AAV vectors targeted to central nervous system

Abstract

To provide chimeric AAV capsids targeted to the central nervous system, virus vectors comprising the same, and methods of using the vectors to target the central nervous system.SOLUTION: The present invention relates to the provision of AAV capsids having a specific sequence, chimeric AAV capsids targeted to oligodendrocytes, virus vectors comprising the same, and methods of using the vectors to target oligodendrocytes.SELECTED DRAWING: None

Description

[Technical field]

[0001] [Priority statement] This application claims the benefit of U.S. Provisional Application No. 62 / 082,897, filed November 21, 2014, and U.S. Provisional Application No. 62 / 218,857, filed September 15, 2015, the entire contents of each of which are incorporated herein by reference.

[0002] [Field of the Invention] The present invention relates to chimeric AAV capsids targeted to the central nervous system, viral vectors comprising the same, and methods of using the vectors for targeting the central nervous system.The present invention further relates to chimeric AAV capsids targeted to oligodendrocytes, viral vectors comprising the same, and methods of using the vectors for targeting oligodendrocytes. [Background technology]

[0003] Adeno-associated virus (AAV) was first reported to efficiently transduce muscle over a decade ago (Xiao et al., (1996) J. Virol. 70:8098-8108). The recombinant AAV (rAAV) genome, consisting of a foreign expression cassette and AAV inverted terminal repeat (ITR) sequences, exists within eukaryotic cells in an episomal form that is responsible for persistent transgene expression (Schnepp et al., (2003) J. Virol. 77:3495-3504). AAV vectors have a good safety profile. No human diseases have been associated with wild-type AAV infection, and low toxicity is observed in human subjects after transduction with rAAV (Manno et al., (2003) Blood 101:2963-2972). Summary of the Invention [Problem to be solved by the invention]

[0004] AAV vectors have been used in clinical trials for central nervous system (CNS) disorders. Although some success has been achieved, the naturally occurring AAV capsid lacks specificity for the CNS and is unsuitable for certain disease applications. Recent advances in AAV technology and directed evolution have expanded the ability to develop novel AAV serotypes, including vectors with altered tropism (Gray et al., (2010) Mol. Ther. 18:570-578). However, no AAV vectors exist that allow widespread CNS gene transfer with minimal tropism for peripheral organs.

[0005] In the brain, the majority of AAV vectors show predominant selectivity for neurons with very low efficacy with respect to other cell types such as oligodendrocytes, and no AAV vectors have been developed that efficiently target oligodendrocytes. [Means for solving the problem]

[0006] The present invention is based in part on the development of chimeric AAV capsid sequences that have minimal tropism for peripheral organs and can achieve widespread CNS gene transfer after delivery to the CNS.The present invention further relates to chimeric AAV capsids that have high transduction capacity in subjects with Rett syndrome.The chimeric capsids can be used to create AAV vectors for use in research or therapeutic applications where widespread CNS gene transfer is desired without widespread vector biodistribution to peripheral organs.

[0007] The present invention is further based in part on the development of chimeric AAV capsid sequences that allow oligodendrocyte-selective or specific gene transfer after delivery to the CNS with minimal tropism for peripheral organs. The chimeric capsids can be used to generate AAV vectors for use in research or therapeutic applications where oligodendrocyte gene transfer is desired without widespread vector biodistribution to neurons or peripheral organs.

[0008] Accordingly, one aspect of the present invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising an AAV capsid coding sequence that is at least 70% identical to: (a) the nucleotide sequence of any one of SEQ ID NOs: 1-43; or (b) the nucleotide sequence encoding any one of SEQ ID NOs: 44-86, as well as to viral particles and cells comprising the nucleic acid.

[0009] Accordingly, one aspect of the present invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising an AAV capsid coding sequence that is at least 70% identical to: (a) the nucleotide sequence of any one of SEQ ID NOs: 87-107; or (b) the nucleotide sequence encoding any one of SEQ ID NOs: 108-128, as well as to viral particles and cells comprising the nucleic acid.

[0010] Another aspect of the present invention relates to an AAV capsid comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 44 to 86, and an AAV particle comprising the AAV capsid and an AAV vector genome of the present invention.

[0011] Another aspect of the present invention relates to an AAV capsid comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 108-128, and an AAV particle comprising the AAV capsid and an AAV vector genome of the present invention.

[0012] A further aspect of the invention relates to a method for producing recombinant AAV particles comprising an AAV capsid, the method comprising: providing to a cell in vitro a nucleic acid of the invention, an AAV rep coding sequence, an AAV vector genome comprising a heterologous nucleic acid, and helper functions to produce a productive AAV infection; and allowing assembly of recombinant AAV particles comprising the AAV capsid and encapsidating the AAV vector genome.

[0013] A further aspect of the invention relates to a pharmaceutical formulation comprising a nucleic acid, viral particle, AAV capsid, or AAV particle of the invention in a pharma- ceutically acceptable carrier.

[0014] Another aspect of the invention relates to a method of delivering a nucleic acid of interest to a CNS cell, the method comprising the step of contacting the cell with an AAV particle of the invention.

[0015] A further aspect of the invention relates to a method for delivering a nucleic acid of interest to a CNS cell in a mammalian subject, the method comprising the step of administering to the mammalian subject an effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0016] A further aspect of the invention relates to a method for delivering a nucleic acid of interest to a region of the CNS adjacent to a compromised blood-brain barrier region in a mammalian subject, the method comprising the step of intravenously administering to the mammalian subject an effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0017] Another aspect of the invention relates to a method for treating a disorder associated with CNS dysfunction in a mammalian subject in need thereof, said method comprising the step of administering to the mammalian subject a therapeutically effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0018] Another aspect of the invention relates to a method of treating Rett syndrome in a mammalian subject in need thereof, the method comprising the step of administering to the mammalian subject a therapeutically effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0019] A further aspect of the invention relates to a method for preparing an AAV capsid with a desired tropism profile, the method comprising the step of modifying an AAV capsid of the invention to insert an amino acid sequence that confers the desired tropism profile.

[0020] One aspect of the present invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising: (a) the nucleotide sequence of any one of SEQ ID NO: 129; or (b) an AAV capsid coding sequence that is at least 70% identical to a nucleotide sequence encoding any one of SEQ ID NOs: 130-132, as well as to viral particles and cells comprising the nucleic acid.

[0021] Another aspect of the present invention relates to an AAV capsid comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 130-132, and an AAV particle comprising the AAV capsid and an AAV vector genome of the present invention.

[0022] Another aspect of the invention relates to a method of delivering a nucleic acid of interest to an oligodendrocyte, the method comprising the step of contacting the cell with an AAV particle of the invention.

[0023] A further aspect of the invention relates to a method for delivering a nucleic acid of interest to oligodendrocytes in a mammalian subject, the method comprising the step of administering to the mammalian subject an effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0024] Another aspect of the invention relates to a method for treating a disorder associated with oligodendrocyte dysfunction in a mammalian subject in need thereof, the method comprising the step of administering to the mammalian subject a therapeutically effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0025] Further aspects of the invention relate to nucleic acids encoding AAV8 capsids containing the E532K substitution, as well as viral particles and cells comprising said nucleic acids.

[0026] Another aspect of the invention relates to AAV8 capsids that include an E532K substitution, as well as AAV particles that include the AAV capsids and AAV vector genomes of the invention.

[0027] Another aspect of the invention relates to a method of delivering a nucleic acid of interest to an oligodendrocyte, the method comprising the step of contacting the cell with an AAV particle of the invention.

[0028] A further aspect of the invention relates to a method for delivering a nucleic acid of interest to oligodendrocytes in a mammalian subject, the method comprising the step of administering to the mammalian subject an effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0029] Another aspect of the invention relates to a method for treating a disorder associated with oligodendrocyte dysfunction in a mammalian subject in need thereof, the method comprising the step of administering to the mammalian subject a therapeutically effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0030] These and other aspects of the invention are set forth in greater detail in the following description of the invention. [Brief description of the drawings]

[0031] [Figure 1] 1 shows the chimeric structure of an AAV capsid clone isolated from the spinal cord of a wild-type mouse. [Diagram 2] 1 shows the chimeric structure of an AAV capsid clone isolated from wild-type mouse brain. [Diagram 3] 1 shows the chimeric structure of an AAV capsid clone isolated from a Rett syndrome mouse. [Figure 4A-4E] The tropism of the isolated clones is shown. [Diagram 5] The tropism of the isolated clones is shown. [Figure 6] The tropism of the isolated clones is shown. [Figure 7] The transduction efficiency of isolated clones is shown. [Figure 8] MeCP2 tropism of isolated clones is shown. [Figure 9] NeuN tropism of the isolated clones is shown. [Figure 10A-10E]We show that Olig001 has oligodendrocyte-selective tropism. (A) Diagram of the cap gene from Olig001 compared to AAV8. Different colors represent the different AAV parental serotypes (blue=AAV2, purple=AAV8, red=AAV9, yellow=AAV1, and orange=AAV6) present in the library input reaction. Black vertical bars indicate point mutations. (B) Olig001 transduction of cells in the rat striatum exhibiting characteristics suggestive of oligodendrocytes, including localization of GFP-positive myelin within patches of striatal / matrix. (C) Confocal images at higher magnification of transduced cells, again reflecting the distinctive morphology of CNS oligodendrocytes. (D) Confocal images reveal a lack of colocalization of GFAP (red)-labeled astrocytes with GFP-positive cells within the striatum. (E) Confocal images show that the majority of Olig001-transduced cells in the striatum do not colocalize with the neuronal marker, NeuN (red); however, the arrow in indicates a single GFP / NeuN-positive cell. [Figure 11] Olig001 is shown to be detargeted from peripheral tissues compared to AAV8. Adult female C57Bl / 6 mice received 5x1010 vg (~2.5x1012 vg / kg body weight) of either Olig001-CBh-GFP (white bars; n=4) or AAV8-CBh-GFP (gray bars; n=5) intravenously. Ten days later, organ distribution of GFP genomes per diploid mouse genome (LaminB2) was determined by qPCR. Error bars indicate standard error of the mean. [Figures 12A-12G]AAV8 with E532K mutation shows to be oligotropic. (A) Diagram of cap gene from Olig001 compared to AAV8 / E532K. Different colors represent different AAV parental serotypes (blue=AAV2, purple=AAV8, red=AAV9, yellow=AAV1, and orange=AAV6). Black vertical bars indicate point mutations. AAV8 / E532K was packaged with CBh-GFP and 2×108 vg was injected intracranially into the striatum of wild-type male Sprague-Dawley rats. Two weeks after injection, rats were perfused transcardially and their brains were fixed and sectioned coronally. (B-D) Confocal images of the striatum show that GFP-positive cells lack colocalization with neuronal (NeuN) marker. (EG) Confocal images of the striatum show that GFP-positive cells lack colocalization and astrocytic (GFAP) markers. [Figures 13A-13G] We show that Olig001 oligodendrocyte-selective tropism is independent of the VP3 sequence. (A) Diagram of the cap gene from Olig001 compared to Olig001 / AAV VP3. Different colors represent different AAV parental serotypes (blue=AAV2, purple=AAV8, red=AAV9, yellow=AAV1, and orange=AAV6). Black vertical bars indicate point mutations. Mutant Olig001 carrying the VP3 of AAV8 (Olig001 / AAV8 VP3) was packaged with CBh-GFP at a titer of 2×108 vg / μl and injected intracranially into the striatum of wild-type male Sprague-Dawley rats. Two weeks later, the rats were perfused transcardially and their brains were fixed and cut coronally. (B-D) Confocal images of the striatum show that GFP-positive cells exhibit striatal oligodendrocyte morphology and lack colocalization with neuronal (NeuN) markers. (E-G) Confocal images of the striatum show that GFP-positive cells exhibit striatal oligodendrocyte morphology and lack colocalization and astrocytic (GFAP) markers. [Figure 14A-14B]Showing that in vitro binding analysis is consistent with in vivo tropism. In vitro mixed glial cultures were generated by isolating neonatal day 3 mouse brains. Cultures were incubated with equivalent amounts of either AAV8-CBh-GFP or Olig001-CBh-GFP for 1 h at 4°C to allow vector binding but not uptake. (A) The amount of vector bound to cells was quantified by qPCR for GFP and normalized to mouse genomic LaminB2. Error bars indicate standard error of the mean, * indicates significant difference at P<0.03, ** indicates significant difference at P<0.01. (B) Fold differences were determined using the average binding for each virus compared to AAV8. [Figure 15] A summary of findings is shown. Diagram of the cap gene used in this study with in vivo dominant tropism when injected into adult rat striatum and fold in vitro binding to AAV8. Different colors represent different AAV parental serotypes (blue=AAV2, purple=AAV8, red=AAV9, yellow=AAV1, and orange=AAV6). Black bars indicate point mutations. ND=not determined, *data not shown. [Figure 16] Mutants derived from Olig001 show detargeting from peripheral tissues compared to AAV8 (see also FIG. 11). Adult female C57Bl / 6 mice received intravenous injections of 5×1010 vg (~2.5×1012 vg / kg body weight) of either Olig001 or one of its mutant derivatives described above packaging the scCBh-GFP genome. Ten days later, the organ distribution of GFP genomes per diploid mouse genome (LaminB2) was determined by qPCR. Error bars indicate standard error of the mean. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] The present invention is based in part on the development of chimeric AAV capsid sequences that have minimal tropism for peripheral organs and can achieve widespread CNS gene transfer after delivery to the CNS.The present invention further relates to chimeric AAV capsids that have high transduction capacity in subjects with Rett syndrome.The chimeric capsids can be used to create AAV vectors for use in research or therapeutic applications where widespread CNS gene transfer is desired without widespread vector biodistribution to peripheral organs.

[0033] The present invention is further based in part on the development of chimeric AAV capsid sequences that are capable of oligodendrocyte-selective or specific gene transfer following delivery to the CNS with minimal tropism for peripheral organs. The chimeric capsids can be used to generate AAV vectors for use in research or therapeutic applications where oligodendrocyte gene transfer is desired without widespread vector biodistribution to neurons or peripheral organs.

[0034] The present invention will be described in more detail below. This description is not intended to be a detailed list of all the different ways in which the present invention can be implemented or all the features that can be added to the present invention. For example, features described with respect to one embodiment can be incorporated into other embodiments, and features described with respect to a particular embodiment can be removed from that embodiment. In addition, numerous modifications and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of this disclosure without departing from the present invention. Therefore, the following specification is intended to describe some specific embodiments of the present invention, and is not intended to exhaustively specify all of the permutations, combinations, and modifications thereof.

[0035] Unless the context dictates otherwise, it is expressly intended that the various features of the invention described herein can be used in any combination. Furthermore, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a composite comprises components A, B, and C, it is expressly intended that any or any combination of A, B, or C, alone or in any combination, can be omitted and eliminated.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. The terminology used in the description of the present invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the present invention.

[0037] Nucleotide sequences are provided herein only as a single strand in a left-to-right 5' to 3' orientation unless otherwise indicated. Nucleotides and amino acids are designated herein in the format recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the single-letter code or the three-letter code, both in accordance with 37 CFR § 1.822 and established usage.

[0038] Unless otherwise indicated, standard methods known to those of skill in the art can be used to produce recombinant and synthetic polypeptides, antibodies or antigen-binding fragments thereof, manipulate nucleic acid sequences, produce transformed cells, construct rAAV constructs, modified capsid proteins, packaging vectors expressing AAV rep and / or cap sequences, and transiently and stably transfected packaging cells. Such techniques are known to those of skill in the art. See, for example, SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, NY, 1989); FMAUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

[0039] All publications, patent applications, patents, nucleotide sequences, amino acid sequences, and other references mentioned herein are incorporated by reference in their entirety.

[0040] I. definition All amino acid position designations within the AAV capsid subunits in the present description and the accompanying claims refer to the numbering of the VP1 capsid subunit.

[0041] As used in the description of this invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise.

[0042] As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the absence of combinations when interpreted in the alternative ("or").

[0043] Furthermore, the present invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted.

[0044] Additionally, the term "about" as used herein when referring to measurable values, such as, for example, amounts, dosages, times, temperatures, etc. of compounds or agents of the invention, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the stated amount.

[0045] The term "consisting essentially of" as used herein in the context of a nucleic acid, protein or capsid structure means that the nucleic acid, protein or capsid structure does not contain any elements other than the recited element(s) that significantly (e.g., by more than about 1%, 5% or 10%) alter the intended function of the nucleic acid, protein or capsid structure, e.g., the protein or capsid, or the tropism profile of the protein or capsid encoded by the nucleic acid.

[0046] The term "adeno-associated virus" (AAV) in the context of the present invention includes, but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV, and any other AAV now known or later discovered. See, for example, BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). Many additional AAV serotypes and clades have been identified (see, for example, Gao et al., (2004) J. Virol. 78:6381-6388 and Table 1), which are also encompassed by the term "AAV".

[0047] The genomic sequences of various AAV and autonomous parvoviruses, as well as the sequences of the ITRs, Rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in public databases such as the GenBank® database. For example, GenBank® Accession Numbers NC 002077, NC 001401, NC 001729, NC 001863, NC 001829, NC 001862, NC 000883, NC 001701, NC 001510, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC 001358, NC See, 001540, AF513851, AF513852, AY530579, AY631965, AY631966; the disclosures of which are incorporated herein in their entireties. For example, Srivistava et al.,(1983)J.Virol.45:555;Chiorini et al., (1998)J.Virol.71:6823;Chiorini et al.,(1999)J.Virol.73:1309;Bantel-Schaal et al.,(1999)J.Virol.73:939;Xiao et al. al.,(1999)J.Virol.73:3994;Muramatsu et al.,(1996)Virology 221:208;Shade et al.,(1986)J.Virol.58:921;Gao et al.,(2002)Proc.Nat.Acad.Sci.USA 99:11854;International Patent Publication WO 00 / 28061, W.O. No. 6,156,303, the disclosures of which are incorporated herein in their entireties. See also Table 1.An early description of the AAV1, AAV2 and AAV3 long terminal repeat sequences is provided by Xiao, X., (1996) "Characterization of Adeno-associated virus (AAV) DNA replication and integration," Ph. D. Dissertation, University of Pittsburgh, Pittsburgh, PA, which is incorporated herein by reference in its entirety.

[0048] [Table 1] JPEG2025072468000002.jpg209166JPEG2025072468000003.jpg117166

[0049] A "chimeric" AAV nucleic acid capsid coding sequence or AAV capsid protein combines portions of two or more capsid sequences. A "chimeric" AAV virion or particle contains a chimeric AAV capsid protein.

[0050] The term "tropism" as used herein refers to the selective entry of a virus into a particular cell or tissue type(s) and / or a selective interaction with the cell surface that facilitates the entry into a particular cell or tissue type, optionally and preferably followed by the expression (e.g., transcription and optionally translation) of sequences carried by the viral genome in the cell, e.g., for recombinant viruses, expression of a heterologous nucleotide sequence(s). Those skilled in the art will understand that transcription of a heterologous nucleic acid sequence from a viral genome cannot be initiated in the absence of a trans-acting factor, e.g., for an inducible promoter or otherwise regulated nucleic acid sequence. In the case of a rAAV genome, gene expression from the viral genome can be from a stably integrated provirus and / or from a non-integrated episome, as well as any other form that viral nucleic acid can take in a cell.

[0051] The term "tropism profile" refers to the pattern of transduction of one or more target cells, tissues and / or organs. Representative examples of chimeric AAV capsids have a tropism profile characterized by efficient transduction of cells of the CNS and only minor transduction of peripheral organs.

[0052] As used herein, the term "specific for CNS cells" refers to a viral vector that, when administered directly to the CNS, selectively transduces all cell types within the CNS, with minimal transduction of cells outside the CNS. In some embodiments, at least about 80% of the transduced cells are CNS cells, e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, 99% or more are CNS cells.

[0053] As used herein, the term "disorders associated with CNS dysfunction" refers to diseases, disorders, or injuries in which CNS cells are damaged, lost, or function improperly. The term includes diseases, disorders, and injuries in which CNS cells are directly affected, as well as diseases, disorders, and injuries in which CNS cells become dysfunctional secondary to injury to other cells (e.g., myocardial infarction or stroke).

[0054] As used herein, the term "oligodendrocyte-specific" refers to a viral vector that, when administered directly to the CNS, selectively transduces oligodendrocytes over neurons, astrocytes, and other CNS cell types. In some embodiments, at least about 80% of the transduced cells are oligodendrocytes, e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, 99% or more are oligodendrocytes.

[0055] As used herein, the term "disorder associated with oligodendrocyte dysfunction" refers to a disease, disorder, or injury in which oligodendrocytes are damaged, lost, or function improperly. The term includes diseases, disorders, and injuries in which oligodendrocytes are directly affected, as well as diseases, disorders, and injuries in which oligodendrocytes become dysfunctional secondary to injury to other cells (e.g., spinal cord injury).

[0056] As used herein, the term "adjacent to a region of compromised blood-brain barrier" refers to CNS cells adjacent to a portion of the blood-brain barrier where barrier function is compromised.

[0057] As used herein, "transduction" of a cell by a viral vector (e.g., an AAV vector) refers to entry of the vector into the cell and transfer of genetic material into the cell by incorporation of nucleic acid into the viral vector and subsequent transfer into the cell via the viral vector.

[0058] Unless otherwise indicated, "efficient transduction" or "efficient tropism" or similar terms can be determined by reference to appropriate positive or negative controls (e.g., at least about 50%, 60%, 70%, 80%, 85%, 90%, 95% or more of the transduction or tropism, respectively, of a positive control, or at least about 110%, 120%, 150%, 200%, 300%, 500%, 1000% or more of the transduction or tropism, respectively, of a negative control).

[0059] Similarly, whether a virus "does not transduce efficiently" or "does not have efficient tropism" for a target tissue, or similar terms, can be determined by reference to an appropriate control. In certain embodiments, a viral vector does not efficiently transduce (i.e., does not have efficient tropism) for tissues outside the CNS, such as the liver, kidney, gonads and / or germ cells. In certain embodiments, undesired transduction of tissue(s) (e.g., liver) is 20% or less, 10% or less, 5% or less, 1% or less, 0.1% or less of the level of transduction of desired target tissue(s) (e.g., CNS cells).

[0060] The term "polypeptide" as used herein, unless otherwise indicated, encompasses both peptides and proteins.

[0061] A "nucleic acid" or "nucleotide sequence" is a sequence of nucleotide bases, which may be an RNA, DNA or DNA-RNA hybrid sequence (containing both naturally occurring and non-naturally occurring nucleotides), but is preferably either a single- or double-stranded DNA sequence.

[0062] As used herein, an "isolated" nucleic acid or nucleotide sequence (e.g., "isolated DNA" or "isolated RNA") means a nucleic acid or nucleotide sequence that is separated or substantially free from at least some other components of the organism or virus in which it naturally originates, e.g., cellular or viral structural components, or other polypeptides or nucleic acids that are typically found in association with the nucleic acid or nucleotide sequence.

[0063] Similarly, an "isolated" polypeptide means a polypeptide that is separated or substantially free from at least some other components of the organism or virus in which it naturally originates, e.g., cellular or viral structural components, or other polypeptides or nucleic acids that are typically found in association with the polypeptide.

[0064] By the terms "treat," "treating," or "treatment of" (or grammatical equivalents) it is meant that the severity of the subject's condition is reduced or at least partially ameliorated or improved, and / or some relief, alleviation, or reduction of at least one clinical symptom is achieved, and / or there is a slowing of the progression of the condition and / or prevention or delay of the onset of a disease or disorder.

[0065] As used herein, the terms "prevent," "prevents," or "prevention" (and their grammatical equivalents) refer to delaying the onset of a disease or disorder, or reducing symptoms at the onset of a disease or disorder. The term is not meant to imply complete abolition of the disease, but encompasses any type of prophylactic treatment that reduces the incidence of symptoms or delays the onset and / or progression of symptoms.

[0066] As used herein, "effective" or "therapeutically effective" amount is an amount sufficient to provide some improvement or benefit to the subject.In other words, "effective" or "therapeutically effective" amount is an amount that provides some relief, alleviation or reduction of at least one clinical symptom in the subject.Those skilled in the art understand that therapeutic effect does not need to be complete or curative, as long as some benefit is provided to the subject.

[0067] A "heterologous nucleotide sequence" or "heterologous nucleic acid" is a sequence that does not naturally occur in the virus. Generally, a heterologous nucleic acid or nucleotide sequence comprises an open reading frame that encodes a polypeptide and / or a non-translated RNA.

[0068] A "therapeutic polypeptide" can be a polypeptide that can alleviate or reduce symptoms resulting from the absence or deficiency of a protein in a cell or subject. In addition, a "therapeutic polypeptide" can be a polypeptide that otherwise confers a benefit to the subject, for example, an anti-cancer effect or improved transplant survival.

[0069] As used herein, the terms "vector", "viral vector", "delivery vector" (and similar terms) generally refer to a viral particle that contains viral nucleic acid (i.e., vector genome) packaged within a virion, which functions as a nucleic acid delivery vehicle. A viral vector according to the present invention comprises a chimeric AAV capsid according to the present invention and can package an AAV or rAAV genome or any other nucleic acid, including viral nucleic acid. Alternatively, in some contexts, the terms "vector", "viral vector", "delivery vector" (and similar terms) may be used to refer to a vector genome (e.g., vDNA) in the absence of a virion, and / or a viral capsid that acts as a transporter to deliver a molecule tethered or packaged within the capsid.

[0070] A "recombinant AAV vector genome" or "rAAV genome" is an AAV genome (i.e., vDNA) that contains at least one inverted terminal repeat (e.g., one, two, or three inverted terminal repeats) and one or more heterologous nucleotide sequences. rAAV vectors generally carry a 145-base terminal repeat(s) (TR(s)) in cis to produce virus, although modified AAV TRs and non-AAV TRs containing partially or completely synthetic sequences can also serve this purpose. All other viral sequences are unnecessary and can be provided in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). rAAV vectors optionally contain two TRs (e.g., AAV TRs), which are generally at the 5' and 3' ends of the heterologous nucleotide sequence(s), but need not be contiguous thereto. The TRs can be identical or different to each other. The vector genome may also contain a single ITR at its 3' or 5' end.

[0071] The term "terminal repeat" or "TR" includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates a desired function such as replication, viral packaging, integration, and / or proviral rescue). The TR may be an AAV TR or a non-AAV TR. For example, non-AAV TR sequences such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19), or the SV40 hairpin acting as an SV40 origin of replication, can be used as a TR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition. Additionally, the TR may be partially or completely synthetic, such as the "double-D sequence" described in U.S. Pat. No. 5,478,745 (Samulski et al.).

[0072] An "AAV terminal repeat" or "AAV TR" may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, or any other AAV now known or later discovered (see, e.g., Table 1). AAV terminal repeats need not have the native terminal repeat sequence (e.g., the native AAV TR sequence may be altered by insertions, deletions, truncations, and / or missense mutations), so long as the terminal repeats mediate the desired function, such as replication, viral packaging, integration, and / or proviral rescue.

[0073] The terms "rAAV particle" and "rAAV virion" are used interchangeably herein. A "rAAV particle" or "rAAV virion" comprises a rAAV vector genome packaged within an AAV capsid.

[0074] AAV capsid structure is described in detail by BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0075] By "substantially retaining" a characteristic, it is meant that at least about 75%, 85%, 90%, 95%, 97%, 98%, 99% or 100% of the characteristic (e.g., activity or other measurable characteristic) is retained.

[0076] II. CNS-targeted chimeric AAV capsids The present inventors have identified a chimeric AAV capsid structure capable of providing broad CNS gene transfer with minimal tropism for peripheral organs. Accordingly, one aspect of the present invention relates to a chimeric AAV capsid structure capable of providing CNS gene transfer in a subject, e.g., a wild-type subject, e.g., a subject without a CNS disorder. In a particular embodiment, the present invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising, consisting essentially of, or consisting of (a) a nucleotide sequence of any one of SEQ ID NOs: 1-43; or (b) an AAV capsid coding sequence that is at least 70% identical to a nucleotide sequence encoding any one of SEQ ID NOs: 44-86; and a virus comprising the chimeric AAV capsid. In some embodiments, the AAV capsid coding sequence is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of (a) or (b). In other embodiments, the AAV capsid coding sequence comprises, consists essentially of, or consists of the nucleotide sequence of (a) or (b).

