Compositions and methods comprising TTR guide RNA and polynucleotide encoding RNA-guided DNA binding agent

Abstract

To provide compositions and methods using a guide RNA with an RNA-guided DNA binding agent such as the CRISPR / Cas system to substantially reduce or knockout expression of the TTR gene, thereby substantially reducing or eliminating the production of TTR protein associated with amyloidosis associated with transthyretin (ATTR).SOLUTION: The present invention provides compositions and methods for editing within a TTR gene, e.g., for introducing double-stranded breaks, by a nucleic acid encoding an RNA-guided DNA binding agent having a specific sequence and a guide RNA having a specific sequence or a vector encoding the guide RNA.SELECTED DRAWING: None

Description

[Technical Field]

[0001] This patent application is a continuation of U.S. Provisional Application No. 62 / 825,637, filed March 28, 2019. No. 10 / 1999,523, filed on Oct. 1, 2002, the contents of which are incorporated herein by reference in their entirety for all purposes. INCORPORATED INTO THE SPECIFICATION.

[0002] This application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The name of this ASCII copy created on March 24, 2020 is incorporated herein by reference. The title is 2020-03-24_01155-0028-00PCT_ST25.txt It is 451KB in size. [Background technology]

[0003] Transthyretin (TTR) is a protein produced by the TTR gene. TTR normally functions to transport retinol and thyroxine throughout the body. TTR is synthesized in the liver and produced in small amounts in the choroid plexus and retina. It circulates as a soluble tetrameric protein.

[0004] Pathogenic variants that can disrupt tetramer stability are caused by mutant alleles of the TTR gene. Mutant TTR can be encoded by amyloid (i.e., misfolded) This can result in misfolded TTR, which can produce aggregates of the TTR protein. In some cases, TTR pathogenic variants may cause amyloidosis, i.e. That is, it can cause diseases resulting from the accumulation of amyloid. TTR monomers are organized into amyloid fibrils in tissues such as peripheral nerves, the heart, and the gastrointestinal tract. Amyloid plaques can also form on wild-type TTR misfolded proteins. It may also include type TTR.

[0005] In addition, wild-type TTR misfolding and deposition were observed in men aged 60 years or older. This has been linked to heart rhythm problems, heart failure, and carpal tunnel.

[0006] Amyloidosis characterized by TTR deposition is referred to as "ATTR" or "TTR-related amyloidosis." "TTR amyloidosis," "TTR amyloidosis," or "ATTR amyloidosis" ATTR familial amyloidosis (when associated with a familial genetic mutation), or or "ATTRwt" or "wild-type ATTR" (misfolded wild-type TTR) and when resulting from deposition).

[0007] ATTR can present with a wide range of symptoms, with different types of ATTR Patients may have different characteristics and prognosis. Some types of ATTR include familial Familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), and Wild-type TTR amyloidosis (wt-TTR amyloidosis) is one example. generally present with sensorimotor neuropathy, whereas FAC and wt-TTR amyloid FAP and FAC are usually associated with the TTR gene. It has been associated with genetic mutations in the TTR gene, with over 100 different mutations in the gene In contrast, wt-TTR amyloidosis is associated with ATTR. It is associated with age and not with genetic mutations in TTR. Approximately 50% of cases worldwide It is estimated that 2,000 patients may suffer from FAP and FAC.

[0008] Over 100 mutations in TTR are associated with ATTR, but certain mutations are associated with neuropathy. These are more closely associated with rheumatoid arthropathy and / or cardiomyopathy. For example, Mutations are associated with both cardiomyopathy and neuropathy, and mutations in V30 are associated with neuropathies. mutations at V122 are more associated with cardiomyopathy, and mutations at V123 are more associated with cardiomyopathy. do.

[0009] Various therapeutic approaches have been investigated for the treatment of ATTR, but none have been successful in halting disease progression. There are no approved drugs that improve quality of life. Liver transplants are being studied to treat ATTR. However, this approach carries significant risks and may result in continued disease progression after transplantation. The use of small molecule stabilizers such as diflunisal and tafamidis is declining. Although these drugs appear to slow the progression of TR, they do not halt the progression of the disease. do not have.

[0010] Small interfering RNA (siRNA) knockdown targets amyloid fibrils for destruction Approaches using genomic DNA, antisense knockdown, or monoclonal antibodies are also promising. Although currently being studied, preliminary results regarding short-term inhibition of TTR expression are encouraging. This indicates that there is a need for treatments that can produce long-lasting inhibition of TTR. There is. Summary of the Invention [Problem to be solved by the invention]

[0011] Accordingly, the following embodiments are provided: In some embodiments, the present invention provides Using guide RNAs in conjunction with RNA-guided DNA binding agents such as CRISPR / Cas systems, substantially reduce or knock out the expression of the TTR gene, thereby Compositions and methods for substantially reducing or eliminating the production of TTR protein associated with TTR The present invention provides a method for producing a TTR protein associated with ATTR by modifying the TTR gene. Substantially reducing or eliminating the production of can result in a long-term reduction or elimination. do. [Means for solving the problem]

[0012] The following embodiments are provided herein:

[0013] Embodiment 1 is a composition comprising: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder; And, a. The open reading frame has at least 93% identity to SEQ ID NO:311. and / or b. The open reading frame is at least the first 50, 200, 250, or at least 93% identity to SEQ ID NO: 311 over 300 nucleotides. or at least the first 30, 50, 70, 100, 150, 200, 2 At least 95% identity to SEQ ID NO: 311 over 50 or 300 nucleotides and / or c. The open reading frame contains at least 95%, 96%, 97%, or 98%, 99%, 99.5%, or 100% of the codons listed in Table 4, low A in Table 5 and / or d. An open reading frame has an adenine content of at least is within 123% of its minimum adenine content, and / or e. An open reading frame is one whose adenine dinucleotide content is within its minimum adenine dinucleotide content. Adenine dinucleotide content ranges from 150% of the minimum adenine dinucleotide content a nucleic acid, (ii) a guide RNA or a vector encoding a guide RNA, A comprises a guide sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82. and a guide RNA or a vector encoding the guide RNA. .

[0014] Embodiment 2 is directed to a method for modifying the TTR gene and / or creating a double-strand break (D) in the TTR gene. SB), comprising delivering a composition to a cell, the composition comprising: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder; And, a. The open reading frame has at least 93% identity to SEQ ID NO:311. and / or b. The open reading frame is at least the first 50, 200, 250, or at least 93% identity to SEQ ID NO: 311 over 300 nucleotides. or at least the first 30, 50, 70, 100, 150, 200, 2 At least 95% identity to SEQ ID NO: 311 over 50 or 300 nucleotides and / or c. The open reading frame contains at least 95%, 96%, 97%, or 98%, 99%, 99.5%, or 100% of the codons listed in Table 4, low A in Table 5 and / or d. An open reading frame has an adenine content of at least is within 123% of its minimum adenine content, and / or e. An open reading frame is one whose adenine dinucleotide content is within its minimum adenine dinucleotide content. Adenine dinucleotide content ranges from 150% of the minimum adenine dinucleotide content a nucleic acid, (ii) a guide RNA or a vector encoding a guide RNA, A comprises a guide sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82. and a guide RNA or a vector encoding the guide RNA.

[0015] Embodiment 3 is directed to a method for reducing TTR serum concentrations and TTR-associated amyloidosis in a subject. cis (ATTR) and / or amyloid or amyloidogenic compounds containing TTR. A method for reducing or preventing fibrous accumulation comprising administering a composition to a subject in need thereof. wherein the composition comprises: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder; And, a. The open reading frame has at least 95% identity to SEQ ID NO:311. and / or b. The open reading frame is located within at least the first 30, 50, 70, or 10 SEQ ID NO: 311 over 0, 150, 200, 250, or 300 nucleotides and / or has at least 95% identity to c. The open reading frame contains at least 95%, 96%, 97%, or 98%, 99%, 99.5%, or 100% of the codons listed in Table 4, low A in Table 5 and / or d. An open reading frame has an adenine content of at least to 150% of that minimum adenine content, and / or e. An open reading frame is one whose adenine dinucleotide content is within its minimum adenine dinucleotide content. Adenine dinucleotide content ranges from 150% of the minimum adenine dinucleotide content a nucleic acid, (ii) a guide RNA or a vector encoding a guide RNA, A comprises a guide sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82. and a guide RNA or a vector encoding the guide RNA, thereby , reducing TTR serum concentrations in a subject and preventing TTR-associated amyloidosis (ATTR) ) and / or reduce the accumulation of TTR-containing amyloid or amyloid fibrils. It is a method to reduce or prevent

[0016] Embodiment 4 is a method for preparing a guide RNA comprising the steps of: 5, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61 63, 65, 66, 68, or 69. The composition or method is any one of

[0017] Embodiment 5 is directed to inducing a double-strand break (DSB) in the TTR gene in a cell or subject. 5. The composition of embodiment 1 or 4 for use in treating a patient with atopic dermatitis.

[0018] Embodiment 6 is directed to a method for modifying a TTR gene in a cell or a subject, comprising: The composition of embodiment 1, 4, or 5.

[0019] Embodiment 7 is a method for treating TTR-associated amyloidosis (ATTR) in a subject. 7. The composition of embodiment 1, 4, 5, or 6 for use in administering

[0020] Embodiment 8 is directed to a method for use in reducing TTR serum concentrations in a subject, comprising: 1, 4, 5, 6, or 7.

[0021] Embodiment 9 is a method for reducing or preventing amyloid or amyloid fibril accumulation in a subject. is the composition of embodiment 1, 4, 5, 6, 7, or 8 for use in preventing .

[0022] Embodiment 10 is a method in which the method includes administering the composition by infusion for more than 30 minutes. The composition or method for use of any one of embodiments 2 to 9.

[0023] In an eleventh embodiment, the composition is applied for about 45 to 75 minutes, 75 to 105 minutes, 105 to 135 minutes. 135-165 minutes, 165-195 minutes, 195-225 minutes, 225-255 minutes 255-285 minutes, 285-315 minutes, 315-345 minutes, or 345-3 11. The composition for the method or use of embodiment 10, wherein the composition is administered by infusion over 75 minutes. do.

[0024] Embodiment 12 is a method for administering the composition by infusion over about 1.5 to 6 hours. 0 or 11.

[0025] Embodiment 13 is a method for treating a skin condition in which the composition is applied for about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, 11. The method of embodiment 10, wherein the compound is administered by infusion over about 180 minutes, or about 240 minutes. is a composition for use.

[0026] Embodiment 14 is the method of embodiment 10, wherein the composition is administered by infusion over about 120 minutes. A composition for the method or use.

[0027] Embodiment 15 is any of embodiments 2 to 14, wherein the composition reduces serum TTR levels. or a composition for one of the methods or uses.

[0028] Embodiment 16 is a method for treating a patient with a rheumatoid arthritis, the method comprising administering to said patient a dose of 100 mg / kg of TTR serum in ... 16. The composition for the method or use of embodiment 15, wherein the amount of erythrocytes in the blood is reduced by at least 50%.

[0029] Embodiment 17 is a method for treating a patient with a TTR disorder characterized by an increase in serum TTR levels by 50-60%, 60% or more compared to serum TTR levels before administration of the composition. ~70%, 70~80%, 80~90%, 90~95%, 95~98%, 98~99%, 151. The method or use of embodiment 151, which reduces serum TTR levels by 99-100% or by 100%. It is a composition for use.

[0030] Embodiment 18 is any of embodiments 2 to 17, wherein the composition causes editing of the TTR gene. The composition is for any one of the methods or uses.

[0031] Embodiment 19 is a method for determining whether an edit is made as a percentage of the collection that is edited (the edit percentage). 19. The composition for the method or use of embodiment 18, wherein the composition is calculated as follows:

[0032] Embodiment 20 is the same as embodiment 19, wherein the edit percentage is 30 to 99% of the collection. The composition is for a method or use.

[0033] Embodiment 21 is a method for editing a collection of 30 to 35%, 35 to 40%, 40 to 40% of the collection. 5%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70 ~75%, 75~80%, 80~85%, 85~90%, 90~95%, or 95~9 20. The composition for the method or use of embodiment 19, wherein the composition is 9%.

[0034] Embodiment 22 is a method for treating atopic dermatitis, wherein the composition reduces amyloid deposition in at least one tissue. , for the method or use of any one of the embodiments 2 to 21 It is a composition.

[0035] Embodiment 23 is a method for treating at least one tissue comprising administering to a subject therapies ... 23. A composition for the method or use of embodiment 22, comprising one or more of:

[0036] Embodiment 24 is an embodiment in which amyloid deposits are measured 8 weeks after administration of the composition. 22 or 23.

[0037] Embodiment 25 is a method for treating amyloid deposits in a subject, comprising administering a negative control or a control to the subject, the control, or a patient, to the subject, the composition, or a patient, the subject, the patient ... 25. The composition for the method or use of any one of embodiments 22 to 24, as compared to bell. is.

[0038] Embodiment 26 is a method for detecting amyloid deposits in a biopsy sample and / or by immunostaining. 26. The composition for the method or use of any one of embodiments 22 to 25, wherein be.

[0039] Embodiment 27 is a method for treating amyloid deposits in a subject, the method comprising administering to said subject amyloid deposits in a subject amyloid deposits concentration greater than 30% of the amyloid deposits observed in a negative control. ~35%, 35~40%, 40~45%, 45~50%, 50~55%, 55~60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90 %, 90-95%, or 95-99% reduction of any one of embodiments 22-26. A composition for the method or use.

[0040] Embodiment 28 is a method for treating amyloid deposits in a patient in need of treatment with amyloid ... ~35%, 35~40%, 40~45%, 45~50%, 50~55%, 55~60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90 %, 90-95%, or 95-99% reduction of any one of embodiments 22-27. A composition for the method or use.

[0041] Embodiment 29 is a method according to any one of embodiments 2 to 28, wherein the composition is administered or delivered at least twice. The present invention relates to a composition for use in any one of the methods or uses.

[0042] Embodiment 30 is the method of embodiment 29, wherein the composition is administered or delivered at least three times. The composition is for a method or use.

[0043] Embodiment 31 is the method of embodiment 29, wherein the composition is administered or delivered at least four times. The composition is for a method or use.

[0044] Embodiment 32 is a method for administering the composition in a single dose, including administering up to 5, 6, 7, 8, 9, or 10 doses. 30. The composition for the method or use of embodiment 29, wherein the composition is delivered or administered intravenously.

[0045] Embodiment 33 is a method for administering or delivering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 Any of embodiments 29-32, wherein the administration is performed at intervals of 1, 12, 13, 14, or 15 days. or a composition for one of the methods or uses.

[0046] Embodiment 34 is a method for administering or delivering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 Any of embodiments 29-32, wherein the administration is performed at intervals of 1, 12, 13, 14, or 15 weeks. or a composition for one of the methods or uses.

[0047] Embodiment 35 is a method for administering or delivering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 Any of embodiments 29-32, performed at intervals of 1, 12, 13, 14, or 15 months. The composition is for any one of the methods or uses.

[0048] Embodiment 36 is a method for preparing a guide RNA comprising the steps of: and a crRNA further comprising a guide sequence, wherein the nucleotide of SEQ ID NO: 126 is a guide sequence.

[0023] The method or composition of any one of the preceding embodiments, wherein the nucleotide sequence is nucleotide 1 followed at its 3' end by nucleotide 2.

[0049] Embodiment 37 is the same as the preceding embodiment, wherein the guide RNA is a dual guide (dgRNA). The present invention relates to any one of the methods or compositions of the present invention.

[0050] Embodiment 38 is a method of preparing a dual guide RNA comprising the steps of: , a crRNA in which the guide sequence is followed at its 3' end by nucleotides of SEQ ID NO: 126, and a tr 38. The method or composition of embodiment 37, comprising:

[0051] Embodiment 39 is the same as embodiment 1, wherein the guide RNA is a single guide (sgRNA). any one of the methods or compositions of any one of claims 1 to 36.

[0052] Embodiment 40 is a method for producing a sgRNA comprising the steps of: 40. The method or composition of embodiment 39.

[0053] Embodiment 41 is the method of embodiment 39, or It is a composition.

[0054] Embodiment 42 is a method for producing a sgRNA comprising the steps of: A guide sequence and any one of the nucleotides of SEQ ID NO: 126. 42. The method or composition of any one of aspects 39 to 41.

[0055] Embodiment 43 is a method for producing a sgRNA comprising the steps of: 2 to 124 and at least 99%, 98%, 97%, 96%, 95%, 39 to 40, including sequences that are 94%, 93%, 92%, 91%, or 90% identical. 42.

[0056] Embodiment 44 is a method for producing a sgRNA comprising the steps of: 40. The method or composition of embodiment 39, comprising a sequence selected from 2-124.

[0057] Embodiment 45 is any of the preceding embodiments, wherein the guide RNA comprises at least one modification. Any one of the methods or compositions.

[0058] Embodiment 46 is a method for treating a malonic acid deficiency, wherein at least one modification is a 2'-O-methyl (2'-O-Me) modification. 46. ​​The method or composition of embodiment 45, comprising a nucleotide.

[0059] Embodiment 47 is a method for preparing a nucleotide sequence comprising the steps of: 47. The method or composition of embodiment 45 or 46, comprising a .) bond.

[0060] Embodiment 48 is a method for preparing a nucleotide sequence comprising the steps of: 48. The method or composition of any one of embodiments 45-47, comprising a hydroxybenzoate.

[0061] Embodiment 49 is an embodiment in which at least one modification is within the first five nucleotides at the 5' end. 49. The method or method of any one of embodiments 45 to 48, comprising a modification in one or more of the following: is a composition.

[0062] Embodiment 50 is a method in which at least one modification is within the last five nucleotides at the 3' end. 50. The method or method of any one of embodiments 45 to 49, comprising a modification in one or more of the following: is a composition.

[0063] Embodiment 51 is a method in which at least one modification modifies the PS bond between the first four nucleotides. 51. The method or composition of any one of embodiments 45 to 50, comprising:

[0064] Embodiment 52 is a method in which at least one modification modifies the PS bond between the last four nucleotides. 52. The method or composition of any one of embodiments 45 to 51, comprising:

[0065] Embodiment 53 is an embodiment in which at least one modification is within the first three nucleotides at the 5' end. 53. The method of any one of embodiments 45 to 52, wherein the nucleotide comprises 2'-O-Me modified nucleotides. Or a composition.

[0066] Embodiment 54 is a method in which at least one modification is made to the last three nucleotides at the 3' end. 54. The method of any one of embodiments 45 to 53, wherein the nucleotide sequence comprises 2'-O-Me modified nucleotides. Or a composition.

[0067] Embodiment 55 is the method of embodiment 4, wherein the guide RNA comprises modified nucleotides of SEQ ID NO: 3. 5 to 54.

[0068] Embodiment 56 is the composition of any one of embodiments 1 to 5, wherein the composition further comprises a pharmaceutically acceptable excipient. 5. Any one of the methods or compositions.

[0069] Embodiment 57 is a method for producing an open cell antibody encoding a guide RNA and an RNA-guided DNA binder.

[0023] Embodiments in which the nucleic acid comprising the reading frame is associated with a lipid nanoparticle (LNP). 1 to 56.

[0070] Embodiment 58 is the method or composition of embodiment 57, wherein the LNP comprises a CCD lipid. do.

[0071] Embodiment 59 is a method for preparing a CCD lipid, the method comprising the steps of: is lipid A.

[0072] Embodiment 60 is any one of embodiments 57 to 59, wherein the LNP comprises a helper lipid. The method or composition of the present invention is

[0073] Embodiment 61 is the method of embodiment 60, or It is a composition.

[0074] Embodiment 62 is a method for preparing a LNP comprising administering to a subject a drug or drug product ... 7 to 61.

[0075] Embodiment 63 is the method of embodiment 62, wherein the stealth lipid is PEG2k-DMG. or a composition.

[0076] Embodiment 64 is (i) The LNP comprises a lipid component, and the lipid component is an alpha-lipid, such as lipid A, at about 50 to 60 mol %. The mixture consisted of approximately 8-10 mol% of neutral lipids and approximately 2.5-4 mol% of stealth lipids ( The remainder of the lipid components are helper lipids, and the LNP composition The N / P ratio is about 6, (ii) LNPs are composed of approximately 50–60 mol % amine lipids, such as lipid A, and approximately 27–39. 5 mol% helper lipids, about 8-10 mol% neutral lipids, and about 2.5-4 mol% and a stealth lipid (e.g., a PEG lipid), and the N / P ratio of the LNP composition is about 5-7. (e.g., about 6), (iii) The LNP contains a lipid component, and the lipid component is about 50 to 60 mol% of lipid A, etc. amine lipids, about 5-15 mol% neutral lipids, and about 2.5-4 mol% stealth lipids. The remainder of the lipid component is a helper lipid, and the LNP composition The N / P ratio of the product is about 3 to 10, (iv) The LNP contains a lipid component, and the lipid component is about 40 to 60 mol % of lipid A, etc. Amine lipids, approximately 5-15 mol% neutral lipids, and approximately 2.5-4 mol% stealth lipids (e.g., PEG-lipids), with the remainder of the lipid components being helper lipids, forming an LNP composition The N / P ratio of the material is about 6, (v) The LNP comprises a lipid component, and the lipid component is an alpha-lipid, such as lipid A, at about 50 to 60 mol %. amine lipids, approximately 5-15 mol% neutral lipids, and approximately 1.5-10 mol% stealth lipids (e.g., PEG-lipids), with the remainder of the lipid components being helper lipids, forming an LNP composition The N / P ratio of the material is about 6, (vi) The LNP contains a lipid component, and the lipid component is about 40 to 60 mol % of lipid A, etc. Amine lipids, approximately 0-10 mol% neutral lipids, and approximately 1.5-10 mol% stealth lipids The remainder of the lipid component is a helper lipid, and the LNP composition The N / P ratio of the product is about 3 to 10, (vii) The LNP contains a lipid component, and the lipid component is about 40 to 60 mol% of lipid A, etc. amine lipids, less than about 1 mol% neutral lipids, and about 1.5 to 10 mol% stealth lipids. The remainder of the lipid component is a helper lipid, and the LNP composition The N / P ratio of the product is about 3 to 10, (viii) The LNP contains a lipid component, and the lipid component is about 40 to 60 mol % of lipid A. Which amine lipid and about 1.5 to 10 mol% of stealth lipid (e.g., PEG lipid) The remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 3 to 10. and the LNP composition is essentially free of, or free of, neutral phospholipids; or (ix) The LNP contains a lipid component, and the lipid component is about 50 to 60 mol % of lipid A, etc. Amine lipids, approximately 8-10 mol% neutral lipids, and approximately 2.5-4 mol% stealth lipids (e.g., PEG-lipids), with the remainder of the lipid components being helper lipids, forming an LNP composition 64. The method or composition of any one of embodiments 57-63, wherein the N / P ratio of the product is about 3-7. is.

[0077] Embodiment 64a is the method of embodiment 64, or It is a composition.

[0078] Embodiment 64b is a method according to embodiment 64 or 64, wherein the mol % of the amine lipid is about 50. a method or composition.

[0079] Embodiment 64c is the same as that of embodiments 64-64b, wherein the mol % of the amine lipid is about 55. Any one of the methods or compositions.

[0080] Embodiment 64d is a mixture of embodiments 64-6, in which the mol% of amine lipid is ±3 mol%. 4c.

[0081] Embodiment 64e is an embodiment of any of embodiments 64-6, wherein the mol % of the amine lipid is ±2 mol %. 4d.

[0082] Embodiment 64f is a method for preparing a composition comprising the steps of: 4 to 64e.

[0083] Embodiment 64g is a method for preparing a composition comprising the steps of: 4 to 64f.

[0084] Embodiment 64h is a method for preparing a composition comprising the steps of: 4 to 64 g of any one of the methods or compositions.

[0085] Embodiment 64i is any one of embodiments 64-64h, wherein the N / P ratio is 6±1. The method or composition of the present invention is

[0086] Embodiment 64j is any of embodiments 64 to 64i, in which the N / P ratio is 6±0.5. A method or composition.

[0087] Embodiment 64k is any one of embodiments 64 to 64j, in which the amine lipid is lipid A. The present invention relates to a method or composition.

[0088] Embodiment 641 is any of embodiments 64-641, wherein the amine lipid is an analog of lipid A. Any one of the methods or compositions.

[0089] Embodiment 64m is the method of embodiment 64l or 64l, wherein the analog is an acetal analog. It is a composition.

[0090] Embodiment 64n is an embodiment in which the acetal analog is a C4-C12 acetal analog. The method or composition of claim 64m.

[0091] Embodiment 64o is an embodiment in which the acetal analog is a C5-C12 acetal analog. The method or composition of claim 64m.

[0092] Embodiment 64p is an embodiment in which the acetal analog is a C5-C10 acetal analog. The method or composition of claim 64m.

[0093] Embodiment 64q is an embodiment in which the acetal analog is C4, C5, C6, C7, C9, C10, C 11, and C12 analogs.

[0094] Embodiment 64r is any of embodiments 64 to 64q, wherein the helper lipid is cholesterol. Any one of the methods or compositions.

[0095] Embodiment 64s is any one of embodiments 64 to 64r, in which the neutral lipid is DSPC. The present invention relates to a method or composition.

[0096] Embodiment 64t is any one of embodiments 64 to 64s, in which the neutral lipid is DPPC. The present invention relates to a method or composition.

[0097] Embodiment 64u is an embodiment in which the PEG lipid comprises dimyristoylglycerol (DMG). The method or composition of any one of embodiments 64 to 64t.

[0098] Embodiment 64v is any of embodiments 64-64u, wherein the PEG lipid comprises PEG-2k. Any one of the methods or compositions.

[0099] Embodiment 64w is any of embodiments 64-64v, wherein the PEG lipid is PEG-DMG. Any one of the methods or compositions.

[0100] Embodiment 64x is the method of embodiment 64w, wherein the PEG-DMG is PEG2k-DMG. A method or composition.

[0101] Embodiment 64y is any of embodiments 64-6, wherein the LNP composition is essentially free of neutral lipids. 4x any one of the methods or compositions.

[0102] Embodiment 64z is the method or composition of embodiment 64y, wherein the neutral lipid is a phospholipid. is.

[0103] Embodiment 65 is a method in which the LNP comprises a neutral lipid, and optionally, the neutral lipid is DSPC. The method or composition of any one of embodiments 57 to 64z.

[0104] Embodiment 66 is a method according to embodiment 64 or 65, wherein the amine lipid is present at about 50 mol %. The method or composition of the present invention is

[0105] Embodiment 67 is any of embodiments 64-66, wherein the neutral lipid is present at about 9 mol %. or a method or composition.

[0106] Embodiment 68 is any of embodiments 62-67, wherein the stealth lipid is present at about 3 mol %. Any one of the methods or compositions.

[0107] Embodiment 69 is the method of any one of embodiments 60 to 68, wherein the helper lipid is present at about 38 mol %. Any one of the methods or compositions.

[0108] Embodiment 70 is the method of any one of the preceding embodiments, wherein the LNPs have an N / P ratio of about 6. A method or composition.

[0109] Embodiment 71 is a method for preparing an LNP comprising administering to a subject a lipid component comprising administering to said subject an LNP a lipid component comprising about 50 mol % of lipid A or the like. Which amine lipid, about 9 mol% neutral lipid such as DSPC, and about 3 mol% PEG lipid The remainder of the lipid components are and the N / P ratio of the LNP composition is about 6. 71. The method or composition of claim 70.

[0110] Embodiment 72 is the method of any one of embodiments 64 to 71, wherein the amine lipid is lipid A. A method or composition.

[0111] Embodiment 73 is the method of any one of embodiments 64 to 72, wherein the neutral lipid is DSPC. A method or composition.

[0112] Embodiment 74 is the method of any one of embodiments 62 to 73, wherein the stealth lipid is PEG2k-DMG. Any one of the methods or compositions.

[0113] Embodiment 75 is any of embodiments 60 to 74, wherein the helper lipid is cholesterol. Any one of the methods or compositions.

[0114] Embodiment 76 is a method for preparing an LNP comprising administering to a subject a lipid component comprising administering to a subject a lipid component comprising about 50 mol % of lipid A and about 50 mol % of lipid A. , containing about 9 mol% DSPC and about 3 mol% PEG2k-DMG, and the lipid component Embodiment 70, wherein the remainder is cholesterol and the N / P ratio of the LNP composition is about 6. The method or composition is any one of the above.

[0115] Embodiment 77 is the same as any of the preceding embodiments, in which the RNA-guided DNA-binding agent is a Cas cleavase. The present invention relates to any one of the methods or compositions of the present invention.

[0116] Embodiment 78 is the method of embodiment 77, wherein the RNA-guided DNA binding agent is Cas9. Or a composition.

[0117] Embodiment 79 is any of the preceding embodiments, wherein the RNA-guided DNA binding agent is modified. or a method or composition.

[0118] Embodiment 80 relates to a modified RNA-guided DNA binder comprising a nuclear localization signal (NLS). 80. The method or composition of embodiment 79, comprising:

[0119] Embodiment 81 is directed to a method for the preparation of a nucleic acid sequence comprising: The method or composition of any one of the preceding embodiments, wherein the Cas is Cas.

[0120] Embodiment 82 is a method for treating a rheumatoid arthritis, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier. , the method or composition of any one of the preceding embodiments.

[0121] Embodiment 83 is a method for treating amyloid or amyloid fibrils comprising administering to a subject a therapeutically effective amount of TTR. 83. The composition for the method or use of any one of embodiments 2 to 82, .

[0122] Embodiment 84 is a method for treating amyloid or amyloid fibrils in the nervous system, heart, or gastrointestinal tract. 84. The composition for the method or use of embodiment 83, wherein

[0123] Embodiment 85 is directed to a method for repairing a DSB in a TTR gene by non-homologous end joining (NHEJ). 85. The method or composition for use of any one of embodiments 2 to 84, wherein the mutation is induced during replication. It is a composite product.

[0124] Embodiment 86 is a method for repairing a DSB in a TTR gene, comprising the steps of: 86. A composition for the method or use of embodiment 85, which causes a deletion or insertion.

[0125] Embodiment 87 is a method for identifying a deletion or insertion of a nucleotide mutation in a TTR gene. 87. The composition for the method or use of embodiment 86, which induces a mutation in a gene that induces a nonsense or ... be.

[0126] Embodiment 88 is a method for treating a liver cancer, comprising the steps of: 87. The composition for the method or use of embodiment 86, wherein the TTR gene is induced in % of the TTR gene. be.

[0127] Embodiment 89 is a method for determining whether a frameshift or nonsense mutation is present in 50% to 60% of liver cells. , 60%~70%, 70% or 80%, 80%~90%, 90~95%, 95%~99 %, or 99% to 100% of the TTR gene. or a composition for use.

[0128] Embodiment 90 is a method for treating a TTR gene in which a nucleotide deletion or insertion occurs. 90. Any of embodiments 86-89, wherein the target site is at least 50 times more affected than the target site. A composition for one method or use.

[0129] Embodiment 91 is a method for determining whether a nucleotide deletion or insertion occurs in the TTR gene. 50 to 150 times, 150 to 500 times, 500 to 1500 times more than at the target site times, 1500x~5000x, 5000x~15000x, 15000x~30000x or 30,000 to 60,000 times more abundant, for the method or use of embodiment 90. The composition is:

[0130] Embodiment 92 is a method for producing a human hepatocyte having a nucleotide deletion or insertion of 3 or less in primary human hepatocytes. occurs at no more than two, no more than one, or no off-target sites, and optionally The get site does not occur in a protein-coding region within the genome of primary human hepatocytes. A composition for the method or use of any one of aspects 86 to 91.

[0131] Embodiment 93 is a method for determining whether a nucleotide deletion or insertion occurs in cells overexpressing Cas9. The number of primary genes is less than the number of off-target sites where nucleotide deletions or insertions occur. occurs at an off-target site in human hepatocytes, and optionally, the off-target site is 93. The method of embodiment 92, wherein the nucleotide sequence does not occur within a protein-coding region within the genome of a human hepatocyte. or a composition for use.

