Exosome-coated adeno-associated virus as well as preparation method and application thereof
By constructing gp120 overexpressing lentiviral plasmid and preparing exosome-encapsulated adeno-associated viruses, the transfection efficiency of CD4+ T cells was enhanced, and the problem of low AAV infection with T lymphocytes was solved, and effective treatment of GVHD was achieved.
Patent Information
- Application Number
- CN202510464285.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-25
AI Technical Summary
As a gene therapy vector, the existing AAV is less effective in infection of T lymphocytes, making it difficult to effectively increase the proportion of Treg cells, resulting in limited therapeutic effects of GVHD.
By constructing gp120 overexpressing lentiviral plasmid and preparing exosome-encapsulated adeno-associated viruses, the transfection efficiency of CD4+ T cells is enhanced, and the immune escape ability of exosomes and the targeting of gp120 are used to improve the transduction effect of Foxp3 gene.
It significantly improved the infection efficiency of CD4+ T cells, enhanced the proportion of Treg cells, and effectively treated GVHD that occurred after allogeneic hematopoietic stem cell transplantation.
Smart Images

Figure CN120366388A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology, and particularly relates to an exosome-encapsulated adeno-associated virus, a preparation method thereof, and an application thereof. Background Art
[0002] Gene therapy has been applied to a variety of genetic or refractory diseases. This technology can effectively block the occurrence and development of diseases by carrying or manipulating genetic material to modify pathogenic defective genes. Adeno-associated virus (AAV), as an unenveloped single-stranded DNA virus belonging to the genus Dependoparvovirus of the family Parvoviridae, has become a gene therapy vector due to its excellent tissue tropism and safety. Globally, AAV-based gene therapy protocols have accounted for 8.1% of clinical research, and the translational application has continued to grow in the past decade. By methods such as surface coupling encapsulation and capsid modification design, the limitations of natural AAV itself can be overcome; methods such as exosome encapsulation can also reduce the immunogenicity of AAV.
[0003] Current preclinical and clinical studies using AAV are mostly limited to natural capsid serotypes, and their widespread application has significant limitations. Although the safety and tropism engineering capabilities of AAV have promoted its clinical trial applications, systemic administration is still restricted by neutralizing antibodies (NAbs) and low lymphocyte transduction efficiency. Due to previous viral exposure, >50% of the population has NAbs against the AAV capsid, which can hinder the cellular entry, intracellular trafficking, and nuclear translocation of viral particles, severely affecting the therapeutic effect (Bowles, D.E., et al., Phase 1 gene therapy for Duchenne muscular dystrophy using a translational optimized AAV vector. Mol Ther, 2012. 20(2): p. 443-55. and Wu, P., et al., Mutational analysis of the adeno-associated virus type 2 (AAV2) capsid gene and construction of AAV2 vectors with altered tropism. J Virol, 2000. 74(18): p. 8635-47.). Recent progress in the exosome-encapsulated adeno-associated virus (exo-AAV) system has shown its stronger immune escape ability - exo-AAV for liver-targeted gene delivery can avoid the host's humoral immune response to the capsid protein, significantly reduce the vector dose required for treatment, and achieve efficient and safe liver-targeted gene transfer (Asokan, A., et al., Reengineering a receptor footprint of adeno-associated virus enables selective and systemic gene transfer to muscle. Nat Biotechnol, 2010. 28(1): p. 79-82.). By utilizing the endogenous lipid bilayer structure of exosomes, exo-AAV can shield the capsid epitopes from NAb neutralization and effectively deliver even in seropositive hosts. Different from traditional AAV capsid modification, exosome surface engineering can integrate tissue-specific ligands to enhance targeting.Studies have shown that exosome-mediated targeted gene therapy can simultaneously improve the safety and effectiveness of intervention measures (Shen, S., et al., Engraftment of a galactose receptor footprint onto adeno-associated viral capsids improves transduction efficiency. J Biol Chem, 2013. 288(40): p. 28814-23.), and exo-AAV exhibits high biocompatibility, low clearance rate, and cell-specific delivery adaptability.
[0004] Regulatory T cells (Tregs) are key immunomodulatory elements in adaptive immunity and play a core immunosuppressive function by maintaining self-tolerance and preventing pathological hypersensitivity reactions. Tregs play a key protective role in graft-versus-host disease (GVHD). Studies have shown that the number of Tregs in the body of GVHD patients is reduced or functionally defective, and adoptive infusion of in vitro-expanded Tregs or enhancement of their activity through drugs (such as rapamycin, low-dose IL-2) can significantly reduce the inflammatory response and tissue damage of GVHD, while retaining the graft-versus-leukemia (GVL) effect. The pathogenesis of GVHD is related to the lack of immune regulation, and treatment strategies can focus on restoring the proliferative ability of Tregs and increasing their number. There has been no publicly disclosed technical solution that clearly uses in vivo gene therapy to optimize Treg treatment for GVHD in the prior art.
