Method for improving citrus Huanglongbing resistance by using clpsa n gene
By constructing a VIGS vector for the ClPsaN gene in citrus and regulating its expression, the problem of controlling citrus yellow vein disease was solved, significantly improving citrus resistance and reducing disease incidence, and providing important breeding resources.
Patent Information
- Application Number
- CN202510062321.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2045-01-15
AI Technical Summary
The lack of effective control agents for citrus yellow vein virus disease has led to a decline in citrus yield and economic losses. The role of the PsaN gene in plant resistance to viral infection has not been fully studied in the current technology.
By constructing a VIGS vector for the ClPsaN gene in citrus, regulating the expression level of the ClPsaN gene, and using RNAi-mediated gene silencing technology, the transcription level of ClPsaN in citrus was reduced, thereby improving the resistance of citrus to citrus yellow vein disease.
It significantly improves the resistance of citrus to citrus yellow vein disease, reduces virus titer by 22-34%, and viral protein accumulation by 35-50%, thus mitigating the severity of the disease and providing important breeding genetic resources.
Smart Images

Figure CN119824029B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biogenetics technology, and more specifically, to a method for improving resistance to citrus yellow vein disease using the ClPsaN gene. Background Technology
[0002] Citrus yellow vein clearing virus (CYVCV) is a viral disease that poses a serious threat to the citrus industry. This virus causes citrus yellow vein clearing disease (CYVCD), which can infect most citrus varieties and severely threatens the lemon and other citrus fruits. Infection weakens citrus trees, leading to a significant drop in yield. Controlling this disease is difficult, and currently, there are no effective pesticides; prevention relies primarily on strict quarantine and enhanced management practices.
[0003] Citrus plants infected with CYVCV exhibit symptoms of lateral vein yellowing and vein prominence, accompanied by leaf wrinkling and young leaf curling. Later stages show leaf retraction, wrinkling, and deformity, with a water-soaked appearance on the underside of the leaves, and occasionally ring spots and vein necrosis. These symptoms are more pronounced on newly emerging leaves from spring and autumn shoots, and some young shoots may experience leaf drop. Mature leaves show reduced yellowing and turn green, but leaf wrinkling does not resolve, and yellow veins remain prominent when viewed against the light, with elongated yellow spots of varying lengths observed between or near the veins. The manifestation of these symptoms is temperature-dependent, visible between 18 and 24°C, and disappearing after 32°C. The symptoms caused by citrus yellowing and vein prominence virus infection directly affect normal photosynthesis, weakening seedling growth and significantly impacting citrus quality and yield, posing a threat to the economic development of citrus cultivation in various regions.
[0004] Chloroplasts, organelles unique to higher plants, not only provide carbon and energy to cells through photosynthesis but are also crucial sites for the production of reactive oxygen species, calcium ion signals, and immune molecules such as salicylic acid and jasmonic acid within plant cells. Chloroplast-mediated immune responses play a vital role in resisting plant virus infections. Photosystem I (PSI) is a key complex in plant photosynthesis, primarily responsible for capturing light energy and converting it into chemical energy. With the deepening of research on photosynthesis and the advancement of molecular biology techniques, the structural components of the PSI complex have been gradually elucidated. During this process, researchers discovered the peripheral accessory subunit of PSI, PsaN (Photosystem I Subunit N). PsaN was initially isolated from barley (Hordeum vulgare L.) by scientists Knoetzel and Simpson, who determined its full-length gene sequence and named it. Due to the inherent complexity of the PSI in higher plants, research progress on PsaN has been relatively slow. Currently, the homology of PsaN in seed plants is known to be as high as 79.22%, indicating its stability during plant evolution and suggesting its prominent role in photosynthesis. With the development of molecular biology techniques, PsaN has begun to be resolved in a few algae, but the difference in the number of amino acid residues in the PsaN subunits between algae and higher plants leads to differences in the PsaN's position. Current research has found that PsaN gene expression is affected by various factors such as temperature and nutrient status. Through genetic transformation, overexpression or silencing of the PsaN gene in Arabidopsis thaliana directly affects PSI assembly and photosynthetic efficiency. However, research on PSI's involvement in plant antiviral activity is extremely limited, and there are no reports on the role of PsaN in disease infection. Furthermore, there is no research or application of RNAi-mediated PsaN silencing to improve citrus resistance to citrus yellow vein disease.
