Method for treating patient having undergone pre-transplantation process in hematopoietic stem cell transplantation, and composition for use in the method

Abstract

To provide a method for treating a patient who has undergone a pre-transplantation process in hematopoietic stem cell transplantation, and a composition for use in the method.SOLUTION: A composition according to the present disclosure contains bone-marrow common progenitor cells (CMP).SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to methods of treating patients undergoing conditioning in hematopoietic stem cell transplantation and compositions for use in said methods. [Background technology]

[0002] In the culture of hematopoietic stem cells, research is being conducted on the proliferation using chemically defined media, and it has been demonstrated that mouse hematopoietic stem cells can be cultured using chemically defined media (Non-Patent Document 1, Patent Documents 1 and 2).

[0003] In hematopoietic stem cell transplantation, a technique of transplanting hematopoietic stem cells, which may be allogeneic, has been proposed to compensate for the limited (ie, small) number of transplanted cells (Patent Document 3). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] WO2021 / 049617A [Patent Document 2] WO2021 / 149799A [Patent Document 3] JP2016-104711A [Non-patent literature]

[0005] [Non-Patent Document 1] Wilkinson et al., Nature, 571:117-121, 2019 Summary of the Invention

[0006] The present disclosure provides methods of treating patients undergoing conditioning in hematopoietic stem cell transplantation and compositions for use in said methods. The present disclosure also provides methods of producing such compositions.

[0007] According to the present disclosure, the following inventions are provided. (1) A composition comprising a cell population, the cell population comprising common myeloid progenitor cells (CMPs); A composition in which the expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1 is downregulated in common myeloid progenitor cells (CMPs) compared to CMPs contained in the hematopoietic stem cell fraction of bone marrow in a living organism. (2) A composition comprising a cell population, the cell population comprising common myeloid progenitor cells (CMPs); A composition, wherein the common myeloid progenitor cells (CMP) are expanded in vitro, preferably expanded in serum albumin-free medium. (3) The composition described in (1) or (2) above, wherein the common myeloid progenitor cells (CMP) are DPP4 negative. (4) The composition according to (2) or (3) above, wherein the medium contains polyvinyl alcohol or modified polyalkylene glycol. (5) The composition according to any one of (1) to (4) above, wherein CXCR4 is knocked down or knocked out in common myeloid progenitor cells (CMP). (6) The composition according to any one of (1) to (5) above, wherein the common myeloid progenitor cells (CMP) do not have major histocompatibility complexes on the cell membrane surface. (7) A composition comprising a cell population, the cell population comprising common myeloid progenitor cells (CMPs), administered to a recipient undergoing conditioning for hematopoietic stem cell transplantation. (8) The composition according to (7) above, comprising a cell population defined in any one of (1) to (6) above. (9) The composition according to any one of (1) to (8) above, which is administered prior to, simultaneously with, or after hematopoietic stem cell transplantation. (10) The composition according to (8) or (9) above for use in supporting early hematopoiesis after hematopoietic stem cell transplantation in a recipient. (11) The composition according to (9) above for use in supporting survival of a recipient. (12) The composition according to (10) or (11) above, which is administered multiple times to a recipient. (13) The composition according to any one of (8) to (12) above, for use in inducing hematopoiesis in the spleen. (14) A method for culturing a cell population comprising common myeloid progenitor cells (CMP), comprising: A method comprising culturing a cell population comprising common myeloid progenitor cells (CMPs) in a serum albumin-free medium, thereby expanding the common myeloid progenitor cells (CMPs). (15) The method according to (14) above, wherein the medium contains polyvinyl alcohol or modified polyalkylene glycol. (16) The method according to (14) or (15) above, further comprising recovering common myeloid progenitor cells (CMP) from the cell population after culture. (17) A composition comprising a cell population containing common myeloid progenitor cells (CMP) obtained by the method according to (16) above. (18) The composition described in (17) above, in which the expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1 is downregulated in common myeloid progenitor cells (CMPs) compared to CMPs contained in the hematopoietic stem cell fraction in the body.

[0008] (31) Any of the above compositions, wherein when the CMP is transplanted into a lethally irradiated mouse, it can initiate hematopoietic system more quickly than a pre-cultured CMP (fresh CMP) obtained from bone marrow. (32) Any of the above compositions, wherein the CMP is more responsive to granulocyte colony-stimulating factor (GCSF) compared to a pre-cultured CMP (fresh CMP) obtained from bone marrow. (33) The composition according to (32) above, wherein the responsiveness to GCSF is, for example, responsiveness to the effect of promoting the differentiation and proliferation of granulocytes, particularly the effect of increasing neutrophils. (34) Any of the above compositions, wherein the CMP is expanded in the presence of hematopoietic stem cells. (35) Any of the above compositions, wherein CMP proliferation is carried out in the presence of a PI3K activator. (36) Any of the above compositions, wherein the proliferation of CMP is carried out in the presence of a TPO receptor agonist. (37) Any of the above compositions, wherein CMP proliferation is carried out in the presence of a PI3K activator and a TPO receptor agonist. (38) Any of the above compositions, wherein the proliferation of CMP is carried out under cytokine-free conditions. (39) The composition according to any of the above, wherein the proliferation is 2x or more, 3x or more, 4x or more, 5x or more, 6x or more, 7x or more, 8x or more, 9x or more, 10x or more, 20x or more, 30x or more, 40x or more, 50x or more, 60x or more, 70x or more, 80x or more, 90x or more, 100x or more, 200x or more, 300x or more, 400x or more, 500x or more, 600x or more, 700x or more, 800x or more, 900x or more, 1000x or more, 2000x or more, 3000x or more, 4000x or more, 5000x or more, 6000x or more, 7000x or more, 8000x or more, 9000x or more, or 10000x or more proliferation. [Brief description of the drawings]

[0009] [Figure 1A] FIG. 1A shows a sequential scheme for testing the contribution of Akaluc-expressing hematopoietic stem cells cultured in albumin-free polyvinyl alcohol-containing medium in irradiated mice transplanted with said hematopoietic stem cells. [Figure 1B] FIG. 1B is an IVIS image showing the contribution of mNG-positive, Akaluc-expressing hematopoietic stem cells in an irradiated mouse transplanted with the hematopoietic stem cells after culture. [Figure 1C] FIG. 1C is an IVIS image showing the contribution of mNG-positive, Akaluc-expressing hematopoietic stem cells in an irradiated mouse transplanted with the hematopoietic stem cells after culture. [Figure 2A]FIG. 2A is an IVIS image showing the contribution of CD150+CD201+ Akaluc-expressing hematopoietic stem cells in an irradiated mouse transplanted with the hematopoietic stem cells after culture. [Figure 2B] FIG. 2B shows flow cytometry results showing isolation of CD150+CD201+ Akaluc-expressing hematopoietic stem cells from the cultures after culturing. [Figure 2C] FIG. 2C shows that after 16 weeks in culture, CD150+CD201+ Akaluc-expressing hematopoietic stem cells contained in the culture had the capacity to differentiate into myeloid, B-cell, and T-cells. [Figure 2D] FIG. 2D shows the time course of the average brightness of Akaluc in the spleen of irradiated mice transplanted with CD150+CD201+ Akaluc-expressing hematopoietic stem cells after culture and the time course of IVIS images. [Figure 3A] FIG. 3A shows that only administered mNG+ cells (donor cells) produced luminescence derived from Akaluc. [Figure 3B] Figure 3B shows the change in cell number in the spleen and bone marrow of various cells derived from the administered mNG+ cells (donor cells). The solid line indicates the cell number in the spleen (SP), and the dashed line indicates the cell number in the bone marrow (BM). [Figure 3C] FIG. 3C shows the time course of the proportions of cell types in the spleen (SP) and bone marrow (BM). [Figure 4A] FIG. 4A shows the results of clustering based on marker expression of mNG+Lin- cell populations in the bone marrow and spleen of irradiated mice after hematopoietic stem cell transplantation. [Figure 4B] Figure 4B shows the time course of the results of clustering based on marker expression of cells present in the spleen (SP) and bone marrow (BM) of irradiated mice after hematopoietic stem cell transplantation. [Figure 4C] FIG. 4C shows the time course of the proportion of CMPs, MEPs, and GMPs among cells present in the spleen (SP) and bone marrow (BM) of irradiated mice after hematopoietic stem cell transplantation. [Figure 4D] FIG. 4D shows the time course of the abundance of each cell fraction in the spleen (SP) of irradiated mice after hematopoietic stem cell transplantation. [Figure 5A] FIG. 5A shows time-dependent changes in IVIS images after transplantation of irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) transplanted with cultured CD150+CD201+ Akaluc-expressing hematopoietic stem cells. [Figure 5B] FIG. 5B shows the number of mNG+ cells in the bone marrow in irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) transplanted with CD150+CD201+ Akaluc-expressing hematopoietic stem cells after culture. [Figure 5C] FIG. 5C shows the percentage of CMPs in the bone marrow in irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) transplanted with CD150+CD201+ Akaluc-expressing hematopoietic stem cells after culture. [Figure 6] FIG. 6 shows the transition of Hb levels and the number of Gr1 / Mac1 positive cells in irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) transplanted with CD150+CD201+ Akaluc-expressing hematopoietic stem cells after culture. [Figure 7A] FIG. 7A shows the experimental scheme of FIG. 7B. [Figure 7B] FIG. 7B shows the time course of the percentage of peripheral blood cells derived from irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) transplanted with CD150+CD201+ Akaluc-expressing hematopoietic stem cells. [Figure 8A] FIG. 8A shows a scheme for further transplantation of CMPs, MEPs, or GMPs obtained from hematopoietic stem cell fractions 12 weeks after transplantation of irradiated mice transplanted with cultured CD150+CD201+ Akaluc-expressing hematopoietic stem cells into irradiated B6 mice. [Figure 8B] FIG. 8B shows the results of analysis of bone marrow cells 12 weeks after transplantation of irradiated mice transplanted with cultured CD150+CD201+ Akaluc-expressing hematopoietic stem cells. [Figure 8C] FIG. 8C shows post-implant IVIS images of irradiated B6 mice transplanted with CMP, MEP, or GMP. [Figure 8D]FIG. 8D shows the time course of signal intensity in IVIS images of irradiated B6 mice transplanted with CMP, MEP, or GMP. FIG. 8C shows the time course of signal intensity in IVIS images of irradiated B6 mice transplanted with CMP, MEP, or GMP. [Figure 8E] FIG. 8E shows the results of an analysis of marker expression in cells from the spleens after transplantation of irradiated B6 mice transplanted with CMP, MEP, or GMP. [Figure 8F] FIG. 8F shows the percentage of engrafted cells in the peripheral blood 4 weeks after transplantation of irradiated B6 mice transplanted with CMP, MEP, or GMP. [Figure 9A] FIG. 9A shows a scheme for administration of whole blood to irradiated mice and subsequent analysis. [Figure 9B] FIG. 9B shows the percentage of CMPs in the spleen (SP) and bone marrow (BM). [Figure 9C] FIG. 9C shows the percentage of CMPs, MEPs, and GMPs in peripheral blood (PB), spleen (SP), and bone marrow (BM). [Figure 10A] FIG. 10A shows the results of analysis of cultured Akaluc-positive hematopoietic stem cells. [Figure 10B] FIG. 10B shows IVIS images after the resulting exCMPs and exGMPs were transplanted into irradiated mice. [Figure 10C] FIG. 10C shows the time course of signal intensity in IVIS images of mice transplanted with exCMP or exGMP. [Figure 10D] FIG. 10D shows the results of analyzing marker expression in cells in the spleen after transplantation of mice transplanted with exCMP or exGMP. [Figure 10E] FIG. 10E shows the number of Gr1 / Mac1 positive cells or Ter119+ cells in the spleens of irradiated mice transplanted with each cell fraction. [Figure 10F] FIG. 10F shows the percentage of exCMP-derived cells in the peripheral blood of irradiated mice transplanted with exCMPs. [Figure 11A] FIG. 11A shows an IVIS image of an irradiated mouse engrafted with an Akaluc-positive exCMP. [Figure 11B]FIG. 11B shows signal intensity in the spleen, bone marrow, and periphery 24 hours after transplantation of irradiated mice transplanted with Akaluc-positive exCMPs. [Figure 11C] FIG. 11C shows the percentage of engrafted cells in the spleen and bone marrow 24 hours after transplantation of irradiated mice transplanted with Akaluc-positive exCMP. [Figure 11D] FIG. 11D shows the percentage of engrafted cells in the spleen (SP), bone marrow (BM), and peripheral blood (PB) 24 hours after transplantation of irradiated mice transplanted with Akaluc-positive exCMPs. [Figure 12A] FIG. 12A shows the results of analysis of CMPs in cultures obtained by culturing cKit-positive cells using the cKit bulk culture system. [Figure 12B] FIG. 12B shows the time course of the number of CMPs in cultures obtained by culturing cKit-positive cells using the cKit bulk culture system. [Figure 13A] FIG. 13A shows the difference in gene expression between freshCMP (fCMP) and exCMP. [Figure 13B] FIG. 13B shows the results of flow cytometry analyzing DPP4 expression in freshCMP (fCMP) and exCMP. [Figure 13C] FIG. 13C shows the results of measuring the DPP4 activity of fresh CMP (fCMP) and exCMP. [Figure 14A] FIG. 14A shows an IVIS image of an irradiated mouse transplanted with a mixture of CD150+CD201+ Akaluc-expressing hematopoietic stem cells, ecCMPs, and bone marrow cells. [Figure 14B] FIG. 14B shows the time course of signal intensity from IVIS images of an irradiated mouse transplanted with a mixture of CD150+CD201+ Akaluc-expressing hematopoietic stem cells, ecCMPs, and bone marrow cells. [Figure 14C] FIG. 14C shows an IVIS image 3 days after transplantation of an irradiated mouse transplanted with a mixture of CD150+CD201+ Akaluc-expressing hematopoietic stem cells, ecCMPs, and bone marrow cells. [Figure 14D]Figure 14D shows the time course of Hb, Gr1 / Mac1 positive cell counts, and platelet (PLT) amounts in peripheral blood of irradiated mice transplanted with a mixture of CD150+CD201+ Akaluc-expressing hematopoietic stem cells and ecCMPs. [Figure 14E] FIG. 14E shows the time course of Hb, Gr1 / Mac1 positive cell counts, and platelets (PLTs) in irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) transplanted with a mixture of CD150+CD201+ Akaluc-expressing hematopoietic stem cells and ecCMPs. [Figure 15A] FIG. 15A shows the experimental scheme in which exCMP was administered periodically every week to lethally irradiated mice. [Figure 15B] FIG. 15B shows survival curves for irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) that received exCMP on a weekly schedule, as well as for irradiated non-splenectomized mice that received no exCMP. [Figure 15C] FIG. 15C shows survival curves of irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) that received exCMP on a weekly schedule. [Figure 15D] FIG. 15D shows the number of Gr1 / Mac1 positive cells, Hb, and platelet (PLT) counts on day 10 in irradiated non-splenectomized mice (WT) and irradiated splenectomized mice (SPex) that were regularly administered exCMP once a week. [Figure 16A] FIG. 16A shows the results of a CRISPR / Cas9-mediated knockout experiment of cell surface expression of MHC class I. [Figure 16B] FIG. 16B shows an IVIS image 5 days after transplantation of an allogeneic irradiated mouse transplanted with an exCMP in which cell surface expression of MHC class I has been knocked out (UN exCMP). [Figure 16C] FIG. 16C shows the signal intensity in the spleen on day 7 of allogeneic irradiated mice transplanted with wild-type (WT) or exCMP with knockout of MHC class I cell surface expression (UN exCMP), and the number of mNG+ cells in the spleen on day 7. [Figure 16D]Figure 16D shows the administration scheme of wild-type (WT) or exCMP with knockout of MHC class I cell surface expression (UN exCMP), and bone marrow cells to irradiated mice, as well as the survival curves of mice treated with this scheme and the results of chimerism analysis in peripheral blood 4 weeks after transplantation. [Figure 17A] FIG. 17A shows IVIS images of irradiated mice receiving CMP or exCMP after transplantation. [Figure 17B] FIG. 17B shows the time course of signal intensity in IVIS images after transplantation of irradiated mice administered CMP or exCMP. [Figure 17C] FIG. 17C shows the number of mNG+ cells in the spleens 7 days after transplantation of irradiated mice receiving CMP or exCMP. [Figure 17D] FIG. 17D shows the percentage of CMPs and exCMPs in the spleens 7 days after irradiation of mice receiving equal numbers of CMPs and exCMPs and additionally receiving GCSF. [Figure 18] FIG. 18 shows the numbers of Ter119+ and Gr1 / Mac1+ cells in the spleens 7 days after transplantation of irradiated mice receiving mNG+ CMP, MEP, GMP, cCMP (exCMP), or cGMP (exGMP). [Figure 19] FIG. 19 shows the numbers of human CMPs and hematopoietic stem cells (HSCs) in the spleens of irradiated mice transplanted with human CMPs or exCMPs 7 days after transplantation. Detailed Description of the Invention