[0005] However, as a commonly used gene therapy vector at present, the infection efficiency of AAV for T lymphocytes is relatively low, usually less than 50%, while the infection efficiency of AAV for cells such as the liver and neurons is above 80% (Nawaz W, Huang B, Xu S, Li Y, Zhu L, Yiqiao H, Wu Z, Wu X. AAV-mediated in vivo CAR gene therapy for targeting human T-cell leukemia. Blood Cancer J. 2021 Jun 23;11(6):119. and Ellis B L, Hirsch M L, Barker J C, Connelly J P, Steininger R J 3rd, Porteus M H. A survey of ex vivo / in vitro transduction efficiency of mammalian primary cells and cell lines with Nine natural adeno-associated virus(AAV1-9)and one engineered adeno-associated virus serotype. Virol J. 2013 Mar 6;10:74.). Since its infection efficiency for T lymphocytes is low, how to improve the infection efficiency of AAV for T lymphocytes has become a key bottleneck problem in obtaining Treg cells by gene therapy. There have been literature reports on using exosome-related AAV8 to infect primary mouse T lymphocytes, but the infection efficiency is still less than 20% (Breuer C B, Hanlon K S, Natasan J S, et al. In vivo engineering of lymphocytes after systemic exosome-associated AAV delivery. Sci Rep. 2020;10(1):4544. Published 2020 Mar 11. doi:10.1038 / s41598-020-61518-w). Therefore, it is necessary to find a more effective method to enhance the infection of AAV for T lymphocytes. Summary of the Invention
[0006] The object of the present invention is to overcome the deficiencies of the prior art. The present invention provides an exosome-encapsulated adeno-associated virus carrying the Foxp3 gene, and enhances the binding ability to CD4 by overexpressing gp120 (HIV virus protein) on the membrane, thereby enhancing the targeting to CD4 +The transfection efficiency of T cells, and further regulate the proportion of Treg cells, for the treatment of GVHD occurring after allogeneic hematopoietic stem cell transplantation.
[0007] The present invention is achieved by the following technical solutions:
[0008] On the one hand, the present invention provides a method for preparing exosome-coated adeno-associated virus, comprising the following steps:
[0009] S1, construct a gp120 overexpression lentiviral plasmid, insert the optimized gp120 overexpression gene into the lentiviral overexpression vector plasmid to obtain the gp120 overexpression lentiviral plasmid;
[0010] The nucleotide sequence of the optimized gp120 overexpression gene is as shown in SEQ ID NO.1;
[0011] S2, prepare a HEK293 cell line stably expressing gp120, use the packaged gp120 overexpression lentivirus to infect HEK293 cells, and then obtain a HEK293 cell line stably expressing gp120 through Puro (Puromycin) screening;
[0012] S3, construct a Foxp3 overexpression AAV vector, insert the optimized human Foxp3 gene into the AAV expression vector to obtain the Foxp3 overexpression AAV vector;
[0013] The nucleotide sequence of the optimized human Foxp3 gene is as shown in SEQ ID NO.2;
[0014] S4, prepare exosome-coated adeno-associated virus, use the first plasmid, the second plasmid, and the third plasmid to transfect the HEK293 cell line stably expressing gp120 prepared in S2, after transfection and culture, collect the culture supernatant to obtain the exosome-coated adeno-associated virus;
[0015] The mass ratio of the first plasmid, the second plasmid, and the third plasmid is: 0.2 - 0.3:0.7 - 0.8:1;
[0016] The first plasmid is: the main plasmid pITR-Foxp3 containing the transgene and the promoter sequence, that is, the Foxp3 overexpression AAV vector prepared in S3;
[0017] The second plasmid is: the helper plasmid PXR6 containing the rep gene and the cap gene;
[0018] The third plasmid is: the helper plasmid pXX680 containing the AAV packaging helper proteins E1A / E2 / E3 / E4.
[0019] In the above technical solution, it further includes S5, a purification step. The collected culture supernatant is subjected to preliminary centrifugation and filtration through a filter membrane to obtain the supernatant free of cell debris. The supernatant free of cell debris is further ultracentrifuged, and the obtained precipitate is the preliminarily purified exosome-encapsulated adeno-associated virus;
[0020] The preliminarily purified exosome-encapsulated adeno-associated virus is washed with PBS, and then subjected to ultracentrifugation again and resuspended with PBS to obtain the purified exosome-encapsulated adeno-associated virus;
[0021] The preliminary centrifugation process is: centrifugation at 500×g for 10 - 15 minutes and centrifugation at 2500×g for 10 - 15 minutes;
[0022] The filter membrane filtration process uses a filter membrane with a pore size of 0.22 μm;
[0023] The ultracentrifugation process is: ultracentrifugation at 150000×g at 4°C for 70 - 80 minutes.