[0132] Embodiment 94 is a method for producing a Cas9-overexpressing cell line comprising: 94. The composition for the method or use of embodiment 93, wherein the cell is 293 cells.

[0133] Embodiment 95 is a method for determining whether the number of off-target sites in primary human hepatocytes is greater than or equal to the number of Cas9 mRNAs. Gel derived from primary human hepatocytes transfected in vitro with NA and guide RNA and optionally, off-target sites are determined by analyzing the genome DNA of the primary 95. Any of embodiments 92 to 94, wherein the gene does not occur within a protein-coding region in the genome of a human hepatocyte. The composition is for any one of the methods or uses.

[0134] Embodiment 96 is a method for determining whether the number of off-target sites in primary human hepatocytes is greater than or equal to the number of Cas9 mRNAs. Transfected in vitro with NA, guide RNA and donor oligonucleotides The oligonucleotide insertion assay involves analyzing genomic DNA from primary human hepatocytes. and optionally, off-target sites are determined by the assay, and 95. The method of any one of embodiments 92 to 94, wherein the sequence does not occur within a protein coding region within or a composition for use.

[0135] Embodiment 97 is a method for producing a guide RNA comprising the steps of: a) SEQ ID NO: 92 or 104, b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112, or d) SEQ ID NOs: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108 96. The method or method of any one of embodiments 1 to 36 or 39 to 96, wherein is a composition.

[0136] Embodiment 98 is a method for identifying a target gene for a human hepatocyte, the method comprising: 98. The method or composition of embodiment 97, wherein the method or composition does not generate indels at off-target sites occurring within the It is a composite product.

[0137] Embodiment 99 is a method for administering a composition to a subject, the method comprising: A composition for the method or use of any one of embodiments 2 to 98.

[0138] Embodiment 100 is a method according to embodiment 99, in which the level of TTR is reduced by at least 50%. The composition is for a method or use.

[0139] Embodiment 101 is a method for treating TTR in a patient with a TTR level of 50% to 60%, 60% to 70%, 70% or is 80%, 80%-90%, 90-95%, 95%-99%, or 99%-100% lower 101. The composition for the method or use of embodiment 100, wherein the composition reduces

[0140] Embodiment 102 is a method for determining whether the level of TTR is in serum, plasma, blood, cerebrospinal fluid, or sputum. 102. The composition for the method or use of embodiment 100 or 101, wherein the composition is measured using a

[0141] Embodiment 103 is a method for treating a patient in which TTR levels are measured in the liver, choroid plexus, and / or retina. 102. The composition for the method or use of embodiment 100 or 101, as defined above.

[0142] Embodiment 104 is a method for determining the level of TTR via enzyme-linked immunosorbent assay (ELISA). The composition for the method or use of any one of embodiments 99 to 103, wherein the composition is measured as is.

[0143] Embodiment 105 is the method of any one of embodiments 2 to 104, wherein the subject has ATTR. A composition for the method or use.

[0144] Embodiment 106 is the method or method of any one of embodiments 2 to 105, wherein the subject is a human. or a composition for use.

[0145] Embodiment 107 is the method of embodiment 105 or 106, in which the subject has ATTRwt. The composition is for a method or use.

[0146] Embodiment 108 is the method of embodiment 105 or 106, wherein the subject has an inherited ATTR. A composition for the method or use.

[0147] Embodiment 109 is a method according to any of embodiments 2-106 or 1, wherein the subject has a family history of ATTR. 08. A composition for any one of the methods or uses.

[0148] Embodiment 110 is an embodiment in which the subject has familial amyloid polyneuropathy. 2 to 10 or 10 to 10 .

[0149] Embodiment 111 is a method for treating a rheumatoid arthritis (RA) in a subject having only or primarily neurological symptoms of ATTR. 111. The composition for the method or use of any one of embodiments 2 to 110, comprising:

[0150] Embodiment 112 is the method of any one of embodiments 2 to 111, wherein the subject has familial amyloidotic cardiomyopathy. The composition is for any one of the methods or uses.

[0151] Embodiment 113 is a method for treating a cardiac disorder in which the subject is suffering from only or primarily cardiac symptoms of ATTR. 113. The method or composition for use of any one of embodiments 2 to 110 or 112, It is a composite product.

[0152] Embodiment 114 is the method of any one of embodiments 2 to 11, wherein the subject expresses TTR with a V30 mutation. 3. A composition for any one of the methods or uses.

[0153] Embodiment 115 is an embodiment in which the V30 mutation is V30A, V30G, V30L, or V30M. 115. A composition for the method or use of embodiment 114.

[0154] Embodiment 116 is a method according to any one of embodiments 2 to 11, wherein the subject expresses TTR with a T60 mutation. 3 is a composition for the method or use of any one of the three embodiments.

[0155] Embodiment 117 is the method or use of embodiment 116, wherein the T60 mutation is T60A. It is a composition for

[0156] Embodiment 118 is a method according to any one of embodiments 2 to 1, wherein the subject expresses TTR with a V122 mutation. 13. A composition for the method or use of any one of embodiments 13.

[0157] Embodiment 119 is an embodiment of the present invention, wherein the V122 mutation is V122A, V122I, or V122(-). 119. The composition for the method or use of embodiment 118, wherein

[0158] Embodiment 120 is the method of any of embodiments 2 to 113, wherein the subject expresses wild-type TTR. A composition for one method or use.

[0159] Embodiment 121 is a method for treating a TTR disorder in which the subject develops a TTR having a V30, T60, or V122 mutation. 120. The method or use of any one of embodiments 2 to 107, or 120. It is a composition.

[0160] Embodiment 122 is a method according to any one of embodiments 2-1, wherein the subject does not express TTR with a pathogenic mutation. 07, or a composition for use in any one of the methods or uses of 120 to 121.

[0161] Embodiment 123 is the method of embodiment 122, wherein the subject is homozygous for wild-type TTR. A composition for the method or use.

[0162] Embodiment 124 is a method for treating a subject, the method comprising administering a therapeutically effective amount of a compound to ... For the method or use of any one of embodiments 2 to 123, It is a composition for

[0163] Embodiment 125 is a method for improving, stabilizing, or slowing down the changes in sensorimotor neuropathy. that is measured using electromyography, nerve conduction studies, or patient-reported outcomes. 125. A composition for the method or use of embodiment 124.

[0164] Embodiment 126 is a method for treating a subject experiencing improvement, stabilization, or no change in symptoms of congestive heart failure. The composition for the method or use of any one of embodiments 2 to 125, wherein the

[0165] Embodiment 127 is directed to a method for improving, stabilizing, or slowing down congestive heart failure. , measured using cardiac biomarker tests, pulmonary function tests, chest x-rays, or electrocardiograms 127. A composition for the method or use of embodiment 126.

[0166] Embodiment 128 is a method for administering a composition or pharmaceutical formulation via a viral vector. , a composition for the method or use of any one of embodiments 2 to 127.

[0167] Embodiment 129 is a method for administering a composition or pharmaceutical formulation via lipid nanoparticles. A composition for the method or use of any one of embodiments 2 to 127.

[0168] Embodiment 130 is a method for treating a subject with a specific gene in the TTR gene prior to administering the composition or formulation. 130. The method or use of any one of embodiments 2 to 129, wherein the mutation of The composition is:

[0169] Embodiment 131 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. The sequences are SEQ ID NOs: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30 , 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69. The method or composition of any one of the embodiments.

[0170] Embodiment 132 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 5. do.

[0171] Embodiment 133 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 6. do.

[0172] Embodiment 134 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 7. do.

[0173] Embodiment 135 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 8. do.

[0174] Embodiment 136 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 9. do.

[0175] Embodiment 137 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 10. be.

[0176] Embodiment 138 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 11. be.

[0177] Embodiment 139 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 12. be.

[0178] Embodiment 140 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 13. be.

[0179] Embodiment 141 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 14. be.

[0180] Embodiment 142 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 15. be.

[0181] Embodiment 143 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 16. be.

[0182] Embodiment 144 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 17. be.

[0183] Embodiment 145 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 18. be.

[0184] Embodiment 146 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 19. be.

[0185] Embodiment 147 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 20. be.

[0186] Embodiment 148 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 21. be.

[0187] Embodiment 149 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 22. be.

[0188] Embodiment 150 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 23. be.

[0189] Embodiment 151 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 24. be.

[0190] Embodiment 152 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 25. be.

[0191] Embodiment 153 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 26. be.

[0192] Embodiment 154 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 27. be.

[0193] Embodiment 155 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 28. be.

[0194] Embodiment 156 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 29. be.

[0195] Embodiment 157 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 30. be.

[0196] Embodiment 158 ​​is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 31. be.

[0197] Embodiment 159 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 32. be.

[0198] Embodiment 160 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 33. be.

[0199] Embodiment 161 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 34. be.

[0200] Embodiment 162 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 35. be.

[0201] Embodiment 163 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 36. be.

[0202] Embodiment 164 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 37. be.

[0203] Embodiment 165 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 38. be.

[0204] Embodiment 166 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 39. be.

[0205] Embodiment 167 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 40. be.

[0206] Embodiment 168 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 41. be.

[0207] Embodiment 169 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 42. be.

[0208] Embodiment 170 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 43. be.

[0209] Embodiment 171 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 44. be.

[0210] Embodiment 172 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 45. be.

[0211] Embodiment 173 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 46. be.

[0212] Embodiment 174 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 47. be.

[0213] Embodiment 175 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 48. be.

[0214] Embodiment 176 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 49. be.

[0215] Embodiment 177 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 50. be.

[0216] Embodiment 178 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 51. be.

[0217] Embodiment 179 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 52. be.

[0218] Embodiment 180 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 53. be.

[0219] Embodiment 181 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 54. be.

[0220] Embodiment 182 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 55. be.

[0221] Embodiment 183 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 56. be.

[0222] Embodiment 184 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 57. be.

[0223] Embodiment 185 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 58. be.

[0224] Embodiment 186 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 59. be.

[0225] Embodiment 187 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 60. be.

[0226] Embodiment 188 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 61. be.

[0227] Embodiment 189 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 62. be.

[0228] Embodiment 190 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 63. be.

[0229] Embodiment 191 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 64. be.

[0230] Embodiment 192 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 65. be.

[0231] Embodiment 193 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 66. be.

[0232] Embodiment 194 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 67. be.

[0233] Embodiment 195 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 68. be.

[0234] Embodiment 196 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 69. be.

[0235] Embodiment 197 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 70. be.

[0236] Embodiment 198 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 71. be.

[0237] Embodiment 199 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 72. be.

[0238] Embodiment 200 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 74. be.

[0239] Embodiment 201 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 75. be.

[0240] Embodiment 202 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 76. be.

[0241] Embodiment 203 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 77. be.

[0242] Embodiment 204 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 78. be.

[0243] Embodiment 205 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 80. be.

[0244] Embodiment 206 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 81. be.

[0245] Embodiment 207 is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. 131. The method or composition of any one of embodiments 1 to 130, wherein the sequence is SEQ ID NO: 82. be.

[0246] Embodiment 208 is an embodiment of the present invention, wherein the open reading frame comprises at least the first portion of the sequence. SEQ ID NO: 1 across 10%, 12%, 15%, 20%, 25%, 30%, or 35% of the 311. The composition of any one of the preceding embodiments, is a method.

[0247] Embodiment 209 is an embodiment of the present invention, wherein the open reading frame is a sequence identical to SEQ ID NO: 311 and at least 9 4%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity

[0023] The composition or method of any one of the preceding embodiments, comprising a sequence having the following structure:

[0248] Embodiment 210 is a method for identifying at least 95%, 96%, or more of the codons of an open reading frame. %, 97%, 98%, 99%, 99.5%, or 100% of the results are in Table 4, Table 5, or Table 7.

[0023] The composition or method of any one of the preceding embodiments, wherein the codon is one of the codons listed in

[0249] Embodiment 211 is a method for preparing a codon listed in Table 4, Table 5, or Table 7, comprising the steps of: 211. The composition or method of embodiment 210, wherein the codon is

[0250] Embodiment 212 is an embodiment in which the codon listed in Table 4, Table 5, or Table 7 is a low U codon in Table 5. 211. The composition or method of embodiment 210, wherein the codons are a set of codons.

[0251] Embodiment 213 is an embodiment in which the codon listed in Table 4, Table 5, or Table 7 is a low A codon in Table 5. 211. The composition or method of embodiment 210, wherein the codons are a set of codons.

[0252] Embodiment 214 is a method for determining whether a codon listed in Table 4, Table 5, or Table 7 is a low A / U codon listed in Table 5. 211. The composition or method of embodiment 210, wherein the codon is a codon of the set.

[0253] Embodiment 215 is a method for preparing a codon listed in Table 4, Table 5, or Table 7, comprising the steps of: 211. The composition or method of embodiment 210, wherein the codon is

[0254] Embodiment 216 is an embodiment of the present invention, wherein the open reading frame has an adenine content of at least 1000 nucleotides. Adenine content ~ 101%, 102%, 103%, 105%, 1% of the minimum adenine content Any one of the preceding embodiments, wherein the ratio is in the range of 10%, 115%, 120%, or 123%. The present invention relates to a composition or method.

[0255] Embodiment 217 is a method for preparing an open reading frame comprising the steps of: However, the minimum adenine dinucleotide content is 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, the preceding embodiment, in the range of 130%, 135%, 140%, 145%, or 150%. The composition or method is any one of

[0256] Embodiment 218 is the method for producing a nucleic acid comprising the steps of: contains a 5'UTR that shares at least 90% identity with any one of 275 to 277 , the composition or method of any one of the preceding embodiments.

[0257] Embodiment 219 is the method of claim 219, wherein the nucleic acid is selected from the group consisting of SEQ ID NOs: 233, 235, 237, 239, and 240. any one of the preceding embodiments, comprising a 3'UTR having at least 90% identity to any one of Any one of the compositions or methods.

[0258] Embodiment 220 is a method for preparing a nucleic acid comprising the steps of: The composition or method of any one of the above embodiments.

[0259] Embodiment 221 is an embodiment of the present invention, wherein the nucleic acid has a 5'

[0023] The composition or method of any one of the preceding embodiments, wherein the mRNA comprises a cap. .

[0260] Embodiment 222 is an embodiment of the present invention, wherein the open reading frame is a sequence identical to SEQ ID NO: 377 and at least 9 5%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity 10. The composition or method of any one of the preceding embodiments, comprising the sequence

[0261] Embodiment 223 is a method for preparing a nucleic acid comprising the steps of: The composition or method of any one of the preceding embodiments, wherein the compound is mRNA.

[0262] Embodiment 224 is an embodiment in which the modified uridine is N1-methyl-pseudouridine, pseudouridine. uridine, 5-methoxyuridine, or 5-iodouridine. 224. The composition or method of claim 223.

[0263] Embodiment 225 is directed to a method for treating a uridine comprising administering to a patient a therapeutically effective amount of a uridine, the method ... 224. The composition or method of embodiment 223, wherein the compound is one or both of xylidine. .

[0264] Embodiment 226 is an embodiment in which the modified uridine is N1-methyl-pseudouridine. The composition or method of claim 223.

[0265] Embodiment 227 is the method of embodiment 223, wherein the modified uridine is 5-methoxyuridine. A composition or method.

[0266] Embodiment 228 is an embodiment in which 15% to 45% of the uridines in the mRNA are replaced with modified uridines. 211. The composition or method of any one of embodiments 223 to 210, wherein

[0267] Embodiment 229 is directed to at least 20% or at least 30% of the uridines in the mRNA. The composition or method of any one of embodiments 223 to 211, wherein Or a method.

[0268] Embodiment 230 is directed to a method for preparing a uridine-containing mRNA comprising: 230. The composition or method of embodiment 229, wherein is substituted with a modified uridine.

[0269] Embodiment 231 is an embodiment in which 100% of the uridines in the mRNA are replaced with modified uridines. 229. The composition or method of embodiment 229.

[0270] Embodiment 232 relates to a method for preparing a medicament for treating a human subject having ATTR, Use of the composition or formulation of any of embodiments 1 or 4 to 231. [Brief explanation of the drawings]

[0271] [Figure 1A] 1 shows % editing in primary human hepatocytes from two donors as described in Example 2. [Figure 1B] (As shown above (Figure 1A)). [Figure 2] 1 shows % editing in primary cynomolgus monkey hepatocytes as described in Example 2. [Figure 3A]Serum TTR levels (Figure 3A), hepatic TTR editing (Figure 3B), and circulating ALT levels (Figure 3C) in an in vivo study in non-human primates comparing 30-minute administration of LNPs with a longer dosing protocol are shown. [Figure 3B] (As mentioned above.) [Figure 3C] (As mentioned above.) DETAILED DESCRIPTION OF THE INVENTION

[0272] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it is to be understood that these are exemplary of the invention. It will be understood that it is not intended to be limited to these embodiments. To the contrary, the present invention may be included within the invention as defined by the appended claims. , it is intended to cover all alternatives, modifications, and equivalents.

[0273] Before describing the present teachings in detail, it is understood that the disclosure is not limited to particular compositions or process steps. It should be understood that these are not intended to be limiting and may therefore vary. As used in the appended claims, the singular forms "a" and "an" are used interchangeably. and "the" includes plural references unless the context clearly dictates otherwise. Therefore, for example, "a conjugate" e) includes multiple conjugates, and reference to "a cell" includes , including multiple cells, etc.

[0274] Numeric ranges are inclusive of the numbers that define the range. Measured and measurable values ​​are valid. It is understood that these are approximate values, taking into account various orders of magnitude and errors associated with measurements. "comprise", "comprises", "compr ising, contain, contains "containing," "include," "in The use of "includes" and "including" is intended to be limiting. The foregoing general description and the following detailed description are exemplary only and are not intended to be limiting. It should be understood that this is for illustrative purposes only and is not intended to limit the teachings. is.

[0275] Unless otherwise stated in the above specification, various components may be "comprised" or "included." Embodiments herein that recite "composed of" or "consisting of" the recited elements also are not intended to be limiting. or "consists essentially of" them. An embodiment herein that recites "comprising" also "comprises" the recited component. It is assumed that the term "rising" is used interchangeably with "theories" or "consists essentially of" them. Embodiments herein that recite "consisting essentially of" components also refer to those recited components. "Consists of" or "comprising" the elements (This interchangeability does not apply to the use of these terms in the claims.) The term "or" is used in its inclusive sense to include all, unless the context clearly indicates otherwise. That is, it is used in the same sense as "and / or."

[0276] The section headings used herein are for organizational purposes only and are not intended to be limiting unless otherwise specified. Any material incorporated by reference is not intended to be limiting. , which contradicts any term defined herein or any other express content herein. Although the present teachings are described in conjunction with various embodiments, the present teachings are not intended to be limiting unless otherwise specified. On the contrary, the present teachings should be readily apparent to those skilled in the art. As will be understood, this encompasses various alternatives, modifications and equivalents.

[0277] I. Definition Unless otherwise stated, the following terms and phrases used herein have the following meanings: It is intended to

[0278] "Polynucleotides" and "nucleic acids" refer to nucleic acids composed of nitrogen-based heterocyclic rings linked together along a backbone. Nucleosides or nucleoside analogs (conventional RNA) having the formula base or base analog DNA, mixed RNA-DNA, and their analogous polymers) The nucleic acid "backbone" is used herein to refer to a nucleotide compound consisting of sugar phosphodiester linkages. As a result, peptide-nucleic acid conjugates ("peptide nucleic acids" or PNA, PCT Publication No. WO95 / 3230 No. 5), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof The sugar moiety of a nucleic acid may be composed of a variety of linkages, including one or more of the following: ribose, dextran, thiazolinone ... oxyribose, or substitutions such as 2' methoxy or 2' halide substitutions Nitrogenous bases can be any of the conventional bases (A, G, C, T, U), their analogues, and the like. analogs (e.g., 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine) modified uridines such as douridine), inosine, purine or pyrimidine derivatives (e.g. , N 4-methyldeoxyguanosine, deaza- or aza-purine, deaza- or Aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methyl- cytosine), purine bases with substituents at the 2, 6, or 8 positions, 2-amino-6- Methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 -Alkyl-pyrimidines, rice Patent No. 5,378,825 and PCT No. WO93 / 13121). For a general discussion, see The Biochemistry of the Nuc Leic Acids 5-36, edited by Adams et al., 11 th ed., Nucleic acids are those in which the backbone contains one or more " Nucleic acids may contain "abasic" residues (U.S. Patent No. 5,585,481). Nucleic acids may also be used in the context of conventional RNA. or may contain only DNA sugars, bases and linkages, or may contain conventional building blocks and Both substitutions (e.g., a conventional base with a 2' methoxy linkage, or a conventional base and a 1' methoxy linkage) Nucleic acids can include polymers containing both one or more base analogs. It has bicyclic furanose units locked into a sugar mimicking structure and is compatible with complementary RNA and DNA sequences. one or more LNA nucleotide monomers, which enhance hybridization affinity to These include "locked nucleic acids" (LNAs), which are analogs containing Wengel,2004,Biochemistry 43(42):13233-41 ) RNA and DNA have different sugar moieties, with uracil or its analogues in RNA and may vary depending on the presence of thymine or its analogues in the DNA.

[0279] As used herein, a "polypeptide" refers to an amino acid that is capable of adopting a three-dimensional conformation. Polypeptides refer to polymeric compounds containing amino acid residues. Polypeptides include, but are not limited to, enzymes, enzyme Precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, Polypeptides include those containing post-translational modifications, unnatural amino acids, artificial groups, etc. Good, but not necessarily so.

[0280] "Guide RNA," "gRNA," and "guide" refer to the CRISPR RNA), or a combination of crRNA and trRNA (tra are used interchangeably herein to refer to either crRNA and trRNA are single-stranded RNA molecules (single guide RNA, sgR NA), or can be assembled into two separate RNA molecules (dual guide RNA, The terms "guide RNA" and "gRNA" refer to each type. The trRNA may be a naturally occurring sequence or a sequence that has been modified or altered relative to the naturally occurring sequence. The guide RNA may be a trRNA sequence having diversity. The modified RNA may include such modified RNA.

[0281] As used herein, a "guide sequence" is a sequence that is complementary to a target sequence and A guide to a target sequence for binding or modification (e.g., cleavage) by a DNA binder This refers to the sequence within the guide RNA that functions to direct the guide RNA. " may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be, for example, , Streptococcus pyogenes (i.e., Spy Cas9) and and related Cas9 homologs / orthologs, may be 20 base pairs in length, e.g. , 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides Shorter or longer sequences, such as the length, can also be used as a guide. In some embodiments, the guide sequence and target sequence are 100% complementary or identical. In this embodiment, the guide sequence and the target sequence contain at least one mismatch. For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches. The total length of the target sequence may be at least 17, 18, 19, 20, In some embodiments, the guide sequence and the target sequence are The sequence may contain 1 to 4 mismatches, and the guide sequence must be at least 17, 1 In some embodiments, the amino acid sequence comprises 8, 19, 20, or more nucleotides. The guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches. Often the guide sequence comprises 20 nucleotides.

[0282] The nucleic acid substrate of Cas proteins is a double-stranded nucleic acid, so the target sequence of Cas proteins is , plus and minus strands of genomic DNA (i.e., a given sequence and its sequence Therefore, the guide sequence is "complementary to the target sequence." When said to be present, the guide RNA can be directed to bind to the reverse complement of the target sequence. Therefore, in some embodiments, the guide sequence is When a guide sequence binds to the reverse complement of a target sequence, the guide sequence will react with the substitution of U for T in the guide sequence. Identical to specific nucleotides of the target sequence (e.g., the target sequence without the PAM) except for do.

[0283] As used herein, an "RNA-guided DNA binding agent" refers to an RNA- and DNA-binding agent. A polypeptide or a complex of polypeptides having a binding activity, or a complex of such a polypeptide The DNA-binding subunit is a sequence-specific subunit of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavases. se) / nickases and their inactivated forms ("dCas DNA binders"). As used herein, "Cas nucleases," also referred to as "Cas proteins," include , Cas cleavase, Cas nickase, and dCas DNA binders. Cas cleavase / nickases and dCas DNA binders include type III CRISP Csm or Cmr complexes of R systems, Cas10, Csm1, or their Cmr2 subunits Cascade complex of type I CRISPR system, its Cas3 subunit and class As used herein, "Class 2 Cas nucleases" include class 2 Cas nucleases. "nuclease" refers to an RNA-guided nuclease, such as Cas9 nuclease or Cpf1 nuclease. It is a single-chain polypeptide with NA-binding activity. Class 2 Cas nucleases include R Class 2 Cas cleavages that additionally possess NA-guided DNA cleavage or nickase activity Cas nickases and class 2 Cas nickases (e.g., H840A, D10A, or N863 A variant), and class 2 in which cleavase / nickase activity is inactivated Class 2 Cas nucleases include, for example, Cas dCas DNA binders. 9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N69 2A, M694A, Q695A, H698A variants), eSPCas9(1.0)( e.g., K810A, K1003A, R1060A variants), and eSPCas9 (1.1) (e.g., K848A, K1003A, R1060A variants) protein and modifications thereof. l., Cell, 163:1-13(2015)) is homologous to Cas9 and The Cpf1 sequence of Zetsche is incorporated herein by reference. See, e.g., Tables S1 and S3 of Zetsche. " refers to Spy Cas9, the variants of Cas9 listed herein, and their Equivalents are included. See, e.g., Makarova et al., Nat Rev Mic robiol,13(11):722-36(2015), Shmakov et al. ., Molecular Cell, 60:385-397 (2015) .

[0284] "Modified uridine," as used herein, refers to a compound that has the same hydrogen bond acceptor as uridine and is is used to refer to nucleosides other than thymidine that have one or more structural differences In some embodiments, the modified uridine is a substituted uridine, i.e., one or more aprotic substituents (e.g., alkoxy, e.g., methoxy) are substituted in place of a proton In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., That is, one or more aprotic substituents (e.g., alkyl, e.g., methyl) are proton Alternatively, pseudouridine may be placed, for example, N1-methylpseudouridine. In some embodiments, the modified uridine is a substituted uridine, a pseudouridine, or substituted pseudouridines.

[0285] As used herein, a "uridine position" refers to a position occupied by a uridine or modified uridine. Thus, for example, "the 100th uridine position" refers to the position in a polynucleotide where the A polynucleotide in which 100% of the bases are modified uridines is a polynucleotide that is identical to a conventional RNA (in which all bases are modified uridines) of the same sequence. Modifications are made to all positions that could be uridines in the Unless otherwise indicated, the sequences in this disclosure or the accompanying sequence listing ( sequence table or sequence listing The U in the polynucleotide sequence can be a uridine or a modified uridine.

[0286] As used herein, alignment of a first sequence to a second sequence provides: If X% or more of the positions in the second sequence are shown to match the first sequence , the first sequence is considered to "contain a sequence having at least X% identity" to the second sequence. For example, the sequence AAGA includes sequences that have 100% identity with the sequence AAG, but The reason is that the alignment shows a match at all three positions in the second sequence. This is because they give 100% identity in terms of the difference between RNA and DNA (generally Nucleosides such as uridine (exchanging uridine for uridine or vice versa) and modified uridines The presence of nucleotide analogs indicates the presence of related nucleotides (thymidine, uridine, or modified uridines, etc.). ) for all of the same complement (e.g., thymidine, uridine, or modified uridine) Adenosine; another example is cytosine and 5-methylcytosine, both of which are complementary As long as the polynucleotide has a guanosine or modified guanosine as the base, Thus, for example, if X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxy The sequence 5'-AXG, which is a uridine, is perfectly complementary to the same sequence (5'-CAU) is considered to be 100% identical to AUG in that: The algorithms are well known in the art, such as Smith-Waterman and and the Needleman-Wunsch algorithm. Those skilled in the art will appreciate that the alignment For a given pair of sequences, what algorithm and parameter setting is appropriate? Generally, similar lengths and predicted identities are found in For more than 50% of the sequences for acids or more than 75% of the sequences for nucleotides Needlem, provided by EBI on the www.ebi.ac.uk web server Needle with default settings in the an-Wunsch algorithm interface The Eman-Wunsch algorithm is generally suitable.

[0287] "mRNA" is RNA or modified RNA that can be translated into a polypeptide. (i.e., as a substrate for translation by ribosomes and aminoacylated tRNAs) refers to a polynucleotide containing an open reading frame (capable of functioning) As used herein, mRNA refers to a molecule that contains ribose residues or analogs thereof, such as 2'- In some embodiments, the phosphate sugar backbone may include a methoxyribose residue. In the nucleic acid phosphate sugar backbone, the sugar is a ribose residue, a 2'-methoxyribose residue, or Generally, mRNA contains a substantial amount of thymidine residues. (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidyl groups) residues; or 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1% , 0.5%, 0.2%, or less than 0.1% thymidine content). can contain modified uridines at some or all of its uridine positions.

[0288] As used herein, the "minimum uridine content" of a given ORF is defined as (a) all (b) uses a minimal uridine codon at position (a) and encodes the same amino acid sequence as the given ORF. is the uridine content of the ORF. The minimum uridine codon for a given amino acid is is the codon with the fewest uridines (excluding the codon for phenylalanine). (Usual values ​​are 0 or 1, with the minimum uridine codon having two uridines.) Lysine residues are considered equivalent to uridine for purposes of assessing minimum uridine content.

[0289] As used herein, the "minimum uridine dinucleotide content" of a given ORF is , (a) use minimal uridine codons (as described above) at all positions, and (b) use a given O The minimum possible uridine dinucleotide (U) of the ORF that encodes the same amino acid sequence as the RF. The uridine dinucleotide (UU) content is the number of UU dinucleotides in the ORF. as the enumeration of nucleotides, or occupied by uridine in the uridine dinucleotide It can be expressed in absolute terms, based on a percentage, as a percentage of the position (e.g., A UUAU has two of the five positions occupied by uridines in the uridine dinucleotide. (The uridine dinucleotide content is 40% due to the presence of modified uridine residues.) is considered equivalent to uridine for the purposes of assessing minimum uridine dinucleotide content. As used herein, the term "sequence" refers to the sequence of a given open reading frame (ORF). "Minimum adenine content" refers to the use of (a) minimal adenine codons at all positions and (b) adenine codons at all positions. The adenine content of an ORF that encodes the same amino acid sequence as a given ORF. The minimal adenine codon for amino acids is the codon with the fewest adenines (lysine and Usually 0 or 1, except for the codons for ribonucleotides and asparagine, with a minimum of 1 for the adenine codon (has two adenines). The modified adenine residues are used for the purpose of assessing the minimum adenine content. is considered equivalent to adenine.

[0290] As used herein, the "minimum" sequence of a given open reading frame (ORF) is "Adenine dinucleotide content" refers to (a) the minimum adenine codon at every position (see above) (b) the possibility of ORFs that encode the same amino acid sequence as the given ORF. The minimum adenine dinucleotide (AA) content is Content is measured as the count of AA dinucleotides in the ORF or as the adenine dinucleotide in absolute terms, based on percentages, as the proportion of positions occupied by adenines in (e.g., UAAUA means that two of the five positions are adenine dinucleotides.) The adenine dinucleotide content is The modified adenine residues were used to assess the minimum adenine dinucleotide content. It is generally considered equivalent to adenine.

[0291] As used herein, "TTR" refers to the transmembrane protein (TTR) that is the gene product of the TTR gene. Refers to thyretin.

[0292] As used herein, "amyloid" refers to a protein or peptide that is normally soluble. Amyloid refers to abnormal aggregates of peptides. Amyloid is insoluble and accumulates in organs and tissues. Proteins or peptides in amyloid can form proteinaceous deposits. misfolding into a form that allows many copies of the protein to stick together to form fibrils Some forms of amyloid have normal functions in the human body. Although "amyloid" as used herein refers to abnormal aggregates of proteins or disease. Amyloid refers to aggregates of proteins that contain a single protein or peptide, such as TTR. or multiple proteins or peptides, such as TTR and additional proteins. It may include

[0293] As used herein, "amyloid fibrils" refer to amyloid fibrils that are resistant to degradation. Amyloid fibrils are insoluble fibers formed from specific proteins or peptides, as well as their This can result in symptoms based on the tissue and cell type that is aggregated.

