ka] During the ceremony, Z is H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, OR 6 or NR 6 R 7 wherein alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR, 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from R 1 , R 2 , R 3 and R 4 are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, F, Cl, Br, I 、 CN, OR 6 , N.R. 6 R 7, C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 1 and R 2 together with the atoms to which they are attached form a saturated or partially unsaturated carbocyclyl ring, where the carbocyclyl ring is an alkyl, alkenyl, alkynyl, F, Cl, Br, I 、 CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 3 and R 4 are both oxo, R 5 is H, F, Cl, Br, I, OMe, CH3, CH2F, CHF2, CF3 or CF2CF3, R 6 and R 7are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR, 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino 、 CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and optionally substituted with one or more groups independently selected from or R 6 and R 7 together with the atom to which they are attached form a saturated or partially unsaturated heterocyclyl ring, where the heterocyclyl ring is selected from the group consisting of alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , N.R. 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 , (C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , S.R. 6 and SO2R 6 and n is 0, 1, 2, 3 or 4.

[0252] In some embodiments, Z is OR 6 In some embodiments, R 6 is alkyl, e.g., (1-6C)alkyl. In certain embodiments, R 6 is ethyl, propyl, isopropyl or isobutyl.

[0253] In some embodiments, Z is NR 6 R 7 In some embodiments, R 6 and R 7 is independently H or alkyl, e.g., (1-6C)alkyl. In some embodiments, R 6 and R 7 In some embodiments, n is 0 or 1.

[0254] In some embodiments, R 5 is CF2CF3. In certain embodiments, R 3 is H or alkyl, e.g., (1-4C)alkyl, and R 4 is H. In certain embodiments, R is alkyl, such as (1-4C)alkyl. In some embodiments, R is methyl. In other certain embodiments, R 3 is H. In some embodiments, R is H or alkyl, such as (1-4C)alkyl, and R is H. In some embodiments, R 1 is alkyl. In some embodiments, R 1 is methyl. In some particular embodiments, R 1 is H.

[0255] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist represented by the structure of formula (XV): [ka] In the formula, ring A represents a 6- to 10-membered aromatic carbocyclyl ring or a 5- to 10-membered heteroaromatic ring. R represents a halogen atom, an alkyl group, a hydroxyalkyl group, a haloalkyl group, an alkoxy group, a hydroxyalkoxy group, a haloalkoxy group, an amino group, an alkylamino group, a dialkylamino group, or a 4-7 membered cyclyl group containing 1 to 2 nitrogen atoms and optionally 1 to 2 ring heteroatoms selected from 0 to 1 oxygen atom or 0 to 1 sulfur atom; n represents an integer of 0 to 2, and when n is 2, Rs may be the same or different; Z 1 represents a substituted or unsubstituted alkylene group or a substituted or unsubstituted cycloalkylene group, X 2 is an oxygen atom, a sulfur atom, SO2, NR 5 , CO, CONR. 5 , N.R. 5 CO, SO2NR 5 , N.R. 5 SO2, NR 5 CONR 6 or NR 5 CSNR 6 (where R 5 and R 6 each independently represents a hydrogen atom, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted cycloalkyl group; Y 1 , Y 2 and Y 3 each independently represents a single bond or an alkylene group, X 1 is an oxygen atom, a sulfur atom, SO2, NR 4 (where R 4 represents a hydrogen atom or an alkyl group) or a single bond; R 2 represents a hydrogen atom, a substituted or unsubstituted alkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted alkynyl group, or a substituted or unsubstituted cycloalkyl group, and R 1represents a hydrogen atom, a hydroxy group, an alkoxy group, an alkoxycarbonyl group, a haloalkyl group, a haloalkoxy group, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, or a substituted or unsubstituted cycloalkyl group. The linker is attached to one of the binding sites of the agonist, for example, -NH2.

