Bacteriocins for control of salmonella enterica

Abstract

To provide a method of preventing or reducing infection or contamination of an object with Salmonella.SOLUTION: Proteins capable of exerting a cytotoxic effect on Salmonella, referred to as salmocins are used. A protein containing or consisting of any one of the specific amino acid sequences is brought into contact with an object. Preferably, whole animal carcasses, meat, eggs, raw fruits or vegetables are sprayed with or immersed in an aqueous solution containing the protein.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a novel anti-Salmonella antibody, called "salmocins." The present invention provides a pharmaceutical composition comprising a protein capable of exerting a cytotoxic effect on a patient. Also provided are compositions comprising one or more of the above proteins, including compositions comprising the proteins. Methods for preventing or reducing infection or contamination of objects with Illa, and a method for treating an infection caused by Salmonella in a subject or patient comprising administering said protein to said subject or patient. Methods for producing compositions containing the substances are also provided. [Background technology]

[0002] Salmonella is a rod-shaped, gram-positive bacterium in the family Enterobacteriaceae. Salmonella enterica is the type species and is divided into six subspecies. and S.enterica ssp. Salmonella infections are common and range from asymptomatic to This can result in a variety of clinical symptoms ranging from very severe illness. Erica causes an estimated 1 million illnesses and an estimated 19,000 hospitalizations each year in the United States. In the past five years, there have been 46 outbreaks of Salmonella. Outbreaks have been recorded in the United States, where most food poisoning cases are caused by contaminated poultry or vegetables, but red meat and fish are also causes (CDC website).

[0003] Preventing Salmonella infection or reducing food contamination with Salmonella The food industry operates from agricultural production on farms to food processing, manufacturing and Control means are required at all stages of the food chain up to and including preparation. Good hygiene practices reduce food contamination by Salmonella, but do not guarantee the absence of Salmonella in the product. Preventive measures against Salmonella in the home are similar to those used against bacteria from other food sources. Basic food hygiene practices such as "cooking thoroughly" are recommended as preventive measures against salmonellosis. See WHO at www.who.int / mediacentre / factsheets / fs13 9 / en / .

[0004] Antimicrobial therapy may be used to treat humans or animals suffering from Salmonella infection. However, antimicrobial resistance is a global public health concern, and Salmonella is one of several organisms in which resistant serotypes have emerged that affect the food chain.

[0005] Many of the methods described above for preventing or treating Salmonella infection, or reducing contamination by Salmonella, are essentially independent of specific pathogenic bacteria or specific serotypes of Salmonella. This has the advantage that little prior knowledge of the specific Salmonella strain or Salmonella enterica serotype in question is required before taking countermeasures. However, the methods described above for preventing Salmonella infection or reducing contamination by Salmonella, such as heating, are not always applicable or may or change the food in an undesirable way. Other methods may have resulted in ineffective outcomes in certain patients. Therefore, there is a need for additional methods to prevent or treat Salmonella infection or contamination, or to reduce or prevent contamination of an object by Salmonella, particularly by

[0006] Salmonella enterica ssp. enterica. Some proteins that are active against Salmonella have been previously described (WO2018 / 172065) and were referred to as "salmosins". The salmosins described in WO2018 / 172065 exhibit high activity against Salmonella species and strains, but there are limitations in that their toxic activities are similar, and even when different known salmosins are combined, the range of activity is limited. Furthermore, the medium - or long - term use of the same or similar salmosin species may select for Salmonella strains that are resistant to the salmosin being used.

[0007] Regarding proteins for technical applications, ease of production, purification, and storage can be a crucial aspect in determining whether the technical application is feasible.