[0077] In certain embodiments, the invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising, consisting essentially of, or consisting of a VP1, VP2, or VP1 / VP2-encoding portion of an AAV capsid coding sequence that is at least 70% identical to (a) a nucleotide sequence of any one of SEQ ID NOs:1-43; or (b) a nucleotide sequence encoding any one of SEQ ID NOs:44-86; operably linked to a VP3-encoding portion of a different AAV capsid coding sequence; and to a virus comprising the chimeric AAV capsid. In some embodiments, the VP1, VP2, or VP1 / VP2 encoding portion of the AAV capsid coding sequence is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the VP1, VP2, or VP1 / VP2 encoding portion of the nucleotide sequence of (a) or (b). In other embodiments, the VP1, VP2, or VP1 / VP2 encoding portion of the AAV capsid coding sequence comprises, consists essentially of, or consists of the VP1, VP2, or VP1 / VP2 encoding portion of the nucleotide sequence of (a) or (b). In some embodiments, the VP3-encoding portion of the different AAV capsid coding sequence is a chimeric sequence that differs from a wild-type capsid sequence (eg, AAV8 or AAV9) or any capsid sequence of the invention.

[0078] Another aspect of the invention relates to chimeric AAV capsid structures capable of providing CNS gene transfer in subjects with CNS disorders, such as neurodevelopmental disorders, particularly Rett syndrome, a disorder resulting from a mutation in the gene encoding methylcytosine-binding protein 2 (MECP2). In certain embodiments, the invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising, consisting essentially of, or consisting of an AAV capsid coding sequence that is at least 70% identical to (a) the nucleotide sequence of any one of SEQ ID NOs: 87-107; or (b) the nucleotide sequence encoding any one of SEQ ID NOs: 108-128; and to a virus comprising the chimeric AAV capsid. In some embodiments, the AAV capsid coding sequence is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of (a) or (b). In other embodiments, the AAV capsid coding sequence comprises, consists essentially of, or consists of the nucleotide sequence of (a) or (b).

[0079] In certain embodiments, the invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising, consisting essentially of, or consisting of a VP1, VP2, or VP1 / VP2-encoding portion of an AAV capsid coding sequence that is at least 70% identical to (a) a nucleotide sequence of any one of SEQ ID NOs: 87-107; or (b) a nucleotide sequence encoding any one of SEQ ID NOs: 108-128; operably linked to a VP3-encoding portion of a different AAV capsid coding sequence; and to a virus comprising the chimeric AAV capsid. In some embodiments, the VP1, VP2, or VP1 / VP2 encoding portion of the AAV capsid coding sequence is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the VP1, VP2, or VP1 / VP2 encoding portion of the nucleotide sequence of (a) or (b). In other embodiments, the VP1, VP2, or VP1 / VP2 encoding portion of the AAV capsid coding sequence comprises, consists essentially of, or consists of the VP1, VP2, or VP1 / VP2 encoding portion of the nucleotide sequence of (a) or (b). In some embodiments, the VP3-encoding portion of the different AAV capsid coding sequence is a chimeric sequence that differs from a wild-type capsid sequence (eg, AAV8 or AAV9) or any capsid sequence of the invention.

[0080] SEQ ID NOs: 44-86 and 108-128 show VP1 capsid protein sequences. All amino acid position designations in the present description and the appended claims refer to VP1 numbering. Those skilled in the art will appreciate that AAV capsids generally include smaller VP2 and VP3 capsid proteins as well. Due to overlapping coding sequences for AAV capsid proteins, the nucleic acid coding sequences and amino acid sequences of VP2 and VP3 capsid proteins are apparent from the VP1 sequence shown in the disclosed sequences. Specifically, VP2 begins at nucleotide 412 (acg) of SEQ ID NO:1 and threonine 138 of SEQ ID NO:44. VP3 begins at nucleotide 607 (atg) of SEQ ID NO:1 and methionine 203 of SEQ ID NO:44. In certain embodiments, isolated VP2 and VP3 capsid proteins comprising sequences from SEQ ID NO:44, and isolated nucleic acids encoding VP2 or VP3 proteins or both, are contemplated.

[0081] The present invention also provides chimeric AAV capsid proteins and chimeric capsids, wherein the capsid proteins comprise, consist essentially of, or consist of the amino acid sequence set forth in SEQ ID NOs: 44-86 and 108-128, where 1, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 12 or less, 15 or less, 20 or less, 25 or less, 30 or less, 40 or less, or 50 or less of the amino acids within the capsid protein coding sequence of SEQ ID NOs: 44-86 and 108-128 are replaced by another amino acid (naturally occurring, modified and / or synthetic), where In some embodiments, the capsid protein is replaced by conservative amino acid substitutions and / or deleted, and / or inserted (including N- and C-terminal extensions) of 1, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 12 or less, 15 or less, 20 or less, 25 or less, 30 or less, 40 or less, or 50 or less amino acids, or any combination of substitutions, deletions, and / or insertions, where the substitutions, deletions, and / or insertions do not unduly impair the structure and / or function of the mutant capsid protein or virion (e.g., AAV virion) comprising the capsid. For example, in representative embodiments of the invention, an AAV virion comprising a chimeric capsid protein substantially retains at least one characteristic of a chimeric virion comprising a chimeric capsid protein set forth in SEQ ID NOs: 44-86 and 108-128. For example, virions containing the chimeric capsid proteins can substantially retain the CNS tropism profile of virions containing the chimeric AAV capsid proteins set forth in SEQ ID NOs: 44-86 and 108-128. Methods for assessing biological attributes such as viral transduction are well known in the art (see, e.g., the Examples).

[0082] Conservative amino acid substitutions are known in the art. In certain embodiments, conservative amino acid substitutions include substitutions in one or more of the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and / or phenylalanine, tyrosine.

[0083] It will be apparent to those skilled in the art that the amino acid sequences of the chimeric AAV capsid proteins of SEQ ID NOs: 44-86 and 108-128 can be further modified to incorporate other modifications known in the art to confer desired characteristics. As a non-limiting possibility, the capsid protein can be modified to incorporate targeting sequences (e.g., RGD) or sequences that facilitate purification and / or detection. For example, the capsid protein can be fused to all or part of glutathione-S-transferase, maltose-binding protein, heparin / heparan sulfate binding domain, poly-His, ligand, and / or reporter protein (e.g., green fluorescent protein, β-glucuronidase, β-galactosidase, luciferase, etc.), immunoglobulin Fc fragment, single chain antibody, hemagglutinin, c-myc, FLAG epitope, etc., to form a fusion protein. Methods for inserting targeting peptides into the AAV capsid are known in the art (see, e.g., International Patent Publication WO 00 / 28004; Nicklin et al., (2001) Mol. Ther. 474-181; White et al., (2004) Circulation 109:513-319; Muller et al., (2003) Nature Biotech. 21:1040-1046).

[0084] The viruses of the present invention may further comprise a double-stranded viral genome as described in International Patent Publication WO 01 / 92551 and US Pat. No. 7,465,583.

[0085] The present invention also provides AAV capsids comprising the chimeric AAV capsid proteins of the present invention and viral particles (i.e., virions) comprising the same, where the viral particles package (i.e., encapsidate) a vector genome, optionally an AAV vector genome. In certain embodiments, the present invention provides AAV particles comprising AAV capsids comprising the AAV capsid proteins of the present invention, where the AAV capsid packages an AAV vector genome. The present invention also provides AAV particles comprising AAV capsid proteins or AAV capsids encoded by the chimeric nucleic acid capsid coding sequences of the present invention.

[0086] In certain embodiments, the virion is a recombinant vector that contains a heterologous nucleic acid of interest, e.g., for delivery to a cell. Thus, the present invention is useful for delivery of nucleic acids to cells in vitro, ex vivo, and in vivo. In representative embodiments, the recombinant vectors of the present invention can be advantageously used to deliver or transfer nucleic acids to animal (e.g., mammalian) cells.

[0087] Any heterologous nucleotide sequence(s) can be delivered by the viral vectors of the invention. Nucleic acids of interest include nucleic acids encoding polypeptides, optionally therapeutic (e.g., for medical or veterinary use) and / or immunogenic (e.g., for a vaccine).

[0088] In some embodiments, the polypeptide stimulates proliferation and / or differentiation of CNS cells, such as neurons, glial cells, oligodendrocytes, astrocytes, microglia, and / or ependymal cells. Examples include, but are not limited to, insulin-like growth factor-1, glial-derived neurotrophic factor, neurotrophin-3, neurotrophin-4, artemin, neurterin, persephin, brain-derived neurotrophic factor, nerve growth factor, ciliary neurotrophic factor, transforming growth factor alpha, platelet-derived growth factor, leukemia inhibitory factor, prolactin, monocarboxylate transporter 1, or nuclear factor 1A.

[0089] Therapeutic polypeptides include, but are not limited to, the cystic fibrosis transmembrane conductance regulator protein (CFTR), dystrophin (the protein product of the dystrophin mini-gene or micro-gene, e.g., Vincent et al., (1993) Nature Genetics 5:130; U.S. Patent Publication 2003017131; Wang et al., (2000) Proc. Natl. Acad. Sci. USA 97:13714-9 [mini-dystrophin]; Harper et al., (2002) Nature Med. 8:253-61 [micro-dystrophin]); mini-agrin, laminin-α2, sarcoglycan (α, β, γ or δ), fukutin-related protein, myostatin pro-peptide, follistatin, dominant negative myostatin, angiogenic factors (e.g., VEGF, angiopoietin-1 or 2), anti-apoptotic factors (e.g., heme oxygenase-1, TGF-β, inhibitors of pro-apoptotic signals, e.g., caspases, proteases, kinases, death receptors [e.g., CD-095], regulators of cytochrome C release, inhibitors of mitochondrial pore opening and swelling); activin type 2 soluble receptors, anti-inflammatory polypeptides, e.g., Ikappa B dominant mutants, sarcospan, utrophin, mini-utrophin, antibodies or antibody fragments against myostatin or myostatin propeptide, cell cycle regulators, Rho kinase regulators such as cethrin, a modified bacterial C3 exoenzyme [BioAxone available from BioTherapeutics, Inc., Saint-Lauren, Quebec, Canada], BCL-xL, BCL2, XIAP, FLICEc-s, dominant negative caspase-8, dominant negative caspase-9, SPI-6 (see, e.g., U.S. Patent Application No. 20070026076), transcription factor PGC-α1, Pinch gene, ILK gene and thymosin β4 gene), coagulation factors (e.g., factor VIII, factor IX, factor X, etc.), erythropoietin, angiostatin, endostatin, catalase, tyrosine hydroxylase, intracellular and / or extracellular superoxide dismutase, leptin, LDL receptor, neprilysin,Lipoprotein lipase, ornithine transcarbamylase, β-globin, α-globin, spectrin, α1-antitrypsin, methylcytosine-binding protein 2, adenosine deaminase, hypoxanthine guanine phosphoribosyltransferase, β-glucocerebrosidase, sphingomyelinase, lysosomal hexosaminidase A, branched ketoacid dehydrogenase, RP65 protein, cytokines (e.g., α-interferon, β-interferon, interferon-γ, interleukin-1 to -14, granulocyte-macrophage sphingomyelinase, erythr ... phage colony stimulating factor, lymphotoxin, etc.), peptide growth factors, neurotrophic factors and hormones (e.g., somatotropin, insulin, insulin-like growth factors including IGF-1 and IGF-2, GLP-1, platelet-derived growth factor, epidermal growth factor, fibroblast growth factor, nerve growth factor, neurotrophic factor-3 and -4, brain-derived neurotrophic factor, glial-derived growth factor, transforming growth factor-α and -β, etc.), bone morphogenetic proteins (including RANKL and VEGF), lysosomal proteins, glutamate receptors, lymphokines, soluble CD4, Fc receptors, T cell receptors, ApoE, ApoC, inhibitor of protein phosphatase inhibitor 1 (I-1), phospholamban, serca2a, lysosomal acid α-glucosidase, α-galactosidase A, Barkct, β2-adrenergic receptor, β2-adrenergic receptor kinase (BARK), phosphoinositide-3 kinase (PI3 kinase), calsarcin, receptors (e.g., tumor necrosis growth factor-α soluble receptor), anti-inflammatory factors, e.g., IRAP, Pim-1, PGC-1α, SOD-1, SOD-2, ECF-SOD, calculein , thymosin-β4, hypoxia-inducible transcription factor [HIF], angiogenic factors, S100A1, parvalbumin, type 6 adenylyl cyclase, molecules that activate type 2 G-protein coupled receptor kinase knockdown, e.g., truncated constitutively active bARKct; phospholamban inhibitory or dominant negative molecules, e.g., phospholamban S16E, monoclonal antibodies (including single chain monoclonal antibodies), or suicide gene products (e.g., thymidine kinase, cytosine deaminase, diphtheria toxin, and tumor necrosis factor, e.g., TNF-α),and any other polypeptide that has a therapeutic effect in a subject in need thereof.

[0090] Heterologous nucleotide sequences encoding polypeptides include those that encode reporter polypeptides (e.g., enzymes). Reporter polypeptides are known in the art and include, but are not limited to, fluorescent proteins (e.g., EGFP, GFP, RFP, BFP, YFP, or dsRED2), enzymes that produce detectable products, such as luciferase (e.g., from Gaussia, Renilla, or Photinus), β-galactosidase, β-glucuronidase, alkaline phosphatase, and chloramphenicol acetyltransferase genes, or proteins that can be directly detected. Virtually any protein can be directly detected, for example, by using an antibody specific for the protein. Further suitable markers (and associated antibiotics) for either positive or negative selection of eukaryotic cells are disclosed in Sambrook and Russell (2001), Molecular Cloning, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and Ausubel et al. (1992), Current Protocols in Molecular Biology, John Wiley & Sons, which includes periodic updates.

[0091] Alternatively, the heterologous nucleic acid may encode functional RNA, such as an antisense oligonucleotide, a ribozyme (e.g., as described in U.S. Pat. No. 5,877,022), an RNA that causes spliceosome-mediated trans-splicing (see Puttaraju et al., (1999) Nature Biotech. 17:246; U.S. Pat. No. 6,013,487; U.S. Pat. No. 6,083,702), an interfering RNA (RNAi), including small interfering RNA (siRNA) that mediates gene silencing (see Sharp et al., (2000) Science 287:2431), a microRNA, or other non-translated "functional" RNA, such as a "guide" RNA (Gorman et al., (1998) Proc. Nat. Acad. Sci. USA 95:4929; U.S. Pat. No. 5,869,248 (Yuan et al.)). Exemplary non-coding RNAs include RNAi or antisense RNA against multidrug resistance (MDR) gene products (e.g., for treating tumors and / or for administration to the heart to prevent damage from chemotherapy), RNAi or antisense RNA against myostatin (Duchenne or Becker muscular dystrophy), RNAi or antisense RNA against tumor immunogens, including but not limited to the tumor immunogens specifically described herein or VEGF (for treating tumors), RNAi or antisense oligonucleotides targeting mutant dystrophin (Duchenne or Becker muscular dystrophy), RNAi or antisense RNA against the Hepatitis B surface antigen gene (for preventing and / or treating Hepatitis B infection), RNAi or antisense RNA against the HIV tat and / or rev genes (for preventing and / or treating HIV), and / or RNAi or antisense RNA against any other immunogen from a pathogen (for protecting a subject from a pathogen), or a defective gene product (for preventing or treating a disease). RNAi or antisense RNA against the above targets or any other target can also be used as a research reagent.

[0092] As known in the art, antisense nucleic acid (e.g., DNA or RNA) and inhibitory RNA (e.g., microRNA and RNAi, e.g., siRNA or shRNA) sequences can be used to induce "exon skipping" in patients with muscular dystrophy caused by defects in the dystrophin gene. Thus, the heterologous nucleic acid may encode an antisense nucleic acid or inhibitory RNA that induces appropriate exon skipping. Those skilled in the art will understand that the specific approach to exon skipping depends on the nature of the underlying defect in the dystrophin gene, and numerous such strategies are known in the art. Exemplary antisense nucleic acid and inhibitory RNA sequences target the upstream branch point and / or downstream donor splice site and / or internal splicing enhancer sequence of one or more of the dystrophin exons (e.g., exon 19 or 23). For example, in certain embodiments, the heterologous nucleic acid encodes an antisense nucleic acid or inhibitory RNA that is directed against the upstream branch point and downstream splice donor site of exon 19 or 23 of the dystrophin gene. Such sequences can be incorporated into AAV vectors that deliver modified U7 snRNA and antisense nucleic acid or inhibitory RNA (see, for example, Goyenvalle et al., (2004) Science 306:1796-1799). Another strategy is to incorporate modified U1 snRNA into AAV vectors together with siRNA, microRNA or antisense RNA that are complementary to the upstream and downstream splice sites of dystrophin exons (e.g., exon 19 or 23) (see, for example, Denti et al., (2006) Proc. Nat. Acad. Sci. USA 103:3758-3763). In addition, antisense nucleic acid and inhibitory RNA can target splicing enhancer sequences in exons 19, 43, 45 or 53 (see, for example, U.S. Patent No. 6,653,467; U.S. Patent No. 6,727,355; and U.S. Patent No. 6,653,466).

[0093] Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific manner. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim et al., (1987) Proc. Natl. Acad. Sci. USA 84:8788; Gerlach et al., (1987) Nature 328:802; Forster and Symons, (1987) Cell 49:211). For example, many ribozymes accelerate phosphoester transfer reactions with high specificity, and often cleave only one of several phosphates in oligonucleotide substrates (Michel and Westhof, (1990) J. Mol. Biol. 216:585; Reinhold-Hurek and Shub, (1992) Nature 357:173). This specificity results from the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.

[0094] Ribozyme catalysis was initially observed as part of sequence-specific cleavage / ligation reactions involving nucleic acids (Joyce, (1989) Nature 338:217). For example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as endonucleases with sequence specificity greater than that of known ribonucleases, approaching that of DNA restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of nucleic acid expression may be particularly suitable for therapeutic applications (Scanlon et al., (1991) Proc. Natl. Acad. Sci. USA 88:10591; Sarver et al., (1990) Science 247:1222; Sioud et al., (1992) J. Mol. Biol. 223:831).

[0095] MicroRNAs (mirs) are naturally occurring cellular RNA molecules that can regulate the expression of many genes by controlling the stability of mRNA. Overexpression or reduction of specific microRNAs can be used to treat dysfunction and has been shown to be effective in animal models of disease and in many pathologies (see, e.g., Couzin, (2008) Science 319:1782-4). Chimeric AAVs can be used to deliver microRNAs into cells, tissues, and subjects to treat genetic and acquired diseases or to enhance function and promote growth of specific tissues. For example, mir-1, mir-133, mir-206, and / or mir-208 can be used to treat heart and skeletal muscle diseases (see, e.g., Chen et al., (2006) Genet. 38:228-33; van Rooij et al., (2008) Trends Genet. 24:159-66). MicroRNAs can also be used to modulate the immune system following gene delivery (Brown et al., (2007) Blood 110:4144-52).

[0096] The term "antisense oligonucleotide" (including "antisense RNA") used herein refers to a nucleic acid that is complementary to and specifically hybridizes with a specific DNA or RNA sequence. Antisense oligonucleotides and the nucleic acids that code for them can be made according to conventional techniques. For example, see U.S. Patent No. 5,023,243 (Tullis); U.S. Patent No. 5,149,797 (Pederson et al.).

[0097] One of skill in the art will appreciate that it is not necessary for the antisense oligonucleotide to be perfectly complementary to the target sequence, so long as the degree of sequence similarity is sufficient such that the antisense nucleotide sequence specifically hybridizes to its target (defined above) and reduces production of a protein product (e.g., by at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more).

[0098] To determine the specificity of hybridization, the hybridization of such oligonucleotides to the target sequence can be performed under low stringency, medium stringency, or more stringent conditions. Suitable conditions for achieving low, medium, and stringent hybridization conditions are as described herein.

[0099] Stated another way, in certain embodiments, the antisense oligonucleotides of the invention have at least about 60%, 70%, 80%, 90%, 95%, 97%, 98% or more sequence identity with the complement of the target sequence and reduce production of a protein product (as defined above). In some embodiments, the antisense sequence contains 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mismatches compared to the target sequence.

[0100] Methods for determining percent identity of a nucleic acid sequence are described in more detail elsewhere herein.

[0101] The length of antisense oligonucleotide is not critical as long as it specifically hybridizes to the intended target and reduces the production of protein product (as defined above), and can be determined according to routine procedures.In general, antisense oligonucleotide is at least about 8, 10 or 12 or 15 nucleotides in length and / or less than about 20, 30, 40, 50, 60, 70, 80, 100 or 150 nucleotides in length.

[0102] RNA interference (RNAi) is another useful method for reducing the production of protein products (e.g., shRNA or siRNA). RNAi is a mechanism of post-transcriptional gene silencing in which double-stranded RNA (dsRNA) corresponding to a target sequence of interest is introduced into a cell or organism, resulting in the degradation of the corresponding mRNA. The mechanism by which RNAi achieves gene silencing is reviewed in Sharp et al., (2001) Genes Dev 15:485-490; and Hammond et al., (2001) Nature Rev. Gen. 2:110-119). The RNAi effect persists for many cell divisions before gene expression is restored. Thus, RNAi is a powerful method for creating targeted knockouts or "knockdowns" at the RNA level. RNAi has been proven successful in human cells, including human embryonic kidney and HeLa cells (see, for example, Elbashir et al., Nature (2001) 411:494-8).

[0103] The first attempts to use RNAi in mammalian cells resulted in an antiviral defense mechanism involving PKR in response to dsRNA molecules (see, for example, Gil et al., (2000) Apoptosis 5:107). Since then, it has been shown that short synthetic dsRNAs of about 21 nucleotides known as "short interfering RNAs" (siRNAs) can mediate silencing in mammalian cells without triggering an antiviral response (see, for example, Elbashir et al., Nature (2001) 411:494-8; Caplen et al., (2001) Proc. Nat. Acad. Sci. USA 98:9742).

[0104] RNAi molecules (including siRNA molecules) may be short hairpin RNAs (shRNAs; see Paddison et al., (2002), Proc. Nat. Acad. Sci. USA 99:1443-1448), which are believed to be processed intracellularly into 20-25mer siRNA molecules by the action of the RNase III-like enzyme Dicer. shRNAs generally have a stem-loop structure in which two inverted repeats are separated by a short spacer sequence that loops out. There have been reports of shRNAs with loops ranging from 3 to 23 nucleotides in length. In general, the loop sequence is not critical. Exemplary loop sequences include the following motifs: AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC, and UUCAAGAGA.

[0105] RNAi further includes circular molecules that include a sense and an antisense region with two loop regions on either side, which can form a "dumbbell" shaped structure upon dsRNA formation between the sense and antisense regions. This molecule can be processed in vitro or in vivo to release the dsRNA portion, e.g., siRNA.

[0106] International Patent Publication WO01 / 77350 describes vectors for bidirectional transcription in eukaryotic cells to produce both sense and antisense transcripts of heterologous sequences. This technology can be used to produce RNAi for use according to the present invention.

[0107] Shinagawa et al., (2003) Genes Dev. 17:1340, reported a method for expressing long dsRNA from a CMV promoter (pol II promoter), which can also be applied to tissue-specific pol II promoters. Similarly, the method of Xia et al., (2002) Nature Biotech. 20:1006, can be used in conjunction with tissue-specific promoters, avoiding poly(A) tailing.

[0108] Methods for producing RNAi include chemical synthesis, in vitro transcription, digestion of long dsRNA with Dicer (in vitro or in vivo), in vivo expression from a delivery vector, and in vivo expression from PCR-derived RNAi expression cassettes (see, e.g., TechNotes 10(3) "Five Ways to Produce siRNAs" from Ambion, Inc., Austin TX; available at www.ambion.com).

[0109] Guidelines for designing siRNA molecules are available (see, e.g., literature from Ambion, Inc., Austin TX; available at www.ambion.com). In certain embodiments, siRNA sequences have a G / C content of about 30-50%. Furthermore, when using RNA polymerase III to transcribe the RNA, stretches of more than four T or A residues are generally avoided. Online siRNA target finders are available, for example, from Ambion, Inc. (www.ambion.com), through the Whitehead Institute of Biomedical Research (www.jura.wi.mit.edu), or from Dharmacon Research, Inc. (www.dharmacon.com).

[0110] The antisense region of an RNAi molecule can be, but need not be, perfectly complementary to the target sequence, so long as it specifically hybridizes to the target sequence (defined above) and reduces (e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more) the production of a protein product. In some embodiments, hybridization of such oligonucleotides to a target sequence can be performed under low stringency, medium stringency, or more stringent conditions (defined above).

[0111] In other embodiments, the antisense region of the RNAi has at least about 60%, 70%, 80%, 90%, 95%, 97%, 98% or more sequence identity with the complement of the target sequence and reduces the production of protein product (e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more). In some embodiments, the antisense region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mismatches compared to the target sequence. Mismatches are generally more tolerated at the ends of the dsRNA than in the middle.

[0112] In certain embodiments, RNAi is formed by intermolecular complexation between two separate sense and antisense molecules.RNAi comprises ds region formed by intermolecular base pairing between two separate strands.In other embodiments, RNAi comprises ds region formed by intramolecular base pairing within a single nucleic acid molecule, which typically comprises both sense and antisense regions as inverted repeats (e.g. shRNA or other stem-loop structures, or circular RNAi molecules).RNAi may further comprise a spacer region between sense and antisense regions.

[0113] Generally, RNAi molecules are highly selective.If necessary, those skilled in the art can easily eliminate the candidate RNAi that may interfere with the expression of non-target nucleic acid by searching relevant databases, for example, using BLAST (available at www.ncbi.nlm.nih.gov / BLAST) to identify the RNAi sequence that does not have substantial sequence homology with other known sequences.

[0114] Kits for the production of RNAi are commercially available, for example, from New England Biolabs, Inc. and Ambion, Inc.

[0115] Recombinant viral vectors can also contain heterologous nucleotide sequences that share homology with the host chromosome and recombine with loci on the host chromosome. This method can be used to correct genetic defects in the host cell.

[0116] The present invention also provides recombinant viral vectors expressing immunogenic polypeptides, e.g., for vaccination. The heterologous nucleic acid may encode any immunogen of interest known in the art, including, but not limited to, immunogens derived from human immunodeficiency virus, influenza virus, gag proteins, tumor antigens, cancer antigens, bacterial antigens, viral antigens, etc. Alternatively, the immunogen can be presented within (e.g., incorporated into) or tethered to (e.g., by covalent modification) the viral capsid.

[0117] The use of parvoviruses as vaccines is known in the art (see, e.g., Miyamura et al., (1994) Proc. Nat. Acad. Sci. USA 91:8507; U.S. Pat. No. 5,916,563 (Young et al.); U.S. Pat. No. 5,905,040 (Mazzara et al.); U.S. Pat. No. 5,882,652; U.S. Pat. No. 5,863,541 (Samulski et al.); the disclosures of which are incorporated herein by reference in their entireties). Antigens may be presented within the viral capsid. Alternatively, antigens may be expressed by heterologous nucleic acid introduced into a recombinant vector genome.

[0118] The immunogenic polypeptide, or immunogen, can be any polypeptide suitable for protecting a subject against disease, including, but not limited to, microbial, bacterial, protozoan, parasitic, fungal, and viral diseases. For example, the immunogen can be an orthomyxovirus immunogen (e.g., an influenza virus immunogen, such as an influenza virus hemagglutinin (HA) surface protein or influenza virus nucleoprotein gene, or an equine influenza virus immunogen), or a lentivirus immunogen (e.g., an equine infectious anemia virus immunogen, a simian immunodeficiency virus (SIV) immunogen, or a human immunodeficiency virus (HIV) immunogen, such as an HIV or SIV membrane GP160 protein, an HIV or SIV matrix / capsid protein, and an HIV or SIV gag, pol, and env gene product). The immunogen may also be an arenavirus immunogen (e.g., a Lassa virus immunogen, such as the Lassa virus nucleocapsid protein gene and the Lassa virus envelope glycoprotein gene), a poxvirus immunogen (e.g., vaccinia, such as the vaccinia L1 or L8 genes), a flavivirus immunogen (e.g., a yellow fever virus immunogen or a Japanese encephalitis virus immunogen), a filovirus immunogen (e.g., an Ebola virus immunogen, or a Marburg virus immunogen, such as the NP and GP genes), a Bunyavirus immunogen (e.g., RVFV, CCHF, and SFS viruses), or a coronavirus immunogen (e.g., an infectious human coronavirus immunogen, such as a human coronavirus envelope glycoprotein gene, or a porcine transmissible gastroenteritis virus immunogen, or an avian infectious bronchitis virus immunogen, or a severe acute respiratory syndrome (SARS) immunogen, such as the S [S1 or S2], M, E, or N proteins or immunogenic fragments thereof). The immunogen may further be a polio immunogen, a herpes immunogen (e.g., CMV, EBV, HSV immunogen), a mumps immunogen, a measles immunogen, a rubella immunogen, a diphtheria toxin or other diphtheria immunogen, a pertussis antigen, a hepatitis (e.g., hepatitis A, hepatitis B, or hepatitis C) immunogen, or any other vaccine immunogen known in the art.