[0256] In some embodiments, R 1 is hydrogen, hydroxyl, or C1-C6 alkoxy, C2-C5 alkoxycarbonyl, C1-C6 haloalkyl, C1-C6 haloalkoxy, C6-C 10 Aryl, C5-C 10 heteroaryl or a C3-C8 cycloalkyl group, each of which is optionally substituted with one or more substituents independently selected from halogen, hydroxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C2-C5 alkoxycarbonyl, amino(NH2), (mono)-C1-C6 alkylamino, and (di)-C1-C6 alkylamino groups; Y 1 represents a single bond or a C1-C6 alkylene; X 1 is a single bond, oxygen, sulfur atom, sulfonyl (SO2) or NR 3 represents Z 1 represents a C2-C6 alkylene or a C3-C8 cycloalkylene group, each of which is optionally substituted with at least one hydroxyl; X 2 is NR 4 represents Y 2 represents a single bond or a C1-C6 alkylene; Y 3 represents a single bond or a C1-C6 alkylene; n is an integer of 0, 1 or 2; R represents a halogen or a C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 hydroxyalkoxy, C1-C6 haloalkoxy, amino(NH2), (mono)-C1-C6 alkylamino, (di)-C1-C6 alkylamino group, or a C3-C8 saturated heterocyclyl ring containing a ring nitrogen atom and optionally one or more further heteroatoms independently selected from nitrogen, oxygen and sulfur, optionally substituted with one or more substituents independently selected from halogen, hydroxyl, oxo, C1-C6 alkyl, C1-C6 alkoxy, C2-C5 alkylcarbonyl and C2-C5 alkoxycarbonyl; R 2 represents hydrogen or a C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C8 cycloalkyl group, each of which is halogen, hydroxyl or C1-C6 alkoxy, C2-C 10 and optionally substituted with one or more substituents independently selected from the group consisting of acyloxy, C2-5 alkylcarbonyloxy, C2-C5 alkenylcarbonyloxy, C2-C5 alkynylcarbonyloxy, C6-C9 arylcarbonyloxy and C5-C9 heteroarylcarbonyloxy, each of which is selected from halogen, hydroxyl, C1-C3 alkoxy and phenyl, amino(NH2), (mono)-C1-C6 alkylamino, provided that the total number of carbon atoms in the acyloxy group does not exceed 10. , (di)-C1-C6 alkylamino groups, and a C3-C8 saturated heterocyclyl ring comprising a ring nitrogen atom and optionally one or more further heteroatoms independently selected from nitrogen, oxygen and sulfur, which in turn is optionally substituted with one or more substituents independently selected from halogen, hydroxyl, oxo, C1-C6 alkyl, C1-C6 alkoxy, C2-C5 alkylcarbonyl and C2-C5 alkoxycarbonyl groups; R 3 represents hydrogen or C1-C6 alkyl, R 4 CO2R 5 , SO2R 5 , C.O.R. 5 , SO2NR 6 R 7 and CONR 6 R 7 represents R 5 is independently (i) Ring group NR 8 , S(O) m or oxygen, wherein the 3- to 8-membered heterocyclyl ring is optionally substituted with one or more substituents independently selected from halogen, hydroxyl, or C1-C6 alkyl and C1-C6 alkoxy groups; (ii) C6~C 10 Aryl or C5~C 10 heteroaryl groups, each of which is selected from halogen, cyano, C1-C6 alkyl, C1-C3 haloalkyl, carboxyl, S(O) m R 9 , OR 10 , CO2R 10 , SO2NR 10 R 11 ,CONR 10 R 11 , N.R. 10 R 11 , N.R. 10 SO2R 9 , N.R. 10 CO2R 9 , N.R. 10 COR 9 or (iii) a C1-C6 alkyl, a C2-C6 alkenyl, a C2-C6 alkynyl or a C3-C8 cycloalkyl group, each of which is halogen, CN, a C3-C8 cycloalkyl, S(O) p R 12 , OR 13 , C.O.R. 13 , CO2R 13 , SO2NR 13 R14 ,CONR 13 R 14 , N.R. 13 R 14 , N.R. 13 SO2R 12 , N.R. 13 CO2R 12 , N.R. 13 COR 12 , N.R. 13 SO2R 12 Or C6~C 10 Aryl or C5~C 10 Heteroaryl groups or heterocyclyl rings may be optionally substituted with one or more substituents independently selected from C1-C6 alkyl (optionally substituted with hydroxy, C1-C6 alkoxy, C1-C6 alkoxycarbonyl, amino, C1-C6 alkylamino, di-C1-C6 alkylamino, NHC(O)-, C1-C6 alkylNHC(O), di-C1-C6 alkylNC(O), -OCHCHOH, pyrrolidinyl, pyrrolidinylcarbonyl, furanyl, piperidinyl, methylpiperidinyl, or phenyl), C2-C6 alkenyl (optionally substituted with phenyl), optionally substituted with one or more substituents independently selected from halogen, hydroxy, cyano, carboxy, amino, C1-C6 alkylamino, di-C1-C6 alkylamino, NHC(O)-, C1-C6 alkylNHC(O)-, di-C1-C6 alkylNC(O), C1-C6 alkoxycarbonyl, C1-C6 alkylsulfonyl, C1-C6 alkylcarbonylamino, C1-C6 alkylcarbonylmethylamino, phenyl (optionally substituted with hydroxy, fluoro or methyl), pyrrolidinyl, pyridyl, piperidinyl, benzothiazolyl or pyrimidinyl; R 6 represents hydrogen, a C1-C6 alkyl, a C2-C6 alkenyl, a C2-C6 alkynyl, a C3-C8 cycloalkyl group, or a heterocyclyl ring, each of which is selected from the group consisting of halogen, hydroxyl, oxo, cyano, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, OR 15 , S(O)q R 15 , CO2R 16 , C.O.R. 16 , N.R. 16 R 17 ,CONR 16 R 17 , N.R. 16 COR 17 , N.R. 16 CO2R 15 , SO2NR 16 R 17 , N.R. 16 SO2R 15 , or C6~C 10 Aryl or C5~C 10 The heteroaryl group or the heterocyclyl ring may be optionally substituted with one or more substituents independently selected from the following: C1-C6 alkyl, C3-C8 cycloalkyl, halogen, S(O) q R 15 , CO2R 16 , C.O.R. 16 , optionally substituted with one or more substituents independently selected from , hydroxy or cyano; and R 7 is hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or C3-C8 cycloalkyl, each of which is selected from the group consisting of halogen, C3-C8 cycloalkyl, C6-C 10 Aryl or C5~C 10 Heteroaryl groups, carboxy, cyano, OR 15 , hydroxy or NR 18 R 19 or R 6 and R 7 are nitrogen, S(O) together with the nitrogen atom to which they are attached. m or oxygen, wherein the heterocyclyl ring is selected from halogen, hydroxyl, carboxyl, cyano, OR, or oxygen. 20 , N.R. 21 R 22, S(O) q R 23 , C.O.R. 24 , CO2R 24 , N.R. 24 R 25 ,CONR 24 R 25 , N.R. 24 COR 25 , N.R. 24 CO2R 23 , SO2NR 24 R 25 , N.R. 24 SO2R 23 , C6~C 10 Aryl, C5-C 10 and optionally substituted with one or more substituents independently selected from a heteroaryl group, a heterocyclyl ring, a C1-C6 alkyl, a C2-C6 alkenyl, a C2-C6 alkynyl, or a C3-C8 cycloalkyl group, the latter seven groups being selected from halogen, hydroxyl, oxo, cyano, OR 20 , S(O) q R 23 , C.O.R. 24 , CO2R 24 , N.R. 24 R 25 ,CONR 24 R 25 , N.R. 24 CO2R 23 , N.R. 24 COR 25 , SO2NR 24 R 25 , N.R. 24 SO2R 23 , heterocyclyl ring or C6-C 10 Aryl or C5~C 10 heteroaryl groups, the latter three groups being optionally substituted with one or more substituents independently selected from C1-C6 alkyl, halogen, hydroxy, or cyano; R 8 Hydrogen, CO2R 26 , C.O.R. 26 , SO2R 26, C1-C6 alkyl or C3-C6 cycloalkyl groups, each of which is selected from halogen, hydroxyl, and NR 27 R 28 and optionally substituted with one or more substituents independently selected from R 10 , R 11 , R 16 , R 17 , R 18 , R 19 , R 21 , R 22 , R 26 , R 27 Or R 28 each independently represents hydrogen, and a C1-C6 alkyl or C3-C6 cycloalkyl group; R 24 and R 25 each independently represents hydrogen, and a C1-C6 alkyl or C3-C6 cycloalkyl group; or R 24 and R 25 are nitrogen, S(O) together with the nitrogen atom to which they are attached. m or oxygen, forming a 3- to 8-membered saturated or partially saturated heterocyclyl ring optionally further containing a heteroatom or heterogroup selected from R 9 , R 12 , R 15 and R 23 represents C1-C6 alkyl or C3-C6 cycloalkyl, R 13 and R 14 are R 6 and R 7 It is defined as R 20 is halogen, hydroxyl or OR 23 represents a C1-C6 alkyl optionally substituted by one or more substituents independently selected from m, p, q and r each independently represent an integer of 0, 1 or 2; and A is C6~C 10 Aryl or C5~C 12represents a heteroaryl group. See WO 2008 / 004948, U.S. Pat. No. 8,138,172, and U.S. Pat. No. 8,575,180, the disclosures of which are incorporated by reference.

[0257] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist having the structure: [ka] In the formula, R is Me or H.

[0258] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist having the structure: [ka] [ka] [ka]

[0259] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist having the structure of formula (XVI). [ka] In the formula, R 1 are independently H, -C(O)R 3 or the racemic, L-, or D-amino acid group -C(O)CHNHR 4 where R 3 is a substituted or unsubstituted alkyl; R 4 is H or substituted or unsubstituted alkyl; R 2 H, O, OR 5 , or N(R 6 )2, where R 5 are independently H or alkyl; R 6are independently H, substituted or unsubstituted alkyl, cycloalkyl, or together with the nitrogen form a substituted or unsubstituted heterocycloalkyl ring, and when R is -OH, at least one of the R groups is a racemic, L-, or D-amino acid group -C(O)CHNHR 4 See U.S. Patent No. 6,924,271, the disclosure of which is incorporated by reference in its entirety.

[0260] In some embodiments, R 1 At least one of the groups is a racemic, L-, or D-amino acid group -C(O)CHNHR 4 where R 4 is a substituted or unsubstituted alkyl, and the remaining R 1 The group is H, and R 2 OR 5 Or N(R 6 )2, where R 5 is independently selected from H or alkyl, and R is independently H, substituted or unsubstituted alkyl, cycloalkyl, or together with the nitrogen forms a substituted or unsubstituted heterocycloalkyl ring.

[0261] In some embodiments, R 1 At least one of the groups is an L-amino acid group -C(O)CHNHR 4 where R 4 is a substituted or unsubstituted alkyl, and the remaining R 1 The group is H, and R 2 OR 5 Or N(R 6 )2, where R 4 is a substituted alkyl; R 6 is independently H or substituted or unsubstituted alkyl.

[0262] In some embodiments, R 1 At least one of the groups is an L-amino acid group -C(O)CHNHR, where R 4 is -CH(CH3)2, and the remaining R 1 The group is H, and R 2is OH.

[0263] In some embodiments, the TLR7 and / or agonist is [ka] [ka] [ka] [ka] is selected from the group consisting of:

[0264] In some embodiments, the activating moiety is TLR7 and / or TLR8 having the structure: [ka] [ka] During the ceremony, Each R 1 is H, or substituted or unsubstituted alkyl, alkenyl, or alkynyl, which may be interrupted by one or more O, S, or N heteroatoms, or substituted or unsubstituted aryl or heteroaryl; R 2 is H, OH, SH, halo, or substituted or unsubstituted alkyl, alkenyl, or alkynyl, which may be interrupted by one or more O, S, or N heteroatoms, or substituted or unsubstituted -O-(alkyl), -O-(aryl), -O-(heteroaryl), -S-(alkyl), -S-(aryl), -S-(heteroaryl), aryl, or heteroaryl; R 3is H, OH, or SH, or a substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl, heteroaryl, -O-(alkyl), -O-(aryl), -O-(heteroaryl), -S-(alkyl), -S-(aryl), -S-(heteroaryl), -NH(alkyl), -NH(aryl), -NH(heteroaryl), -NH(R 4 )(alkyl), -NH(R 4 ) (aryl), or -NH(R 4 ) (heteroaryl), where R 4 is a substituted or unsubstituted alkyl; X is O or S; Y is H, halo, OH, OR 4 , S.H., S.R. 4 or substituted or unsubstituted alkyl or aryl, and Z is H, halo, OH, OR 4 , SH, or SR 4 See U.S. Patent No. 7,576,068, the disclosure of which is incorporated by reference in its entirety.