Summary of the Invention

[0008] To provide a method for preventing or treating Salmonella infections such as food-derived Salmonella infections. Another object of the present invention is to provide a method for preventing or reducing contamination of an object, particularly food, by Salmonella. It is a further object to provide a method for preventing or treating Salmonella infections that is effective against a wide range of Salmonella serogroups and / or for reducing contamination of an object by Salmonella. Another object is to provide additional salmosins that act on Salmonella by different or additional mechanisms. It is a further object of the present invention to provide an agent that is active against Salmonella and can be easily produced and / or purified and / or stored with high stability. Furthermore, compounds, agents, and compositions for such methods are desired. Accordingly, the present invention provides the subject matter defined in the claims. The present invention also provides the following: (1) A protein that can preferably exert a cytotoxic effect on Salmonella and contains at least any one of derivatives thereof defined by the following amino acid sequence segments (a-i) to (a-x) or (b-i) to (b-x), (c-i) to (c-x), or (d-i) to (d-x): (a-i) A segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1), (a-ii) A segment of amino acid residues 315 to 483 of ScolE3 (SEQ ID NO: 2), [Means for Solving the Problems]

[0009] (a-iii) Segment of amino acid residues 318 - 451 of ScolE7 (SEQ ID NO: 3) , (a-iv) Segment of amino acid residues 174 - 297 of ScolE1a (SEQ ID NO: 4) , (a-v) Segment of amino acid residues 198 - 322 of ScolE1b (SEQ ID NO: 5), (a-vi) Containing at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6 segment, (a-vii) Segment of amino acid residues 195 - 319 of ScolE1c (SEQ ID NO: 25) segment, (a-viii) Segment of amino acid residues 195 - 319 of ScolE1d (SEQ ID NO: 26) segment, (a-ix) Segment of amino acid residues 193 - 317 of ScolE1e (SEQ ID NO: 27) segment, (a-x) Segment of amino acid residues 38 - 138 of ScolMa (SEQ ID NO: 28), (a-xi) Segment of amino acid residues 38 - 138 of ScolMb (SEQ ID NO: 33), or (a-xii) Segment of amino acid residues 38 - 138 of ScolMc (SEQ ID NO: 34) , or (b-i) A segment having at least 75% sequence identity to the segment of amino acid residues 316 - 449 of ScolE2 (SEQ ID NO: 1) , (b-ii) A segment having at least 70% sequence identity to the segment of amino acid residues 315 - 483 of ScolE3 (SEQ ID NO: 2) , (b-iii) Segment of amino acid residues 318 - 451 of ScolE7 (SEQ ID NO: 3) having at least 77% sequence identity to the segment, (b-iv) Segment of amino acid residues 174 - 297 of ScolE1a (SEQ ID NO: 4) A segment having at least 70% sequence identity thereto, (b-v) To the segment of amino acid residues 198 to 322 of ScolE1b (SEQ ID NO: 5) A segment having at least 70% sequence identity thereto, (b-vi) Containing at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6 A segment having at least 70% sequence identity thereto, (b-vii) To the segment of amino acid residues 195 to 319 of ScolE1c (SEQ ID NO: 25) A segment having at least 70% sequence identity thereto, (b-viii) To the segment of amino acid residues 195 to 319 of ScolE1d (SEQ ID NO: 26) A segment having at least 70% sequence identity thereto, (b-ix) To the segment of amino acid residues 193 to 317 of ScolE1e (SEQ ID NO: 27) A segment having at least 70% sequence identity thereto, (b-x) To the segment of amino acid residues 38 to 138 of ScolMa (SEQ ID NO: 28) A segment having at least 70% sequence identity thereto, (b-xi) To the segment of amino acid residues 38 to 138 of ScolMb (SEQ ID NO: 33) A segment having at least 70% sequence identity thereto, or (b-xii) To the segment of amino acid residues 38 to 138 of ScolMc (SEQ ID NO: 34) A segment having at least 70% sequence identity thereto, Or (c-i) To the segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1) A segment having at least 85% sequence similarity thereto, (c-ii) To the segment of amino acid residues 315 to 483 of ScolE3 (SEQ ID NO: 2) A segment having at least 80% sequence similarity thereto, (c-iii) A segment of amino acid residues 318 - 451 of ScolE7 (SEQ ID NO: 3) that has at least 85% sequence similarity to the segment, (c-iv) A segment of amino acid residues 174 - 297 of ScolE1a (SEQ ID NO: 4) that has at least 80% sequence similarity to the segment, (c-v) A segment of amino acid residues 198 - 322 of ScolE1b (SEQ ID NO: 5) that has at least 80% sequence similarity to the segment, (c-vi) A segment that contains at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6 and has at least 80% sequence similarity to the segment, (c-vii) A segment of amino acid residues 195 - 319 of ScolE1c (SEQ ID NO: 25) that has at least 80% sequence similarity to the segment, (c-viii) A segment of amino acid residues 195 - 319 of ScolE1d (SEQ ID NO: 26) that has at least 80% sequence similarity to the segment, (c-ix) A segment of amino acid residues 193 - 317 of ScolE1e (SEQ ID NO: 27) that has at least 80% sequence similarity to the segment, (c-x) A segment of amino acid residues 38 - 138 of ScolMa (SEQ ID NO: 28) that has at least 80% sequence similarity to the segment, (c-xi) A segment of amino acid residues 38 - 138 of ScolMb (SEQ ID NO: 33) that has at least 80% sequence similarity to the segment, or (c-xii) A segment of amino acid residues 38 - 138 of ScolMc (SEQ ID