[0024] In the above technical solution, in step 2, the process of packaging the gp120-overexpressing lentivirus is as follows:
[0025] Add the gp120-overexpressing lentivirus plasmid, the packaging helper plasmid PAX2, the packaging helper plasmid VSVG and PEI to Opti-MEM; the mass ratio of the gp120-overexpressing lentivirus plasmid, the packaging helper plasmid PAX2, the packaging helper plasmid VSVG to PEI is 2:1:1:12 - 15; add 2 μg of the gp120-overexpressing lentivirus plasmid to every 0.1 ml of Opti-MEM; obtain the first mixture; then add it to 293FT cells, and the packaged gp120-overexpressing lentivirus is in the cell culture supernatant after 72 hours.
[0026] In the above technical solution, in step 3, the concentration of the Puro screening process is 2.5 μg / ml of Puro.
[0027] On the other hand, the present invention provides an exosome-encapsulated adeno-associated virus, which is composed of an adeno-associated virus and the exosome encapsulated outside it;
[0028] The adeno-associated virus is an adeno-associated virus carrying the optimized human Foxp3 gene;
[0029] The exosome is an exosome overexpressing the optimized gp120-overexpressing gene;
[0030] The nucleotide sequence of the optimized gp120-overexpressing gene is as shown in SEQ ID NO.1;
[0031] The nucleotide sequence of the optimized human Foxp3 gene is shown in SEQ ID NO.2.
[0032] On the other hand, the present invention provides an exosome-coated adeno-associated virus prepared by the method described in any one of the above.
[0033] On the other hand, the present invention provides the use of the exosome-coated adeno-associated virus described above in the preparation of a medicament for treating graft-versus-host disease.
[0034] In the above technical solution, the graft-versus-host disease is the graft-versus-host disease occurring after allogeneic hematopoietic stem cell transplantation.
[0035] It should be noted that the application provided by the present invention is not limited to the above fields such as drug screening. Using the exosome-coated adeno-associated virus provided by the present invention for research or use in other fields also belongs to the protection scope of the present invention.
[0036] Optionally, in some embodiments of the present invention, the above research is for non-diagnostic or therapeutic purposes of diseases.
[0037] The advantages and beneficial effects of the present invention are:
[0038] The exo-AAV transgenic vector with gp120 membrane expression of the present invention is formed by triple plasmid transfection and ultracentrifugation. The preparation method is simple and easy to operate. This transgenic vector efficiently transduces the Foxp3 gene into CD4 + T cells and can be applied to the preparation of a medicament for treating GVHD, and has a therapeutic effect on GVHD. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 It is a schematic diagram of the sequence of the optimized gp120 overexpressing gene of the present invention.
[0040] Figure 2 It is the plasmid map of the gp120 overexpressing lentivirus in the present invention.
[0041] Figure 3 It is the map of the Foxp3 overexpressing AAV vector prepared in S3 in Example 1 of the present invention.
[0042] Figure 4 It is the characterization of the purified exosome-coated adeno-associated virus prepared in Example 1 of the present invention; wherein, a is a transmission electron micrograph and b is a particle size analysis diagram.
[0043] Figure 5 It is the infection efficiency schematic diagram of CD4 + T cells of the present invention.
[0044] Figure 6It is a graph showing the change in disease score after the inventor humanized the GVHD model mice.
[0045] Figure 7 It is a graph showing the change in survival period after the present invention treats humanized GVHD model mice
[0046] For those of ordinary skill in the art, without creative efforts, other relevant drawings can be obtained based on the above drawings. Detailed implementation manners
[0047] In order to enable those in the technical field to better understand the solution of the present invention, the technical solution of the present invention will be further described below in conjunction with specific embodiments.
[0048] Example 1
[0049] A method for preparing exosome-coated adeno-associated virus, comprising the following steps:
[0050] S1, constructing a gp120 overexpression lentiviral plasmid: Designing a codon-optimized gp120 overexpression gene, as Figure 1 shown, which is composed of a CD8α signal peptide, gp120, a linker sequence, LAMP2b (transmembrane region), and an HA-taq combination; After the gene sequence was synthesized by Tsingke Company, it was inserted into the lentiviral overexpression vector plasmid to obtain the gp120 overexpression lentiviral plasmid, as Figure 2 shown.