[0265] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist having the structure of Formula (XVIII): [ka] During the ceremony, YZ-CR 4 R 5 -, -CR 4 R 5 -CR 4 R 5 -, -C(O)CR 4 R 5 -, -CR 4 R 5 C(O)-, -NR 8 C(O)-, -C(O)NR 8 -, -CR 4 R 5 S(O)2- or -CR 5 -CR 5 - and L 1 -NR8 -, -O-, -S-, -N(R 8 )C(O)-, -S(O)2-, -S(O)-C(O)N(R 8 )-, -N(R 8 )S(O)2-, -S(O)2N(R 8 )- or a covalent bond, R 1 is alkyl, substituted alkyl, haloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, or substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl; X 1 is an alkylene, a substituted alkylene, a heteroalkylene, a substituted heteroalkylene, an alkenylene, a substituted alkenylene, an alkynylene, a substituted alkynylene, a carbocyclylene, a substituted carbocyclylene, a heterocyclylene, a substituted heterocyclylene, -NR 8 -, -O-, -C(O)-, -S(O)-, S(O)2-, or a bond; D is carbocyclyl, substituted carbocyclyl, heterocyclyl or substituted heterocyclyl, wherein the carbocyclyl, substituted carbocyclyl, heterocyclyl or substituted heterocyclyl is selected from the group consisting of one or two -L 2 -NR 6 R 7 is replaced by, or D is heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl, where the heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl contains 1 to 4 nitrogen atoms; Each L 2is independently alkylene, substituted alkylene, heteroalkylene, substituted heteroalkylene, or a covalent bond; Each R 3 are independently halogen, cyano, azido, nitro, alkyl, substituted alkyl, hydroxyl, amino, heteroalkyl, substituted heteroalkyl, alkoxy, haloalkyl, haloalkoxy, -CHO, -C(O)OR 8 , -S(O)R 8 , -S(O)2R 8 , -C(O)NR 9 R 10 , -N(R 9 )C(O)R 8 , carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, -S(O)2NR 9 R 10 , -N(R 9 )S(O)2R 8 , -N(R 9 )S(O)2OR 10 , -OS(O)2NR 9 R 10 and n is 0, 1, 2, 3, 4 or 5; R 4 and R 5 each independently represents H, alkyl, substituted alkyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl, cyano, azido, OR 8 , -C(O)H, -C(O)R 8 , -S(O)R 8 , -S(O)2R 8, -C(O)OR 8 or -C(O)NR 9 R 10 or R 4 and R 5 together with the carbon to which they are both attached form a carbocycle, substituted carbocycle, heterocycle, or substituted heterocycle, or R 4 and R 5 are on the same carbon atom together with the carbon to which they are attached, -C(O)- or -C(NR 8 )-or Two R on adjacent carbon atoms 4 or two R's 5 form, together with the carbon to which they are attached, a 3- to 6-membered carbocycle, substituted carbocycle, heterocycle or substituted heterocycle; R 6 and R 7 each independently represents H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl, -C(O)H, -C(O)R 8 , -S(O)R 8 , -S(O)2R 8 , -C(O)OR 8 or -C(O)NR 9 R 10 , S(O)NR 9 R 10 or R 6 and R 7together with the nitrogen to which they are attached form a substituted or unsubstituted heterocycle which may contain one or more further heteroatoms selected from N, O, P, or S; or R 7 , L 2 and together with the N to which they are attached form a substituted or unsubstituted 3- to 8-membered heterocycle which may contain one or more additional heteroatoms selected from N, O, S, or P; R 8 is H, alkyl, substituted alkyl, haloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl; and R 9 and R 10 are each independently H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl; R 9 and R 10together with the nitrogen to which they are both attached form a substituted or unsubstituted heterocycle, wherein each substituted alkyl, substituted alkenyl, substituted alkynyl, substituted heteroalkyl, substituted carbocyclyl, substituted carbocyclylalkyl, substituted heterocyclyl, substituted heterocyclylalkyl, substituted arylalkyl, substituted heteroarylalkyl, substituted carbocyclylheteroalkyl, substituted heterocyclylheteroalkyl, substituted arylheteroalkyl, substituted heteroarylheteroalkyl, substituted alkylene, substituted heteroalkylene, substituted alkenylene, substituted alkynylene, substituted carbocyclylene, or substituted heterocyclylene is independently selected from -halogen, -R, -O - , =O, -OR, -SR, -S - , -NR2, -N(+)R3, =NR, -C(halogen)3, -CR(halogen)2, -CR2(halogen), -CN, -OCN, -SCN, -N=C=O, -NCS, -NO, -NO2, =N2, -N3, -NRC(=O)R, -NRC(=O)OR, -NRC(=O)NRR, -C(=O)NRR, -C(=O)OR, -OC(=O)NRR, -OC(=O)OR, -C(=O)R, -S(=O)2OR, -S(=O)2R, -OS(=O)2OR, -S(=O)2NR, -S(=O)R, -NRS(=O)2R, -NRS( -N(=O)RR, -NRS(=O)OR, -OP(=O)(OR), -P(=O)(OR), -P(O)(OR)(O)R, -C(=O)R, -C(=S)R, -C(=O)OR, -C(=S)OR, -C(=O)SR, -C(=S)SR, -C(=O)NRR, -C(=S)NRR, -C(=NR)NRR, and -NRC(=NR)NRR, wherein each R is independently H, alkyl, cycloalkyl, aryl, arylalkyl, or heterocyclyl. See U.S. Patent Application Publication No. 20100143301, the disclosure of which is incorporated by reference in its entirety.

[0266] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist having the structure: [ka] During the ceremony, L 1 is -NH- or -O-, R 1 is alkyl, substituted alkyl, heteroalkyl, substituted heteroalkyl, heterocyclylalkyl, substituted heterocyclylalkyl, carbocyclylalkyl, or substituted carbocyclylalkyl; Each R 4 and R 5 are independently H or C1-C6 alkyl, or R taken together with the carbon to which they are attached. 4 and R 5 is -C(O)-, X 1 is C1-C6 alkylene, C1-C6 heteroalkylene or C1-C6 substituted heteroalkylene; D is phenyl, biphenyl or pyridinyl, where phenyl, biphenyl or pyridinyl is -L 2 -NR 6 R 7 is replaced by, or D is pyridinyl, piperidinyl, piperazinyl or 1,2,3,4-tetrahydroisoquinolinyl; n is 0 or 1, R 3 is halogen, cyano, alkyl, carbocyclyl, carbocyclylalkyl, haloalkyl, -C(O)OR 6 , -C(O)NR 9 R 10 or -CHO, L 2 is a C1-C6 alkylene or a covalent bond, Each R 6 and R 7 are independently H, alkyl, or heteroaryl, or R together with the nitrogen to which they are attached 6 and R 7 forms a substituted or unsubstituted 4- to 6-membered heterocycle containing 0 to 2 heteroatoms selected from N, O, or S.

[0267] In some embodiments, the activating moiety is a TLR7 and / or TLR8 agonist having the structure: [ka]

[0268] C. Amount of Immunotherapeutic Agent in Combination of Therapeutic Agents In another aspect, the invention provides a combination of therapeutic agents comprising a targeted therapeutic agent and an immunotherapeutic agent in amounts suitable for the combined therapeutic treatment of diseases such as tumors and cancer.

[0269] In some embodiments, the immunotherapeutic agent is in an amount capable of: (1) inducing IFN-α in enriched human blood DCs; (2) inducing TNF-α in enriched human blood DCs; and / or (3) inducing IL-12-α in enriched human blood DCs.

[0270] Methods for measuring the activity of immunotherapeutic agents include 1) assays that measure cytokines released from human dendritic cells stimulated with the immunotherapeutic agent, 2) assays that detect antibody-dependent cell-mediated cytotoxicity enhanced by the immunotherapeutic agent, and 3) efficacy tests of tumor models treated with the immunotherapeutic agent.