NO: 34) that has at least 80% sequence similarity to the segment, or (d-i) A segment having 1 to 25 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1) (d-ii) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 315 to 483 of ScolE3 (SEQ ID NO: 2) (d-iii) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 318 to 451 of ScolE7 (SEQ ID NO: 3) (d-iv) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 174 to 297 of ScolE1a (SEQ ID NO: 4) (d-v) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 198 to 322 of ScolE1b (SEQ ID NO: 5) (d-vi) With respect to a segment containing at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6 A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions (d-vii) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of ScolE1c (SEQ ID NO: 25) (d-viii) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of ScolE1d (SEQ ID NO: 26) (d-ix) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 193 to 317 of ScolE1e (SEQ ID NO: 27) (d-x) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of ScolMa (Accession No. 28). (d-xi) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of ScolMb (Accession No. 33), or (d-xii) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of ScolMc (Accession No. 34). (2) The protein according to (1), comprising a cytotoxic domain or a catalytic domain having any one or more of the following activities: pore-forming activity in a membrane, DNase activity, RNase activity or cell wall degrading activity, such as muramidase activity. (3) The protein according to (1) or (2), comprising a cytotoxic domain or a catalytic domain containing any one of the following amino acid sequence segments (a-i)' to (a-x)', or (b-i)' to (b-x)', (c-i)' to (c-x)' or (d-i)' to (d-x)': (a-i)' The segment of amino acid residues 453 to 582 of ScolE2 (Accession No. 1). (a-ii)' The segment of amino acid residues 501 to 584 of ScolE3 (Accession No. 2). (a-iii)' The segment of amino acid residues 455 to 584 of ScolE7 (Accession No. 3). (a-iv)' The segment of amino acid residues 306 to 478 of ScolE1a (Accession No. 4). (a-v) Segment of amino acid residues 350 to 522 of ’ScolE1b (SEQ ID NO: 5) , (a-vi) Segment of amino acid residues 112 to 288 of ’Spst (SEQ ID NO: 6), (a-vii) Segment of amino acid residues 347 to 519 of ’ScolE1c (SEQ ID NO: 25) ment, (a-viii) Segment of amino acid residues 347 to 519 of ’ScolE1d (SEQ ID NO: 26) gment, (a-ix) Segment of amino acid residues 345 to 517 of ’ScolE1e (SEQ ID NO: 27) nt, (a-x) Segment of amino acid residues 139 to 269 of ’ScolMa (SEQ ID NO: 28) , (a-xi) Segment of amino acid residues 139 to 269 of ’ScolMb (SEQ ID NO: 33) t, or (a-xii) Segment of amino acid residues 139 to 269 of ’ScolMc (SEQ ID NO: 34) nt, or (b-i) A segment having at least 70% sequence identity to the segment of amino acid residues 453 to 582 of ’ScolE2 (SEQ ID NO: 1) with respect to, (b-ii) Segment of amino acid residues 501 to 584 of ’ScolE3 (SEQ ID NO: 2) A segment having at least 70% sequence identity to the segment (b-iii) Segment of amino acid residues 455 to 584 of ’ScolE7 (SEQ ID NO: 3) to which has at least 70% sequence identity to the segment, (b-iv) Segment of amino acid residues 306 to 478 of ’ScolE1a (SEQ ID NO: 4) to which has at least 70% sequence identity to the segment, (b-v) Segment of amino acid residues 350 to 522 of ’ScolE1b (SEQ ID NO: 5) A segment having at least 70% sequence identity thereto, (b-vi) A segment having at least 70% sequence identity to the segment of amino acid residues 112 to 288 of ’Spst (SEQ ID NO: 6), A segment having at least 70% sequence identity thereto, (b-vii) A segment having at least 70% sequence identity to the segment of amino acid residues 347 to 519 of ’ScolE1c (SEQ ID NO: 25), A segment having at least 70% sequence identity thereto, (b-viii) A segment having at least 70% sequence identity to the segment of amino acid residues 347 to 519 of ’ScolE1d (SEQ ID NO: 26), A segment having at least 70% sequence identity thereto, (b-ix) A segment having at least 70% sequence identity to the segment of amino acid residues 345 to 517 of ’ScolE1e (SEQ ID NO: 27), A segment having at least 70% sequence identity thereto, (b-x) A segment having at least 70% sequence identity to the segment of amino acid residues 139 to 269 of ’ScolMa (SEQ ID NO: 28), A segment having at least 70% sequence identity thereto, (b-xi) A segment having at least 70% sequence identity to the segment of amino acid residues 139 to 269 of ’ScolMb (SEQ ID NO: 33), A segment having at least 70% sequence identity thereto, or (b-xii) A segment having at least 70% sequence identity to the segment of amino acid residues 139 to 269 of ’ScolMc (SEQ ID NO: 34), A segment having at least 70% sequence identity thereto, Or (c-i) A segment having at least 80% sequence similarity to the segment of amino acid residues 453 to 582 of ’ScolE2 (SEQ ID NO: 1), A segment having at least 80% sequence similarity thereto, (c-ii) A segment having at least 80% sequence similarity to the segment of amino acid residues 501 to 584 of ’ScolE3 (SEQ ID NO: 2), A segment having at least 80% sequence similarity thereto, (c-iii) A segment having at least 80% sequence similarity to the segment of amino acid residues 455 to 584 of ’ScolE7 (SEQ ID NO: 3), A segment having at least 80% sequence similarity thereto, (c-iv) A segment of amino acid residues 306 - 478 of ScolE1a (SEQ ID NO: 4) that has at least 80% sequence similarity to the