[0005] In view of the above, this application is hereby submitted. Summary of the Invention
[0006] This invention provides a method for improving the resistance of citrus to yellow vein disease by utilizing the ClPsaN gene. By transferring the VIGS vector of the citrus ClPsaN gene into citrus, the transcription level of citrus ClPsaN is reduced, which can significantly improve the resistance of citrus to yellow vein disease and reduce the severity of the disease. This method has significant application value in citrus breeding and can be used as a candidate gene for resistance breeding along with multiple citrus yellow vein virus resistance and susceptibility genes.
[0007] This invention is achieved through the following technical solution:
[0008] A method for improving resistance to citrus yellow vein disease using the ClPsaN gene is disclosed. This method improves the resistance of citrus plants to citrus yellow vein disease by regulating the expression level of the ClPsaN gene in citrus plants. The nucleotide sequence of the ClPsaN gene is shown in SEQ ID NO: 1.
[0009] In one specific implementation, the method for regulating the expression level of the ClPsaN gene is to downregulate the expression level of the ClPsaN gene in citrus plants.
[0010] In one specific implementation, the expression level of the ClPsaN gene in citrus plants is downregulated by using VIGS gene silencing technology.
[0011] In a specific implementation, the following steps are included:
[0012] (1) Cloning the VIGS fragment of the citrus ClPsaN gene;
[0013] (2) Construct two VIGS expression vectors, TRV and CLBV;
[0014] (3) The VIGS expression vector was transformed into citrus to obtain VIGS plants in which the citrus ClPsaN gene was silenced.
[0015] In a specific embodiment, in step (1), the cloning method of the VIGS fragment of the citrus ClPsaN gene is as follows: extract total RNA from citrus, then reverse transcribe it into cDNA, and finally amplify it by high-fidelity enzyme PCR to obtain the VIGS fragment of the citrus ClPsaN gene.
[0016] In one specific embodiment, the nucleotide sequence of the VIGS fragment of the citrus ClPsaN gene is shown in SEQ ID NO: 2.
[0017] In a specific embodiment, in step (1), the primers used for PCR amplification are ClPsaN-TRV-F, ClPsaN-TRV-R and ClPsaN-CLBV-F, ClPsaN-CLBV-R, and their nucleotide sequences are shown as SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6, respectively.
[0018] In a specific embodiment, in step (2), the VIGS expression vector is constructed as follows: the VIGS fragment of the citrus ClPsaN gene obtained in step (1) is ligated with the TRV2 vector digested by EcoRI and BamHI and the CLBV vector digested by SmaI, respectively, and transformed into competent Escherichia coli cells. The plasmid is then extracted to obtain the VIGS expression vector of the ClPsaN gene.
[0019] In a specific embodiment, in step (3), the method of transforming citrus with the VIGS expression vector is as follows: the VIGS expression vector obtained in step (2) is transformed into Agrobacterium, Agrobacterium bacterial solution containing the VIGS expression vector is prepared, and sterile citrus seedlings are infected to obtain VIGS plants in which the citrus ClPsaN gene is silenced.
[0020] In one specific embodiment, the method further includes PCR verification of VIGS plants, using primers TRV2-ClPsaN detection-F and TRV2-ClPsaN detection-R, CLBV-ClPsaN detection-F and CLBV-ClPsaN detection-R, whose nucleotide sequences are shown in SEQ ID No: 9 and SEQ ID No: 10, SEQ ID No: 13 and SEQ ID No: 14, respectively.
[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0022] 1. The present invention provides a method for improving the resistance of citrus yellow vein disease by using the ClPsaN gene. By constructing a VIGS vector of the citrus ClPsaN gene and then transforming it into citrus, the resulting citrus plants can show significant resistance to citrus yellow vein disease. The titer of citrus yellow vein disease virus can be reduced by 22-34%, and the accumulation of viral protein can be reduced by 35-50%, which significantly reduces the severity of citrus yellow vein disease.
[0023] 2. The present invention provides a method for improving the resistance of citrus yellow vein disease by using the ClPsaN gene. By silencing the citrus ClPsaN gene with VIGS, the severity of citrus yellow vein disease can be significantly reduced, and the resistance of citrus to yellow vein disease can be improved. Moreover, the silencing of the citrus ClPsaN gene with TRV does not affect the phenotype of citrus plants.