[0294] As used herein, "amyloidosis" refers to amyloid or amyloidogenic Amyloidosis refers to a disease characterized by symptoms caused by the deposition of fibrils. May affect many organs, including the heart, kidneys, liver, spleen, nervous system, and gastrointestinal tract There is.

[0295] As used herein, "ATTR," "TTR-associated amyloidosis," "TT" TTR amyloidosis, ATTR amyloidosis, or TTR-associated amyloidosis "Amyloidosis" refers to amyloidosis associated with TTR deposition.

[0296] As used herein, "familial amyloidotic cardiomyopathy" or "FAC" refers to a condition that primarily involves Refers to hereditary transthyretin amyloidosis (ATTR), which is characterized by fascicular cardiomyopathy Congestive heart failure is common in FAC. The average age of onset is approximately 60-70 years. The estimated life expectancy after diagnosis is 4-5 years.

[0297] As used herein, "familial amyloidotic polyneuropathy" or "FAP" " is a hereditary transthyretin amyloid-mediated neurodegenerative disorder characterized primarily by sensorimotor neuropathy. Autonomic neuropathy is common in FAP. Although rheumatoid arthropathy is the primary feature, symptoms of FAP also include cachexia, kidney failure, and heart disease. The average age of onset of FAP is approximately 30-50 years, with an estimated life expectancy of 5 years after diagnosis. ~15 years.

[0298] As used herein, "wild-type ATTR" and "ATTRwt" refer to T60A , V30M, V30A, V30G, V30L, V122I, V122A, or V122 ATTRwt refers to ATTR not associated with a pathogenic TTR mutation, such as (-). It has also been called systemic amyloidosis. It typically occurs in men over the age of 60. The most common symptoms are congestive heart failure and abnormal heart rhythms such as atrial fibrillation. Symptoms that may occur include shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, trouble sleeping, and Consequences of poor cardiac function include weight loss and a history of carpal tunnel syndrome. Indicate increased risk and, in some cases, may indicate early stage disease. Generally, TTR deposits cause a decline in cardiac function over time, whereas wild-type TTR deposits cause a decline in cardiac function over time. Because it accumulates more slowly, it may have a better prognosis than hereditary ATTR. Treatment for this condition is similar to other forms of ATTR (except liver transplantation) and generally involves diuretics and and cardiac treatments ranging from fluid and salt restriction to anticoagulants and, in severe cases, heart transplants. It is intended to support or improve organ function. Nevertheless, like FAC, ATTRwt can lead to death from heart failure within 3 to 5 years of diagnosis.

[0299] Guide sequences useful in the guide RNA compositions and methods described herein are listed in Table 1 and herein. As shown throughout the application.

[0300] As used herein, "inherited ATTR" refers to a mutation in the sequence of the TTR gene. Known mutations in the TTR gene associated with ATTR include T6 0A, V30M, V30A, V30G, V30L, V122I, V122A, or V1 Mutations resulting in TTR with a 22(-) substitution are included.

[0301] As used herein, an "indel" refers to a portion of a double-strand break (DSB) within a target nucleic acid. It consists of a number of nucleotides that are either inserted or deleted at positions This refers to an insertion / deletion mutation that occurs.

[0302] As used herein, "knockdown" refers to the reduction of a particular gene product (e.g., a protein). Protein knockdown refers to the reduction of expression of a protein, mRNA, or both. Proteins secreted by tissues or cell aggregates (e.g., in serum or cell culture medium) by detecting proteins or by extracting the entire protein from a tissue or cell population of interest. The amount of mRNA knockdown can be measured by either detecting the amount of mRNA in the cell. Methods for measuring the level of mRNA are known and involve the use of mRNA isolated from a tissue or cell population of interest. In some embodiments, "knockdown" refers to the act of sequencing a particular Some loss of expression of the gene product, e.g., a reduction in the amount of mRNA transcribed, or expressed or secreted by cellular aggregates (including in vivo aggregates such as those found in tissues) It may refer to a reduction in the amount of protein that is absorbed.

[0303] As used herein, a "mutant TTR" refers to a mutant TTR that is a TTR variant that is a mutant TTR compared to the wild-type amino acid sequence of TTR. Therefore, the TTR gene (i.e., TTR protein) has a change in the amino acid sequence of TTR. The human wild-type TTR sequence is NCBI Gene ID: 7276; Available at sembl:Ensembl:ENSG00000118271. For example, the mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-) can be done.

[0304] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" RNA-guided DNA binding agents, e.g., Cas nucleases, e.g., Cascleavers Cas nickases, or dCas DNA binders (e.g., Cas9) In some embodiments, the guide sequence refers to a guide RNA containing a target gene, such as Cas9. The guide RNA guides the DNA binder to the target sequence, and the guide RNA hybridizes with the target sequence. The drug binds to the target sequence, where the drug acts as a cleavase or nickase. and binding can be followed by cleavage or nicking.

[0305] As used herein, a "target sequence" refers to a sequence complementary to the guide sequence of a gRNA. The interaction of the target sequence with the guide sequence results in the formation of an RNA fragment. A guide DNA binder binds within the target sequence and potentially (depending on the activity of the agent) creates a nick The cleavage site is directed to form or cleave the nucleotide sequence.

[0306] As used herein, "treatment" refers to the administration or administration of a drug for a disease or disorder in a subject. refers to any application of a drug or treatment that inhibits the disease, stops its progression, or improves the condition. alleviating one or more symptoms of a disease, curing the disease, or For example, treatment of ATTR includes preventing the recurrence of the symptoms of ATTR. This may include mitigating.

[0307] As used herein, the term "pathogenic mutation" refers to a mutation in a gene product such as TTR. may cause, promote, contribute to, or inhibit the development of diseases such as ATTR. This refers to a mutation that is unlikely to occur.

[0308] As used herein, the term "lipid nanoparticle" (LNP) refers to a lipid nanoparticle that is formed by intermolecular forces. refers to a particle that contains multiple (i.e., more than one) lipid molecules physically associated with each other by LNPs are, for example, microspheres (unilamellar and multilamellar vesicles, e.g., some In embodiments, the particles may be substantially spherical and, in more particular embodiments, may include an aqueous core. "Liposomes" comprise a lamellar lipid bilayer and contain, for example, a substantial portion of RNA molecules. ), the dispersed phase in an emulsion, a micelle, or the internal phase in a suspension. WO2017173054A1 and WO2017173054A1, the contents of which are incorporated herein by reference in their entirety. See also WO2019067992A1. Any LNP known to those skilled in the art that can be synthesized can be used in combination with a guide RNA and an RNA guide described herein. The present invention may be utilized in conjunction with nucleic acids encoding DNA binders.

[0309] As used herein, a "donor oligonucleotide" or "donor template" refers to a The term "target" refers to a desired nucleic acid that is inserted into a target site (e.g., a target site in genomic DNA). A donor oligonucleotide refers to an oligonucleotide containing a single-stranded oligonucleotide. It may be a nucleotide or a double-stranded oligonucleotide. The donor oligonucleotide is then delivered to the target cell via the use of LNP or transfection. Nucleic acid sequences encoding guide RNAs and RNA-guided DNA binders (e.g., Cas9) It may be delivered with the train.

[0310] As used herein, "nuclear localization signal" (NLS) or "nuclear localization sequence" The term "genuine" refers to a molecule that contains or is linked to such a sequence. Nuclear localization signals are amino acid sequences that direct transport of a molecule into the nucleus of a cell. In some embodiments, the NLS can form part of a molecule by covalent bonding, hydrogen bonding, or may be linked to the rest of the molecule by ionic interactions.

[0311] As used herein, the phrase "pharmaceutically acceptable" refers to a substance that is generally non-toxic and are not biologically undesirable and are otherwise acceptable for pharmaceutical use It is meant to be useful for preparing pharmaceutical compositions that are not intended to be pharmaceuticals.

[0312] As used herein, "infusion" refers to, for example, an infusion of approximately 30 minutes to 12 hours. In some embodiments, the active administration of one or more drugs The agent can, for example, encode an RNA-guided DNA-binding agent (e.g., Cas9) described herein. The present invention also includes LNPs comprising an mRNA encoding a gene encoding a gene for a target gene and a gRNA described herein.

[0313] As used herein, "infusion prophylaxis" refers to the administration of intravenous corticosteroids (e.g., dextromethorphan). 10 mg or equivalent), antipyretics (e.g., oral acetaminophen or paracetamol 500 mg), intravenous H1 blockers (e.g., diphenhydramine 50 mg or equivalent), and intravenous H2 blockers (e.g., ranitidine 50 mg or equivalent)

[0039] The subject is administered a steroid hormone (SHRH) prior to treatment (e.g., including administration of LNPs), including one or more or all of the following: Infusion prophylaxis refers to the regimen administered. Infusion prophylaxis may optionally include oral corticosteroids (e.g. , combined with pre-administration of dexamethasone 8 mg or equivalent. In some cases, oral corticosteroids are administered 8 to 24 hours before treatment. In some embodiments, intravenous corticosteroids (e.g., dexamethasone 10 mg or or equivalent), oral acetaminophen 500 mg, intravenous H1 blocker (e.g., Diphen hydramine 50 mg or equivalent), intravenous H2 blockers (e.g., ranitidine 50 mg or equivalent) are administered 1-2 hours before treatment. In some embodiments, the H1 blocker and / or the H2 blocker are administered orally.

[0314] The terms "about" or "approximately" are used to refer to a particular value as determined by one of ordinary skill in the art. means the tolerance to error, which depends in part on how the value is measured or determined. do.

[0315] II. Methods and Compositions Targeting the TTR Gene As described herein, a double-strand break (DSB) in the TTR gene is induced in a subject, and cells are also or modifying the TTR gene in a subject, thereby producing a TTR-associated amyloid in the subject. cis (ATTR) to reduce TTR serum concentrations in a subject and / or a method for reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject; As well as related compositions, including compositions for use in such methods, are disclosed. In general, the disclosed compositions comprise a guide RNA targeting TTR and an RNA guide DNA. An open reading frame encoding a binding agent (e.g., a CRISPR / Cas system) and a nucleic acid comprising the nucleic acid. Subjects treated with such methods and compositions may be those having a wild-type or It may have a non-wild-type TTR gene sequence, for example, ATTR (ATTRwt, or or a genetic or familial form of ATTR. stomach.

[0316] In some embodiments, the composition is administered by infusion for greater than 30 minutes. In some embodiments, the composition is administered by infusion over a 30 minute period. In some embodiments, the composition is administered by infusion for more than 60 minutes. In embodiments, the composition is administered by infusion for greater than 90 minutes. In embodiments, the composition is refrigerated for more than 120 minutes, more than 150 minutes, more than 180 minutes, or Longer, longer than 240 minutes, longer than 300 minutes, or longer than 360 minutes of infusion In some embodiments, the composition is administered for at least 1 hour. 2 hours, at least 4 hours, at least 6 hours, at least 7 hours, at least 8 hours, At least 9 hours, at least 10 hours, at least 11 hours, or at least 12 hours In some embodiments, the composition is administered by infusion for 0.5 to 1.5 minutes. Hours, 1.5-2.5 hours, 2.5-3.5 hours, 3.5-4.5 hours, 4.5-5.5 hours Hours, 5.5-6.5 hours, 6.5-7.5 hours, 7.5-8.5 hours, 8.5-9.5 hours hours, 9.5-10.5 hours, 10.5-11.5 hours, or 11.5-12.5 hours In some embodiments, the composition is administered by infusion for about 60 minutes. 0 minutes, approx. 120 minutes, approx. 150 minutes, approx. 180 minutes, approx. 240 minutes, approx. 300 minutes, or In some embodiments, the composition is administered by infusion over a period of about 360 minutes. Approximately 45-75 minutes, 75-105 minutes, 105-135 minutes, 135-165 minutes, 16 5-195 minutes, 195-225 minutes, 225-255 minutes, 255-285 minutes, 28 Administered by infusion over 5 to 315 minutes, 315 to 345 minutes, or 345 to 375 minutes In some embodiments, the composition is administered by infusion over a period of about 1.5 to 6 hours. do.

[0317] A. Guide RNA (gRNA) The guide RNAs used in the disclosed methods and compositions target the TTR gene. Exemplary guide sequences targeting the TTR gene are listed in Table 1 and SEQ ID NO:5. Denoted by ~82. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9]

[0318] Each of the above guide sequences may further comprise additional nucleotides to form the crRNA. For example, at its 3' end, the guide sequence may include the following exemplary nucleotide sequence: It has the sequence GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 126) In the case of sgRNA, the guide sequence described above serves as a guide for the addition of additional nucleosides to form the sgRNA. The guide sequence may further comprise a nucleotide, such as the following exemplary nucleotide, following the 3' end of the guide sequence: It has the nucleotide sequence, in 5' to 3' orientation, GUUUUAGAGCUAGAAA UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 125).

[0319] In some embodiments, the sgRNA is modified. wherein the sgRNA comprises the modification pattern shown below in SEQ ID NO: 3, where N is , any natural or unnatural nucleotide, and N is an integer as described herein. and the modified sgRNA comprises a guide sequence such as NNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmU mGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmAmGmUmCmG mGmUmGmCmU*mU*mU*mU (SEQ ID NO: 3), wherein "N" is any naturally occurring or may be a non-naturally occurring nucleotide. For example, included herein are number 3, where N is replaced by any of the guide sequences disclosed herein. The modifications are as shown in SEQ ID NO: 3, regardless of the N substitution for the guide nucleotide. i.e., the guide nucleotide replaces the "N", but the first three The nucleotide is 2'OMe modified, and the first nucleotide and the second nucleotide are between the second and third nucleotides, and between the third and fourth nucleotides. There is a phosphorothioate bond between the nucleotides.

[0320] In some embodiments, the sequence includes any one of the sequences listed in Table 2. do. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10]

[0321] Alignment mapping of guide IDs with corresponding sgRNA IDs, and The homology to the cynomolgus genome and the cynomolgus match guide ID are provided in Table 3 . [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0322] In some embodiments, the gRNA is capable of inhibiting a nuclease (e.g., a C such as Cas9). The RNA-guided DNA binding agent, which may be a nuclease, binds to the target DNA in TTR. The gRNA contains a guide sequence that directs it to a target sequence. The gRNA contains a guide sequence shown in Table 1. The gRNA may comprise a guide sequence 17, 18, 19, or In some embodiments, the crRNA may comprise 20 consecutive nucleotides. The gRNA contains at least 17, 18, 19, or 20 of the guide sequences shown in Table 1. Approximately 75%, 80%, 85%, 90%, 95%, 96%, and 97% of consecutive nucleotides , 98%, 99%, or 100% identity. In some embodiments, the gRNA is about 75%, 8%, or 9% of the target sequence shown in Table 1. 0%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% The gRNA may further comprise a trRNA. In each of the composition and method embodiments described herein, crRNA and tRNA are The rRNAs may be associated as a single RNA (sgRNA) or as separate R In the context of sgRNA, crRNA and tRNA may be present on the dgRNA. The components of rRNA are shared, for example, via phosphodiester bonds or other covalent bonds. can be combined.

[0323] In each of the composition, use and method embodiments described herein, a guide RNA A may comprise two RNA molecules as a "dual guide RNA" or "dgRNA" The dgRNA is a first RRNA containing a crRNA containing a guide sequence, for example, as shown in Table 1. The first RNA molecule and the second RNA molecule include trRNA. The RNA molecules do not have to be covalently linked, but the bases between the crRNA and trRNA portions Pairing may occur to form an RNA duplex.

[0324] In each of the composition, use and method embodiments described herein, a guide RNA A contains a single RNA molecule referred to as a "single guide RNA" or "sgRNA" The sgRNA is a crR containing a guide sequence shown in Table 1 covalently linked to a trRNA. The sgRNA may contain any of the guide sequences shown in Table 1. In some embodiments, the amino acid sequence may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides. In some implementations, the crRNA and trRNA are covalently linked via a linker. In this configuration, the sgRNA is transduced by base pairing between portions of the crRNA and trRNA. , forming a stem-loop structure. In some embodiments, the crRNA and trR The NA is covalently bound via one or more bonds that are not phosphodiester bonds.

[0325] In some embodiments, the trRNA is a naturally occurring CRISPR / Cas system In some embodiments, the trRNA sequence may comprise all or part of a trRNA sequence derived from The rRNA includes truncated or modified wild-type trRNA. The length of the trRNA is It depends on the CRISPR / Cas system used. In some embodiments, the trRN A is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or 100 In some embodiments, the amino acid sequence comprises or consists of more than 1 nucleotide. The trRNA may have, for example, one or more hairpin or stem-loop structures, or one or more It may contain specific secondary structures such as the bulge structure above.

[0326] In some embodiments, the composition comprises a guide sequence selected from SEQ ID NOs: 5-82. and one or more guide RNAs comprising:

[0327] In some embodiments, the composition comprises at least one sequence selected from SEQ ID NOs: 5-82. At least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or or 90% identical to the gRNA containing the guide sequence.

[0328] In some embodiments, the composition comprises SEQ ID NOs: 5-72, 74-78, and 80. In some embodiments, the guide RNA comprises one or more guide RNAs comprising a guide sequence selected from the group consisting of: In one embodiment, the composition comprises a nucleic acid sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. The sequences are matched with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, and 92% of the 90%, 91%, or 91% identical guide sequences. In the embodiment, a sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 is , SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 2 7, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, and is 69. In some embodiments, SEQ ID NOs: 5-72, 74-78, and 8 The sequence selected from SEQ ID NOs: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69. In particular, a sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 The guide RNA containing the guide sequence may be an sgRNA. 78, and 80 to 82, and the guide RNA containing the guide sequence selected from the group consisting of chemically modified sg The nucleic acid may be RNA, for example, terminally modified RNA. The guide RNA comprising a guide sequence selected from 0 to 82 is a dgRNA, e.g., a chemically modified It can be a decorated dgRNA.

[0329] In other embodiments, the composition comprises any two of the guide sequences of SEQ ID NOs: 5-82. At least one, e.g., at least two, gRs containing a guide sequence selected from In some embodiments, the composition comprises any one of the nucleic acids set forth in SEQ ID NOs: 5-82. At least 99%, 98%, 97%, 96%, 95%, 94%, 93% for either At least two gRs each containing guide sequences that are 92%, 91%, or 90% identical Contains NA.

[0330] In other embodiments, the composition comprises SEQ ID NOs: 5-72, 74-78, and 80-82. A small amount of a guide sequence selected from any two or more of the guide sequences selected from In some embodiments, the gene comprises at least one, e.g., at least two, gRNAs. The composition may comprise any of the sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82. Either at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92% At least two gRNAs each containing guide sequences that are 91%, 90%, or 91% identical. In some embodiments, the sequences of SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 are The sequences selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 3 7, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65 , 66, 68, or 69. In some embodiments, the nucleic acid sequence is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. The sequences are SEQ ID NOs: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 3 Selected from 0, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69 It contains one sequence or two sequences.

[0331] In some embodiments, the gRNA has the sequence shown in Table 2 (SEQ ID NOs: 87-12). 4). In some embodiments, the gRNA is , any one of the sequences shown in Table 2 (SEQ ID NOs: 87 to 124), but with the indicated modifications sgRNAs that do not contain the modified SEQ ID NOs: 87 to 124 (i.e., unmodified SEQ ID NOs: 87 to 124). In some embodiments, the sgRNA is at least 9 copies of any of the nucleic acids of SEQ ID NOs: 87-124. 9%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90 In some embodiments, the sgRNA comprises a sequence that is % identical to SEQ ID NO: 87 Identification with any of 124 nucleic acids by at least 99%, 98%, 97%, 96%, 95%, or 94% , 93%, 92%, 91%, or 90% identical but not containing the indicated modification (i.e., In some embodiments, the sgR comprises an unmodified sequence (i.e., unmodified SEQ ID NOS: 87-124). The sgRNAs are those shown in Table 2, SEQ ID NOs: 87-124, with or without modifications. Instead of the guide sequence shown, include any one of the guide sequences shown in Table 1.

[0332] In some embodiments, the gRNA is selected from the group consisting of SEQ ID NOs: 87-113, 115-120, or an sgRNA comprising any one of 122 to 124. In this case, the gRNA is any one of SEQ ID NOs: 87 to 113, 115 to 120, or 122 to 124. any one of the following, but not including the modifications shown in Table 2 (i.e., unmodified SEQ ID NO: 87 to 113, 115-120, or 122-124) sgRNA. In this embodiment, the gRNA is selected from the group consisting of SEQ ID NOs: 87 to 113, 115 to 120, and 122 to 123. 4, but with at least one chemical modification, and the modifications shown in Table 2. does not contain a decorative pattern (i.e., chemically modified SEQ ID NOs: 87-113, 115-12 0, or 122-124) sgRNA. Chemically modified guide RNAs are listed in Table 2. In some embodiments, the amino acid sequence may include one or more of the modifications shown in Table 1. Chemically modified SEQ ID NOs: 87 to 113, 115 to 116, and 117 to 118, which do not contain the modification pattern shown in 2 20, or 122-124 contain 5' and / or 3' end modifications. In embodiments, the sgRNA is selected from the group consisting of SEQ ID NOs: 87-113, 115-120, or 122. ~124 nucleic acids with at least 99%, 98%, 97%, 96%, 95%, 94% %, 93%, 92%, 91%, or 90% identical to the sequence of the first embodiment. wherein the sgRNA is selected from the group consisting of SEQ ID NOs: 87 to 113, 115 to 120, and 122 to 123. 4 nucleic acids and at least 99%, 98%, 97%, 96%, 95%, 94%, 9 3%, 92%, 91%, or 90% identical but without the modifications indicated (all That is, unmodified SEQ ID NOs: 87-113, 115-120, or 122-124) In some embodiments, the sgRNA comprises, with or without modifications, a sequence similar to SEQ ID NO: sgRNA sequences in Table 2 at positions 87–113, 115–120, or 122–124 In place of the guide sequence shown, include any one of the guide sequences shown in Table 1 .

[0333] The guide RNAs provided herein recognize target sequences within the TTR gene (e.g., For example, the TTR target sequence may be useful for hybridizing to a target gene. The RNA can be recognized and cleaved by the provided Cas cleavase. Therefore, RNA-guided DNA binding agents, such as Cas cleavage, bind guide RNAs to the TTR gene. The guide sequence of the guide RNA may be directed against a target sequence of a gene, and the guide sequence of the guide RNA may be homogenous with the target sequence. The RNA-guided DNA binding agent, e.g., Cas cleavase, binds to the target sequence. Disconnect.

[0334] In some embodiments, the selection of one or more guide RNAs comprises targeting a target sequence within the TTR gene. The sequence is determined based on the target sequence.

[0335] Without being bound by any particular theory, mutations in specific regions of genes (e.g. For example, frameshift mutations caused by indels resulting from nuclease-mediated DSBs mutations) may be less tolerated than mutations in other regions of the gene, and therefore, The location of B is an important factor in the amount or type of protein knockdown that can be achieved. In some embodiments, the target sequence is complementary to or The gRNA, which is complementary to the TTR gene, targets the RNA-guided DNA-binding agent to a specific location within the TTR gene. In some embodiments, the gRNA is used to direct the TTR gene to the target site. Complementary to a target sequence within exon 1, exon 2, exon 3, or exon 4 The nucleic acid sequence is designed to have a guide sequence that is complementary to or has a complementary guide sequence.

[0336] B. gRNA Modification In some embodiments, the gRNA is chemically modified. gRNAs containing nucleotides or amino acids instead of the standard A, G, C, and U residues one or more non-naturally occurring and / or naturally occurring compounds used instead of or in addition to them To describe the presence of components or structures that In some embodiments, the modified gRNA contains a non-standard nucleoside. or synthesized with nucleotides, and are referred to herein as "modified." A nucleotide or nucleotide may have (i) a modification in the phosphodiester backbone bond, e.g., For example, one or both of the non-bridging phosphate oxygens and / or one or more of the bridging phosphate oxygens (ii) replacement of the ribose sugar moiety, e.g., (iii) modification, e.g., replacement, of the 2' hydroxyl (an exemplary sugar modification); (iv) extensive replacement of non-standard nucleotides with “dephosphorylated” linkers (exemplary backbone modifications); Modification or replacement of naturally occurring nucleobases, including by quasi-nucleobases (e.g., (v) ribose phosphate backbone replacement or modification (exemplary backbone modifications) (vi) modifications of the 3' or 5' end of the oligonucleotide, e.g., a terminal phosphate group Removal, modification or replacement of, or conjugation of, a moiety, cap or linker cations (such 3' or 5' cap modifications may involve sugar and / or backbone modifications) (vii) one or more of the following sugar modifications or replacements (exemplary sugar modifications): Chemical modifications such as those listed above may be combined to form two, three, four, or more Modifications, including nucleosides and nucleotides (collectively "residues"), which may have one or more modifications. For example, modified residues can include modified sugars and modified nucleobases. In some embodiments, each base of the gRNA is modified, e.g., All bases have modified phosphate groups, such as phosphorothioate groups. Therefore, all or substantially all of the phosphate groups of the gRNA molecule are converted to phosphorothioate groups. In some embodiments, the modified gRNA is replaced by It contains at least one modified residue at or near the end. In some embodiments, the modified gRNA has a small amino acid sequence at or near the 3' end of the RNA. It contains at least one modified residue.

[0337] In some embodiments, the gRNA contains one, two, three, or more modified residues. In some embodiments, at least 5% of the positions in the modified gRNA (e.g., At least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, At least 50%, at least 55%, at least 60%, at least 65%, at least At least 70%, at least 75%, at least 80%, at least 85%, at least 90% , at least 95%, or 100%) are modified nucleosides or nucleotides .

[0338] Unmodified nucleic acids are resistant to degradation by, for example, intracellular nucleases or those found in serum. For example, nucleases hydrolyze the phosphodiester bonds of nucleic acids. Thus, in one embodiment, the gRNAs described herein can be used to express, for example, One or more modifications to introduce stability against endogenous or serum-derived nucleases In some embodiments, the amino acid sequence described herein may comprise a nucleoside or a nucleotide. The modified gRNA molecules described were introduced into cell populations both in vivo and ex vivo. When administered to a patient, the patient may exhibit a reduced innate immune response. single-stranded nucleic acids, including induction of kine (especially interferon) expression and release and cell death The present invention also includes cellular responses to exogenous nucleic acids, including:

[0339] In some embodiments of backbone modifications, the phosphate group of the modified residue has one or more oxygen atoms different from the phosphate group. Further, modified residues, e.g., modified Modified residues present in modified nucleic acids may be present in unmodified phosphate moieties, as described herein. In some embodiments, the phosphate group may be extensively replaced with a modified phosphate group. Backbone modifications of the acid backbone can be achieved by adding uncharged linkers or charged linkers with asymmetric charge distribution. The linker may include modifications that result in either

[0340] Examples of modified phosphate groups are phosphorothioates, phosphoroselenates, boranophosphates, boronates, and the like. Phosphoric acid ester, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphate The phosphate atom in the unmodified phosphate group is an acyl group. However, one of the non-bridging oxygen atoms or groups of atoms mentioned above can make the phosphorus atom chiral. A stereogenic phosphorus atom is designated "R " configuration (referred to herein as Rp) or "S" configuration (referred to herein as Sp) The backbone may have the following structure: Nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged The substitution can also be modified by substitution with either This may occur at either or both bridging oxygens.

[0341] The phosphate group can be replaced by a non-phosphorus-containing linking group in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group include, but are not limited to, methyl hydroxylamino, siloxane, carbonate, carboxymethyl, Carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfo amide, thioformacetal, formacetal, oxime, methyleneimino, methylene Methylenemethylimino, methylenehydrazo, methylene Dimethylhydrazo (methylenedimethylhydrazo), methylene It may include methyleneoxymethylimino. The phosphate linker and ribose sugar replace the nuclease-resistant nucleoside or nucleotide. Scaffolds can also be constructed that can mimic the nucleic acids that they replace. Such modifications may include backbone and sugar modifications. In some embodiments, nucleic acid salts The group may be tethered by an alternative backbone. Examples include, but are not limited to, morpholino, cyclobutyl, Pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates may be included.

[0342] Modified nucleosides and nucleotides contain one or more modifications to the sugar, i.e., For example, the 2' hydroxyl group (OH) may be modified, e.g. can be replaced by many different "oxy" or "deoxy" substituents, for example. In some embodiments, the modification to the 2' hydroxyl group is such that the hydroxyl is It can no longer be further deprotonated to form the '-alkoxide ion. This can enhance the stability of the nucleic acid.

[0343] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" is alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar; (obtained), polyethylene glycol (PEG), O(CH2CH2O) n CH2CH2OR where R is, for example, H or optionally substituted alkyl, and n is 0 to 2. 0 integers (e.g., 0-4, 0-8, 0-10, 0-16, 1-4, 1- 8, 1-10, 1-16, 1-20, 2-4, 2-8, 2-10, 2-16, 2-20, In some embodiments, the number of nucleotides in the nucleotide sequence may be 4 to 8, 4 to 10, 4 to 16, and 4 to 20. In some embodiments, the 2' hydroxyl group modification may be 2'-O-Me. The 2'-hydroxyl group modification is a 2'-fluoro modification in which the 2'-hydroxyl group is replaced with fluorine. In some embodiments, the 2' hydroxyl group modification can be a 2' hydroxyl group modification. The hydroxyl may be, for example, C alkylene or C 1-6 via a heteroalkylene bridge Even if it contains a "locked" nucleic acid (LNA) that can be attached to the 4' carbon of the same ribose sugar Exemplary bridges include methylene, propylene, ether, or amino bridges, O -amino (wherein amino is, for example, NH2, alkylamino, dialkylamino, tetracyclyl, arylamino, diarylamino, heteroarylamino, or di heteroarylamino, ethylenediamine, or polyamino), and Aminoalkoxy, O(CH2) n -amino (wherein amino is, for example, NH2, alkyl arylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, Heteroarylamino, or diheteroarylamino, ethylenediamine, or poly In some embodiments, the 2' hydroxyl group may be modified. The ribose ring is "unlocked" in that it lacks the C2'-C3' bond. d) "Nucleic Acid (UNA)" may include a 2' hydroxyl group modified nucleic acid (UNA). The decoration is a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., PEG derivatives) may include:

[0344] A "deoxy" 2' modification refers to a modification of a hydrogen (i.e., a deoxyribose sugar, e.g., a partial d overhangs of sRNA), halo (e.g., bromo, chloro, fluoro, or iodo), a amino (wherein amino is, for example, NH2, alkylamino, dialkylamino, hetero Acrylic, arylamino, diarylamino, heteroarylamino, diheteroaryl amino, or amino acid), NH(CH2CH2NH) n CH2CH2-Ami -(wherein amino is, for example, as described herein), -NH C(O)R (where R is, for example, alkyl, cycloalkyl, aryl, aralkyl, Heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl alkoxy, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by, for example, amino as described herein. It may be substituted by The sugar modification contains one or more carbons and has the opposite stereochemistry to that of the corresponding carbon in ribose. Thus, modified nucleic acids may contain sugar groups with chemical configurations such as arabinose as the sugar. Modified nucleic acids may also contain nucleotides containing abasic sugars. The base sugar may also be further modified at one or more of the constituent sugar atoms. It may also contain one or more sugars that are in the L-form, eg, an L-nucleoside.

[0345] The modified nucleosides and Modified nucleotides may contain modified bases, also called nucleobases. Examples of nucleobases are adenosines, amides, and nucleotides. These include cytosine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases may be modified or completely replaced to form modified Nucleotide bases can provide modified residues that can be incorporated into nucleic acids. are independently selected from a purine, a pyrimidine, a purine analog, or a pyrimidine analog. In some embodiments, the nucleobase may be, for example, a naturally occurring salt. The bases may include synthetic derivatives of the groups and bases. In embodiments using dual guide RNAs, each of the crRNA and tracrRNA Such modifications may include modifications of the crRNA and / or tracrRNA. It may be present at one or both ends. One or more residues at one or both ends of A may be chemically modified; and In some embodiments, the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include a 3' end modification. In certain embodiments, the guide RNA molecule One or more or all of the nucleotides in the single-stranded overhang of It is Do.