segment, (c-v) A segment of amino acid residues 350 - 522 of ScolE1b (SEQ ID NO: 5) that has at least 80% sequence similarity to the segment, (c-vi) A segment that has at least 80% sequence similarity to the segment of amino acid residues 112 - 288 of Spst (SEQ ID NO: 6) to the segment, (c-vii) A segment of amino acid residues 347 - 519 of ScolE1c (SEQ ID NO: 25) that has at least 80% sequence similarity to the segment, (c-viii) A segment of amino acid residues 347 - 519 of ScolE1d (SEQ ID NO: 26) that has at least 80% sequence similarity to the segment, (c-ix) A segment of amino acid residues 345 - 517 of ScolE1e (SEQ ID NO: 27) that has at least 80% sequence similarity to the segment, (c-x) A segment of amino acid residues 139 - 269 of ScolMa (SEQ ID NO: 28) that has at least 80% sequence similarity to the segment, (c-xi) A segment of amino acid residues 139 - 269 of ScolMb (SEQ ID NO: 33) that has at least 80% sequence similarity to the segment, or (c-xii) A segment of amino acid residues 139 - 269 of ScolMc (SEQ ID NO: 34) that has at least 80% sequence similarity to the segment, or (d-i) A segment that has 1 - 20 amino acid substitutions, additions, insertions or deletions relative to the segment of amino acid residues 453 - 582 of ScolE2 (SEQ ID NO: 1) to the segment, (d-ii) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 501 to 584 of ’ScolE3 (SEQ ID NO: 2) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 501 to 584 of ’ScolE3 (SEQ ID NO: 2), (d-iii) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 455 to 584 of ’ScolE7 (SEQ ID NO: 3) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 455 to 584 of ’ScolE7 (SEQ ID NO: 3), (d-iv) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 306 to 478 of ’ScolE1a (SEQ ID NO: 4) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 306 to 478 of ’ScolE1a (SEQ ID NO: 4), (d-v) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 350 to 522 of ’ScolE1b (SEQ ID NO: 5) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 350 to 522 of ’ScolE1b (SEQ ID NO: 5), (d-vi) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 112 to 288 of ’Spst (SEQ ID NO: 6) A segment having 1 to 20 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 112 to 288 of ’Spst (SEQ ID NO: 6), (d-vii) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of ’ScolE1c (SEQ ID NO: 25) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of ’ScolE1c (SEQ ID NO: 25) , (d-viii) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of ’ScolE1d (SEQ ID NO: 26) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of ’ScolE1d (SEQ ID NO: 26) , (d-ix) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 345 to 517 of ’ScolE1e (SEQ ID NO: 27) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 345 to 517 of ’ScolE1e (SEQ ID NO: 27), or (d-x) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of ’ScolMa (SEQ ID NO: 28) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of ’ScolMa (SEQ ID NO: 28), (d-xi) A segment of amino acid residues 139 to 269 of ScolMb (SEQ ID NO: 33) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment, or or (d-xii) A segment of amino acid residues 139 to 269 of ScolMc (SEQ ID NO: 34) A segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment. (4) Any one of the following amino acid sequence segments (a-i)'' to (a-v)'', (a-vii )'' to (a-x)'', (a-xi)'', and (a-xii)'', or (b -i)'' to (b-v)'', (b-vii)'' to (b-x)'', (b-xi) '' and (b-xii)'', (c-i)'' to (c-v)'', (c-vii)' ' to (c-x)'', (c-xi)'' and (c-xii)'', or (d-i) '' to (d-v)'', (d-vii)'' to (d-x)'', (d-xi)'', and (d-xii)'', or a derivative (or amino acid sequence segment) defined by any one of them, containing (or consisting of) a metastasis domain: The protein according to (1), (2) or (3): (a-i)'' A segment of amino acid residues 43 to 313 of ScolE2 (SEQ ID NO: 1), (a-ii)'' A segment of amino acid residues 35 to 315 of ScolE3 (SEQ ID NO: 2) (a-iii)'' A segment of amino acid residues 43 to 316 of ScolE7 (SEQ ID NO: 3) , (a-iv)'' A segment of amino acid residues 1 to 170 of ScolE1a (SEQ ID NO: 4) (a-v)'' A segment of amino acid residues 1 to 195 of ScolE1b (SEQ ID NO: 5), (a-vi)'' A segment of amino acid residues 1 to 195 of ScolE1c (SEQ ID NO: 6), , (a-vii)'' A segment of amino acid residues 1 to 195 of ScolE1d (SEQ ID NO: 7), (a-vii) Segment of amino acid residues 6 to 194 of ’’ScolE1c (SEQ ID NO: 25) segment, (a-viii) Segment of amino acid residues 6 to 194 of ’’ScolE1d (SEQ ID NO: 26) segment, (a-ix) Segment of amino acid residues 5 to 192 of ’’ScolE1e (SEQ ID NO: 27) segment, (a-x) Segment of amino acid residues 1 to 37 of ’’ScolMa (SEQ ID NO: 28), (a-xi) Segment of amino acid residues 1 to 37 of ’’ScolMb (SEQ ID NO: 33), or (a-xii) Segment of amino acid residues 1 to 37 of ’’ScolMc (SEQ ID NO: 34) , or (b-i) A segment having at least 75%, preferably at least 80%, more preferably at least 85 %, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 43 to 313 of ’’ScolE2 (SEQ ID NO: 1) , a segment having sequence identity, (b-ii) Segment of amino acid residues 35 to 315 of ’’ScolE3 (SEQ ID NO: 2) having at least 75%, preferably at least 80%, more preferably at least 8 5%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment, (b-iii) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 43 to 316 of ’’ScolE7 (SEQ ID NO: 3) , (b-iv) Segment of amino acid residues 1 to 170 of ’’ScolE1a (SEQ ID NO: 4) at least 70%, preferably at least 80%, more preferably at least 8 