[0051] The nucleotide sequence of the optimized gp120 overexpression gene is shown in SEQ ID NO.1;
[0052] SEQ ID NO.1
[0053] atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccgcaggtgctagcactatgggcagtggagctagcaaactgtgggtg
[0054] accgtgtattatggcgtgccggtgtggaaagaagcgaccaccaccctgttttgcgcgagcgatgcgaaagcgtatgataccgaagtgcataacgtgtgggcgaccc
[0055] atgcgtgcgtgccgaccgatccgaacccgcaggaagtggtgctggtgaacgtgaccgaaaactttaacatgtggaaaaacgatatggtggaacagatgcatgaaga
[0056] tattattagcctgtgggatcagagcctgaaaccgtgcgtgaaactgaccccgctgtgcgtgagcctgaaatgcaccgatctgaaaaacgataccaacaccaacagca
[0057] gcagcggccgcatgattatggaaaaaggcgaaattaaaaactgcagctttaacattagcaccagcattcgcggcaaagtgcagaaagaatatgcgtttttttataaact
[0058] ggatattattccgattgataacgataccaccagctataaactgaccagctgcaacaccagcgtgattacccaggcgtgcccgaaagtgagctttgaaccgattccgatt
[0059] cattattgcgcgccggcgggctttgcgattctgaaatgcaacaacaaaacctttaacggcaccggcccgtgcaccaacgtgagcaccgtgcagtgcacccatggcat
[0060] tcgcccggtggtgagcacccagctgctgctgaacggcagcctggcggaagaagaagtggtgattcgcagcgtgaactttaccgataacgcgaaaaccattattgtgc
[0061] agctgaacaccagcgtggaaattaactgcacccgcccgaacaacaacacccgcaaacgcattcgcattcagcgcggcccgggccgcgcgtttgtgaccattggca
[0062] aaattggcaacatgcgccaggcgcattgcaacattagccgcgcgaaatggaacaacaccctgaaacagattgcgagcaaactgcgcgaacagtttggcaacaaca
[0063] aaaccattatttttaaacagagcagcggcggcgatccggaaattgtgacccatagctttaactgcggcggcgaatttttttattgcaacagcacccagctgtttaacagca
[0064] cctggtttaacagcacctggagcaccgaaggcagcaacaacaccgaaggcagcgataccattaccctgccgtgccgcattaaacagattattaacatgtggcagaaa
[0065] gtgggcaaagcgatgtatgcgccgccgattagcggccagattcgctgcagcagcaacattaccggcctgctgctgacccgcgatggcggcaacagcaacaacga
[0066] aagcgaaatttttcgcccgggcggcggcgatatgcgcgataactggcgcagcgaactgtataaatataaagtggtgaaaattgaaccgctgggcgtggcgccgacc
[0067] aaagcgaaacgccgcgtggtgcagcgcgaaaaacgcggatccggtggcagtggatctggatccggtggctcgagtttggaacttaatttgacagattcagaaaatg
[0068] ccacttgcctttatgcaaaatggcagatgaatttcacagttcgctatgaaactacaaataaaacttataaaactgtaaccatttcagaccatggcactgtgacatataatgg
[0069] aagcatttgtggggatgatcagaatggtcccaaaatagcagtgcagttcggacctggcttttcctggattgcgaattttaccaaggcagcatctacttattcaattgacag
[0070] cgtctcattttcctacaacactggtgataacacaacatttcctgatgctgaagataaaggaattcttactgttgatgaacttttggccatcagaattccattgaatgaccttttta
[0071] gatgcaatagtttatcaactttggaaaagaatgatgttgtccaacactactgggatgttcttgtacaagcttttgtccaaaatggcacagtgagcacaaatgagttcctgtgt
[0072] gataaagacaaaacttcaacagtggcacccaccatacacaccactgtgccatctcctactacaacacctactccaaaggaaaaaccagaagctggaacctattcagtt
[0073] aataatggcaatgatacttgcctgctggctaccatggggctgcagctgaacatcactcaggataaggttgcttcagttattaacatcaaccccaatacaactcactccac
[0074] aggcagctgccgttctcacactgctctacttagactcaatagcagcactattaagtatctagactttgtctttgctgtgaaaaatgaaaaccgattttatctgaaggaagtga
[0075] acatcagcatgtatttggttaatggctccgttttcagcattgcaaataacaatctcagctactgggatgcccccctgggaagttcttatatgtgcaacaaagagcagactgt
[0076] ttcagtgtctggagcatttcagataaatacctttgatctaagggttcagcctttcaatgtgacacaaggaaagtattctacagcccaagagtgttcgctggatgatgacacc
[0077] attctaatcccaattatagttggtgctggtctttcaggcttgattatcgttatagtgattgcttacgtaattggcagaagaaaaagttatgctggatatcagactctgggaagc
[0078] ggatacccatacgatgtgccagattacgcttctagaggggctagctaa
[0079] S2. Preparation of HEK293 cell line stably expressing gp120:
[0080] Seed 293FT cells at an appropriate density in a six-well plate. After 12 - 16 hours, when the density reaches 80 - 90%, perform transfection. Dosage per well: 2 μg of the gp120 overexpression lentiviral plasmid, 1 μg of the helper plasmid VSVG, 1 μg of PAX2, 12 μg of PEI, and 100 μl of Opti-MEM. Slowly add the PEI solution to the plasmid solution and mix well. After standing for 10 minutes, add it to the culture medium. After 60 hours of transfection, collect the cell culture supernatant containing lentivirus and infect the HEK293 cells in a 10-cm dish by changing the medium, and make up to 10 ml with DMEM. After 24 hours, replace the medium containing the virus with a conventional cell culture medium, continue culturing for 48 hours and then passage, and add 2.5 μg / ml of Puro for screening. Change the medium every day until the cells basically do not fall off and die. In this way, the HEK293 cell line stably expressing gp120 is obtained.