[0346] In some embodiments, the guide RNAs disclosed herein are "Chemically Modified Guide R" filed on December 8, One of the modification patterns disclosed in US 62 / 431,756 entitled "NAs" , the contents of which are incorporated herein by reference in their entirety. In some embodiments, the present invention includes gRNAs that include one or more modifications. In some embodiments, the modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification includes an internucleotide phosphorothioate (P S) bonds.

[0347] The terms "mA," "mC," "mU," or "mG" refer to the amino acid sequence of 2'-O-Me. The term "nucleotide" can be used to refer to a nucleotide that is modified in a specific manner.

[0348] The 2'-O-methyl modification can be depicted as follows: [ka]

[0349] Another chemical modification that has been shown to affect the nucleotide sugar ring is halogen substitution. For example, 2'-fluoro (2'-F) substitutions on the nucleotide sugar ring can be used to The nucleotide binding affinity and nuclease stability can be increased.

[0350] In this application, the terms "fA," "fC," "fU," or "fG" refer to 2' It can be used to represent a nucleotide substituted with -F.

[0351] The substitution of 2'-F can be depicted as follows: [ka]

[0352] Phosphorothioate (PS) linkages or bonds are phosphodiester linkages, e.g., nucleic acids. It refers to a bond in which a sulfur replaces one non-bridging phosphate oxygen in the bond between the bases of a phosphate group. When oligonucleotides are generated using thiolates, the modified oligonucleotides are It may also be referred to as an S-oligo.

[0353] An "*" may be used to indicate a PS modification. In this application, the terms A*, C*, U*, or or G* to the adjacent (e.g., 3') nucleotide via a PS bond. Nucleotides can be indicated.

[0354] In this application, the terms "mA*," "mC*," "mU*," or "mG*" are used to refer to , substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide by a PS bond The nucleotides present can be indicated.

[0355] The diagram below shows the substitution of S- for a non-bridging phosphate oxygen, instead of a phosphodiester bond. PS bond is formed. [ka]

[0356] An abasic nucleotide is one that lacks a nitrogenous base. 1 depicts an oligonucleotide with an abasic (also known as apurinic) site. [ka]

[0357] Inverted bases refer to those having a linkage that is inverted from the normal 5' to 3' linkage ( i.e., either a 5' to 5' linkage or a 3' to 3' linkage). For example, [ka]

[0358] The abasic nucleotide can be connected with an inverted linkage. The nucleotide may be attached to the terminal 5' nucleotide via a 5' to 5' linkage, or The abasic nucleotide may be attached to the terminal 3' nucleotide via a 3' to 3' linkage. An inverted abasic nucleotide at either the terminal 5' or 3' nucleotide It may also be referred to as an inverted abasic end cap.

[0359] In some embodiments, the first 3, 4, or 5 nucleotides at the 5' end one or more of the nucleotides at the 3' end and the last 3, 4, or 5 nucleotides at the 3' end In some embodiments, one or more of the 2' nucleotides are modified. -O-Me, 2'-F, inverted abasic nucleotides, PS bonds, or stability and / or or other nucleotide modifications known in the art to increase performance. .

[0360] In some embodiments, the first four nucleotides at the 5' end, and The last four nucleotides at the 3' end are phosphorothioate (PS) bonds. are connected.

[0361] In some embodiments, the first three nucleotides at the 5' end, and The last three nucleotides at the 3' end are 2'-O-methyl (2'-O-Me) In some embodiments, the first three nucleotides at the 5' end the first nucleotide and the last three nucleotides at the 3' end are 2'-fluoro In some embodiments, the 5' end contains a 2'-F modified nucleotide. The first three nucleotides at the 3' end of the , containing an inverted abasic nucleotide.

[0362] In some embodiments, the guide RNA comprises a modified sgRNA. In embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 3, wherein N is any N is a natural or unnatural nucleotide, and the entire N directs the nuclease to the target sequence. It contains a guide sequence that directs

[0363] In some embodiments, the guide RNA is any one of SEQ ID NOs: 87-124. In some embodiments, the guide RNA comprises a sgRNA as shown in Any one of the guide sequences of SEQ ID NO: 5 to 82 and the nucleotide of SEQ ID NO: 125 , wherein the nucleotide of SEQ ID NO: 125 is located at the 3' end of the guide sequence. and the guide sequence may be modified as shown in SEQ ID NO:3.

[0364] In some embodiments, the guide RNA is selected from the group consisting of SEQ ID NOs: 5-72, 74-78, and and 80 to 82, and the nucleotide of SEQ ID NO: 125. a gRNA, the nucleotide of SEQ ID NO: 125 being at the 3' end of the guide sequence; The code sequence may be modified as shown in SEQ ID NO:3.

[0365] C. Contains an open reading frame encoding an RNA-guided DNA binder nucleic acid The RNA-guided DNA binding agents disclosed herein (e.g., S. pyogenes C Nucleic acids comprising an ORF encoding a Cas9 nuclease (e.g., Cas9) are disclosed herein. The gRNAs described herein may be combined in compositions or methods using any of the gRNAs described herein. In any of the described embodiments, an open linker encoding the RNA-guided DNA binder is The nucleic acid containing the reading frame may be an mRNA.

[0366] 1. Low adenine content ORFs In some embodiments, the RNA-guided DNA binding agent, e.g., S. pyogenes The ORFs encoding Cas9 nucleases, such as esCas9, have an adenine content of The range is from the minimum adenine content to approximately 150% of the minimum adenine content. In one embodiment, the adenine content of the ORF is about 145% of its minimum adenine content. Below, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 11 5% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less. In some embodiments, the ORF has an adenine content of , equal to its minimum adenine content. In some embodiments, the ORF contains In some embodiments, the adenine content is about 150% or less of the minimum adenine content. Thus, the ORF has an adenine content of about 145% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content of about its minimum adenine content. In some embodiments, the ORF has an adenine content of 140% or less. In some embodiments, the ORF has a minimum adenine content of about 135% or less. The adenine content is about 130% or less of the minimum adenine content. In this embodiment, the ORF has an adenine content of about 125% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content greater than or equal to its minimum adenine content. In some embodiments, the ORF has an adenine content of about 120% or less. is about 115% or less of its minimum adenine content. RF has an adenine content of approximately 110% or less of its minimum adenine content. In one embodiment, the ORF has an adenine content of about 105 of its minimum adenine content. In some embodiments, the ORF has an adenine content of less than or equal to its minimum adenine content. In some embodiments, the ORF has an adenine content of about 104% or less. In some embodiments, the amino acid content is about 103% or less of its minimum adenine content. In this case, the ORF has an adenine content of about 102% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content of less than its minimum adenine content. It is approximately 101% or less.

[0367] In some embodiments, the ORF has a minimum adenine dinucleotide content of Adenine dinucleotide content - 200% of the minimum adenine dinucleotide content In some embodiments, the adenine dinucleotide content of the ORF is in the range about 195% or less, 190% or less, 185% or less of the minimum adenine dinucleotide content of 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less Lower, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125 % or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 1 In some embodiments, the chromatic aberration is 0.03% or less, 102% or less, or 101% or less. The ORF must have an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content equal to or greater than that of the In some embodiments, the minimum adenine dinucleotide content is about 200% or less of the minimum adenine dinucleotide content of the nucleic acid. The ORF must have an adenine dinucleotide content equal to or greater than its minimum adenine dinucleotide content. In some embodiments, the ORF is about 195% or less of the adenine dinucleotide. The nucleotide content is less than or equal to about 190% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content of at least 1000 nucleotides. In some embodiments, the OR has an OR dinucleotide content of about 185% or less. F is the adenine dinucleotide content of a molecule that is approximately 1 / 2 of its minimum adenine dinucleotide content. In some embodiments, the ORF contains an adenine dinucleotide. The amount is approximately 175% or less of its minimum adenine dinucleotide content. In an embodiment, the ORF has an adenine dinucleotide content of at least In some embodiments, the ORF has an adenovirus content of about 170% or less. adenine dinucleotide content of less than about 165% of its minimum adenine dinucleotide content In some embodiments, the ORF has an adenine dinucleotide content of In some embodiments, the minimum adenine dinucleotide content is about 160% or less of the minimum adenine dinucleotide content of the nucleic acid. The ORF must have an adenine dinucleotide content equal to or greater than its minimum adenine dinucleotide content. In some embodiments, the ORF is about 155% or less of the adenine dinucleotide. The nucleotide content is equal to its minimum adenine dinucleotide content. In this embodiment, the ORF has an adenine dinucleotide content of at least In some embodiments, the ORF has an adenine content of about 150% or less. The dinucleotide content is less than or equal to about 145% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content of at most In some embodiments, the small adenine dinucleotide content is about 140% or less. , the ORF has an adenine dinucleotide content equal to or greater than its minimum adenine dinucleotide content In some embodiments, the ORF is about 135% or less of the adenine dinucleotide. The adenine dinucleotide content is less than or equal to about 130% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content of at least In some embodiments, the ORF has a dinucleotide content of about 125% or less. , the adenine dinucleotide content is about 120 of the minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content of 0.05 or less. is less than about 115% of its minimum adenine dinucleotide content. In this embodiment, the ORF has an adenine dinucleotide content of at least In some embodiments, the ORF has an adenine or less than about 110% adenine content. The dinucleotide content is less than or equal to about 105% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content of at most In some embodiments, the small adenine dinucleotide content is about 104% or less. , the ORF has an adenine dinucleotide content equal to or greater than its minimum adenine dinucleotide content In some embodiments, the ORF is about 103% or less of the adenine dinucleotide. The adenine dinucleotide content is less than or equal to about 102% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content of at least It is about 101% or less of the dinucleotide content.

[0368] In some embodiments, the ORF has a minimum adenine dinucleotide content of Based on the adenine dinucleotide content, it encodes the same protein as the mRNA in question. Adenine dinucleotides that are less than or equal to 90% of the maximum adenine dinucleotide content of the reference sequence In some embodiments, the adenine dinucleotide content of the ORF ranges from 0 to 1000 nucleotides. The adenine content is the maximum adenine content of a reference sequence that encodes the same protein as the mRNA in question. Approximately 85% or less, 80% or less, 75% or less, 70% or less, or 65% of the dinucleotide content Below, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 3 0% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less.

[0369] In some embodiments, the ORF has an adenine trinucleotide content of 0 Adenine trinucleotides: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 3 ranges from 0, 40, or 50 adenine trinucleotides (even longer numbers Adenine is counted as the number of unique three adenine segments within it, e.g., A Adenine tetranucleotide contains two adenine trinucleotides and (A trinucleotide contains three adenine trinucleotides, etc.) In this form, the ORF has an adenine trinucleotide content of 0%. From leotide, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7 %, 0.8%, 0.9%, 1%, 1.5%, or 2% adenine trinucleotide and the percentage of adenine trinucleotide content is in the range of A sequence occupied by adenines forming part of a sequence (or a longer sequence of adenines) The resulting sequence UUUAAA and UUUUAA is calculated as the percentage of positions in AA each has a 50% adenine trinucleotide content. In embodiments, the ORF has an adenine trinucleotide content of 2% or less. In some embodiments, the ORF has an adenine trinucleotide content of 1.5% In some embodiments, the ORF has an adenine trinucleotide content of In some embodiments, the ORF has an adenine trinucleotide repeat sequence of 1% or less. In some embodiments, the ORF contains an adenine trinucleotide. In some embodiments, the ORF has an adenovirus content of 0.8% or less. In some embodiments, the OR has a trinucleotide content of 0.7% or less. F has an adenine trinucleotide content of 0.6% or less. In some cases, the ORF has an adenine trinucleotide content of less than 0.5%. In an embodiment, the ORF has an adenine trinucleotide content of 0.4% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.3% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0 In some embodiments, the ORF has an adenine trinucleotide repeat sequence of 0.2% or less. In some embodiments, the adenine trinucleotide content is 0.1% or less.

[0023] Nucleic acids encoding RNA-guided DNA-binding agents comprising an ORF that does not include

[0370] In some embodiments, the ORF has an adenine trinucleotide content of at least The small adenine trinucleotide content indicates that the mRNA encodes the same protein as the target mRNA. adenine trinucleotide content that is 90% or less of the maximum adenine trinucleotide content of the corresponding reference sequence In some embodiments, the adenine nucleotide content of the ORF ranges from 0 to 1000 nucleotides. The nucleotide content of a reference sequence that encodes the same protein as the mRNA in question. Approximately 85% or less, 80% or less, 75% or less, or 70% of the maximum adenine trinucleotide content Below, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 3 5% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% The following is the result.

[0371] For example, by using minimal adenine codons in a sufficient fraction of the ORFs, A given ORF may be based on adenine content or adenine dinucleotide content or adenine trinucleotide content. The nucleotide content can be reduced. For example, the amino acid sequence of the RNA-guided DNA binder can be The amino acid sequence can be reverse translated into an ORF sequence by converting the amino acids into codons. In this case, some or all of the ORFs may use the exemplary minimal adenine codons shown below. In some embodiments, at least about 50%, about 55%, or Approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, About 98%, about 99%, or about 100% are codons listed in Table 4. [Table 4]

[0372] In some embodiments, at least about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% are codons listed in Table 4 RNA-guided DNA binders (e.g., Sp Nucleic acids encoding Cas9 nucleases (e.g., Cas9 from E. coli) are provided. In some embodiments, the ORF is a minimal homopolymer of nucleotides, e.g. For example, in some embodiments, the repeating string of nucleotides in Table 4 When the minimum uridine codon is selected from the codons listed in Selecting minimal adenine codons to reduce the number and length of the polymer, e.g., Selecting GCG instead of GCC for amine or GGG for glycine Instead, it is constructed by selecting GGC.

[0373] In any of the foregoing embodiments, the nucleic acid may be mRNA.

[0374] 2. Codons that increase translation and / or correspond to highly expressed tRNAs, e.g. Codon set In some embodiments, the nucleic acid increases translation in a mammal, such as a human. In a further embodiment, the nucleic acid is derived from a mammal (e.g., It contains ORFs with codons that increase translation in organs (e.g., the liver) of the host (human). In further embodiments, the nucleic acid is expressed in a mammalian (e.g., human) cell type (e.g., a hepatocyte). Contains ORFs with codons that increase translation in mammals, cell types, mammalian The increase in translation in organs, humans, and human organs is comparable to the degree of translation of the wild-type sequence of the ORF. The ORF most similar to the ORF at the amino acid level or the organism from which the ORF originates Organisms containing S. pyogenes, S. aureus, or prokaryotes In some cases, the Cas nuclease may be derived from another prokaryotic organism, such as another Cas nuclease described below. The codon distribution of the Cas nucleases (Cas nucleases derived from prokaryotes) is consistent with that of the Cas nucleases (Cas nucleases derived from prokaryotes) Alternatively, in some embodiments, the RF can be determined by comparing the Increased translation of Cas9 sequences in animals, cell types, mammalian organs, humans, human organs, etc. The addition is of SEQ ID NO: 2, all else being equal, including any applicable point mutations, heterologous domains, etc. The sequence of the ORF is determined by comparing it with the translation of the ORF with the sequence of 05. Codons useful for increasing expression in humans, including those with high expression in human liver / hepatocytes, are also useful. The codons may be those corresponding to tRNAs. These are described in Dittmar KA, PLos Genetics 2(12):e221(2006). In embodiments, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113 5%, 96%, 97%, 98%, 99%, or 100% of the Codons corresponding to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) In some embodiments, at least 75%, 80%, or 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% human organs Highly expressed tRNAs in mammalian organs such as the liver (e.g., the highest expression level for each amino acid) In some embodiments, the codons in the ORF are codons corresponding to the tRNA. At least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% , or 100% are highly expressed tRNAs in mammalian livers, such as human livers (e.g., each In some embodiments, the codon corresponds to the highest expressed tRNA for that amino acid. At least 75%, 80%, 85%, 90%, 95%, 96% of the codons in the ORF %, 97%, 98%, 99%, or 100% in mammalian hepatocytes, such as human hepatocytes The coding sequence corresponds to the highly expressed tRNA in the target sequence (e.g., the highest expressed tRNA for each amino acid). It is.

[0375] Alternatively, codons corresponding to highly expressed tRNAs in an organism (e.g., humans) are commonly used. It may also be used.

[0376] Any of the aforementioned approaches to codon selection may be used, for example, to select codons from Table 4. start, and then, if more than one option is available, generally in an organism (e.g., a human) or in an organ or cell type of interest, such as the liver or hepatocytes (e.g., human liver codons corresponding to more highly expressed tRNAs in either human liver or human hepatocytes By using it, it can be combined with the minimal adenine codon shown above.

[0377] In some embodiments, at least 75%, 80%, 85% of the codons in the ORF , 90%, 95%, 96%, 97%, 98%, 99%, or 100% are shown in Table 5 codons from a codon set that is low U, low A, or low A / U codon set Codons in the low A and low A / U sets are more likely to be used if more than one alternative is available. The codons corresponding to the more highly expressed tRNAs are also used, while minimizing the number of nucleotides represented. In some embodiments, at least 75 of the codons in the ORF are used. %, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % are codons from the low U codon set shown in Table 5. In some embodiments, At least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons are from the low-A codon set shown in Table 5. In some embodiments, at least 75%, 80%, or 90% of the codons in the ORF are nucleotides. %, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% are displayed in the table. 5 is a codon from the low A / U codon set. [Table 5]

[0378] 3. Exemplary Sequences In some embodiments, the ORF encoding the RNA-guided DNA-binding agent has the sequence and / or the ORF comprises a sequence having at least 93% identity to SEQ ID NO:311. over at least its first 50, 200, 250, or 300 nucleotides having at least 93% identity to SEQ ID NO: 311 or at least the first 3 0, 50, 70, 100, 150, 200, 250, or 300 nucleotides and / or the ORF has at least 95% identity to SEQ ID NO: 311. At least 95%, 96%, 97%, 98%, 99%, 99.5%, or 10% of the and / or The ORF has an adenine content between its minimum adenine content and 1 of its minimum adenine content. 23% and / or the ORF has an adenine dinucleotide content of Its minimum adenine dinucleotide content - 15% of its minimum adenine dinucleotide content The range is up to 0%.

[0379] In some embodiments, the ORF encoding the RNA-guided DNA-binding agent has the sequence Number 377 and at least 95%, 96%, 97%, 98%, 99%, 99.5%, or Contains sequences with 100% identity.

[0380] In some embodiments, the ORF encoding the RNA-guided DNA-binding agent has the sequence Numbers 311-313, 328, 329, 346-348, 355, 356, 363, and contains a sequence that has at least 90% identity to any one of 364. In some embodiments, the mRNA comprises an ORF encoding an RNA-guided DNA-binding agent. The RNA-guided DNA binder is selected from SEQ ID NOs: 203, 213, 268, and 386- 396, comprising an amino acid sequence having at least 90% identity to any one of The ORF has an adenine content between its minimum adenine content and 15 of its minimum adenine content. 0% and / or the adenine dinucleotide content is within the range of its minimum adenine dinucleotide content. Adenine dinucleotide content up to 150% of the minimum adenine dinucleotide content In some embodiments, the encoded RNA-guided DNA-binding agent is At least one of column numbers 203, 213, 268, or 386-396 The ORF contains an amino acid sequence with 90% identity to the nucleotide sequence of ... Low uridine content up to 150% of the minimum uridine content, and / or The uridine dinucleotide content is the minimum uridine dinucleotide content ~ the minimum The uridine dinucleotide content ranges from 0.1 to 150%. In the morphology, both the adenine and uridine nucleotide content are at their respective minimum values. In some embodiments, the adenine and uridine dinucleotides In some embodiments, both of the octide contents are no more than 150% of their respective minimum values. In the present invention, any of the aforementioned levels of identity may be at least 95%, at least 98%, or at least At least 99% or 100%.

[0381] In some embodiments, the ORF encoding the RNA-guided DNA-binding agent comprises at least At least the first 30, 50, 70, 100, 150, 200, 250, or 300 SEQ ID NOs: 311-313, 328, 329, 346-348, spanning the nucleotides 355, 356, 363, or 364. The first 30, 50, 70, 100, 150, 200, 250, or 300 The nucleotides are measured from the first nucleotide of the start codon (typically ATG). so that A is nucleotide 1, T is nucleotide 2, etc. In some embodiments, an open reading frame comprises at least one of the sequences. distributed over the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of Column numbers 311-313, 328, 329, 346-348, 355, 356, 363, or 364. The length of the ORF sequence is , the number of nucleotides from the beginning of the start codon to the end of the stop codon, The first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of the total sequence length The nucleotides starting from the first nucleotide of the start codon make up a given percentage of the length of the Corresponds to the number of punches.

[0382] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 243 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0383] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 244 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0384] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 256 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0385] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 257 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0386] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The sequence has at least 90% identity with SEQ ID NO: 258 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0387] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 259 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0388] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The sequence has at least 90% identity with SEQ ID NO: 260 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0389] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 261 and is That is, SEQ ID NO: 204) is SEQ ID NO: 311 to 313, 328, 329, 346 to 34 8, 355, 356, 363, or 364. Contains arrays.

[0390] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 376, and optionally, The ORFs of SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 35 6, 363, or 364, replaced with one of the alternative ORFs. include.

[0391] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 377, and optionally, The ORFs of SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 35 6, 363, or 364, replaced with one of the alternative ORFs. include.

[0392] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 378, and optionally, The ORFs of SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 35 6, 363, or 364, replaced with one of the alternative ORFs. include.

[0393] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 379, and the ORF of SEQ ID NO: 379 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0394] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 380, and the ORF of SEQ ID NO: 380 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0395] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 381, and the ORF of SEQ ID NO: 381 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0396] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 382, ​​and the ORF of SEQ ID NO: 382 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0397] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 383, and the ORF of SEQ ID NO: 383 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0398] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 384, and the ORF of SEQ ID NO: 384 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0399] In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid has at least 90% identity to SEQ ID NO: 385, and the ORF of SEQ ID NO: 385 is SEQ ID NOs: 311 to 313, 328, 329, 346 to 348, 355, 356, 363, or 364 ORFs.

[0400] In some embodiments, SEQ ID NOs: 243, 244, 256-261, or 37 The degree of identity with the optionally substituted sequence of 6-385 is at least 95%. In some embodiments, SEQ ID NO: 243, 244, 256-261, or 376 The degree of identity with the optionally substituted sequence of 385 is at least 98%. In some embodiments, SEQ ID NOs: 243, 244, 256-261, or 176- The degree of identity with the optionally substituted sequence of 385 is at least 99%. In some embodiments, SEQ ID NOs: 243, 244, 256-261, or 376-3 The degree of identity with the 85 optionally substituted sequences is 100%.

[0401] 4. Additional Characteristics of Nucleic Acids, mRNAs, and ORFs Any of the additional features described herein may be incorporated into any of the above-described embodiments, to the extent feasible. It can be combined with

[0402] a) Low uridine content In some embodiments, the RNA-guided DNA binding agent (e.g., S. pyogenes) The ORFs encoding Cas9 nucleases (e.g., Cas9) have a high uridine content. , the range is from the minimum uridine content to about 150% of the minimum uridine content. In some embodiments, the uridine content of the ORF is about 145 of its minimum uridine content. % or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 1 15% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less or 101% or less. In some embodiments, the ORF has a uridine content of is equal to its minimum uridine content. In some embodiments, the uridine content is about 150% or less of its minimum uridine content. In this case, the ORF has a uridine content of about 145% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of less than its minimum uridine content. In some embodiments, the ORF has a uridine content of about 140% or less. In some embodiments, the ORF has a minimum uridine content of about 135% or less of the minimum uridine content of , the uridine content is about 130% or less of the minimum uridine content. In this configuration, the ORF has a uridine content of about 125% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of at least In some embodiments, the ORF is about 120% or less of the uridine-containing In some embodiments, the amount is about 115% or less of the minimum uridine content. The ORF has a uridine content of about 110% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content that is about 10% of its minimum uridine content. In some embodiments, the ORF has a uridine content of at least 5%. In some embodiments, the ORF has a uridine content of about 104% or less. In some embodiments, the uridine content is about 103% or less of its minimum uridine content. wherein the ORF has a uridine content of about 102% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of at least its minimum uridine content. This is approximately 101% or less of the

[0403] In some embodiments, the ORF has a uridine dinucleotide content of at least Uridine dinucleotide content - 200% of the minimum uridine dinucleotide content In some embodiments, the uridine dinucleotide content of the ORF is in the range about 195% or less, 190% or less, 185% or less of the minimum uridine dinucleotide content of 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less Lower, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125 % or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 1 In some embodiments, the chromatic aberration is 0.03% or less, 102% or less, or 101% or less. An ORF must have a uridine dinucleotide content equal to its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content equal to or greater than that of the In some embodiments, the minimum uridine dinucleotide content is about 200% or less of the minimum uridine dinucleotide content of the nucleic acid sequence. The ORF must have a uridine dinucleotide content of at least In some embodiments, the ORF is about 195% or less of the total amino acid sequence. The nucleotide content is less than or equal to about 190% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content of at least 100 nucleotides. In some embodiments, the OR has less than about 185% of the dinucleotide content. F is the minimum uridine dinucleotide content of the In some embodiments, the ORF contains a uridine dinucleotide. The amount of uridine dinucleotides present is approximately 175% or less of its minimum uridine dinucleotide content. In embodiments, the ORF has a uridine dinucleotide content of at least 100 nucleotides. In some embodiments, the ORF is about 170% or less of the nucleotide content of the cucumber. uridine dinucleotide content of less than or equal to about 165% of its minimum uridine dinucleotide content In some embodiments, the ORF has a uridine dinucleotide content of In some embodiments, the minimum uridine dinucleotide content is about 160% or less of the minimum uridine dinucleotide content of the nucleic acid sequence. The ORF must have a uridine dinucleotide content of at least In some embodiments, the ORF is less than about 155% of the total amino acid sequence. The nucleotide content is equal to its minimum uridine dinucleotide content. In this embodiment, the ORF has a uridine dinucleotide content of at least In some embodiments, the ORF has a uridine content of about 150% or less. dinucleotide content of less than or equal to about 145% of its minimum uridine dinucleotide content In some embodiments, the ORF has a uridine dinucleotide content of at most In some embodiments, the small uridine dinucleotide content is about 140% or less. , an ORF has a uridine dinucleotide content equal to or greater than its minimum uridine dinucleotide content In some embodiments, the ORF is about 135% or less of the uridine dinucleotide. The dinucleotide content of the uridine dinucleotide is less than or equal to about 130% of its minimum dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content of at least In some embodiments, the ORF has a dinucleotide content of about 125% or less. , the uridine dinucleotide content is about 120 of the minimum uridine dinucleotide content In some embodiments, the ORF has a uridine dinucleotide content of 0.05% or less. is less than or equal to about 115% of its minimum uridine dinucleotide content. In this embodiment, the ORF has a uridine dinucleotide content of at least In some embodiments, the ORF has a uridine content of about 110% or less. dinucleotide content of less than or equal to about 105% of its minimum uridine dinucleotide content In some embodiments, the ORF has a uridine dinucleotide content of at most In some embodiments, the small uridine dinucleotide content is about 104% or less. , an ORF has a uridine dinucleotide content equal to or greater than its minimum uridine dinucleotide content In some embodiments, the ORF is about 103% or less of the uridine dinucleotide. The dinucleotide content of the uridine dinucleotide is less than or equal to about 102% of its minimum dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content of at least It is about 101% or less of the dinucleotide content.

[0404] In some embodiments, the ORF has a uridine dinucleotide content of at least It encodes the same protein as the mRNA in question due to its uridine dinucleotide content. A uridine dinucleotide that is less than or equal to 90% of the maximum uridine dinucleotide content of the reference sequence. In some embodiments, the uridine dinucleotide content of the ORF ranges from 0 to 1000 nucleotides. The nucleotide content is the maximum nucleotide content of a reference sequence that encodes the same protein as the mRNA in question. Approximately 85% or less, 80% or less, 75% or less, 70% or less, or 65% of the dinucleotide content Below, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 3 0% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less.

[0405] In some embodiments, the ORF has a uridine trinucleotide content of 0 Uridine trinucleotides: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 3 Ranges from 0, 40, or 50 uridine trinucleotides (even longer numbers Uridines are counted as the number of unique 3 uridine segments within them, e.g., U Lysine tetranucleotides contain two uridine trinucleotides, and the uridine pentanucleotide (e.g., a trinucleotide contains three uridine trinucleotides). In this form, the ORF has a uridine trinucleotide content of 0%. From leotide, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7 %, 0.8%, 0.9%, 1%, 1.5%, or 2% uridine trinucleotide and the percentage of uridine trinucleotide content is in the range of A sequence occupied by uridines forming part of a sequence (or a longer sequence of uridines) The resulting sequence UUUAAA and UUUUAA is calculated as the percentage of positions in AA has a 50% uridine trinucleotide content of each. In an embodiment, the ORF has a uridine trinucleotide content of 2% or less. For example, in some embodiments, the ORF has a uridine trinucleotide content of 1. In some embodiments, the ORF contains a uridine trinucleotide. In some embodiments, the ORF contains a uridine trinucleotide at an abundance of 1% or less. In some embodiments, the ORF has a uridimidyl content of 0.9% or less. In some embodiments, the OR has a trinucleotide content of 0.8% or less. F has a uridine trinucleotide content of 0.7% or less. In some cases, the ORF has a uridine trinucleotide content of 0.6% or less. In this embodiment, the ORF has a uridine trinucleotide content of 0.5% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0. In some embodiments, the ORF contains a uridine trinucleotide. In some embodiments, the ORF contains a uridine trinucleotide at an abundance of 0.3% or less. In some embodiments, the ORF has a nucleotide content of 0.2% or less. The lysine trinucleotide content is 0.1% or less. The ORF does not have a uridine trinucleotide.

[0406] In some embodiments, the ORF has a uridine trinucleotide content of at most The small uridine trinucleotide content indicates that the mRNA encodes the same protein as the problematic one. A uridine trinucleotide that is 90% or less of the maximum uridine trinucleotide content of the reference sequence to be In some embodiments, the uridine nucleotide content of the ORF ranges from 0.1 to 1.0. The nucleotide content of a reference sequence that encodes the same protein as the mRNA in question. Approximately 85% or less, 80% or less, 75% or less, or 70% of the maximum uridine trinucleotide content Below, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 3 5% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% The following is the result.

[0407] For example, by using minimal uridine codons in a sufficient fraction of the ORFs, A given ORF may be determined by its uridine content or uridine dinucleotide content or uridine trinucleotide content. The nucleotide content can be reduced. For example, the amino acid sequence of the RNA-guided DNA binder can be The amino acid sequence can be reverse translated into an ORF sequence by converting the amino acids into codons. In this case, some or all of the ORFs may use the exemplary minimal uridine codons shown below. In some embodiments, at least about 50%, about 55%, or Approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, About 98%, about 99%, or about 100% are codons listed in Table 6. [Table 6]

[0408] In some embodiments, the ORF contains at least about 75%, 80%, 85%, or 90% of the codons. %, 90%, 95%, 98%, 99%, or 100% are codons listed in Table 6. It consists of a set of codons.

[0409] b) Low adenine and uridine content To the extent practicable, any of the characteristics described herein regarding low adenine content and may be combined with any of the features described herein regarding low uridine content. For example, the uridine content can be determined by the following formula: (e.g., the uridine content of an ORF is in the range of about 150% of its minimum uridine content. Approximately 145% or less of the amount, 140% or less, 135% or less, 130% or less, 125% or less, 12 0% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less), and the adenine content is within the range of that minimum adenine content. The amount of adenine in the α-amino acid ranges from about 150% of its minimum adenine content (e.g., Approximately 145% or less of the amount, 140% or less, 135% or less, 130% or less, 125% or less, 12 0% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less) of the ORF, For example, a nuclear gene encoding a Cas9 nuclease such as S. pyogenes Cas9 For uridine and adenine dinucleotides, Similarly, the uridine nucleotides and adenine dinucleotides in the ORF The content of uridine dinucleotides in the ORF may be as described above. The nucleotide and adenine nucleotide content may be as described above.