[0271] In some embodiments, the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered orally or intravenously using an oral or intravenous formulation in an amount such that the local concentration of the immunotherapeutic agent (e.g., near or at the site of a solid tumor) is between about 0.005 μg / ml and about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 μg / ml (all values ​​inclusive).

[0272] The local concentration of an immunotherapeutic agent (e.g., near or at the site of a solid tumor) can be measured using methods known in the art, such as, for example, measuring tissue or lymphatic concentrations. The effective local concentration of a therapeutic agent depends on its absorption from the route, tissue distribution, and metabolic processes, and the plasma pharmacokinetics of the agent and tissue concentrations can be routinely measured using methods known in the art.

[0273] In some embodiments, the immunotherapeutic agent is administered in an amount such that the local concentration of the immunotherapeutic agent (e.g., near or at the site of a solid tumor) is between about 0.05 μg / ml, 0.1 μg / ml, 0.15 μg / ml, 0.2 μg / ml, 0.3 μg / ml, or 0.4 μg / ml, to about 0.5 μg / ml (inclusive).

[0274] In some embodiments, a subject is administered an oral formulation comprising an immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of between about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, or 0.015 mg / kg to about 0.02 mg / kg (inclusive). In some embodiments, a subject is administered an oral formulation comprising an immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of between about 0.0005 mg / kg to about 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, 0.015 mg / kg, or 0.02 mg / kg (inclusive) twice weekly.

[0275] In some embodiments, a subject is administered an oral formulation comprising an immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg or less twice weekly.

[0276] In some embodiments, a subject is administered an intravenous formulation comprising an immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, or between about 0.015 mg / kg and about 0.02 mg / kg, inclusive, every week. In some embodiments, a subject is administered an intravenous formulation comprising an immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of between about 0.0005 mg / kg, to about 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, 0.015 mg / kg, or 0.02 mg / kg (inclusive) every week.

[0277] In some embodiments, the methods include administering to the subject an intravenous formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of between about 0.0008 mg / kg and about 0.0133 mg / kg weekly.

[0278] In some embodiments, the method includes administering to the subject an intravenous formulation comprising an immunotherapeutic agent (e.g., resiquimod or an analog thereof) at a dose of about 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or 0.006 mg / kg or less to about 0.007 mg / kg weekly. For references regarding safe dosages of immunotherapeutic agents, see Jurk et al., Nature Immunology, Vol. 4, No. 6, "499 (2002), and Pockros et al., J. Hepatology, 47:174-182 (2007), the disclosures of which are incorporated by reference in their entireties.

[0279] III. Pharmaceutical Formulations and Administration The present invention further relates to pharmaceutical formulations comprising a compound of the invention, or a pharma- ceutically acceptable salt thereof, and one or more pharma- ceutically acceptable carriers.

[0280] The compounds described herein, including pharma- ceutically acceptable carriers such as addition salts or hydrates thereof, can be delivered to patients using a wide variety of administration routes or modes.Suitable administration routes include inhalation, transdermal, oral, rectal, transmucosal, intestinal, and parenteral administration, including intramuscular, subcutaneous, and intravenous injection.Preferably, the compounds of the present invention that include an antibody or antibody fragment as a targeting moiety are administered parenterally, more preferably intravenously.

[0281] As used herein, the terms "administer" or "administration" are intended to encompass all methods of directly and indirectly delivering a compound to its intended site of action.

[0282] The compounds described herein, or their pharma- ceutically acceptable salts and / or hydrates, may be administered alone, in combination with other compounds of the invention, and / or in cocktails in combination with other therapeutic agents. Of course, the choice of therapeutic agents that can be co-administered with the compounds of the invention will depend, in part, on the condition being treated.

[0283] For example, when administered to a patient suffering from a disease state caused by an organism dependent on an autoinducer, the compounds of the invention can be administered in cocktails containing drugs used to treat pain, infection, and other symptoms and side effects commonly associated with the disease, such drugs including, for example, analgesics, antibiotics, etc.

[0284] When administered to patients undergoing cancer treatment, the compounds may be administered in cocktails containing anti-cancer agents and / or adjuvant boosting agents. The compounds may also be administered in cocktails containing agents that treat the side effects of radiation therapy, such as antiemetics, radiation protectants, etc.

[0285] Co-potentiating agents that may be co-administered with the compounds of the present invention include, for example, tricyclic antidepressants (e.g., imipramine, desipramine, amitriptyline, clomipramine, trimipramine, doxepin, nortriptyline, protriptyline, amoxapine, and maprotiline); non-tricyclic antidepressants (e.g., sertraline, trazodone, and citalopram); Ca+2 antagonists (e.g., verapamil, nifedipine, nitrendipine, and caroverine); amphotericin; triparanol analogs (e.g., tamoxifen); antiarrhythmics (e.g., quinidine); antihypertensives (e.g., reserpine); thiol-depleting agents (e.g., buthionine, and sulfoximine); and calcium leucovorin.

[0286] The active compound(s) of the present invention is administered by itself or in the form of a pharmaceutical composition in which the active compound(s) is mixed with one or more pharma- ceutically acceptable carriers, excipients, or diluents.The pharmaceutical composition for use according to the present invention is typically formulated in a conventional manner using one or more physiologically acceptable carriers, including excipients and adjuvants that facilitate the processing of the active compound into pharma- ceutically usable preparations.The appropriate formulation depends on the route of administration selected.

[0287] For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0288] For oral administration, the compounds can be easily formulated by combining the active compound(s) with pharma- ceutically acceptable carriers well known in the art. Such carriers allow the compounds of the present invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions for oral ingestion by the patient to be treated. Pharmaceutical preparations for oral use can be obtained by processing a mixture of granules, optionally grinding the resulting mixture with solid excipients, and adding suitable adjuvants, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

[0289] Dragee cores are provided with suitable coatings.For this purpose, sugar concentrates can be used, which can optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and / or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.Dyes or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0290] Orally usable pharmaceutical preparations include push-fit capsules made of gelatin, as well as soft sealed capsules made of gelatin and plasticizers such as glycerol or sorbitol. Push-fit capsules can contain the active ingredient in a mixture with fillers such as lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate, and optionally stabilizers. In soft capsules, the active compound can be dissolved or suspended in a suitable liquid, such as fatty oils, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.

[0291] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0292] For administration by inhalation, the compound for use according to the present invention is conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer with the use of a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount.For example, capsules and cartridges of gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base, such as lactose or starch.

[0293] The compound can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion.Injection is the preferred method of administration of the composition of the present invention.The preparation for injection can be in unit dosage form, for example, in ampoules or multi-dose containers, with the addition of preservatives.The composition can take the form of a suspension, solution, or emulsion in oily or aqueous vehicle, and can contain formulating agents such as suspending agents, stabilizing agents, and / or dispersing agents, and can add cross-linked polyvinylpyrrolidone, agar, or alginic acid or its salt, such as sodium alginate.

[0294] Pharmaceutical preparations for parenteral administration include aqueous solutions of the active compound in water-soluble form. In addition, suspensions of the active compound can be prepared as suitable oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Optionally, the suspension can contain suitable stabilizers or agents that increase the solubility of the compound to allow the preparation of highly concentrated solutions. For injection, the agents of the present invention can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.

[0295] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water, before use.

[0296] The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, eg, containing conventional suppository bases such as cocoa butter or other glycerides.

[0297] In addition to the above-mentioned preparation, compound can also be formulated as depot preparation.Such long-acting preparation can be administered by implantation or transdermal delivery (for example, subcutaneous or intramuscular), intramuscular injection or transdermal patch.Thus, for example, compound can be formulated with suitable polymer or hydrophobic material (for example, as emulsion in acceptable oil), or ion exchange resin, or as sparingly soluble derivative, for example as sparingly soluble salt.

[0298] The pharmaceutical compositions may also include suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.

[0299] A preferred pharmaceutical composition is a composition formulated for injection, such as intravenous injection, and contains about 0.01% to about 100% by weight of a compound of the present invention, based on 100% by weight of the total pharmaceutical composition. The drug-ligand conjugate may be an antibody-cytotoxin conjugate, in which the antibody is selected to target a particular cancer.

[0300] In some embodiments, a pharmaceutical composition of the present invention further comprises an additional therapeutic agent.