[0010] As used herein, a "subject" may be a mammal, for example, a primate such as a human; a rodent such as a mouse, rat, and hamster; a carnivore such as a dog and a cat; a perissodactyl such as a horse, donkey, and a mule; an even-toed ungulate such as a cow, pig, llama, alpaca, goat, and sheep. As used herein, a cell may be a cell of a mammal, for example, a primate such as a human; a rodent such as a mouse, rat, and hamster; a carnivore such as a dog and a cat; a perissodactyl such as a horse, donkey, and a mule; an even-toed ungulate such as a cow, pig, llama, alpaca, goat, and sheep, and may preferably be a human cell or a mouse cell.

[0011] As used herein, the term "recipient" refers to a subject who receives hematopoietic stem cell transplantation. As used herein, the term "donor" refers to a subject who provides cells for hematopoietic stem cell transplantation. Usually, hematopoietic stem cell transplantation is performed allogeneic. In recent years, a technique has been developed that facilitates allogeneic transplantation by deleting major histocompatibility complex (MHC, HLA in humans). The cells obtained in this manner are called universal cells.

[0012] As used herein, a "hematopoietic stem cell" is a stem cell that can differentiate into blood lineage cells. Hematopoietic stem cells can be collected from bone marrow, umbilical cord, placenta, and peripheral blood. Human hematopoietic stem cells are CD34-positive cells. In humans, hematopoietic stem cells are known to be abundant in the CD34-positive CD38-negative cell fraction (also called "hematopoietic stem cell fraction"). Thus, human hematopoietic stem cells can be CD34-positive CD38-negative. Hematopoietic stem cells can be cells obtained by ex vivo differentiation of pluripotent stem cells such as ES cells and iPS cells. In mice, hematopoietic stem cells can be KSL cells. KSL cells are characterized as c-kit+Sca1+Lineage-.

[0013] As used herein, "blood cell" refers to hematopoietic stem cells and cells resulting from the differentiation of hematopoietic stem cells. Hematopoietic cells are broadly classified into hematopoietic stem cells, hematopoietic progenitor cells, and blood cells according to the differentiation stage. Hematopoietic stem cells differentiate into blood cells via hematopoietic progenitor cells. More specifically, hematopoietic stem cells can differentiate into lymphocytes (e.g., T cells, B cells, NK cells) via lymphoblasts. Hematopoietic stem cells can also differentiate into monocytes via hematopoietic progenitor cells and monoblasts. Hematopoietic stem cells can also differentiate into granulocytic leukocytes such as neutrophils, eosinophils, or basophils, or macrophages via hematopoietic progenitor cells, common myeloid progenitor cells (CMP), and granulocytic / monocytic progenitor cells (GMP). Hematopoietic stem cells can also differentiate into red blood cells via hematopoietic progenitor cells, common myeloid progenitor cells (CMP), and erythroblastic / megakaryocytic progenitor cells (MEP). Hematopoietic stem cells can also differentiate into hematopoietic progenitor cells, common myeloid progenitor cells (CMPs), megakaryocyte-erythroid progenitor cells (MEPs), megakaryocytes, and then platelets. All of the cells that are generated by differentiation from these hematopoietic stem cells are blood cells.

[0014] As used herein, a "common myeloid progenitor cell" (CMP) is a stem cell capable of differentiating into granulocytic leukocytes, macrophages, erythrocytes, and platelets. CMP may be included in the hematopoietic stem cell fraction. Thus, CMP can be obtained from the hematopoietic stem cell fraction based on the expression of markers of CMP. For example, human CMP is characterized as CD34+CD38+CD123+CD45RA- cells in the hematopoietic stem cell fraction. Human GMP is characterized as CD34+CD38+CD123+CD45RA+ cells. Human MEP is characterized as CD34+CD38+CD123-CD45RA- cells. Human GMP and MEP can also be obtained from the hematopoietic stem cell fraction based on the markers expressed in these cells. Mouse CMP is characterized as Lin-cKit+Sca1-FcgR-CD34+ cells.

[0015] As used herein, "ex vivo" means outside the body. As used herein, ex vivo is used in contrast to in vivo (within the living body) and means a state in which cells present in a living body are removed from the living body to outside the living body. Culturing can be performed ex vivo.

[0016] As used herein, "positive" means that the cell is recognized to express the molecule specified by the term immediately preceding it. Positive means that the molecule is expressed with a significant difference compared to a negative control. As used herein, "positive" may be simply written as "+". As used herein, "negative" means that the cell is recognized to not express the molecule specified by the term immediately preceding it. Negative means that the expression is not significantly different or is not expressed compared to a negative control. As used herein, "negative" may be simply written as "-".

[0017] In this specification, "polyvinyl alcohol" (PVA) means a polymer of vinyl alcohol. Polyvinyl alcohol can be obtained by saponifying polyvinyl acetate, which is obtained by polymerizing vinyl acetate monomer. The weight average molecular weight (M W ) can be, for example, 1 kDa to 20 kDa, 3 kDa to 17 kDa, 5 kDa to 15 kDa, or 7 kDa to 13 kDa. When PVA is obtained by saponifying polyvinyl acetate by the above method, the saponification rate can be 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more.

[0018] In this specification, "albumin" refers to a protein known as a plasma component. Albumin is said to account for 60% of plasma proteins, and is present in large quantities in blood, serum, and plasma. Albumin is thought to be responsible for maintaining the osmotic pressure of blood in the body, and for binding to biological substances such as fatty acids and hormones to transport them. The importance of serum albumin is also known in the maintenance culture of hematopoietic stem cells. Human serum albumin (hereinafter sometimes referred to as "HSA") is human serum albumin, and may be, for example, a protein having an amino acid sequence registered under GenBank registration number: AAN17825.1, or a human serum albumin having an amino acid sequence corresponding thereto.

[0019] As used herein, the term "agonist" refers to a substance that activates proteins such as receptors and enzymes.

[0020] As used herein, "PI3K" refers to phosphatidylinositol 3-kinase. PI3K is an enzyme that phosphorylates inositol phospholipids, which are components of cells. Phosphatidylinositol 3,4,5-triphosphate (PIP3), which is generated by phosphorylation, phosphorylates Akt (also known as protein kinase B), and transmits the signal downstream. As used herein, "PI3K activator" refers to an agonist of receptor tyrosine kinase and a substance that activates PI3K. PI3K activator may have selectivity for PI3K.