[0119] Alternatively, the immunogen can be any tumor or cancer cell antigen. In some cases, the tumor or cancer antigen is expressed on the surface of a cancer cell. Exemplary cancer and tumor cell antigens are described in SA Rosenberg, (1999) Immunity 10:281). Exemplary cancer and tumor antigens include, but are not limited to: BRCA1 gene product, BRCA2 gene product, gp100, tyrosinase, GAGE-1 / 2, BAGE, RAGE, NY-ESO-1, CDK-4, β-catenin, MUM-1, caspase-8, KIAA0205, HPVE, SART-1, PRAME, p15, melanoma tumor antigen (Kawakami et al., (1994) Proc. Natl. Acad. Sci. USA 91:3515; Kawakami et al., (1994) J. Exp. Med., 180:347; Kawakami et al., (1994) Cancer Res. 54:3124), MART-1 (Coulie et al., (1991) J. Exp. Med. 180:35), gp100 (Wick et al., (1992) J. Exp. Med. 180:33), and / or other cancer and tumor antigens. al.,(1988) J. Cutan. Pathol. 4:201) and MAGE antigens (MAGE-1, MAGE-2 and MAGE-3) (Van der Bruggen et al.,(1991) Science,254:1643), CEA, TRP-1; TRP-2; P-15 and tyrosinase (Brichard et al. al., (1993) J. Exp. Med. 178:489); HER-2 / neu gene product (U.S. Pat. No. 4,968,603); CA125; HE4; LK26; FB5 (endosialin); TAG72; AFP; CA19-9; NSE; DU-PAN-2; CA50; Span-1; CA72-4; HCG; STN (sialyl-Tn antigen); c-erbB-2 protein; PSA; L-CanAg; estrogen receptor; milk fat globulin; p53 tumor suppressor protein (Levine, (1993) Ann. Rev. Biochem.62:623); mucin antigens (International Patent Publication WO 90 / 05142); telomerase; nuclear matrix proteins; prostatic acid phosphatase; papilloma virus antigens; and antigens associated with the following cancers: melanoma, adenocarcinoma, thymoma, sarcoma, lung cancer, liver cancer, colorectal cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, renal cancer, pancreatic cancer, brain cancer, kidney cancer, stomach cancer, esophageal cancer, head and neck cancer, and others (see, e.g., Rosenberg, (1996) Annu. Rev. Med. 47:481-91).

[0120] Alternatively, the heterologous nucleotide sequence may encode any polypeptide that is desirably produced in a cell, in vitro, ex vivo, or in vivo For example, a viral vector can be introduced into cultured cells and the expressed protein product isolated therefrom.

[0121] It will be understood by those skilled in the art that the heterologous nucleic acid(s) of interest can be operably linked to appropriate control sequences. For example, the heterologous nucleic acid can be operably linked to expression control elements, such as transcription / translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, enhancers, and the like.

[0122] Those skilled in the art will further understand that various promoter / enhancer elements can be used depending on the tissue-specific expression and level desired. The promoter / enhancer can be constitutive or inducible depending on the expression pattern desired. The promoter / enhancer can be native or foreign, and can be a natural or synthetic sequence. By foreign, it is meant that the transcription initiation region is not found in the wild-type host into which it is introduced.

[0123] The promoter / enhancer element may be native to the target cell or subject to be treated and / or may be native to the heterologous nucleic acid sequence. The promoter / enhancer element is generally selected to function in the target cell(s) of interest. In representative embodiments, the promoter / enhancer element is a mammalian promoter / enhancer element. The promoter / enhancer element may be constitutive or inducible.

[0124] Inducible expression control elements are commonly used in applications where it is desirable to provide control over the expression of a heterologous nucleic acid sequence(s). Inducible promoter / enhancer elements for gene delivery may be tissue-specific or tissue-selective promoter / enhancer elements, including muscle-specific or selective (including cardiac, skeletal and / or smooth muscle), nervous tissue-specific or selective (including brain-specific), eye (including retina-specific and cornea-specific), liver-specific or selective, bone marrow-specific or selective, pancreas-specific or selective, spleen-specific or selective, and lung-specific or selective promoter / enhancer elements. In one embodiment, CNS cell-specific or CNS cell-selective promoters are used. Examples of neuron-specific or selective promoters include, but are not limited to, neuron-specific enolase, synapsin, and MeCP2. Examples of astrocyte-specific or selective promoters include, but are not limited to, glial fibrillary acidic protein and S100β. Examples of ependymal cell specific or selective promoters include, but are not limited to, wdr16, Foxj1, and LRP2. Examples of microglia specific or selective promoters include, but are not limited to, F4 / 80, CX3CR1, and CD11b. Examples of oligodendrocyte specific or selective promoters include, but are not limited to, myelin basic protein, cyclic nucleotide phosphodiesterase, proteolipid protein, Gtx, and Sox10. The use of CNS cell specific or selective promoters can increase the specificity to the CNS achieved by the chimeric AAV vector by further restricting the expression of the heterologous nucleic acid. Other inducible promoter / enhancer elements include hormone-inducible and metal-inducible elements. Exemplary inducible promoter / enhancer elements include, but are not limited to, the Tet on / off element, the RU486-inducible promoter, the ecdysone-inducible promoter, the rapamycin-inducible promoter, and the metallothionein promoter.

[0125] In embodiments in which the heterologous nucleic acid sequence(s) are transcribed and then translated in the target cell, specific initiation signals are generally used for efficient translation of the inserted protein-coding sequence. These exogenous translational control sequences may include the ATG initiation codon and adjacent sequences, and may be of a variety of origins, both natural and synthetic.

[0126] The present invention also provides chimeric AAV particles comprising an AAV capsid and an AAV genome, where the AAV genome "corresponds to" (i.e., encodes) the AAV capsid. Also provided are collections or libraries of such chimeric AAV particles, where the collection or library is 2 or more, 10 or more, 50 or more, 100 or more, 1000 or more, 10 4 That's it, 10 5 More than or equal to 10 6 The above separate sequences are included.

[0127] The present invention further encompasses "empty" capsid particles (i.e., the absence of vector genome) that comprise, consist of, or consist essentially of the chimeric AAV capsid proteins of the present invention. The chimeric AAV capsids of the present invention can be used as "capsid vehicles" as described in U.S. Pat. No. 5,863,541. Molecules that can be covalently attached, bound, or packaged by viral capsids for transfer into cells include DNA, RNA, lipids, carbohydrates, polypeptides, small organic molecules, or combinations thereof. Additionally, molecules can be associated (e.g., "tethered") to the outside of the viral capsid for transfer of the molecules into the host target cell. In one embodiment of the present invention, the molecules are covalently attached (i.e., conjugated or chemically bonded) to the capsid proteins. Methods for covalently attaching molecules are known to those skilled in the art.

[0128] The viral capsids of the present invention also find use in raising antibodies against the novel capsid structure. As a further alternative, exogenous amino acid sequences can be inserted into the viral capsid to generate an immune response against the exogenous amino acid sequence for antigen presentation to cells, e.g., for administration to a subject.

[0129] The present invention also provides nucleic acids (e.g., isolated nucleic acids) encoding the chimeric capsid proteins and chimeric viral capsids of the present invention. Additionally, vectors comprising the nucleic acids and cells (in vivo or in culture) comprising the nucleic acids and / or vectors of the present invention are provided. Such nucleic acids, vectors and cells can be used, for example, as reagents (e.g., helper constructs or packaging cells) for the production of the viral vectors described herein.

[0130] In exemplary embodiments, the present invention provides a nucleic acid sequence encoding an AAV capsid of SEQ ID NO: 44-86 or 108-128, or a nucleic acid sequence at least 70% identical to a nucleotide sequence of SEQ ID NO: 1-44 or 87-107. The present invention also provides nucleic acids encoding the AAV capsid mutants, capsid protein mutants and fusion proteins described above. In certain embodiments, the nucleic acid hybridizes under standard conditions known by those of skill in the art to the complement of the nucleic acid sequence specifically disclosed herein and encodes a mutant capsid and / or capsid protein. Optionally, the mutant capsid or capsid protein substantially retains at least one of the characteristics of the capsid and / or capsid protein encoded by the nucleic acid sequence of SEQ ID NO: 1-44 or 87-107. For example, a viral particle comprising a mutant capsid or mutant capsid protein can substantially retain the CNS tropism profile of a viral particle comprising a capsid or capsid protein encoded by a nucleic acid coding sequence of SEQ ID NO: 1-44 or 87-107.

[0131] For example, hybridization of such sequences may be performed under low stringency, medium stringency, or more stringent conditions. Exemplary conditions for low, medium, and stringent hybridization are as follows: (e.g., conditions represented by 35-40% formamide washing stringency with 5x Denhardt's solution, 0.5% SDS, and 1x SSPE (37°C); conditions represented by 40-45% formamide washing stringency with 5x Denhardt's solution, 0.5% SDS, and 1x SSPE (42°C); and conditions represented by 50% formamide washing stringency with 5x Denhardt's solution, 0.5% SDS, and 1x SSPE (42°C)). See, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual (2d Ed. 1989) (Cold Spring Harbor Laboratory).

[0132] In other embodiments, nucleic acid sequences encoding mutant capsids or capsid proteins of the invention have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to a nucleic acid sequence of SEQ ID NO:1-44 or 87-107, and optionally encode a mutant capsid or capsid protein that substantially retains at least one attribute of a capsid protein or capsid encoded by a nucleic acid of SEQ ID NO:1-44 or 87-107.

[0133] As known in the art, many different programs can be used to identify whether a nucleic acid or polypeptide has sequence identity to a known sequence.Percent identity as used herein means that a nucleic acid or a fragment thereof shares a certain percent identity with another nucleic acid when optimally aligned with the other nucleic acid (or its complementary strand) using BLASTN (with appropriate nucleotide insertion or deletion).To determine the percent identity between two different nucleic acids, the percent identity is determined using the BLASTN program "BLAST 2 sequences".This program is available for public use from the National Center for Biotechnology Information (NCBI) on the Internet (Altschul et al., (1997) Nucleic Acids Res.25(17):3389-3402). The parameters used are any combination that results in the highest calculated percent identity (calculated below), with default parameters shown in parentheses:Program--blastn Matrix--0 BLOSUM62 Reward for a match--0 or 1(1)Penalty for a mismatch--0,-1,-2 or -3(-2)Open gap penalty--0,1,2,3,4 or 5(5)Extension gap penalty--0 or 1(1)Gap x_dropoff--0 or 50(50)Expect--10.

[0134] Percent identity or similarity, when referring to a polypeptide, refers to the polypeptide in question exhibiting a certain percent identity or similarity when compared to another protein or a portion thereof over a common length as determined using BLASTP. This program is also available for public use from the National Center for Biotechnology Information (NCBI) on the Internet (Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402). Percent identity or similarity for polypeptides is typically measured using sequence analysis software. See, for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using a measure of homology that is assigned to various substitutions, deletions and other modifications. Conservative substitutions typically include substitutions in the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0135] In certain embodiments, the nucleic acid may comprise, consist essentially of, or consist of a vector, including, but not limited to, a plasmid, a phage, a viral vector (e.g., an AAV vector, an adenoviral vector, a herpes viral vector, or a baculoviral vector), a bacterial artificial chromosome (BAC), or a yeast artificial chromosome (YAC). For example, the nucleic acid may comprise, consist, or consist essentially of an AAV vector including 5' and / or 3' terminal repeats (e.g., 5' and / or 3' AAV terminal repeats).

[0136] In some embodiments, the nucleic acid encoding the chimeric AAV capsid protein further comprises an AAV rep coding sequence. For example, the nucleic acid can be a helper construct for producing a viral stock.

[0137] The invention also provides packaging cells that stably contain a nucleic acid of the invention, for example, the nucleic acid can be stably integrated into the genome of the cell or can be stably maintained in an episomal form (e.g., an "EBV-based nuclear episome").

[0138] The nucleic acid can be incorporated into a delivery vector, such as a viral delivery vector. For illustration, the nucleic acid of the present invention can be packaged in an AAV particle, an adenovirus particle, a herpes virus particle, a baculovirus particle, or any other suitable viral particle.

[0139] Additionally, the nucleic acid can be operably linked to a promoter element, which is described in more detail herein.

[0140] The present invention further provides a method for producing a viral vector of the present invention. In an exemplary embodiment, the present invention provides a method for producing a recombinant viral vector, the method comprising the step of providing a cell in vitro with (a) (i) a heterologous nucleic acid, and (ii) a template comprising a packaging signal sequence (e.g., one or more (e.g., two) terminal repeats, e.g., AAV terminal repeats) sufficient for encapsidation of the AAV template into a viral particle, and (b) AAV sequences (e.g., AAV rep and AAV cap sequences encoding the AAV capsid of the present invention) sufficient for replication and encapsidation of the template into a viral particle. The template and AAV replication and encapsidation sequences are provided under conditions such that recombinant viral particles comprising the template packaged within the capsid are produced within the cell. The method may further comprise the step of collecting the viral particles from the cell. The viral particles may be collected from the culture medium and / or by lysing the cells.

[0141] In one exemplary embodiment, the invention provides a method for producing rAAV particles comprising an AAV capsid, the method comprising the steps of providing to cells in vitro a nucleic acid encoding a chimeric AAV capsid of the invention, an AAV rep coding sequence, an AAV vector genome comprising a heterologous nucleic acid, and helper functions to produce a productive AAV infection; and allowing assembly of AAV particles comprising the AAV capsid and encapsidating the AAV vector genome.

[0142] The cell is typically a cell that allows AAV virus replication.Any suitable cell known in the art may be used, such as mammalian cells.Trans-complementing packaging cell lines that provide the functions that are deleted from replication-defective helper virus, such as 293 cells or other E1a trans-complementing cells, are also suitable.

[0143] AAV replication and capsid sequences can be provided by any method known in the art. Current methods typically express AAV rep / cap genes on a single plasmid. AAV replication and packaging sequences do not need to be provided together, but it may be convenient to do so. AAV rep and / or cap sequences can be provided by any viral or non-viral vector. For example, rep / cap sequences can be provided by a hybrid adenovirus or herpesvirus vector (e.g., inserted into the E1a or E3 region of a deleted adenovirus vector). EBV vectors can also be used to express AAV cap and rep genes. One advantage of this method is that EBV vectors are episomal, and further maintain high copy number throughout successive cell divisions (i.e., stably integrated into cells as extrachromosomal elements, named EBV-based nuclear episomes).

[0144] As a further alternative, the rep / cap sequences may be stably maintained (episomal or integrated) within the cell.

[0145] Typically, the AAV rep / cap sequences are not flanked by AAV packaging sequences (eg, AAV ITRs) to prevent rescue and / or packaging of these sequences.

[0146] The template (e.g., rAAV vector genome) can be provided to the cell using any method known in the art. For example, the template can be provided by a non-viral (e.g., plasmid) or viral vector. In certain embodiments, the template is provided by a herpesvirus or adenovirus vector (e.g., inserted into the E1a or E3 region of a deleted adenovirus). As an alternative illustration, Palombo et al., (1998) J. Virol. 72:5025, describes a baculovirus vector carrying a reporter gene flanked by AAV ITRs. EBV vectors may also be used to deliver the template as described above for the rep / cap genes.

[0147] In another exemplary embodiment, the template is provided by a replicating rAAV virus. In yet another embodiment, the AAV provirus is stably integrated into a chromosome of the cell.

[0148] To obtain maximum virus titer, cells are generally provided with helper virus functions (e.g., adenovirus or herpesvirus) that are essential for productive AAV infection. Helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences are provided by helper adenovirus or herpesvirus vectors. Alternatively, adenovirus or herpesvirus sequences can be provided by other non-viral or viral vectors, for example, as non-infectious adenovirus mini-plasmids that carry all the helper genes required for efficient AAV production, as described by Ferrari et al., (1997) Nature Med.3:1295, and U.S. Patent Nos. 6,040,183 and 6,093,570.

[0149] Additionally, helper virus functions can be provided by the packaging cell using helper genes integrated within the chromosome or maintained as stable extrachromosomal elements, hi representative embodiments, the helper virus sequences cannot be packaged into AAV virions, e.g., are not flanked by the AAV ITRs.

[0150] Those skilled in the art will appreciate that it may be advantageous to provide AAV replication and capsid sequences and helper virus sequences (e.g., adenovirus sequences) on a single helper construct, which may be a non-viral or viral construct, but optionally is a composite adenovirus or composite herpesvirus that contains the AAV rep / cap genes.

[0151] In one particular embodiment, the AAV rep / cap sequence and the adenovirus helper sequence are provided by a single adenovirus helper vector, which further comprises a rAAV template. The AAV rep / cap sequence and / or the rAAV template can be inserted into a deleted region of the adenovirus (e.g., the E1a or E3 region).

[0152] In a further embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. The rAAV template is provided as a plasmid template.

[0153] In another exemplary embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are provided by a single adenovirus helper vector and the rAAV template is integrated into the cell as a provirus. Alternatively, the rAAV template is provided by an EBV vector that is maintained in the cell as an extrachromosomal element (e.g., as an "EBV-based nuclear episome," see Margolski, (1992) Curr. Top. Microbiol. Immun. 158:67).

[0154] In a further exemplary embodiment, the AAV rep / cap sequence and the adenovirus helper sequence are provided by a single adenovirus helper. The rAAV template is provided as a separate replicating viral vector. For example, the rAAV template can be provided by a rAAV particle or a second recombinant adenovirus particle.

[0155] According to the foregoing methods, the composite adenoviral vector typically contains sufficient adenoviral 5' and 3' cis sequences (i.e., adenoviral terminal repeats and PAC sequences) for adenoviral replication and packaging. The AAV rep / cap sequences, and, if present, the rAAV template, are incorporated into the adenoviral backbone and flanked by the 5' and 3' cis sequences so that these sequences can be packaged into the adenoviral capsid. As noted above, in representative embodiments, the adenoviral helper sequences and the AAV rep / cap sequences are not flanked by AAV packaging sequences (e.g., AAV ITRs) so that these sequences are not packaged into the AAV virion.

[0156] Herpesviruses may also be used as helper viruses in AAV packaging methods. Complex herpesviruses encoding the AAV rep protein(s) may advantageously facilitate a more scalable AAV vector production scheme. Complex herpes simplex virus type I (HSV-1) vectors expressing AAV-2 rep and cap genes have been described (Conway et al., (1999) Gene Therapy 6:986 and WO 00 / 17377, the disclosures of which are incorporated herein in their entirety).

[0157] As a further alternative, the viral vectors of the invention can be produced in insect cells using a baculovirus vector to deliver the rep / cap genes and a rAAV template as described by Urabe et al., (2002) Human Gene Therapy 13:1935-43.

[0158] Another method of producing AAV uses stably transformed packaging cells (see, eg, US Pat. No. 5,658,785).

[0159] AAV vector stocks free of contaminating helper virus may be obtained by any method known in the art. For example, AAV and helper virus can be easily distinguished based on size. AAV may also be separated from helper virus based on affinity for heparin substrate (Zolotukhin et al., (1999) Gene Therapy 6:973). In a representative embodiment, a replication-defective helper virus is used that is deleted so that any contaminating helper virus is not replication competent. As a further alternative, an adenovirus helper lacking expression of late genes may be used, since only expression of the early adenovirus genes is required to mediate packaging of the AAV virus. Adenovirus mutants lacking expression of late genes are known in the art (e.g., ts100K and ts149 adenovirus mutants).

[0160] Using the packaging methods of the present invention, high titer stocks of viral particles can be produced. In certain embodiments, viral stocks are at least about 10 5 Transducing units (tu) / ml, at least about 10 6 tu / ml, at least about 10 7 tu / ml, at least about 10 8 tu / ml, at least about 10 9 tu / ml, or at least about 10 10 It has a titer of tu / ml.

[0161] The novel capsid proteins and capsid structures find use raising antibodies, for example, for diagnostic or therapeutic uses, or as research reagents. Thus, the present invention also provides antibodies against the novel capsid proteins and capsids of the present invention.

[0162] The term "antibody" or "antibodies" as used herein refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD, and IgE. Antibodies may be monoclonal or polyclonal, of any species of origin, including (for example) mouse, rat, rabbit, horse, goat, sheep, or human, or may be chimeric antibodies. See, for example, Walker et al., Mol. Immunol. 26, 403-11 (1989). Antibodies may be recombinant monoclonal antibodies, produced, for example, according to the methods disclosed in U.S. Pat. No. 4,474,893 or U.S. Pat. No. 4,816,567. Antibodies may also be chemically constructed, for example, according to the methods disclosed in U.S. Pat. No. 4,676,980.

[0163] Antibody fragments included within the scope of the present invention include, for example, Fab, F(ab')2, and Fc fragments, and corresponding fragments obtained from antibodies other than IgG. Such fragments can be produced by known techniques. For example, F(ab')2 fragments can be produced by pepsin digestion of the antibody molecule, and Fab fragments can be produced by reducing the disulfide bridges of F(ab')2 fragments. Alternatively, Fab expression libraries can be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al., (1989) Science 254, 1275-1281).

[0164] Polyclonal antibodies can be produced by immunizing a suitable animal (e.g., rabbit, goat, etc.) with an antigen to which a monoclonal antibody against the target binds, collecting immune serum from the animal, and isolating the polyclonal antibodies from the immune serum according to known procedures.

[0165] Monoclonal antibodies can be produced in hybridoma cell lines according to the techniques of Kohler and Milstein, (1975) Nature 265, 495-97. For example, a solution containing the appropriate antigen can be injected into a mouse, and after a sufficient time, the mouse can be sacrificed to obtain spleen cells. The spleen cells are then immortalized by fusing with myeloma or lymphoma cells, typically in the presence of polyethylene glycol, to produce hybridoma cells. The hybridoma cells are then grown in a suitable medium, and the supernatant is screened for monoclonal antibodies with the desired specificity. Monoclonal Fab fragments can be produced in E. coli by recombinant techniques known to those skilled in the art. See, for example, W. Huse, (1989) Science 246, 1275-81.

[0166] Antibodies specific for a target polypeptide can also be obtained by phage display techniques known in the art.

[0167] A variety of immunoassays can be used for screening to identify antibodies with the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificity are well known in the art. Such immunoassays typically involve the measurement of complex formation between an antigen and its specific antibody (e.g., antigen / antibody complex formation). Two-site, monoclonal-based immunoassays utilizing monoclonal antibodies reactive to two non-interfering epitopes can be used as well as competitive binding assays.

[0168] The antibodies can be conjugated to a solid support (e.g., a bead, plate, slide, or well formed from materials such as latex or polystyrene) in accordance with known techniques. The antibodies can also be conjugated to a radioactive label (e.g., 35 S, 125 I, 131 I), enzyme labels (e.g., horseradish peroxidase, alkaline phosphatase), and fluorescent labels (e.g., fluorescein). Determination of the formation of antibody / antigen complexes in the methods of the invention may be by detection of, for example, precipitation, aggregation, coagulation, radioactivity, color development or change, fluorescence, luminescence, etc., as known in the art.

[0169] III. Methods using chimeric AAV capsids targeted to the CNS The present invention also relates to a method of delivering heterologous nucleotide sequences to the CNS while minimizing delivery to peripheral organs. For example, the viral vector of the present invention can be used to deliver a nucleotide sequence of interest to CNS cells in vitro, for example, to produce a polypeptide or nucleic acid in vitro, or for ex vivo gene therapy. The vector is further useful in a method of delivering a nucleotide sequence to a subject in need thereof, for example, to express a therapeutic or immunogenic polypeptide or nucleic acid. Thus, the polypeptide or nucleic acid can be produced in vivo in the subject. The subject may need the polypeptide or nucleic acid because it is deficient in the polypeptide, or because the production of the polypeptide or nucleic acid in the subject can provide some therapeutic effect, as a treatment or other method, and as further described below.

[0170] In certain embodiments, the vector is useful for expressing a polypeptide or nucleic acid that provides a beneficial effect to the CNS, for example, for promoting the proliferation and / or differentiation of neurons or glial cells. The ability to target the vector to the CNS may be particularly useful for treating diseases or disorders that involve CNS dysfunction. In other embodiments, the vector is useful for expressing a polypeptide or nucleic acid that provides a beneficial effect to cells (e.g., neurons and / or glial cells) in the CNS.

[0171] Thus, one aspect of the invention relates to a method of delivering a nucleic acid of interest to a CNS cell, the method comprising the step of contacting the CNS cell with an AAV particle of the invention.

[0172] In another aspect, the invention relates to a method for delivering a nucleic acid of interest to a CNS cell in a mammalian subject, the method comprising the step of administering to the mammalian subject an effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0173] A further aspect of the invention relates to a method for treating a disorder associated with CNS dysfunction in a subject in need thereof, the method comprising the step of administering to the subject a therapeutically effective amount of an AAV particle of the invention.

[0174] CNS disorders include, but are not limited to, disorders of thought and cognition, such as schizophrenia and delirium; amnesic disorders; mood disorders, such as affective disorders and anxiety disorders (including post-traumatic stress disorder, separation anxiety disorder, selective mutism, reactive attachment disorder, stereotypic movement disorder, panic disorder, agoraphobia, specific phobia, social phobia, obsessive-compulsive disorder, acute stress disorder, generalized anxiety disorder, substance-induced anxiety disorder and / or anxiety disorder not otherwise specified); disorders of social behavior; disorders of learning and memory, such as learning disabilities (e.g., dyslexia); motor skill disorders; communication disorders (e.g., stuttering); pervasive developmental disorders (e.g., autistic disorder, Rett disorder (Rett syndrome), childhood disintegrative disorder, Asperger's disorder, and / or pervasive developmental disorder not otherwise specified) and dementia. Thus, the term "central nervous system disorder" includes those disorders listed above as well as antidepressant disorders (including major depressive disorder, dysthymic disorder, antidepressant disorder not otherwise specified, postpartum depression); seasonal affective disorder; mania; bipolar disorders (including bipolar disorder I, bipolar disorder II, cyclothymic disorder, bipolar disorder not otherwise specified); attention deficit and disruptive behavior disorders (including attention deficit disorder with hyperactivity disorder, conduct disorder, oppositional defiant disorder and / or disruptive behavior disorder not otherwise specified); drug dependence / substance abuse (including abuse of opiates, amphetamines, alcohol, hallucinogens, cannabis, inhalants, phencyclidine, sedatives, hypnotics, tranquilizers and / or cocaine); alcohol-induced disorders; amphetamine-induced disorders; caffeine-induced disorders; nicotine-induced disorder;cannabis-induced disorder;cocaine-induced disorder;hallucinogen-induced disorder;inhalant-induced disorder;nicotine-induced disorder;opioid-induced disorder;phencyclidine-induced disorder;sedative-, hypnotic- or tranquilizer-induced disorder;agitation;apathy;psychosis;excitability;disinhibition;schizophreniform disorder;schizoaffective disorder;delusional disorder;brief psychotic disorder, shared psychotic disorder;substance-induced psychotic disorder;psychotic disorder not otherwise specified;unipolar disorder, mood disorder (e.g. mood disorder with psychotic features);somatoform disorder;factitious psychosis;dissociative disorder;mental retardation;affective and contact disorder of infancy or early childhood;eating disorders, e.g., anorexia nervosa, bulimia nervosa and / or eating disorder not otherwise specified; sleep disorders (e.g., primary insomnia, primary hypersomnia, narcolepsy, breathing-related sleep disorder and circadian rhythm sleep disorder and / or parasomnia); impulse control disorders (e.g., kleptomania, pyromania, trichotillomania, pathological gambling and / or intermittent explosive disorder); adjustment disorders; personality disorders (e.g., paranoid personality disorder, schizophrenic personality disorder, schizophrenic personality disorder, antisocial personality disorder, borderline personality disorder, histrionic personality disorder, narcissistic personality disorder, avoidant personality disorder, dependent personality disorder and / or obsessive-compulsive personality disorder); tic disorders (e.g., Tourette's disorder, chronic motor or vocal tic disorder, transient tic disorder and / or tic disorder not otherwise specified); elimination disorders; and any combination of the foregoing, as well as any other disorder or disorder according to the Diagnostic and Statistical Manual of Mental Disorders - Fourth The term "central nervous system disorders" includes disorders described in the DSM-IV Edition (DSM-IV; the American Psychiatric Association, Washington DC, 1994). "Central nervous system disorders" also includes other conditions involving the CNS, including, but not limited to, neurodegenerative diseases such as Alzheimer's disease, involuntary movement disorders such as Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), and the like. Other CNS disorders include, but are not limited to, epilepsy, multiple sclerosis, neurogenic pain, psychogenic pain, and migraine.