[0410] For example, using minimal uridine and adenine codons in a sufficient fraction of the ORF By this, a given ORF may contain uridine and adenine nucleotides and / or dinucleotides. The nucleotide content can be reduced. For example, the amino acid sequence of the RNA-guided DNA binder can be reduced. The amino acid sequence can be reverse translated into an ORF sequence by converting amino acids to codons. In some cases, some or all of the ORFs may contain the exemplary minimal uridine and adenine codons shown below. In some embodiments, at least about 50% of the codons in the ORF are used. , about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90% , about 95%, about 98%, about 99%, or about 100% are codons listed in Table 7 . [Table 7]

[0411] In some embodiments, the ORF contains at least about 75%, 80%, 85%, or 90% of the codons. %, 90%, 95%, 98%, 99%, or 100% are codons listed in Table 7. As can be seen from Table 7, the three serine codons listed Each of the dons contains either one A or one U. In some embodiments , uridine minimization is preferred by using the AGC codon for serine. In some embodiments, adenine minimization is achieved by UCC and / or serine to serine. Preference is given to using the UCG codon.

[0412] c) an encoded RNA-guided DNA binder In some embodiments, the RNA-guided DNA binding agent is a Class 2 Cas nuclease. In some embodiments, the RNA-guided DNA binding agent has cleavase activity. In some embodiments, the enzyme has double-stranded endonuclease activity. In the present invention, the RNA-guided DNA binder binds to a Cas nuclease, e.g., a class 2 Cas nuclease. a Cas nuclease (which may be, for example, a type II, type V, or type VI Cas nuclease) Class 2 Cas nucleases include, for example, Cas9, Cpf1, and C2c1. , C2c2, and C2c3 proteins, and modifications thereof. Examples of nucleases include those from S. pyogenes, S. aureus, and other prokaryotes. Type II CRISPR systems of living organisms (see the list in the next paragraph for an example), and Examples of modified (e.g., engineered or mutant) versions of these include those described in US201 See US2016 / 0312198(A1), US2016 / 0312199(A1). Other examples of as nucleases include the Csm or Cmr complexes of type III CRISPR systems. Cas10, Csm1, or its Cmr2 subunit, and type I CR The Cascade complex of the ISPR system, or its Cas3 subunit, is one example. In some embodiments, the Cas nuclease is Type IIA, Type IIB, or Type IIC. For a discussion of various CRISPR systems and Cas nucleases, see See, for example, Makarova et al., Nat. Rev. Microbiol. .9:467-477(2011), Makarova et al., Nat.Rev .Microbiol,13:722-36(2015), Shmakov et al. ., Molecular Cell, 60:385-397 (2015) In some embodiments, the RNA-guided DNA binding agent is a Cas cleavase, e.g., For example, a Cas9 cleavase. In some embodiments, RNA-guided DNA binding In some embodiments, the agent is a Cas nickase, e.g., a Cas9 nickase. In this case, the RNA-guided DNA binder is S. pyogenes Cas9 nuclease, e.g. For example, Clibase.

[0413] Non-limiting exemplary species from which Cas nucleases can be derived include Strepto coccus pyogenes, Streptococcus thermophil us, Streptococcus sp., Staphylococcus aure us, Listeria innocua, Lactobacillus gasser i, Francisella novicida, Wolinella succino genes, Sutterella wadsworthensis, Gammapro teobacterium, Neisseria meningitidis, Camp ylobacter jejuni, Pasteurella multocida, F ibrobacter succinogene, Rhodospirillum ru brum, Nocardiopsis dassonvillei, Streptomy ces pristinaespiralis, Streptomyces virid ochromogenes、Streptomyces viridochromoge nes、Streptosporangium roseum、Streptospor Angium roseum, Alicyclobacillus acidocald arius、Bacillus pseudomycoides、Bacillus s elenitireducens, Exiguobacterium sibiricus m、Lactobacillus delbrueckii、Lactobacillus s salivarius、Lactobacillus buchneri、Trep Onema denticola、Microscilla marine、Burkh olderiales bacterium、Polaromonas naphtha lenivorans、Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeru ginosa, Synechococcus sp., Acetohalobium a rabaticum, Ammonifex degensii, Caldicelulo syrup becscii, Candidatus Desulfurudis 、Clostridium botulinum、Clostridium diffi cile、Finegoldia magna、Natranaerobius the rmophilus、Pelotomaculum thermopropionicu m、Acidithiobacillus caldus、Acidithiobaci llus ferrooxidans, Allochromatium vinosum , Marinobacter sp., Nitrosococcus halophil us, Nitrosococcus watsoni, Pseudoalteromon as haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena var iabilis, Nodularia spumigena, Nostoc sp., A rthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotog a mobilis, Thermosipho africanus, Streptococcus occus pasteurianus, Neisseria cinerea, Cam pylobacter lari, Parvibaculum lavamentivo rans, Corynebacterium diphtheria, Acidamine ococcus sp., Lachnospiraceae bacterium ND 2006, and Acaryochloris marina.

[0414] In some embodiments, the Cas nuclease is selected from the group consisting of Streptococcus In some embodiments, the Cas9 nuclease is derived from C. pyogenes. The as nuclease is a C In some embodiments, the Cas nuclease is a Ne The Cas9 nuclease is derived from Isseria meningitidis. In some embodiments, the Cas nuclease is selected from the group consisting of Staphylococcus auricularia, Staphylococcus aureus ... eus. In some embodiments, the Cas nuclease The enzyme is Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is In some embodiments, the Cas nuclease is a Cpf1 nuclease from Cas sp. The nuclease was isolated from the Lachnospiraceae bacterium ND2006 In a further embodiment, the Cas nuclease is a Cpf1 nuclease derived from , Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, P eregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Can didatus Methanoplasma termitum, Eubacteri um eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prev. Otella disiens, or Porphyromonas macacae In certain embodiments, the Cas nuclease is a Cpf1 nuclease. Cpf1 genes from cidaminococcus or Lachnospiraceae It's crease.

[0415] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The uvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease binds more than one RuvC domain. In some embodiments, the nucleotide sequence of the present invention comprises more than one main and / or HNH domain. In some embodiments, the Cas9 nuclease is wild-type Cas9. s9 can induce double-strand breaks in target DNA. Cas nucleases may cleave dsDNA, cleaving one strand of dsDNA. The DNA may or may not have DNA cleavage or nickase activity. An exemplary Cas9 amino acid sequence is provided as SEQ ID NO: 203. An exemplary Cas9 mRNA ORF sequence containing the sequence is provided as SEQ ID NO: 311. An exemplary Cas9 mRNA coding sequence suitable for inclusion in a fusion protein is SEQ ID NO: Provided as No. 346.

[0416] In some embodiments, chimeric Cas nucleases are used, where one of the proteins One domain or region is replaced by a part of a different protein. In some embodiments, the Cas nuclease domain is capable of binding to a different nuclease, such as Fok1. In some embodiments, the domain from a Cas gene may be replaced with a domain from a Casase. The nuclease may be a modified nuclease.

[0417] In other embodiments, the Cas nuclease is derived from a Type I CRISPR / Cas system. In some embodiments, the Cas nuclease is a type I CRISPR / Ca In some embodiments, the Cas nuclease may be a component of the Cascade complex of the Cas system. The nuclease can be a Cas3 protein. The clease may be derived from a type III CRISPR / Cas system. In this case, the Cas nuclease may have RNA cleavage activity.

[0418] d) Heterologous functional domains, nuclear localization signals In some embodiments, the RNA-guided DNA binding agent (e.g., S. pyogenes) Cas9 nucleases, such as Cas9, contain one or more heterologous functional domains ( For example, being or comprising a fusion polypeptide).

[0419] In some embodiments, the heterologous functional domain is an RNA-guided DNA binding agent (e.g., For example, Cas9 nucleases such as S. pyogenes Cas9) into the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent is fused to 1 to 10 NLSs. In some embodiments, the RNA-guided DNA binding agent may contain 1 to 5 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused to one N When one NLS is used, the NLS acts as a nucleotide sequence for the RNA-guided DNA binding site. The combination may be linked at the N- or C-terminal end of the sequence. The NA-guided DNA binder can be fused C-terminally to at least one NLS. The LS can also be inserted within the sequence of the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder can be fused to more than one NLS. In embodiments, the RNA-guided DNA binder is fused to two, three, four, or five NLSs. In some embodiments, the RNA-guided DNA binding agent may comprise two NLSs and In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs). S), or may be different. In some embodiments, the RNA The guide DNA binder binds to the sequence of two SV40 NLSs linked at the carboxy terminus. In some embodiments, the RNA-guided DNA binding agent is fused to two NLSs. , one linked to the N-terminal end and one linked to the C-terminal end. In some embodiments, the RNA-guided DNA-binding agent is fused to three NLSs. In some embodiments, the RNA-guided DNA-binding agent is fused without an NLS. In some embodiments, the NLS may be a monokaryotic sequence, such as the SV40 NL S, PKKKRKV (SEQ ID NO: 278) or PKKKRRV (SEQ ID NO: 290) In some embodiments, the NLS may be a bipartite sequence, e.g., a nucleoplast. Even the NLS of sumin, KRPAATKKAGQAKKKK (SEQ ID NO: 291), In some embodiments, the NLS sequence is LAAKRSRTT (SEQ ID NO: 27 9), QAAKRSRTT (SEQ ID NO: 280), PAPAKRERTT (SEQ ID NO: 281 ), QAAKRPRTT (SEQ ID NO: 282), RAAKRPRTT (SEQ ID NO: 283), AAAKRSWSMAA (SEQ ID NO: 284), AAAKRVWSMAF (SEQ ID NO: 285 ), AAAKRSWSMAF (SEQ ID NO: 286), AAAKRKYFAA (SEQ ID NO: 28 7), RAAKRKAFAA (SEQ ID NO: 288), or RAAKRKYFAV (SEQ ID NO: In certain embodiments, a single PKKKRKV (SEQ ID NO: 27) may be included. 8) The NLS may be linked at the C-terminal end of the RNA-guided DNA binder. In some embodiments, the fusion site is optionally comprised of a nucleotide sequence similar to that of the aforementioned embodiment. One or more NLSs of any of the following heterologous functional domains may be included: present in RNA-guided DNA binders in combination with one or more additional heterologous functional domains Coding sequences for exemplary NLSs are provided as SEQ ID NOs: 292-304.

[0420] In some embodiments, the heterologous functional domain is an RNA-guided DNA binding agent (e.g., For example, improving the intracellular half-life of Cas9 nucleases such as S. pyogenes Cas9 In some embodiments, the half-life of the RNA-guided DNA-binding agent can be varied. In some embodiments, the half-life of the RNA-guided DNA-binding agent may be reduced. In some embodiments, the heterologous functional domain may be an RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can increase the stability of the In some embodiments, the stability of the RNA-guided DNA binder can be reduced. In this case, the heterologous functional domain may function as a signal peptide for proteolysis. In some embodiments, protein degradation occurs via, for example, proteasomes, lysosomal processes, or the like. It is mediated by proteolytic enzymes such as proteases or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the RNA-guided DNA binding agent binds ubiquitin or polyubiquitin. In some embodiments, ubiquitin can be modified by the addition of a ubiquitin chain. It may also be a chitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins These include small ubiquitin-like modifiers (SUMOs), ubiquitin cross-reactive proteins, (UCRP, also known as interferon-stimulated gene-15 (ISG15)), URM1 (Urquitin-related modifier-1), a developmentally downregulated protein expressed by neural progenitor cells Neoaded protein-8 (NEDD8, also known as Rub1 in S. cerevisiae) ), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and - 12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MU B), ubiquitin fold modifier-1 (UFM1), and ubiquitin-like proteins -5 (UBL5) is an example.

[0421] In some embodiments, the heterologous functional domain may be a marker domain Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and the like. In some embodiments, the marker sequence includes a sequence of a gene encoding a marker gene, ... and a reporter gene sequence. The domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include: For example, green fluorescent protein (e.g., GFP, GFP-2, tagGFP, turboG FP, sfGFP, EGFP, Emerald, Azami Green, Monome ric Azami Green, CopGFP, AceGFP, ZsGreen1), Yellow fluorescent protein (e.g., YFP, EYFP, Citrine, Venus, YPe) t, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, E BFP2, Azurite, mKalamal, GFPuv, Sapphire, Ts fluorescent protein (e.g., ECFP, Cerulean, Cy Pet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g. For example, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer , HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRas berry, mStrawberry, Jred), and orange fluorescent protein (mOr ange, mKO, Kusabira-Orange, Monomeric Kusab ira-Orange, mTangerine, tdTomato), or any other In another embodiment, the marker domain is a fluorescent protein. It may be a tag and / or an epitope tag. Non-limiting exemplary tags include: Glutathione-S-transferase (GST), chitin-binding protein (CBP), Maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), Tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, E CS, E2, FLAG, HA, nus, Softag 1, Softag 3, Stre p, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6 xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-Hi Non-limiting exemplary reporter genes include: , glutathione-S-transferase (GST), horseradish peroxidase (H RP), chloramphenicol acetyltransferase (CAT), β-galactosidase Examples of suitable markers include β-glucuronidase, luciferase, or fluorescent proteins.

[0422] In additional embodiments, the heterologous functional domain is an RNA-guided DNA binding agent (e.g., Cas9 nucleases (such as S. pyogenes Cas9) in specific organelles, In some embodiments, heterologous functional domains may be used to target specific cell types, tissues, or organs. This can target RNA-guided DNA-binding agents to mitochondria.

[0423] In a further embodiment, the heterologous functional domain may be an effector domain. When an RNA-guided DNA binding agent is directed to its target sequence, e.g., Cas nuclease When the ATPase is directed to the target sequence by the gRNA, the effector domain binds to the target In some embodiments, the effector may modify or affect the sequence. The domains include nucleic acid binding domains, nuclease domains (e.g., non-Cas nucleases), and ze domain), epigenetic modification domain, transcriptional activation domain, or transcriptional repression domain In some embodiments, the heterologous functional domain may be selected from a nucleic acid domain. nucleases, such as FokI nuclease. See, e.g., U.S. Patent No. 9,023,649 In some embodiments, the heterologous functional domain is a transcriptional activator or is a transcriptional repressor. For example, Qi et al., "Repurposing CR ISPR as an RNA-guided platform for seque nce-specific control of gene expression” ,Cell 152:1173-83(2013), Perez-Pinera et. al., “RNA-guided gene activation by CRISP R-Cas9-based transcription factors”, Nat. Methods 10:973-6(2013), Mali et al., “CAS9 transcriptional activators for target s pecificity screening and paired nickases for cooperative genome engineering”,Nat .Biotechnol.31:833-8(2013), Gilbert et al. .,“CRISPR-mediated modular RNA-guided re gulation of transcription in eukaryotes” , Cell 154:442-51 (2013). Therefore, RNA guide DNA binding agents essentially use guide RNAs to bind to desired target sequences. In certain embodiments, the DNA-modifying domain is a demethylated a methylation domain, such as a methylation domain or a methyltransferase domain. In certain embodiments, the effector domain is a DNA-modifying domain, such as a base-editing domain. In certain embodiments, the DNA-modifying domain is a domain that specifically modifies DNA. For example, a nucleic acid editing domain that introduces a deaminase domain. See US 2016 / 0304846, WO2015 / 08 9406 and US2016 / 0304846, nucleic acid editing domains, The amino acid sequence of the Cas9 domain and the Cas9 variants are incorporated herein by reference.

[0424] e) UTR, Kozak sequence In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR , 3'UTR, or 5'UTR and 3'UTR. The polynucleotide (e.g., mRNA) encodes a hydroxysteroid 17-beta dehydrogenase. at least one UTR from steroidogenase 4 (HSD17B4 or HSD), e.g. In some embodiments, the polynucleotide (e.g., For example, the mRNA is a globin mRNA, for example, human alpha globin (HBA) mRNA. NA, human beta globin (HBB) mRNA, or Xenopus laevis beta It contains at least one UTR from xenoglobin (XBG) mRNA. In some embodiments, the polynucleotide (e.g., mRNA) may be a globin mRNA, e.g., 5'UTR, 3'UTR, or 5' and 3'UTR from HBA, HBB, or XBG In some embodiments, the polynucleotide (e.g., mRNA) comprises a Bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, a Several experiments have been performed using the 5'UTR from the albumin gene, HBA, HBB, or XBG. In embodiments, the polynucleotide (e.g., mRNA) encodes bovine growth hormone, megalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or In some embodiments, the polynucleotide ( For example, mRNA) is used to express bovine growth hormone, cytomegalovirus, and mouse Hba-a1. , HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (H sp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta -actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor It contains the 5' and 3' UTRs from the receptor (EGFR).

[0425] In some embodiments, the polynucleotides (e.g., mRNA) are from the same source. , e.g., actin, albumin, or globins such as HBA, HBB, or XBG and the like.

[0426] In some embodiments, the nucleic acids disclosed herein are selected from the group consisting of SEQ ID NOs: 232, 234, 236, 238, 239, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, , 236, 238, 241, or 275-277 and at least 9 In some embodiments, the 5' UTR comprises a 5' UTR having 0% identity to the 5' UTR disclosed herein. The nucleic acid to be used is any one of SEQ ID NOs: 233, 235, 237, 239, or 240. In some embodiments, the 3' UTR has at least 90% identity to one of the In this case, any of the aforementioned levels of identity may be at least 95%, at least 98%, or at least In some embodiments, the solubility of the compounds disclosed herein is 99% or 100%. The nucleic acid is any one of SEQ ID NOs: 232, 234, 236, 238, or 241. In some embodiments, the 5' UTR comprises one or more sequences disclosed herein. The nucleic acid is any one of SEQ ID NOs: 233, 235, 237, 239, or 240. It contains a 3'UTR with two sequences.

[0427] In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR , e.g., there are no additional nucleotides between the 5' cap and the start codon In some embodiments, the polynucleotide (e.g., mRNA) is 5' capped. The nucleotide sequence may contain a Kozak sequence (described below) between the primer and the start codon, but may also contain any additional nucleotides. In some embodiments, the polynucleotide (e.g., mRNA) A) does not include the 3'UTR, e.g., it does not include additional nucleotides between the stop codon and the polyA tail. There is no punch line.

[0428] In some embodiments, the polynucleotide (e.g., mRNA) is purified using the Kozak The Kozak sequence determines the translation initiation and overall yield of a polypeptide translated from a nucleic acid. The Kozak sequence is a methionine that can function as an initiation codon. The minimum Kozak sequence is NNNRUGN, which contains at least one of the following: Both of these are true: the first N is A or G and the second N is G. Nucleotides In the context of the sequence, R refers to a purine (A or G). The Kozak sequences are RNNRUGN, NNNRUGG, RNNRUGG, RNNA UGN, NNNAUGG, or RNNAUGG. Kozak sequences have zero or one mismatch at the lowercase positions. In some embodiments, the nucleotide sequence is rccRUGg with up to two mismatches. , Kozak sequences have zero or no mismatches for the lowercase positions. or rccAUGg with up to two mismatches. Kozak sequences have zero or one mismatch for the lowercase positions. , gccRccAUGG (SEQ ID NO: 305) with two or up to three mismatches In some embodiments, the Kozak sequence is For character positions, there can be zero mismatches, or one, two, three, or four In some embodiments, the amino acid sequence is gccAccAUG with up to 1 mismatch. The Kozak sequence is GCCACCAUG. The k sequence has zero, one, two, or three mismatches at the lowercase positions. , or gccgccRccAUGG (SEQ ID NO: 305) with up to four mismatches )

[0429] f) PolyA tail In some embodiments, the polynucleotide (e.g., mRNA) is polyadenylated. Optionally, the polyA tail further comprises a poly(A) tail. "interrupted" by one or more non-adenine nucleotide "anchors" at one or more positions in The poly-A tail may contain at least eight consecutive adenine nucleotides, but may contain at least one As used herein, the term "non-adenine nucleotides" also includes the above non-adenine nucleotides. "Adenine" refers to any natural or unnatural nucleotide that does not contain adenine. Thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the polyA tail on the polynucleotides (e.g., mRNA) described herein , 3' to the nucleotide encoding the RNA-guided DNA binder or sequence of interest In some cases, the polynucleotides on the mRNA may contain consecutive adenine nucleotides located between the two. The A-tail is directed against the nucleotides encoding the RNA-guided DNA binder or the sequence of interest. and non-adenine nucleotides located 3' to the base of the sequence. It interrupts adenine nucleotides at regular or irregular intervals.

[0430] In some embodiments, a polyA tail is used for in vitro transcription of mRNA. The poly(A) sequence encoded by the plasmid is part of the transcription product. The number of consecutive adenine nucleotides in the polyA sequence does not have to be exact. For example, 100 polyA sequences in a plasmid will be found in exactly 100 copies of the transcribed mRNA. In some embodiments, the polyA sequence may not be generated. The gene is not encoded on the plasmid and can be generated by PCR tailing or enzymatic tailing. and added using, for example, E. coli poly(A) polymerase.

[0431] In some embodiments, the one or more non-adenine nucleotides are poly(A)-linked. A series of adenine nucleotides is formed so that the protein can bind to a series of consecutive adenine nucleotides. In some embodiments, the amino acid sequence is positioned to interrupt an adjacent adenine nucleotide. The one or more non-adenine nucleotides are at least 8, 9, 10, 11, or 12 It is located after consecutive adenine nucleotides. In some embodiments, one or more The non-adenine nucleotides in In some embodiments, the one or more non-adenine nucleotides are located after It is located after at least 8 to 100 consecutive adenine nucleotides. In the form, the non-adenine nucleotides may be 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides. adenine nucleotide followed by at least eight consecutive adenine nucleotides continues.

[0432] The poly-A tail of the present disclosure is a sequence of consecutive adenine nucleotides followed by Contains one or more non-adenine nucleotides and, optionally, an additional adenine nucleotide. It can be seen.

[0433] In some embodiments, the poly-A tail is comprised of one non-adenine nucleotide or It comprises or contains one continuous string of 2 to 10 non-adenine nucleotides. In some embodiments, the non-adenine nucleotides are at least 8, 9, 10, 1 It is located after 1 or 12 consecutive adenine nucleotides. At least 8 to 50 consecutive adenine nucleotides are present. In some embodiments, one or more non-adenine nucleotides are located after the nucleotide. At least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 4 It is located after 6, 47, 48, 49, or 50 consecutive adenine nucleotides.

[0434] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or In some cases, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some embodiments, the non-adenine nucleotide is a thymine nucleotide. In some cases, if more than one non-adenine nucleotide is present, The nucleotides are a) guanine and thymine nucleotides, b) guanine and cytosine nucleotides c) thymine and cytosine nucleotides, or d) guanine, thymine and cytosine nucleotides. Examples containing non-adenine nucleotides A typical polyA tail is provided as SEQ ID NO:262.

[0435] g) Modified Nucleotides In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The acid contains modified uridines at some or all of the uridine positions. In the modified uridine, for example, the 5-position is modified with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is, for example, a C1- A pseudouridine modified at position 1 with C3 alkoxy. Modified uridines include, for example: , pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodo In some embodiments, the modified The modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is N1-methyl- In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the combination of N-methyl-pseudouridine and N1-methyl-pseudouridine is The modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridines are N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodo-uridine. A combination of pseudouridine and N1-methyl-pseudouridine. In this embodiment, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is 5-iodouridine and 5-methoxyuridine. It is a combination of uridine.

[0436] In some embodiments, at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 210%, 220%, 230%, 240%, 250%, 260%, 0%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 7 0%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% In some embodiments, 10% to 20% of the uridine positions in the nucleic acid are modified uridines. 5%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65 ~75%, 75-85%, 85-95%, or 90-100% are modified uridines, e.g. Examples include 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, In some embodiments, the nucleic acid 10%-25%, 15-25%, 25-35%, 35-45%, 45- 55%, 55-65%, 65-75%, 75-85%, 85-95%, or 90-10 0% is 5-methoxyuridine. In some embodiments, the uridine in the nucleic acid 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 5 5-65%, 65-75%, 75-85%, 85-95%, or 90-100% In some embodiments, 10% to 10% of the uridine positions in the nucleic acid are uridine. 25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 6 5-75%, 75-85%, 85-95%, or 90-100% is N1-methylsulfonyl In some embodiments, 10% to 2% of the uridine positions in the nucleic acid are uridine. 5%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65 ~75%, 75-85%, 85-95%, or 90-100% 5-iodouridine In some embodiments, 10% to 25%, 15% to 30% of the uridine positions in the nucleic acid are 25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 7 5-85%, 85-95%, or 90-100% is 5-methoxyuridine, and the remainder is In some embodiments, the uridine in the nucleic acid is N1-methylpseudouridine. 10%-25%, 15-25%, 25-35%, 35-45%, 45-55% of lysine positions %, 55-65%, 65-75%, 75-85%, 85-95%, or 90-100% is 5-iodouridine, and the rest are N1-methylpseudouridine.

[0437] h) 5' cap In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder is The nucleic acid (e.g., mRNA) may have a 5' cap, e.g., Cap0, Cap1, or Cap 2. The 5' cap generally comprises the first nucleotide of the 5'-3' strand of a nucleic acid (i.e., via a 5'-triphosphate to the 5' position of the first cap-proximal nucleotide 7-methylguanine ribonucleotides linked in a manner similar to that of ARCA (e.g., (which may be further modified as described). and the ribose of the second cap-proximal nucleotide both have 2'-hydroxyl In Cap1, the ribose of the first and second transcribed nucleotides of mRNA is , which contain 2'-methoxy and 2'-hydroxy, respectively. The riboses of the first and second cap-proximal nucleotides of A are both 2'-methionine. For example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30, Abbas et a. l.(2017)Proc Natl Acad Sci USA 114(11):E See 2106-E2115. Most internal nucleic acids, including mammalian nucleic acids such as human nucleic acids, Higher eukaryotic mRNAs contain Cap1 or Cap2. Cap0, and Ca Other cap structures distinct from p1 and Cap2 include IFIT-1 and IFIT-5. In mammals, such as humans, they are recognized as "non-self" by components of the innate immune system. may be immunogenic in the setting of elevated cytokine levels, including type I interferons Components of the innate immune system, such as IFIT-1 and IFIT-5, can also In addition, caps other than Cap1 or Cap2 compete with eIF4E for nucleic acid binding. may occur, potentially inhibiting mRNA translation.

[0438] A cap can be co-transcriptionally included in the RNA. For example, ARCA (anti-reverse capping tup analog, Thermo Fisher Scientific Catalog No. AM80 45) is a 7-methylguanine 3'-methylguanine nucleotide linked to the 5' position of a guanine ribonucleotide. A cap analog containing 5'-triphosphate, which is transcribed in vitro at initiation ARCA can be incorporated into the transcript 2' of the first cap-proximal nucleotide. This results in a Cap0 cap where the hydroxyl position is hydroxyl. For example, Stepinski et al. t al.,(2001)“Synthesis and properties of mRNAs containing the novel 'anti-reversal e' cap analogs 7-methyl(3'-O-methyl)Gppp G and 7-methyl(3'deoxy)GpppG,”RNA 7:1486 See -1495. The structure of ARCA is shown below. [ka]

[0439] CleanCap(TM)AG (m7G(5')ppp(5')(2'OMeA)p G, TriLink Biotechnologies Catalog No. N-7113) or is CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG (TriLink Biotechnologies catalog number N-7133) The Cap1 structure can be co-transcriptionally provided using CleanCap™ AG. and 3'-O-methylated versions of CleanCap™ GG, respectively, are also available from the catalog TriLink Biotechnolog under numbers N-7413 and N-7433 The structure of CleanCap™ AG is shown below: anCap™ structures are referred to herein as those with the last part of the catalog number listed above. It is sometimes referred to using three digits (e.g., TriLink Biotechno Logies Catalog Number N-7113 ("CleanCap™ 113") . [ka]

[0440] Alternatively, a cap can be added to the RNA after transcription. The nia capping enzyme is commercially available (New England Biolabs Catalog No. M2080S), and its D1 subunit contributes to the RNA triphosphate catalyse and guanylyltransferase activity and its D12 subunit Therefore, S-adenosyl In the presence of methionine and GTP, 7-methylguanine is converted to R to give Cap0. NA can be added. For example, Guo, P. and Moss, B. (1990 )Proc.Natl.Acad.Sci.USA 87,4023-4027, Mao , X. and Shuman, S. (1994) J. Biol. Chem. 269, 24 See 472-24479. Additional Considerations for Caps and Capping Approaches For example, see WO2017 / 053297 and Ishikawa et al. .,Nucl.Acids.Symp.Ser.(2009)No.53,129-13 See 0.

[0441] D. Determining RNA validity In some embodiments, the efficacy of the gRNA is determined by other components, e.g., together with a nucleic acid encoding an RNA-guided DNA-binding agent, such as any of those described in In some embodiments, the gRNA and the RNA guide DNA are delivered to the target site. The effectiveness of the combination with a nucleic acid encoding an NA binder is determined.

[0442] As used herein, the RNA-guided DNA nucleases and The use of guide RNAs can create double-strand breaks in DNA, which can disrupt the cellular machinery. During repair by DNA repair, errors can occur in the form of insertion / deletion (indel) mutations. Many mutations change the reading frame or introduce premature stop codons. and thus producing a non-functional protein.

[0443] In some embodiments, the efficacy of a particular gRNA or combination can be determined by in vitro In some embodiments, the in vitro model is based on a H In some embodiments, the in vitro model is HUH7 human EK293 cells. In some embodiments, the in vitro model is a HepG2 liver cancer cell line. In some embodiments, the in vitro model is a primary human hepatocyte. In some embodiments, the in vitro model is primary cynomolgus monkey hepatocytes. Regarding the use of primary human hepatocytes, commercially available primary human hepatocytes were used to ensure consistent results between experiments. In some embodiments, the in vitro model can provide greater consistency. Off-target sites where deletions or insertions occur (e.g., in primary human hepatocytes) The number of positions can be determined, for example, by transfection with Cas9 mRNA and guide RNA in vitro. This is determined by analyzing genomic DNA from transplanted primary human hepatocytes. In some embodiments, such determination is performed by in vitro analysis of Cas9 mRNA, donor RNA, and primary human hepatocyte-derived transfected with donor oligonucleotides An exemplary procedure for such a determination is as follows: A working example is provided.

[0444] In some embodiments, the efficacy of a particular gRNA or combination is determined by the gRNA The selection process is determined across multiple in vitro cell models. In some embodiments, cell line comparisons of the data with selected gRNAs are performed. In an embodiment, cross-screening is performed across multiple cell models.

[0445] In some embodiments, the efficacy of a particular gRNA or combination can be assessed by in vivo In some embodiments, the in vivo model is a rodent model. In some embodiments, the rodent model is a mutant human TTR gene. In some embodiments, the mouse expresses the human TTR gene. In vivo models are non-human primates, such as cynomolgus monkeys.

[0446] In some embodiments, the efficacy of the guide RNA or combination is assessed by the transcription factor TTR. In some embodiments, the percentage of edited TTRs is measured by the percentage of edited TTRs. The model can be, for example, in whole cell culture for in vitro models or in vivo models. In this case, the required amount of TTR protein in serum or tissue is Compare this to the required edit percentage.

[0447] In some embodiments, the efficacy of the guide RNA or combination is evaluated in a target cell type. measured by the number and / or frequency of indels in off-target sequences within the genome In some embodiments, the cells are transfected into the cell aggregate and / or at the target site. The frequency of indel generation in off-target genes is very low (e.g., less than 5%) compared with the frequency of indel generation in off-target genes. Effective guide RNAs and combinations that generate indels at target sites are provided. Thus, the present disclosure provides a method for detecting off-target indels in a target cell type (e.g., hepatocytes). No formation or indel formation in cell aggregates and / or at the target site Guide RNAs with off-target indel formation rates of less than 5% compared to the frequency of off-target indel formation In some embodiments, the present disclosure provides a method for targeting a cell type (e.g., a hepatocyte). We present guide RNAs and combinations that do not exhibit any off-target indel formation in In some embodiments, for example, one or more of the methods described herein are If assessed by the guideline, the guideline will generate indels at fewer than five off-target sites. In some embodiments, for example, the present invention provides a method for the preparation of a nucleic acid sequence comprising the steps of: If evaluated by one or more of the methods described in the document, 4, 3, 2, or 1 or less Guide RNAs and combinations that generate indels at off-target sites are provided. In some embodiments, the off-target site is a target cell (e.g., a hepatocyte). ) do not occur within protein-coding regions of the genome.