[0024] 3. The present invention provides a method for improving the resistance of citrus yellow vein disease by using the ClPsaN gene. By silencing the ClPsaN gene, the resistance of citrus plants to yellow vein disease can be greatly improved. This has significant application value for breeding citrus resistant to citrus yellow vein disease. It can be used as a candidate gene to synergistically carry out citrus yellow vein disease resistance breeding with multiple citrus yellow vein disease resistance and susceptibility genes using VIGS silencing, RNA interference and gene editing technologies. Attached Figure Description
[0025] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 Bioinformatics feature diagram of citrus ClPsaN provided in the embodiments of the present invention: A, prediction of conserved domains of citrus ClPsaN gene; B, prediction of transmembrane region of citrus ClPsaN gene; C, analysis of conserved domains of PsaN protein and analysis of secondary structure of ClPsaN protein; D, phylogenetic tree constructed based on the amino acid sequence of PsaN protein, with red pentagrams marking ClPasN protein;
[0027] Figure 2 Electrophoresis diagram of PCR amplification of the VIGS fragment of the citrus ClPsaN encoding gene provided in the embodiments of the present invention: VIGS represents the RNAi fragment of the ClPsaN encoding gene; M represents the DNA molecular weight standard, the same below;
[0028] Figure 3 The VIGS vector structure diagram of citrus ClPsaN provided in the embodiments of the present invention is as follows: A, TRV vector structure diagram; B, CLBV vector structure diagram; 35S: plant constitutive promoter derived from cauliflower mosaic virus, CP: coat protein, RdRp: NA-dependent RNA polymerase, GFP: green fluorescent protein, MP: motor protein, NOS: crown gall synthase gene terminator, LB: left homologous arm, RB: right homologous arm;
[0029] Figure 4 PCR identification diagrams of transgenic plants provided in the embodiments of the present invention: A, PCR detection diagram of TRV silent plants; B, PCR detection diagram of CLBV silent plants; CK: control of plant samples without any treatment; P: plasmid control; M: DNA Marker; TRV2-GFP and TRV2-ClPsaN detection fragments 300bp, CLBV-GUS and CLBV-ClPsaN detection fragments 461bp.
[0030] Figure 5 The following is a qRT-PCR detection diagram of ClPsaN expression in VIGS plants provided in this embodiment of the invention: A, TRV2-ClPsaN, plants transformed with the TRV vector of ClPsaN (the same below); B, CLBV-ClPsaN, plants transformed with the CLBV vector of ClPsaN; *, **, and *** indicate significant differences P<0.05, P<0.01, and P<0.001, respectively (the same below);
[0031] Figure 6 Phenotypic diagrams of VIGS plants provided for embodiments of the present invention: A, Phenotypic diagram of TRV silent plants; B, Phenotypic diagram of CLBV silent plants;
[0032] Figure 7 The disease incidence of VIGS plants after leaf inoculation with Citrus Yellowing Veining Virus provided in this embodiment of the invention: A, TRV-silenced plants after 20 days of inoculation with Citrus Yellowing Veining Virus; B, CLBV-silenced plants after 30 days of inoculation with Citrus Yellowing Veining Virus.
[0033] Figure 8 The protein accumulation of VIGS plants after re-inoculation with Citrus Yellowing Veining Virus (CYVCV) in the leaves provided in this embodiment of the invention is as follows: A, CYVCV CP accumulation of TRV-silenced plants 20 days after re-inoculation with CYVCV; B, CYVCV CP accumulation of CLBV-silenced plants 30 days after re-inoculation with CYVCV. Coomassie Brilliant Blue (CBB) staining was used to verify the consistency of sample loading, ImageJ was used to calculate gray values, and Student's t-test was used for statistical analysis of the data.
[0034] Figure 9 The following are examples of virus titer determination for VIGS plant leaves after re-inoculation with Citrus Yellowing Veining Virus: A, Virus titer determination for TRV-silenced plants 20 days after re-inoculation with Citrus Yellowing Veining Virus; B, Virus titer determination for CLBV-silenced plants 30 days after re-inoculation with Citrus Yellowing Veining Virus. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.
[0036] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be apparent to those skilled in the art that these specific details are not necessary to practice the invention. In other embodiments, well-known structures, circuits, materials, or methods have not been specifically described in order to avoid obscuring the invention.