[0175] In one embodiment, the disorder associated with CNS dysfunction is a demyelinating disease. In one embodiment, the disorder associated with CNS dysfunction is multiple sclerosis, Pelizaeus-Merzbacher disease, Krabbe disease, metachromatic leukodystrophy, adrenoleukodystrophy, Canavan disease, Alexander disease, orthochromatic leukodystrophy, Zellweger disease, 18q-syndrome, cerebral palsy, spinal cord injury, traumatic brain injury, stroke, phenylketonuria, or viral infection, or any other disorder known or later discovered to be associated with CNS dysfunction. In another embodiment, the method of the invention is used to treat disorders that are not directly associated with CNS dysfunction but would benefit from expression of a heterologous polypeptide or nucleic acid in CNS cells. Examples include, but are not limited to, neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, and Huntington's disease, CNS tumors, and other CNS disorders.

[0176] In other embodiments, the CNS disorder includes any subset of the aforementioned diseases or excludes any one or more of the aforementioned symptoms. In certain embodiments, the term "central nervous system disorder" does not include benign and / or malignant tumors of the CNS.

[0177] In certain embodiments, the CNS disorder is Rett syndrome. In further embodiments, the present invention relates to a method of treating Rett syndrome in a mammalian subject in need thereof. In certain embodiments, the method comprises administering a therapeutically effective amount of an AAV particle of the present invention, e.g., an AAV particle comprising a nucleic acid encoding methylcytosine-binding protein 2.

[0178] In another aspect of the present invention, the chimeric AAV capsids and vectors of the present invention are fully or nearly fully detargeted vectors that can be further modified to a desired tropism profile for targeting one or more peripheral organs or tissues, as described below. In this aspect, the present invention also relates to a method for delivering heterologous nucleotide sequences into a wide range of cells, including dividing and non-dividing cells. The viral vectors of the present invention can be used to deliver a nucleotide sequence of interest to cells in vitro, for example, to produce a polypeptide in vitro or for ex vivo gene therapy. The vectors are further useful in a method for delivering a nucleotide sequence to a subject in need thereof, for example, to express a therapeutic or immunogenic polypeptide or nucleic acid. In such a method, the polypeptide or nucleic acid can be produced in vivo in the subject. The subject may need the polypeptide or nucleic acid because the subject is deficient in the polypeptide or because the production of the polypeptide or nucleic acid in the subject can provide some therapeutic effect, as a treatment or other method, and as described further below.

[0179] In general, the viral vectors of the present invention can be used to deliver any exogenous nucleic acid having a biological effect to treat or ameliorate symptoms associated with any disorder related to gene expression. Additionally, the present invention can be used to treat any disease state in which it is beneficial to deliver a therapeutic polypeptide. Exemplary disease states include, but are not limited to: cystic fibrosis (cystic fibrosis transmembrane conductance regulator protein) and other diseases of the lung, hemophilia A (factor VIII), hemophilia B (factor IX), thalassemia (β-globin), anemia (erythropoietin) and other blood disorders, Alzheimer's disease (GDF; neprilysin), multiple sclerosis (β-interferon), Parkinson's disease (glial cell line-derived neurotrophic factor [GDNF]), Huntington's disease (inhibitory RNA, including but not limited to, RNAi such as siRNA or shRNA, microRNA or antisense RNA to remove repeats), amyotrophic lateral sclerosis, epilepsy (galanin, neurotrophic factors), and other neurological disorders, cancer (cytokines including endostatin, angiostasin, TRAIL, FAS-ligand, interferons;Inhibitory RNA, including but not limited to RNAi (e.g., siRNA or shRNA), antisense RNA and microRNA, including inhibitory RNA against VEGF, multidrug resistance gene products or cancer immunogens), diabetes (insulin, PGC-α1, GLP-1, myostatin pro-peptide, glucose transporter 4), muscular dystrophies including Duchenne and Becker (e.g., inhibitory RNA [e.g., RNAi, antisense RNA or microRNA] against dystrophin, mini-dystrophin, micro-dystrophin, insulin-like growth factor I, sarcoglycans [e.g., α, β, γ], myostatin or myostatin pro-peptide, laminin-α2, fukutin-related protein, dominant negative myostatin, follistatin, activin type 2 soluble receptor, anti-inflammatory polypeptides, e.g., Ikappa Inhibitory RNAs (e.g., RNAi, antisense RNA, or microRNAs) directed against splice sites in the B dominant mutant, sarcospan, utrophin, mini-utrophin, dystrophin gene to induce exon skipping [see, e.g., WO / 2003 / 095647], U7 inhibitory RNA against snRNA (e.g. RNAi, antisense RNA or microRNA [see, e.g. WO / 2006 / 021724] and antibodies or antibody fragments against myostatin or myostatin propeptide), Gaucher disease (glucocerebrosidase), Furler disease (α-L-iduronidase), adenosine deaminase deficiency (adenosine deaminase), glycogen storage diseases (e.g. Fabry disease [α-galactosidase] and Pompe disease [lysosomal acid α-glucosidase]) and other metabolic defects including other lysosomal and glycogen storage diseases, congenital emphysema (α1-antitrypsin), Lesch-Nyhan syndrome (hypoxanthine guanine phosphoribosyltransferase), Niemann-Pick disease (sphingomyelinase), maple syrup urine disease (branched ketoacid dehydrogenase), retinal degenerative diseases (and other diseases of the eye and retina;For example, for macular degeneration, PDGF, endostatin and / or angiostatin), diseases of solid organs such as the brain (including Parkinson's disease [GDNF], astrocytoma [RNAi against endostatin, angiostatin and / or VEGF], glioblastoma [RNAi against endostatin, angiostatin and / or VEGF]), liver (RNAi such as siRNA or shRNA, microRNA or antisense RNA for hepatitis B and / or hepatitis C genes), kidney, heart, congestive heart failure or peripheral arterial disease (PAD), including (e.g., protein phosphatase inhibitor I [I-1], phospholamban, sarcoplasmic endoreticulum Ca; 2+-ATPase [serca2a], zinc finger proteins regulating the phospholamban gene, Pim-1, PGC-1α, SOD-1, SOD-2, ECF-SOD, calculin, thymosin-β4, hypoxia-inducible transcription factor [HIF], βarkct, β2-adrenergic receptor, β2-adrenergic receptor kinase [βARK], phosphoinositide-3 kinase [PI3 kinase], calsarcin, angiogenic factors, S100A1, parvalbumin, type 6 adenylyl cyclase, molecules that actuate knockdown of type 2 G-protein coupled receptor kinase, e.g., truncated constitutively active bARKct, inhibitory RNA against phospholamban [e.g., RNAi, antisense RNA or microRNA]; by delivery of phospholamban inhibitory or dominant negative molecules, e.g., phospholamban S16E, etc. ), arthritis (insulin-like growth factor), joint disorders (insulin-like growth factor), intimal hyperplasia (e.g., by delivery of enos, inos), improved survival of heart transplants (superoxide dismutase), AIDS (soluble CD4), muscle wasting (insulin-like growth factor I, myostatin pro-peptide, anti-apoptotic factors, follistatin), limb ischemia (VEGF, FGF, PGC-1α, EC-SOD, HIF), renal deficiency (erythropoietin), anemia (erythropoietin), arthritis (anti-inflammatory factors, e.g., IRAP and TNFα soluble receptor), hepatitis (α-interferon), LDL receptor deficiency (LDL receptor), hyperammonemia (ornithine transcarbamylase), spinocerebral ataxias, including SCA1, SCA2 and SCA3, phenylketonuria (phenylalanine hydroxylase), autoimmune diseases, etc. Additionally, the present invention can be used following organ transplantation to enhance transplant success and / or reduce negative side effects or adjuvant therapy of organ transplantation (e.g., by administering immunosuppressants or inhibitory nucleic acids to block cytokine production). As another example, bone morphogenetic proteins (including RANKL and / or VEGF) can be administered with bone allografts, for example, following fracture break or surgical removal in cancer patients.

[0180] Exemplary lysosomal diseases that can be treated according to the present invention include, but are not limited to: Hurler syndrome (MPS IH), Scheie syndrome (MPS IS), and Hurler-Scheie syndrome (MPS IH / S) (α-L-iduronidase); Hunter syndrome (MPS II) (iduronate sulfate sulfatase); Sanfilippo A syndrome (MPS IIIA) (heparan-S-sulfate sulfaminidase), Sanfilippo B syndrome (MPS IIIB) (N-acetyl-D-glucosaminidase), Sanfilippo C syndrome (MPS IIIC) (acetyl-CoA-glucosaminide N-acetyltransferase), Sanfilippo D syndrome (MPS IIID) (N-acetyl-glucosamine-6-sulfate sulfatase); Morquio A disease (MPS IVA) (galactosamine-6-sulfate sulfatase), Morquio B disease (MPS IH / S) (α-L-iduronidase); IVB) (β-galactosidase); Maroteaux-Imay disease (MPS VI) (arylsulfatase B); Sly syndrome (MPS VII) (β-glucuronidase); hyaluronidase deficiency (MPS IX) (hyaluronidase); sialidosis (mucolipidosis I), mucolipidosis II (I-cell disease) (N-actylglucos-aminyl-1-phosphotransferase catalytic subunit), mucolipidosis III (pseudo-Hurler polydystrophy) (N-acetylglucos-aminyl-1-phosphotransferase; type IIIA [catalytic subunit] and type IIIC [substrate recognition subunit]); GM1 gangliosidosis (ganglioside β-galactosidase), type I GM GM2 gangliosidosis type 2 (Tay-Sachs disease) (β-hexaminidase A), GM2 gangliosidosis type II (Sandhoff disease) (β-hexosaminidase B); Niemann-Pick disease (types A and B) (sphingomyelinase); Gaucher disease (glucocerebrosidase); Farber disease (ceraminidase); Fabry disease (α-galactosidase A); Krabbe disease (galactosylceramide β-galactosidase); metachromatic leukodystrophy (arylsulfatase A); lysosomal acid lipase deficiency including Wolman disease (lysosomal acid lipase);Includes Batten disease (juvenile neuronal ceroid lipofuscinosis) (lysosomal transmembrane CLN3 protein); sialidosis (neuraminidase 1); galactosialidosis (Goldberg syndrome) (protective protein / cathepsin A); α-mannosidosis (α-D-mannosidase); β-mannosidosis (β-D-mannosidosis); fucosidosis (α-D-fucosidase); aspartylglucosaminuria (N-aspartylglucosaminidase); and sialic aciduria (sodium phosphate cotransporter);

[0181] Exemplary glycogen storage diseases that can be treated according to the present invention include, but are not limited to, GSD type Ia (von Gierke's disease) (glucose-6-phosphatase), GSD type Ib (glucose-6-phosphate translocase), GSD type Ic (microsomal phosphate or pyrophosphate transporter), GSD type Id (microsomal glucose transporter), GSD type II, including Pompe's disease or early childhood GSD type IIa (lysosomal acid α-glucosidase) and GSD type IIb (Danon) (lysosomal membrane protein-2), GSD types IIIa and IIIb. GSD type IV (Anderson's disease) (branching enzymes), GSD type V (McArdle's disease) (muscle phosphorylase), GSD type VI (Haas's disease) (liver phosphorylase), GSD type VII (Tarui's disease) (phosphofructokinase), GSD type VIII / IXa (X-linked phosphorylase kinase), GSD type IXb (liver and muscle phosphorylase kinase), GSD type IXc (liver phosphorylase kinase), GSD type IXd (muscle phosphorylase kinase), GSD O (glycogen synthase), Fanconi-Bickel syndrome (glucose transporter-2), phosphoglucoisomerase deficiency, muscle phosphoglycerate kinase deficiency, phosphoglycerate mutase deficiency, fructose 1,6-diphosphatase deficiency, phosphoenolpyruvate carboxykinase deficiency, and lactate dehydrogenase deficiency.

[0182] Nucleic acids and polypeptides that can be delivered to the myocardium include those that are beneficial in treating damaged, deteriorated or degenerated myocardium and / or congenital heart defects. For example, angiogenic factors useful for promoting angiogenesis in the treatment of cardiac disease include, but are not limited to, vascular endothelial growth factor (VEGF), VEGFII, VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF-F ... 121 , VEGF 138 , VEGF 145 , VEGF 165 , VEGF 189 , VEGF 206, hypoxia-inducible factor 1α (HIF 1α), endothelial NO synthase (eNOS), iNOS, VEFGR-1 (Flt1), VEGFR-2 (KDR / Flk1), VEGFR-3 (Flt4), angiogenin, epidermal growth factor (EGF), angiopoietin Platelet-derived growth factor, angiogenic factor, transforming growth factor-α (TGF-α), transforming growth factor-β (TGF-β), vascular permeability factor (VPF), tumor necrosis factor α (TNF-α), interleukin-3 (IL-3), Interleukin-8 (IL-8), platelet-derived endothelial growth factor (PD-EGF), granulocyte colony-stimulating factor (G-CSF), hepatocyte growth factor (HGF), scatter factor (SF), pleitrophin, proliferin, follistatin, placental growth factor (PIGF), midkine, platelet-derived growth factor-BB (PDGF), fractalkine, ICAM-1, angiopoietin-1 and -2 (Ang1 and Ang2), Tie-2, neuropilin-1, ICAM-1, chemokines, and cytokines that stimulate smooth muscle cell, monocyte, or leukocyte migration, anti-apoptotic peptides and proteins, fibroblast growth factors (FGFs), FGF-1, FGF-1b, FGF-1c, FGF-2, FGF-2b, FGF-2c, FGF-3, FGF-3b, FGF-3c, FGF-4, FGF-5, FGF-7, FGF-9, acidic FGF, basic FGF, monocyte chemotaxis These include chemokine protein-1, granulocyte-macrophage-colony stimulating factor, insulin-like growth factor-1 (IGF-1), IGF-2, early growth response factor-1 (EGR-1), ETS-1, human tissue calkurein (HK), matrix metalloproteinase, chymase, urokinase-type plasminogen activator, and heparinase (see, e.g., U.S. Patent Application No. 20060287259 and U.S. Patent Application No. 20070059288).

[0183] The most common congenital heart defect seen in adults is the bicuspid aortic valve, while atrial septal defect accounts for 30-40% of congenital heart defects seen in adults. The most common congenital heart defect seen in the pediatric population is the ventricular septal defect. Other congenital heart defects include Eisenmenger syndrome, patent ductus arteriosus, pulmonary stenosis, coarctation of the aorta, transposition of the great arteries, tricuspid atresia, single ventricle, Ebstein anomaly, and double outlet right ventricle. Many studies have identified putative genetic loci associated with one or more of these congenital heart diseases. For example, the putative gene(s) for congenital heart disease associated with Down syndrome is 21q22.2-q22.3 between ETS2 and MX1. Similarly, most cases of DiGeorge syndrome result from deletions of chromosome 22q11.2 (the DiGeorge syndrome chromosomal region, or DGCR). Several genes are lost in this deletion, including the putative transcription factor TUPLE1.This deletion is associated with various phenotypes, such as Shprintzen syndrome; conotruncal dysfacies (or Takao syndrome); and isolated cardiac outflow tract defects, including tetralogy of Fallot, truncus arteriosus, and interrupted aortic arch.All of the above disorders can be treated according to the present invention.

[0184] Other serious diseases of the heart and vascular system are also thought to have a genetic, typically polygenic, component of etiology. These diseases include, for example, hypoplastic left heart syndrome, valvular dysplasia, Peiffel cardiorenal syndrome, oculofaciocardiodental syndrome, Kaper-Triello syndrome, Sonoda syndrome, Ohdo palpebral fissure syndrome, heart-hand syndrome, Pierre Robin syndrome, Hirschsprung disease, Kousseff syndrome, Grange occlusive arterial syndrome, Kearns-Sayre syndrome, Kartagener syndrome, Alagille syndrome, Richter-Skinzel syndrome, Ivemark syndrome, Young-Simpson syndrome, hemacromatosis, Holzgreve syndrome, Baxter syndrome, and others. These disorders include, but are not limited to, Fabry disease, Lowry-Maclean syndrome, Rett syndrome, Opitz syndrome, Marfan syndrome, Miller-Dieker dysbiosis, mucopolysaccharidoses, Brugada syndrome, humerospinal osteogenesis imperfecta, Fabry syndrome, McDonough syndrome, Marfan-like hypermobility syndrome, atransferrinemia, Cornelia de Lange syndrome, Leopard syndrome, Diamond-Blackfan anemia, Steinfeld syndrome, progeria, and Williams-Beuren syndrome. All of these disorders can be treated according to the present invention.

[0185] Anti-apoptotic factors can be delivered to skeletal, diaphragm and / or cardiac muscle to treat muscle wasting diseases, limb ischemia, myocardial infarction, heart failure, coronary artery disease and / or type I or type II diabetes.

[0186] Nucleic acids that can be delivered to skeletal muscle include those that are beneficial in treating damaged, deteriorated or degenerated skeletal muscle. Genetic defects that cause muscular dystrophy are known for many forms of the disease. These defective genes either fail to produce a protein product, produce a protein product that cannot function properly, or produce a dysfunctional protein product that prevents the proper functioning of the cell. The heterologous nucleic acid can encode a therapeutically functional protein or polynucleotide that inhibits the production or activity of the dysfunctional protein. Polypeptides that may be expressed from the resulting nucleic acid or inhibited by the resulting nucleic acid (e.g., by delivery of RNAi, microRNA or antisense RNA) include, but are not limited to, dystrophin, mini-dystrophin or micro-dystrophin (Duchene's and Becker MD); dystrophin-associated glycoproteins β-sarcoglycan (limb girdle MD 2E), δ-sarcoglycan (limb girdle MD 2 2F), α-sarcoglycan (limb girdle MD 2D) and γ-sarcoglycan (limb girdle MD 2C), utrophin, calpain (autosomal recessive limb girdle MD type 2A), caveolin-3 (autosomal dominant limb girdle MD), laminin-α2 (merosin-deficient congenital MD), miniagrin (laminin-α2-deficient congenital MD), fukutin (Fukuyama type congenital MD), emerin (Emery-Dreifuss MD), myotilin, lamin A / C, calpain-3, dysferlin, and / or telethonin. Additionally, the heterologous nucleic acid may encode antisense RNA, RNAi (e.g., siRNA or shRNA) or microRNA, or mir-1, mir-133, mir-206, mir-208 to induce exon skipping in the defective dystrophin gene.

[0187] In certain embodiments, the nucleic acid is delivered to the tongue muscle (e.g., to treat a dystrophic tongue) by any method known in the art, including direct injection into the tongue, oral administration, topical administration, intravenous administration, intra-articular administration, etc.

[0188] The proteins can also be administered to the diaphragm muscle to treat muscular dystrophies.

[0189] Alternatively, a gene transfer vector encoding any other therapeutic polypeptide may be administered.

[0190] In certain embodiments, the viral vectors of the invention are used to deliver a nucleic acid of interest as described herein to skeletal muscle, diaphragm muscle and / or cardiac muscle, e.g., to treat disorders associated with one or more of these tissues, such as muscular dystrophies, cardiac diseases (including PAD and congestive heart failure), etc.

[0191] Gene transfer has substantial potential applications in providing and understanding treatments for disease states. There are many genetic diseases for which the defective genes are known and cloned. In general, the above disease states are divided into two classes: deficiency states, usually enzyme deficiencies, which are generally inherited in a recessive manner, and imbalance states, which may involve regulatory or structural proteins, which are typically inherited in a dominant manner. For diseases with deficiency states, gene transfer can be used to carry normal genes into affected tissues for replacement therapy, as well as to create animal models for the disease using inhibitory RNA, such as RNAi (e.g., siRNA or shRNA), microRNA or antisense RNA. For imbalance disease states, gene transfer can be used to create the disease in a model system, which can then be used to resolve the disease. Thus, the viral vectors according to the present specification allow the treatment of genetic diseases. As used herein, a disease state is treated by treating, partially or totally, the deficiency or imbalance that causes the disease or makes it more severe. The use of site-specific recombination of nucleic acid sequences to create mutations or correct defects is also possible.

[0192] The viral vector of the present invention may also be used to provide antisense nucleic acid or inhibitory RNA (e.g., microRNA or RNAi, e.g., siRNA or shRNA) to cells in vitro or in vivo. Expression of inhibitory RNA in a target cell reduces the expression of a particular protein(s) by the cell. Thus, inhibitory RNA may be administered to reduce the expression of a particular protein in a subject in need thereof. Inhibitory RNA may also be administered to cells in vitro to regulate the physiology of the cell, for example, to optimize cell or tissue culture systems.

[0193] In a further aspect, the viral vector of the present invention can be used to generate an immune response in a subject. According to this embodiment, a viral vector containing a nucleic acid encoding an immunogen can be administered to a subject, and the subject can mount an active immune response (optionally a protective immune response) against the immunogen. The immunogen is as described above.

[0194] Alternatively, the viral vector may be administered to cells ex vivo and the modified cells administered to a subject. A heterologous nucleic acid is introduced into the cells and the cells are administered to a subject, where the heterologous nucleic acid encoding an immunogen is optionally expressed to induce an immune response in the subject against the immunogen. In certain embodiments, the cells are antigen-presenting cells (e.g., dendritic cells).

[0195] An "active immune response" or "active immunity" is "characterized by the participation of host tissues and cells after an immunogen is encountered. It involves the differentiation and proliferation of immunocompetent cells in lymphoreticular tissues, resulting in the synthesis of antibodies or the development of cell-mediated reactivity, or both." Herbert B. Herscowitz, Immunophysiology: Cell Function and Cellular Interactions in Antibody Formation, in IMMUNOLOGY: BASIC PROCESSES 117 (Joseph A. Bellanti ed., 1985). In other words, an active immune response is mounted by the host after exposure to an immunogen, either by infection or by vaccination. Active immunity can be contrasted with passive immunity, which is acquired through "the transfer of preformed substances (antibodies, transfer factors, thymus grafts, interleukin-2) from an actively immunized host to a non-immunized host." Id.

[0196] As used herein, a "protective" immune response or "protective" immunity indicates that the immune response provides some benefit to the subject in terms of preventing or reducing the incidence of disease. Alternatively, a protective immune response or immunity may be useful in the treatment of disease, particularly cancer or tumor (e.g., by causing the regression of cancer or tumor and / or by preventing metastasis and / or by preventing the growth of metastatic nodules). The protective effect may be complete or partial, so long as the benefits of the treatment outweigh any disadvantages thereof.

[0197] The viral vector of the present invention may also be administered for cancer immunotherapy by administering a viral vector that expresses a cancer cell antigen (or an immunologically similar molecule) or any other immunogen that generates an immune response against cancer cells. To explain, an immune response can be generated against a cancer cell antigen in a subject by administering a viral vector that contains a heterologous nucleotide sequence that encodes the cancer cell antigen, for example, to treat a patient with cancer. The viral vector can be administered to a subject by using in vivo or ex vivo methods as described herein.

[0198] As used herein, the term "cancer" includes cancers that form tumors. Similarly, the term "cancerous tissue" includes tumors. "Cancer cell antigens" includes tumor antigens.

[0199] The term "cancer" has its art-understood meaning as uncontrolled tissue growth with the potential to spread (i.e., metastasize) to distant sites in the body. Exemplary cancers include, but are not limited to, leukemia, lymphoma (e.g., Hodgkin's and non-Hodgkin's lymphoma), colorectal cancer, renal cancer, liver cancer, breast cancer, lung cancer, prostate cancer, testicular cancer, ovarian cancer, uterine cancer, cervical cancer, brain cancer (e.g., glioma and glioblastoma), bone cancer, sarcoma, melanoma, head and neck cancer, esophageal cancer, thyroid cancer, and the like. In an embodiment of the invention, the invention is practiced to treat and / or prevent tumor-forming cancers.

[0200] The term "tumor" is also understood in the art as, for example, an abnormal mass of undifferentiated cells within a multicellular organism. Tumors can be malignant or benign. In exemplary embodiments, the methods disclosed herein are used to prevent and treat malignant tumors.

[0201] Cancer cell antigens are described above. By the term "treating cancer" or "treatment of cancer", it is intended that the severity of cancer is reduced, or that cancer is prevented or at least partially eliminated. For example, in certain contexts, these terms indicate that the metastasis of cancer is prevented or reduced or at least partially eliminated. In further representative embodiments, these terms indicate that the growth of metastatic nodules (e.g., after surgical removal of primary tumor) is prevented or reduced or at least partially eliminated. By the term "preventing cancer" or "preventing cancer", it is intended that the method at least partially eliminates or reduces the incidence or onset of cancer. In other words, the onset or progression of cancer in a subject can be slowed, controlled, reduced possibility or probability, or delayed.

[0202] In certain embodiments, cells can be removed from a subject with cancer and contacted with the viral vector of the present invention. The modified cells are then administered to the subject, thereby eliciting an immune response against the cancer cell antigens. This method is particularly advantageously used in immunocompromised subjects who are unable to mount a sufficient immune response in vivo (i.e., unable to produce high levels of antibodies in sufficient quantities).

[0203] It is known in the art that immune responses can be enhanced by immunomodulatory cytokines (e.g., α-interferon, β-interferon, γ-interferon, ω-interferon, τ-interferon, interleukin-1α, interleukin-1β, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-6, interleukin-7, interleukin-8, interleukin-9, interleukin-10, interleukin-11, interleukin-12, interleukin-13, interleukin-14, interleukin-18, B-cell growth factor, CD40 ligand, tumor necrosis factor-α, tumor necrosis factor-β, monocyte chemotactic protein-1, granulocyte-macrophage colony-stimulating factor, and lymphotoxin). Thus, immunomodulatory cytokines (e.g., CTL-inducing cytokines) can be administered to a subject together with a viral vector.

[0204] The cytokine may be administered by any method known in the art. Exogenous cytokines may be administered to a subject, or, alternatively, a nucleotide sequence encoding the cytokine may be delivered to a subject using an appropriate vector and the cytokine produced in vivo.

[0205] Viral vectors are further useful for targeting CNS cells for research purposes, e.g., for the study of CNS function in vitro or in animals, or for use in creating and / or studying animal models of disease. For example, vectors can be used to deliver heterologous nucleic acid to neurons in animal models of neuronal injury, such as traumatic brain injury or spinal cord injury, or animal models of neurodegenerative disease. For example, vectors can be used to deliver heterologous nucleic acid to oligodendrocytes in animal models of demyelinating disease. Demyelination can be induced in animals by a variety of means, including, but not limited to, administration of viruses (e.g., Semliki virus, murine hepatitis virus, or Theiler-Mueller-Encephalomyelitis virus) and administration of chemicals (e.g., cuprizone, ethidium bromide, or lysolecithin). In some embodiments, vectors can also be used in animal models of experimental autoimmune encephalomyelitis. This condition can be induced, for example, by administration of kainite, SIN-1, antigalactocerebroside, or by irradiation. In other embodiments, a toxic drug or an enzyme that produces a toxic drug (eg, thymidine kinase) can be delivered specifically to oligodendrocytes using a viral vector to kill some or all of the cells.

[0206] Furthermore, the viral vectors according to the invention find further use in diagnostic and screening methods, whereby a gene of interest is expressed, either transiently or stably, in cell culture systems or, alternatively, in transgenic animal models. The invention can also be implemented to deliver nucleic acids, for example, for the purpose of protein production for experimental, industrial or commercial purposes.

[0207] The recombinant viral vectors of the present invention find use in both veterinary and medical applications. Suitable subjects include both birds and mammals. The term "birds" as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasants, parrots, and parakeets. The term "mammals" as used herein includes, but is not limited to, humans, primates, non-human primates (e.g., monkeys and baboons), cows, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g., rats, mice, hamsters, and the like), and the like. Human subjects include neonates, infants, juveniles, and adults. In some cases, a subject is "in need" of the methods of the present invention, for example, because the subject is believed to have or be at risk for a disorder, including those described herein, or would benefit from delivery of a nucleic acid, including those described herein. For example, in certain embodiments, the subject has (or has had), or is at risk for, a demyelinating disorder or spinal cord or brain injury. As a further option, the subject may be an experimental animal and / or an animal model of a disease.

[0208] In certain embodiments, the present invention provides pharmaceutical compositions comprising a viral vector of the present invention in a pharma- ceutically acceptable carrier, and optionally other medicinal agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier is typically a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier is respirable, and is preferably in solid or liquid particulate form.

[0209] By "pharmacologically acceptable" it is meant a material that is not toxic or otherwise undesirable, ie, the material may be administered to a subject without causing any undesired biological effects.

[0210] One aspect of the present invention is a method for transferring a nucleotide sequence into a cell in vitro. The viral vector can be introduced into the cell at an appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cell. The titer of the viral vector or capsid administered can vary depending on the target cell type and number and the particular viral vector or capsid, and can be determined by one of skill in the art without undue experimentation. In certain embodiments, the titer is at least about 10 3 10 infectious units, more preferably at least about 10 5 The infectious unit is introduced into the cells.