[0301] In some embodiments, the additional therapeutic agent is an anti-cancer agent.

[0302] In some embodiments, the additional anti-cancer agent is selected from antimetabolites, inhibitors of topoisomerase I and II, alkylating agents, microtubule inhibitors, antiandrogens, GNRh modulators, or mixtures thereof.

[0303] In some embodiments, the additional therapeutic agent is a chemotherapeutic agent.

[0304] As used herein, "chemotherapeutic agent" refers to a chemical compound useful in the treatment of cancer. Examples include, but are not limited to, gemcitabine, irinotecan, doxorubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, TAXOL, methotrexate, cisplatin, melphalan, vinblastine, and carboplatin.

[0305] In some embodiments, the second chemotherapeutic agent is selected from the group consisting of tamoxifen, raloxifene, anastrozole, exemestane, letrozole, imatanib, paclitaxel, cyclophosphamide, lovastatin, minocine, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide etoposide, gemcitabine, epothilone, vinorelbine, camptothecin, daunorubicin, actinomycin D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin.

[0306] IV. Kit In another aspect, the present invention provides a kit comprising the therapeutic combination provided herein and instructions for using the therapeutic combination. The kit may also include a container and optionally one or more vials, test tubes, flasks, bottles, or syringes. Other formats of the kit may be apparent to those skilled in the art and are within the scope of the present invention.

[0307] V. Medical Use In another aspect, the invention provides a method for treating a disease condition in a subject in need thereof, comprising administering to the subject a therapeutic combination or pharmaceutical composition comprising a therapeutically effective amount of a compound of the invention, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier.

[0308] In addition to the above compositions and constructs, the present invention also provides a number of uses of the combinations of the present invention. Uses of the combinations of the present invention include killing or inhibiting the growth, proliferation or replication of tumor or cancer cells, treating cancer, treating precancerous conditions, preventing the proliferation and division of tumor or cancer cells, preventing cancer, and preventing the proliferation and division of cells expressing autoimmune antibodies. These uses include administering an effective amount of the compounds of the present invention to an animal, such as a mammal or human, in need thereof.

[0309] The combinations of the present invention are useful for treating diseases such as cancer in a subject, such as a human. The combinations and uses are provided for treating tumors by providing a pharma- ceutical effective amount of a composition of the present invention to a subject in a pharma- ceutically acceptable manner.

[0310] As used herein, "cancer" refers to a pathological condition in humans that is characterized by unregulated cell proliferation. Examples include, but are not limited to, carcinoma, lymphoma, blastoma, and leukemia. More specific examples of cancer include, but are not limited to, lung (small cell and non-small cell), breast, prostate, carcinoid, bladder, stomach, pancreas, liver (hepatocellular), hepatoblastoma, colorectal, head and neck squamous cell carcinoma, esophagus, ovary, cervix, endometrium, mesothelioma, melanoma, sarcoma, osteosarcoma, liposarcoma, thyroid, desmoid, chronic myelogenous leukemia (AML), and chronic myelogenous leukemia (CML).

[0311] As used herein, "inhibit" or "treat" or "treatment" refers to reduction, therapeutic treatment, and prophylactic or preventative treatment, where the purpose is to reduce or prevent the targeted pathological disorder or condition. In one example, after administration of the compound of the present invention, a cancer patient may experience a reduction in tumor size. "Treatment" or "treating" includes (1) inhibiting a disease in a subject experiencing or exhibiting a pathology or symptom of the disease, (2) ameliorating the disease in a subject experiencing or exhibiting a pathology or symptom of the disease, and / or (3) causing any measurable reduction in the disease in a subject experiencing or exhibiting a pathology or symptom of the disease. To the extent that the compound of the present invention can prevent and / or kill the growth of cancer cells, it can be cytostatic and / or cytotoxic.

[0312] As used herein, a "therapeutically effective amount" refers to an amount of a compound provided herein that is effective to "treat" a disorder in a subject or mammal. In the case of cancer, a therapeutically effective amount of a drug may either reduce the number of cancer cells, reduce tumor size, inhibit the invasion of cancer cells into peripheral organs, inhibit tumor metastasis, inhibit tumor growth to some extent, and / or relieve one or more symptoms associated with cancer to some extent.

[0313] Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) and sequential administration in any order. As used herein, the term "pharmaceutical combination" refers to a product obtained by mixing or combining active ingredients, and includes both fixed and non-fixed combinations of active ingredients. The term "fixed combination" means that the active ingredients, e.g., the compound of formula (1) and the co-agent, are both administered to a patient at the same time in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g., the compound of formula (1) and the co-agent, are both administered to a patient as separate entities, simultaneously, concurrently, or sequentially without any specific time limit, such administration providing a therapeutically effective level of the active ingredients in the patient's body. The latter also applies to cocktail therapy, e.g., administration of three or more active ingredients.

[0314] In some embodiments, the disease condition is a tumor or cancer. In some embodiments, the cancer or tumor is selected from stomach, colon, rectum, liver, pancreas, lung, breast, cervix, uterine body, ovary, testis, bladder, kidney, brain / CNS, head and neck, throat, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, leukemia, melanoma, non-melanoma skin cancer, acute lymphocytic leukemia, acute myeloid leukemia, Ewing's sarcoma, small cell lung cancer, choriocarcinoma, rhabdomyosarcoma, Wilms' tumor, neuroblastoma, hairy cell leukemia, oral / pharyngeal, esophageal, laryngeal, renal cancer or lymphoma.

[0315] In some embodiments, the disease condition comprises abnormal cell proliferation, such as a precancerous lesion.

[0316] The present invention is particularly useful for the treatment of cancer and for inhibiting the proliferation of tumor or cancer cells in animals. Cancer or precancerous conditions include any disease or disorder characterized by tumors, metastases, or unregulated cell growth, and can be treated or prevented by administration of the drug-ligand complex of the present invention. The compound delivers the activating moiety to the tumor or cancer cell. In some embodiments, the targeting moiety specifically binds to or associates with a cancer cell or tumor cell-associated antigen. Due to its proximity to the ligand, after internalization, the activating moiety can be taken up into the tumor or cancer cell, for example, through receptor-mediated endocytosis. The antigen can be an extracellular matrix protein that can attach to the tumor or cancer cell or associates with the tumor or cancer cell. Once inside the cell, the linker is hydrolytically or enzymatically cleaved by tumor or cancer cell-associated proteases, thereby releasing the activating moiety. The released activating moiety is then free to diffuse and induce or enhance immune cell or tumor cell immune activity. In an alternative embodiment, the activating moiety is cleaved from the tumor microenvironment of the compound, followed by penetration of the drug into the cell.

[0317] Representative examples of precancerous conditions that may be targeted by the compounds of the present invention include metaplasia, hyperplasia, dysplasia, colorectal polyps, actinic keratosis, actinic cheilitis, human papilloma virus, vitiligo, lichen planus, and Bowen's disease.

[0318] Representative examples of cancer or tumor that can be targeted by the compounds of the present invention include lung cancer, colon cancer, prostate cancer, lymphoma, melanoma, breast cancer, ovarian cancer, testicular cancer, CNS cancer, renal cancer, kidney cancer, pancreatic cancer, gastric cancer, oral cancer, nasal cancer, cervical cancer, and leukemia.It will be easily understood by those skilled in the art that the specific targeting moiety used in the compound can be selected to target the activating moiety to the tumor tissue that is treated with the drug (i.e., a targeting agent specific to a tumor-specific antigen is selected).Examples of such targeting moieties are well known in the art, and include anti-Her2 for the treatment of breast cancer, anti-CD20 for the treatment of lymphoma, anti-PSMA for the treatment of prostate cancer, and anti-CD30 for the treatment of lymphoma, including non-Hodgkin's lymphoma.

[0319] In some embodiments, the abnormal growth is of cancer cells.

[0320] In some embodiments, the cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.

[0321] In some embodiments, the present invention provides a compound for use in killing a cell. The compound is administered to a cell in an amount sufficient to kill said cell. In an exemplary embodiment, the compound is administered to a subject having the cell. In a further exemplary embodiment, the administration serves to slow or stop the growth of a tumor comprising the cell (e.g., the cell can be a tumor cell). For administration to slow growth, the rate of growth of the cell should be at least 10% below the rate of growth before administration. Preferably, the rate of growth is slowed by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or completely stopped.