[0081] S3. Construction of Foxp3 overexpression AAV vector. Insert the optimized human Foxp3 gene into the AAV expression vector (purchased from Tsingke Company) to obtain the Foxp3 overexpression AAV vector (as Figure 3 shown);
[0082] The nucleotide sequence of the optimized human Foxp3 gene is shown in SEQ ID NO.2;
[0083] SEQ ID NO.2
[0084] atgcccaaccccaggcctggcaagccctcggccccttccttggcccttggcccatccccaggagcctcgcccagctggagggctgcacccaaagcctcagacctg
[0085] ctgggggcccggggcccagggggaaccttccagggccgagatcttcgaggcggggcccatgcctcctcttcttccttgaaccccatgccaccatcgcagctgcag
[0086] ctgcccacactgcccctagtcatggtggcaccctccggggcacggctgggccccttgccccacttacaggcactcctccaggacaggccacatttcatgcaccagct
[0087] ctcaacggtggatgcccacgcccggacccctgtgctgcaggtgcaccccctggagagcccagccatgatcagcctcacaccacccaccaccgccactggggtctt
[0088] ctccctcaaggcccggcctggcctcccacctgggatcaacgtggccagcctggaatgggtgtccagggagccggcactgctctgcaccttcccaaatcccagtgca
[0089] cccaggaaggacagcaccctttcggctgtgccccagagctcctacccactgctggcaaatggtgtctgcaagtggcccggatgtgagaaggtcttcgaagagccag
[0090] aggacttcctcaagcactgccaggcggaccatcttctggatgagaagggcagggcacaatgtctcctccagagagagatggtacagtctctggagcagcagctggt
[0091] gctggagaaggagaagctgagtgccatgcaggcccacctggctgggaaaatggcactgaccaaggcttcatctgtggcatcatccgacaagggctcctgctgcatc
[0092] gtagctgctggcagccaaggccctgtcgtcccagcctggtctggcccccgggaggcccctgacagcctgtttgctgtccggaggcacctgtggggtagccatggaa
[0093] acagcacattcccagagttcctccacaacatggactacttcaagttccacaacatgcgaccccctttcacctacgccacgctcatccgctgggccatcctggaggctcc
[0094] agagaagcagcggacactcaatgagatctaccactggttcacacgcatgtttgccttcttcagaaaccatcctgccacctggaagaacgccatccgccacaacctgag
[0095] tctgcacaagtgctttgtgcgggtggagagcgagaagggggctgtgtggaccgtggatgagctggagttccgcaagaaacggagccagaggcccagcaggtgttc
[0096] caaccctacacctggcccc
[0097] S4. Prepare exosome - encapsulated adeno - associated virus. Amplify and culture the HEK293 cell line stably expressing gp120 prepared in S2 to a sufficient number. After plating for 6 hours, transfect three plasmids. The amount of plasmid used for each 15 - cm culture dish is 9 μg of the first plasmid, 12 μg of the second plasmid, and 15 μg of the third plasmid. The relevant transfection reagent dosage is 108 μg of PEI and 1 ml of Opti - MEM. Slowly add PEI to the plasmid mixture diluted with Opti - MEM, incubate at room temperature for 15 minutes, and add the Opti - MEM + DNA + PEI solution to the medium and mix well. At 12 - 16 hours after transfection, replace the medium with DMEM containing 2% exosome - free serum. After 72 hours, centrifuge to collect the culture supernatant to obtain the exosome - encapsulated adeno - associated virus;
[0098] The first plasmid is the main plasmid pITR-Foxp3 containing the transgene and promoter sequence, that is, the Foxp3 overexpressing AAV vector prepared in S3;
[0099] The second plasmid is the helper plasmid PXR6 containing the rep gene and cap gene;
[0100] The third plasmid is the helper plasmid pXX680 containing the AAV packaging helper proteins E1A / E2 / E3 / E4 (both the second plasmid and the third plasmid are directly purchased);
[0101] S5, purification step: The culture supernatant collected in S4 is centrifuged at 500×g for 10 minutes and then at 2500×g for 10 minutes to remove cells and cell debris. Then the supernatant is filtered through a 0.22-μm pore size filter membrane to more thoroughly remove cell debris. The treated supernatant is ultracentrifuged at 150000×g at 4°C for 70 minutes, and then the supernatant is carefully aspirated. The transparent film-like substance that can be seen only by careful discrimination at the bottom is the preliminarily purified exosome-encapsulated adeno-associated virus. Then an appropriate amount of PBS is used to resuspend and wash the preliminarily purified exosome-encapsulated adeno-associated virus once; it is ultracentrifuged again at 150000×g at 4°C for 70 minutes. Finally, the supernatant is carefully aspirated and the pellet is resuspended in 500 μL of PBS to obtain the purified exosome-encapsulated adeno-associated virus (gp120-exo-AAV). The purified exosome-encapsulated adeno-associated virus obtained can be verified by particle size analysis and transmission electron microscopy, as Figure 4 shown. Figure 4 In [reference], the particle size analysis results show that the particle size of the purified exosomes is in the range of 70 - 150 μm, which meets the standard exosome size and there are no impurity peaks, indicating high purity. Viral particles can be seen encapsulated in the exosomes by transmission electron microscopy, indicating the successful preparation of exosome-encapsulated adeno-associated virus.