5%, more preferably at least 90%, most preferably at least 95% sequence identity with a segment, (b-v)’’A segment of amino acid residues 1 to 195 of ScolE1b (SEQ ID NO: 5) has at least 70%, preferably at least 80%, more preferably at least 85 %, more preferably at least 90%, most preferably at least 95% sequence identity with a segment, (b-vii)’’A segment of amino acid residues 6 to 194 of ScolE1c (SEQ ID NO: 25) has at least 70%, preferably at least 80%, more preferably at least 80 also 85%, more preferably at least 90%, most preferably at least 95% sequence identity with a segment, (b-viii)’’A segment of amino acid residues 6 to 194 of ScolE1d (SEQ ID NO: 26) has at least 70%, preferably at least 80%, more preferably at least 80 also 85%, more preferably at least 90%, most preferably at least 95% sequence identity with a segment, (b-ix)’’A segment of amino acid residues 5 to 192 of ScolE1e (SEQ ID NO: 27) has at least 70%, preferably at least 80%, more preferably at least 80 also 85%, more preferably at least 90%, most preferably at least 95% sequence identity with a segment, (b-x)’’A segment of amino acid residues 1 to 37 of ScolMa (SEQ ID NO: 28) has at least 70%, preferably at least 80%, more preferably at least 85% having at least 90%, more preferably at least 95% and most preferably at least 98% sequence identity to the segment (b-xi) a segment of amino acid residues 1 to 37 of ScolMb (SEQ ID NO: 33) having at least 70%, preferably at least 80%, more preferably at least 85 %, more preferably at least 90%, most preferably at least 95% sequence identity to the segment, or (b-xii) a segment of amino acid residues 1 to 37 of ScolMc (SEQ ID NO: 34) having at least 70%, preferably at least 80%, more preferably at least 8 5%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment, or (c-i) a segment of amino acid residues 43 to 313 of ScolE2 (SEQ ID NO: 1) having at least 85%, preferably at least 90%, more preferably at least 95 % sequence similarity to the segment, (c-ii) a segment of amino acid residues 35 to 315 of ScolE3 (SEQ ID NO: 2) having at least 85%, preferably at least 90%, more preferably at least 9 5% sequence similarity to the segment, (c-iii) a segment of amino acid residues 43 to 316 of ScolE7 (SEQ ID NO: 3) having at least 90%, preferably at least 95% sequence similarity to the segment nt, (c-iv) a segment of amino acid residues 1 to 170 of ScolE1a (SEQ ID NO: 4) having at least 80%, preferably at least 90, more preferably at least 95 % sequence similarity to the segment, (c-v) A segment of amino acid residues 1 to 195 of ScolE1b (SEQ ID NO: 5) having at least 80%, preferably at least 90%, more preferably at least 95 % sequence similarity to the segment, (c-vii) A segment of amino acid residues 6 to 194 of ScolE1c (SEQ ID NO: 25) having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to the segment, (c-viii) A segment of amino acid residues 6 to 194 of ScolE1d (SEQ ID NO: 26) having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to the segment, (c-ix) A segment of amino acid residues 5 to 192 of ScolE1e (SEQ ID NO: 27) having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to the segment, (c-x) A segment of amino acid residues 1 to 37 of ScolMa (SEQ ID NO: 28) having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to the segment, (c-xi) A segment of amino acid residues 1 to 37 of ScolMb (SEQ ID NO: 33) having at least 80%, preferably at least 90%, more preferably at least 95 % sequence similarity to the segment, or (c-xii) A segment of amino acid residues 1 to 37 of ScolMc (SEQ ID NO: 34) having at least 80%, preferably at least 90%, more preferably at least 9 5% sequence similarity to the segment, or (d-i) A segment of amino acid residues 43 to 313 of ScolE2 (SEQ ID NO: 1) has 1 to 50, preferably 1 to 40, more preferably 1 to 30, even more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-ii) A segment of amino acid residues 35 to 315 of ScolE3 (SEQ ID NO: 2) has 1 to 50, preferably 1 to 40, more preferably 1 to 30, even more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-iii) A segment of amino acid residues 43 to 316 of ScolE7 (SEQ ID NO: 3) has 1 to 30, preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-iv) A segment of amino acid residues 1 to 170 of ScolE1a (SEQ ID NO: 4) has 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-v) A segment of amino acid residues 1 to 195 of ScolE1b (SEQ ID NO: 5) has 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-vii) A segment of amino acid residues 6 to 194 of ScolE1c (SEQ ID NO: 25) has 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-viii) A segment of amino acid residues 6 to 194 of ScolE1d (SEQ ID NO: 26) has, relative to the segment, 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-ix) A segment of amino acid residues 5 to 192 of ScolE1e (SEQ ID NO: 27) has, relative to the segment, 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, or is (d-x) A segment of amino acid residues 1 to 37 of ScolMa (SEQ ID NO: 28) has, relative to the segment, 1 to 7, preferably 1 to 5, more preferably 1 to 3, and most preferably 1 to 3 amino acid substitutions, additions, insertions or deletions, (d-xi) A segment of amino acid residues 1 to 37 of ScolMb (SEQ ID NO: 33) has, relative to the segment, 1 to 7, preferably 1 to 5, more preferably 1 to 3, and most preferably 1 to 3 amino acid substitutions, additions, insertions or deletions, or (d-xii) A segment