[0211] The cell(s) into which the viral vector can be introduced can be of any type, including, but not limited to, neural cells (including cells of the peripheral and central nervous system, specifically brain cells, e.g., neurons, oligodendrocytes, glial cells, astrocytes), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g., intestinal and respiratory epithelial cells), skeletal muscle cells (including myoblasts, myotubes, and myofibers), diaphragm muscle cells, dendritic cells, pancreatic cells (including pancreatic islet cells), hepatic cells, cells of the digestive tract (including smooth muscle cells, epithelial cells), cardiac cells (including cardiac muscle cells), bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, articular cells (including, e.g., cartilage, meniscus, synovium, and bone marrow), germ cells, and the like. Alternatively, the cell can be any progenitor cell. As a further alternative, the cell can be a stem cell (e.g., neural stem cells, hepatic stem cells). Additionally, as a further alternative, the cells may be cancer or tumor cells (cancer and tumor are discussed above). Additionally, the cells may be from any of the species of origins indicated above.

[0212] The viral vector can be introduced into cells in vitro for the purpose of administering the modified cells to a subject. In certain embodiments, cells are removed from a subject, the viral vector is introduced into them, and then the cells are returned to the subject. Methods for removing cells from a subject for ex vivo treatment and then returning them to the subject are known in the art (see, for example, U.S. Patent No. 5,399,346). Alternatively, the recombinant viral vector is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof.

[0213] Cells suitable for ex vivo gene therapy are described above. The dose of cells administered to a subject varies based on the age, condition and species of the subject, the type of cells, the nucleic acid expressed by the cells, the method of administration, etc. Typically, the cells are administered in a pharma- ceutically acceptable carrier at least about 10 2 ~about 10 8 or about 10 3 ~about 10 6 of cells are administered per dose. In certain embodiments, cells transduced with a viral vector are administered to a subject in an effective amount in combination with a pharmaceutical carrier.

[0214] In some embodiments, cells that have been transduced with a viral vector can be administered to induce an immunogenic response against the delivered polypeptide (e.g., expressed as a transgene or within the capsid). Typically, an amount of cells expressing an effective amount of the polypeptide is administered in combination with a pharma- ceutically acceptable carrier. Optionally, the dose is sufficient to generate a protective immune response (as defined above). The degree of protection conferred need not be complete or permanent, so long as the benefits of administering the immunogenic polypeptide outweigh any disadvantages.

[0215] A further aspect of the present invention is a method of administering the capsid or viral vector of the present invention to a subject. In a particular embodiment, the method includes a method of delivering a nucleic acid of interest to an animal subject, the method comprising administering an effective amount of the viral vector of the present invention to the animal subject. The administration of the viral vector of the present invention to a human subject or an animal in need thereof may be by any means known in the art. Optionally, the viral vector is delivered in an effective dosage in a pharma- ceutically acceptable carrier.

[0216] Furthermore, the viral vector of the present invention can be administered to a subject to induce an immunogenic response (e.g., as a vaccine). Typically, the vaccine of the present invention comprises an effective amount of the virus in combination with a pharma- ceutically acceptable carrier. In some cases, the dose is sufficient to generate a protective immune response (as defined above). The degree of protection provided does not need to be complete or permanent, as long as the benefits of administering the immunogenic polypeptide outweigh any disadvantages thereof, and the subject and immunogen are as described above.

[0217] The dose of the viral vector administered to a subject depends on the method of administration, the disease or condition being treated, the condition of the individual subject, the particular viral vector, and the nucleic acid being delivered, and can be determined by routine methods. An exemplary dosage to achieve a therapeutic effect is at least about 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 3 , 10 14 , 10 15 Transducing units or more, preferably about 10 7 or 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 or 10 14Transducing units, even more preferably about 10 12 Viral titer in transducing units.

[0218] In certain embodiments, more than one administration (e.g., 2, 3, 4 or more administrations) may be used to achieve a desired level of gene expression over various intervals, e.g., daily, weekly, monthly, yearly, etc.

[0219] Exemplary methods of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intrauterine (or intraovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to the skeleton, diaphragm and / or myocardium], intradermal, intrapleural, intracerebral, and intra-articular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, etc., as well as direct tissue or organ injection (e.g., to the liver, skeletal muscle, myocardium, diaphragm muscle, or brain). Administration may also be to a tumor (e.g., in or near a tumor or lymph node). The most appropriate route in any given case will depend on the nature and severity of the condition being treated and the nature of the particular vector being used.

[0220] In some embodiments, the viral vector is administered directly to the CNS, e.g., the brain or spinal cord. Direct administration can result in highly specific transduction of CNS cells, e.g., where at least 80%, 85%, 90%, 95% or more of the transduced cells are CNS cells. Any method known in the art for administering a vector directly to the CNS can be used. The vector can be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary, substantia nigra, pineal gland), cerebellum, telencephalon (cerebrum including striatum, occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and amygdala), limbic system, neocortex, striatum, cerebrum, and inferior colliculus. The vector can also be administered to different regions of the eye, such as the retina, cornea or optic nerve. The vector can be delivered into the cerebrospinal fluid (e.g., by lumbar puncture) to better distribute the administration of the vector.

[0221] The delivery vector may be administered to the desired region(s) of the CNS by any route known in the art, including, but not limited to, intrathecal, intracerebral, intraventricular, intranasal, intraaural, intraocular (e.g., intravitreal, subretinal, anterior chamber) and periocular (e.g., sub-Tenon's area) delivery, or any combination thereof.

[0222] Typically, viral vectors are administered in liquid formulations to the desired area or compartment in the CNS by direct injection (e.g., stereotactic injection). In some embodiments, the vectors can be delivered via a reservoir and / or pump. In other embodiments, the vectors can be provided by topical application to the desired area or by intranasal administration of an aerosol formulation. Administration into the eye or ear can be by topical application of liquid droplets. As a further alternative, the vectors can be administered as a solid sustained release formulation. Controlled release of parvovirus and AAV vectors is described in International Patent Publication WO 01 / 91803.

[0223] In some embodiments, where a subject has a compromised blood-brain barrier (BBB), a viral vector can be delivered systemically (e.g., intravenously) to the subject, where the vector transduces CNS cells in areas (e.g., borders) of BBB compromise. In certain embodiments, the vector transduces cells in the compromised area, but not cells in intact areas. Thus, one aspect of the invention relates to a method of delivering a nucleic acid of interest to an area of ​​the CNS adjacent to a compromised blood-brain barrier area in a mammalian subject, the method comprising the step of intravenously administering an effective amount of an AAV particle of the invention.

[0224] In some embodiments, the damage in the BBB is due to a disease or disorder. Examples include, but are not limited to, neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and multiple sclerosis, epilepsy, CNS tumors, or cerebral infarction. In other embodiments, the BBB damage can be induced destruction, for example, to facilitate the delivery of drugs to the CNS. Transient BBB damage can be induced, for example, by toxic chemicals (e.g., metrazol, VP-16, cisplatin, hydroxyurea, fluorouracil, and etoposide), permeation agents (e.g., mannitol and arabinose), biological agents (e.g., retinoic acid, phorbol myristate acetate, leukotriene C4, bradykinin, histamine, RMP-7, and alkylglycerol), or irradiation (e.g., ultrasound or electromagnetic radiation).

[0225] Administration to skeletal muscle in accordance with the present invention includes, but is not limited to, administration to skeletal muscle in the limbs (e.g., upper arm, forearm, upper leg, and / or lower leg), back, neck, head (e.g., tongue), chest, abdomen, pelvis / perineum, and / or fingers. Suitable skeletal muscle tissues include, but are not limited to, abductor digiti minimi (hand), abductor digiti minimi (foot), abductor pollicis, abductor ossis metatarsi (abductor ossis metatarsi), and / or muscularis pars intermedius (abductor ossis metatarsi). quinti), abductor pollicis brevis, abductor pollicis longus, adductor brevis, adductor hallucis, adductor longus, adductor magnus, adductor pollicis, anterior scalene, genu, biceps brachii, biceps femoris, brachialis, brachioradialis, buccinator, coracoidos, corrugator supercilii, deltoid, depressor anguli oris, depressor labii inferior, digastric, dorsal interosseous (hand), dorsal interosseous (foot), extensor carpi radialis brevis, extensor carpi radialis longus, ulnaris Extensor carpi radialis, Extensor digitorum minimi, Extensor digitorum brevis, Extensor digitorum longus, Extensor pollicis brevis, Extensor hallucis longus, Extensor digitorum index, Extensor pollicis brevis, Extensor pollicis longus, Flexor carpi radialis, Flexor carpi ulnaris, Flexor digitorum brevis (hand), Flexor digitorum brevis (foot), Flexor digitorum brevis, Flexor digitorum longus, Flexor digitorum profundus, Flexor digitorum superficialis, Flexor hallucis brevis, Flexor hallucis longus, Flexor pollicis brevis, Flexor pollicis longus, Frontalis, Gastrocnemius, Geniohyoid, Gluteus maximus, gluteus medius, gluteus minimus, gracilis, iliocostalis cervicis, iliocostalis lumborum, iliocostalis thoracis, iliacus, inferior gemellus, inferior oblique, inferior rectus, infraspinatus, interspinatus, intertransversi, lateral pterygoid, lateral rectus, latissimus dorsi, levator anguli oris, infraorbital, levator labii nasalis superioris, levator palpebrae superioris, levator scapulae, rotator longus rotators), Longissimus capitis, Longissimus cervix, Longissimus thoracis, Longus capitis, Longus colli, Lumbricus (hand), Lumbricus (foot), Masseter, Medial pterygoid, Medial rectus, Scalene medial, Multifidus, Mylohyoid, Oblique capitis inferior, Oblique capitis superior, Obturator externus, Obturator internus, Occipitalis, Omotohyoid, Opponents digiti minimi, Opponents pollicis, Orbicularis oculi, Orbicularis oris, Palmar interosseous, Palmaris brevis, Palmaris longus, Pubicius, Pectoralis major, Pectoralis minor, Peroneus brevis Muscles, peroneus longus, peroneus 3, piriformis, interosseus plantaris, plantaris, platysma, popliteus, scalene posterior, pronator quadratus, pronator teres, psoas major, quadratus femoris, quadratus plantaris, rectus capitis anterior, rectus capitis posterior, rectus capitis posterior major, rectus capitis posterior minor, rectus femoris, rhomboid major, rhomboid minor, sartorius, scalene minimus, semimembranosus, semispinalis capitis, semispinalis cervix, semispinalis thoracic, semitendinosus, serratus anterior, short rotatorrotators), soleus, spinalis capitis, spinalis cervicis, thoracic spinalis, splenius capitis, splenius cervicis, sternocleidomastoid, sternohyoid, sternothyroid, stylohyoid, subclavius, subscapularis, superior gemellus, superior oblique, superior rectus, supinator, supraspinatus, temporalis, tensor fasciae latae, teres major, teres minor, thoracic, thyrohyoid, tibialis anterior, tibialis posterior, trapezius, triceps brachii, vastus intermedius, vastus lateralis, vastus medialis, zygomaticus major, and zygomaticus minor, and any other suitable skeletal muscle known in the art.

[0226] Viral vectors can be delivered to skeletal muscle by any suitable method, including, but not limited to, intravenous administration, intraarterial administration, intraperitoneal administration, isolated limb perfusion (foot and / or arm; see, e.g., Arruda et al., (2005) Blood 105:3458-3464), and / or direct intramuscular injection.

[0227] Administration to the myocardium includes, but is not limited to, administration to the left atrium, right atrium, left ventricle, right ventricle and / or septum. The viral vector can be delivered to the myocardium by any method known in the art, including, for example, intravenous administration, intra-aortic administration, e.g., intra-arterial administration, direct cardiac injection (e.g., into the left atrium, right atrium, left ventricle, right ventricle), and / or coronary perfusion.

[0228] Administration to the diaphragm muscle may be by any suitable method, including intravenous administration, intraarterial administration, and / or intraperitoneal administration.

[0229] Delivery to any of these tissues can also be accomplished by delivering a depot containing the viral vector that can be implanted into the skeletal, cardiac and / or diaphragm muscle tissue, or the tissue can be contacted with a film or other matrix containing the viral vector. Examples of such possible matrices or substrates are described in U.S. Patent No. 7,201,898.

[0230] In certain embodiments, viral vectors of the invention are administered to skeletal, diaphragm and / or cardiac muscles (e.g., to treat muscular dystrophy or cardiac disease (e.g., PAD or congestive heart failure)).

[0231] The present invention can be used to treat disorders of skeletal, cardiac and / or diaphragm muscles. Alternatively, the present invention can be implemented to deliver nucleic acids to skeletal, cardiac and / or diaphragm muscles, and used as a platform for the production of non-translated RNA (e.g., RNAi, microRNA, antisense RNA) or protein products (e.g., enzymes) that normally circulate in the blood, or for systemic delivery to other tissues to treat disorders (e.g., metabolic disorders such as diabetes (e.g., insulin), hemophilia (e.g., factor IX or factor VIII), or lysosomal storage diseases (e.g., Gaucher disease [glucocerebrosidase], Pompe disease [lysosomal acid alpha-glucosidase] or Fabry disease [alpha-galactosidase A]) or glycogen storage diseases (e.g., Pompe disease [lysosomal acid alpha-glucosidase]). Other suitable proteins for the treatment of metabolic disorders are described above.

[0232] In an exemplary embodiment, the present invention provides a method of treating muscular dystrophy in a subject in need thereof, the method comprising administering to the mammalian subject an effective amount of a viral vector of the present invention, the viral vector comprising a heterologous nucleic acid effective to treat muscular dystrophy. In an exemplary embodiment, the method comprises administering to the mammalian subject an effective amount of a viral vector of the present invention, the viral vector comprising a heterologous nucleic acid effective to treat muscular dystrophy. In an exemplary embodiment, the method comprises administering to the mammalian subject an effective amount of a viral vector of the present invention, the viral vector comprising a heterologous nucleic acid effective to treat muscular dystrophy. The heterologous nucleic acid may include an antibody or antibody fragment against B-dominant mutant, sarcospan, myostatin or myostatin propeptide, or an inhibitory RNA (e.g., antisense RNA, microRNA or RNAi) against myostatin, mir-1, mir-133, mir-206, mir-208, or an inhibitory RNA (e.g., microRNA, RNAi or antisense RNA) for inducing exon skipping in a defective dystrophin gene. In certain embodiments, the viral vector may be administered to the skeleton, diaphragm and / or myocardium, as described elsewhere herein.

[0233] The present invention further encompasses a method of treating a metabolic disorder in a subject in need thereof. In an exemplary embodiment, the method comprises administering an effective amount of a viral vector of the present invention to a skeletal muscle of a subject, the viral vector comprising a heterologous nucleic acid encoding a polypeptide, wherein the metabolic disorder is the result of a deficiency and / or defect in the polypeptide. Exemplary metabolic disorders and heterologous nucleic acids encoding polypeptides are described herein. As a further option, the heterologous nucleic acid may encode a secreted protein.

[0234] The invention can also be practiced to produce inhibitory RNA (eg, antisense RNA, microRNA or RNAi) for systemic delivery.

[0235] The present invention also provides a method of treating a congenital heart defect in a subject in need thereof, the method comprising administering to the mammalian subject an effective amount of a viral vector of the present invention, the viral vector comprising a heterologous nucleic acid effective to treat the congenital heart defect. In an exemplary embodiment, the method comprises administering to the mammalian subject an effective amount of a viral vector of the present invention, the viral vector comprising a heterologous nucleic acid effective to treat the congenital heart defect. 2+ -ATPase (SERCA2a), angiogenic factors, phospholamban, PI3 kinase, calsarcan, beta-adrenergic receptor kinase (βARK), βARKct, inhibitor of protein phosphatase 1 1, Pim-1, PGC-1α, SOD-1, SOD-2, EC-SOD, calculus, HIF, thymosin-β4, S100A1, parvalbumin, type 6 adenylyl cyclase, molecules that activate knockdown of type 2 G-protein coupled receptor kinase, e.g., truncated constitutively active bARKct; phospholamban inhibitory or dominant negative molecules, e.g., phospholamban S16E, mir-1, mir-133, mir-206, mir-208.

[0236] Injectables can be prepared in conventional forms, as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid before injection, or as emulsions.Alternatively, viral vectors can be administered in a local rather than systemic manner, for example, in depot or sustained release formulations.Furthermore, viral vectors can be delivered dry in surgically implantable matrices, for example, bone substitutes, sutures, stents, etc. (for example, as described in U.S. Patent No. 7,201,898).

[0237] Pharmaceutical compositions suitable for oral administration may be provided in discrete units such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the composition of the invention; as powders or granules; as solutions or suspensions in aqueous or non-aqueous solutions; or as oil-in-water or water-in-oil emulsions. Oral delivery may be performed by compounding the viral vectors of the invention with carriers capable of withstanding degradation by digestive enzymes in the animal's digestive tract. Examples of such carriers include plastic capsules or tablets known in the art. Such formulations are prepared by any suitable method of pharmacy, including the step of combining the composition and a suitable carrier, which may include one or more supplementary ingredients as described above. In general, pharmaceutical compositions according to embodiments of the invention are prepared by uniformly and intimately admixing the composition with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the resulting mixture. For example, a tablet may be prepared by compressing or shaping a powder or granules containing the composition, optionally with one or more supplementary ingredients. Compressed tablets are prepared by compressing in a suitable machine a composition in free form, e.g., powder or granules, optionally mixed with a binder, lubricant, inert diluent, and / or surface active / dispersing agent(s). Molded tablets are made by molding in a suitable machine, the powdered compound is moistened with an inert liquid binder.

[0238] Pharmaceutical compositions suitable for buccal (sublingual) administration include lozenges comprising the composition of the invention in a flavored base, usually sucrose and acacia or tragacanth; and lozenges comprising the composition in an inert base, such as gelatin and glycerin or sucrose and acacia.

[0239] Pharmaceutical compositions suitable for parenteral administration may include sterile aqueous and non-aqueous injection solutions of the compositions of the present invention, which formulations are optionally isotonic with the blood of the intended recipient. These formulations may include antioxidants, buffers, bacteriostats and solutes that render the compositions isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions and emulsions may include suspending agents and thickening agents. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include saline, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.

[0240] The compositions may be presented in unit / dose or multi-dose containers, for example, sealed ampoules and vials and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water for injections immediately prior to use.

[0241] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the type described above. For example, the injectable, stable, sterile composition of the present invention in a unit dosage form in a sealed container can be provided. The composition can be provided in the form of a lyophilizate and reconstituted with a suitable pharma-ceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form can be about 1 μg to about 10 g of the composition of the present invention. If the composition is substantially water-insoluble, a sufficient amount of emulsifying agent that is physiologically acceptable can be included in an amount sufficient to emulsify the composition in an aqueous carrier. One such useful emulsifying agent is phosphatidylcholine.

[0242] Pharmaceutical compositions suitable for rectal administration may be presented as unit-dose suppositories. These may be prepared by admixing the composition with one or more conventional solid carriers, such as cocoa butter, and then shaping the resulting mixture.

[0243] The pharmaceutical composition of the present invention suitable for topical application to the skin can take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers that can be used include, but are not limited to, petrolatum, lanolin, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof. In some embodiments, for example, topical delivery can be achieved by mixing the pharmaceutical composition of the present invention with a lipid-soluble agent (e.g., DMSO) that can penetrate into the skin.

[0244] Pharmaceutical compositions suitable for transdermal administration may be in the form of a discrete patch adapted to remain in intimate contact with the epidermis of a subject for a prolonged period of time. Compositions suitable for transdermal administration may also be delivered by iontophoresis (see, e.g., Pharm.Res.3:318 (1986)) and typically take the form of an optionally buffered aqueous solution of the composition of the invention. Suitable formulations may include citrate or bis\tris buffer (pH 6) or ethanol / water and may contain 0.1-0.2M of active ingredient.

[0245] The viral vectors disclosed herein can be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respirable particles consisting of the viral vectors, which the subject inhales. The respirable particles can be liquid or solid. Aerosols of liquid particles containing the viral vectors can be produced by any suitable means, for example, using a pressure-driven aerosol nebulizer or ultrasonic nebulizer known to those skilled in the art. See, for example, U.S. Pat. No. 4,501,729. Aerosols of solid particles containing the viral vectors can be produced by any solid particulate drug aerosol generator, similarly, by techniques known in the pharmaceutical arts.

[0246] IV. Use of AAV capsids to target peripheral tissues. The AAV capsids and vectors of the present invention have been shown to completely or nearly completely detarget peripheral organs and tissues. This detargeting makes the vectors ideal as "blank" vectors that can be modified to produce a desired tropism profile, e.g., to target specific organs and tissues and / or detarget other organs and tissues. Thus, one aspect of the present invention relates to a method of preparing an AAV capsid with a desired tropism profile, comprising modifying the AAV capsid of the present invention to insert an amino acid sequence that provides the desired tropism profile. In some embodiments, the desired tropism profile is highly selective for tissues selected from skeletal muscle, cardiac muscle, diaphragm, kidney, liver, pancreas, spleen, gastrointestinal tract, lung, joint tissue, tongue, ovary, testis, germ cells, cancer cells, or a combination thereof, and / or is less selective for tissues selected from liver, ovary, testis, germ cells, or a combination thereof.

[0247] Examples of specific targeting and detargeting sequences are known in the art. One example is the molecular basis for selective liver tropism, which in the case of AAV2 and AAV6, has been mapped to a continuous base footprint that appears to be associated with the interaction of either serotype with heparin. Specifically, it has been previously shown that a single lysine residue (K531) on AAV6 defines heparin binding ability and, consequently, liver tropism. Inferentially, substitutional mutagenesis of the lysine residue with the corresponding glutamic acid / aspartic acid residue on other serotypes confers heparin binding, possibly by forming a minimal continuous base footprint on the capsid surface. Another example is a capsid mutant that includes an alteration in three-fold axis loop 4, as disclosed in International Publication WO2012 / 093784, which is incorporated herein by reference in its entirety. These mutants exhibit one or more traits including: (i) reduced transduction of liver, (ii) increased movement across endothelial cells, (iii) systemic transduction; (iv) increased transduction of muscle tissue (e.g., skeletal muscle, cardiac muscle and / or diaphragm muscle), and / or (v) reduced transduction of brain tissue (e.g., neurons). Other tropic sequences are described in Li et al., (2012) J. Virol. 86:7752-7759; Pulicherla et al., (2011) Mol. Ther. 19:1070-1078; Bowles et al., (2012) Mol. Ther. 20:443-455; Asokan et al., (2012) Mol. Ther. 20:699-708; and Asokan et al., (2010) Nature Biotechnol. 28:79-82; each of which is incorporated by reference in its entirety.

[0248] In some embodiments, the AAV capsids of the invention can be engineered through DNA scrambling and / or directed evolution to identify engineered capsids with desired tropism profiles. Techniques for DNA scrambling and directed evolution of AAV capsids are described in International Publication WO2009 / 137006, which is incorporated herein by reference in its entirety.

[0249] V. Chimeric AAV capsids targeted to oligodendrocytes The present inventors have identified a chimeric AAV capsid structure capable of preferentially transducing oligodendrocytes over neurons and other cells of the CNS.Accordingly, one aspect of the present invention relates to a nucleic acid encoding an AAV capsid, the nucleic acid comprising, consisting essentially of, or consisting of (a) the nucleotide sequence of SEQ ID NO: 129 (BNP61); or (b) a VP1, VP2, or VP1 / VP2-encoding portion of an AAV capsid coding sequence that is at least 90% identical to the nucleotide sequence encoding SEQ ID NO: 130 (BNP61); operably linked to the VP3 portion of a different AAV capsid coding sequence; and a virus comprising the chimeric AAV capsid. In some embodiments, the VP1, VP2, or VP1 / VP2 portion of the AAV capsid coding sequence is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the VP1, VP2, or VP1 / VP2 encoding portion of the nucleotide sequence of (a) or (b). In other embodiments, the AAV capsid coding sequence comprises, consists essentially of, or consists of the VP1, VP2, or VP1 / VP2 encoding portion of the nucleotide sequence of (a) or (b). In some embodiments, the VP3 encoding portion of the different AAV capsid coding sequence is a chimeric sequence that differs from a wild-type capsid sequence (e.g., AAV8 or AAV9) or any of the capsid sequences of the invention.

[0250] In certain embodiments, the nucleic acids of the invention further encode an E532K substitution in the capsid protein (numbering relative to the AAV8 capsid sequence).

[0251] In some embodiments, the nucleic acid encoding an AAV capsid comprises, consists essentially of, or consists of a VP1, VP2, or VP1 / VP2-encoding portion of an AAV capsid coding sequence that is at least 90% identical to a nucleotide sequence encoding SEQ ID NO: 131 (BNP62) or 132 (BNP63), operably linked to a VP3-encoding portion of a different AAV capsid sequence; the virus comprises the chimeric AAV capsid. In some embodiments, the VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the VP1, VP2, or VP1 / VP2-encoding portion of the nucleotide sequence encoding SEQ ID NO: 131 or 132. In another embodiment, the AAV capsid coding sequence comprises, consists essentially of, or consists of a VP1, VP2, or VP1 / VP2 encoding portion of a nucleotide sequence encoding SEQ ID NO: 131 or 132 operably linked to the VP3 portion of a different AAV capsid coding sequence. In some embodiments, the VP3 encoding portion of the different AAV capsid coding sequence is a chimeric sequence that differs from the wild-type capsid sequence (e.g., AAV8 or AAV9) or any capsid sequence of the invention.

[0252] In certain embodiments, the nucleic acids of the invention further encode an E532K substitution in the capsid protein (numbering relative to the AAV8 capsid sequence).

[0253] SEQ ID NOs: 130-132 show examples of VP1 capsid protein sequences of the invention. All amino acid position designations in the present description and the appended claims refer to VP1 numbering. Those skilled in the art will understand that AAV capsids generally include smaller VP2 and VP3 capsid proteins as well. Due to overlapping coding sequences for AAV capsid proteins, the nucleic acid coding sequences and amino acid sequences of VP2 and VP3 capsid proteins are evident from the VP1 sequences shown in SEQ ID NOs: 129-132. Specifically, VP2 starts at nucleotide 412 (acg) of SEQ ID NO: 129 and threonine 148 of SEQ ID NO: 130. VP3 starts at nucleotide 607 (atg) of SEQ ID NO: 129 and methionine 203 of SEQ ID NO: 130. In certain embodiments, isolated VP2 and VP3 capsid proteins comprising sequences from SEQ ID NOs:130-132, and isolated nucleic acids encoding the VP2 or VP3 proteins, or both, are contemplated.

[0254] In a specific embodiment, a capsid of the invention further comprises an E532K substitution (numbering relative to the AAV8 capsid sequence).

[0255] The present invention also provides chimeric AAV capsid proteins and chimeric capsids, the capsid protein comprising, consisting essentially of, or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 130-132, wherein 1, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 12 or less, 15 or less, 20 or less, 25 or less, 30 or less, 40 or less, or 50 or less of the amino acids within the capsid protein coding sequence of one of SEQ ID NOs: 130-132 are replaced by another amino acid (naturally occurring, modified and / or synthetic), optionally a conserved amino acid. In some embodiments, the capsid protein is substituted with selective amino acid substitutions and / or deleted and / or inserted (including N- and C-terminal extensions) of 1, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 12 or less, 15 or less, 20 or less, 25 or less, 30 or less, 40 or less, or 50 or less amino acids, or any combination of substitutions, deletions, and / or insertions is present, where the substitutions, deletions, and / or insertions do not unduly impair the structure and / or function of the mutant capsid protein or virion (e.g., an AAV virion) comprising the capsid. For example, in an exemplary embodiment of the invention, an AAV virion comprising a chimeric capsid protein substantially retains at least one characteristic of a chimeric virion comprising a chimeric capsid protein set forth in one of SEQ ID NOs: 130-132. For example, virions containing a chimeric capsid protein can substantially retain the oligodendrocyte tropism profile of virions containing a chimeric AAV capsid protein set forth in one of SEQ ID NOs: 130-132. Methods for assessing biological attributes such as viral transduction are well known in the art (see, e.g., the Examples).