[0102] Comparative Example 1
[0103] S1, preparation of adeno-associated virus: Unmodified HEK293 cells are amplified and cultured to a sufficient number. After plating for 6 hours, the three plasmids are transfected. The plasmid dosage for each 15-cm culture dish is 9 μg of the first plasmid, 12 μg of the second plasmid, and 15 μg of the third plasmid. The relevant transfection reagent dosages are 108 μg of PEI and 1 mL of Opti-MEM. PEI is slowly added to the plasmid mixture diluted with Opti-MEM and incubated at room temperature for 15 minutes. The Opti-MEM+DNA+PEI solution is added to the culture medium and mixed evenly; the medium is replaced with DMEM containing 2% exosome-free serum 12 - 16 hours after transfection. The culture supernatant is collected by centrifugation 72 hours later to obtain the adeno-associated virus;
[0104] The first plasmid is: the main plasmid pITR-Foxp3 containing the transgene and the promoter sequence (i.e., the Foxp3 overexpression AAV vector prepared in S3 of Example 1)
[0105] The second plasmid is: the helper plasmid PXR6 containing the rep gene and the cap gene
[0106] The third plasmid is: the helper plasmid pXX680 containing the AAV packaging helper proteins E1A / E2 / E3 / E4
[0107] S2, culture supernatant concentration step: The culture supernatant collected in S1 is centrifuged at 500×g for 10 minutes and then at 2500×g for 10 minutes to remove cells and cell debris. Then, the supernatant is filtered through a 0.22-μm pore size filter membrane to more thoroughly remove cell debris. 6. Add 25 ml of 40% PEG solution to every 100 ml of supernatant, stir evenly to allow sufficient precipitation. Transfer the entire sample to a 50-ml conical flask and centrifuge at 2,818 g at 4°C for 15 minutes. Discard the supernatant, and resuspend the virus in 10 ml of PBS + 0.001% pluronic F68 + 200 mM NaCl.
[0108] S3, iodixanol gradient ultracentrifugation for AAV purification
[0109] 1. Preparation of the iodixanol gradient:
[0110] 15% iodixanol: Mix 4.5 ml of 60% iodixanol and 13.5 ml of 1M NaCl / PBS-MK buffer
[0111] 25% iodixanol: Mix 5 ml of 60% iodixanol, 7 ml of 1*PBS-MK buffer, and 30 μl of phenol red
[0112] 40% iodixanol: Mix 6.7 ml of 60% iodixanol with 3.3 ml of 1*PBS-MK buffer
[0113] 60% iodixanol: Mix 10 ml of 60% iodixanol with 45 μl of phenol red
[0114] 2. Using a 10-ml syringe and needle, add each solution to the ultracentrifugation tube in the following order, taking care to avoid the formation of air bubbles.
[0115] (1) 5 ml of 60% iodixanol
[0116] (2) 5 ml of 40% iodixanol
[0117] (3) 6 ml of 25% iodixanol
[0118] (4) 8 ml of 15% iodixanol
[0119] 3. Add 5 ml of the clarified supernatant to the top of the gradient, and then fill the tube with PBS; centrifuge at 350,000 g for 90 minutes at 10 °C. Carefully remove the sealed tube from the rotor to avoid disturbing the gradient. Collect the fractions: Prepare a row of 20 open 1.5 μl microcentrifuge tubes on a rack. Pierce the large centrifuge tube at a position near 40% between 40% - 60% iodixanol with a needle, place the microcentrifuge tube under the opening of the needle, and collect the clarified 40% fraction.
[0120] S4, Concentration of the virus
[0121] 1. Solution preparation
[0122] (1) 0.1% Pluronic F68 PBS: 49.5 ml PBS + 500 μl Pluronic F68
[0123] (2) 0.01% Pluronic F68 PBS: 45 ml PBS + 5 ml of solution (1)
[0124] (3) 0.001% Pluronic F68 PBS: 45 ml PBS + 5 ml of solution (2) + 200 mM NaCl
[0125] 2. Cover the filter membrane with 15 ml of 0.1% Pluronic F68 PBS and incubate at room temperature for 10 minutes; remove the 0.1% Pluronic F68 PBS, add 15 ml of 0.01% Pluronic F68 PBS solution, centrifuge at 3000 rpm / min at 4 °C for 5 minutes, and discard the centrifuged liquid; add 15 ml of 0.001% Pluronic F68 PBS solution, centrifuge at 3000 rpm at 4 °C for 5 minutes, and discard the centrifuged liquid; add the sample, centrifuge at 3500 rpm at 4 °C for 8 minutes, and discard the centrifuged liquid. Add more sample and centrifuge at 3500 Rpm for 4 minutes, and discard the centrifuged liquid. Repeat this step as needed. Store the virus at -80 °C. The final product is adeno-associated virus carrying the Foxp3 gene (denoted as AAV6 / Foxp3).