[0037] Throughout this specification, references to "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in connection with that embodiment or example is included in at least one embodiment of the present invention. Therefore, the phrases "an embodiment," "an example," "an example," or "an example" appearing in various places throughout the specification do not necessarily refer to the same embodiment or example. Furthermore, specific features, structures, or characteristics can be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. Moreover, those skilled in the art will understand that the illustrations provided herein are for illustrative purposes and are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0038] In the description of this invention, the terms "front", "rear", "left", "right", "up", "down", "vertical", "horizontal", "high", "low", "inner", and "outer" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are only for the convenience of describing this invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limiting the scope of protection of this invention.
[0039] Example 1
[0040] Bioinformatics analysis of citrus ClPsaN
[0041] like Figure 1 As shown, InterPro (https: / / www.ebi.ac.uk / interpro / ) was used to predict conserved domains of ClPsaN; DeepTMHMM (https: / / dtu.biolib.com / ) was used to predict transmembrane regions of ClPsaN; Swiss-model (https: / / swissmodel.expasy.org / ) was used to predict the secondary structure of ClPsaN. The results were then imported into ESPript 3.0 (https: / / espript.ibcp.fr / ) for visualization and adjustment. Using MEGA 11 software, a phylogenetic tree of PSAN was constructed using the collar join method and 1000 repetitions of the guide value.
[0042] The nucleotide sequence of the ClPsaN gene is SEQ ID NO: 1:
[0043] ATGGCAGCCATGAACTCTAGTGTACTCGCATGCAACTATGCTATTTCAGGCAGTGCTGGATCATCTGAGCTCAATGCAAAGATTGTTTCAGTTTCAACCCCGGCTGTGCATGGCCACAAAATGCCTGT GATCAGAGCTCAACAAGTTGATGTTTCAAAAGAATCAAGAGGAACTGATGGAAGGAGAGCTGCCATGGCTCTTCTAGCAGTTACCCTTTTCACCACAGCTACTGCTGCTGCTTCTTCTGCTAATGCTG GGGTCATCGATGAATACCTTGAGAGAAGCAAGCCAACAAGGAATTGAATGACCAGAAGAGATTGGCAACAAGTGGTGCAAACTTTGCCAGAGCATACACTGTTCAATTTGGCACATGCAAGTTCCCTGAGAACTTCACAGGCTGCCAAGATCTTGCCAAGCAAAAGAAAGTGCCATTCATCTCGGATGATTTGGAATTGGAGTGCAAAGGGAAAGATAAATACAAGTGTGGTTCCAATGTTTTCTGGAAATGGTGA
[0044] Example 2
[0045] RNAi fragment cloning of the ClPsaN encoding gene
[0046] 1. RNA extraction and cDNA synthesis
[0047] Total RNA was extracted from citrus (Eureka lemon) leaves using the CTAB method, and its concentration was determined using a concentration meter. cDNA was synthesized using the PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) reverse transcription kit and stored at -20℃ for later use.
[0048] 2. VIGS fragment amplification
[0049] Using primers ClPsaN-TRV-F (SEQ ID NO: 3), ClPsaN-TRV-R (SEQ ID NO: 4), and ClPsaN-CLBV-F (SEQ ID NO: 5), ClPsaN-CLBV-R (SEQ ID NO: 6), and employing the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), the VIGS fragment of the ClPsaN encoding gene, with a length of 300 bp (SEQ ID NO: 2), was cloned from citrus cDNA. Figure 2 (As shown). Under UV light, use a clean blade to cut off the agarose gel block containing the target fragment, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.
[0050] PCR amplification program: 98℃, 3 min; 98℃, 10 s, 55℃, 30 s, 72℃, 15 s, 35 cycles; extension at 72℃ for 10 min.