[0448] In some embodiments, gene editing events, e.g., insertions / deletions ("indels"), Detecting mutation formation and homology-directed repair (HDR) events in target DNA , WO2018 / 067447 or Schmidt et al., Nature M Methods 4:1051-1057 (2007) It utilizes linear amplification with mers and isolation of tagged amplification products (hereafter referred to as This is called "LAM-PCR" or "linear amplification (LA)" method.

[0449] In some embodiments, gene editing events, e.g., insertions / deletions ("indels"), Detecting mutation formation and homology-directed repair (HDR) events in target DNA The method further includes sequencing the linear amplification product or the further amplification product. Sequencing is the process of next-generation sequencing and the addition of linear or further amplified products. including cloning into a plasmid, sequencing of a plasmid or part of a plasmid, Exemplary next generation sequencing methods include, for example, For example, Shendure et al., Nature 26:1135-1145(2 In other embodiments, gene editing events, such as insertions / deletions ("insertion / deletions"), are described in Detects the formation of "under" mutations and homology-directed repair (HDR) events in target DNA The main purpose is to perform digital PCR (dPCR) on linear amplification products or further amplification products. ) or droplet digital PCR (ddPCR), or linear amplification products Alternatively, further amplification products may be designed to identify DNA containing HDR template sequences. contacting the nucleic acid probe with the linear amplification product or further amplification product; In some embodiments, the method further comprises detecting the probe bound to the entity. The method further includes determining the location of the HDR template in the target DNA.

[0450] In certain embodiments, the method involves determining the sequence of the insertion site within the target DNA. and wherein the insertion site is the position at which the HDR template is integrated into the target DNA. The insertion site contains some target DNA sequence and some HDR template sequence. obtain.

[0451] In some embodiments, the efficacy of the guide RNA or combination is assessed by the analysis of TTR. In some embodiments, the secretion of TTR is measured by the cell culture medium or It is measured using an enzyme-linked immunosorbent assay (ELISA) using serum. In an embodiment, secretion of TTR is measured using the same in vitro assay used to measure editing. In some embodiments, T is measured in a laboratory or in vivo system or model. Secretion of the TR is measured in primary human hepatocytes. In some embodiments, the secretion of the TT In some embodiments, TTR secretion is measured in HUH7 cells. Secretion is measured in HepG2 cells.

[0452] ELISA assays, commonly known to those skilled in the art, are used to determine serum TTR levels. In an exemplary embodiment, blood is collected and serum is isolated. Total TTR serum levels were measured using Mouse Prealbumin (Transthyrelin). etin) ELISA Kit (Aviva Systems Biology, Determined using a kit for measuring human TTR (BOKIA00111) or a similar kit for measuring human TTR If a kit is not available, a capture antibody specific for TTR can be used to measure the Pre-coated plates can be used to develop ELISAs. The plate is incubated at room temperature for a predetermined time and then washed. Add gates and incubate. Remove unbound antibody conjugates and plate After washing the plate, a color-developing substrate solution that reacts with the enzyme is added. and the absorbance specific for the substrate is read on a suitable plate reader.

[0453] In some embodiments, the amount of TTR in cells (including those derived from tissues) is determined by measuring the amount of gR In some embodiments, the efficacy of the TT in cells is measured. The amount of R is measured using Western blot. The cells used are HUH7 cells. In some embodiments, the cells used are In some embodiments, the cells used are derived from animals. In some embodiments, the amount of TTR is adjusted to control the change in cell number. To control this, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) The amount of the gene is compared with that of the target gene (pairing gene).

[0454] III. LNP formulations and treatment of ATTR In some embodiments, a method for inducing a double-strand break (DSB) in the TTR gene and comprising a guide RNA described herein (e.g., among SEQ ID NOs: 5 to 82). or any one or more guide sequences of sgRNAs of SEQ ID NOs: 87 to 124 In some embodiments, methods are provided that include administering a composition comprising any one or more of the following: In one embodiment, a gRN comprising any one or more of the guide sequences of SEQ ID NOs: 5 to 82. A is administered to induce a DSB in the TTR gene. A nuclease, e.g., a Cas nuclease (e.g., Cas9) is encoded by the present invention. The nucleic acid (e.g., mRNA) or vector described in the literature is administered together with the RNA. The isolated DNA nuclease may be S. pyogenes Cas9. In some embodiments, the guide RNA is chemically modified. Nucleic acids encoding the RNA-guided RNA and RNA-guided DNA nucleases are described herein. LNPs, e.g., CCD lipids (e.g., amine lipids such as lipid A), helper lipids (e.g., cholesterol), stealth lipids (e.g., PEG lipids such as PEG2k-DMG), ), and optionally a neutral lipid (e.g., DSPC).

[0455] In some embodiments, a method for inducing a double-strand break (DSB) in the TTR gene and one or more guides of SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82. sgR sequences of SEQ ID NOs: 87 to 113, 115 to 120, and 122 to 124 A guide RNA containing any one or more of the following NAs (e.g., a chemically modified guide RNA) A method is provided comprising administering a composition comprising: Among the sgRNAs of SEQ ID NOs: 87 to 113, 115 to 120, and 122 to 124 or any one or more of the guides of SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 A gRNA containing one or more of these sequences is administered to induce a DSB in the TTR gene. The guide RNA can be used to target RNA-guided DNA nucleases, such as Cas nucleases (e.g., For example, administered with a nucleic acid or vector described herein encoding Cas9. RNA-guided DNA nucleases, such as S. pyogenes Cas9, In certain embodiments, the guide RNA is chemically modified. In this embodiment, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is The LNPs described herein, e.g., CCD lipids (e.g., amine lipids such as lipid A), lipids (e.g., cholesterol), stealth lipids (e.g., PEG2k-DMG, etc.) Administered in LNPs containing a PEG-lipid, and optionally a neutral lipid (e.g., DSPC) will be done.

[0456] In some embodiments, the method of modifying the TTR gene comprises the steps of: A guide RNA (for example, any one or more of the guide sequences of SEQ ID NOs: 5 to 82) to be used or a combination comprising any one or more of the sgRNAs of SEQ ID NOs: 87 to 124 In some embodiments, a method is provided comprising administering a composition selected from the group consisting of SEQ ID NO: Any one or more of the guide sequences of SEQ ID NOs: 5 to 82, or sgR of SEQ ID NOs: 87 to 124 A gRNA containing one or more of the above NAs is administered to modify the TTR gene. The guided RNA can be used to target RNA-guided DNA nucleases, such as Cas nucleases (e.g. , Cas9) The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In this case, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is LNPs as described herein, e.g., CCD lipids (e.g., amine lipids such as lipid A), helper -lipids (e.g., cholesterol), stealth lipids (e.g., PEG2k-DMG, etc.) PEG-lipid), and optionally a neutral lipid (e.g., DSPC) do.

[0457] In some embodiments, the method for modifying the TTR gene comprises: Any one or more of the guide sequences 2, 74-78, and 80-82, or the sequence Any of sgRNAs numbered 87-113, 115-120, and 122-124 or one or more guide RNAs. In some embodiments, the guides of SEQ ID NOs: 5-72, 74-78, and 80-82 or any one or more of SEQ ID NOs: 87 to 113, 115 to 120, and A gRNA containing one or more of sgRNAs 122 to 124 is administered, and T The guide RNA modifies the TR gene. The guide RNA is used to target the RNA-guided DNA nuclease, e.g., C A nucleic acid or vector described herein encoding a Cas nuclease (e.g., Cas9) RNA-guided DNA nuclease is administered with S. pyogenes In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA-guided DNA nuclease Nucleic acids encoding the LNPs described herein, e.g., CCD lipids (e.g., lipid A, etc.), which amine lipids), helper lipids (e.g., cholesterol), stealth lipids (e.g., PEG lipids such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC ) is administered in an LNP containing

[0458] In some embodiments, the method of treating ATTR comprises administering to a subject a therapeutically effective amount of any of the compounds described herein. guide RNA (for example, any one or more of the guide sequences of SEQ ID NOs: 5 to 82, or or a composition comprising any one or more of the sgRNAs of SEQ ID NOs: 87 to 124 In some embodiments, a method is provided comprising administering SEQ ID NO: 5 to a mammalian subject. Any one or more of the 82 guide sequences or sgRNAs of SEQ ID NOs: 87 to 124 A gRNA containing one or more of the following is administered to treat ATTR. A is an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas 9) is administered in conjunction with a nucleic acid or vector described herein encoding RNA. The guide DNA nuclease may be S. pyogenes Cas9. In embodiments, the guide RNA is chemically modified. The nucleic acids encoding the guide RNA and the RNA-guided DNA nuclease are described herein. The LNPs contain, for example, CCD lipids (e.g., amine lipids such as lipid A), helper lipids ( cholesterol), stealth lipids (e.g., PEG lipids such as PEG2k-DMG), The drug is administered in an LNP comprising a lipid-rich substance, and optionally a neutral lipid (e.g., DSPC).

[0459] In some embodiments, the method of treating ATTR comprises administering to a subject a gene encoding a gene encoding an antibody of SEQ ID NO: 5-72, Any one or more of the guide sequences of 74 to 78 and 80 to 82, or SEQ ID NOs: Any one of sgRNAs 87-113, 115-120, and 122-124 Methods are provided that include administering a composition comprising one or more guide RNAs. In some embodiments, the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82 Any one or more of the sequences, or sequence numbers 87 to 113, 115 to 120, and 1 A gRNA containing one or more of 22 to 124 sgRNAs was administered to induce ATT Treat R. The guide RNA is used to target RNA-guided DNA nucleases, such as Cas nucleases. a nucleic acid or vector described herein encoding a lyase (e.g., Cas9); RNA-guided DNA nuclease is a nucleotide sequence encoding the S. pyogenes Cas gene. 9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid sequence encoding the guide RNA and the RNA-guided DNA nuclease is The nucleic acid can be incorporated into an LNP as described herein, e.g., an amino acid such as a CCD lipid (e.g., lipid A). lipids), helper lipids (e.g., cholesterol), stealth lipids (e.g., PEG2 PEG lipids such as k-DMG), and optionally a neutral lipid (e.g., DSPC) It is administered via LNP.

[0460] In some embodiments, the method for reducing TTR serum concentrations comprises administering to a subject a subject, the subject being a patient, a mammal, a mammal, a human, a mammal, a cationic surfactant, a steroid, a steroid hormone ... The guide RNA (for example, any one or more of the guide sequences of SEQ ID NOs: 5 to 82) or any one or more of the sgRNAs of SEQ ID NOs: 87 to 124) In some embodiments, a method is provided, comprising: Any one or more of the guide sequences or sgRNAs of SEQ ID NOs: 87 to 124 gRNA containing one or more of the following is administered to form amyloid or amyloid fibrils: gRNAs are RNA-guided DNA nucleases that reduce or prevent TTR accumulation in the nuclei. and a nucleic acid sequence described herein that encodes a Cas nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease is administered in conjunction with a nucleic acid or vector containing S. In certain embodiments, the guide RNA may be a CRISPR / Cas9. In some embodiments, the guide RNA and the RNA guide D are chemically modified. Nucleic acids encoding NA nucleases can be used in LNPs described herein, such as CCD lipids ( amine lipids such as lipid A), helper lipids (e.g., cholesterol), esters a lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid ( For example, it is administered in an LNP containing DSPC.

[0461] In some embodiments, the method for reducing TTR serum concentrations comprises administering to a subject a subject, the subject being a patient, a mammal, a mammal, a human, a mammal, a cationic surfactant, a steroid, a steroid hormone ... The guide RNAs described above (e.g., guide RNAs of SEQ ID NOs: 5-72, 74-78, and 80-82) Any one or more of the sequences, or SEQ ID NOs: 87 to 113, 115 to 120, and 122 to 124), In some embodiments, methods are provided for the preparation of SEQ ID NOs: 5-72, 74-78, and and 80 to 82, or any one or more of SEQ ID NOs: 87 to 113, 1 gR containing one or more of sgRNAs 15 to 120 and 122 to 124 NA is administered to reduce or eliminate the accumulation of TTR in amyloid or amyloid fibrils. gRNAs are RNA-guided DNA nucleases, e.g., Cas nucleases. together with a nucleic acid or vector described herein encoding a caspases (e.g., Cas9). The RNA-guided DNA nuclease is S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In one embodiment, a nucleic acid encoding a guide RNA and an RNA-guided DNA nuclease Nucleic acids can be incorporated into LNPs described herein, e.g., CCD lipids (e.g., amine lipids such as lipid A). lipids), helper lipids (e.g., cholesterol), stealth lipids (e.g., PEG2k- LN containing a PEG-lipid such as DMG, and optionally a neutral lipid (e.g., DSPC) It is administered in P.

[0462] In some embodiments, the T in the amyloid or amyloid fibril of the subject A method for reducing or preventing accumulation of a TR, comprising administering to a subject a guide RNA ( For example, any one or more of the guide sequences of SEQ ID NOs: 5 to 82, or SEQ ID NO: 87 administering a composition comprising any one or more of the 124 sgRNAs In some embodiments, a method is provided comprising: detecting amyloid or amyloid-associated proteins in a subject. 1. A method for reducing or preventing accumulation of TTR in thyroid fibrils, comprising administering to a subject a polypeptide comprising SEQ ID NO: 87 a method comprising administering a composition comprising any one or more of the sgRNAs of any one of 113 to 113. In some embodiments, the method further comprises: Any one or more of the sgRNAs of SEQ ID NOs: 87 to 124 and administration of a gRNA containing TTR, which induces accumulation of TTR in amyloid or amyloid fibrils. The gRNA reduces or prevents the production of RNA-guided DNA nucleases, e.g., Ca A nucleic acid or vector described herein encoding a nuclease (e.g., Cas9) RNA-guided DNA nuclease is administered with S. pyogenes In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA-guided DNA nuclease The nucleic acid encoding the LNP described herein, e.g., a CCD lipid (e.g., lipid A, etc.), amine lipids), helper lipids (e.g., cholesterol), stealth lipids (e.g., P PEG lipids such as EG2k-DMG), and optionally a neutral lipid (e.g., DSPC) It is administered in an LNP containing

[0463] In some embodiments, the T in the amyloid or amyloid fibril of the subject A method for reducing or preventing accumulation of a TR, comprising administering to a subject a guide RNA ( For example, any of the guide sequences of SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 or one or more of the sgRNAs of SEQ ID NOs: 87 to 124 In some embodiments, a method is provided, comprising administering a composition comprising: , reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject A method for producing a nucleic acid sequence comprising the steps of: and administering a composition comprising any one or more of the gRNAs. In some embodiments, the sequences of SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 are Any one or more of the guide sequences, or SEQ ID NOs: 87 to 113, 115 to 120, and a gRNA containing one or more of sgRNAs 122 to 124 is administered. , reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils. The gRNA can be used to target an RNA-guided DNA nuclease, such as a Cas nuclease (e.g., The antibody may be administered in combination with a nucleic acid or vector described herein encoding the antibody (Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In this regard, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is LNPs as described herein, e.g., CCD lipids (e.g., amine lipids such as lipid A), helper Lipids (e.g., cholesterol), stealth lipids (e.g., P such as PEG2k-DMG) EG lipid), and optionally a neutral lipid (e.g., DSPC) .

[0464] In some embodiments, a guide sequence from Table 1 or one or more sgRs from Table 2 NA is an RNA-guided DNA nuclease, e.g., a Cas nuclease, which is a nucleotide sequence translated from a nucleic acid. The gRNA containing the enzyme induces DSB and promotes non-homologous end joining (NHEJ) during repair. In some embodiments, NHEJ results in a mutation in the TTR gene. Deletion or insertion mutations in the TTR gene cause frameshifts or induces nonsense.

[0465] In some embodiments, the method further comprises: Administering a nucleic acid (e.g., in a composition provided herein) that inhibits T cell proliferation in a subject lowering the level (e.g., serum level) of TR and thus reducing amyloid or amyloid Prevents accumulation and aggregation of TTR in thyroid fibrils.

[0466] In some embodiments, the T in the amyloid or amyloid fibril of the subject Reducing or preventing the accumulation and aggregation of TRs can be achieved by administering to one or more tissues of a subject, e.g., This includes reducing or preventing TTR deposition in the stomach, colon, or neural tissue. In some embodiments, the nerve tissue comprises a sciatic nerve or a dorsal root ganglion. Morphologically, TTR deposits are found in two or three of the following areas: the stomach, colon, sciatic nerve, and dorsal root ganglia. The level of deposition in a given tissue is reduced, e.g., by immunostaining. Color can be determined using a biopsy sample. , reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject and / or reducing or preventing TTR deposition is associated with a decrease in serum TTR levels over a predetermined period of time. As discussed in the Examples, For example, by reducing serum TTR levels according to the methods and uses provided in , such as those discussed above and in the Examples, as measured 8 weeks after administration of the composition. It has been found that it can cause clearance of deposited TTR from tissues.

[0467] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a cow, a pig, a monkey, a sheep, or The animal may be a dog, cat, fish, or poultry.

[0468] In some embodiments, one or more guide RNAs described herein (e.g., 1 or one or more guide sequences from Table 2, or one or more sgRNAs from Table 2. and the use of RNA-guided DNA binding (e.g., in the compositions provided herein). The use of nucleic acids (e.g., mRNA) described herein that encode combination agents can be used to treat cancers with ATTRs. The present invention provides a method for preparing a medicament for treating a human subject having an RNA-guided DNA binding agent. may be Cas9, e.g., S. pyogenes Cas9. In this embodiment, the guide RNA is chemically modified.

[0469] In some embodiments, the composition comprising the guide RNA and nucleic acid is administered intravenously. In some embodiments, the guide RNA and the composition comprising the nucleic acid are delivered to the liver. is administered.

[0470] In some embodiments, a composition comprising a guide RNA and a nucleic acid provided herein is provided. A single administration of the compound is sufficient to knock down expression of the mutant protein. In some embodiments, the compositions comprising the guide RNA and nucleic acids provided herein may be used alone. A single dose was sufficient to knock down the expression of the mutant protein in the cell population. In other embodiments, compositions comprising the guide RNA and nucleic acids provided herein. More than one administration of an entity may be beneficial to maximize editing through a cumulative effect. For example, the compositions provided herein may be administered two, three, four, five, or even more times. For example, it can be administered twice. The administration can be, for example, for one day to two years, for example, for one day. ~7 days, 7 days to 14 days, 14 days to 30 days, 30 days to 60 days, 60 days to 1 20 days, 120 days to 183 days, 183 days to 274 days, 274 days to 366 days , or can be divided into periods ranging from 366 days to 2 years.

[0471] In some embodiments, the composition is administered at a concentration of 0.01 to 10 mg / kg (mpk), e.g., For example, 0.01-0.1mpk, 0.1-0.3mpk, 0.3-0.5mpk, 0.5- in the range of 1mpk, 1-2mpk, 2-3mpk, 3-5mpk, 5-10mpk, or Administered at effective doses of 0.1, 0.2, 0.3, 0.5, 1, 2, 3, 5, or 10 mpk In some embodiments, the composition is administered at a dose of 2 to 4 mg / kg, for example, 2.5 to 4 mg / kg. In some embodiments, the composition is administered in an amount of about 3 mg / kg. / kg.

[0472] In some embodiments, the efficacy of treatment with the compositions herein is maintained at 1 year from delivery. In some embodiments, the patient may have a pulmonary embolism, which may be seen after 2 years, 3 years, 4 years, 5 years, or 10 years. The efficacy of treatment with the composition of the present invention can be assessed by measuring serum levels of TTR before and after treatment. In some embodiments, a decrease in serum levels of TTR is assessed. The efficacy of treatment with the composition, as assessed by a reduction in , 2nd month, 3rd month, 4th month, 5th month, 6th month, 7th month, 8th month, 9th month , 10th, or 11th month.

[0473] In some embodiments, treatment slows or stops the progression of the disease.

[0474] In some embodiments, treatment slows or stops the progression of FAP. In some embodiments, the treatment is a sensory motor neuropathy or an autonomic neuropathy. Improves, stabilizes, or slows changes in Qi symptoms.

[0475] In some embodiments, treatment improves, stabilizes, or changes the symptoms of FAC. In some embodiments, the treatment is for restrictive cardiomyopathy or congestive heart failure. Improve, stabilize, or slow the progression of symptoms.

[0476] In some embodiments, the efficacy of treatment is measured by an increase in the subject's survival time. can be.

[0477] In some embodiments, the efficacy of treatment is measured by the level of sensorimotor neuropathy or autonomic neuropathy. It is measured by the improvement of neuropathic symptoms or slowing of their progression. In embodiments, the effectiveness of treatment is measured by mobilizing an area of ​​the body or by increasing the number of cells in any area of ​​the body. It is measured by an increase in the ability to feel in certain areas, or a delayed decline. In embodiments, the effectiveness of treatment is measured by the ability to swallow, breathe, use an arm, hand, leg, or foot, or walk. It is measured by the improvement of the ability to perform the task or the increase in the ability to perform the task, or the delay in the decrease. In embodiments, the effectiveness of treatment is measured by amelioration or slowing of the progression of neuralgia. In some embodiments, neuralgia is characterized by pain, burning, numbness, or abnormal sensations. In some embodiments, the effectiveness of treatment is measured by the reduction of postural hypotension, dizziness, gastrointestinal Measured by improvement or delayed increase in motility, bladder, or sexual dysfunction In some embodiments, the effectiveness of treatment is measured by ameliorating or slowing the progression of weakness. In some embodiments, the effectiveness of treatment is measured using electromyography, nerve conduction studies, or measured using patient-reported outcomes.

[0478] In some embodiments, the effectiveness of treatment is measured by reducing the symptoms of congestive heart failure or CHF. In some embodiments, the efficacy of treatment is measured by improvement or slowing of progression. Reduced shortness of breath, difficulty breathing, fatigue, swelling of the ankles, feet, legs, abdomen, or neck veins In some embodiments, the effectiveness of the treatment is measured by a delay in the increase in the Measured by improvement or slowing of fluid accumulation and no significant changes such as weight gain, frequent urination, or nighttime coughing. In some embodiments, the effectiveness of treatment may be assessed by any measure. Cardiac biomarker testing (e.g., B-type natriuretic peptide [BNP] or N-terminal protease inhibitors) (NT-proBNP), pulmonary function tests, chest x-rays, and is measured using electrocardiography.

[0479] A. Combination Therapy In some embodiments, the present invention provides a method for the production of a medicament comprising administering to a subject ... For example, any one or more of the guide sequences disclosed in Table 1 or the sgRNAs in Table 2. and any one or more of the RNA-guided DNA-binding agents described herein. Nucleic acids encoding (e.g., in the compositions provided herein), e.g., S. pyoge A nucleic acid (e.g., mRNA) or vector described herein encoding nes Cas9. in combination with additional therapy appropriate to alleviate the symptoms of ATTR. In certain embodiments, the guide RNA is chemically modified. In some embodiments, a gene encoding a guide RNA and an RNA-guided DNA nuclease is provided. The nucleic acid may be attached to a LNP as described herein, e.g., an amine-containing CCD lipid (e.g., lipid A). lipids), helper lipids (e.g., cholesterol), stealth lipids (e.g., PEG2k L-DMG), and optionally a neutral lipid (e.g., DSPC). It is administered by NP.

[0480] In some embodiments, the additional therapy for ATTR is sensorimotor neuropathy. In some embodiments, the treatment is for a neuropathic or autonomic neuropathy. Treatment for sensory motor or autonomic neuropathy is nonsteroidal anti-inflammatory drug (NSAID). The agent is an inflammatory agent, an antidepressant, an anticonvulsant, an antiarrhythmic agent, or a narcotic agent. In this condition, antidepressants are tricyclics or serotonin-norepinephrine reuptake inhibitors. In some embodiments, the antidepressant is amitriptyline, duloxacin, or benzodiazepine. In some embodiments, the anticonvulsant is: gabapentin, pregabalin, topiramate, or carbamazepine. In embodiments, the additional therapy for sensorimotor neuropathy is transcutaneous electrical nerve stimulation. is.

[0481] In some embodiments, the additional therapy for ATTR is restrictive cardiomyopathy or caries. In some embodiments, the treatment of CHF is for congestive heart failure (CHF). Treatments include ACE inhibitors, aldosterone antagonists, angiotensin receptor blockers, Beta-blockers, digoxin, diuretics, or isosorbide dinitrate / hydralazine hydrochloride In some embodiments, the ACE inhibitor is enalapril, captopril, Ramipril, perindopril, imidapril, or quinapril. In some embodiments, the aldosterone antagonist is eplerenone or spironolactone. In some embodiments, the angiotensin receptor blocker is azilsartan. cadesartan, eprosartan, irbesartan, losartan, olmesartan, tetanus, In some embodiments, the beta-blocker is lumisartan or valsartan. are acebutolol, atenolol, bisoprolol, metoprolol, nadolol, and neprolol. In some embodiments, the diuretic is: Chlorothiazide, chlorthalidone, hydrochlorothiazide, indapamide, metolazone, bumetanide, furosemide, torsemide, amiloride, or triameterene.

[0482] In some embodiments, the combination therapy includes any of the guide sequences disclosed in Table 1. or a gRNA containing one or more of the sgRNAs in Table 2. and a nucleic acid encoding an RNA-guided DNA binder (e.g., a nucleic acid encoding a nucleic acid sequence as provided herein). and administering the composition containing the TTR or mutant TTR together with an siRNA targeting the TTR or mutant TTR. In some embodiments, the siRNA comprises a nucleotide sequence encoding a wild-type or mutant TTR. Any siRNA that can further reduce or eliminate expression. In an embodiment, the siRNA is a medicament for treating atopic dermatitis with the drug patisiran (ALN-TTR02) or ALN-TTR02. In some embodiments, the siRNA is N-TTRsc02. Any one or more of the guide sequences listed in Table 2 or any one of the sgRNAs listed in Table 2 or any one of the gRNAs (e.g., in the compositions provided herein) containing In some embodiments, the siRNA is administered in a manner similar to that of the gRNA provided herein. After treatment with either of the compositions, the drug is administered periodically.

[0483] In some embodiments, the combination therapy comprises a guide sequence described herein (e.g., Table 1). any one or more of the sgRNAs in Table 1), or any one of the sgRNAs in Table 2 Any one of the gRNAs comprising one or more of the RNA guides described herein. The nucleic acid encoding the TTR DNA binder (e.g., in the compositions provided herein) may be or administration of the compound with an antisense nucleotide that targets mutant TTR. In some embodiments, the antisense nucleotide is a wild-type or mutant TT Any antisense nucleotides that can further reduce or eliminate expression of R In some embodiments, the antisense nucleotide is the drug inotercept. IONS-TTR Rx In some embodiments, the antisense nucleic acid The guide sequence may be any one or more of the guide sequences disclosed in Table 1 or the sgRNs in Table 2. Any one of gRNAs containing any one or more of A, and RNA guide DNA The nucleic acid encoding the binding agent (eg, in a composition provided herein) is administered after the administration. In some embodiments, the antisense nucleotides are those derived from the gR The NA compositions are administered periodically after treatment.

[0484] In some embodiments, the combination therapy includes any of the guide sequences disclosed in Table 1. or a gRNA containing one or more of the sgRNAs in Table 2. and a nucleic acid encoding an RNA-guided DNA binder (e.g., a nucleic acid encoding a nucleic acid sequence as provided herein). (composition containing TTR) promotes dynamic stabilization of the correctly folded tetrameric form of TTR. In some embodiments, the small molecule stabilizer The stabilizer is the drug tafamidis (Vyndaqel®) or diflunisal. In some embodiments, the small molecule stabilizer is selected from the group consisting of guide sequences disclosed in Table 1. or a gRNA containing one or more of the sgRNAs in Table 2. After any one of the above (e.g., a composition provided herein). In embodiments, the small molecule stabilizer is a compound that is Later, it is administered periodically.

[0485] In any of the foregoing embodiments, the guide sequences disclosed in Table 1 are SEQ ID NOs: 5-7 2, 74-78, and 80-82, and / or sgR in Table 2 NA is selected from SEQ ID NOs: 87 to 113, 115 to 120, and 122 to 124. and / or the guide RNA may be a chemically modified guide RNA.

[0486] In some embodiments, the methods described herein include injection prophylaxis. In embodiments, the infusion prophylaxis is administered to the subject prior to the gene editing composition. In embodiments, the injection prophylaxis is administered 8 to 24 hours or 1 to 2 hours prior to administration of the nucleic acid composition. In some embodiments, the infusion prophylaxis is administered to the subject at a dose of 0.5 mg / kg / day. In some embodiments, the infusion prophylaxis includes a corticosteroid, pain and fever relief. Antipyretic, which may reduce and / or inhibit COX enzymes and / or prostaglandins drugs (e.g., oral acetaminophen (also called paracetamol)), H1-blockers, or H2 blockers. Infusion prophylaxis consists of intravenous corticosteroids (dexamethasone 8–12 mg, e.g., 10 mg or equivalent) and antipyretics (e.g., oral acetaminophen or paracetamol) In some embodiments, the drug comprises an H1 blocker (e.g., diphenhydramine). dramamine 50 mg or equivalent) and / or H2 blockers (e.g., ranitidine 50 mg g or equivalent) is administered orally. In some embodiments, an H1 blocker (e.g., diphenhydramine 50 mg or equivalent) and / or H2 blockers (e.g., laminar Nitidine 50 mg or equivalent) is administered intravenously. Infusion prophylaxis is administered intravenously 1-2 hours prior to infusion of the nucleic acid composition. Intravenous H1-blockers and / or intravenous H2-blockers are replaced with oral equivalents. Infusion prophylaxis serves to reduce adverse reactions associated with administering nucleic acid compositions. In some embodiments, injection prophylaxis may be administered prior to administering the nucleic acid composition. The corticosteroids, infusion prophylaxis, and gastrointestinal prophylaxis described herein are administered as a premedication. The dosage, frequency, and mode of administration of the idRNA-containing composition can be independently controlled. .

[0487] The corticosteroids used in the disclosed methods may be administered in any of the following regimens known in the art: For example, it may be administered according to a regimen approved by the US FDA. and the like, including administration to or for use in human subjects. The corticosteroid may be administered in an amount ranging from about 0.75 mg to about 25 mg. In embodiments, for example, including administration to or for use in human subjects. Therefore, the corticosteroid should be administered at a dose of about 0.01 to 0.5 mg / kg, e.g., 0.1 to 0.40 mg / kg or in amounts ranging from 0.25 to 0.40 mg / kg.

[0488] In some embodiments, the corticosteroid is a Guide R In some embodiments, the corticosteroid is administered before the NA-containing composition. , administered after the guide RNA-containing composition described herein. In the method, a corticosteroid is administered simultaneously with the guide RNA-containing composition described herein. In some embodiments, multiple doses of corticosteroid are administered at once. In some embodiments, the compound is administered before or after administration of the RNA-containing composition. Several doses of the guide RNA-containing composition may be administered before or after administration of a corticosteroid. In some embodiments, multiple doses of a corticosteroid and multiple doses is administered.