[0126] Comparative Example 2
[0127] S1. Prepare exosomes without overexpressing gp120 to encapsulate adeno-associated virus. Expand and culture unmodified HEK293 cells to a sufficient number. After plating for 6 hours, transfect three plasmids. The amount of plasmid used for each 15-cm culture dish is 9 μg of the first plasmid, 12 μg of the second plasmid, and 15 μg of the third plasmid. The relevant transfection reagent amounts are 108 μg of PEI and 1 ml of Opti-MEM. Slowly add PEI to the plasmid mixture diluted with Opti-MEM, incubate at room temperature for 15 minutes, and add the Opti-MEM+DNA+PEI solution to the culture medium and mix well. At 12 - 16 hours after transfection, change the medium with DMEM containing 2% exosome-free serum. After 72 hours, centrifuge to collect the culture supernatant to obtain the exosomes without overexpressing gp120 encapsulating adeno-associated virus.
[0128] The first plasmid is: the main plasmid pITR-Foxp3 containing the transgene and promoter sequence (i.e., the Foxp3 overexpressing AAV vector prepared in S3 of Example 1)
[0129] The second plasmid is: the helper plasmid PXR6 containing the rep gene and cap gene
[0130] The third plasmid is: the helper plasmid pXX680 containing the AAV packaging helper proteins E1A / E2 / E3 / E4
[0131] S2. Purification step: Centrifuge the culture supernatant collected in S1 at 500×g for 10 minutes and 2500×g for 10 minutes to remove cells and cell debris. Then filter the supernatant through a 0.22-μm pore size filter membrane to more thoroughly remove cell debris. The treated supernatant is ultracentrifuged at 150000×g for 70 minutes at 4°C, and then carefully aspirate the supernatant. The transparent film-like substance that needs to be carefully distinguished at the bottom is the preliminarily purified exosomes encapsulating adeno-associated virus. Then resuspend and wash the preliminarily purified exosomes encapsulating adeno-associated virus once with an appropriate amount of PBS; ultracentrifuge again at 150000×g for 70 minutes at 4°C, and finally carefully aspirate the supernatant and resuspend the precipitate with 500 μl of PBS to obtain the purified exosomes without overexpressing gp120 encapsulating adeno-associated virus (denoted as control exo-AAV).
[0132] Use the purified AAV6 / Foxp3, control exo-AAV, and gp120-exo-AAV to infect human peripheral blood PBMC cells in vitro respectively, and infect at a ratio of virus particles: cells of 5*10 5 :1. After 72 hours, perform flow cytometry staining to analyze the proportion of Treg cells (CD4 + CD25 + Foxp3+ ) As Figure 5 shown, the experimental results show that the proportion of Tregs in the AAV6 / Foxp3 group is the lowest. The control exo-AAV is significantly increased compared with AAV6 / Foxp3, and the gp120-exo-AAV group is further increased compared with the control exo-AAV.
[0133] Example 2
[0134] Intervene in the humanized GVHD mouse model:
[0135] Step 1, the experimental subjects used in this example: Donor: normal human peripheral blood PBMC (peripheral blood mononuclear cells); Recipient mouse: 6-8-week-old NSG (NOD-scid IL2Rγnull) mice (severely immunodeficient, without T / B / NK cells).
[0136] Step 2, isolation of human peripheral blood cells: Collect peripheral blood from healthy donors, and isolate PBMCs by Ficoll density gradient centrifugation.
[0137] Step 3, cell transplantation: Divide the recipient mice into three groups, the GVHD disease + AAV6 / Foxp3 virus control group, the GVHD disease + control exo-AAV control group, and the GVHD disease + gp120-exo-AAV transgenic vector group. After the GVHD disease model mice were irradiated with a sublethal dose (1-2 Gy) of whole body irradiation for seven days, the conventional dose was 5×10 6 ~1×10 7 PBMCs / mouse were injected via the tail vein. After quantitative calculation of virus particles, each group was treated with 1×10 11 vg virus particle intervention;
[0138] Step 4, GVHD induction and monitoring: Observe the signs of the recipient mice after transplantation, including listlessness, poor appetite, diarrhea, weight loss, arched back, decreased activity, skin hair loss and ulceration. Clinical scores were performed for different signs. Record the mortality rate of the mice, and the typical GVHD lethal time is 4-8 weeks.
[0139] Result analysis: As Figure 6 compared with Figure 7 shown, compared with the group only injected with AAV6 / Foxp3 virus particles and the unmodified control exo-AAV treatment group, the gp120-exo-AAV transgenic vector treatment group can significantly improve the clinical symptoms of the humanized GVHD disease mouse model and promote the survival period.