[0021] As used herein, "TPO" refers to thrombopoietin. TPO is a protein responsible for differentiation of hematopoietic stem cells into megakaryocytes. TPO is known to be involved in the proper maintenance of hematopoietic stem cells. Human thrombopoietin may be, for example, a protein having an amino acid sequence registered under GenBank accession number: AAB33390.1 or a thrombopoietin having an amino acid sequence corresponding thereto. As used herein, the term "TPO receptor agonist" refers to a substance other than TPO that activates the TPO receptor. Examples of TPO receptor agonists include TPO variants other than TPO, peptides, and compounds that activate the TPO receptor. As used herein, the term "compound" encompasses organic compounds. The TPO receptor agonist may have selectivity for the TPO receptor.

[0022] As used herein, stem cell factor (SCF) refers to a hematopoietic cell growth factor that acts in the early stage of hematopoiesis. Human stem cell factor may be, for example, a protein having an amino acid sequence registered under GenBank accession number AAA85450.1 or an SCF having an amino acid sequence corresponding thereto.

[0023] As used herein, "culturing" means incubating cells under conditions suitable for their growth or maintenance. Incubation may be preferably performed at 37°C and 5% CO2 atmosphere in the case of human cells. When "culturing" involves growth, it is understood that "culturing" is the production of the grown cells. As used herein, "culturing" may be performed in a serum-free medium. As used herein, "culturing" may be performed in a chemically defined culture medium (or in a synthetic complete medium). A chemically defined culture medium is a serum-free medium.

[0024] As used herein, "culture medium" refers to a medium used for culturing cells. A medium can be prepared by adding necessary components to a basal medium. The necessary components can be pH adjusters, sugar sources such as glucose, antibiotics (e.g., penicillin, streptomycin, etc.), and essential amino acids such as glutamine, as well as culture additives such as insulin, transferrin, selenium (e.g., sodium selenite), and ethanolamine.

[0025] As used herein, "in the absence" refers to an environment that is substantially free or free of the component specified by the immediately preceding term. Here, "substantially" may be used in the sense of not excluding unavoidable contamination in the manufacturing process or contamination below the detection limit. As used herein, "free" refers to free at a concentration above the detection limit or completely free. For example, a serum-free medium without the addition of serum or albumin is albumin-free and does not contain serum or albumin. "Albumin-free" refers to substantially free or free of albumin. Also, "cytokine-free" refers to substantially free or free of cytokines. The medium may be albumin-free. The medium may be cytokine-free. The medium may be albumin-free and cytokine-free. The medium is preferably serum-free, albumin-free and cytokine-free. The medium is more preferably chemically defined, albumin-free and cytokine-free.

[0026] As used herein, "cytotoxicity" refers to a property that reduces the number of cells or kills cells during culture. As used herein, "non-cytotoxicity" refers to a property that does not reduce the number of cells during culture. Some substances may be cytotoxic by increasing the concentration, but in this case, if the substance exhibits the expected effect even when the concentration is reduced to a level that does not cause cytotoxicity, it can be defined as non-cytotoxic. As used herein, "the medium does not contain a cytotoxic agent" or "does not contain a cytotoxic agent" means that the medium does not contain a cytotoxic agent or a cytotoxic agent in an amount sufficient to cause cytotoxicity. Therefore, even if a certain agent has cytotoxicity at a high concentration, when it is used at a concentration that does not cause cytotoxicity, the agent is not a cytotoxic agent or a cytotoxic agent.

[0027] In the present specification, a "cell population" is a group of multiple cells. A cell population is usually dispersed in an aqueous solution. Therefore, a cell population can be an aqueous solution containing multiple cells, in which the cells are dispersed in the aqueous solution. The aqueous solution has a composition suitable for the growth, maintenance, or storage of cells. For example, the aqueous solution is a culture medium, a physiological saline solution, etc. A cell population is not necessarily limited to a form containing only one type of cell, but includes a form containing two or more different types of cells. A cell population may be a cell population obtained by culturing a specific cell population, or a specific cell population obtained from a living body before culture. A cell population may be a cell fraction separated from other cells based on the expression of one or more markers. In addition to the cell population in which the cells are dispersed in an aqueous solution as described above, a cell population in the form of a precipitate obtained by precipitating the cells of the cell population, or a cell population that has formed a cell cluster, may also be included in the definition of a cell population. A cell population containing CMP may be, for example, a cell fraction separated from a hematopoietic stem cell fraction based on marker expression. Alternatively, a cell population containing a CMP may be a cell fraction that is separated based on marker expression from a culture obtained by culturing and preferably expanding a hematopoietic stem cell fraction under conditions suitable for its culture (e.g., in the absence of albumin).

[0028] A cell population containing CMP can be obtained, for example, from a hematopoietic stem cell fraction (e.g., a hematopoietic stem cell fraction before culture extracted from a living body) based on the fact that the fraction is CD34+CD38+CD123+CD45RA-. A cell population containing CMP after culture can be obtained from a cultured hematopoietic stem cell fraction (e.g., a hematopoietic stem cell fraction cultured in the absence of albumin) based on the fact that the fraction is CD34+CD38+CD123+CD45RA-. Other cell populations containing CMP can be obtained from cell populations using the expression of markers characteristic of CMP as an indicator.

[0029] According to the present disclosure, a composition comprising a cell population is provided. According to the present disclosure, the cell population comprises a common myeloid progenitor cell (CMP). According to the present disclosure, the cell population may be a cell population obtained by enriching CMP from a hematopoietic stem cell fraction. According to the present disclosure, the cell population may also be a cell population obtained by enriching CMP from a culture obtained by culturing a hematopoietic stem cell fraction. Enrichment of CMP can be performed from the cell population based on expression of CMP markers. As described above, enrichment of CMP can be performed by obtaining a cell population that is CD34+CD38+CD123+CD45RA- from the cell population. Other cell populations containing CMP can be enriched from the cell population using expression of markers characteristic of CMP as an indicator.

[0030] The present disclosure also provides a composition comprising a cell population, the composition comprising a CMP, the CMP having downregulated expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1. In one embodiment, the CMP has downregulated expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1, compared to the CMP contained in the hematopoietic stem cell fraction in the living body. The downregulation may be downregulated to an expression level of about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less of the expression level in the CMP contained in the hematopoietic stem cell fraction in the living body. In one embodiment, the CMP may be DPP4 negative.

[0031] The present disclosure also provides a composition comprising a cell population, the composition comprising an exCMP. The exCMP can be obtained by a variety of methods. The present disclosure also provides a composition comprising a cell population, the composition comprising a CMP, the common myeloid progenitor cell (CMP) being grown in a serum albumin-free medium. The common myeloid progenitor cell (CMP) or exCMP is cultured or grown under conditions suitable for its culture or growth. The expansion may be 2x or more, 3x or more, 4x or more, 5x or more, 6x or more, 7x or more, 8x or more, 9x or more, 10x or more, 20x or more, 30x or more, 40x or more, 50x or more, 60x or more, 70x or more, 80x or more, 90x or more, 100x or more, 200x or more, 300x or more, 400x or more, 500x or more, 600x or more, 700x or more, 800x or more, 900x or more, 1000x or more, 2000x or more, 3000x or more, 4000x or more, 5000x or more, 6000x or more, 7000x or more, 8000x or more, 9000x or more, or 10000x or more. CMPs grown in the absence of albumin may have various advantages over CMPs, as set forth below.

[0032] In one embodiment, the CMP has downregulated, substantially no expression, or no expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1, compared to the CMP contained in the hematopoietic stem cell fraction in the living body. In one embodiment, the CMP may be DPP4 negative. In one embodiment, the CMP has substantially no or no DPP4 activity. Here, the term "substantially" in the context of expression and activity allows for differences that do not result in significant differences, for example. Thus, substantially no expression means that, even if there is expression, the expression is at, for example, background levels or at a level that does not result in significant differences from the negative control.

[0033] In one embodiment, the CMP is more responsive to granulocyte colony-stimulating factor (GCSF) than a pre-cultured CMP (fresh CMP) obtained from bone marrow. GCSF has the effect of promoting the differentiation and proliferation of granulocytes, and in particular exhibits various effects such as an increase in neutrophils. The responsiveness to GCSF is, for example, responsiveness to the effect of promoting the differentiation and proliferation of granulocytes, in particular an increase in neutrophils.

[0034] In certain aspects, the CMP can initiate hematopoietic system more quickly when transplanted into lethally irradiated mice compared to fresh CMPs obtained from bone marrow, hi certain aspects, the CMP can produce or promote the production of more hematopoietic cells in the spleen when transplanted into lethally irradiated mice compared to fresh CMPs obtained from bone marrow.

[0035] CMP or exCMP can be obtained from a culture obtained by culturing a cell population containing CMP, but preferably from a culture obtained by culturing a hematopoietic stem cell fraction. CMP or exCMP is continuously supplied from hematopoietic stem cells, so it is thought that it is possible to obtain a large amount by culturing in the presence of hematopoietic stem cells. Methods for culturing mouse and human hematopoietic stem cells in vitro have been developed. For example, WO2021 / 049617A and WO2021 / 149799A have developed methods for culturing hematopoietic stem cells in the absence of albumin, which makes it possible to prepare large amounts of mouse and human hematopoietic stem cells in vitro. CMP or exCMP itself can also be cultured and grown in the absence of albumin under the same conditions as the culture of hematopoietic stem cells. In a preferred embodiment, hematopoietic stem cells and CMP or exCMP can be well cultured or grown in a medium containing polyvinyl alcohol or modified polyalkylene glycol. Hematopoietic stem cells and CMPs or exCMPs can be cultured or expanded, for example, in medium containing polyvinyl alcohol or modified polyalkylene glycol in the absence of albumin.

[0036] In some embodiments, the modified polyalkylene glycol may be, for example, a modified polyethylene glycol. The modified polyalkylene glycol or modified polyethylene glycol may preferably be modified with a copolymer of a polyvinyl caprolactam block and a polyvinyl acetate block. In some embodiments, the modified polyalkylene glycol is a polyalkylene glycol (e.g., polyethylene glycol) modified with a copolymer of a polyvinyl caprolactam block and a polyvinyl acetate block. In some preferred embodiments, the modified polyalkylene glycol may have the following formula (I):

[0037] [ka] {In the formula, n is a natural number of 5 to 50, m is a natural number of 10 to 100, and l is a natural number of 10 to 200.}

[0038] In one embodiment, n can be a natural number of 5 to 20 or 10 to 20, m can be a natural number of 20 to 50 or 30 to 40, and l can be a natural number of 30 to 100 or 50 to 60.

[0039] Hematopoietic stem cells and CMPs or exCMPs can be cultured or grown, for example, in a medium containing polyvinyl alcohol or a compound of formula (I) in the absence of albumin. As a medium for culturing or growing hematopoietic stem cells and CMPs or exCMPs, a medium suitable for culturing hematopoietic stem cells can be appropriately used. The basal media include S-clone SF-3 medium, F12 medium, StemSpan or StemSpan SFEM (Stem Cell technologies), STEMα (STEM ALPHA), StemPro-34 serum-free medium (Gibco Invitrogen), StemPro MSC serum-free medium (Invitrogen), HSC-CFU medium (Miltenyl Biotech), S-Clone serum-free medium (SF-02, SF-03, CM-B, SF-B) (Sanko Junyaku), HPGM medium (Sanko Junyaku), AIM V medium (Invitrogen), Marrow MAX bone marrow medium (Invitrogen), KnockOut DMEM / F-12 medium (Invitrogen), Stemline hematopoietic stem cell growth medium (Sigma), SYN serum-free medium (SYN H, SYN B) (AbCys SA), SPE IV medium (AbCys SA), MyeloCult medium (StemCell Technologies), HPG serum-free medium (Lonza), UltraCULTURE medium (Lonza), Opti-MEM medium (Gibco Invitrogen and others), MEM medium (Gibco Invitrogen and others), MEMα (Gibco Invitrogen and others), DMEM medium (Gibco Invitrogen and others), IMDM medium (Gibco Invitrogen and others), PRMI1640 medium (Gibco Invitrogen and others), Ham F-12 medium (Gibco and others), RD medium, and the like can be used. The culture medium includes a basal medium. The culture medium may include, for example, one or more selected from insulin, transaminase (apo), sodium selenite, and ethanolamine, or all of them. The culture medium may include HEPES, sodium pyruvate, vitamins, amino acids, heparin, heparan sulfate, chondroitin sulfate, and the like.The culture medium may contain antibiotics (e.g., penicillin and streptomycin). The culture medium may contain glutamine. The culture medium may contain, for example, insulin, transaminase (apo), sodium selenite, ethanolamine, and antibiotics, and may further contain HEPES.