[0322] Additionally, the present invention provides a compound or pharmaceutical composition of the present invention for use as a medicament. The present invention also provides a compound or pharmaceutical composition for killing tumor or cancer cells, inhibiting or slowing the growth of tumor or cancer cells, or treating a disease in which TLR7 and / or TLR8 is implicated.

[0323] Effective Dose Suitable pharmaceutical compositions for use in the present invention include compositions in which the active ingredient is contained in a therapeutically effective amount, i.e., an amount effective to achieve its intended purpose.The actual effective amount for a particular application will depend, inter alia, on the condition being treated.Determining the effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein.

[0324] For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. The target plasma concentration will be the concentration of active compound(s) that can inhibit cell growth or division. In a preferred embodiment, cell activity is inhibited by at least 25%. Target plasma concentrations of active compound(s) that can induce inhibition of cell activity of at least about 30%, 50%, 75%, or even 90% or more are preferred in the present invention. The inhibition percentage of cell activity in the patient can be monitored to assess the appropriateness of the plasma drug concentration achieved, and the dosage can be adjusted upward or downward to achieve the desired inhibition percentage.

[0325] As is well known in the art, therapeutically effective amounts for use in humans can also be determined from animal models.For example, a dose for humans can be formulated to achieve a circulating concentration that has been found to be effective in animals.Dosages in humans can be adjusted by monitoring cell inhibition and adjusting dosage upwards or downwards, as described above.

[0326] Therapeutically effective doses can also be determined from human data for compounds known to exhibit similar pharmacological activity, and the applied dose can be adjusted based on the relative bioavailability and potency of the administered compound compared to the known compound.

[0327] Adjusting dosages to achieve maximal efficacy in humans based on the methods described above and other methods known in the art is well within the capabilities of one of ordinary skill in the art.

[0328] In the case of local administration, the systemic circulating concentration of the administered compound may not be particularly important: in such cases, the compound is administered to achieve a concentration in the local area that is effective to achieve the intended result.

[0329] Therapeutic amounts of certain antibodies described herein may also be administered with immunotherapeutic agents, either in a single mixed form or separately, as a component of a combination. In some embodiments, a therapeutic amount is an amount that eliminates or reduces the tumor burden in the patient, or inhibits or reduces the growth of metastatic cells. The dose will depend on many parameters, including the nature of the tumor, the patient's medical history, the patient's condition, the possible simultaneous use of other oncolytic agents, and the method of administration. Methods of administration include injection (e.g., parenteral, subcutaneous, intravenous, intraperitoneal, etc.), for which the antibody is provided in a non-toxic pharmacologic acceptable carrier, such as water, saline, Ringer's solution, dextrose solution, 5% human lymphatic albumin, fixed oil, ethyl oleate, or liposomes. Typical doses may range from about 0.01 to about 20 mg / kg, e.g., from about 0.1 to about 10 mg / kg. Other effective methods and doses of administration may be determined by routine experimentation and are within the scope of the present invention.

[0330] The therapeutically effective amount of the administered agent (disclosed herein) when used in a combination therapy may vary depending on the desired effect and the subject being treated. For example, a subject may receive at least 1 mg / kg (e.g., 1 mg / kg to 20 mg / kg, 2.5 mg / kg to 10 mg / kg, or 3.75 mg / kg to 5 mg / kg) of each antibody agent intravenously. The dose may be administered in divided doses (e.g., 2, 3, or 4 divided doses per day) or in a single dose.

[0331] In methods for combined administration, the agent may be administered simultaneously with the antibody used in the invention, or the agent may be administered before or after administration of the antibody used in the invention.

[0332] For other modes of administration, dosage and interval can be individually adjusted to provide effective plasma levels of the administered compound for the particular clinical indication being treated.For example, in one embodiment, the compound of the present invention can be administered multiple times per day at relatively high concentrations.Alternatively, it may be more desirable to administer the compound of the present invention at the lowest effective concentration and use a less frequent administration regimen.This will provide a treatment regimen that is tailored to the severity of an individual's disease.

[0333] Utilizing the teachings provided herein, one can design an effective therapeutic treatment regimen that does not cause substantial toxicity, yet is completely effective in treating the clinical symptoms exhibited by a particular patient. This should necessarily include careful selection of an active compound by considering factors such as the potency of the compound, its relative bioavailability, the patient's weight, the presence and severity of adverse side effects, the preferred mode of administration, and the toxicity profile of the selected agent.

[0334] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be employed in the practice of the invention. It is intended that the following claims define the scope of the invention, and that methods and structures within the scope of these claims, and their equivalents, be covered thereby. EXAMPLES

[0335] The present invention is further illustrated, but not limited, by the following and examples which illustrate the preparation of compounds of the invention.

[0336] Example 1 Tumors inoculated and assessment of tumor growth

[0337] Mice: Female 6-week-old BALB / c and C3H / HeN (C3H) mice were purchased from Japan SLC (Hamamatsu, Japan). All procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Tokyo Medical and Dental University. SCCVII (C3H-derived, 3 × 10 5 ) or Colon26 (BALB / c derived, 5 × 10 5 ) parental cells were injected subcutaneously (sc) into the shaved right flank of syngeneic mice and tumor volume was assessed. In experiments investigating the effect of anti-PDL1 (MIH5) mAb with TLRL, 200 μg of anti-PDL1 mAb or 200 μg of anti-PDL1 mAb mixture was injected intraperitoneally with TLRL or control rat IgG three times a week after tumor inoculation. Tumor volume was measured along three orthogonal axes (x, y, z) and calculated as tumor volume = (xyz) / 2. If a mouse loses more than 20% of its body weight or is very sick and unable to consume sufficient food or water, it is removed from the study and euthanized. (Figures 1 and 2)

[0338] Example 2 Enrichment of human dendritic cells (DCs) from PBMCs

[0339] Human PBMCs were prepared from buffy coats obtained from healthy volunteer donors by Ficoll centrifugation. Dendritic cells were enriched by using negative depletion with magnetic beads (Miltenyi Biotec) with a mixture of anti-CD3, CD19, CD20, CD14, and CD16 antibodies from human PBMCs. DC enrichment was stained with goat anti-mouse FITC (series), HLA-DR-APCCy7, CD123-BV421, and CD11C-APC. Stained cells were analyzed by BDLSR Fortessa (BD Biosciences). Anti-CD3, CD4, CD11C, CD19, CD14, CD16, CD123 monoclonal antibodies were purchased from BD Biosciences, CA or Biolgend, San Diego, CA.

[0340] Stimulation and cytokine expression of enriched human DCs

[0341] 1~2×10 5 The enriched DCs were seeded in 100 μL of medium in a 96-well plate, 100 μL of diluted stimuli containing TLRL were added to the plate, and the plates were cultured for 20–22 h in an incubator at 37°C. The supernatants were collected and analyzed for human IFN-α, IL-12 (p70), and TNF-α by ELISA (Mabtech AB, Sweden).

[0342] Figures 3A-3G show the analysis of cytokine production by enriching human DCs from three healthy donors. Enriched human DCs were seeded in 96-well plates and directly cultured in a 37°C incubator with allogeneic untreated (medium) or treated with different concentrations of TLRL for 20-22 h. Supernatants were collected and human IFN-α, IL-12 (p70) and TNF-α were analyzed by ELISA. Data are given as the mean ± standard deviation of triplicate cultures. Three independent experiments from three healthy donors were performed (donor 1: Figure 3A, donor 2: Figure 3B-D, donor 3: Figure 3E-G).