of amino acid residues 1 to 37 of ScolMc (SEQ ID NO: 34) has, relative to the segment, 1 to 7, preferably 1 to 5, more preferably 1 to 3, and most preferably 1 to 3 amino acid substitutions, additions, insertions or deletions. (5) The protein is in the item: (b-x), (c-x), (d-x), (b-xi), (c-xi), (d-xi), ( b-xii), (c-xii), (d-xii), (b-x)', (c-x)', (d-x)', (b-xi)', (c-xi)', (d- xi)', (b-xii)', (c-xii)', (d-xii)', (b-x)'', (c-x)'', (d-x)'', (b-xi)'', (c-xi)' ', (d-xi)'', (b-xii)'', (c-xii)', or (d-xii) '' defined by any one of the following, the amino acid residue of said protein corresponding to residue 155 of SEQ ID NO: 33 is Pro, and and / or the amino acid residue corresponding to residue 246 of SEQ ID NO: 33 is Arg or Ly s, preferably Arg, the protein according to any one of (1) to (4). (6) the amino acid residues corresponding to residues 76 and 84 of SEQ ID NO: 33 are Gln, (5 ) the protein according to. (7) Salmonella such as Salmonella enterica, preferably infection by Salmonella enterica ssp. enterica or contamination for use in a method of treating, the protein according to any one of (1) to (6). protein. (8) against Salmonella enterica, claim 1, in particular the protein according to class (b) to (d) of claim 1 the toxicity of the protein described is, for a sensitive Salmonella en terica strain of cm 2 per 1x10 7 cfu / mL of 0.14 mL of bacterial solution inoculated onto a soft agar overlay plate, 5 microliters of the protein of class (b) to (d) and the protein of SEQ ID NO: 1 are spotted, and then the agar plate is incubated at 37 °C and after 12 hours, the protein and the protein of SEQ ID NO: 1 the protein is, of the same diameter, Salmonella enterica ssp. enteric a serotype Newport strain ATCC® 6962 (trademark) *generating spots that do not contain viable bacteria such as, and the concentration of the protein of classes (b) to (d) is at most 5 times that of the comparative solution of the protein of SEQ ID NO: 1, (1 ) to any one of (7). The protein according to any one of (9) A protein comprising or consisting of any one of the following amino acid sequences: (A-x) SEQ ID NO: 28, (A-xi) SEQ ID NO: 33, or (A-xii) SEQ ID NO: 34, or (B-x) An amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 28 , (B-xi) An amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 33 , or (B-xii) An amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 34 , or (C-x) An amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 28 , (C-xi) An amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 33 , or (C-xii) An amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 34 , or (D-x) An amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the amino acid sequence of SEQ ID NO: 28 (D-xi) An amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the amino acid sequence of SEQ ID NO: 33, or (D-xii) 1 to 40 amino acid substitutions, additions, or substitutions in the amino acid sequence of SEQ ID NO: 34; an amino acid sequence having an insertion or deletion; or (Ex) at least 215 consecutive amino acid residues of SEQ ID NO: 28; or an amino acid sequence consisting of (E-xi) at least 215 consecutive amino acid residues of SEQ ID NO: 33 or or (E-xii) at least 215 consecutive amino acid residues of SEQ ID NO: 34 or The amino acid sequence consisting of (10) The protein is classified as (Bx), (Cx), (Dx), or (Ex). As described above, preferably (B-xi), (C-xi), (D-xi), (Ex i), (B-xii), (C-xii), (D-xii), or (E-xii) and the amino acid sequence (of the protein) corresponding to residue 155 of SEQ ID NO:33 is as set forth above. and / or the amino acid residue corresponding to residue 246 of SEQ ID NO:33. The protein according to (9), wherein the group is Arg or Lys, preferably Arg. (11) The amino acid residues corresponding to residues 76 and 84 of SEQ ID NO: 33 are Gln; 9) or (10). (12) A composition comprising one or more proteins according to any one of (1) to (11). Composition. (13) The one or more proteins are selected from the group consisting of ScolE1c, ScolE1d, and Sco lE1e, ScolMa, ScolMb, or ScolMc, or ScolE1c , ScolE1d, ScolE1e, ScolMa, ScolMb, or ScolM is a derivative of c, or contains it, and the derivative is as described in item (b), (c), and and (d) of item (1), or preferably, as described in item (B), ( C), and (D) of item (9), the composition according to (12). (14) At least two different classes (i ) selected from (x), (xi), and (xii) of (1), (2), or (3), preferably at least two different classes (i) selected from (xii) of (1), (2), or (3), more preferably, at least two different classes (iv), (v), and (x) to (xii) selected from any one of (1) to (4), the composition according to (12) or (13). (15) At least the protein of subclass (x) of any one of classes (a) to (d) and the protein of subclass (v) of any one of classes (a) to (d), or at least the protein of subclass (xi) of any one of classes (a) to (d) and the protein of subclass (v) of any one of classes (a) to (d), or at least the protein of subclass (x ii) of any one of classes (a) to (d) and the protein of subclass (v) of any one of classes (a) to (d), the composition according to (14). (16) For use in a method of treating an infection by Salmonella, preferably Salmonella enterica, more preferably Salmonella enterica ssp. enterica, the composition according to any one of (12) to (15). (16) For use in a method of treating an infection by Salmonella, preferably Salmonella enterica, more preferably