[0040] The medium may contain SCF (which may be recombinant SCF). The SCF may be, for example, mammalian SCF or recombinant human SCF. In one embodiment of the present invention, the SCF concentration is 1 to 200 ng / mL, more preferably 1 to 150 ng / mL, even more preferably 1 to 100 ng / mL, for example, 1 to 50 ng / mL, even more preferably 1 to 30 ng / mL, even more preferably 1 to 20 ng / mL, for example, 5 to 15 ng / mL.

[0041] The medium may contain TPO. The TPO may be, for example, a recombinant mammalian TPO, or a recombinant human TPO. In one embodiment of the present invention, the TPO concentration is 20 to 200 ng / mL, more preferably 30 to 150 ng / mL, and further preferably 40 to 150 ng / mL, and may be, for example, 100 ng / mL.

[0042] The medium may contain SCF and TPO. In this embodiment, the TPO concentration is 20 to 200 ng / mL, more preferably 30 to 150 ng / mL, and even more preferably 40 to 150 ng / mL, and may be, for example, 100 ng / mL, and the SCF concentration is 1 to 200 ng / mL, more preferably 1 to 150 ng / mL, and even more preferably 1 to 100 ng / mL, and may be, for example, 1 to 50 ng / mL, and even more preferably 1 to 30 ng / mL, and even more preferably 1 to 20 ng / mL, and may be, for example, 5 to 15 ng / mL. In a preferred embodiment, the medium used in the culture method of the present invention may contain 40 to 150 ng / mL of recombinant TPO and 1 to 50 ng / mL of recombinant SCF. In a preferred embodiment, the culture medium used in the culture method of the present invention has a TPO concentration higher than the SCF concentration, which may be, for example, any concentration within the above concentration range, and may be 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, or 10-fold or more higher.

[0043] Hematopoietic stem cells and CMPs or exCMPs can be preferably cultured cytokine-free. In this case, the medium is substantially free of cytokines or completely free of cytokines. Here, "substantially free" means that the medium contains cytokines at levels that cannot be removed during the cell isolation and culture steps. Also, "substantially free" means that the medium contains cytokines below the detection limit. SCF and TPO are representative cytokines.

[0044] Hematopoietic stem cells and CMPs or exCMPs can be preferably cultured albumin-free. In this case, the medium is substantially free of albumin or completely free of albumin. Here, "substantially free" means that the medium contains albumin at a level that cannot be removed during the cell isolation and culture steps. Also, "substantially free" means that the medium contains albumin below the detection limit.

[0045] The hematopoietic stem cells and CMPs or exCMPs may be cultured preferably albumin-free and cytokine-free, in which case the medium is substantially free of, or completely free of, both albumin and cytokines.

[0046] In a preferred embodiment, hematopoietic stem cells and CMPs or exCMPs can be cultured in a medium containing an effective amount of a non-cytotoxic PI3K activator. In particular, human hematopoietic stem cells and human CMPs or exCMPs are preferably cultured in a medium containing an effective amount of a non-cytotoxic PI3K activator. This allows human hematopoietic stem cells and human CMPs or exCMPs to exhibit good proliferation even under conditions with reduced albumin or in the absence of albumin. As the PI3K activator, various PI3K activators can be used as long as they are non-cytotoxic, and a preferred example is 740Y-P. In a preferred embodiment, the medium contains an effective amount of a PI3K activator and is substantially free of or free of tissue factor (SCF). In a preferred embodiment, the medium can contain an effective amount of a thrombopoietin (TPO) receptor agonist. In a preferred embodiment, the TPO receptor agonist may be any of various TPO receptor agonists as long as they are non-cytotoxic, and a preferred example may be butizamide. In a preferred embodiment, the medium comprises an effective amount of the TPO receptor agonist and is substantially free or free of TPO. In a preferred embodiment, the medium comprises an effective amount of the PI3K activator and an effective amount of the TPO receptor agonist. In a preferred embodiment, the medium comprises an effective amount of the PI3K activator and an effective amount of the TPO receptor agonist, and is substantially free or free of either or both of SCF and TPO. In a preferred embodiment, the medium may be a cytokine-free medium. In a preferred embodiment, the medium may be an albumin-free and cytokine-free medium. In a preferred embodiment, the medium may be a serum-free medium or a chemically defined medium. In a preferred embodiment, the medium may be an albumin-free and cytokine-free serum-free medium or a chemically defined medium.

[0047] In a preferred embodiment, the medium may further contain 4-N-[2-benzyl-7-(2-methyltetrazol-5-yl)-9H-pyrimido[4,5-b]indol-4-yl]cyclohexane-1,4-diamine (hereinafter also referred to as "UM171"). In a medium further containing UM171, differentiation into megakaryocyte lineage cells is suppressed and proliferation of hematopoietic stem cells is improved.

[0048] In the present disclosure, hematopoietic stem cells and CMPs or exCMPs can be cultured or expanded under conditions suitable for the respective cultures (particularly conditions suitable for the culture of hematopoietic stem cells). In the present disclosure, an in vitro method for culturing hematopoietic stem cells and CMPs or exCMPs is provided, comprising culturing hematopoietic stem cells and CMPs or exCMPs in a medium suitable for the culture thereof. In a preferred embodiment, the medium is substantially free or free of albumin. In a preferred embodiment, the medium comprises polyvinyl alcohol or modified polyalkylene glycol. In a preferred embodiment, the medium further comprises a PI3K activator. In a preferred embodiment, the medium is substantially free or free of SCF. In a preferred embodiment, the medium comprises a TPO receptor agonist. In a preferred embodiment, the medium is substantially free or free of TPO. In a preferred embodiment, the medium is substantially free or free of albumin, comprises polyvinyl alcohol or modified polyalkylene glycol, and further comprises a PI3K activator. In a preferred embodiment, the medium is substantially free or free of albumin, contains polyvinyl alcohol or modified polyalkylene glycol, further contains a PI3K activator, and is substantially free or free of cytokines. The culture may be performed in the presence of fibronectin. In the culture method of the present invention, the culture may be performed under conditions that allow contact between hematopoietic stem cells and fibronectin. In the culture method of the present invention, the inside (e.g., bottom surface) of the culture vessel is preferably coated with fibronectin, for example. In the present disclosure, the hematopoietic stem cells and CMPs or exCMPs may be expanded 10-fold or more, 50-fold or more, 100-fold or more, 200-fold or more, 300-fold or more, 400-fold or more, or 500-fold or more from the start of the culture. In the present disclosure, the hematopoietic stem cells and CMPs or exCMPs can be isolated from the culture. The hematopoietic stem cells and CMPs or exCMPs can be isolated based on the expression of markers characteristic of each of them, for example, using techniques well known to those skilled in the art, such as flow cytometry.

[0049] In hematopoietic stem cell transplantation, it is considered a problem that it takes time for the hematopoietic system to start up after transplantation of hematopoietic stem cells. That is, the subject (referred to as the recipient) who receives hematopoietic stem cell transplantation undergoes a chemical or irradiation treatment (pre-transplant treatment) of his / her own hematopoietic system before hematopoietic stem cell transplantation to remove immune cells and the hematopoietic system from the recipient's body. It is expected that the hematopoietic system will be constructed in the recipient from the transplanted hematopoietic stem cells. Hematopoiesis cannot be performed in the recipient's body after pre-transplant treatment, and therefore it is extremely important to start up the hematopoietic system (especially red blood cells, macrophages, platelets, neutrophils, etc.) early. However, it takes time for the hematopoietic system to start up after hematopoietic stem cell transplantation. In contrast, CMP or exCMP supports the start up of the hematopoietic system (e.g., red blood cells, macrophages, platelets, neutrophils, etc.) earlier than hematopoietic stem cells, or constructs the hematopoietic system. CMP or exCMP administered to a recipient can produce hematopoietic cells other than T cells and B cells in the recipient's body, but can produce hematopoietic cells other than T cells and B cells in the recipient's body. A recipient administered with CMP or exCMP can set up the hematopoietic system (e.g., erythrocytes, macrophages, platelets, or neutrophils, etc.) in the body at an early stage, and the safety of hematopoietic stem cell transplantation can be improved. Therefore, CMP or exCMP can be administered to a recipient before, simultaneously with, or after hematopoietic stem cell transplantation. CMP or exCMP can be preferably administered to a recipient before hematopoietic stem cell transplantation or simultaneously with hematopoietic stem cell transplantation. exCMP has a higher hematopoietic cell induction ability than freshCMP (pre-cultured CMP). exCMP also has the ability to set up the hematopoietic system (e.g., erythrocytes, macrophages, platelets, or neutrophils, etc.) at an early stage compared to freshCMP. Therefore, exCMP can be preferably administered to a recipient during hematopoietic stem cell transplantation. When administered to a recipient, the CMP or exCMP supports the establishment of early hematopoietic systems (e.g., erythrocytes, macrophages, platelets, or neutrophils, etc.) or establishes a hematopoietic system, but is eliminated from the recipient's body and does not survive in the recipient for the long term.Thus, CMPs or exCMPs may be administered to a recipient to rapidly and temporarily establish a hematopoietic system (e.g., red blood cells, macrophages, platelets, or neutrophils, etc.) in the recipient. It is sufficient for the CMPs or exCMPs to temporarily establish a hematopoietic system in the recipient, and thus the CMPs or exCMPs may be cells that are allogeneic to the recipient, but are preferably allogeneic or, more preferably, universalized allogeneic cells, as described below.

[0050] In the present disclosure, the recipient may be kept alive by administering CMP or exCMP once or multiple times after conditioning. Although CMP or exCMP only supports temporary hematopoiesis, multiple administrations can support the hematopoietic system in the recipient's body for a long period of time and sustain the life of the recipient. Thus, CMP or exCMP can be used to support or sustain the life of a recipient that has undergone conditioning.

[0051] In the present disclosure, the CMP or exCMP is universalized. Universalization is a process for suppressing the occurrence of immune diseases such as immune rejection and graft-versus-host disease (GVHD) by, for example, removing a portion of MHC or HLA. Universalization can be achieved by losing the expression of a portion of MHC or HLA. Loss of expression of a portion of MHC or HLA can be achieved, for example, by knocking out β-2-microglobulin (B2M). According to the present disclosure, a universalized CMP or exCMP can be provided. According to the present disclosure, a CMP or exCMP can be provided in which β-2-microglobulin has been knocked out and expression of a portion of MHC or HLA has been lost.

[0052] According to the present disclosure, CMP or exCMP produces hematopoietic cells in the spleen. Thus, according to the present disclosure, CMP or exCMP can induce hematopoiesis in the spleen. According to the present disclosure, preferably, CMP or exCMP has CXCR4 knocked out or knocked down. It is expected that CMP or exCMP with CXCR4 knocked out or knocked down can improve the proliferation activity of CMP or exCMP in the spleen. According to the present disclosure, CMP or exCMP with CXCR4 knocked out or knocked down can be provided.

[0053] In a preferred embodiment, the CMP or exCMP is universalized and has CXCR4 knocked out or knocked down. According to the present disclosure, a CMP or exCMP that is universalized and has CXCR4 knocked out or knocked down can be provided. According to the present disclosure, a CMP or exCMP that has β-2-microglobulin knocked out, has lost expression of a part of MHC or HLA, and has CXCR4 knocked out or knocked down can be provided.