[0256] Further embodiments of the present invention relate to a nucleic acid encoding an AAV8 capsid, the capsid comprising an E532K substitution. In some embodiments, the nucleic acid comprises, consists essentially of, or consists of an AAV capsid coding sequence that is at least 90% identical to (a) the nucleotide sequence of SEQ ID NO: 133 (AAV8 E532K capsid nucleotide sequence); or (b) the nucleotide sequence encoding SEQ ID NO: 134 (AAV8 E532K capsid amino acid sequence); the virus comprises the chimeric AAV capsid. In some embodiments, the AAV capsid coding sequence is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of (a) or (b). In another embodiment, the AAV capsid coding sequence comprises, consists essentially of, or consists of the nucleotide sequence of (a) or (b). In some embodiments, the AAV8 E532K capsid coding sequence further comprises a VP1, VP2, or VP1 / VP2 encoding portion of a capsid sequence of the invention.

[0257] Conservative amino acid substitutions are known in the art. In certain embodiments, conservative amino acid substitutions include substitutions in one or more of the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and / or phenylalanine, tyrosine.

[0258] It will be apparent to one of skill in the art that the amino acid sequence of the chimeric AAV capsid protein of SEQ ID NO: 130-132 and / or the AAV8 E532K substitution can be further modified to incorporate other modifications known in the art to confer desired characteristics. As a non-limiting possibility, the capsid protein can be modified to incorporate targeting sequences (e.g., RGD) or sequences that facilitate purification and / or detection. For example, the capsid protein can be fused to all or part of glutathione-S-transferase, maltose-binding protein, heparin / heparan sulfate binding domain, poly-His, ligands, and / or reporter proteins (e.g., green fluorescent protein, β-glucuronidase, β-galactosidase, luciferase, etc.), immunoglobulin Fc fragments, single chain antibodies, hemagglutinin, c-myc, FLAG epitopes, etc. to form fusion proteins. Methods for inserting targeting peptides into the AAV capsid are known in the art (see, e.g., International Patent Publication WO 00 / 28004; Nicklin et al., (2001) Mol. Ther. 474-181; White et al., (2004) Circulation 109:513-319; Muller et al., (2003) Nature Biotech. 21:1040-1046).

[0259] The viruses of the present invention may further comprise a double-stranded viral genome as described in International Patent Publication WO 01 / 92551 and US Pat. No. 7,465,583.

[0260] The present invention also provides AAV capsids comprising the chimeric AAV capsid proteins of the present invention and viral particles (i.e., virions) comprising the same, where the viral particles package (i.e., encapsidate) a vector genome, optionally an AAV vector genome. In certain embodiments, the present invention provides AAV particles comprising AAV capsids comprising the AAV capsid proteins of the present invention, where the AAV capsid packages an AAV vector genome. The present invention also provides AAV particles comprising AAV capsid proteins or AAV capsids encoded by the chimeric nucleic acid capsid coding sequences of the present invention.

[0261] In certain embodiments, the virion is a recombinant vector that contains a heterologous nucleic acid of interest, e.g., for delivery to a cell. Thus, the present invention is useful for delivery of nucleic acids to cells in vitro, ex vivo, and in vivo. In representative embodiments, the recombinant vectors of the present invention can be advantageously used to deliver or transfer nucleic acids to animal (e.g., mammalian) cells.

[0262] Any heterologous nucleotide sequence(s) can be delivered by the viral vectors of the invention. Nucleic acids of interest include nucleic acids encoding polypeptides, optionally therapeutic (e.g., for medical or veterinary use) and / or immunogenic (e.g., for a vaccine).

[0263] In some embodiments, the polypeptide stimulates the proliferation and / or differentiation of oligodendrocytes. Examples include, but are not limited to, insulin-like growth factor-1, glial derived neurotrophic factor, neurotrophin-3, artemin, transforming growth factor alpha, platelet derived growth factor, leukemia inhibitory factor, prolactin, monocarboxylate transporter 1, or nuclear factor 1A.

[0264] Therapeutic polypeptides include, but are not limited to, those described above.

[0265] Heterologous nucleotide sequences encoding a polypeptide include those encoding the reporter polypeptides described above.

[0266] Alternatively, the heterologous nucleic acid may encode an antisense oligonucleotide, a ribozyme, an RNA that causes spliceosome-mediated trans-splicing, an interfering RNA (RNAi), including small interfering RNA (siRNA) that mediates gene silencing, a microRNA, or other non-translated "functional" RNA, such as a "guide" RNA, as described above.

[0267] The invention also provides recombinant viral vectors expressing immunogenic polypeptides, as described above, for example, for vaccination.

[0268] Alternatively, the heterologous nucleotide sequence can encode any polypeptide that is desirably produced in a cell, in vitro, ex vivo, or in vivo For example, a viral vector can be introduced into cultured cells and the expressed protein product isolated therefrom.

[0269] It will be understood by those skilled in the art that the heterologous nucleic acid(s) of interest can be operably linked to the appropriate control sequences described above. Advantageously, the oligodendrocyte-specific chimeric capsid of the present invention allows the use of a constitutive promoter to express the heterologous nucleic acid(s) of interest in an oligodendrocyte-specific manner, compared to prior art AAV vectors that require the use of an oligodendrocyte-specific promoter.

[0270] The present invention also provides chimeric AAV particles comprising an AAV capsid and an AAV genome, where the AAV genome "corresponds to" (i.e., encodes) the AAV capsid. Also provided are collections or libraries of such chimeric AAV particles, where the collection or library is 2 or more, 10 or more, 50 or more, 100 or more, 1000 or more, 10 4 That's it, 10 5More than or equal to 10 6 The above separate sequences are included.

[0271] The present invention further encompasses "empty" capsid particles (i.e., the absence of vector genome) that comprise, consist of, or consist essentially of the chimeric AAV capsid proteins of the present invention. The chimeric AAV capsids of the present invention can be used as "capsid vehicles" as described in U.S. Pat. No. 5,863,541. Molecules that can be covalently attached, bound, or packaged by viral capsids for transfer into cells include DNA, RNA, lipids, carbohydrates, polypeptides, small organic molecules, or combinations thereof. Additionally, molecules can be associated (e.g., "tethered") to the outside of the viral capsid for transfer of the molecules into the host target cell. In one embodiment of the present invention, the molecules are covalently attached (i.e., conjugated or chemically bonded) to the capsid proteins. Methods for covalently attaching molecules are known to those skilled in the art.

[0272] The viral capsids of the present invention also find use in raising antibodies against the novel capsid structure. As a further alternative, exogenous amino acid sequences may be inserted into the viral capsid to generate an immune response against the exogenous amino acid sequence for antigen presentation to cells, e.g., for administration to a subject.

[0273] The present invention also provides nucleic acids (e.g., isolated nucleic acids) encoding the chimeric capsid proteins and chimeric viral capsids of the present invention. Additionally, vectors comprising the nucleic acids and cells (in vivo or in culture) comprising the nucleic acids and / or vectors of the present invention are provided. Such nucleic acids, vectors and cells can be used, for example, as reagents (e.g., helper constructs or packaging cells) for the production of the viral vectors described herein.

[0274] In exemplary embodiments, the present invention provides nucleic acid sequences encoding AAV capsids of SEQ ID NO: 130-132, or nucleic acid sequences at least 90% identical to the nucleotide sequence of SEQ ID NO: 129. The present invention also provides nucleic acids encoding the AAV capsid mutants, capsid protein mutants, and fusion proteins described above. In certain embodiments, the nucleic acid hybridizes to the complement of the nucleic acid sequences specifically disclosed herein under standard conditions known by those of skill in the art and encodes a mutant capsid and / or capsid protein. In some cases, the mutant capsid or capsid protein substantially retains at least one of the characteristics of the capsid and / or capsid protein encoded by the nucleic acid sequence of SEQ ID NO: 129. For example, a viral particle comprising a mutant capsid or mutant capsid protein can substantially retain the oligodendrocyte tropism profile of a viral particle comprising a capsid protein or capsid encoded by the nucleic acid coding sequence of SEQ ID NO: 129.

[0275] For example, hybridization of such sequences may be performed under conditions of low stringency, medium stringency, or more stringent conditions, as described above.

[0276] In other embodiments, nucleic acid sequences encoding mutant capsids or capsid proteins of the invention have at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence of SEQ ID NO:129, and optionally encode mutant capsids or capsid proteins that substantially retain at least one characteristic of the capsid protein or capsid encoded by the nucleic acid of SEQ ID NO:129.

[0277] As is known in the art, a number of different programs can be used to identify whether a nucleic acid or polypeptide has sequence identity to a known sequence, as described above.

[0278] In certain embodiments, the nucleic acid may comprise, consist essentially of, or consist of a vector, including, but not limited to, a plasmid, a phage, a viral vector (e.g., an AAV vector, an adenoviral vector, a herpes viral vector, or a baculoviral vector), a bacterial artificial chromosome (BAC), or a yeast artificial chromosome (YAC). For example, the nucleic acid may comprise, consist, or consist essentially of an AAV vector including 5' and / or 3' terminal repeats (e.g., 5' and / or 3' AAV terminal repeats).

[0279] In some embodiments, the nucleic acid encoding the chimeric AAV capsid protein further comprises an AAV rep coding sequence. For example, the nucleic acid can be a helper construct for producing a viral stock.

[0280] The present invention also provides a packaging cell that stably contains a nucleic acid of the invention as described above.

[0281] The nucleic acid can be incorporated into a delivery vector, such as a viral delivery vector. For illustration, the nucleic acid of the present invention can be packaged in an AAV particle, an adenovirus particle, a herpes virus particle, a baculovirus particle, or any other suitable viral particle.

[0282] Additionally, the nucleic acid can be operably linked to a promoter element, which is described in more detail herein.

[0283] The present invention further provides a method for producing the above-mentioned viral vector of the present invention.

[0284] Using the packaging methods of the present invention, high titer stocks of viral particles can be produced. In certain embodiments, viral stocks are at least about 10 5 Transducing units (tu) / ml, at least about 10 6 tu / ml, at least about 10 7 tu / ml, at least about 108 tu / ml, at least about 10 9 tu / ml, or at least about 10 10 It has a titer of tu / ml.

[0285] The novel capsid proteins and capsid structures find use raising antibodies, for example for diagnostic or therapeutic uses, or as research reagents. Thus, the present invention also provides antibodies against the novel capsid proteins and capsids of the present invention described above.

[0286] VI. Methods using chimeric AAV capsids targeted to oligodendrocytes. The present invention also relates to a method for delivering heterologous nucleotide sequences to oligodendrocytes. For example, the viral vector of the present invention can be used to deliver a nucleotide sequence of interest to oligodendrocytes in vitro, for example, to produce a polypeptide or nucleic acid in vitro or for ex vivo gene therapy. The vector is further useful in a method for delivering a nucleotide sequence to a subject in need thereof, for example, to express a therapeutic or immunogenic polypeptide or nucleic acid. In such a method, the polypeptide or nucleic acid can be produced in vivo in the subject. The subject may need the polypeptide or nucleic acid because it is deficient in the polypeptide, or because the production of the polypeptide or nucleic acid in the subject can provide some therapeutic effect as a treatment or other method, and as further described below.

[0287] In certain embodiments, the vectors are useful for expressing polypeptides or nucleic acids that provide a beneficial effect to oligodendrocytes, for example, promoting oligodendrocyte proliferation and / or differentiation. The ability to target vectors to oligodendrocytes may be particularly useful for treating diseases or disorders involving oligodendrocyte dysfunction and / or neuronal demyelination. In other embodiments, the vectors are useful for expressing polypeptides or nucleic acids that provide a beneficial effect to cells nearby the oligodendrocytes (e.g., neurons).

[0288] Thus, one aspect of the invention relates to a method of delivering a nucleic acid of interest to an oligodendrocyte, the method comprising the step of contacting the oligodendrocyte with an AAV particle of the invention.

[0289] In another aspect, the invention relates to a method for delivering a nucleic acid of interest to oligodendrocytes in a mammalian subject, the method comprising the step of administering to the mammalian subject an effective amount of an AAV particle or pharmaceutical formulation of the invention.

[0290] A further aspect of the invention relates to a method of treating a disorder associated with oligodendrocyte dysfunction in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an AAV particle of the invention. In one embodiment, the disorder associated with oligodendrocyte dysfunction is a demyelinating disease. In one embodiment, the disorder associated with oligodendrocyte dysfunction is multiple sclerosis, Pelizaeus-Merzbacher disease, Krabbe disease, metachromatic leukodystrophy, adrenoleukodystrophy, Canavan disease, Alexander disease, normochromatic leukodystrophy, Zellweger disease, 18q-syndrome, cerebral palsy, spinal cord injury, traumatic brain injury, stroke, phenylketonuria, or viral infection, or any other disorder known or later discovered to be associated with oligodendrocyte dysfunction. In another embodiment, the methods of the present invention are used to treat disorders that are not directly related to oligodendrocyte dysfunction, but that benefit from expression of heterologous polypeptides or nucleic acids in oligodendrocytes in addition to, or instead of, expression in neurons, astrocytes, or other CNS cell types. Examples include, but are not limited to, neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, and Huntington's disease, CNS tumors, and other CNS disorders mentioned above.

[0291] In another aspect of the present invention, the chimeric AAV capsids and vectors of the present invention are completely or nearly completely detargeted vectors, which can be further modified to a desired tropism profile for targeting one or more peripheral organs or tissues, as described above. In this aspect, the present invention also relates to a method for delivering heterologous nucleotide sequences into a wide range of cells, including dividing and non-dividing cells. The viral vectors of the present invention can be used to deliver a nucleotide sequence of interest to cells in vitro, for example, to produce a polypeptide in vitro or for ex vivo gene therapy. The vectors are further useful in a method for delivering a nucleotide sequence to a subject in need thereof, for example, to express a therapeutic or immunogenic polypeptide or nucleic acid. In such a method, the polypeptide or nucleic acid can be produced in vivo in the subject. The subject may need the polypeptide or nucleic acid because the subject is deficient in the polypeptide or because the production of the polypeptide or nucleic acid in the subject can provide some therapeutic effect, as a treatment or other method, and as further described below.

[0292] In general, the viral vectors of the present invention can be used to deliver any foreign nucleic acid having a biological effect to treat or ameliorate symptoms associated with any disorder related to gene expression. Furthermore, the present invention can be used to treat any disease state in which it is beneficial to deliver a therapeutic polypeptide. Exemplary disease states include those mentioned above.

[0293] The viral vector of the present invention may also be used to provide antisense nucleic acid or inhibitory RNA (e.g., microRNA or RNAi, e.g., siRNA or shRNA) to cells in vitro or in vivo. Expression of inhibitory RNA in a target cell reduces the expression of a particular protein(s) by the cell. Thus, inhibitory RNA may be administered to reduce the expression of a particular protein in a subject in need thereof. Inhibitory RNA may also be administered to cells in vitro to modulate the physiology of the cell, e.g., to optimize a cell or tissue culture system.

[0294] In a further aspect, the viral vector of the present invention can be used to generate an immune response in a subject. According to this embodiment, a viral vector containing a nucleic acid encoding an immunogen can be administered to a subject, and an active immune response (optionally a protective immune response) is mounted by the subject against the immunogen. The immunogen is as described above.

[0295] Alternatively, the viral vector can be administered to cells ex vivo and the modified cells administered to a subject. A heterologous nucleic acid is introduced into the cells and the cells are administered to a subject where the heterologous nucleic acid encoding an immunogen is optionally expressed and induces an immune response in the subject against the immunogen. In certain embodiments, the cells are antigen-presenting cells (e.g., dendritic cells).

[0296] The viral vectors of the present invention may also be administered for cancer immunotherapy by administering a viral vector expressing a cancer cell antigen (or an immunologically similar molecule) or any other immunogen that generates an immune response against cancer cells as described above. The viral vector may be administered to a subject using in vivo or ex vivo methods as described herein.

[0297] In certain embodiments, cells can be removed from a subject with cancer and contacted with the viral vector of the present invention. The modified cells are then administered to the subject, thereby eliciting an immune response against the cancer cell antigens. This method is particularly advantageously used in immunocompromised subjects who are unable to mount a sufficient immune response in vivo (i.e., unable to produce high levels of antibodies in sufficient quantities).

[0298] It is known in the art that immune responses can be enhanced by immunomodulatory cytokines (e.g., α-interferon, β-interferon, γ-interferon, ω-interferon, τ-interferon, interleukin-1α, interleukin-1β, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-6, interleukin-7, interleukin-8, interleukin-9, interleukin-10, interleukin-11, interleukin-12, interleukin-13, interleukin-14, interleukin-18, B-cell growth factor, CD40 ligand, tumor necrosis factor-α, tumor necrosis factor-β, monocyte chemotactic protein-1, granulocyte-macrophage colony-stimulating factor, and lymphotoxin). Thus, immunomodulatory cytokines (e.g., CTL-inducing cytokines) can be administered to a subject together with a viral vector.

[0299] The cytokine may be administered by any method known in the art. Exogenous cytokines may be administered to a subject, or, alternatively, a nucleotide sequence encoding the cytokine may be delivered to a subject using an appropriate vector and the cytokine produced in vivo.

[0300] Viral vectors are further useful for targeting oligodendrocytes for research purposes, e.g., for studying CNS function in vitro or in animals, or for use in creating and / or studying animal models of disease. For example, vectors can be used to deliver heterologous nucleic acid to oligodendrocytes in animal models of demyelinating disease. Demyelination can be induced in animals by various means, including but not limited to, administration of viruses (e.g., Semliki virus, murine hepatitis virus, or Theiler-Mueller-Encephalomyelitis virus) and administration of chemicals (e.g., cuprizone, ethidium bromide, or lysolecithin). In some embodiments, vectors can also be used in animal models of experimental autoimmune encephalomyelitis. The condition can be induced, for example, by administration of kainite, SIN-1, antigalactocerebroside, or by irradiation. In other embodiments, viral vectors can be used to specifically deliver a toxic agent or an enzyme that produces a toxic agent (eg, thymidine kinase) to oligodendrocytes to kill some or all of the cells.

[0301] Furthermore, the viral vectors according to the invention find further use in diagnostic and screening methods, whereby a gene of interest is expressed, either transiently or stably, in cell culture systems or, alternatively, in transgenic animal models. The invention can also be implemented to deliver nucleic acids, for example, for the purpose of protein production for experimental, industrial or commercial purposes.

[0302] The recombinant viral vectors of the present invention find use in both veterinary and medical applications. Suitable subjects include both birds and mammals as described above. In some cases, the subject is "in need" of the method of the present invention, for example, because the subject has or is believed to be at risk of a disorder, including those described herein, or would benefit from delivery of a nucleic acid, including those described herein. For example, in certain embodiments, the subject has (or has had) or is at risk of a demyelinating disorder or spinal cord or brain injury. As a further option, the subject may be an experimental animal and / or an animal model of a disease.

[0303] In certain embodiments, the present invention provides pharmaceutical compositions comprising a viral vector of the present invention in a pharma- ceutically acceptable carrier, and optionally other medicinal agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier is typically a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier is respirable, and is preferably in solid or liquid particulate form.

[0304] By "pharmacologically acceptable" it is meant a material that is not toxic or otherwise undesirable, ie, the material may be administered to a subject without causing any undesired biological effects.

[0305] One aspect of the present invention is a method for transferring a nucleotide sequence into a cell in vitro. The viral vector can be introduced into the cell at an appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cell. The titer of the viral vector or capsid administered can vary depending on the target cell type and number and the particular viral vector or capsid, and can be determined by one of skill in the art without undue experimentation. In certain embodiments, the titer is at least about 10 3 10 infectious units, more preferably at least about 10 5 The infectious unit is introduced into the cells.

[0306] The cell or cells into which the viral vector can be introduced can be of any of the types described above.

[0307] The viral vector can be introduced into cells in vitro for the purpose of administering the modified cells to a subject. In certain embodiments, cells are removed from a subject, the viral vector is introduced into them, and then the cells are returned to the subject. Methods for removing cells from a subject for ex vivo treatment and then returning them to the subject are known in the art (see, for example, U.S. Patent No. 5,399,346). Alternatively, the recombinant viral vector is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof.

[0308] Cells suitable for ex vivo gene therapy are described above. The dose of cells administered to a subject varies based on the age, condition and species of the subject, the type of cells, the nucleic acid expressed by the cells, the method of administration, etc. Typically, the cells are administered in a pharma- ceutically acceptable carrier at least about 10 2 ~about 10 8 or about 10 3 ~about 10 6 of cells are administered per dose. In certain embodiments, cells transduced with a viral vector are administered to a subject in an effective amount in combination with a pharmaceutical carrier.

[0309] In some embodiments, cells that have been transduced with a viral vector can be administered to elicit an immunogenic response against the delivered polypeptide (e.g., expressed as a transgene or within the capsid), as described above.

[0310] A further aspect of the present invention is a method of administering the capsid or viral vector of the present invention to a subject. In a particular embodiment, the method includes a method of delivering a nucleic acid of interest to an animal subject, the method comprising administering an effective amount of the viral vector of the present invention to the animal subject. The administration of the viral vector of the present invention to a human subject or an animal in need thereof may be by any means known in the art. Optionally, the viral vector is delivered in an effective dosage in a pharma- ceutically acceptable carrier.

[0311] Additionally, the viral vectors of the present invention can be administered to a subject to elicit an immunogenic response (eg, as a vaccine), as described above.

[0312] The dose of the viral vector administered to a subject depends on the method of administration, the disease or condition being treated, the condition of the individual subject, the particular viral vector, and the nucleic acid being delivered, and can be determined by routine methods. An exemplary dosage to achieve a therapeutic effect is at least about 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 3 , 10 14 , 10 15 Transducing units or more, preferably about 10 7 or 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 or 10 14 Transducing units, even more preferably about 10 12 Viral titer in transducing units.

[0313] In certain embodiments, more than one administration (e.g., 2, 3, 4 or more administrations) may be used to achieve a desired level of gene expression over various intervals, e.g., daily, weekly, monthly, yearly, etc.

[0314] Exemplary methods of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intrauterine (or intraovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to the skeleton, diaphragm and / or myocardium], intradermal, intrapleural, intracerebral, and intra-articular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, etc., as well as direct tissue or organ injection (e.g., to the liver, skeletal muscle, myocardium, diaphragm muscle, or brain). Administration may also be to a tumor (e.g., in or near a tumor or lymph node). The most appropriate route in any given case will depend on the nature and severity of the condition being treated and the nature of the particular vector being used.

[0315] In some embodiments, the viral vector is administered directly to the CNS, e.g., the brain or spinal cord. Direct administration can result in highly specific transduction of oligodendrocytes, e.g., where at least 80%, 85%, 90%, 95% or more of the transduced cells are oligodendrocytes. Any method known in the art for administering vectors directly to the CNS can be used. The vector can be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary, substantia nigra, pineal), cerebellum, telencephalon (cerebrum, including striatum, occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and amygdala), limbic system, neocortex, striatum, cerebrum, and inferior colliculus. The vector can also be administered to different regions of the eye, such as the retina, cornea or optic nerve. The vector can be delivered into the cerebrospinal fluid (e.g., by lumbar puncture) to better distribute the administration of the vector.

[0316] The delivery vector may be administered to the desired region(s) of the CNS by any route known in the art, including, but not limited to, intrathecal, intracerebral, intraventricular, intranasal, intraaural, intraocular (e.g., intravitreal, subretinal, anterior chamber) and periocular (e.g., sub-Tenon's area) delivery, or any combination thereof.

[0317] Typically, viral vectors are administered in liquid formulations to the desired area or compartment in the CNS by direct injection (e.g., stereotactic injection). In some embodiments, the vectors can be delivered via a reservoir and / or pump. In other embodiments, the vectors can be provided by topical application to the desired area or by intranasal administration of an aerosol formulation. Administration into the eye or ear can be by topical application of liquid droplets. As a further alternative, the vectors can be administered as a solid sustained release formulation. Controlled release of parvovirus and AAV vectors is described in International Patent Publication WO 01 / 91803.

[0318] In some embodiments, where a subject has a compromised blood-brain barrier (BBB), a viral vector can be delivered systemically (e.g., intravenously) to the subject, where the vector transduces oligodendrocytes in the area (e.g., border) of BBB damage. In certain embodiments, the vector transduces cells in the compromised area, but not cells in an intact area. Thus, one aspect of the invention relates to a method of delivering a nucleic acid of interest to a region of the CNS adjacent to a compromised blood-brain barrier region in a mammalian subject, the method comprising the step of intravenously administering an effective amount of an AAV particle of the invention.

[0319] In some embodiments, the damage to the BBB is due to a disease or disorder as described above. In other embodiments, the BBB damage can be an induced disruption, for example, to facilitate delivery of an agent to the CNS, as described above.

[0320] Injectables can be prepared in conventional forms, as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid before injection, or as emulsions.Alternatively, viral vectors can be administered in a local rather than systemic manner, for example, in depot or sustained release formulations.Furthermore, viral vectors can be delivered dry in surgically implantable matrices, for example, bone substitutes, sutures, stents, etc. (for example, as described in U.S. Patent No. 7,201,898).

[0321] Pharmaceutical compositions suitable for different administration routes may be as described above.

[0322] Having described the invention, the same will be described in more detail in the following examples, which are included herein for illustrative purposes only and are not intended to be limitations on the invention. EXAMPLES

[0323] [Example 1] Development of AAV capsids with high CNS tropism and minimal peripheral organ tropism

[0324] Through a process termed capsid DNA shuffling and directed evolution, AAV capsids were developed and used to generate libraries of novel AAV capsid sequences. These capsids were then subjected to multiple rounds of selection pressure in mice, with potential further capsid mutagenesis occurring between rounds of selection. Recovered capsid clones were used as vectors for reporter transgenes (GFP) or therapeutic transgenes (for Rett syndrome, MeCP2) and evaluated in mice for biodistribution and therapeutic potential.

[0325] The original library used consisted of shuffled capsids from AAV serotypes 1, 2, 6, 8, 9, and rh10. Additional modified capsids were also incorporated: AAV2.5, AAV2i8, AAV9.47, Seiz32, Seiz83, and undescribed capsids from Dr. Gray's laboratory (deteriorated clones 1 and 114). Libraries were generated as previously described (Li et al., Mol. Ther. 16:1252-1260 (2008)). Wild-type mice or a mouse model of Rett syndrome (B6.129P2(C)-Mecp2 tm1.1BirdEither the Rett mouse or Rett mouse (male or female) was used for in vivo selection. For each round of selection, mice (WT mice, knockout male Rett mice, or heterozygous female Rett mice) received a single lumbar intrathecal injection of the library, and then, 2–5 days later, tissue was harvested from multiple regions of the cervical spinal cord and brain. From these samples, tissue was mechanically dissociated to selectively recover neurons as described (Li et al., Mol. Ther. 16:1252-1260 (2008)). DNA was recovered from neuron-enriched samples using the DNeasy blood and tissue kit (Qiagen, Cat. No. 69506). Error-prone PCR was used to further diversify the library between rounds using taq polymerase with a low starting template and 50 amplification cycles, with primers as previously described (Li et al., Mol. Ther. 16:1252-1260 (2008)). The pooled PCR products were cloned back into the WT AAV backbone (pSSV9) and the pooled clones were used to generate the starting library for the next round. The pooled clones were transfected into HEK293 cells with a 10-fold excess of pXR2 and an adenovirus helper plasmid (pXX680) containing AAV2 Rep and Cap. By this method, the chimeric capsids were packaged primarily within AAV2 capsids. The AAV2-encapsidated chimeras were then added to HEK293 cells at an MOI of 0.5 genomes per cell along with WT adenovirus at an MOI of 5 infectious units per cell such that each chimeric AAV genome was largely packaged within its own capsid. After 72 hours, cells were harvested and viruses were purified as described (Grieger et al., Nat. Protoc. 1:1412-28 (2006)) and titrated by qPCR. A total of three rounds of selection were performed, and a sampling of capsids recovered after each round were subcloned into recombinant AAV2 backbone (lacking ITR elements) and SSV9 replication-competent backbone and sequenced.

[0326] To assess the biodistribution and, in some cases, therapeutic potential of the recovered capsids, some clones were administered into mice by a single lumbar intrathecal injection in a volume of 5 microliters. When assessing biodistribution, mice were sacrificed 2-4 weeks after injection and tissue samples were analyzed for vector DNA biodistribution as described (Li et al., Mol. Ther. 16:1252-1260 (2008)). When assessing the therapeutic potential of the recovered capsid clones, the human MeCP2 gene (driven by the mouse MeCP2 promoter) was packaged into each capsid and then administered into male knockout Rett mice by lumbar intrathecal injection at 4-5 weeks of age. Mice were monitored for the time point at which they lost 20% of their peak body weight, which was used as a predetermined endpoint indicative of survival, as previously described (Gadalla et al., Mol. Ther. 21(1):18-30 (2013)).