[0140] The above has made an exemplary description of the present invention. It should be noted that without departing from the core of the present invention, any simple deformation, modification or equivalent substitution that can be made by those skilled in the art without creative efforts shall fall within the protection scope of the present invention.
Claims
1. A preparation method of adeno-associated virus encapsulated by exosomes, characterized in that, Comprising the following steps: S1. Construct a gp120 overexpression lentiviral plasmid by inserting the optimized gp120 overexpression gene into a lentiviral overexpression vector plasmid to obtain the gp120 overexpression lentiviral plasmid; The nucleotide sequence of the optimized gp120 overexpression gene is as shown in SEQ ID NO.1; S2. Prepare a HEK293 cell line stably expressing gp120. Infect HEK293 cells with the packaged gp120 overexpression lentivirus, and then obtain a HEK293 cell line stably expressing gp120 after screening with Puro (Puromycin); S3. Construct a Foxp3 overexpression AAV vector by inserting the optimized human Foxp3 gene into an AAV expression vector to obtain the Foxp3 overexpression AAV vector; The nucleotide sequence of the optimized human Foxp3 gene is as shown in SEQ ID NO.2; S4. Prepare exosome-encapsulated adeno-associated virus. Transfect the HEK293 cell line stably expressing gp120 prepared in S2 with the first plasmid, the second plasmid, and the third plasmid. After transfection and culture, collect the culture supernatant to obtain the exosome-encapsulated adeno-associated virus; The mass ratio of the first plasmid, the second plasmid, and the third plasmid is: 0.2 - 0.3:0.7 - 0.8:1; The first plasmid is: the main plasmid pITR-Foxp3 containing the transgene and the promoter sequence, i.e., the Foxp3 overexpression AAV vector prepared in S3; The second plasmid is: the helper plasmid PXR6 containing the rep gene and the cap gene; The third plasmid is: the helper plasmid pXX680 containing the AAV packaging helper proteins E1A / E2 / E3 / E4; 2. The preparation method of adeno-associated virus encapsulated by exosomes according to claim 1, wherein, Also includes S5, a purification step. Centrifuge the collected culture supernatant initially and filter it through a membrane to obtain the supernatant free of cell debris. Further ultracentrifuge the supernatant free of cell debris, and the obtained precipitate is the preliminarily purified exosome-encapsulated adeno-associated virus; Wash the preliminarily purified exosome-encapsulated adeno-associated virus with PBS, and then ultracentrifuge and resuspend the precipitate with PBS again to obtain the purified exosome-encapsulated adeno-associated virus; 3. The preparation method of adeno-associated virus encapsulated by exosomes according to claim 2, wherein, The initial centrifugation process is: centrifuge at 500×g for 10 - 15 minutes and then at 2500×g for 10 - 15 minutes; The ultracentrifugation process is: ultracentrifuge at 150000×g at 4°C for 70 - 80 minutes; 4. The preparation method of adeno-associated virus encapsulated by exosomes according to claim 2, characterized in that, The membrane filtration process uses a membrane with a pore size of 0.22 μm; 5. The preparation method of adeno-associated virus encapsulated by exosomes according to claim 1, characterized in that In step 2, the process of packaging the gp120 overexpression lentiviral plasmid is: Add the gp120 overexpression lentiviral plasmid, packaging helper plasmid PAX2, packaging helper plasmid VSVG and PEI into Opti-MEM; the mass ratio of the gp120 overexpression lentiviral plasmid, packaging helper plasmid PAX2, packaging helper plasmid VSVG to PEI is 2:1:1:12-15; add 2 micrograms of the gp120 overexpression lentiviral plasmid to every 0.1 ml of Opti-MEM; obtain the first mixture; then add it into 293FT cells, and the cell culture supernatant after 72 hours contains the packaged gp120 overexpression lentivirus.
6. The preparation method of adeno-associated virus encapsulated by exosomes according to claim 1, characterized in that In step 3, the concentration of the Puro screening process is 2.5 μg / ml of Puro.
7. An exosome-encapsulated adeno-associated virus, characterized in that, It consists of an adeno-associated virus and exosomes wrapped outside it; The adeno-associated virus is an adeno-associated virus carrying an optimized human Foxp3 gene; The exosomes are exosomes overexpressing an optimized gp120 overexpression gene; The nucleotide sequence of the optimized gp120 overexpression gene is shown in SEQ ID NO.1; The nucleotide sequence of the optimized human Foxp3 gene is shown in SEQ ID NO.
2.
8. An exosome-encapsulated adeno-associated virus, characterized in that It is prepared by the method according to any one of claims 1 to 6.
9. Use of an exosome-coated adeno-associated virus according to claim 7 or 8 in the preparation of a drug for treating graft-versus-host disease.
10. The application according to claim 9, characterized in that, The graft-versus-host disease is graft-versus-host disease occurring after allogeneic hematopoietic stem cell transplantation.