[0051] Nucleotide sequence of the VIGS fragment of the citrus ClPsaN gene SEQ ID NO: 2:
[0052] AGCTCAACAAGTTGATGTTTCAAAAGAATCAAGAGGAACTGATGGAAGGAGAGCTGCCATGGCTCTTCTAGCAGTTACCCTTTTCACCACAGCTACTGCTGCTGCTTCTTCTGCTAATGCTGGGGTCATCGATGAATACCTTGAGAGAAG CAAAGCCAACAAGGAATTGAATGACCAGAAGAGATTGGCAACAAGTGGTGCAAACTTTGCCAGAGCATACACTGTTCAATTTGGCACATGCAAGTTCCCTGAGAACTTCACAGGCTGCCAAGATCTTGCCAAGCAAAAGAAAGTGCCATT
[0053] The nucleotide sequence of primer ClPsaN-TRV-F is SEQ ID NO: 3:
[0054] GTGAGTAAGGTTACCGAATTCAATGGCACTTTTCTTTTGCTTGG
[0055] The nucleotide sequence of primer ClPsaN-TRV-R is SEQ ID NO: 4:
[0056] CGTGAGCTCGGTACCGGATCCAGCTCAACAAGTTGATGTTTCAAA
[0057] The nucleotide sequence of primer ClPsaN-CLBV-F is SEQ ID NO: 5:
[0058] CTCTTAGAAATGTAGCCCGGGAATGGCACTTTTCTTTTGCTTGG
[0059] The nucleotide sequence of primer ClPsaN-CLBV-R is SEQ ID NO: 6:
[0060] TGCCAGAATTCGGGACCCGGGAGCTCAACAAGTTGATGTTTCAAA
[0061] Example 3
[0062] VIGS vector construction
[0063] The VIGS vector TRV2 was digested with EcoRI and BamHI, and CLBV was digested with SmaI. The fragments were recovered from the gel, ligated to their corresponding fragments, and transformed into competent *E. coli* cells. Plasmids were extracted to obtain the VIGS expression vectors TRV2-ClPsaN and CLBV-ClPsaN (e.g., ...). Figure 3 (As shown). Wherein, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; MP: motor protein; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: crown gall synthase gene terminator; LB: left homologous arm; RB: right homologous arm. Agrobacterium was transformed with vectors TRV2-ClPsaN and CLBV-ClPsaN to prepare Agrobacterium bacterial culture containing the ClPsaN gene in the VIGS expression vector.
[0064] Example 4
[0065] VIGS carrier transformation of citrus
[0066] 1. Activation of Agrobacterium tumefaciens
[0067] Take 500 μL of Agrobacterium tumefaciens culture of TRV1, TRV2-GFP (control), and TRV2-ClPsaN respectively, add them to 50 mL of liquid LB medium (containing kanamycin), and incubate at 28℃ and 200 r / min until OD. 600 =1.0; Collect bacterial cells, resuspend in MMA (10mM MgCl2, 10nM MES, 100μM acetylsylgenone) solution, and adjust OD. 600=1.0; TRV1 was mixed with TRV2 and TRV2-ClPsaN vector at a volume ratio of 1:1 and incubated at room temperature in the dark for 1 h.
[0068] Take 500 μL of Agrobacterium tumefaciens culture of CLBV-GUS (control) and CLBV-ClPsaN respectively, add to 50 mL of liquid LB medium (containing kanamycin), and incubate at 28℃ and 200 r / min until OD. 600 =1.0; Collect bacterial cells, resuspend in MMA (10mM MgCl2, 10mM MMEs, 100μM acetylsylgenone) solution, and adjust OD. 600 =1.0, incubate at room temperature in the dark for 1 hour.
[0069] 2. Agrobacterium infection
[0070] Sterile seedlings with radicles reaching 3cm in length were immersed in Agrobacterium tumefaciens solution and vacuumed for 1 minute. They were then rinsed 3-5 times with sterile water, planted in soil, and cultured at 25℃ under light / dark conditions for 16h / 8h, with regular watering.
[0071] Example 5
[0072] Identification and phenotypic observation of VIGS plants
[0073] 1. PCR identification
[0074] One month later, DNA and total RNA were extracted from tissue samples. The RNA was then analyzed using primer pairs TRV2-GFP detection-F (SEQ ID NO: 7) / TRV2-GFP detection-R (SEQ ID NO: 8), TRV2-ClPsaN detection-F (SEQ ID NO: 9) / TRV2-ClPsaN detection-R (SEQ ID NO: 10), CLBV-GUS detection-F (SEQ ID NO: 11) / CLBV-GUS detection-R (SEQ ID NO: 12), and CLBV-ClPsaN detection-F (SEQ ID NO: 13) / CLBV-ClPsaN detection-R (SEQ ID NO: 8). NO: 14) PCR verification: Primer pairs TRV2-GFP detection-F / R and TRV2-ClPsaN detection-F / R amplified 300bp bands in TRV2-GFP and TRV2-ClPsaN positive plants, respectively; primer pairs CLBV-GUS detection-F / R and CLBV-ClPsaN detection-F / R amplified 461bp bands in CLBV-GUS and CLBV-ClPsaN positive plants, respectively (e.g., Figure 4(As shown in the image). A: PCR detection image of TRV-silenced plants; B: PCR detection image of CLBV-silenced plants; CK: Control plant sample without any treatment; P: Plasmid control; M: DNA Marker.