[0327] Representative clones are shown in Figures 1-3. The CNS tropism of clones ITbrain-2.02 and ITbrain-2.04 is shown in Figures 4A-4E. Except as indicated in Figure 4A, adult WT C57BL / 6 mice were injected with 1x10 10 vg scAAV / GFP vectors were IT injected and then sacrificed 3 weeks post-injection for qPCR biodistribution to peripheral organs and IHC for GFP expression. Fig. 4B = Forebrain, cortex. Fig. 4C = Midbrain, hippocampus. Fig. 4D = Hindbrain, cerebellum. Fig. 4E shows the central canal and ventral horn of the lumbar spinal cord. nd = not shown. Scale bar in (A) indicates SEM. Scale bar for (BE) is shown at bottom right and is 100 microns. AAV9 represents the current "gold standard" for widespread CNS gene transfer following intra-CSF administration, while Olig001 is a separately derived shuffled capsid. Fig. 5 shows the CNS and peripheral distribution of clones ITcord-1.06 and ITcord3.03. Adult WT C57BL / 6 mice were injected with 1 × 10 10vg scAAV / GFP vector was IT injected into mice and then sacrificed 3 weeks post-injection for qPCR biodistribution to CNS tissues and peripheral organs. Error bars indicate SEM. Figure 6 shows the CNS tropism of clone RTTF-1.11. The figure shows that clone F1.11 (packaging the GFP gene, 1 × 10 per mouse) was injected into mice at 4–5 weeks of age. 10 Figure 1 shows anti-GFP immunohistochemistry on brain sections from mice that received intrathecal injections of GFP (vg) and then sacrificed 4 weeks later. Images from Rett mice (left) show stronger transduction along the entire cranial-caudal axis compared to WT mice (right). Representative results are shown.

[0328] The transduction efficiency and tropism of nine chimeric AAV / GFP viruses were tested. Each virus was injected intracisternally (5E10vg per mouse) into three MeCP2+ / - female mice aged 5-7 months (unless otherwise indicated). Three weeks after injection, mice were perfused and brains were harvested. After 48 hours of fixation in 1x PBS containing 4% paraformaldehyde, brains were sectioned at 50 μm using a Leica VT 1000S vibrating blade microtome. Sections were incubated in 5% normal goat serum in 0.3 M PBST for 1 h at room temperature, then incubated in primary antibody solution (5% goat serum in 0.3 M PBST, chicken anti-GFP (Aves; 1:500) + rabbit anti-mouse MeCP2 (Cell Signaling; 1:500), or chicken anti-GFP (Aves; 1:500) + rabbit anti-mouse NeuN (Cell Signaling; 1:500)) for 40–48 h at 4°C. After three washes in 0.3 M PBST, sections were incubated in secondary antibody solution (0.3 M PBST, goat anti-chicken Alexa-fluor 488 (Invitrogen; 1:1000), goat anti-rabbit Alexa-fluor 594 (Invitrogen; 1:1000)) for 4 h at room temperature, then washed three more times in 0.3 M PBST. Sections were then incubated with 0.5 μg / mL DAPI in 0.3 M PBST for 30 min at room temperature and washed once with 0.3 M PBS. Immunolabeled sections were imaged using a Zeiss LSM 780 confocal microscope. Images were taken using a 20x objective with 4x digital zoom.

[0329] To estimate transduction efficiency for specific brain regions, the percentage of neurons expressing GFP relative to DAPI stained nuclei was calculated for random fields from sections of the hippocampus, cortex, brainstem, subiculum, cerebral nuclei, and cerebellum (n=12-25). The average transduction efficiency per capsid was calculated by averaging the average efficiencies across all analyses (Figure 7). To determine MeCP2 tropism, the percentage of GFP+ / MeCP2+ neurons relative to GFP+ neurons was calculated for each of the following regions: hippocampus, cortex, brainstem, subiculum, cerebral nuclei, and cerebellum (Figure 8). Because genetically WT glial cells may express MeCP2 at levels too low for detection by immunofluorescence, cells with glial morphology were not used to calculate MeCP2 tropism. NeuN tropism was calculated using a similar method as performed for MeCP2 (Figure 9).

[0330] [Example 2] Development of AAV capsids that selectively target oligodendrocytes material and method AAV capsid DNA shuffling and in vivo clonal rescue A library consisting of shuffled capsids from AAV serotypes 1-6, 8, 9, rh10, several chimeric and mutant capsids, and AAV8 with the E533K mutation was produced using a method previously described (Li et al., Mol. Ther. 16:1252 (2008)). The shuffled library was injected intravenously into rats that had previously received striatal 6-hydroxy-dopamine treatment. Three days later, rats were sacrificed and cells were mechanically dissociated from the striatum. DNA was recovered from neuron-enriched samples using the Qiagen DNeasy blood and tissue kit and subsequently concentrated by ethanol precipitation. The Expand Long Template PCR System (catalog no. 11681834001, low starting template, 50 cycles; Roche, Indianapolis, IN) was used to recover intact capsid library sequences using previously described primers (Li et al., Mol. Ther. 16:1252 (2008)). A subsequent error-prone PCR step was used to further diversify the library between rounds. The pooled mutagenized PCR products were cloned back into the WT AAV backbone (pSSV9) and the pooled clones were used to generate the starting library for the next round. The pooled clones were transfected into HEK293 cells with a 10-fold excess of pXR2 and an adenovirus helper plasmid (pXX680) containing AAV2 rep and cap. By this method, the chimeric capsid genome was packaged primarily into AAV2 capsids. The titer of the AAV2-encapsidated chimeric library was determined using qPCR. AAV2-encapsidated chimeras were then added to HEK293 cells at a multiplicity of infection of 0.5 vg / cell together with WT adenovirus at a multiplicity of infection of 5 infectious units per cell, such that each chimeric AAV genome was largely packaged within its own capsid.After 48 hours, cells were harvested and virus was purified as described (Gray et al., Gene Ther. 20:450 (2013)) and titered by qPCR. A total of two rounds of selection were performed. Recovered clones were recovered after each round, subcloned into rAAV pXR2 backbone and SSV9 replication competent backbone, and sequenced.

[0331] Cloning AAV8 / E532K was generated using site-directed mutagenesis (Agilent quik change II kit) to introduce a single mutation (E532K, using Olig001 VP1 numbering) into pGSK2 / 8 (repAAV2-capAAV8). Primers were designed using the Agilent QuikChange Primer Design Program; forward: 5'GGGAAAAAAACGCTCCTTGTCGTCTTTGTGTGTTG3' (SEQ ID NO: 135) and reverse: 5'CAACACACAAAGACGACAAGGAGCGTTTTTTTCCC (SEQ ID NO: 136). Single colonies were grown and confirmed by Sanger sequencing. To generate Olig001 / AAV8 VP3, the N-terminus of Olig001, including VP1 and VP2, was amplified using forward (F1): 5'AATGTGGATTTGGATGACTG (SEQ ID NO: 137) and reverse primer mutagenic at the VP3 transcription start: 5'CGTTATTGTCTGCCATTGGTGCGCCACCGCCTGCAGCCATTGTAAGAGA3' (SEQ ID NO: 138), resulting in a 659 bp fragment. The C-terminal portion of the AAV8 VP3 sequence was amplified from pGSK2 / 8 using forward primer used: 5'ACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTA3' (SEQ ID NO: 139) and reverse primer used (R2): 5'AGAGCCGAGAACGTAC3' (SEQ ID NO: 140), resulting in a 437 bp product. The two PCR products had 20 bp of overlapping sequence from each other. The entire chimeric cap gene was amplified using both the fragment and the F1 and R2 primers. The final PCR product (Olig001 / AAV8 VP3) and pGSK2 / 8 were digested with SwaI and BsiWI. The 6266 bp GSK2 / 8 band and the 1070 bp chimeric cap gene PCR product were gel extracted. The fragment was ligated with 100 ng of pGSK2 / 8 vector at a molar ratio of 3:1 insert to vector.The ligation mixture was transformed into Blue-XL (Agilent; 200249) cells and plated on LB-Amp plates. Single colonies were grown and confirmed via Sanger sequencing.

[0332] AAV vector production Recombinant AAV was produced in HEK293 cells using a triple plasmid transfection method followed by iodixanol gradient centrifugation and ion exchange chromatography as previously described (Gray et al., Gene Ther. 20:450 (2013)). All AAV vectors were packaged with a self-complementary genome with high GFP under the control of the CMV enhancer, the miniature chicken β-actin promoter (CBh), and the MVM intron (Gray et al., Hum. Gene Ther. 22:1143 (2011)). Peak fractions were dialyzed in phosphate-buffered saline (PBS) containing 5% sorbitol and NaCl was added to a final concentration of 350 mM NaCl. Viral titers were obtained via qPCR (see below).

[0333] Biodistribution studies and qPCR for viral titers qPCR was used to determine viral titers and for biodistribution studies (Gray et al., Current protocols in neuroscience / editorial board, Jacqueline N. Crawley...[et al.] Chapter 4:Unit 4 17(2011)). All reactions were performed on a Roche 480 Lightcycler instrument using SyBR Green-based Lightcycler fast start DNA master mix (Roche) according to the manufacturer's instructions. To prepare virus samples for titers, they were treated with DNase I for 1 h, and then DNase I was inactivated by adding EDTA and warming at 70°C for 10 min. To release the encapsidated viral genome for qPCR analysis, the reaction mixture was digested with proteinase K for at least 2 h at 50°C, and then boiled for 10 min to inactivate proteinase K. Samples were diluted in PCR-grade water and used as templates for qPCR reactions. For quantification of GFP virus, plasmid DNA was used as a standard. For quantification of mouse genomic DNA, purified and quantified mouse genomic DNA was used as a standard. All successful reactions gave a single product by melting curve analysis using a standard curve with an R value of 1, and parallel reactions without template gave no product. GFP primers were as follows: Forward: 5'AGCAGCACGACTTCTTCAACTCC3' (SEQ ID NO: 141) Reverse: 5'TGTAGTTGTACTCCAGCTTGTGCC3' (SEQ ID NO: 142). LaminB2 primers for quantification of mouse genomic DNA were as follows: Forward: 5'GTTAACACTCAGGCGCATGGGCC3' (SEQ ID NO: 143) Reverse: 5'CCATCAGGGTCACCTCTGGTTCC3' (SEQ ID NO: 144). To titrate the AAV vector, the following primers were used: Forward: 5'AACATGCTACGCAGAGAGGGAGTGG3' (SEQ ID NO: 145) Reverse: 5'CATGAGACAAGGAACCCCTAGTGATGGAG3' (SEQ ID NO: 146).

[0334] Animal procedures All animals used in these studies were either male Sprague-Dawley rats (Charles River, Morrisville, NC, USA, 250-250 grams) or adult female C57Bl / 6 mice (Jackson Labs, Bar Harbor, ME) maintained on a 12-h light-dark cycle and with free access to water and food. All care and procedures were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and all procedures were approved in advance by the University of North Carolina Institutional Animal Care and Use Committee.

[0335] 6-Hydroxy-dopamine treatment First, rats (N=2) were anesthetized with 50 mg / kg pentobarbital, ip, and placed in a stereotaxic frame. They then received a unilateral injection of 6-hydroxy-dopamine (2 μl, 20 μg) into the right striatum (0.5 mm prebregma, 3.5 mm lateral, 5.5 mm parietal) according to the atlas of Paxinos and Watson (Paxinos G, Watson C., The rat brain in stereotaxic coordinates, 6th ed. Academic Press / Elsevier, Amsterdam; Boston (2007)). This treatment results in a significant decrease in striatal dopamine content 14 days after treatment.

[0336] AAV capsid library administration The AAV capsid library was administered 14 days after 6-hydroxy-dopamine treatment. For each selection round, two rats were first anesthetized with pentobarbital (50 mg / kg ip) and then received an intravenous tail vein injection of the AAV capsid library virus. Three days later, the rats were euthanized and the right striatum was dissected. Cells were then mechanically dissociated for subsequent PCR clone rescue as previously described (Gray et al., Mol. Ther. 18:570 (2010)).

[0337] Stereotactic AAV vector administration Rats were anesthetized with pentobarbital and placed in a stereotaxic frame as described above. Each of the different AAV clones in phosphate-buffered saline (PBS), 5% sorbitol and 350 mM NaCl) was injected at a rate of 1 μl / 5 min into the striatum (0.5 mm anterior to the bregma, 3.5 mm lateral, 5.5 mm parietal, according to the atlas of Paxinos and Watson (Paxinos G, Watson C., The rat brain in stereotaxic coordinates, 6th ed. Academic Press / Elsevier, Amsterdam; Boston (2007)). Rats were sacrificed 14 days after vector injection for immunohistochemical evaluation.

[0338] immunohistochemistry Fourteen days after vector injection, rats received an overdose of pentobarbital (100 mg / kg, ip) followed by transcardial perfusion with 100 ml of ice-cold 0.1 M PBS pH 7.4 (25 ml / min), followed by 180 ml of ice-cold 4% paraformaldehyde-phosphate buffer (pH 7.4) (30 ml / min). Each brain was post-fixed in 4% paraformaldehyde-phosphate buffer (pH 7.4) overnight at 4°C. Fixed brains were sectioned coronally on a Leica vibratome (40 μm thickness) and stored in ice-cold 0.1 M PBS pH 7.4 until further processing. For immunostaining, slides were washed three times for 5 min in 0.1 M PBS pH 7.4 and then blocked for 30 min in 0.1% Triton-X and 10% goat serum in 0.1 M PBS pH 7.4. Primary antibodies NeuN (1:500; Millipore; MAB377) and GFAP (1:2000; Dako; Z0334) were incubated overnight in 0.1M PBS pH 7.4, 0.05% Triton-X and 5% goat serum at 4°C with gentle agitation. Sections were washed in 0.1M PBS pH 7.4 and blocked again as above. Secondary goat anti-mouse Alexa 594 (A11032) for NeuN or goat anti-rabbit Alexa 594 (A11080) for GFAP (both 1:500 in 0.1M PBS pH 7.4, 0.5% Triton-X and 5% goat serum, 4°C for 45 min with gentle agitation). Sections were washed three times in 0.1M PBS pH 7.4 for 5 min each. Sections were floated, placed on glass slides, and dried overnight at room temperature. Slides were mounted with fluorescent mounting media and coverslipped. Confocal imaging was performed at the Michael Hooker Microscopy Core at UNC-Chapel Hill using a Leica Sp2 confocal. Slides were visualized with a 40x objective using sequential laser scanning to obtain z-stacks. Z-stacks were approximately 4 μm across 10-12 slides, with a thickness of 0.36 μm per stack.Stacks were flattened in Leica software and processed in Image J. At least five independent fields were used to count GFP positive cells and their co-labeling with NeuN or GFAP to determine tropism.

[0339] Biodistribution Adult female C57Bl / 6 mice (Jackson labs; Bar Harbor, ME) were cultured at 5 × 10 10 vg(~2.5×10 12 The mice were injected intravenously into the tail vein at 1000 ng / kg body weight (vg / kg body weight). Organs were harvested 10 days after injection. Total DNA was extracted from each organ using Qiagen DNeasy blood and tissue kit, and total copies of GFP and mouse genomic LaminB2 were determined by qPCR. Data were collected from five mice for AAV8 and four mice for Olig001.

[0340] In vitro binding Mixed glial cultures were prepared from 3-day-old C57BL / 6J pups. Forebrains were minced, dissociated, and washed before plating into T75 flasks. Cells were removed from the flasks and then cultured in approximately 5×10 5Cells were replated into five 35 mm tissue culture dishes. At 95% confluency, four AAV viruses (Olig001 / AAV8 VP3; Olig001; AAV8; AAV8 / E532K) containing the CBh-GFP reporter genome were diluted and added separately in quadruplicate at an MOI of 100 vg / cell and incubated for 1 h at 4°C with mixing every 10 min. Plates were rinsed three times with ice-cold PBS and cells were scraped from the plates, pelleted, and frozen at -80°C. A dish with PBS only was also included as a mock sample. DNA was isolated from samples using Qiagen DNeasy blood and tissue kit. The amounts of viral GFP and mouse genomic LaminB2 were determined by qPCR. Statistical analysis and graphing were performed in Prism. Outliers were determined using the Grubbs test and subsequently removed. Statistical significance (P<0.05) was determined using a one-tailed Mann-Whitney test. Fold changes were determined from the average of each AAV8-derived virus.

[0341] result Identification of oligodendrocyte-selective AAV capsids The shuffled AAV capsid library was administered intravenously 2 weeks after unilateral administration of 6-hydroxy-dopamine (6-OHDA), and AAV clones were recovered by PCR from isolated striatal cells 3 days later. Surprisingly, 10 of 10 selected clones had highly similar, if not identical, sequences. Even in the second round of capsid shuffling, library administration, and clone selection, 12 of 12 clones had nearly identical sequences, as in the first round (Figure 10A). When the chimeric virus (called Olig001) was administered intravenously to rats treated with unilateral 6-OHDA, immunohistochemistry showed only a few GFP-positive neurons and a sparse number of oligodendrocyte-like cells in the ipsilateral striatum after 2 weeks. In striking contrast, 2 weeks after striatal injection of Olig001 clones into naïve rats, oligodendrocytes comprised the majority of transduced cells, even though gene expression was driven by the constitutive CBh promoter (Fig. 10B-10E). GFP-positive cells displayed typical oligodendrocyte morphology with clear labeling of myelin in the striatal patch / matrix (Fig. 10B-10C). Furthermore, GFP-positive cells did not colocalize with glial fibrillary acidic protein (GFAP), an astrocyte marker (Fig. 10D), and only about 5% of GFP-positive cells colocalized with NeuN, a neuronal marker (Fig. 10E). Thus, almost all GFP-positive cells (>95%) were oligodendrocytes with only a few neurons, and not GFP-positive astrocytes or microglia. This change in tropism directly contrasts with the neuronal tropism characteristic of AAV8, which shares 99.3% homology (seven amino acid differences) with the VP3-specific portion of the Olig001 capsid sequence (Fig. 10A ).

[0342] Olig001 is detargeted from peripheral tissues. Given that the selection process involved intravenous administration of the capsid library, we sought to characterize the biodistribution of Olig001 in wild-type rodents compared to AAV8. Adult female C57Bl / 6 mice received equal amounts of either virus intravenously. Ten days later, organs were harvested and biodistribution was quantified by qPCR for Olig001-CBh-GFP (white bars) and AAV8-CBh-GFP (gray bars) (Figure 11). Biodistribution of Olig001 was significantly reduced in all peripheral organs tested compared to AAV8, especially in the liver (Figure 11). Taken together with our previous results, these data indicate that Olig001 has a significantly different tropism than the related AAV8, both in and outside the CNS.

[0343] The E532K mutation in AAV8 switches tropism from neurons to oligodendrocytes. Of the seven amino acids that distinguish Olig001 from the VP3 region of AAV8, so far only one residue (E532K using Olig001 VP1 numbering or E533K using AAV8 VP1 numbering) has been associated with altered receptor / ligand interactions (Wu et al., J. Virol. 80:11393 (2006)). Wu and colleagues found that the differences in ligand binding and tissue tropism seen between the closely related AAV1 and AAV6 were explained solely by the corresponding lysine or glutamic acid at residue 532, and that the E533K mutation in AAV8 confers a novel ability to bind heparin sulfate (Wu et al., J. Virol. 80:11393 (2006)). We then tested the effect of the E532K mutation on the tropism of AAV8 in the brain (Figure 12A). AAV8 / E532K was packaged with CBh-GFP and expressed at 2 × 10 8AAV8 was injected into the striatum of wild-type male Sprague-Dawley rats at a titer of 10000 vg / μl. Two weeks after injection, brains were harvested and assessed for colocalization of native GFP with neuronal (NeuN) and astrocytic (GFAP) markers (Figures 12B-12G). Native GFP did not colocalize with either neuronal (Figures 12B-12D) or astrocytic (Figures 12E-12G) markers. In contrast, GFP-positive cells showed the characteristic morphology of oligodendrocytes. Taken together, AAV8 with the E532K mutation shifted the tropism of AAV8 from neuronal to oligodendrocyte selective, indicating a role for the same residue in Olig001 towards oligodendrocyte tropism. However, in the context of Olig001, we found that reversal of the mutation (K532E) did not affect oligodendrocyte tropism (summarized in Figure 15).

[0344] Olig001 oligodendrocyte tropism is conferred by amino acids outside VP3 Traditionally, only VP3 residues have been thought to contribute to AAV serotype tropism and extracellular receptor binding, whereas specific VP1 and VP2 moieties at the N-terminus are thought to mediate endosomal escape and nuclear import (Bleker et al., J. Virol. 79:2528 (2005); Grieger et al., J. Virol. 80:5199 (2006); Kronenberg et al., J. Virol. 79:5296 (2005); Sonntag et al., J. Virol. 80:11040 (2006)). To identify specific amino acids in the Olig001 capsid that contribute to oligodendrocyte tropism, we generated an Olig001 mutant that reverts the seven residue differences in VP3 to AAV8 residues. However, no single or cluster of mutations in Olig001 VP3 reduced the oligodendrocyte tropism of Olig001 in the rat striatum to less than 98% of cells (summarized in Figure 15). Similarly, peripheral organ biodistribution was highly reduced in all mutants tested, with the greatest reduction seen in mutants that retained the VP1 / VP2 specific region Olig001 (Figure 16). As a next step, we replaced all Olig001 VP3 sequences with AAV8 VP3 sequences to assess the global contribution of VP3 (Figure 13A). Mutant Olig001 with AAV8 VP3 (Olig001 / AAV8 VP3) was packaged with CBh-GFP and injected into the striatum of wild-type male Sprague-Dawley rats. Two weeks later, brains were harvested and assessed for colocalization of native GFP with neuronal (NeuN) and astrocytic (GFAP) markers (Figures 13B-13G). Native GFP barely colocalized with NeuN (2% of cells) (Figures 13B-13D) and did not colocalize with GFAP (Figures 13E-13G). In addition, GFP-positive cells displayed the characteristic morphology of striatal oligodendrocytes. These results suggest that the VP1 / VP2-specific portion of the capsid has a previously unappreciated effect on AAV tropism.

[0345] In vitro binding data The VP1 / VP2-specific portion of the Olig001 capsid may be directed toward the preferred transduction of oligodendrocytes through increased extracellular binding to a receptor(s) on oligodendrocytes or through increased intracellular trafficking by an unknown mechanism that may be specific to oligodendrocytes. To distinguish between these two scenarios, we performed in vitro binding experiments using mixed glial cultures containing Olig001, Olig001 / VP3 AAV8 mutant, AAV8, and AAV8 / E532K mutant (all packaged with CBh-GFP). Mixed glial cultures were incubated with equivalent amounts of each virus for 1 h at 4°C. This procedure allows the vector to bind to the cell surface but prevents internalization (Xiao et al., Mol. Ther. 20:317 (2012)). The amount of vector bound to cells was quantified by qPCR for GFP and normalized to mouse genomic LaminB2 (Figure 14A). Consistent with our in vivo results, Olig001 bound 9-fold more than AAV8 to mixed glial cell populations (Figure 14B). Binding of Olig001 / AAV VP3 was slightly lower than Olig001 (4-fold more than AAV8), while AAV8 / E532K bound 46-fold more than AAV8 (Figure 11B). These results suggest that both the E532K mutation and the VP1 / VP2-specific N-terminal domain each contribute in a redundant manner to the oligodendrocyte tropism of Olig001. Thus, the in vitro data are consistent with the observed in vivo tropism data.

[0346] These studies have yielded the discovery of novel chimeric AAV capsid mutants with selective in vivo tropism for oligodendrocytes, a major departure from the normal neuronal tropism of the chimeric parental AAV serotype. Previous studies have shown the ability of AAV2 or AAV8 to transduce oligodendrocytes with low efficiency, but these studies required the use of oligodendrocyte promoters to prevent expression in neurons, the preferred cell type for these vectors (Chen et al., J. Neurosci. Res. 55:504 (1999); Chen et al., Gene Ther. 5:50 (1998); Klein et al., Mol. Ther. 13:517 (2006); Lawlor et al., Mol. Ther. 17:1692 (2009)). In contrast, Olig001 has the ability to efficiently and selectively transduce oligodendrocytes using a ubiquitous promoter after intracranial administration. Thus, Olig001 has a favorable tropism for oligodendrocytes and a reduced tropism for neurons, which is distinct from any previously reported AAV capsid.

[0347] We identified two distinct and redundant regions of the Olig001 capsid that are sufficient to drive this oligodendrocyte tropism. Interestingly, a single amino acid mutation in AAV8, E532K (AAV8 / E532K), is sufficient to select for the acquired tropism for oligodendrocytes and greatly reduce its neuronal tropism. However, this oligodendrocyte selectivity does not result from a single loss of neuronal tropism, since the AAV8 / E532K mutant shows significantly increased binding to oligodendrocytes in vitro (46-fold higher than AAV8) (Figure 15). The second domain of Olig001 that confers its oligodendrocyte tropism is perhaps more interesting, given its location within the VP1 / VP2-specific N-terminus of the capsid ORF. The VP3-specific region of the capsid (which accounts for 54 of 60 total capsid subunits per virion (Johnson et al., J. Virol. 8:860 (1971); Rose et al., J. Virol. 8:766 (1971)) is generally believed to contain the key elements involved in receptor binding (reviewed in Agbandje-McKenna et al., Meth. Mol. Biol. 807:47 (2011)). In sharp contrast, the VP1 / VP2-dependent switch in AAV tropism indicates that manipulation of VP3 sequences is not the only contributing factor to AAV vector tropism. Clearly, our findings support the notion that VP1 and VP2 (which account for 54 of 60 total capsid subunits per virion (Johnson et al., J. Virol. 8:860 (1971); Rose et al., J. Virol. 8:766 (1971)) are involved in the VP3-specific region of the capsid. al., J. Virol. 8:766 (1971)) show that AAV vector tropism can be influenced greatly by extracellular binding rather than intracellular trafficking.

[0348] The Olig001 vector described herein may be useful for in vivo and in vitro research applications requiring gene transfer into oligodendrocytes, which are typically refractory to efficient chemical transfection or vector-mediated transduction. Furthermore, the ability to efficiently target oligodendrocytes in vivo may develop therapeutic strategies for demyelinating diseases, such as Canavan disease or Krabbe disease. These studies further challenge the commonly accepted view that AAV tropism is exclusively determined by the VP3-specific portion of the capsid, rather than the VP1 / VP1-specific N-terminal domain.

[0349] The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The present invention is defined by the following claims, including equivalents of the claims to be included therein.

Claims

1. A nucleic acid encoding an AAV capsid, said nucleic acid comprising: (a) the nucleotide sequence of any one of SEQ ID NOs: 1 to 43; or (b) a nucleotide sequence encoding any one of SEQ ID NOs: 44 to 86. An AAV capsid coding sequence that is at least 70% identical to Including, Nucleic acid.

2. 2. The nucleic acid of claim 1, The AAV capsid coding sequence is at least 80% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

3. 2. The nucleic acid of claim 1, The AAV capsid coding sequence is at least 90% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

4. 2. The nucleic acid of claim 1, The AAV capsid coding sequence is at least 95% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

5. 2. The nucleic acid of claim 1, The AAV capsid coding sequence comprises the nucleotide sequence of (a) or (b): Nucleic acid.

6. A nucleic acid encoding an AAV capsid, The nucleic acid is (a) the nucleotide sequence of any one of SEQ ID NOs: 1 to 43; or (b) a nucleotide sequence encoding any one of SEQ ID NOs: 44-86; comprising a VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence that is at least 70% identical to operably linked to a VP3-encoding portion of a different AAV capsid coding sequence; Nucleic acid.

7. 7. The nucleic acid of claim 6, the VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence is at least 80% identical to a nucleotide sequence of (a) or (b); Nucleic acid.

8. 7. The nucleic acid of claim 6, the VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence is at least 90% identical to a nucleotide sequence of (a) or (b); Nucleic acid.

9. 7. The nucleic acid of claim 6, the VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence is at least 95% identical to a nucleotide sequence of (a) or (b); Nucleic acid.

10. 7. The nucleic acid of claim 6, The VP1, VP2, or VP1 / VP2 encoding portion of the AAV capsid coding sequence comprises the nucleotide sequence of (a) or (b): Nucleic acid.

11. 11. The nucleic acid of any one of claims 1 to 10, The nucleic acid is a plasmid, a phage, a viral vector, a bacterial artificial chromosome, or a yeast artificial chromosome; Nucleic acid.

12. 12. The nucleic acid of any one of claims 1 to 11, The nucleic acid is an AAV vector comprising the coding sequence. Nucleic acid.

13. 13. The nucleic acid of any one of claims 1 to 12, The nucleic acid further comprises an AAV rep coding sequence. Nucleic acid.

14. An in vitro cell comprising:

14. A method for the production of a nucleic acid vector comprising the steps of: Cells in vitro.

15. 14. The nucleic acid of claim 1 , Virus particles.