[0343] Example 3 Detection of systemic immune activation by IFN-induced gene expression in mouse PBMCs using TLRL

[0344] Six to eight week old, female, Balb / c mice purchased from Vital River were injected intravenously with TLRL at the indicated time points, mice were bled, and IFN-inducible genes were tested by qPCR. At each selected time point, IFN-inducible genes expressed were determined, and separate experiments were performed with various doses of TLRL. At the indicated time points, mice were bled, and IFN-inducible genes were tested. Quantitative real-time PCR was performed, and gene expression data were normalized to the geometric mean of two housekeeping genes (actin). Mouse actin F: CATTGCTGACAGGATGCAGAAGG (SEQ ID NO: 1), Mouse actin R:TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO:2), Mouse Inf-b: F: CTCCAGCACTGGGTGGAATG (SEQ ID NO: 3), Mouse Inf-b R: AGTGGAGAGCAGTTGAGGAC (SEQ ID NO: 4), Mouse Mx2: F; GTGGCAGAGGGAGAATGTCG (SEQ ID NO:5), Mouse Mx2 R:TAAAACAGCATAACCTTTTGCGA (SEQ ID NO:6), Mouse Ifn-a: F: CCTGAGAGAGAAGAAACACAGCC (SEQ ID NO: 7), Mouse Ifn-a R: GGCTCTCCAGACTTCTGCTCTG (SEQ ID NO: 8), Mouse ISG15: F: CAGCAATGGCCTGGGACCTAA (SEQ ID NO:9), Mouse ISG15R: GGAAAGCCGGCACACCAATC (SEQ ID NO:10).

[0345] Figures 4A-4C show the expression of IFN-inducible genes in mouse PBMCs after TLRL injection. RNA was isolated from PBMCs cryopreserved in TRIzol reagent at various time points and the relative expression of IFN-inducible genes was determined by quantitative RT-PCR. The MX2 gene was detected over a time course of 5 h after TLRL injection (Figure 4A), and the MX2 and ISG15 genes were measured at various doses of TLRL at 2 h post-injection (Figure 4B and Figure 4C). Values ​​indicate the mRNA expression of IFN-inducible genes shown relative to the housekeeping gene actin. Bar graphs represent data from three individual animals. ** P < 0.01, *** P<0.001.

[0346] statistical analysis

[0347] The significance of all comparisons was calculated using a two-tailed Student's t-test, assuming unequal variances between mock and sample groups, and results were considered significant when p<0.05. Correlations between parameters were assessed using Spearman's rank correlation test, and a P value <0.05 was considered statistically significant.

[0348] (Additional Note) (Appendix 1) (i) an effective amount of a PD-L / PD-1 axis antagonist, and (ii) an effective amount of an immunotherapeutic capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof; Including, combinations.

[0349] (Appendix 2) The combination of claim 1, wherein the PD-L / PD-1 axis antagonist is selected from the group consisting of a PD-1 binding antagonist, a PD-L1 binding antagonist, and a PD-L2 binding antagonist.

[0350] (Appendix 3) The combination of claim 2, wherein the PD-L / PD-1 axis antagonist is a PD-1 binding antagonist.

[0351] (Appendix 4) The combination of claim 3, wherein the PD-1 binding antagonist inhibits binding of PD-1 to its ligand binding partner.

[0352] (Appendix 5) The combination of claim 3, wherein the PD-1 binding antagonist inhibits binding of PD-1 to PD-L1.

[0353] (Appendix 6) The combination of claim 3, wherein the PD-1 binding antagonist inhibits binding of PD-1 to PD-L2.

[0354] (Appendix 7) The combination of claim 3, wherein the PD-1 binding antagonist inhibits binding of PD-1 to both PD-L1 and PD-L2.

[0355] (Appendix 8) The combination of claim 3, wherein the PD-1 binding antagonist is an antibody.

[0356] (Appendix 9) The combination of claim 8, wherein the PD-1 binding antagonist is MDX-1106, Merck 3745, CT-011, AMP-224 or AMP-514.

[0357] (Appendix 10) The combination described in Appendix 2, wherein the PD-L / PD-1 axis antagonist is a PD-L1 binding antagonist.

[0358] (Appendix 11) The combination of claim 10, wherein the PD-L1 binding antagonist inhibits binding of PD-L1 to PD-1.

[0359] (Appendix 12) The combination of claim 10, wherein the PD-L1 binding antagonist inhibits binding of PD-L1 to B7-1.

[0360] (Appendix 13) The combination of claim 10, wherein the PD-L1 binding antagonist inhibits binding of PD-L1 to both PD-1 and B7-1.

[0361] (Appendix 14) The combination of claim 10, wherein the PD-L1 binding antagonist is an antibody.

[0362] (Appendix 15) The combination of claim 14, wherein the PD-L1 binding antagonist is selected from the group consisting of YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and MSB0010718C.

[0363] (Appendix 16) The combination described in Appendix 2, wherein the PD-L / PD-1 axis antagonist is a PD-L2 binding antagonist.

[0364] (Appendix 17) The combination of claim 16, wherein the PD-L2 binding antagonist is an antibody.

[0365] (Appendix 18) The combination of claim 16, wherein the PD-L2 binding antagonist is an immunoadhesin.

[0366] (Appendix 19) 19. The combination according to any one of appendixes 1 to 18, wherein the immunotherapeutic agent is a compound of any one of formulas (I) to (XIXb), or a pharma- ceutically acceptable salt or solvate thereof.

[0367] (Appendix 20) The immunotherapeutic agent has the structure of formula (I): [ka] wherein the dashed line represents a bond or the absence of a bond; X is S or -NR1, R1 is -W0-W1-W2-W3-W4, W0 is a bond, alkyl, alkenyl, alkynyl, alkoxy, or -alkyl-S-alkyl--; W1 is a bond, --O--, or --NR2--, where R2 is hydrogen, alkyl, or alkenyl; W2 is a bond, --O--, --C(O)--, --C(S)--, or -S(O)2--; W3 is a bond, --NR3--, where R3 is hydrogen, alkyl, or alkenyl; W4 is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl, or heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --alkyl- ... optionally substituted with one or more substituents selected from the group consisting of (O)-R, --alkyl-C(O)-O-R, --C(O)-O-R, --S-R, --S(O)2-R, --NH-S(O)2-R, --alkyl-S-R, --alkyl-S(O)2-R, --NHR, --NR4R, --NH-alkyl-R, halogen, --CN, --NO2, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl; Z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which can be optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halogen, cyano, nitro, --N(R5), --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --OC(O)-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl; R is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, or heterocyclyl, each of which is selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl- optionally substituted with one or more substituents selected from the group consisting of C(O)-O-R, --C(O)-O-R, --OC(O)-R, --S-R, --C(O)-S-R, --SC(O)-R, --S(O)2-R, --NH-S(O)2-R, --alkyl-S-R, --alkyl-S(O)2-R, --NHR, --NR4R, --NH-alkyl-R, halogen, --CN, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl; n is 0, 1, 2, 3, or 4; Y is -NR6R7, -CR6R7R8, or -alkyl-NH2, each of which can be optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, --NH2, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl; wherein R6, R7, and R8 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or -alkyl-OC(O)-R9, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl; X and Z together may optionally form a (5-9) membered ring. 19. A combination according to any one of claims 1 to 18.