[0054] According to the present disclosure, compositions containing these CMPs or exCMPs are provided. The compositions can be administered to a recipient that has undergone a conditioned transplant. The compositions can be used to support the establishment of a hematopoietic system in the body of a recipient that has undergone a conditioned transplant. The compositions can be used to support the life of a recipient that has undergone a conditioned transplant.

[0055] In one embodiment, the medium comprises: Polyvinyl alcohol or modified polyalkylene glycol, and (1) comprising a PI3K activator and one or more selected from the group consisting of TPO and a TPO receptor agonist; (2) one or more selected from the group consisting of SCF and PI3K activators, and a TPO receptor agonist; or (3) A compound comprising a PI3K activator and a TPO receptor agonist. The medium may be a medium. The medium is preferably substantially free or free of albumin. The medium is preferably substantially free or free of cytokines. The medium is preferably a serum-free medium or more preferably a chemically defined medium. The medium is suitable for the growth or culture of, for example, human hematopoietic stem cells and CMPs or exCMPs. The medium may also be, for example, a medium for the growth or culture of hematopoietic stem cells and CMPs or exCMPs.

[0056] According to the present disclosure, a method for culturing hematopoietic stem cells and CMPs or exCMPs is provided. The cells can be cultured in any of the above-described media under suitable conditions for the culture. The hematopoietic stem cells and exCMPs can be increased by the culture. For example, exCMPs can be isolated from the culture containing hematopoietic stem cells and exCMPs after the culture. The isolation of exCMPs can be performed, for example, using flow cytometry, based on the expression of markers characteristic of CMPs.

[0057] According to the present disclosure, there is provided a method for producing a CMP or exCMP, comprising culturing cells contained in a hematopoietic stem cell fraction under suitable conditions in a suitable medium for the culture. Any of the above-mentioned media can be preferably used as the medium. In this method, the cells contained in the hematopoietic stem cell fraction can be proliferated by culturing. This method can further comprise isolating exCMP from the obtained cells. Isolation of exCMP can be performed, for example, using flow cytometry, based on the expression of markers characteristic of exCMP. EXAMPLES

[0058] Materials and Methods (1) Mouse C57BL / 6 (B6-Ly5.2) mice were from SLC, C57BL / 6 (B6-Ly5.1) mice and C57BL / 6 (B6-Ly5.1 / Ly5.2 F1) mice were from Sankyo Labo Service, and B6 Albino (B6N-Tyr c-BrdMice were purchased from Charles River Animal Care and Life Sciences Japan. All experiments were conducted in accordance with the animal experimentation regulations of the University of Tokyo and the University of Tsukuba.

[0059] (2) Splenectomy Mice were anesthetized with a triple anesthetic (medetomidine hydrochloride (Domitor, Nippon Zenyaku Kogyo Co., Ltd.), midazolam (Dormicum injection, Maruishi Pharmaceutical Co., Ltd.), and butorphanol tartrate (Betorfal, Meiji Seika Pharma Co., Ltd.)), and a 5 mm incision was made on the left flank of the mouse, the spleen was excised, and the abdomen was promptly closed with a clip using a suture applicator.

[0060] (3) Complete blood count Peripheral blood was collected from the retinal venous plexus of the mice using a heparinized tube, and a complete blood count was performed using a fully automated blood cell counter MEK-6450 (Nihon Kohden Corporation).

[0061] (4) Purification of mouse hematopoietic stem and progenitor cells Mouse bone marrow stem and progenitor cells were collected from the bone marrow of 8-12 week old mice as follows. Bone marrow cells collected from the mouse pelvis, femur, and tibia were stained with anti-APC-cKit antibody, and cKit positive cells were isolated using anti-APC MACS beads (Miltenyi Biotec) and LS column (Miltenyi Biotec). These cells were reacted with biotinylated lineage antigen antibodies (anti-Gr1, Mac1, B220, CD4, CD8, IL7Ra, Ter119) and then stained with anti-streptavidin-APC-eFluor780 antibody, anti-APC-cKit antibody, anti-FITC-CD34 antibody, anti-PE-Sca1 antibody, and anti-PECy7-CD150 antibody. CD34-KSL and CD34-CD150+KSL cells were sorted using a FACS Aria III cell sorter (BD) and a MoFlo XDP Cell Sorter (Beckman Coulter) for hematopoietic stem cell fractionation. For the culture of cKit-positive cells, cells separated using an LS column were used.

[0062] (5) Culture of mouse hematopoietic stem and progenitor cells CD34-KSL cells were isolated from B6-Ly5.1 mice in 96-well plates (TPP) at 100 cells each, or in 24-well plates (TPP) at 1,000-3,000 cells each, and cultured in F-12 medium (FUJIFILM Wako Pure Chemical Industries, Ltd.) supplemented with SCF (10 ng / mL; Pepro Tech), TPO (100 ng / mL; Pepro Tech), ITSX (1%; Gibco TM ), HEPES (10 mM; Gibco TM ), penicillin-streptomycin-L-glutamine solution (1%; Fujifilm Wako Pure Chemical Industries, Ltd.), and polyvinyl alcohol (PVA) (0.1%; 10% w / v stock, Wako) were added and cultured in a 5% CO2, 37°C incubator. For the culture of cKit-positive cells, 10,000 cKit-positive cells were isolated in 24-well plates and cultured in the same medium and conditions. After the start of culture, the entire medium was replaced every 2-3 days.

[0063] (6) Surface marker analysis and sorting after hematopoietic stem cell culture The cell fractions obtained by hematopoietic stem cell culture were evaluated and sorted as follows: The hematopoietic stem cell fraction was evaluated by collecting the cultured cells, reacting them with biotinylated lineage antigen antibodies (anti-Gr1, Mac1, B220, CD4, CD8, IL7Ra, Ter119), staining them with anti-streptavidin-BV 421 antibody, anti-PE-CD201 antibody, anti-PECy7-CD150 antibody, anti-APC-cKit antibody, and anti-APCCy7-Sca1 antibody, and analyzing and sorting Lin-cKit+Sca1+CD150+CD201+ cells. The bone marrow progenitor cell fraction was evaluated by staining with biotinylated lineage antigen antibodies (anti-Gr1, Mac1, B220, CD4, CD8, IL7Ra, Ter119) followed by anti-streptavidin-APCCy7, anti-PE-Sca1, anti-PECy7-FcgR, and anti-APC-cKit, and analyzing and sorting Lin-cKit+Sca1-FcgR- cells. For recovery of MHC Class I knockout cells, knockout cells were stained with anti-PB-Gr1, anti-PB-Mac1, anti-APC-cKit, anti-APCCy7-Sca1, anti-PECy7-FcgR, and anti-PE-MHC Class I, and Gr1-Mac1-cKit+Sca1-FcgR-MHC Class I- cells were sorted.

[0064] (7) Bone marrow transplantation Competitive bone marrow reconstitution was performed using the Ly5 congenic mouse system. Cells were harvested from B6-Ly5.1 mice and cultured, and 5 × 10 cells were transferred to B6-F1-Ly5.1 / Ly5.2 mice. 5 The mice were then intravenously transplanted with 1 × 10 bone marrow cells into lethally irradiated B6-Ly5.2 mice with 8 Gy of radiation. 6 Bone marrow cells were harvested and transplanted intravenously into B6-Ly5.2 mice that had been lethally irradiated with 8 Gy. Peripheral blood samples were collected every 4 weeks to analyze post-transplant chimerism.

[0065] (8) Analysis of blood cell differentiation in peripheral blood and bone marrow Peripheral blood collected in a heparinized blood collection tube was hemolyzed with NH4Cl solution (150 mM), stained with anti-APC-CD4, anti-APC-CD8, anti-APC / Cy7-B220, anti-PE-Gr1, anti-PE-Mac1, anti-PE / Cy7-CD45.1, and anti-PB-CD45.2 antibodies, and analyzed using a FACS Verse analyzer (BD). The number of each cell fraction was counted using Precision Count Beads. TM The percentage of hematopoietic progenitor cells in the bone marrow and spleen after transplantation was measured using a 100-μg / mL ELISA kit. Chimerism was calculated as (% Ly5.1 cells) × 100 / (% Ly5.1 cells + % F1 cells). To analyze hematopoietic progenitor cells in the bone marrow and spleen after transplantation, the cells were reacted with biotinylated lineage antigen antibodies (anti-Gr1, Mac1, B220, CD4, CD8, IL7Ra, Ter119) and then stained with anti-streptavidin-APCeFluor780 antibody, anti-APC-cKit antibody, anti-BV605-Sca1 antibody, anti-BV510-CD41 antibody, anti-PE-FcgR antibody, anti-PECy7-CD150 antibody, anti-BV786-CD105 antibody, and anti-PB-CD34 antibody. For the analysis of hematopoietic stem cells, cells were stained with anti-streptavidin-APC-eFluor780, anti-APC-cKit, anti-BV605-Sca1, anti-PE-CD201, anti-PECy7-CD150, and anti-PB-CD34 antibodies after reaction with biotinylated lineage antigen antibodies (anti-Gr1, Mac1, B220, CD4, CD8, IL7Ra, and Ter119). For the analysis of mature cells, cells were stained with anti-APC-CD4, anti-APC-CD8, anti-APCCy7-B220, anti-PB-CD45.1, anti-PE-Gr1, anti-PE-Mac1, and anti-PECy7-Ter119 antibodies. Analysis of stained cells was performed using a FACS Verse analyzer and a FACS AriaIII cell sorter. The number of each cell fraction was counted using Precision Count Beads. TMFor comparative analysis of post-transplant hematopoietic stem / progenitor cell fractions in the spleen and bone marrow, the UMAP and X-shift algorithms of the Flowjo plugin were used for the integrated data of the mNG+Lin- cell population. The abundance ratio of each cell fraction in the spleen and bone marrow was defined as log2 (fraction of each fraction in spleen Lin- / fraction of each fraction in bone marrow Lin-) and a heat map was created.

[0066] (9) Lentiviral vector construction The LV-Ubc-mNeonGreen-2A-Akaluc vector was constructed using the NEBuilder HiFi DNA assembly system. The Akaluc fragment was kindly provided by Dr. Atsushi Miyawaki and Dr. Satoshi Iwano of the RIKEN Center for Brain Science.

[0067] (10) Lentivirus production The desired lentivirus was produced by transfection of 293T cells using the PEI method. Specifically, a plasmid mixture (desired plasmid vector: packaging plasmid (psPAX2): envelope plasmid (pDM2G) = 4:2:1) was prepared in HBSS, PEI (1 μg / μL) was added, and the mixture was left to stand for 10-15 minutes. After that, 293T cells (5.0 × 10 6 The following day, the medium was replaced with DMEM containing forskolin (10uM), and the cells were cultured for an additional 48 hours, after which the supernatant was collected and concentrated by ultracentrifugation, and the functional infectious titer was assessed using 293T cells.

[0068] (11) Gene transfer into hematopoietic stem / progenitor cells using lentiviruses The concentrated lentivirus stock was administered to the culture medium at a functional infectious titer of approximately 300-600 MOI for hematopoietic stem cells in culture, and half of the medium was replaced 24 hours later, followed by another half-replacement 48 hours later. The cells transfected with LV-Ubc-mNeonGreen-2A-Akaluc were sorted as mNeonGreen-positive cells using a FACS Aria III cell sorter and a MoFlo XDP Cell Sorter.

[0069] (12)Akaluc In vivo Luminescence Imaging 3D luminescence imaging of transplanted mice was performed using IVIS Spectrum CT. 2D luminescence imaging was performed using IVIS Lumina Series III and IVIS Spectrum. Mice were anesthetized with isoflurane, Akalumine (15mM, 50μL) was administered, and luminescence imaging was performed 5 minutes later. Emission time was adjusted between 1-300 seconds according to the luminescence intensity. Luminescence signal intensity was analyzed using Living Image Software.