16. 16. The virus particle of claim 15, The virus particle is an AAV particle, an adenovirus particle, a herpes virus particle, or a baculovirus particle. Virus particles.

17. An AAV capsid, Contains an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 44 to 86; AAV capsid.

18. 18. The AAV capsid of claim 17, Contains an amino acid sequence at least 95% identical to any one of SEQ ID NOs: 44 to 86; AAV capsid.

19. 18. The AAV capsid of claim 17, Contains an amino acid sequence at least 99% identical to any one of SEQ ID NOs: 44 to 86; AAV capsid.

20. 18. The AAV capsid of claim 17, Contains any one of the amino acid sequences of SEQ ID NOs: 44 to 86; AAV capsid.

21. An AAV capsid, comprising a VP1, VP2, or VP1 / VP2 portion comprising an amino acid sequence at least 90% identical to any one of SEQ ID NOs:44-86; operably linked to the VP3 portion of a different AAV capsid; AAV capsid.

22. 22. The AAV capsid of claim 21, comprising a VP1, VP2, or VP1 / VP2 portion comprising an amino acid sequence at least 95% identical to any one of SEQ ID NOs: 44-86; AAV capsid.

23. 22. The AAV capsid of claim 21, comprising a VP1, VP2, or VP1 / VP2 portion comprising an amino acid sequence at least 99% identical to any one of SEQ ID NOs: 44-86; AAV capsid.

24. 22. The AAV capsid of claim 21, comprising a VP1, VP2, or VP1 / VP2 portion comprising the amino acid sequence of any one of SEQ ID NOs: 44-86; AAV capsid.

25. 25. The AAV capsid of any one of claims 21 to 24, covalently linked, bound or encapsidated to a compound selected from the group consisting of a DNA molecule, an RNA molecule, a polypeptide, a carbohydrate, a lipid, and a small organic molecule; AAV capsid.

26. 1. An AAV particle comprising: An AAV vector genome; and The AAV capsid of any one of claims 21 to 24. Including, The AAV capsid encapsidates the AAV vector genome. AAV particles.

27. 27. The AAV particle of claim 26, The AAV vector genome comprises a heterologous nucleic acid. AAV particles.

28. 28. The AAV particle of claim 27, The heterologous nucleic acid encodes an antisense RNA, a microRNA, or an RNAi. AAV particles.

29. 28. The AAV particle of claim 27, The heterologous nucleic acid encodes a polypeptide. AAV particles.

30. 30. The AAV particle of claim 29, The heterologous nucleic acid encodes a therapeutic polypeptide. AAV particles.

31. 30. The AAV particle of claim 29, The heterologous nucleic acid encodes a growth factor or a differentiation factor. AAV particles.

32. 30. The AAV particle of claim 29, The heterologous nucleic acid encodes insulin-like growth factor-1, glial derived neurotrophic factor, neurotrophin-3, neurotrophin-4, artemin, neurturin, persephin, brain-derived neurotrophic factor, nerve growth factor, ciliary neurotrophic factor, transforming growth factor alpha, platelet-derived growth factor, leukemia inhibitory factor, prolactin, monocarboxylate transporter 1, or nuclear factor 1A. AAV particles.

33. 30. The AAV particle of claim 29, The heterologous nucleic acid encodes a reporter protein. AAV particles.

34. 34. The AAV particle of any one of claims 26 to 33, The heterologous nucleic acid is operably linked to a constitutive promoter. AAV particles.

35. 34. The AAV particle of any one of claims 26 to 33, The heterologous nucleic acid is operably linked to a central nervous system (CNS) cell-specific or CNS cell-selective promoter; AAV particles.

36. 36. The AAV particle of claim 35, The CNS cell-specific or CNS cell-selective promoter is a promoter from neuron-specific enolase, synapsin, MeCP2, glial fibrillary acidic protein, S100β, wdr16, Foxj1, LRP2, myelin basic protein, cyclic nucleotide phosphodiesterase, proteolipid protein, Gtx, or Sox10; AAV particles.

37. 1. A method for producing a recombinant AAV particle comprising an AAV capsid, comprising: The method comprises: Providing a cell in vitro with a nucleic acid according to any one of claims 1 to 8, an AAV rep coding sequence, an AAV vector genome comprising the heterologous nucleic acid, and helper functions to produce a productive AAV infection; and allowing assembly of the recombinant AAV particles that contain the AAV capsid and encapsidate the AAV vector genome; Including, method.

38. Produced by the method of claim 37. AAV particles.

39. 1. A pharmaceutical formulation comprising:

38. A method for the preparation of a nucleic acid of any one of claims 1 to 13, a viral particle of any one of claims 15 or 16, an AAV capsid of any one of claims 17 to 25, or an AAV particle of any one of claims 26 to 36 or 38, in a pharma- ceutically acceptable carrier. Pharmaceutical preparations.

40. 1. A method for delivering a nucleic acid of interest to a CNS cell, comprising: The method comprises contacting the cell with an AAV particle of any one of claims 26 to 36 or 38. method.

41. 1. A method for delivering a nucleic acid of interest to a CNS cell in a mammalian subject, comprising: The method comprises: Administering to a mammalian subject an effective amount of the AAV particles of any one of claims 26-36 or 38 or the pharmaceutical formulation of claim 30. method.

42. 42. The method of claim 41, The mammalian subject is a human subject. method.

43. 43. The method of claim 41 or 42, The AAV particles are delivered to the CNS. method.

44. 44. The method of claim 43, The AAV particles are delivered directly to the CNS by intrathecal, intracerebral, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof; method.

45. 44. The method of claim 43, the subject has a compromised blood-brain barrier; The AAV particles are delivered to the CNS by intravenous administration. method.

46. 1. A method for delivering a nucleic acid of interest to a region of the CNS adjacent to a compromised blood-brain barrier region in a mammalian subject, comprising: The method comprises:

37. The method of claim 36, comprising administering intravenously to a mammalian subject an effective amount of the AAV particles of any one of claims 26-36 or 38 or the pharmaceutical formulation of claim 30. method.

47. 1. A method for treating a disorder associated with CNS dysfunction in a mammalian subject in need thereof, comprising: The method comprises administering to a mammalian subject a therapeutically effective amount of the AAV particles of any one of claims 26-36 or 38 or the pharmaceutical formulation of claim 39. method.

48. A nucleic acid encoding an AAV capsid, The nucleic acid is (a) the nucleotide sequence of any one of SEQ ID NOs: 87-107; or (b) a nucleotide sequence encoding any one of SEQ ID NOs: 108 to 128. comprising an AAV capsid coding sequence that is at least 70% identical to Nucleic acid.

49. 49. The nucleic acid of claim 48, The AAV capsid coding sequence is at least 80% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

50. 49. The nucleic acid of claim 48, The AAV capsid coding sequence is at least 90% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

51. 49. The nucleic acid of claim 48, The AAV capsid coding sequence is at least 95% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

52. 49. The nucleic acid of claim 48, The AAV capsid coding sequence comprises the nucleotide sequence of (a) or (b). Nucleic acid.

53. A nucleic acid encoding an AAV capsid, The nucleic acid is (a) the nucleotide sequence of any one of SEQ ID NOs: 87-107; or (b) a nucleotide sequence encoding any one of SEQ ID NOs: 108-128; comprising a VP1, VP2, or VP1 / VP2-encoding portion of an AAV capsid coding sequence that is at least 70% identical to operably linked to a VP3-encoding portion of a different AAV capsid coding sequence; Nucleic acid.

54. 54. The nucleic acid of claim 53, the VP1, VP2, or VP1 / VP2-encoding portion of said AAV capsid coding sequence is at least 80% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

55. 54. The nucleic acid of claim 53, the VP1, VP2, or VP1 / VP2-encoding portion of said AAV capsid coding sequence is at least 90% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

56. 54. The nucleic acid of claim 53, the VP1, VP2, or VP1 / VP2-encoding portion of said AAV capsid coding sequence is at least 95% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

57. 54. The nucleic acid of claim 53, The VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence comprises the nucleotide sequence of (a) or (b): Nucleic acid.

58. 58. The nucleic acid of any one of claims 48 to 57, The nucleic acid is a plasmid, a phage, a viral vector, a bacterial artificial chromosome, or a yeast artificial chromosome; Nucleic acid.

59. 59. The nucleic acid of any one of claims 48 to 58, The nucleic acid is an AAV vector comprising the coding sequence. Nucleic acid.

60. 60. The nucleic acid of any one of claims 48 to 59, The nucleic acid further comprises an AAV rep coding sequence. Nucleic acid.

61. An in vitro cell comprising:

61. The nucleic acid of any one of claims 48 to 60, stably integrated into the genome. Cells in vitro.

62. A virus particle, 61. The nucleic acid of any one of claims 48 to 60, Virus particles.

63. 63. The viral particle of claim 62, The virus particle is an AAV particle, an adenovirus particle, a herpes virus particle, or a baculovirus particle. Virus particles.

64. An AAV capsid, Contains an amino acid sequence at least 90% identical to any one of SEQ ID NOs: 108-128; AAV capsid.

65. 65. The AAV capsid of claim 64, Contains an amino acid sequence at least 95% identical to any one of SEQ ID NOs: 108-128; AAV capsid.

66. 65. The AAV capsid of claim 64, Contains an amino acid sequence at least 99% identical to any one of SEQ ID NOs: 108-128; AAV capsid.

67. 65. The AAV capsid of claim 64, Comprising any one of the amino acid sequences of SEQ ID NOs: 108 to 128; AAV capsid.

68. An AAV capsid, comprising a VP1, VP2, or VP1 / VP2 portion comprising an amino acid sequence at least 90% identical to any one of SEQ ID NOs: 108-128; operably linked to the VP3 portion of a different AAV capsid; AAV capsid.

69. 22. The AAV capsid of claim 21, comprising a VP1, VP2, or VP1 / VP2 portion comprising an amino acid sequence at least 95% identical to any one of SEQ ID NOs: 108-128; AAV capsid.

70. 22. The AAV capsid of claim 21, comprising a VP1, VP2, or VP1 / VP2 portion comprising an amino acid sequence at least 99% identical to any one of SEQ ID NOs: 108-128; AAV capsid.

71. 22. The AAV capsid of claim 21, comprising a VP1, VP2, or VP1 / VP2 portion comprising the amino acid sequence of any one of SEQ ID NOs: 108-128; AAV capsid.

72. 72. The AAV capsid of any one of claims 64 to 71, covalently linked, bound or encapsidated to a compound selected from the group consisting of a DNA molecule, an RNA molecule, a polypeptide, a carbohydrate, a lipid, and a small organic molecule; AAV capsid.

73. 1. An AAV particle comprising: An AAV vector genome; and The AAV capsid of any one of claims 64 to 71. Including, The AAV capsid encapsidates the AAV vector genome. AAV particles.

74. 74. The AAV particle of claim 73, The AAV vector genome comprises a heterologous nucleic acid. AAV particles.

75. 75. The AAV particle of claim 74, The heterologous nucleic acid encodes an antisense RNA, a microRNA, or an RNAi. AAV particles.

76. 75. The AAV particle of claim 74, The heterologous nucleic acid encodes a polypeptide. AAV particles.

77. 77. The AAV particle of claim 76, The heterologous nucleic acid encodes a therapeutic polypeptide. AAV particles.

78. 78. The AAV particle of claim 77, The therapeutic polypeptide is methylcytosine binding protein 2. AAV particles.

79. 77. The AAV particle of claim 76, The heterologous nucleic acid encodes a growth factor or a differentiation factor. AAV particles.

80. 77. The AAV particle of claim 76, The heterologous nucleic acid encodes insulin-like growth factor-1, glial derived neurotrophic factor, neurotrophin-3, neurotrophin-4, artemin, neurturin, persephin, brain-derived neurotrophic factor, nerve growth factor, ciliary neurotrophic factor, transforming growth factor alpha, platelet-derived growth factor, leukemia inhibitory factor, prolactin, monocarboxylate transporter 1, or nuclear factor 1A; AAV particles.

81. 77. The AAV particle of claim 76, The heterologous nucleic acid encodes a reporter protein. AAV particles.

82. 82. The AAV particle of any one of claims 73 to 81, The heterologous nucleic acid is operably linked to a constitutive promoter. AAV particles.

83. 82. The AAV particle of any one of claims 73 to 81, The heterologous nucleic acid is operably linked to a CNS cell-specific or CNS cell-selective promoter; AAV particles.

84. 84. The AAV particle of claim 83, The CNS cell-specific or CNS cell-selective promoter is a promoter from neuron-specific enolase, synapsin, MeCP2, glial fibrillary acidic protein, S100β, wdr16, Foxj1, LRP2, myelin basic protein, cyclic nucleotide phosphodiesterase, proteolipid protein, Gtx, or Sox10; AAV particles.

85. 1. A method for producing a recombinant AAV particle comprising an AAV capsid, comprising: The method comprises: Providing a cell in vitro with a nucleic acid according to any one of claims 48 to 60, an AAV rep coding sequence, an AAV vector genome comprising the heterologous nucleic acid, and helper functions to produce a productive AAV infection; and allowing assembly of the recombinant AAV particles that contain the AAV capsid and encapsidate the AAV vector genome; Including, method.

86. 86. Produced by the method of claim 85. AAV particles.

87. 1. A pharmaceutical formulation comprising: 48-60, a viral particle of any one of claims 62 or 63, an AAV capsid of any one of claims 64-72, or an AAV particle of any one of claims 73-84 or 86, in a pharma- ceutically acceptable carrier. Pharmaceutical preparations.

88. 1. A method for delivering a nucleic acid of interest to a CNS cell, comprising: The method comprises contacting the cell with an AAV particle of any one of claims 73 to 84 or 86. method.

89. 1. A method for delivering a nucleic acid of interest to a CNS cell in a mammalian subject, comprising: The method comprises: Administering to a mammalian subject an effective amount of the AAV particles of any one of claims 73-84 or 86 or the pharmaceutical formulation of claim 87. method.

90. 90. The method of claim 89, The mammalian subject is a human subject. method.

91. 91. The method of claim 89 or 90, The subject has Rett Syndrome. method.

92. 92. The method of any one of claims 89 to 91, comprising: The AAV particles are delivered to the CNS. method.

93. 93. The method of claim 92, The AAV particles are delivered directly to the CNS by intrathecal, intracerebral, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof; method.

94. 93. The method of claim 92, the subject has an impaired blood-brain barrier; The AAV particles are delivered to the CNS by intravenous administration. method.

95. 1. A method for delivering a nucleic acid of interest to a region of the CNS adjacent to a compromised blood-brain barrier region in a mammalian subject, comprising: The method comprises:

87. The method of claim 85, comprising administering intravenously to a mammalian subject an effective amount of the AAV particles of any one of claims 73-84 or 86 or the pharmaceutical formulation of claim 87. method.

96. 96. The method of claim 95, The subject has Rett Syndrome. method.

97. 1. A method of treating Rett Syndrome in a mammalian subject in need thereof, comprising: The method comprises administering to a mammalian subject a therapeutically effective amount of the AAV particles of any one of claims 73-84 or 86 or the pharmaceutical formulation of claim 87. method.

98. A nucleic acid encoding an AAV capsid, The nucleic acid is (a) the nucleotide sequence of SEQ ID NO: 129; or (b) a nucleotide sequence encoding one of SEQ ID NOs: 130-132; comprising a VP1, VP2, or VP1 / VP2-encoding portion of an AAV capsid coding sequence that is at least 90% identical to operably linked to a VP3-encoding portion of a different AAV capsid coding sequence; Nucleic acid.

99. 99. The nucleic acid of claim 98, the VP1, VP2, or VP1 / VP2-encoding portion of said AAV capsid coding sequence is at least 95% identical to the nucleotide sequence of (a) or (b); Nucleic acid.

100. 99. The nucleic acid of claim 98, The VP1, VP2, or VP1 / VP2-encoding portion of the AAV capsid coding sequence comprises the nucleotide sequence of (a) or (b): Nucleic acid.

101. 101. The nucleic acid of any one of claims 98 to 100, Further encoding the E532K substitution, Nucleic acid.

102. 102. The nucleic acid of any one of claims 98 to 101, The nucleic acid is a plasmid, a phage, a viral vector, a bacterial artificial chromosome, or a yeast artificial chromosome; Nucleic acid.

103. 103. The nucleic acid of any one of claims 98 to 102, The nucleic acid is an AAV vector comprising the coding sequence. Nucleic acid.

104. 104. The nucleic acid of any one of claims 98 to 103, The nucleic acid further comprises an AAV rep coding sequence. Nucleic acid.

105. An in vitro cell comprising:

105. The nucleic acid of any one of claims 98 to 104, stably integrated into the genome. Cells in vitro.

106. A virus particle, 105. The nucleic acid of any one of claims 98 to 104, Virus particles.

107. 107. The viral particle of claim 106, The virus particle is an AAV particle, an adenovirus particle, a herpes virus particle, or a baculovirus particle. Virus particles.

108. An AAV capsid. Contains an amino acid sequence that is at least 96% identical to one of SEQ ID NOs: 130 to 132; AAV capsid.

109. 109. The AAV capsid of claim 108, Contains an amino acid sequence at least 99% identical to one of SEQ ID NOs: 130-132; AAV capsid.

110. 110. The AAV capsid of claim 109, Comprising one of the amino acid sequences of SEQ ID NOs: 130 to 132; AAV capsid.

111. 111. The AAV capsid of any one of claims 108 to 110, Further encoding the E532K substitution, AAV capsid.

112. 112. The AAV capsid of any one of claims 108 to 111, covalently linked, bound or encapsidated to a compound selected from the group consisting of a DNA molecule, an RNA molecule, a polypeptide, a carbohydrate, a lipid, and a small organic molecule; AAV capsid.

113. 1. An AAV particle comprising: An AAV vector genome; and The AAV capsid of any one of claims 108 to 112. Including, The AAV capsid encapsidates the AAV vector genome. AAV particles.

114. 114. The AAV particle of claim 113, The AAV vector genome comprises a heterologous nucleic acid. AAV particles.

115. 114. The AAV particle of claim 113, The heterologous nucleic acid encodes an antisense RNA, a microRNA, or an RNAi. AAV particles.

116. 114. The AAV particle of claim 113, The heterologous nucleic acid encodes a polypeptide. AAV particles.

117. 117. The AAV particle of claim 116, The heterologous nucleic acid encodes a therapeutic polypeptide. AAV particles.

118. 117. The AAV particle of claim 116, The heterologous nucleic acid encodes a growth factor or a differentiation factor. AAV particles.

119. 117. The AAV particle of claim 116, The heterologous nucleic acid encodes insulin growth factor-1, glial derived neurotrophic factor, neurotrophin-3, artemin, transforming growth factor alpha, platelet derived growth factor, leukemia inhibitory factor, prolactin, monocarboxylate transporter 1, or nuclear factor 1A. AAV particles.

120. 117. The AAV particle of claim 116, The heterologous nucleic acid encodes a reporter protein. AAV particles.

121. 121. The AAV particle of any one of claims 113 to 120, The heterologous nucleic acid is operably linked to a constitutive promoter. AAV particles.

122. 121. The AAV particle of any one of claims 113 to 120, The heterologous nucleic acid is operably linked to an oligodendrocyte-specific or oligodendrocyte-selective promoter. AAV particles.

123. 123. The AAV particle of claim 122, The oligodendrocyte-specific or oligodendrocyte-selective promoter is a promoter selected from myelin basic protein, cyclic nucleotide phosphodiesterase, proteolipid protein, Gtx, or Sox10; AAV particles.

124. 1. A method for producing a recombinant AAV particle comprising an AAV capsid, comprising: The method comprises: Providing a cell in vitro with a nucleic acid according to any one of claims 98 to 104, an AAV rep coding sequence, an AAV vector genome comprising the heterologous nucleic acid, and helper functions to produce a productive AAV infection; and allowing assembly of the recombinant AAV particles that contain the AAV capsid and encapsidate the AAV vector genome; Including, method.

125. Produced by the method of claim 124. AAV particles.

126. 1. A pharmaceutical formulation comprising: 98-104, a viral particle of any one of claims 106 or 107, an AAV capsid of any one of claims 108-112, or an AAV particle of any one of claims 113-123 or 125, in a pharma- ceutically acceptable carrier. Pharmaceutical preparations.

127. 1. A method for delivering a nucleic acid of interest to an oligodendrocyte, comprising: The method comprises contacting the oligodendrocytes with an AAV particle of any one of claims 113 to 123 or 125. method.

128. 1. A method for delivering a nucleic acid of interest to oligodendrocytes in a mammalian subject, comprising: The method comprises:

127. The method of claim 126, comprising administering to a mammalian subject an effective amount of the AAV particles of any one of claims 113-123 or 125 or the pharmaceutical formulation of claim 126. method.

129. 129. The method of claim 128, The mammalian subject is a human subject. method.

130. 130. The method of claim 128 or 129, comprising: The AAV particles are delivered to the central nervous system (CNS). method.

131. 131. The method of claim 130, The AAV particles are delivered directly to the CNS by intrathecal, intracerebral, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof; method.

132. 132. The method of claim 131, the subject has an impaired blood-brain barrier; The AAV particles are delivered to the CNS by intravenous administration. method.

133. 1. A method for delivering a nucleic acid of interest to a region of the CNS adjacent to a compromised blood-brain barrier region in a mammalian subject, comprising: The method comprises:

127. The method of claim 126, comprising administering intravenously to a mammalian subject an effective amount of the AAV particles of any one of claims 113-123 or 125 or the pharmaceutical formulation of claim 126. method.

134. 1. A method of treating a disorder associated with oligodendrocyte dysfunction in a mammalian subject in need thereof, comprising: The method comprises administering to a mammalian subject a therapeutically effective amount of the AAV particles of any one of claims 113-123 or 125 or the pharmaceutical formulation of claim 126. method.

135. 135. The method of claim 134, The disorder associated with oligodendrocyte dysfunction is a demyelinating disease. method.

136. 135. The method of claim 134, The disorder associated with oligodendrocyte dysfunction is multiple sclerosis, Pelizaeus-Merzbacher disease, Krabbe disease, metachromatic leukodystrophy, adrenoleukodystrophy, Canavan disease, Alexander disease, normochromatic leukodystrophy, Zellweger disease, 18q-syndrome, cerebral palsy, spinal cord injury, traumatic brain injury, stroke, phenylketonuria, or viral infection. method.

137. 1. A method for preparing an AAV capsid having a desired tropism profile, comprising: The method comprises modifying the AAV capsid of any one of claims 108 to 112 to insert an amino acid sequence that confers the desired tropism profile. method.

138. 138. The method of claim 137, The tropism profile of interest is a tissue selected from skeletal muscle, liver, cardiac muscle, diaphragm, kidney, liver, pancreas, spleen, gastrointestinal tract, lung, joint tissue, tongue, ovary, testis, germ cell, cancer cell, or a combination thereof; method.

139. A nucleic acid encoding an AAV8 capsid, The capsid comprises an E532K substitution. Nucleic acid.

140. 140. The nucleic acid of claim 139, The nucleic acid is a plasmid, a phage, a viral vector, a bacterial artificial chromosome, or a yeast artificial chromosome; Nucleic acid.

141. 141. The nucleic acid of any one of claims 139 to 140, The nucleic acid is an AAV vector comprising the coding sequence. Nucleic acid.

142. 142. The nucleic acid of any one of claims 139 to 141, The nucleic acid further comprises an AAV rep coding sequence. Nucleic acid.

143. An in vitro cell comprising:

143. The nucleic acid of any one of claims 139 to 142, stably integrated into the genome. Cells in vitro.

144. A virus particle, 143. The nucleic acid of any one of claims 139 to 142, Virus particles.

145. 145. The viral particle of claim 144, The virus particle is an AAV particle, an adenovirus particle, a herpes virus particle, or a baculovirus particle. Virus particles.

146. Containing an E532K substitution, AAV8 capsid.

147. 147. The AAV capsid of claim 146, covalently linked, bound or encapsidated to a compound selected from the group consisting of a DNA molecule, an RNA molecule, a polypeptide, a carbohydrate, a lipid, and a small organic molecule; AAV capsid.

148. 1. An AAV particle comprising: An AAV vector genome; and The AAV capsid of any one of claims 146 to 147. Including, The AAV capsid encapsidates the AAV vector genome. AAV particles.

149. 149. The AAV particle of claim 148, The AAV vector genome comprises a heterologous nucleic acid. AAV particles.

150. 149. The AAV particle of claim 148, The heterologous nucleic acid encodes an antisense RNA, a microRNA, or an RNAi. AAV particles.

151. 149. The AAV particle of claim 148, The heterologous nucleic acid encodes a polypeptide. AAV particles.

152. 152. The AAV particle of claim 151, The heterologous nucleic acid encodes a therapeutic polypeptide. AAV particles.

153. 152. The AAV particle of claim 151, The heterologous nucleic acid encodes a growth factor or a differentiation factor. AAV particles.

154. 152. The AAV particle of claim 151, The heterologous nucleic acid encodes insulin growth factor-1, glial derived neurotrophic factor, neurotrophin-3, artemin, transforming growth factor alpha, platelet derived growth factor, leukemia inhibitory factor, prolactin, monocarboxylate transporter 1, or nuclear factor 1A. AAV particles.

155. 152. The AAV particle of claim 151, The heterologous nucleic acid encodes a reporter protein. AAV particles.

156. 156. The AAV particle of any one of claims 148 to 155, The heterologous nucleic acid is operably linked to a constitutive promoter. AAV particles.

157. 156. The AAV particle of any one of claims 148 to 155, The heterologous nucleic acid is operably linked to an oligodendrocyte-specific or oligodendrocyte-selective promoter. AAV particles.

158. 158. The AAV particle of claim 157, The oligodendrocyte-specific or oligodendrocyte-selective promoter is a promoter selected from myelin basic protein, cyclic nucleotide phosphodiesterase, proteolipid protein, Gtx, or Sox10; AAV particles.

159. 1. A method for producing a recombinant AAV particle comprising an AAV capsid, comprising: The method comprises: Providing a cell in vitro with a nucleic acid according to any one of claims 139 to 142, an AAV rep coding sequence, an AAV vector genome comprising the heterologous nucleic acid, and helper functions to produce a productive AAV infection; and allowing assembly of the recombinant AAV particles that contain the AAV capsid and encapsidate the AAV vector genome; Including, method.

160. Produced by the method of claim 159. AAV particles.

161. 1. A pharmaceutical formulation comprising: 139-142, the viral particle of any one of claims 144 or 145, the AAV capsid of any one of claims 146-147, or the AAV particle of any one of claims 148-158 or 160, in a pharma- ceutically acceptable carrier. Pharmaceutical preparations.

162. 1. A method for delivering a nucleic acid of interest to an oligodendrocyte, comprising: The method comprises contacting the oligodendrocytes with an AAV particle of any one of claims 148 to 158 or 160. method.

163. 1. A method for delivering a nucleic acid of interest to oligodendrocytes in a mammalian subject, comprising: The method comprises: Administering to a mammalian subject an effective amount of the AAV particles of any one of claims 148-158 or 160 or the pharmaceutical formulation of claim 161. method.

164. 164. The method of claim 163, comprising: The mammalian subject is a human subject. method.

165. 165. The method of claim 163 or 164, comprising: The AAV particles are delivered to the central nervous system (CNS). method.

166. 166. The method of claim 165, The AAV particles are delivered directly to the CNS by intrathecal, intracerebral, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof; method.

167. 166. The method of claim 165, the subject has an impaired blood-brain barrier; The AAV particles are delivered to the CNS by intravenous administration. method.

168. 1. A method for delivering a nucleic acid of interest to a region of the CNS adjacent to a compromised blood-brain barrier region in a mammalian subject, comprising: The method comprises:

162. The method of claim 161, comprising administering intravenously to a mammalian subject an effective amount of the AAV particles of any one of claims 148-158 or 160 or the pharmaceutical formulation of claim 161. method.

169. 1. A method of treating a disorder associated with oligodendrocyte dysfunction in a mammalian subject in need thereof, comprising: The method comprises administering to a mammalian subject a therapeutically effective amount of the AAV particles of any one of claims 148-158 or 160 or the pharmaceutical formulation of claim 161. method.

170. 170. The method of claim 169, The disorder associated with oligodendrocyte dysfunction is a demyelinating disease. method.

171. 170. The method of claim 169, The disorder associated with oligodendrocyte dysfunction is multiple sclerosis, Pelizaeus-Merzbacher disease, Krabbe disease, metachromatic leukodystrophy, adrenoleukodystrophy, Canavan disease, Alexander disease, normochromatic leukodystrophy, Zellweger disease, 18q-syndrome, cerebral palsy, spinal cord injury, traumatic brain injury, stroke, phenylketonuria, or viral infection. method.

Images