[0075] PCR reaction conditions: 98℃, 3 min; 98℃, 10 s, 55℃, 30 s, 72℃, 15 s, 35 cycles; extension at 72℃ for 10 min.
[0076] Primer TRV2-GFP detects the nucleotide sequence of -F SEQ ID NO: 7:
[0077] TCCAGCGAGTGGAAGTCCGA
[0078] Primer TRV2-GFP detection -R nucleotide sequence SEQ ID NO: 8:
[0079] ATGGCGGACTTGAAGAAGTC
[0080] Primer TRV2-ClPsaN detects the nucleotide sequence of -F SEQ ID NO: 9:
[0081] CGGACGAGTGGACTTAGATT
[0082] Primer TRV2-ClPsaN detects the nucleotide sequence of -R SEQ ID NO: 10:
[0083] GGAAGGAGAGCTGCCATGGCTCTT
[0084] Primer CLBV-GUS detects the nucleotide sequence of -F SEQ ID NO: 11:
[0085] ATTCCAACTGAAGCTGATGGGAG
[0086] Primer CLBV-GUS detects the nucleotide sequence of -R SEQ ID NO: 12:
[0087] AGCACGATACGCTGGCCTGCCCAA
[0088] Primer CLBV-ClPsaN detects the nucleotide sequence of -F SEQ ID NO: 13:
[0089] ATTCCAACTGAAGCTGATGGGAG
[0090] Primer CLBV-ClPsaN detects the nucleotide sequence of -R SEQ ID NO: 14:
[0091] GGAAGGAGAGCTGCCATGGCTCTT
[0092] 2. qRT-PCR analysis
[0093] qRT-PCR was performed using primers ClPsaN-RT-F (SEQ ID NO: 15) and ClPsaN-RT-R (SEQ ID NO: 16) to verify whether ClPsaN was successfully silenced. The gene expression level of plants transfected with TRV2-GFP and CLBV-GUS vectors was set to 1. If the ClPsaN gene expression level in plants containing the target fragment vector was less than 1, gene silencing had occurred. Identification showed that ClPsaN transcriptional levels decreased by 46-66% (e.g., ...). Figure 5 (As shown).
[0094] qRT-PCR reaction conditions: 95℃ for 3 min, 95℃ for 15 s; 60℃ for 15 s, 72℃ for 15 s, 40 cycles.
[0095] The nucleotide sequence of primer ClPsaN-RT-F is SEQ ID NO: 15:
[0096] AACTGATGGAAGGAGAGCTGC
[0097] The nucleotide sequence of primer ClPsaN-RT-R is SEQ ID NO: 16:
[0098] TGACCCCAGCATTAGCAGAAG
[0099] 3. Phenotypic observation
[0100] Observation of the phenotype of VIGS plants with the ClPsaN gene revealed that plants silenced by the TRV vector showed no obvious abnormalities in appearance or growth, while plants silenced by the CLBV vector exhibited chlorosis and mottled whitening symptoms compared to the control (e.g., ...). Figure 6 (As shown).
[0101] Example 6
[0102] Resistance evaluation of VIGS plants
[0103] After silencing the ClPsaN gene for 30-45 days, half of the plants were injected with citrus yellowing virus, while the other half were injected with an empty vector control.
[0104] 1. Phenotypic observation
[0105] After 20-30 days of cultivation, symptom observation revealed that the symptoms of leaf yellowing and vein bleaching were less pronounced in plants with silenced ClPsaN gene and inoculated with CYVCV compared to the control group. In plants with ClPsaN gene silenced using CLBV followed by CYVCV inoculation, the symptoms of ClPsaN gene silencing were masked by CYVCV symptoms (e.g., ...). Figure 7 (As shown).