[0489] When appropriate, doses of corticosteroids should be administered separately at appropriate intervals. In some embodiments, both corticosteroids may be administered as two subdoses. The drug is administered at least twice prior to administration of the guide RNA-containing composition described herein. In some embodiments, a dose of corticosteroid is administered. The composition is administered at least twice after the administration of the guide RNA-containing composition described above. In embodiments, the corticosteroid is administered for 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 1 hour, 2 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1 4 or 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or at 15-week intervals, or within a range bounded by any two of the preceding values. for an amount of time within the range (e.g., before administration of a guide RNA-containing composition described herein, after administration of In some embodiments, the medicament is administered in combination with and / or after administration of The steroid may be administered 1 hour, 2 hours, or both prior to administration of the guide RNA-containing composition described herein. Between, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 1 At intervals of 1, 12, 13, 14, or 15 weeks, or any two of the preceding values In some embodiments, the dose is administered for an amount of time within a range limited by one of the following: The luteosteroid was administered at 1 hour, 2 hours, and 3 days after administration of the guide RNA-containing composition described herein. Hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, At intervals of 11, 12, 13, 14, or 15 weeks, or any of the aforementioned values It is administered in a time amount within the range bounded by two.

[0490] In some embodiments, the corticosteroid is administered at least twice. In some embodiments, the corticosteroid is administered at least three times. In some embodiments, the corticosteroid is administered at least four times. In some embodiments, the corticosteroid may be administered up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 3 The first dose may be oral, and the second or Subsequent doses may be parenterally administered, e.g., by injection. Alternatively, the first dose The first dose may be parenteral, with the second or subsequent doses being by oral administration. It is also possible.

[0491] In some embodiments, the corticosteroid is administered in combination with a guide RNA described herein. In some embodiments, the corticosteroid is administered orally prior to intravenous administration of the containing composition. Steroids may be administered intravenously or intravenously with the guide RNA-containing compositions described herein. It is administered orally after administration.

[0492] In some embodiments, the corticosteroid is dexamethasone. In some embodiments, dexamethasone is administered intravenously 1 to 2 hours prior to injection of the nucleic acid composition. In some embodiments, dexamethasone is administered 1-2 times after the injection of the nucleic acid composition. The dose is administered intravenously in an amount of 8-12 mg, e.g., 10 mg, hours before the start of treatment. In some embodiments, dexamethasone is administered orally 8 to 24 hours prior to injection of the nucleic acid composition. In some embodiments, dexamethasone is administered 8 to 24 hours prior to injection of the nucleic acid composition. In some embodiments, the compound is orally administered in an amount of 8 to 12 mg, e.g., 8 mg. Dexamethasone is administered at a dose of 8 to 12 mg, for example, 8 mg, 8 to 24 hours before injection of the nucleic acid composition. g orally, and dexamethasone is administered 8-10 times 1-2 hours before injection of the nucleic acid composition. It is administered intravenously in an amount of 2 mg, for example 10 mg.

[0493] B. Delivery of Nucleic Acid Compositions In some embodiments, the gRNA and the RNA are RNA-guided DNA-binding agents or encoded on one or more vectors, comprising a nucleic acid described herein encoding The nucleic acid compositions described herein may be formulated in lipid nanoparticles or may be For example, see, e.g., the contents of which are incorporated herein by reference in their entirety. "LIPID NANOPARTICLE FORMULATIONS FOR WO20171730 entitled "R CRISPR / CAS COMPONENTS" 54A1 and WO2019067992A1 entitled "FORMULATIONS" Any lipid nanoparticle known to those skilled in the art that is capable of delivering nucleotides to a subject can be used. The particles (LNPs) contain guide RNAs as described herein and RNA-guided DNA nucleases. can be used in conjunction with nucleic acids encoding

[0494] Various embodiments of LNP formulations for RNA, including CRISPR / Cas cargo, include: Disclosed herein are LNP formulations that comprise (i) a CCD lipid, e.g., an amine lipid, and (ii) neutral lipids; (iii) helper lipids; and (iv) stealth lipids, e.g., P Some embodiments of the LNP formulation may include a helper lipid, a neutral lipid, Some implementations include "amine lipids," as well as stealth lipids such as PEG and PEG-lipids. In some embodiments, the LNP formulation contains less than 1% neutral phospholipids. In this case, the LNP formulation contains less than 0.5% neutral phospholipids. By "lipid nanoparticles" we mean: Multiple (i.e., more than one) lipid molecules that are physically bound to each other by intermolecular forces It means particles containing

[0495] CCD lipids for delivery of CRISPR / Cas mRNA and guide RNA components into liver cells The lipid composition comprises a CCD lipid.

[0496] In some embodiments, the CCD lipid is 3-((4,4-bis(octyloxy) )butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl )oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate and Also called (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl) oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl Lipid A is the following: It can be described as follows. [ka]

[0497] Lipid A was synthesized according to WO2015 / 095340 (e.g., pages 84-86). obtain.

[0498] In some embodiments, the CCD lipid is ((5-((dimethylamino)methyl) -1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(deca ((5-((dimethylamino)methyl)-1,3-phenylene), also known as ((5-((dimethylamino)methyl)-1,3-phenylene )bis(oxy))bis(octane-8,1-diyl)bis(decanoate) B. Lipid B can be depicted as follows: [ka]

[0499] Lipid B was synthesized according to WO2014 / 136086 (e.g., pages 107-09). It is possible.

[0500] In some embodiments, the CCD lipid is 2-((4-(((3-(dimethylamino) Propoxycarbonyloxyhexadecanoyloxypropane-1,3- Diyl(9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoar) Lipid C is a lipid that is a soluble fiber. Lipid C can be depicted as follows: [ka]

[0501] In some embodiments, the CCD lipid is 3-(((3-(dimethylamino)pro (Oxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octyl It is lipid D, an undecanoate.

[0502] Lipid D can be depicted as follows: [ka]

[0503] Lipid C and lipid D can be synthesized according to WO2015 / 095340.

[0504] The CCD lipid may also be an equivalent to lipid A, lipid B, lipid C, or lipid D. In certain embodiments, the CCD lipid is an equivalent to lipid A, an equivalent to lipid B, It is an equivalent to lipid C, or an equivalent to lipid D.

[0505] Amine lipids In some embodiments, LNP compositions for delivery of bioactive agents include "amine Lipids" and the amine lipid is lipid A, lipid B, lipid C, lipid D, or an equivalent of lipid A. (including acetal analogs of lipid A), equivalents of lipid B, equivalents of lipid C, and lipid D is defined as the equivalent of

[0506] In some embodiments, the amine lipid is lipid A, (9Z,12Z)-3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethyl (amino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12- dienoate, 3-((4,4-bis(octyloxy)butanoyl)oxy)- 2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propion Lipid A is also known as octadeca-9,12-dienoate. It can be depicted as below. [ka]

[0507] Lipid A was synthesized according to WO2015 / 095340 (e.g., pages 84-86). In certain embodiments, the amine lipid is an equivalent to lipid A.

[0508] In certain embodiments, the amine lipid is an analog of lipid A. In certain LNP compositions, the lipid A analog is an acetal analog of lipid A. In some embodiments, the acetal analog is a C4 to C12 acetal analog. In further embodiments, the acetal analog is a C5 to C12 acetal analog. In a further embodiment, the acetal analog is a C5 to C10 acetal analog. In the present invention, the acetal analogs are C4, C5, C6, C7, C9, C10, C11, and C12 acetal analogs.

[0509] Amine lipids suitable for use in the LNPs described herein are biodegradable in vivo. Amine lipids are suitable for delivering bioactive agents (e.g., RNA) into cells. and low toxicity (e.g., no side effects in animals with RNA cargo at doses of 10 mg / kg or more). In certain embodiments, LNPs comprising amine lipids are At least 75% of the amine lipids are removed within 8, 10, 12, 24, or 48 hours, or These include those that are cleared from plasma within 3, 4, 5, 6, 7, or 10 days. In embodiments, the LNPs comprising amine lipids are at least 50% of the mRNA or gRNA. % within 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or In certain embodiments, the amine lipids are cleared from plasma within 10 days or less. LNPs containing, for example, lipids (e.g., amine lipids), RNA (e.g., mRNA), or by measuring another component, at least 50% of the LNPs are Within 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days In certain embodiments, the lipid-encapsulated LNPs are removed from plasma. The relative free lipid, RNA, or nucleic acid components are measured.

[0510] Lipid clearance may be measured as described in the literature. .A., et al. “Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeuti cs,”Mol.Ther.2013,21(8),1570-78(“Maier”) See, for example, Maier, in which siRNA targeting luciferase was used. The LNP-siRNA system containing the siRNA was administered to 6-8 week-old male C57Bl / 6 mice via the lateral tail vein. The dose was 0.3 mg / kg by intravenous bolus injection. Blood, liver at 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours Prior to tissue collection, mice were perfused with saline and blood samples were collected. The samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. Additionally, Maier has developed a procedure for assessing toxicity following administration of LNP-siRNA formulations. For example, siRNA targeting luciferase was injected into male Sprague Dawley mice. -Dawley rats were administered 0 mg of 0.0 ... The animals were administered 1, 3, 5, and 10 mg / kg (5 animals / group). Approximately 1 mL of blood was obtained from the jugular vein of each animal, and serum was isolated. All animals were euthanized for necropsy. Clinical signs, body weight, serum chemistry, organ weights and tissue Maier described a method for evaluating siRNA-LNP formulations. Although described, these methods are not intended to limit the clearance, pharmacokinetics, or other properties of the LNP compositions of the present disclosure. This method can be applied to assessing morphology and toxicity.

[0511] Amine lipids may increase the clearance rate. In some embodiments, The clearance rate is the lipid clearance rate, e.g., the rate at which lipids are released from blood, serum, or In some embodiments, the clearance rate is R The clearance rate of the mRNA or gRNA is, for example, the rate at which the mRNA or gRNA is released into blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the plasma is cleared. In some embodiments, the rate at which P is removed from the blood, serum, or plasma. Clearance rate is the rate at which LNPs are removed from tissues such as the liver or spleen. In certain embodiments, the high clearance rate allows for the administration of the compound without substantial adverse effects. Amine lipids reduce LNP accumulation in circulation and tissues. In some embodiments, the accumulation of LNPs in the circulation and tissues can be reduced. provides a safety profile without substantial adverse effects.

[0512] The amine lipids of the present disclosure may be ionized (e.g., ionized) depending on the pH of the medium in which they are contained. For example, in a slightly acidic medium, amine lipids may form protons. Conversely, for example, at a pH of approximately 7.3 In a slightly basic medium such as blood, where 5 is the pH, the amine lipids are not protonated, but In some embodiments, the amine lipids of the present disclosure may be uncharged. may be protonated at a pH of at least about 9. In some embodiments, The disclosed amine lipids may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 10. stomach.

[0513] The pH at which an amine lipid is mostly protonated is related to its intrinsic pKa. In some embodiments, the amine lipids of the present disclosure each independently have an average molecular weight of from about 5.1 to about 7.4 In some embodiments, the amine lipids of the present disclosure may have a pKa in the range of may each independently have a pKa in the range of about 5.5 to about 6.6. In some embodiments, the amine lipids of the present disclosure each independently have an average molecular weight of from about 5.6 to about 6.4 In some embodiments, the amine lipids of the present disclosure may have a pKa in the range of may each independently have a pKa in the range of about 5.8 to about 6.2. For example, The amine lipids of the present disclosure each independently have a pKa in the range of about 5.8 to about 6.5. Cationic lipids having a pKa in the range of about 5.1 to about 7.4 may be used in vivo to For example, LNPs have been formulated because they have been shown to be effective in delivering cargo to the liver. The pKa of the amine lipid can be an important consideration when preparing the amine lipid. Cationic lipids with pKa in the range of 0.1 to 1.5 are effective for delivery in vivo, e.g., to tumors. It has been found that, see, for example, WO2014 / 136086.

[0514] Additional fats Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, various neutral lipids. Neutral phospholipids suitable for use in the present disclosure include charged, uncharged, or zwitterionic lipids. Examples of substances are 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoyl Diphosphate-binding protein (DPPC), distearoylphosphatidylcholine (DS PC), pohsphocholine (DOPC), dimyristoyl Phosphatidylcholine (DMPC), Phosphatidylcholine (PLPC), 1,2-disulfide thiaroyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine Egg phosphatidylcholine (EPC), dilauroyl phosphatidylcholine Choline (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl 1-palmitoyl-2-methylphosphatidylcholine (MPPC), 1-palmitoyl-2-methylphosphatidylcholine Ristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine Sphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phospho Phosphatidylcholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (S PPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC) , palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine Dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylethanolamine (DOPE) Phosphatidylcholine Distearoylphosphatidylethanolamine (DSPE), Dimyris Dipalmitoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DMPE), ethanolamine (DPPE), palmitoyl oleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof In one embodiment, the neutral phospholipid is a distearoyl phospholipid. Dimyristoylphosphatidylcholine (DSPC), and dimyristoylphosphatidylethanolamine In another embodiment, the neutral phospholipid may be selected from the group consisting of: In another embodiment, the phosphate group may be distearoylphosphatidylcholine (DSPC). The neutral phospholipid can be dipalmitoylphosphatidylcholine (DPPC).

[0515] "Helper lipids" include steroids, sterols, and alkylresorcinols. Suitable helper lipids for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate In one embodiment, the helper lipid may be cholesterol. In an embodiment, the helper lipid may be cholesterol hemisuccinate.

[0516] "Stealth lipids" limit the length of time that nanoparticles can exist in vivo (e.g., in blood vessels). Stealth lipids are lipids that change particle size, for example, by reducing particle aggregation. The steroids used herein are useful in the formulation process. The lipids may modulate the pharmacokinetic properties of the LNP. Suitable stealth lipids include, but are not limited to, those having a hydrophilic head group linked to the lipid moiety. Stealth lipids suitable for use in the lipid compositions of the present disclosure include: Information on the biochemistry of such lipids is available from Romberg et al., Pharm. aceutical Research,Vol.25,No.1,2008,pg.5 5-71 and Hoekstra et al., Biochimica et Bio Physica Acta 1660 (2004) 41-52. Suitable PEG lipids are disclosed, for example, in WO2006 / 007712.

[0517] In one embodiment, the hydrophilic head group of the stealth lipid is selected from PEG-based polymers. The stealth lipid may comprise a lipid moiety. In one embodiment, the stealth lipid is a PEG lipid. PEG lipids, for example, can reduce particle aggregation. This can aid in the formulation process by reducing the amount of hydroxybenzoates present and controlling particle size. The PEG-lipid can modulate the pharmacokinetic properties of the LNP. Typically, the PEG-lipid is It comprises a lipid portion and a PEG-based polymer portion.

[0518] In one embodiment, the stealth lipid is a PEG-based polymer (poly(ethylene oxide) Poly(vinyl alcohol), poly(oxazoline), poly(vinyl alcohol), poly(vinyl methyl alcohol), poly(vinyl ... Poly(glycerol), poly(N-vinylpyrrolidone), polyamino acids, and poly[N- (2-hydroxypropyl) methacrylamide].

[0519] In one embodiment, the PEG lipid is a PEG-based polymer moiety (poly(ethylene glycol)). It contains hydroxybenzoates (sometimes called hydroxybenzoates).

[0520] The PEG-lipid further comprises a lipid moiety. In some embodiments, the lipid moiety is independently Diameter 100-120mm diameter, 100-200mm thick ... diacylglycerols, including those containing a diacylglycerol or diacylglycamide group or may be derived from a diacylglycamide, the chain having one or more functional groups (e.g., In some embodiments, the alkyl group may include an alkyl group (such as an alkylamide or ester). The chain length of the dialkylglycerol or dialkylglycamine is about C10 to C20. The alkyl group may further include one or more substituted alkyl groups. The chain length may be symmetric or asymmetric. .

[0521] Unless otherwise indicated, the term "PEG" as used herein refers to any It means polyethylene glycol or other polyalkylene ether polymer. In the form, PEG is optionally substituted ethylene glycol or ethylene oxide. In one embodiment, the PEG is a linear or branched polymer of PEG. In one embodiment, PEG may be, for example, one or more of alkyl, alkoxy, acyl, In one embodiment, the term includes PEG copolymers such as PEG-polyurethane or PEG-polypropylene (See, e.g., J. Milton Harris, Poly(ethylene glyco l) chemistry:biotechnical and biomedical In another embodiment, the The term does not include PEG copolymers. In one embodiment, PEG is from about 130 to about 5 0,000, in subembodiments, about 150 to about 30,000, in subembodiments In a subembodiment, about 150 to about 20,000, and in a subembodiment, about 150 to about 15, 000, in a subembodiment, about 150 to about 10,000, in a subembodiment In a subembodiment, about 150 to about 6,000; in a subembodiment, about 150 to about 5,000; In a subembodiment, about 150 to about 4,000, and in a subembodiment, about 1 In a secondary embodiment, about 50 to about 3,000; in a secondary embodiment, about 300 to about 3,000; In one embodiment, about 1,000 to about 3,000, and in a subembodiment, about 1,50 It has a molecular weight of 0 to about 2,500.

[0522] In certain embodiments, PEG (e.g., covalently attached to a lipid moiety or lipid, such as a stealth lipid) The most commonly used PEG is "PEG-2K", also known as "PEG2000", which is approximately 2.0 PEG-2K is herein defined as a compound having the following formula (I): ), where n is 45, which indicates a number average degree of polymerization of about 45 subunits. to [ka] However, for example, a polymer having a number-average degree of polymerization of about 23 subunits (n =23), and / or 68 subunits (n=68) Other known PEG embodiments may also be used. In some embodiments, n is about 3 n may range from 0 to about 60. In some embodiments, n ranges from about 35 to about 55. In some embodiments, n may range from about 40 to about 50. In some embodiments, n may range from about 42 to about 48. In embodiments, n can be 45. In some embodiments, R can be H, In some embodiments, R In some embodiments, R can be methyl. good.

[0523] In any of the embodiments described herein, the PEG lipid may be a PEG-diglyceride. Lauroyl glycerol, PEG-dimyristoyl glycerol (PEG-DMG) (N OF, Tokyo, Japan (Cat. No. GM-020), PEG-dipalmitate PEG-distearoylglycerol (PEG-DSPE) (Catalog No. DSPE-020CN, NOF, Tokyo, Japan), PEG-dilauryl Licamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and and PEG-distearoylglycamide, PEG-cholesterol (1-[8'-(cholesterol) 5-ene-3(beta)-oxy)carboxamido-3',6'-dioxaocta [Nyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DM B(3,4-ditetradecoxybenzyl-[omega]-methyl-poly(ethyleneglycol) 1,2-Dimyristoyl-sn-glycero-3-phosphoethanol Min-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMG) , 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[meth [Dextrin (polyethylene glycol)-2000] (PEG2k-DSPE) (Avanti Polar Lipids, Alabaster, Alabama, USA (Product Code: 880120C), 1,2-distearoyl-sn-glycerol, methoxypoly Ethylene glycol (PEG2k-DSG, GS-020, NOF Tokyo, Japan) an), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DM A), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(poly PEG-DSA) (PEG2k-DSA). In some embodiments, the PEG lipid may be PEG2k-DMG. In one embodiment, the PEG lipid may be PEG2k-DSG. The G lipid may be PEG2k-DSPE. In one embodiment, the PEG lipid is In one embodiment, the PEG lipid may be PEG2k-DMA. In one embodiment, the PEG lipid may be C-DMA. Even if the compound S027 is disclosed in 840 (paragraphs

[0240] to

[0244] ), In one embodiment, the PEG lipid may be PEG2k-DSA. In some embodiments, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. , the PEG lipid may be PEG2k-C18.

[0524] LNP formulation LNPs contain (i) amine lipids for encapsulation and endosomal escape and (ii) stabilization (iii) neutral lipids for stabilization, and (iv) sterol lipids. The neutral lipid may be omitted.

[0525] In some embodiments, the LNP composition comprises an RNA-guided DNA binding agent, a Cas nuclease, nuclease mRNA, class 2 Cas nuclease mRNA, Cas9 mRNA, and In some embodiments, the RNA component may include one or more of a gRNA and a nucleotide sequence. The LNP composition contains, as the RNA component, an mRNA encoding a class 2 Cas nuclease. In certain embodiments, the LNP composition comprises an RNA component and a gRNA. The specific LNP composition may include a phospholipid, a helper lipid, a neutral lipid, and a stealth lipid. In some compositions, the helper lipid is cholesterol. In other compositions, the helper lipid is a neutral lipid. In additional embodiments, the stealth lipid is PEG2k-DMG or DSPC. or PEG2k-C11. In certain embodiments, the LNP composition is lipid A or contains an equivalent of lipid A, a helper lipid, a neutral lipid, a stealth lipid, and a guide RNA. In certain compositions, the amine lipid is lipid A. In certain compositions, the amine lipid is lipid A. The main lipid is lipid A or its acetal analogue, and the helper lipid is cholesterol. where the neutral lipid is DSPC and the stealth lipid is PEG2k-DMG.

[0526] In certain embodiments, the lipid composition is determined according to the respective molar ratios of the component lipids in the formulation. The embodiments of the present disclosure are described as follows: In one embodiment, the mol% of the amine lipid is about 3 In one embodiment, the mol % of the amine lipid is In one embodiment, the molar ratio of the amine lipid is about 40 mol % to about 60 mol %. The 1% can be about 45 mol% to about 60 mol%. In one embodiment, the amine lipid The mol % of may be about 50 mol % to about 60 mol %. The mol % of the lipids may be about 55 mol % to about 60 mol %. In one embodiment, the mol % of the amine lipid may be about 50 mol % to about 55 mol %. In one embodiment, the mol % of the amine lipid may be about 50 mol %. In some embodiments, the mol% of LN lipids may be about 55 mol%. The amine lipid mol% of the P batch was ±30%, ±25%, ±20%, ± In some embodiments, L The amine lipid mol% of the NP batches was ±4 mol%, ±3 mol%, ± 2mol%, ±1.5mol%, ±1mol%, ±0.5mol%, or ±0.25m All mol% numbers are expressed as the lipid component fraction of the LNP composition. In certain embodiments, the amine lipid mol% variability between LNP lots is less than 15%. It may be less than 10%, or less than 5%.

[0527] In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, is about 5 mol% to In one embodiment, the m of a neutral lipid, e.g., a neutral phospholipid, In one embodiment, the mol% of the neutral lipid may be from about 7 mol% to about 12 mol%. For example, the mol% of neutral phospholipids can be from about 0 mol% to about 5 mol%. In this embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, is about 0 mol% to about 10 mol%. In one embodiment, the mol % of neutral lipids, e.g., neutral phospholipids, may be: In one embodiment, the neutral lipid, e.g., The mol % of the soluble phospholipids can be about 8 mol % to about 10 mol %.

[0528] In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, is about 5 mol%, Approximately 6mol%, approximately 7mol%, approximately 8mol%, approximately 9mol%, approximately 10mol%, approximately 11m mol%, about 12 mol%, about 13 mol%, about 14 mol%, or about 15 mol% In one embodiment, the mol % of neutral lipids, e.g., neutral phospholipids, is about 9 mol It can be 1%.

[0529] In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, is about 1 mol% to In one embodiment, the mol% of neutral lipids is about 0.1 mol In one embodiment, the amount of a neutral lipid, such as a neutral phospholipid, may be from about 1 mol % to about 1 mol %. Mol% is approximately 0.1 mol%, approximately 0.2 mol%, approximately 0.5 mol%, 1 mol%, approximately 1.5mol%, about 2mol%, about 2.5mol%, about 3mol%, about 3.5mol%, It can be about 4 mol%, about 4.5 mol%, or about 5 mol%.

[0530] In one embodiment, the mol % of neutral lipids, e.g., neutral phospholipids, is less than about 1 mol %. In one embodiment, the mol % of neutral lipids, e.g., neutral phospholipids, is about In one embodiment, the amount of a neutral lipid, e.g., a neutral phospholipid, is less than 0.5 mol %. The mol% of is approximately 0 mol%, approximately 0.1 mol%, approximately 0.2 mol%, approximately 0.3 mol% , about 0.4mol%, about 0.5mol%, about 0.6mol%, about 0.7mol%, about 0. In some embodiments, the amount of hydroxybenzoates may be about 8 mol %, about 0.9 mol %, or about 1 mol %. In this regard, the formulations disclosed herein do not contain neutral lipids (i.e., 0 mol% neutral lipids). In some embodiments, the formulations disclosed herein contain essentially neutral lipids. In some embodiments, the present invention is substantially free of neutral lipids (i.e., about 0 mol % neutral lipids). The formulations disclosed herein are neutral phospholipid-free (i.e., 0 mol % neutral phospholipids). In some embodiments, the formulations disclosed herein contain neutral phospholipids. Qualitatively free (i.e., approximately 0 mol % neutral phospholipids).

[0531] In some embodiments, the mol % of neutral lipids in the LNP batch is greater than or equal to the mol % of the target neutral lipid. ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2% of mol%. In certain embodiments, the lot-to-lot variability of the LNP is less than 15%, 10% or less. %, or even less than 5%.

[0532] In one embodiment, the mol% of the helper lipid is about 20 mol% to about 60 mol%. In one embodiment, the mol% of the helper lipid is about 25 mol% to about 55 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to In one embodiment, the mol % of the helper lipid is about 25 mol %. In one embodiment, the mol % of the helper lipid is In one embodiment, the molar ratio of the helper lipid is about 30 mol % to about 50 mol %. 1% may be about 30 mol% to about 40 mol%. The mol% of the lipids is determined by dividing the lipid components into amine lipids, neutral lipids, and In one embodiment, the mol of helper lipid is adjusted based on the concentration of the lipid and the PEG-lipid. The percentage is based on the concentration of amine lipid and PEG lipid so that the lipid component is 100 mol%. In one embodiment, the mol % of the helper lipid is adjusted based on the amount of the lipid component. The concentrations of the amine lipid and PEG lipid were adjusted so that both were 99 mol%. In some embodiments, the mol% of the helper in the LNP batch is greater than the mol% of the target ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the In certain embodiments, the lot-to-lot variability of the LNP is less than 15%, less than 10%, Or maybe less than 5%.

[0533] In one embodiment, the mol% of the PEG lipid is about 1 mol% to about 10 mol%. In one embodiment, the mol% of the PEG lipid is about 2 mol% to about 10 mol%. In one embodiment, the mol% of the PEG lipid is about 2 mol% to about 8 mol%. In one embodiment, the mol% of the PEG lipid may be from about 2 mol% to about 4 mol In one embodiment, the mol % of the PEG lipid may be from about 2.5 mol % to about 4 In one embodiment, the mol% of the PEG lipid is about 3 mol%. In one embodiment, the mol % of the PEG lipid may be about 2.5 mol %. In some embodiments, the mol% of the PEG lipid in the LNP batch is the target PEG lipid. ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2% of mol% In certain embodiments, the lot-to-lot variability of the LNP is less than 15%, 1.5%. It will be less than 0% or less than 5%.

[0534] In certain embodiments, the cargo is an RNA-guided DNA-binding agent (e.g., a Cas nucleic acid). a nucleic acid encoding a Cas nuclease (Cas nuclease, Class 2 Cas nuclease, or Cas9), and gRNA or nucleic acid encoding gRNA, or a combination of mRNA and gRNA In one embodiment, the LNP composition can include lipid A or its equivalent. In some embodiments, the amine lipid is lipid A. The amine lipid is a lipid A equivalent, e.g., an analog of lipid A. In certain embodiments, the amine lipid The lipid is an acetal analog of lipid A. In various embodiments, the LNP composition comprises an acetal analog of lipid A. In certain embodiments, the lipid composition includes a methyl lipid, a neutral lipid, a helper lipid, and a PEG-lipid. In certain embodiments, the helper lipid is cholesterol. In a particular embodiment, the PEG lipid is PEG2k-DMG. In some embodiments, the LNP composition comprises lipid A, a helper lipid, a neutral lipid, and In some embodiments, the LNP composition may comprise an amine lipid and a PEG lipid. , DSPC, cholesterol, and PEG lipids. The LNP composition comprises a PEG lipid comprising DMG. In certain embodiments, the amine lipid is selected from lipid A, equivalents of lipid A, including acetal analogs of lipid A. In an embodiment, the LNP composition comprises lipid A, cholesterol, DSPC, and PEG2 Includes k-DMG.

[0535] In various embodiments, the LNP composition comprises an amine lipid, a helper lipid, and a neutral lipid. and a PEG-lipid. In various embodiments, the LNP composition comprises an amine lipid and a PEG-lipid. In various embodiments, the LNP comprises a luper lipid, a neutral phospholipid, and a PEG-lipid. The composition comprises a lipid component consisting of an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In various embodiments, the LNP composition comprises an amine lipid, a helper lipid, and a PE In certain embodiments, the LNP composition comprises a neutral lipid, such as a neutral phospholipid. In various embodiments, the LNP composition is free of amine lipids, helper lipids, and a lipid component consisting of a PEG-lipid. In certain embodiments, the neutral lipid is a DS One of PC, DPPC, DAPC, DMPC, DOPC, DOPE, and DSPE In certain embodiments, the neutral lipid is selected from one or more of: In embodiments, the neutral lipid is DPPC. In certain embodiments, the neutral lipid is In certain embodiments, the neutral lipid is DMPC. In certain embodiments, the neutral lipid is DOPC. In certain embodiments, the neutral lipid is DSPE. In some embodiments, the helper lipid is cholesterol. The G lipid is PEG2k-DMG. In some embodiments, the LNP composition comprises: It may comprise lipid A, a helper lipid, and a PEG lipid. The NP composition can include a lipid component consisting of lipid A, a helper lipid, and a PEG lipid. In some embodiments, the LNP composition comprises an amine lipid, cholesterol, and PE. In some embodiments, the LNP composition comprises an amine lipid, a cholesterol lipid, and a GI lipid. In some embodiments, the lipid component comprises a PEG-lipid. The P composition comprises a PEG lipid comprising DMG. In certain embodiments, the amine lipid is Selected from lipid A and equivalents of lipid A, including acetal analogs of lipid A. In embodiments, the amine lipid is a C5-C12 or C4-C12 acetal of lipid A. In additional embodiments, the LNP composition comprises lipid A, cholesterol, and , PEG2k-DMG and

[0536] Embodiments of the present disclosure also provide a method for encapsulating nucleic acids by isolating the positively charged amine groups (N) of the amine lipids of the nucleic acids to be encapsulated. and a negatively charged phosphate group (P), This may be expressed mathematically by the formula N / P. In some embodiments, L The NP composition comprises lipid components including amine lipids, helper lipids, neutral lipids, and PEG lipids. and a nucleic acid component, and the N / P ratio is about 3 to 10. In some embodiments, the LNP composition comprises a lipid composition comprising an amine lipid, a helper lipid, and a PEG lipid. The nucleic acid component may contain a nucleic acid component and a nucleic acid component, and the N / P ratio is about 3 to 10. In embodiments, the LNP composition comprises an amine lipid, a helper lipid, a neutral lipid, and a helper lipid. The lipid component may contain a lipid, and an RNA component, and the N / P ratio is about 3 to 10. In some embodiments, the LNP composition comprises an amine lipid, a helper lipid, and and a lipid component containing PEG-lipids, and an RNA component, and the N / P ratio is about 3 to 100%. In one embodiment, the N / P ratio may be about 5 to 7. In this case, the N / P ratio may be about 3 to 7. In one embodiment, the N / P ratio is about 4 In one embodiment, the N / P ratio may be about 6. In an embodiment, the N / P ratio may be 6±1. In one embodiment, the N / P ratio is , 6±0.5. In some embodiments, the N / P ratio is greater than the target N / P ratio ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the In certain embodiments, the lot-to-lot variability of the LNP is less than 15%, less than 10%, Or maybe less than 5%.

[0537] In some embodiments, the RNA component is a nucleic acid, such as a nucleic acid disclosed herein. an acid, such as a Cas nuclease described herein (e.g., a Cas9 nuclease described herein) The nucleic acid encoding the gene may include a nucleic acid encoding the gene (e.g., mRNA) and a gRNA as described herein. In embodiments, the RNA component comprises a Cas nuclease mRNA as described herein and and a gRNA as described herein. In some embodiments, the RNA component comprises a The Class 2 Cas nuclease mRNA described in the specification and the gRNA described herein are used to In any of the foregoing embodiments, the gRNA is an sgRNA described herein, For example, it may be a chemically modified sgRNA as described herein.