Salmonella enterica ssp. enterica, the composition according to any one of (12) to (15). (16) For use in a method of treating an infection by Salmonella, preferably Salmonella enterica, more preferably Salmonella enterica ssp. enterica, the composition according to any one of (12) to (15). (16) For use in a method of treating an infection by Salmonella, preferably Salmonella enterica, more preferably Salmonella enterica ssp. enterica, the composition according to any one of (12) to (15). For use in a method of treating an infection by Salmonella, preferably Salmonella enterica, Composition. (17) The composition is a plant material or an extract thereof, and the plant material is the one that expresses the protein, preferably a material derived from an edible plant that expresses the protein. (1 2) - (16) The composition according to any one of (12) - (16). (18) The plant material is selected from the group consisting of spinach, Brassica rapa, beet root, carrot, sugar beet, kohlrabi, leaf beet, amaranth, and Nicotiana, and / or the plant material is one or more leaves, roots, tubers or seeds, or a crushed, milled, or pulverized product of the leaves, roots, tubers or seeds. (17) The composition according to (17). (19) The composition is an aqueous solution containing the protein. (12) - (18) The composition according to any one of (12) - (18). (20) When the protein or the composition contains two or more different proteins, the concentration of the protein in the aqueous solution is 0.0001 - 1 mg / ml, preferably 0.001 - 0.1 mg / ml, more preferably 0.005 - 0.05 mg / ml, or 0.1 - 15 mg / kg of food, preferably 0.5 - 10 mg / kg, more preferably 0.1 - 5 mg / kg of food. (19) The composition according to (19). (21) The protein described in item (A - iv), (B - iv), (C - iv), (D - iv) or (E - iv), and / or the protein described in item (A - x), (B - x), (C - x) , (D - x) or (E - x), or the protein described in item (A - v), ( B - v), (D - v) or (E - v), and / or the protein described in item (A - x), (B - x), (D - x) or (E - x). (12 )~(20) Any one of the compositions described in any one of (1) to (20), and the preferred embodiments defined herein may be combined with the embodiments defined in this item (21). Composition. (22) A method for preventing or reducing infection or contamination of an object by Salmonella, comprising contacting the object with the protein described in any one of (1) to (11) or the composition described in any one of (12) to (21). (21). (23) The method according to (22), wherein the object is sprayed with the aqueous solution or immersed in the aqueous solution. (24) The method according to (22) to (23), wherein the object is immersed in the aqueous solution of the protein for at least 10 seconds, preferably at least 1 minute, preferably at least 5 minutes. (25) The method according to any one of (22) to (24), wherein the object is food or animal feed. (26) The food is the whole body of an animal, meat, eggs, raw fruits or vegetables, preferably the food is meat, raw fruits or vegetables, more preferably the food is meat. (25). (27) A method for treating an infection of a subject by Salmonella in need thereof, comprising administering to the subject the protein described in any one of (1) to (11) or the composition described in any one of (12) to (21). (25). (27) A method for treating an infection of a subject by Salmonella in need thereof, comprising administering to the subject the protein described in any one of (1) to (11) or the composition described in any one of (12) to (21). (28) The method according to any one of (22) to (27), wherein the Salmonella is Salmonella enterica, preferably Salmonella enterica ssp. enterica. (29) A method for producing a composition comprising the protein described in any one of (1) to (11). (22)~(27). (29) A method for producing a composition comprising the protein described in any one of (1) to (11). A method comprising: (i) expressing said protein in a plant, preferably an edible plant or Nicotiana; (ii) collecting plant material containing the expressed protein from said plant; (iii) extracting said protein from said plant material using an aqueous buffer to obtain a composition containing said protein; (iv) optionally removing unwanted contaminants from said composition. (30) Is said protein one of: - (a-vii), (b-vii), (c-vii), or (d-vii), each optionally in combination with item (3), or - (A-vii), (B-vii), (C-vii), (D-vii) or (E-vii), or Is said protein one of: - (a-viii), (b-viii), (c-viii), or (d-viii), each optionally in combination with item (3), or - (A-viii), (B-viii), (C-viii), (D-viii) or (E-viii), or Is said protein one of: - (a-x), (b-x), (c-x), or (d-x), each optionally in combination with item (3), or - (A-x), (B-x), (C-x), (D-x) or (E-x), or Is said protein one of: - (a-xi), (b-xi), (c- xi), or (d-xi), or -(A-xi), (B-xi), (C-xi), (D-xi) or (E-xi) is of, or the protein is the item - (a-xii), (b-xii), ( c-xii), or (d-xii), or -(A-xii), (B-xii), (C-xii), (D-xii) or (E-x ii) which is the protein according to (1) or (9). (31) - optionally further the items (A-x), (B-x), (C-x) described in claim 7 or 8, and / or the items (A-xi), (B- xi), (C-xi), (D-xi) or (E-xi), and / or (A-xi i), (B-xii), (C-xii), (D-xii) or (E-xii) described in the protein, and - the protein described in the items (A-viii), (B-viii), (C-viii), (D-viii) or (E-iii) which is the composition according to (12).