[0106] 2. Viral protein accumulation detection
[0107] Total protein was extracted from plant leaves and added to 5× protein loading buffer at the specified ratio. The mixture was then boiled in water for 10 min to denature the protein. Subsequent Western blot experiments were performed using a CYVCV CP-specific antibody, and grayscale analysis was conducted to quantify protein expression levels. The results showed that CYVCV CP protein accumulation decreased by 35-50% (e.g., ...). Figure 8 (As shown). Coomassie Brilliant Blue (CBB) staining was used to verify the consistency of sample loading. Image J was used to calculate gray values, and Student's t-test was used for statistical analysis of the data.
[0108] 3. Virus titer detection
[0109] qRT-PCR was performed using primers CYVCV CP-RT-F (SEQ ID NO: 17) and CYVCV CP-RT-R (SEQ ID NO: 18) to verify the titer content of citrus yellowing vein virus. Identification showed that the citrus yellowing vein virus content was reduced by 22-34% (e.g., ...). Figure 9 (As shown).
[0110] The nucleotide sequence of primer CYVCV CP-RT-F is SEQ ID NO: 17:
[0111] TCCAACTCACAAACCCAGCG
[0112] The nucleotide sequence of primer CYVCV CP-RT-R is SEQ ID NO: 18:
[0113] ATGGGCTCTTGGTTTTCCTT
[0114] Therefore, interference with the ClPsaN gene can significantly reduce the accumulation of citrus yellow vein virus and alleviate the severity of citrus yellow vein disease. This gene can be used independently for molecular breeding of disease resistance, or it can be used in conjunction with other disease resistance or susceptibility genes for molecular breeding of citrus resistance to citrus yellow vein disease.
[0115] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A method for improving resistance to citrus yellow vein disease using the ClPsaN gene, characterized in that, By using VIGS gene silencing technology to downregulate the expression level of the ClPsaN gene in citrus, the resistance of citrus to citrus yellow vein disease can be improved. The nucleotide sequence of the ClPsaN gene is shown in SEQ ID NO:
1.
2. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 1, characterized in that, Specifically, the following steps are included: (1) Cloning the VIGS fragment of the citrus ClPsaN gene; (2) Construct two VIGS expression vectors, TRV and CLBV; (3) The VIGS expression vector was transformed into citrus to obtain VIGS plants in which the citrus ClPsaN gene was silenced.
3. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 2, characterized in that, In step (1), the cloning method of the VIGS fragment of the citrus ClPsaN gene is as follows: extract total RNA from citrus, then reverse transcribe it into cDNA, and finally amplify it by high-fidelity enzyme PCR to obtain the VIGS fragment of the citrus ClPsaN gene.
4. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 3, characterized in that, The nucleotide sequence of the VIGS fragment of the citrus ClPsaN gene is shown in SEQ ID NO:
2.
5. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 3, characterized in that, In step (1), the primers used for PCR amplification are ClPsaN-TRV-F, ClPsaN-TRV-R and ClPsaN-CLBV-F, ClPsaN-CLBV-R, and their nucleotide sequences are shown as SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6, respectively.
6. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 3, characterized in that, In step (2), the VIGS expression vector is constructed by: combining the VIGS fragment of the citrus ClPsaN gene obtained in step (1) with ...2). Eco RӀ and Bam TRV2 vector digested with HӀ enzyme, via Sma The CLBV vector digested by the enzyme Ӏ was ligated and transformed into competent E. coli cells, and the plasmid was extracted to obtain the VIGS expression vector of the ClPsaN gene.
7. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 3, characterized in that, In step (3), the method for transforming citrus with the VIGS expression vector is as follows: the VIGS expression vector obtained in step (2) is transformed into Agrobacterium, Agrobacterium bacterial solution containing the VIGS expression vector is prepared, and sterile citrus seedlings are infected to obtain VIGS plants in which the citrus ClPsaN gene is silenced.
8. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 7, characterized in that, It also includes PCR verification of VIGS plants, using primers TRV2-ClPsaN detection-F and TRV2-ClPsaN detection-R, CLBV-ClPsaN detection-F and CLBV-ClPsaN detection-R, whose nucleotide sequences are shown in SEQ ID No: 9 and SEQ ID No: 10, SEQ ID No: 13 and SEQ ID No: 14, respectively.
Citation Information
Patent Citations
Virus-induced gene silencing vector, application thereof and citrus disease prevention and control method
CN114317598A
Application of tomato SlCab12 gene in enhancing disease resistance to tomato chlorosis virus
CN116024230A