[0070] (13) Collection of splenic stromal cells Spleens were removed from normal mice and irradiated mice, and the cells were dispersed using a slide glass and treated with collagenase for 30 minutes at 37°C in collagenase solution (RPMI1640 culture medium (Fujifilm Wako Pure Chemical Industries, Ltd.), 2% FBS, 20 mM Hepes, Collagenase P 0.2 mg / mL (Roche)). The cell suspension was filtered and stained with anti-APC-Ter119 antibody, anti-APC-CD45 antibody, and anti-APC-B220 antibody, and then cKit-negative cells were separated using anti-APC MACS beads and an LS column. Next, the cells were stained with anti-APC-Ter119, anti-APC-CD45, anti-APC-B220, anti-APCCy7-Sca1, anti-FITC-CD71, anti-PE-ICAM1, anti-PECy7-CD31, and anti-PB-CD105 antibodies, and the CD45-Ter119-B220-CD31+Sca1+ / ICAM1+ fraction was collected as splenic vascular endothelial cells, and the CD45-Ter119-B220-CD31-CD71-CD105+ICAM1+ fraction was collected as red pulp stromal cells using a MoFlo XDP Cell Sorter.

[0071] (14)Bulk RNA sequencing For CMP analysis, 30,000 Lin-cKit+Sca1-CD34+FcgR- cells and 30,000 Lin-cKit+Sca1-FcgR- cells obtained after 1 week of CD34-KSL cell culture were collected from 8-week-old B6 mice and suspended in Trizol-LS. For splenic stromal cell analysis, 10,000 CD45-Ter119-CD31-CD71-CD105+ICAM1+ cells (red pulp stromal cells) and 10,000 CD45-Ter119-CD31+ICAM1+ or Sca1+ cells (vascular endothelial cells) were collected from 8-week-old B6 mice, and 3,000 red pulp stromal cells and 10,000 vascular endothelial cells were collected from mice 10 days after 4 Gy irradiation and suspended in Trizol-LS. Subsequent RNA extraction, RNA-Seq cDNA library construction, and mapping of sequence fragments onto the mouse genome were performed using the analysis services of the Department of Genome Biology, Transborder Medical Research Center, University of Tsukuba. Gene expression analysis was performed using the DESeq2 package. Ontology analysis was performed using the Gene Ontology annotation database for mouse genes. Raw transcriptomic analysis data are available at ***.

[0072] (15) Genome editing Ribonucleoprotein (RNP) duplex was generated by mixing 9μg of recombinant S. pyogenes Cas9 (Alt-R Sp Cas9 Nuclease V3, IDT) with the designed single guide RNA (Alt-R CRISPR-Cas9 sgRNA, synthesized at IDT) at a molar ratio of 1:2.5 and reacting at 25℃ for 10 minutes. HSCs were washed twice with PBS, suspended in 20μl of electroporation buffer P3 (Lonza), and mixed with RNP. The suspension was transferred to a 16-well cuvette (P3 Primary Cell 96-well-Nucleofector Kit) and electroporated using a 4D nucleofector device (Lonza) (EO-100 program). Ca-free DMEM medium was then added to the cells immediately and incubated for 10 minutes. The cells were then returned to PVA-based HSC expansion medium and culture was resumed.

[0073] (16) Analysis of target gene knockout efficiency by TIDE As recommended in the TIDE (http: / / shinyapps.datacurators.nl / tide / ) protocol, appropriate primers were designed to include a region of approximately 700 bp around the Cas9 cleavage site and a cleavage site approximately 200 bp from the end. To quantify indels from cultured cells, genomic DNA was extracted from cultured cells using Nucleo Spin Tissue columns (Macherey-Nagel). DNA concentration was measured with a Nanodrop spectrophotometer (Thermo Fisher). PCR reactions were performed on the obtained genomic DNA using the designed primers and Q5 High-Fidelity DNA Polymerase (Biolabs). The obtained PCR products were separated by electrophoresis, stained with Midori Green Xtra (Nippon Genetics), visualized with blue light, and the fragments corresponding to the expected target products (approximately 700 bp) were excised and gel-purified. The obtained purified fragments were subjected to Sanger sequencing using the forward TIDE primer (sequencing was outsourced to FASMAC). As a negative control, the sequence of hematopoietic stem cells that had not undergone genome editing was used, and the knockout rate was calculated using the TIDE algorithm.

[0074] (17) Statistical analysis Data are shown as mean values ​​(± standard deviation), and statistical significance was calculated by two-tailed Student's t test, one-way ANOVA analysis, and two-way ANOVA analysis using Prism (version >8.0, Graphpad). Statistical significance was indicated as *P<0.05, **P<0.01, ***P<0.001.

[0075] result 1. Hematopoiesis occurs in the spleen early after transplantation and changes over time When hematopoietic stem cells are administered to mice after lethal irradiation, they expand and differentiate over time, and are able to reconstitute all blood cell lineages. However, the spatial dynamics and time course of how hematopoietic stem cells initiate hematopoiesis in the same individual are poorly understood. To continuously observe the spatiotemporal dynamics of early hematopoiesis in mice after hematopoietic stem cell transplantation, we applied the Akaluc bioluminescence imaging (AkaBLI) system. AkaBLI is a recently established bioluminescence technology, and Akalumine (AKA), a newly synthesized D-luciferin analog, achieves 100-1000 times higher luminescence than conventional bioluminescence, enabling the detection of AkaLuc-expressing HeLa fibroblasts trapped in the pulmonary vasculature after intravenous injection at the single-cell level. Therefore, 100 CD34-CD150+KSL cells, which are HSC fractions, were isolated from each mouse, and the Akaluc gene was introduced using lentivirus (LV-Ubc-mNG2A-Akaluc). After that, 10,000 mNG positive cells were amplified and cultured using a recently established hematopoietic stem cell culture technique using PVA. 6 The cells were transplanted into lethally irradiated mice together with 3000 cells, and real-time 3D imaging was performed over time using IVIS Spectrum CT (see Figure 1A). Signals were clearly visible from the fifth day after transplantation, and whole-body imaging combined with micro-CT revealed that the spleen was the main site of hematopoiesis, surpassing the bone marrow, early after hematopoietic stem cell transplantation (see Figure 1B, C). No significant hematopoiesis was observed in organs other than the spleen and bone marrow. To investigate in more detail and in a continuous manner how hematopoietic stem cells after transplantation reconstruct blood throughout the body in a spatiotemporal manner, 3000 cells of Akaluc+CD150+CD201+KSL cells, which are the hematopoietic stem cell fraction after culture, and 5 × 10 cells of F1 mouse bone marrow cells were transplanted into lethally irradiated mice, and real-time 3D imaging was performed over time using IVIS Spectrum CT (see Figure 1A). Signals were clearly visible from the fifth day after transplantation, and whole-body imaging combined with micro-CT revealed that the spleen was the main site of hematopoiesis, surpassing the bone marrow, early after hematopoietic stem cell transplantation (see Figure 1B, C). 5The Akaluc+CD150+CD201+KSL cells were transplanted into lethally irradiated mice, and imaging by IVIS over time and evaluation of long-term bone marrow reconstitution ability were performed (see Figure 2A). Evaluation of long-term donor cell chimerism in peripheral blood after transplantation showed that Akaluc+CD150+CD201+KSL cells engrafted three lineages of cells, myeloid, B lymphoid, and T lymphoid, for 16 weeks, and maintained hematopoiesis for 16 weeks after secondary transplantation, confirming that the fraction contains hematopoietic stem cells (see Figure 2B, C). Observation by IVIS imaging from day 5 to day 25 after transplantation showed that significant hematopoiesis occurred in the spleen from an early stage, as observed by 3D imaging. Furthermore, observation over time revealed that hematopoiesis in the spleen changed dynamically compared to the bone marrow, forming multiple hematopoietic peaks (peaks I to III in Figure 2D) (see Figure 2D). To compare the constituent cells of hematopoiesis in the spleen and their changes over time, and to compare with hematopoiesis in the bone marrow, the spleen and bone marrow were collected after transplantation and the cell fraction derived from the transplanted cells was analyzed. Akaluc protein and mNG were designed downstream of the same promoter with 2A in between, so they were expected to be expressed simultaneously. In fact, mNG+ cells collected from the spleen on the 9th day after transplantation luminesced when Akalumine was administered, but mNG- cells did not luminesce when Akalumine was administered (see Figure 3A). Therefore, when the cell fraction of mNG+ cells was examined in detail as donor-derived cells, the fraction of blood cells present in the spleen changed significantly over time and was significantly different from that of the bone marrow (see Figure 3B). Specifically, in the spleen, bone marrow progenitor cell fractions and neutrophils / macrophages proliferated on the 9th-10th day after transplantation, followed by the hematopoietic peak at the 12th day after transplantation, when red blood cells accounted for the majority of hematopoiesis. A hematopoietic peak was confirmed on the 18th-20th day after transplantation, recognizing multiple lineages including lymphocytes. Early hematopoiesis in the spleen was significantly different from that in the bone marrow; whereas mature neutrophils and macrophages predominated in the bone marrow, myeloid progenitor cells and erythropoiesis were prominent in the spleen (see Fig. 3C ).To clarify the difference in hematopoiesis between bone marrow and spleen at the bone marrow hematopoietic stem and progenitor cell level, we combined the mNG+Lin- cell populations from bone marrow and spleen at steady state and on days 7, 9, 10, 11, 12, 16, 19, 22, and 28 and 16 weeks after transplantation based on the FACS data, and performed clustering analysis (UMAP) and automated clustering by X-shift based on the expression levels of cKit, Sca1, FcgR, CD34, CD41, CD150, and CD105 (see Figure 4A). As a result, there was a large difference between the spleen and bone marrow at the hematopoietic stem / progenitor cell level, and FcgR+ positive populations such as GMP (Lin-cKit+Sca1-FcgR+CD34+ cells, hereafter the same) were prominent in the bone marrow on days 7-12 after transplantation, whereas CMP (Lin-cKit+Sca1-FcgR-CD34+ cells, hereafter the same) and MEP (Lin-cKit+Sca1-CD34-FcgR- cells, hereafter the same) populations were characteristic in the spleen (see Fig. 4B). Since a large difference was observed in the bone marrow progenitor cell fraction, we investigated the proportion of bone marrow progenitor cell fractions among Lin- cells in the bone marrow and spleen after transplantation, and found that CMP and MEP were present in higher proportions in the spleen than in the bone marrow on days 7-12 after transplantation. The increase in CMP in the spleen was temporary, and by day 19 after transplantation there was no difference between the spleen and bone marrow. On day 28 after transplantation, the GMP and MEP populations accounted for the majority of the spleen, while CMP was significantly more abundant in the bone marrow, returning to a balance similar to that at steady state (Fig. 4C). To clarify the cell fractions that are specifically concentrated in the spleen early after transplantation, we comprehensively compared the proportions of each fraction of hematopoietic stem and progenitor cells between the spleen and bone marrow. As a result, it was confirmed that the CMP fraction, Pre-GM fraction, and Pre Mk / E fraction were particularly concentrated in the spleen on day 7 after transplantation (Fig. 4D).

[0076] Next, because hematopoiesis was observed in the spleen after hematopoietic stem cell transplantation, we used splenectomized mice to observe how hematopoietic dynamics change in the absence of a spleen. Mice that had previously had their spleens removed were transplanted with 3,000 Akaluc+CD150+CD201+KSL cells and 5×10 F1 mouse bone marrow cells. 5The cells were transplanted after lethal irradiation, and imaging was performed over time using IVIS. Early hematopoiesis was also confirmed in splenectomized mice, but the amount of hematopoiesis in the bone marrow was only temporarily increased slightly, and no significant hematopoiesis was confirmed in other organs such as the liver (see Figure 5A). In fact, when comparing the number of mNG+ cells in the bone marrow, the number of mNG+ cells was higher in the bone marrow of splenectomized mice on days 9 and 12, and the difference disappeared on day 19 (see Figure 5B). We therefore examined whether the fraction of CMPs characteristically observed in the spleen early after transplantation could be compensated for in the bone marrow of splenectomized mice, but no significant difference was observed between splenectomized mice and normal mice (see Figure 5C). In other words, it was found that hematopoiesis by splenic CMPs was not sufficiently compensated for in the bone marrow of splenectomized mice.