[0538] In certain embodiments, the LNP composition comprises an RNA component as described above, an amine lipid, and a helical lipid. In certain LNP compositions, the lipids may include perlipids, neutral lipids, and PEG-lipids. The perlipid is cholesterol and the neutral lipid is DSPC and / or PEG The lipid is PEG2k-DMG or PEG2k-C11. The amine lipid is selected from lipid A and its equivalents, e.g., acetal analogs of lipid A. In one embodiment, the lipid components of the LNP composition comprise an amine lipid, a helper lipid, a neutral lipid, and a hydroxyl group. In one embodiment, the lipid component of the LNP composition consists of: It consists of an amine lipid, a helper lipid, and a PEG lipid. In certain compositions containing mRNA and gRNA, the helper lipid acts as a cholesterol Several combinations containing mRNA and gRNA encoding Cas nucleases are In the composition, the neutral lipid is DSPC. and a gRNA, the composition may contain less than about 1 mol% neutral lipid, e.g., a neutral phospholipid. Specific compositions comprising mRNA and gRNA encoding Cas nucleases. contains less than about 0.5 mol % neutral lipids, e.g., neutral phospholipids. Therefore, LNPs do not contain neutral lipids, e.g., neutral phospholipids. In additional embodiments comprising an mRNA and gRNA encoding the mRNA, the PEG lipid is PEG2 In certain embodiments, the amine lipid is: k-DMG or PEG2k-C11. It is selected from lipid A and its equivalents, such as acetal analogs of lipid A.

[0539] In certain embodiments, the LNP composition comprises a Cas nuclease mRNA described herein. NA (e.g., Class 2 Cas mRNA) and at least one gR as described herein. In certain embodiments, the LNP composition comprises a gRNA and a Cas nucleus. The ratio of the mRNA to the Class 2 Cas nuclease mRNA (e.g., Class 2 Cas nuclease mRNA) is about 25:1 to about 1 In certain embodiments, the LNP formulation comprises a gRNA and a Cas nuclease. mRNA (e.g., class 2 Cas nuclease mRNA) at a ratio of about 10:1 to about 1: 10. In certain embodiments, the LNP formulation comprises a gRNA and a Cas nuclease m RNA (e.g., class 2 Cas nuclease mRNA) at a ratio of about 8:1 to about 1:8. As measured herein, ratios are by weight. In some embodiments, , LNP formulations contain gRNA and Cas nuclease mRNA (e.g., class 2 Cas mRNA). In some embodiments, the ratio of the α- and β-actin-containing polymerase (RNA) to the α- and β-actin-containing polymerase (RNA) is about 5:1 to about 1:5. In some embodiments, the ratio ranges from , about 3:1~1:3, about 2:1~1:2, about 5:1~1:2, about 5:1~1:1, about 3: 1 to 1:2, about 3:1 to 1:1, about 3:1, about 2:1 to 1:1. In some embodiments, the ratio of gRNA to mRNA is about 3:1 or about 2:1. In embodiments, a gRNA and a Cas nuclease mRNA (e.g., a Class 2 Cas nuclease) The ratio of urease to urease is about 1:1. The ratios are about 25:1, 10:1, 5:1, 3:1 , 1:1, 1:3, 1:5, 1:10, or 1:25.

[0540] In some embodiments, LNPs are prepared by combining an aqueous solution of RNA with an organic solvent-based lipid solution (e.g., , 100% ethanol). A suitable solution or solvent is , water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform , diethyl ether, cyclohexane, tetrahydrofuran, methanol, isopropanol For example, for in vivo administration of LNPs, A pharmaceutically acceptable buffer may be used. In certain embodiments, the buffer is LN It is used to maintain the pH of compositions containing P at or above pH 6.5. In the present invention, a buffer is used to maintain the pH of the composition containing the LNP at pH 7.0 or higher. In certain embodiments, the composition has a pH in the range of about 7.2 to about 7.7. In additional embodiments, the composition has a pH in the range of about 7.3 to about 7.7, or about 7.4 to about 7.7. In a further embodiment, the composition has a pH in the range of about 7.2, 7.6, 7.7, 7.8, 7.9, 7.10, 7.11, 7.12, 7.13, 7.14, 7.15, 7.16, 7.17, 7.18, 7.19, 7.20, 7.21, 7.22, 7.23, 7. The pH of the composition is 7.3, 7.4, 7.5, 7.6, or 7.7. The pH may be measured with a pH probe. In certain embodiments, a cryoprotectant is included in the composition. Non-limiting examples of cryoprotectants include sucrose, trehalose, and glycerol. , DMSO, and ethylene glycol. In certain embodiments, the LNP composition may contain up to 10% of a cryoprotectant such as lysine. The product may contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% cryoprotectant. In certain embodiments, the LNP composition comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9 , or 10% sucrose. In some embodiments, the LNP composition The composition may include a buffer. In some embodiments, the buffer is a phosphate buffer ( PBS), Tris buffer, citrate buffer, and mixtures thereof. In certain exemplary embodiments, the buffer comprises NaCl. NaCl is omitted. Exemplary amounts of NaCl range from about 20 mM to about 45 mM. An exemplary amount of NaCl may range from about 40 mM to about 50 mM. In some embodiments, the amount of NaCl is about 45 mM. In the present invention, the buffer is a Tris buffer. An exemplary amount of Tris is about 20 mM to about 60 mM. Exemplary amounts of Tris range from about 40 mM to about 60 mM. In some embodiments, the amount of Tris is about 50 mM. In some embodiments, the buffer comprises NaCl and Tris. Certain exemplary embodiments are 5% sucrose and 45 mM NaCl in Tris buffer. In another exemplary embodiment, the composition contains sucrose in an amount of about 5% w / v. The buffer solution contains about 45 mM NaCl and about 50 mM Tris at pH 7.5. The amount of buffer and cryoprotectant may be varied to maintain osmolality throughout the formulation. For example, the final osmolality may be maintained below 450 mOsm / L. In some embodiments, the osmolality is 350 to 250 mOsm / L. with a final osmolality of ±20 mOsm / L.

[0541] In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain embodiments, the flow rate, the size of the junction, the geometry of the junction, the shape of the junction, the pipe The diameter of the LNP, the solution, and / or the concentration of RNA and lipids may be varied. The LNP composition can be purified by, for example, dialysis, tangential flow filtration, or chromatography. LNPs may be concentrated or purified through, for example, suspensions, emulsions, or In some embodiments, the LNP compositions may be stored as a lyophilized powder. In certain embodiments, the LNP compositions are stored at room temperature. In embodiments, the LNP compositions are stored frozen, for example, at −20° C. or −80° C. In this embodiment, the LNP composition is stored at a temperature ranging from about 0°C to about -80°C. Frozen LNP compositions may be thawed, for example, on ice, at room temperature, or at 25° C., prior to use. .

[0542] LNPs are, for example, microspheres (unilamellar and multilamellar vesicles, e.g., in some implementations It is substantially spherical in shape and, in more particular embodiments, may contain an aqueous core. "Liposome" means a membrane comprising a lamellar lipid bilayer and containing, for example, a substantial portion of an RNA molecule. , the dispersed phase in an emulsion, micelles, or the internal phase in a suspension.

[0543] Furthermore, LNP compositions accumulate to cytotoxic levels in vivo at therapeutically effective doses. In some embodiments, the LNP compositions are biodegradable in that they do not accumulate. They do not induce innate immune responses that result in substantial adverse effects at therapeutic dose levels. In embodiments, the LNP compositions provided herein induce toxicity at therapeutic dose levels. Don't wake him up.

[0544] In some embodiments, pdi may range from about 0.005 to about 0.75. In some embodiments, pdi may range from about 0.01 to about 0.5. In some embodiments, pdi may range from about 0 to about 0.4. In some embodiments, pdi may range from about 0 to about 0.35. In some embodiments, pdi may range from about 0 to about 0.35. In some embodiments, pdi may range from about 0 to about 0.3. In some embodiments, the pdi may range from about 0 to about 0.25. In some embodiments, pdi may range from about 0 to about 0.2. Thus, the pdi may be less than about 0.08, 0.1, 0.15, 0.2, or 0.4. stomach.

[0545] The LNPs disclosed herein have a size (e.g., Z-average diameter) of about 1 to about 250 nm. In some embodiments, the LNPs are about 10 to about 200 nm in size. In a further embodiment, the LNPs are about 20 to about 150 nm in size. In some embodiments, the LNPs are about 50 to about 150 nm in size. In some embodiments, the LNPs are about 50 to about 100 nm in size. In some embodiments, the LNPs are about 50 to about 120 nm in size. In some embodiments, the LNPs are about 60 to about 100 nm in size. The NPs are about 75 to about 150 nm in size. In some embodiments, the LNPs are In some embodiments, the LNPs have a size of about 75 to about 120 nm. Unless otherwise indicated, all references herein to The size of the particles was measured by dynamic light scattering on a Malvern Zetasizer. The nanoparticle samples were counted. Dilute with phosphate buffered saline (PBS) to a concentration of approximately 200-400 kcp. Data are presented as a weighted average of the intensity measurements (Z-average diameter).

[0546] In some embodiments, the LNPs have an average encapsulation efficiency ranging from about 50% to about 100%. In some embodiments, the LNPs have an average solubility in the range of about 50% to about 70%. In some embodiments, the LNPs are formed with an average encapsulation efficiency of about 70% to about 90%. In some embodiments, the LNPs are formed with an average encapsulation efficiency in the range of about 90%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from about 100% to about 100%. are formed with an average encapsulation efficiency ranging from about 75% to about 95%.

[0547] In some embodiments, the LNPs have a pH of from about 1.00E+05 g / mol to about 1.00 In some embodiments, L is formed with an average molecular weight in the range of E+10 g / mol. NP has an average molecular weight ranging from about 5.00E+05 g / mol to about 7.00E+07 g / mol. In some embodiments, the LNPs are formed at a molecular weight of about 1.00E+06 g / m They are formed with average molecular weights ranging from 0.1 to about 1.00E+10 g / mol. In the form of LNP, the LNP has a molecular weight of about 1.00E+07 g / mol to about 1.00E+09 g / mol. In some embodiments, the LNPs are formed with an average molecular weight in the range of about 5.0 Formed with average molecular weights ranging from 0E+06 g / mol to approximately 5.00E+09 g / mol .

[0548] In some embodiments, the polydispersity (Mw / Mn, the logarithm of the weight average molar mass (Mw) The ratio of the average molar mass (Mn) may be in the range of about 1.000 to about 2.000. In some embodiments, Mw / Mn may range from about 1.00 to about 1.500. In some embodiments, Mw / Mn is in the range of about 1.020 to about 1.400. In some embodiments, Mw / Mn may be from about 1.010 to about 1.1 In some embodiments, the Mw / Mn may range from about 1.100 may be in the range of about 1.350.

[0549] To characterize the polydispersity index (“pdi”) and size of the LNPs of the present disclosure, dynamic DLS can be used to measure the amount of light that is emitted as a result of subjecting a sample to a light source. The PDI determined from DLS measurements is the particle size (average particle size) within the aggregate. The PDI represents the distribution of particles (near the average particle size), and a completely uniform aggregate has a PDI of zero. In some embodiments, the pdi may be in the range of 0.005 to 0.75. In some embodiments, the pdi may be in the range of 0.01 to 0.5. In some embodiments, pdi may be in the range of 0.02 to 0.4. In some embodiments, pdi may be in the range of 0.03 to 0.35. The pdi may be in the range of 0.1 to 0.35.

[0550] In some embodiments, the LNPs disclosed herein range in size from 1 to 250 nM. In some embodiments, the LNPs are 10-200 nm in size. In a further embodiment, the LNPs are 20-150 nm in size. In some embodiments, the LNPs are 50-150 nm in size. In some embodiments, the LNPs are 50-100 nm in size. In some embodiments, the LNPs are 50-120 nm in size. In some embodiments, the LNPs have a size of 30 to 150 nm. 200 nm. Unless otherwise indicated, all sizes referred to herein are in Perfectly formed as measured by dynamic light scattering on a Alvern Zetasizer The average size (diameter) of the nanoparticles formed was approximately 2. The data are diluted with phosphate buffered saline (PBS) to a concentration of 0.00 to 400 kcal. The data is presented as a weighted average of the intensity measurements. In some embodiments, the LNP , with an average encapsulation efficiency ranging from 50% to 100%. LNPs are formed with an average encapsulation efficiency ranging from 50% to 70%. In some embodiments, LNPs are formed with an average encapsulation efficiency in the range of 70% to 90%. In this state, LNPs are formed with average encapsulation efficiencies ranging from 90% to 100%. In this embodiment, LNPs are formed with an average encapsulation efficiency ranging from 75% to 95%.

[0551] In some embodiments, the gRNAs disclosed herein and the A nuclear gene encoding an RNA-guided DNA binder (e.g., Cas9, Spy Cas9) The LNPs associated with an acid (e.g., mRNA) can be used in the preparation of a medicament for treating ATTR. In some embodiments, the g disclosed herein is for use in RNA and the RNA-guided DNA binding agents disclosed herein (e.g., Cas9, Sp The LNP associated with a nucleic acid (e.g., mRNA) encoding the ATTR (Cas9) Accumulation and aggregation of TTR in amyloid or amyloid fibrils in subjects with for use in the preparation of a medicament for reducing or preventing infection. In some embodiments, the gRNA disclosed herein and the RNA disclosed herein A nucleic acid (e.g., For example, LNPs associated with TTR mRNA can be used in the preparation of a medicament for reducing serum TTR concentrations. In some embodiments, the gR disclosed herein is for use in NA and the RNA-guided DNA binding agents disclosed herein (e.g., Cas9, Spy The LNPs associated with nucleic acids (e.g., mRNA) encoding the target gene (e.g., Cas9) are then delivered to a target, e.g., for use in treating ATTR in a mammal, e.g., a primate, such as a human. In some embodiments, the gRNAs disclosed herein and The RNA-guided DNA binding agents (e.g., Cas9, Spy Cas9) disclosed in the document are used as codons. The LNP associated with the nucleic acid (e.g., mRNA) that encodes the ATTR is then delivered to a subject, e.g., , amyloid or amyloid fibrils in mammals, e.g., primates such as humans. The compound is for use in reducing or preventing the accumulation and aggregation of TTR in patients with rheumatoid arthritis. In some embodiments, the gRNAs disclosed herein and the Nucleic acids encoding RNA-guided DNA-binding agents (e.g., Cas9, Spy Cas9) The LNP associated with the mRNA (e.g., mRNA) is delivered to a subject, e.g., a mammal, e.g., a human. The compound is for use in reducing serum TTR concentrations in non-human primates.

[0552] Electroporation is also a well-known means for delivery of cargo and is disclosed herein. Any electroporation method can be used for delivery of any one of the gRNAs used. In some embodiments, electroporation can be used to , gRNAs and RNA-guided DNA nucleases such as Cas9 as disclosed herein or any of the nucleic acids encoding an RNA-g...

Claims

1. 1. A composition comprising: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA-binding agent And, a. the open reading frame has at least 93% identity with SEQ ID NO:311 and / or b. The open reading frame is a sequence of at least the first 50, 200, 2 At least 93% identical to SEQ ID NO:311 over 50 or 300 nucleotides. or at least the first 30, 50, 70, 100, 150, 20 311 and at least 95% over 0, 250, or 300 nucleotides % identity to the sequence c. The open reading frame has at least 95%, 96%, 97%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 7%, 98%, 99%, 99.5%, or 100% of the codons are listed in Table 4; or a low A / U set of Table 5, Iwa d. The open reading frame has an adenine content of at least its minimum adenine content. and / or e. The open reading frame has an adenine dinucleotide content of Minimum adenine dinucleotide content - 150% of the minimum adenine dinucleotide content and a nucleic acid, (ii) a guide RNA or a vector encoding a guide RNA, The RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. A composition comprising a guide RNA or a vector encoding a guide RNA, comprising the guide RNA or a vector encoding a guide RNA.

2. Modifying the TTR gene and / or inducing a double strand break (DSB) in the TTR gene 20. A method of inducing a cell comprising delivering a composition to a cell, the composition comprising: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA-binding agent And, a. the open reading frame has at least 93% identity with SEQ ID NO:311 and / or b. The open reading frame is a sequence of at least the first 50, 200, 2 At least 93% identical to SEQ ID NO:311 over 50 or 300 nucleotides. or at least the first 30, 50, 70, 100, 150, 20 311 and at least 95% over 0, 250, or 300 nucleotides % identity to the sequence c. The open reading frame has at least 95%, 96%, 97%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 7%, 98%, 99%, 99.5%, or 100% of the codons are listed in Table 4; or a low A / U set of Table 5, and / or Iwa d. The open reading frame has an adenine content of at least its minimum adenine content. and / or e. The open reading frame has an adenine dinucleotide content of Minimum adenine dinucleotide content - 150% of the minimum adenine dinucleotide content and a nucleic acid, (ii) a guide RNA or a vector encoding a guide RNA, The RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. and a guide RNA or a vector encoding the guide RNA, comprising the above.

3. The present invention relates to a method for reducing TTR serum concentrations in a subject, and for treating TTR-associated amyloidosis (ATTR). ) and / or reduce accumulation of amyloid or amyloid fibrils comprising TTR. A method for reducing or preventing a disease comprising administering a composition to a subject in need thereof. , wherein the composition comprises (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA-binding agent And, a. the open reading frame has at least 95% identity with SEQ ID NO:311 and / or b. The open reading frame is at least the first 30, 50, 70, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1500, 1000, 1500, 2500, 3500, 4500, 5000, 6000, 7000, 8000, 9000, 10000, 15 ... , 100, 150, 200, 250, or 300 nucleotides. and / or has at least 95% identity to 311; c. The open reading frame has at least 95%, 96%, 97%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560 7%, 98%, 99%, 99.5%, or 100% of the codons are listed in Table 4; or a low A / U set of Table 5, Iwa d. The open reading frame has an adenine content of at least its minimum adenine content. and / or e. The open reading frame has an adenine dinucleotide content of Minimum adenine dinucleotide content - 150% of the minimum adenine dinucleotide content and a nucleic acid, (ii) a guide RNA or a vector encoding a guide RNA, The RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. and a guide RNA or a vector encoding the guide RNA, Thus, the present invention provides a method for reducing TTR serum concentration in a subject, and preventing TTR-associated amyloidosis ( ATTR) and / or inhibiting amyloid or amyloid fibrils containing TTR. A method for reducing or preventing accumulation.

4. The guide RNA is selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, １７、２２、２３、２７、２９、３０、３５、３６、３７、３８、５５、６１、６３、６ Any of claims 1 to 3, comprising a guide sequence selected from 5, 66, 68, or 69.

2. The composition or method according to claim 1.

5. Inducing a double strand break (DSB) in the TTR gene in a cell or subject, Alternatively, the TTR gene may be modified in a subject, and amyloid associated with TTR may be expressed in the subject. To treat ATTR idiopathies, to reduce TTR serum concentrations in a subject, or to For use in reducing or preventing accumulation of amyloid or amyloid fibrils in The composition according to claim 1 or 4.

6. The method may be performed for more than 30 minutes, for example, for about 45-75 minutes, 75-105 minutes, 10 5-135 minutes, 135-165 minutes, 165-195 minutes, 195-225 minutes, 22 5-255 minutes, 255-285 minutes, 285-315 minutes, 315-345 minutes, 34 5 to 375 minutes, about 1.5 to 6 hours, about 60 minutes, about 90 minutes, about 120 minutes, about 150 administering the composition by infusion for about 180 minutes, about 240 minutes, or about 30 minutes. A composition or method for use according to any one of claims 2 to 5.

7. The composition reduces, for example, at least 50%, or a serum TTR level before administration of the composition Compared to 50-60%, 60-70%, 70-80%, 80-90%, 90-95% , 95-98%, 98-99%, or 99-100% reduction in serum TTR levels A composition for the method or use according to any one of claims 2 to 6.

8. The composition causes editing of the TTR gene, and optionally, the editing comprises The percentage of the collection that is edited (the edit percentage), and optionally The edit percentage is 30-99% of the collection, for example 30-35% of the collection. 、３５～４０％、４０～４５％、４５～５０％、５０～５５％、５５～６０％、６０～６ ５％、６５～７０％、７０～７５％、７５～８０％、８０～８５％、８５～９０％、９０ 8. The method according to claim 2, wherein the solubility of the cellulose in the cellulose membrane is 95% or less, or 95% or less, or 99% or less. Composition for use.

9. wherein the composition reduces amyloid deposition in at least one tissue, and optionally The at least one tissue is one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion. A composition for the method or use according to any one of claims 2 to 8 comprising:

10. 10. The method of claim 9, wherein amyloid deposition is measured 8 weeks after administration of the composition. or a composition for use.

11. amyloid deposits are 30-35% of the amyloid deposits seen before administration of the composition, ５～４０％、４０～４５％、４５～５０％、５０～５５％、５５～６０％、６０～６５％ 、６５～７０％、７０～７５％、７５～８０％、８０～８５％、８５～９０％、９０～９ 5%, or 95-99% reduction, for the method or use according to claim 9 or 10 Composition of.

12. Any one of claims 2 to 11, wherein the composition is administered or delivered at least twice. A composition for the method or use described in.

13. The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 1 At intervals of 3, 14, or 15 days, or at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 At intervals of 0, 11, 12, 13, 14, or 15 weeks, or at intervals of 1, 2, 3, 4, 5, Taken at intervals of 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months 13. A composition for the method or use according to claim 12.

14. The guide RNA comprises the guide sequence and has the nucleotide sequence of SEQ ID NO:

126. wherein the nucleotide of SEQ ID NO: 126 further comprises the guide sequence 14. The method or composition of any one of claims 1 to 13, wherein the nucleotide sequence is followed at its 3' end by:

15. Any of claims 1 to 14, wherein the guide RNA is a single guide RNA (sgRNA).

2. The method or composition according to claim 1 .

16. The method of claim 15, wherein the sgRNA comprises a guide sequence having the pattern of SEQ ID NO:

3. The method or composition described above.

17. 17. The method of claim 15 or 16, wherein the sgRNA comprises the sequence of SEQ ID NO:

3. is a composition.

18. The sgRNA comprises the guide sequence of SEQ ID NOs: 5-72, 74-78, and 80-82. 1, comprising any one of the nucleotides of SEQ ID NO: 126, 18. The method or composition of any one of 5 to 17.

19. The sgRNA is selected from SEQ ID NOs: 87-113, 115-120, and 122-124. and at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 18. Any of claims 15 to 17, comprising a sequence that is 92%, 91% or 90% identical to the sequence of claim 15.

2. The method or composition according to claim 1.

20. The sgRNA is selected from SEQ ID NOs: 87-113, 115-120, and 122-124.

20. The method or composition of claim 19, comprising a sequence selected from:

21. The method according to any one of claims 1 to 20, wherein the guide RNA comprises at least one modification. The method or composition described.

22. The at least one modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. , phosphorothioate (PS) internucleotide linkage, or 2'-fluoro (2'-F) 22. The method or composition of claim 21 comprising modified nucleotides.

23. The at least one modification is at least one of the first five nucleotides at the 5' end. at one or more of the last five nucleotides at the 3' end and / or at one or more of the last five nucleotides at the 3' end 23. The method or composition of claim 21 or 22, comprising a modification in

24. The at least one modification is between the first four nucleotides and / or the last four nucleotides. The method according to any one of claims 21 to 23, further comprising a PS bond between nucleotides of is a composition.

25. The at least one modification is a 2-nucleotide sequence in the first three nucleotides at the 5' end. '-O-Me modified nucleotide and / or the last three nucleotides at the 3' end 25. The method according to claim 21, further comprising the step of: The method or composition described.

26. The method according to any one of claims 21 to 25, wherein the guide RNA comprises modified nucleotides of SEQ ID NO:

3. The method or composition according to any one of claims 1 to 5.

27. An open reading frame encoding the guide RNA and the RNA-guided DNA binding agent The nucleic acid comprising the frame is associated with a lipid nanoparticle (LNP) according to claims 1 to 26.

2. The method or composition according to any one of claims 1 to 11.

28. The LNPs comprise a CCD lipid, and optionally the CCD lipid is lipid A or lipid 28. The method of claim 27, wherein the CCD lipid is lipid A. Method or composition.

29. The LNPs include a helper lipid, and optionally, the helper lipid is a cholesterol lipid.

29. The method or composition of claim 27 or 28,

30. The LNPs include a stealth lipid (e.g., a PEG lipid), and optionally, the stealth lipid The method according to any one of claims 27 to 29, wherein the lipid is PEG2k-DMG. Or compositions.

31. (i) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid Amine lipid such as A, about 8-10 mol% neutral lipid, and about 2.5-4 mol% stearyl lipid. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. the N / P ratio of the LNP composition is about 6; (ii) the LNPs comprise about 50-60 mol % of an amine lipid, such as lipid A, and about 27-3 9.5 mol % of helper lipid, about 8-10 mol % of neutral lipid, and about 2.5-4 mol % of and l% stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP composition is about 5 to 7 (e.g., about 6); (iii) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid amine lipid such as Substance A, about 5-15 mol % neutral lipid, and about 2.5-4 mol % s and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. and the N / P ratio of the LNP composition is about 3 to 10; (iv) the LNP comprises a lipid component, the lipid component being about 40-60 mol % lipid Amine lipid such as A, about 5-15 mol % neutral lipid, and about 2.5-4 mol % stearyl lipid. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. the N / P ratio of the LNP composition is about 6; (v) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid A amine lipids such as 5 to 15 mol % neutral lipids and about 1.5 to 10 mol % stearyl lipids. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. the N / P ratio of the LNP composition is about 6; (vi) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % lipid Amine lipid such as A, about 0-10 mol % neutral lipid, and about 1.5-10 mol % of S and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. and the N / P ratio of the LNP composition is about 3 to 10; (vii) the LNP comprises a lipid component, the lipid component being about 40-60 mol % lipid amine lipids such as Substance A, less than about 1 mol % neutral lipids, and about 1.5-10 mol % s and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. and the N / P ratio of the LNP composition is about 3 to 10; (viii) the LNP comprises a lipid component, and the lipid component comprises about 40-60 mol % An amine lipid such as lipid A and about 1.5 to 10 mol % of a stealth lipid (e.g., PEG lipid The remainder of the lipid component is a helper lipid, and the N / P of the LNP composition The ratio is about 3 to 10, and the LNP composition is essentially free of neutral phospholipids; and does not include, or (ix) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid Amine lipid such as A, about 8-10 mol% neutral lipid, and about 2.5-4 mol% stearyl lipid. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. The method according to any one of claims 27 to 30, wherein the N / P ratio of the LNP composition is about 3 to 7. The method or composition described above.

32. The method according to any one of claims 26 to 31, wherein the LNP has an N / P ratio of about 6. Method or composition.

33. The LNPs comprise a neutral lipid, and optionally, the neutral lipid is DSPC.

33. The method or composition according to any one of claims 26 to 32.

34. The LNP comprises a lipid component, the lipid component being about 50 mol % of an amine such as lipid A. % of a carboxylic acid lipid, about 9 mol % of a neutral lipid such as DSPC, and about 3 mol % of a PEG lipid. and a stealth lipid (e.g., PEG2k-DMG), with the remainder of the lipid component being a collagen. and the N / P ratio of the LNP composition is about 6.

33. The method or composition of any one of paragraphs 32.

35. The LNP comprises a lipid component, the lipid component being about 50 mol % of lipid A and about 9 m % DSPC and about 3 mol % PEG2k-DMG, the remainder of the lipid component being is cholesterol, and the N / P ratio of the LNP composition is about 6.

2. The method or composition according to any one of claims 1 to 11.

36. The method according to any one of claims 1 to 35, wherein the RNA-guided DNA binding agent is Cas cleavase.

2. The method or composition according to claim 1 .

37. 37. The method or composition of claim 36, wherein the RNA-guided DNA binding agent is Cas9. Composition.

38. The RNA-guided DNA binding agent is modified, and optionally the modified RNA Any of claims 1 to 37, wherein the guide DNA binding agent comprises a nuclear localization signal (NLS).

2. The method or composition according to claim 1.

39. The RNA-guided DNA binding agent is a Cas derived from a type II CRISPR / Cas system.

39. The method or composition of any one of claims 1 to 38.

40. The composition according to claim 1, wherein the composition is a pharmaceutical formulation and further comprises a pharma- ceutically acceptable carrier.

39. The method or composition of any one of claims 39 to 40.

41. Non-homologous end joining (NHEJ) results in a frameshift or null mutation in the TTR gene. causing a mutation during repair of a DSB in the TTR gene that induces a sense mutation; 41. A composition for the method or use according to claim 40.

42. A frameshift or nonsense mutation is present in the TTR gene in at least 50% of liver cells.

42. The method or composition for use according to claim 41, which is induced in a gene.

43. Nucleotide deletions or insertions are located at off-target sites in the TTR gene.

43. The method or use according to claim 41 or 42, wherein the amount of the β-glucosamine produced is at least 50 times greater than in the case of Composition for use.

44. The sequence of the guide RNA is a) SEQ ID NO: 92 or 104, b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112, or d) SEQ ID NOs: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108, Or 109, Optionally, the guide RNA is located within a protein coding region in the genome of the primary human hepatocyte. Any one of claims 1 to 43, wherein the method does not generate indels at off-target sites occurring in 20. The method or composition according to claim 19 .

45. 2. The method of claim 1, wherein administering the composition reduces the level of TTR in the subject.

45. A composition for the method or use according to any one of claims 1 to 44.

46. The subject has ATTR, such as ATTRwt or inherited ATTR.

45. A composition for the method or use according to any one of claims 45.

47. The method or use according to any one of claims 2 to 46, wherein the subject is a human. Composition for.

48. The subject has familial amyloidotic polyneuropathy, ATTR neurological symptoms only, or Predominantly neurological symptoms of ATTR, familial amyloid cardiomyopathy, or cardiac symptoms of ATTR alone, or The method according to any one of claims 2 to 47, wherein the patient has cardiac symptoms of ATTR or predominantly ATTR. is a composition for use.

49. The subject has a V30 mutation, such as V30A, V30G, V30L, or V30M. and the subject expresses a TTR having a T60 mutation, such as T60A; The subject has a V122 mutation, such as V122A, V122I, or V122(-). or the subject expresses wild-type TTR. A composition for use according to any one of the methods or uses.

50. the subject experiences improvement or stabilization of symptoms of sensorimotor neuropathy after administration; or the changes are slowed and / or the subject experiences improvement and stabilization of symptoms of congestive heart failure; or the change is slowed down for the method or use according to any one of claims 2 to 49 Composition of.

51. The composition or pharmaceutical preparation is administered via a viral vector, claims 2 to 5.

13. A composition for the method or use according to any one of claims 0 to 12.

52. The composition or pharmaceutical formulation according to any one of claims 2 to 50, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles. A composition for the method or use according to any one of the claims.

53. A sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 is SEQ ID NO: 5 、６、９、１３、１４、１５、１６、１７、２２、２３、２７、３０、３５、３６、３７ , 38, 55, 63, 65, 66, 68, or 69.

20. The method or composition according to claim 19 .

54. the open reading frame has at least 94%, 95%, or Sequences with 96%, 97%, 98%, 99%, 99.5% or 100% identity 54. The composition or method of any one of claims 1 to 53, comprising

55. At least 95%, 96%, 97% of said codons of said open reading frame , 98%, 99%, 99.5%, or 100% are listed in Table 4, Table 5, or Table 7.

55. The composition or method of any one of claims 1 to 54, wherein the codon is

56. the open reading frame has at least 95%, 96%, or 97%, 98%, 99%, 99.5% or 100% identity.

56. The composition or method of any one of claims 1 to 55.

57. The nucleic acid is an mRNA in which at least 10% of the uridines are replaced with modified uridines. The composition or method of any one of claims 1 to 56.

58. The modified uridine may be N1-methyl-pseudouridine, pseudouridine, 5-methyl 58. The compound according to claim 57, which is one or more of 5-iodouridine, xylidine, or 5-iodouridine. Composition or method.

59. A method for preparing a medicament for treating a human subject having ATTR, comprising administering to said subject a compound according to claim 1 or 4 ...

58. Use of a composition or formulation according to any one of claims 58.

Images