[0368] (Appendix 21) The immunotherapeutic agents include 2-propylthiazolo[4,5-c]quinolin-4-amine, 1-(2-methylpropyl)-1H-imidazo[4,5-c]quinolin-4-amine, 4-amino-2-(ethoxymethyl)-a,a-di-methyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-(4-amino-2-ethylaminomethylimidazo-[4,5-c]quinolin-1-yl)-2-methylpropan-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinolin-1-yl)butyl-] Methanesulfonamide, 4-amino-2-ethoxymethyl-aa-dimethyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1-ethanol, 4-amino-aa-dimethyl-2-methoxyethyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-{2-[3-(benzyloxy)propoxy]ethyl}-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-4-amine, N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridine-1 -yl)butyl]-n'-butylurea, N1-[2-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridin-1-yl)ethyl]-2-amino-4-methylpentanamide, N-(2-{2-[4-amino-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinolin-1-yl]ethoxy}ethyl)-n'-phenylurea, 1-(2-amino-2-methylpropyl)-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-4-amine, 1-{4-[(3,5-dichlorophenyl) phenyl)sulfonyl]butyl}-2-ethyl-1H-imidazo[4,5-c]quinolin-4-amine, N-(2-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-1-yl]ethoxy}ethyl)-n'-cyclohexylurea, N-{3-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-1-yl]propyl}-n'-(3-cyanophenyl)thiourea, N-[3-(4-amino-2-butyl-1H-imidazo[4,5-c]quinolin-1-yl)-2,2-Dimethylpropyl]benzamide, 2-butyl-1-[3-(methylsulfonyl)propyl]-1H-imidazo[4,5-c]quinolin-4-amine, N-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin-1-yl]-1,1-dimethylethyl}-2-ethoxyacetamide, 1-[4-amino-2-ethoxymethyl-7-(pyridin-4-yl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, 1-[4-amino-2-(ethoxymethyl)- 7-(pyridin-3-yl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, N-{3-[4-amino-1-(2-hydroxy-2-methylpropyl)-2-(methoxyethyl)-1H-imidazo[4,5-c]quinolin-7-yl]phenyl}methanesulfonamide, 1-[4-amino-7-(5-hydroxymethylpyridin-3-yl)-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinolin-1-yl]-2-methylpropan-2-ol, 3-[4-amino-2- (Ethoxymethyl)-7-(pyridin-3-yl)-1H-imidazo[4,5-c]quinolin-1-yl]propane-1,2-diol, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinolin-1-yl)-1,1-dimethylethyl]-3-propylurea, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinolin-1-yl)-1,1-dimethylethyl]-3-cyclopentylurea, 1-[(2,2-dimethyl-1,3-dioxolan-4-yl)methyl]-2-( ethoxymethyl)-7-(4-hydroxymethylphenyl)-1H-imidazo[4,5-c]quinolin-4-amine, 4-[4-amino-2-ethoxymethyl-1-(2-hydroxy-2-methylpropyl)-1H-imidazo[4,5-c]quinolin-7-yl]-N-methoxy-N-methylbenzamide, 2-ethoxymethyl-N1-isopropyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1,4-diamine, 1-[4-amino-2-ethyl-7-(pyridin-4-yl)-1H-imidazo[4,N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c][1,5]naphthyridin-1-yl)butyl]-n'-cyclohexylurea, The combination described in Appendix 20.

[0369] (Appendix 22) The immunotherapeutic agent has the structure of formula (II): [ka] wherein V is -NR6R7, where each of R6 and R7 is independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or -alkyl-OC(O)-R9, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl; R 10 and R 11 are independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl, or cycloalkyl, each of which is optionally substituted by one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, halogen, --N(R5), --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5), aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl; 19. A combination according to any one of claims 1 to 18.

[0370] (Appendix 23) The combination of any one of appendixes 1 to 22, further comprising an effective amount of an additional therapeutic agent.

[0371] (Appendix 24) 24. The combination of claim 23, wherein the additional therapeutic agent is an anti-cancer agent.

[0372] (Appendix 25) 25. The combination of claim 24, wherein the anticancer agent is an antimetabolite, an inhibitor of topoisomerase I and II, an alkylating agent, a microtubule inhibitor, an antiandrogen, a GNRh modulator, or a mixture thereof.

[0373] (Appendix 26) 24. The combination of claim 23, wherein the additional therapeutic agent is a chemotherapeutic agent selected from the group consisting of tamoxifen, raloxifene, anastrozole, exemestane, letrozole, imatanib, paclitaxel, cyclophosphamide, lovastatin, minosine, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide, etoposide, gemcitabine, epothilone, vinorelbine, camptothecin, daunorubicin, actinomycin D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin.

[0374] (Appendix 27) The amount of the immunotherapeutic agent is (1) Induction of IFN-α in enriched human blood DCs, (2) inducing TNF-α in enriched human blood DCs; and / or (3) Induction of IL-12-α in enriched human blood DCs; 27. The combination according to any one of claims 1 to 26,

[0375] (Appendix 28) A method of treating a disease condition in a subject in need of such treatment comprising administering to said subject a combination according to any one of claims 1 to 27.

[0376] (Appendix 29) 29. The method of claim 28, wherein the disease state is a tumor.

[0377] (Appendix 30) 29. The method of claim 28, wherein the disease condition comprises abnormal cell proliferation.

[0378] (Appendix 31) 31. The method of claim 30, wherein the abnormal cell growth comprises a precancerous lesion.

[0379] (Appendix 32) 31. The method of claim 30, wherein the abnormal cell growth is of a cancer cell.

[0380] (Appendix 33) 32. The method of claim 31, wherein the cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.

[0381] (Appendix 34) 34. The method of any one of claims 28 to 33, comprising administering to the subject an oral formulation comprising the immunotherapeutic agent at a dose of about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or all values ​​between 0.01 mg / kg and about 0.02 mg / kg, including all values ​​between 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or 0.01 mg / kg and about 0.02 mg / kg, twice weekly.

[0382] (Appendix 35) 34. The method of any one of claims 28 to 33, comprising administering to the subject an oral formulation comprising the immunotherapeutic agent at a dose of about or less than 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or 0.01 mg / kg twice weekly.

[0383] (Appendix 36) 34. The method of any one of claims 28 to 33, comprising administering to the subject an intravenous formulation comprising the immunotherapeutic agent at a dose of about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or any value between 0.006 mg / kg and about 0.015 mg / kg every week.

[0384] (Appendix 37) 34. The method of any one of claims 28 to 33, comprising administering to the subject an intravenous formulation comprising the immunotherapeutic agent at a dose of about 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or 0.006 mg / kg or less to about 0.01 mg / kg every week.

[0385] (Appendix 38) 38. The method of any one of claims 28 to 37, wherein the immunotherapeutic agent in the subject has a local concentration of between about 0.005 μg / ml and about 12 μg / ml.

[0386] (Appendix 39) 39. The method of any one of claims 28 to 38, wherein the immunotherapeutic agent in the subject has a local concentration of between about 0.05 μg / ml, 0.1 μg / ml, 0.15 μg / ml, 0.2 μg / ml, 0.3 μg / ml, or 0.4 μg / ml to about 0.5 μg / ml.

[0387] (Appendix 40) A kit comprising a combination according to any one of appendixes 1 to 27.

Claims

1. A combination comprising an immunotherapeutic agent and an effective amount of a PD-L / PD-1 axis antagonist for use in combination therapy to treat a disease state in a subject in need of treatment, comprising administering to the subject an effective amount of the immunotherapeutic agent and an effective amount of the PD-L / PD-1 axis antagonist, the immunotherapeutic agent is capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof, and is selected from the group consisting of resiquimod and imiquimod; The PD-L / PD-1 axis antagonist is an anti-PD-1 antibody or an anti-PD-L1 antibody, the PD-L / PD-1 axis antagonist and the immunotherapeutic agent are not linked to each other; The immunotherapeutic agent is administered to the subject as a pharmaceutical composition comprising the immunotherapeutic agent and a pharmaceutically acceptable carrier. Combination.

2. The combination described in claim 1, wherein the PD-L / PD-1 axis antagonist is an anti-PD-L1 antibody.

3. The combination of claim 2, wherein the anti-PD-L1 antibody is selected from the group consisting of YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and MSB0010718C.

4. The combination of claim 1, wherein the PD-L / PD-1 axis antagonist is an anti-PD-1 antibody.

5. The combination described in claim 4, wherein the anti-PD-1 antibody is selected from the group consisting of MDX-1106, MK-3475, CT-011, AMP-224, and AMP-514.

6. A combination described in any one of claims 1 to 5, wherein the immunotherapeutic agent is resiquimod.

7. The combination described in claim 6, wherein the resiquimod is a pharmaceutically acceptable salt or solvate thereof.

8. A combination described in any one of claims 1 to 7, further comprising an effective amount of an additional therapeutic agent.

9. The combination described in claim 8, wherein the additional therapeutic agent is an anticancer agent.

10. The combination of claim 9, wherein the anticancer agent is an antimetabolite, an inhibitor of topoisomerase I and II, an alkylating agent, a microtubule inhibitor, an antiandrogen, a GNRh modulator or a mixture thereof.

11. The combination described in claim 8, wherein the additional therapeutic agent is a chemotherapeutic agent.

12. The amount of the immunotherapeutic agent: (1) Induction of IFN-α in enriched human blood DCs; (2) inducing TNF-α in enriched human blood DCs, and / or (3) Induction of IL-12-α in enriched human blood DCs; 12. The combination according to claim 1, in an amount sufficient to

13. A combination described in any one of claims 1 to 12, wherein the disease state includes a tumor or abnormal cell proliferation.

14. The combination of claim 13, wherein the abnormal cell growth includes a precancerous lesion or the growth is of cancer cells.

15. The combination of claim 14, wherein the cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.