[0077] Next, to examine the effect of early hematopoiesis in the spleen on peripheral blood, we compared peripheral blood in splenectomized mice and normal mice early after transplantation. 3,000 CD150+CD201+KSL cells obtained by HSC culture were transplanted into splenectomized mice and normal mice after lethal irradiation, and peripheral blood was collected and analyzed every 3 days from the second day after transplantation. As a result, it was found that the recovery of Hb levels and Gr1 / Mac1 positive cells in the peripheral blood was delayed in splenectomized mice. This result confirmed that the spleen is important for early hematopoietic recovery (see Figure 6).

[0078] Finally, we investigated whether delayed recovery from radiation due to splenectomy affects hematopoietic stem cells in the bone marrow. We prepared normal Ly5.1 B6 mice and splenectomized Ly5.2 B6 mice, irradiated them with 4 Gy, and harvested their bone marrow 5 or 12 weeks later. We then cultured 5 × 10 bone marrow cells from each mouse. 5The mice were mixed and transplanted into F1 mice, and the peripheral blood chimerism was analyzed every 4 weeks (see Figure 7A). As a result, the ratio of Ly5.1-derived cells and Ly5.2-derived cells in the peripheral blood was similar in both mice transplanted with bone marrow after 5 and 12 weeks, and there was no difference in the ratio of hematopoietic stem cells in the bone marrow of both groups (see Figure 7B). In other words, the spleen is important for early hematopoietic recovery after hematopoietic disorders, but HSCs in the bone marrow are protected from hematopoietic stress even in the absence of the spleen.

[0079] 2.CMP induces hematopoiesis in the spleen early after transplantation From the results of IVIS imaging, we were able to confirm the presence of bone marrow progenitor cell populations such as CMP in the spleen after transplantation at an early stage. We hypothesized that this fraction plays an important role in early hematopoiesis after transplantation, and therefore observed the spatiotemporal dynamics of early hematopoiesis after transplantation when each bone marrow progenitor cell fraction was transplanted. First, Aka+CD150+CD201+KSL 3000 cells were transplanted into Sca1- F1 5.0×10 5 The recipient mice were then transplanted with the Aka+ cells into lethally irradiated mice, and all of the recipient mice's blood cells were replaced with the Aka+ cells to generate Aka+ mice. After 12 weeks or more had passed since transplantation, bone marrow was collected from the Aka+ mice, and CMP, GMP, and MEP fractions were collected. 10,000 cells each were cultured in F1 5.0×10 5The CMPs were transplanted into lethally irradiated mice together with CMP cells, and IVIS imaging and analysis were performed on the spleens collected 7 days after transplantation (see Fig. 8A and B). As previously reported, CMPs produced neutrophils, macrophages, and erythrocytes, GMPs produced neutrophils and macrophages, and MEPs produced erythrocytes. IVIS observations showed that after transplantation, GMPs produced hematopoiesis mainly in the bone marrow, while MEPs produced hematopoiesis in the spleen, forming one hematopoietic peak. After transplantation, CMPs also produced hematopoiesis mainly in the spleen, forming hematopoietic peaks consisting of neutrophils, macrophages, and erythrocytes around days 9 and 12 (see Fig. 8C, D, E). Both showed only short-term hematopoiesis, and were not detected in peripheral blood analysis 4 weeks later (see Fig. 8F). When comparing hematopoietic reconstitution after transplantation of the same number of cells, CMPs, GMPs, and MEPs, based on signal intensity by IVIS, it was confirmed that far more hematopoiesis was produced when CMPs were transplanted (see Fig. 8D). Thus, it was suggested that CMPs may play a role in hematopoiesis mainly in the spleen after transplantation and contribute to early hematopoiesis. This was consistent with the fact that when Aka+ hematopoietic stem cells were transplanted, the CMP fraction was more abundant in the spleen compared to the bone marrow on days 7 to 12 after transplantation.

[0080] The fact that CMPs were able to induce hematopoiesis in the spleen after transplantation suggested that CMPs may home to the spleen immediately after transplantation. To confirm this, we used 2 × 10 total bone marrow cells from Ly5.1 mice. 7 The donor cells were transplanted into irradiated Ly5.2 mice, and 24 hours later, bone marrow, spleen, and peripheral blood were collected and the donor-derived cell fraction was analyzed (Fig. 9A). As a result, it was confirmed that the proportion of CMP was higher in the spleen than in the bone marrow and peripheral blood (Fig. 9B, C). These results indicate that CMP are more likely to migrate to the spleen than to the bone marrow during the homing stage.

[0081] 3. Expanded CMP (exCMP) induces hematopoiesis in the spleen earlier than fresh CMP Since it was found that CMP contributes to early hematopoiesis after transplantation via extramedullary hematopoiesis in the spleen, we next examined whether a similar fraction could be obtained by culturing hematopoietic stem cells. CD34-KSL cells were collected from mouse bone marrow, transfected with Akaluc gene, and cultured for 7 days under the conditions described above in (5). Then, 10,000 cells each of the FcgR+ fraction (expanded GMP; exGMP) and FcgR- fraction (expanded CMP; exCMP) were collected from the Lin-Sca1-cKit+CD34+ fraction and transplanted into mice (see Figure 10A). Imaging with IVIS showed that the signal intensity observed in exGMP was generally weak, but the exCMP fraction confirmed expanded hematopoiesis in the spleen (see Figures 10B and C). When the spleens were collected and analyzed 7 days after transplantation, neutrophils and macrophages were predominant in the exGMP fraction, whereas differentiation into neutrophils, macrophages, and erythrocytes was confirmed in the exCMP fraction (see Fig. 10D). Analysis of the collected spleens showed that the exCMP fraction was capable of producing a large amount of neutrophils and macrophages compared with the exGMP fraction (see Fig. 10E). These results suggest that exCMP is a fraction that corresponds to CMP based on its differentiation potential. Next, to examine the difference in hematopoietic potential between exCMP and CMP in bone marrow, CMP collected from the bone marrow of Aka+ mice (CMP before culture, freshly collected from bone marrow, called "fresh CMP") and exCMP obtained by culture were transplanted at 10,000 cells each, and the results of imaging were compared. Although hematopoiesis was mainly in the spleen in both cases, hematopoiesis in the spleen occurred earlier when the exCMP fraction after culture was transplanted (see Fig. 10C). Analysis of the cell counts in the spleen 7 days after transplantation showed that the number of neutrophils, macrophages, and red blood cells was indeed higher when the cultured exCMP fraction was transplanted (see Figure 10E). Analysis of the peripheral blood of the transplanted mice showed that the exCMPs produced a large amount of hematopoiesis soon after transplantation, but this was only temporary and they did not remain engrafted for a long period of time (see Figure 10F). These results indicate that the exCMPs obtained by culture have the same differentiation potential as CMPs, but are capable of hematopoiesis in the spleen earlier than CMPs.

[0082] To confirm that exCMP also migrate to the spleen during the homing stage after transplantation, Aka+ exCMP 5 × 10 5 The cells were transplanted into irradiated Albino B6 mice, and 24 hours later, IVIS imaging and analysis of the spleen and bone marrow were performed. As expected, the signal was concentrated in the spleen (see Figure 11A and B), and FACS analysis also showed that the transplanted cells were concentrated in the spleen compared to the bone marrow and peripheral blood (see Figure 11C and D). These results indicate that exCMP accumulates in the spleen at the homing stage.

[0083] Hematopoietic cells, including CMPs, were difficult to grow in the absence of albumin. In response to this, WO2021 / 049617A and WO2021 / 149799A developed a method for culturing hematopoietic stem cells in the absence of albumin, which made it possible to culture hematopoietic cells, including hematopoietic stem cells, in the absence of albumin. In addition, in the above method, hematopoietic stem cells can be cultured even under cytokine-free conditions (particularly in a chemically defined medium) by replacing SCF and TPO with alternatives. CMPs could be grown in vitro by the above method, but CMPs and exCMPs could also be cultured in the recently established cKit bulk culture system (Nat. Commun., 2021, 12(1): 3568). In the cKit bulk culture system, cKit-positive cells were isolated by the method described above in (4), and the resulting 10,000 cKit-positive cells were cultured in 1 mL of medium containing the PVA described in (5) above. In cKit bulk culture, 20-50% of the cultured cells are exCMP. When 10,000 cKit+ cells were cultured, 4 × 10 5We were able to produce exCMPs of cells (see Figures 12A and B). CMPs are a cell type that is continuously produced from hematopoietic stem cells, and therefore are thought to be obtained in particularly large quantities under culture conditions in the absence of albumin, which allows hematopoietic stem cells to proliferate. Furthermore, in the absence of albumin, exCMPs show higher expression of platelet-related genes than in the presence of albumin. This suggests that culturing in the absence of albumin increases the number of exCMPs that have the properties of more immature CMPs.

[0084] Since exCMP was able to produce more mature cells at an earlier stage than freshCMP, we performed bulk RNAseq to investigate the differences between exCMP and freshCMP in more detail. As a result, it was found that there were differences between exCMP and freshCMP in the cell cycle and the expression levels of chemokine receptors and integrins (see Figure 13A, B, C). Specifically, exCMP had more cells in the G2-M phase than freshCMP. As for chemokine receptors, it was found that the expression level of CXCR4 was lower in exCMP than in freshCMP. In transplantation of CXCR4 knockout hematopoietic stem cells, the number of proliferating cells in the spleen 7 days after transplantation was significantly higher than the number of cells after wild-type hematopoietic stem cell transplantation. Therefore, the lower expression level of CXCR4 in exCMP may be related to the active cell proliferation in the spleen of exCMP. Regarding the expression of integrins, Itga4 and L-selectin were highly expressed in freshCMP, while their expression levels were low in exCMP, and Itgb1 / b2 / b3, Itga6, and P-selectin were highly expressed. Another notable feature was that the expression of the serine protease DPP4 was significantly lower in exCMPs. Flow cytometry showed that exCMPs were DDP4 negative (see Figure 13B). TMAccording to protease assay, freshCMP has DPP4 activity, but exCMP does not (see Figure 13C). It is suggested that the low expression of DPP4 may improve responsiveness to cytokines (see Nat. Med., 18(12): 1786-1796, 2012). Next, we compared the expression of genes related to myeloid progenitor cells to see if there was a difference in the differentiation stage between exCMP and freshCMP. Myeloid and erythroid maturation markers such as MPO and Gata1 were more highly expressed in freshCMP. On the other hand, platelet-related genes such as Pf4, Itga2b (Cd41), and Nfe2 were more highly expressed in exCMP. In addition, even when comparing gene sets reported in previous papers, the degree of contribution to differentiation into myeloid cells was different at the gene expression level, and it was found that exCMP and freshCMP are similar but different cells, although both have the characteristics of CMP. The results are summarized in Table 1.

[0085] [Table 1]

[0086] 4. exCMP can rescue recipients after radiation exposure by promoting early hematopoiesis in the spleen Since exCMP induces hematopoiesis in the spleen early, we thought that it could play a role as a bridge after radiation exposure by initiating hematopoiesis earlier than when HSCs alone were transplanted. Therefore, to investigate how the spatiotemporal dynamics of hematopoietic reconstruction changes when exCMP are mixed and transplanted, 3000 Aka+CD150+CD201+KSL fraction cells and 10000 Aka+ exCMP cells were mixed with 5 × 10 F1 mouse bone marrow cells. 5The exCMP-derived hematopoiesis peaked earlier than when only the Aka+CD150+CD201+KSL fraction was transplanted into lethally irradiated mice, and imaging was performed over time using IVIS. As expected, the exCMP-derived hematopoietic peak was observed earlier than when only the Aka+CD150+CD201+KSL fraction was transplanted (see Figure 14A and B). The signal itself was already confirmed on the third day after transplantation, and hematopoiesis in the spleen derived from the exCMP was detected (see Figure 14C). To confirm that the exCMP-derived hematopoiesis actually contributed to rescue, 3000 Aka+ CD150+CD201+KSL fraction cells and 10,000 Aka+ exCMP cells were transplanted into lethally irradiated mice, and the early rise was examined by peripheral blood analysis. As expected, it was confirmed that the peripheral blood Hb value, neutrophil / macrophage count, and platelet count all recovered earlier when the exCMP was mixed and transplanted (see Figure 14D). To confirm that these rescues were spleen-dependent, similar experiments were performed in splenectomized mice, and the recovery of Hb levels and neutrophil / macrophage counts was delayed compared to normal mice (Fig. S1E). These results suggest that exCMP can initiate early hematopoiesis through hematopoiesis in the spleen.

[0087] We applied this technology to the idea that lethally irradiated mice could be rescued by periodically transplanting only exCMP, so we periodically transplanted 30,000 or 100,000 exCMP cells into lethally irradiated mice every week (see Figure 15A). As a result, as expected, the mice survived for a long time in both cases (see Figures 15B and 15C). When similar experiments were performed in splenectomized mice, rescue failed, confirming that these effects were spleen-dependent. When peripheral blood analysis was performed on the 10th day after transplantation of 100,000 cells, it was found that all mouse groups were alive at the 10th day, but the splenectomized mice had decreased Hb levels, neutrophil / macrophage counts, and platelet counts (see Figure 15D). These results suggest that exCMP can contribute to hematopoietic reconstruction in irradiated mice through spleen-dependent early hematopoiesis, and that by understanding the spatiotemporal dynamics after transplantation, rescue after radiation exposure is possible by planned administration.

[0088] 5. Universal Expanded CMP can be used in allogeneic transplants to rescue recipients after radiation therapy In clinical practice, autologous transplantation, in which a graft derived from the patient is prepared in advance, is extremely advantageous in that it does not cause immune rejection, but it also has many challenges. First, it is costly because it must be individually adjusted for each patient, and it takes a long time to collect cells from the patient, manipulate them, and apply them to treatment. In addition, because the cells are collected from the patient, the quality of the cells depends on the patient's condition, which may hinder the subsequent application of the technology. Allogeneic transplantation can solve these problems, and if a common cell stock that can be administered to any patient can be created, it will be highly applicable. Previous experiments have shown that exCMP can rescue mice after irradiation by early hematopoiesis in the spleen, so we next examined whether exCMP can be allogeneically transplanted. Aka+ exCMP 1×10 derived from cells collected from B6 mice was used as a treatment for rheumatoid arthritis. 5The cells were transplanted into irradiated B6 and BALB / c mice, and IVIS imaging was performed on the 5th day. As a result, when transplanted into B6 mice, early hematopoiesis in the spleen was confirmed as in the past, but when transplanted into BALB / c mice, early hematopoiesis in the spleen was not confirmed, and hematopoietic signals were confirmed in the bone marrow other than the spleen. We believe that this is because the spleen is not an organ for extramedullary hematopoiesis, but functions as an immune tissue in allotransplantation, causing immune rejection. In fact, in past clinical studies, it has been reported that when allotransplantation is performed on patients whose spleens have been removed for some reason, hematopoietic recovery is actually faster than in normal cases. This is thought to be because the spleen functions as an immune tissue and thus hinders hematopoietic recovery in allotransplantation. Therefore, we planned to make exCMP universal in order to effectively utilize the spleen as a site for extramedullary hematopoiesis even in allotransplantation. CD34-KSL cells were collected from the bone marrow of B6 mice and cultured for 5-7 days, after which the β2 microglobulin (B2M) gene, which is important for the presence of MHC Class 1, was knocked out using the CRSPR-Cas9 system. After further culture for 3 days, the knockout efficiency was analyzed by confirming the presence or absence of MHC Class 1 expression by FACS. When the knockout efficiency was confirmed in about 90% of the cells with guide RNA 1 (sequence number 1: CTGGTGCTTGTCTCACTGAC) and about 70% of the cells with guide RNA 2 (sequence number 2: TTCGGCTTCCCATTCTCCGG), respectively, it was confirmed that MHC Class 1 was knocked out in about 70% of the cells with guide RNA 2 (see Figure 16A). In subsequent experiments, guide RNA 1, which had good knockout efficiency, was selected. Then, the Akaluc gene was introduced using lentivirus, and after 1-2 weeks of amplification and culture, MHC Class 1 (-) exCMP was collected by sorting. Since MHC Class 1 (-) cells are known to be attacked by NK cells, the recipient BALB / c mice were administered anti-ASGM1 antibodies to deplete NK cells two days before transplantation, and then irradiated with radiation. 5MHC Class1 (-) exCMP (Universal exCMP; UNexCMP) was transplanted. As a result, in mice transplanted with control cells that were not knocked out, hematopoiesis was not observed in the spleen on days 5 and 7 after transplantation, and hematopoiesis did not increase. However, hematopoiesis was observed in the spleen of mice transplanted with MHC Class1 (-) exCMP on day 5 after transplantation, and the signal was further amplified on day 7 (see Figure 16B and C). In fact, when the spleens of mice transplanted with UNexCMP were collected on day 7 and analyzed, the number of mNG+ cells was significantly higher in mice transplanted with UNexCMP, and hematopoiesis was observed in the spleen (see Figure 16C). It was confirmed that UNexCMP was involved in hematopoiesis in the spleen, and differentiation into MHC ClassI (-) erythrocytes, neutrophils, and macrophages was confirmed. From the above, it was found that MHC Class1 (-) exCMP can utilize the spleen as a site of hematopoiesis in allogeneic transplantation after NK cell treatment and can induce early hematopoiesis. Next, to confirm whether NK-treated BALB / c mice could be rescued after irradiation, we administered 1×10 MHC Class1 (-) exCMP or control exCMP to NK-treated BALB / c mice after irradiation. 5 Cells were transplanted at the 1st and 2nd week, and 1 × 10 BALB / c bone marrow cells were transplanted at the 3rd week. 6 As expected, mice transplanted with control exCMP could not survive for more than 2 weeks, whereas mice transplanted with MHC Class1 (-) exCMP could survive for a long time (see the left panel of Figure 16D). When peripheral blood was analyzed 4 weeks after bone marrow cell transplantation, almost no UNexCMP-derived cells were detected, confirming that UNexCMP rescued the individual through short-term hematopoiesis (see the right panel of Figure 16D). Thus, by combining the exCMP, whose spatiotemporal dynamics after transplantation were clarified in this study, with cell universalization, it became possible to rescue allorecipients after irradiation by systematically administering UNexCMP.

[0089] Furthermore, we compared the hematopoietic cell induction ability of CMP and exCMP (or cultured CMP). When exCMP was transplanted into irradiated mice, hematopoiesis was observed in the spleen from day 6, with the first peak in cell mass occurring on day 7 and the second peak on day 10 (see Fig. 17A and Fig. 10C). In other words, compared with the results of the transplantation experiment of CMP before culture, the increase in cell number and the time of peak arrival were earlier (see Fig. 10C). When the number of mNG+ cells in the spleen was measured 7 days after transplantation, the number of cells derived from exCMP was significantly higher than that of CMP (see Fig. 17C). Irradiated mice were transplanted with exCMP (Ly5.1) and fCMP (F1), and then GCSF was administered on days 0, 1, 3, and 5, and the spleens were collected on day 7. The exCMP-derived cells increased the cell number in the spleen in response to GCSF. Compared with fCMP, exCMP showed higher responsiveness to GCSF, and as a result, the number of exCMP-derived cells was shown to be increased more than that of fCMP-derived cells (see FIG. 17D).

[0090] mNG+ CMP, MEP, and GMP, as well as exCMP and exGMP obtained by culturing under the culture conditions described in (5) above, were administered to irradiated mice, and the spleens were collected on the 7th day. The number of cells derived from the transplanted cells that emitted fluorescence was counted by flow cytometry. As a result, Ter119+ cells were significantly increased in the exCMP transplant group (see FIG. 10E). In addition, Gr / Mac1+ cells were also significantly increased in the exCMP transplant group. This further demonstrated the usefulness of the exCMP fraction in initiating early hematopoiesis (see FIG. 18).

[0091] Human CD34+ peripheral blood mononuclear cells (PBMCs) were collected and cultured for one week in serum-free medium containing 50 ng / mL each of human TPO, human SCF, human IL6, and Flt3L, and 1 μM of SR1. Stempan™ SFEM was used as the serum-free medium. CMP fractions or exCMP fractions or hematopoietic stem cell fractions in the resulting cultures were transplanted into irradiated mice, and spleens were collected 7 days after transplantation to evaluate the number of exCMP-derived cells. As a result, human CMPs (CD34+CD38+CD123+CD45RA-) and human hematopoietic stem cells (HSCs) (CD34+CD38-CD45RA-CD90+) could be expanded from human CD34+PBMCs, and the number of cells derived from the obtained cells could be increased in the spleen (see FIG. 19).

Claims

1. 1. A composition comprising a cell population, said cell population comprising common myeloid progenitor cells (CMPs); A composition in which the expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1 is downregulated in common myeloid progenitor cells (CMP) compared to CMP contained in the hematopoietic stem cell fraction of bone marrow in a living organism.

2. 1. A composition comprising a cell population, said cell population comprising common myeloid progenitor cells (CMPs); A composition, wherein the common myeloid progenitor cells (CMP) are grown in serum albumin-free medium.

3. The composition of claim 1 or 2, wherein the common myeloid progenitor cells (CMP) are DPP4 negative.

4. The composition of claim 2 or 3, wherein the medium comprises polyvinyl alcohol or a modified polyalkylene glycol.

5. The composition according to any one of claims 1 to 4, wherein CXCR4 is knocked down or knocked out in common myeloid progenitor cells (CMP).

6. The composition according to any one of claims 1 to 5, wherein the common myeloid progenitor cells (CMP) do not have major histocompatibility complexes on the cell membrane surface.

7. A composition comprising a cell population, said cell population comprising common myeloid progenitor cells (CMP), administered to a recipient undergoing conditioning for hematopoietic stem cell transplantation.

8. The composition according to claim 7, comprising a cell population as defined in any one of claims 1 to 6.

9. The composition of any one of claims 1 to 8, which is administered prior to, simultaneously with, or after hematopoietic stem cell transplantation.

10. The composition according to claim 8 or 9, for use in supporting early hematopoiesis after hematopoietic stem cell transplantation in a recipient.

11. 10. The composition of claim 9 for use in supporting survival of a recipient.

12. 12. The composition of claim 10 or 11, which is administered multiple times to a recipient.

13. The composition according to any one of claims 8 to 12 for use in inducing hematopoiesis in the spleen.

14. 1. A method for culturing a cell population comprising common myeloid progenitor cells (CMP), comprising:

1. A method comprising culturing a cell population comprising common myeloid progenitor cells (CMP) in a serum albumin-free medium, thereby expanding the common myeloid progenitor cells (CMP).

15. The method of claim 14 , wherein the medium comprises polyvinyl alcohol or a modified polyalkylene glycol.

16. 16. The method of claim 14 or 15, further comprising recovering common myeloid progenitor cells (CMP) from the cell population after culturing.

17. A composition comprising a cell population comprising common myeloid progenitor cells (CMP) obtained by the method of claim 16.

18. The composition of claim 17, wherein the expression of one or more or all of the marker genes selected from the group consisting of CXCR4, ITGA4, DPP4, MPO, CEBPA, and GATA1 is downregulated in common myeloid progenitor cells (CMP) compared to CMP contained in the hematopoietic stem cell fraction in the body.

Images