[0010] In this specification, the bacteriocin of Salmonella called "salmocine" (abbreviated as "Scol" " or "Sal" in this specification) together with its derivatives is a certain natural non-antibiotic antibacterial protein produced by some Salmonella strains that kills other Salmonella strains or inhibits their growth. Relatively well-studied Escherichia coli proteins called colicins ​ Unlike colicins, salmonocins have received little attention. There are several Salmonella sequences in publicly available genomic databases that have similarity to colicin sequences, and many of them show high identity to colicins M, Ia, Ib, 5, and 10. The inventors have identified salmonocins that are similar but different from colicins and can be used to prevent or reduce infection or contamination by Salmonella, particularly by Salmonella enterica ssp. enterica. There are several Salmonella sequences in publicly available genomic databases that have similarity to colicin sequences, and many of them show high identity to colicins M, Ia, Ib, 5, and 10. The inventors have identified salmonocins that are similar but different from colicins and can be used to prevent or reduce infection or contamination by Salmonella, particularly by Salmonella enterica ssp. enterica. The inventors have discovered that salmonocins can be efficiently expressed in plants. Expression methods such as those used in this study have already reached the level of GMP compliance and are currently being used in various clinical trials as manufacturing methods. Most salmonocins are expressed at high yields (up to 1.7 g of active protein per kilogram of fresh green biomass), which means low manufacturing costs that are commercially viable. Production can be carried out using, in particular, tobacco and edible plants such as leaf beet or spinach. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Each of these two salmonocins, ScolE1a and ScolE1b, also has been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Each of these two salmonocins, ScolE1a and ScolE1b, also has been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Each of these two salmonocins, ScolE1a and ScolE1b, also has

[0011] The inventors have discovered that salmonocins can be efficiently expressed in plants. Expression methods such as those used in this study have already reached the level of GMP compliance and are currently being used in various clinical trials as manufacturing methods. Most salmonocins are expressed at high yields (up to 1.7 g of active protein per kilogram of fresh green biomass), which means low manufacturing costs that are commercially viable. Production can be carried out using, in particular, tobacco and edible plants such as leaf beet or spinach. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Expression methods such as those used in this study have already reached the level of GMP compliance and are currently being used in various clinical trials as manufacturing methods. Most salmonocins are expressed at high yields (up to 1.7 g of active protein per kilogram of fresh green biomass), which means low manufacturing costs that are commercially viable. Most salmonocins are expressed at high yields (up to 1.7 g of active protein per kilogram of fresh green biomass), which means low manufacturing costs that are commercially viable. Production can be carried out using, in particular, tobacco and edible plants such as leaf beet or spinach. Production can be carried out using, in particular, tobacco and edible plants such as leaf beet or spinach. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. Among the various salmonocins, salmonocins Ma (ScolMa), Mb (ScolMb), and Mc (ScolMc) are preferred, and compositions of these M-type salmonocins together with E1a (ScolE1a) and (more preferably) E1b (ScolE1b) or their derivatives are more preferred because they have been found to have very broad antibacterial activity against the main pathogenic Salmonella strains. It exhibits very high activity. Also, ScolMa has been shown to have broad antibacterial activity against major pathogenic Salmonella strains (see Figure 32). Interestingly, ScolMa has high antibacterial activity against some pathogenic Salmon ella strains with low activity of ScolE1 salmocidin. Therefore, ScolMa, as well as Scol Mb and ScolMc, are ideal salmocidins for use in combination with ScolE1 salmocidin in the compositions of the present invention and thus for use in the methods of the present invention . ScolMb and ScolMc have an antibacterial activity spectrum against Salmonella strains that is very similar to that of ScolMa (see Figure 37). Therefore, S colMb and ScolMc have the same or similar utility as ScolMa for the uses and methods described herein. From the perspective of ease of purification, among the ScolM salmocidins, ScolMb and ScolMc (and their derivatives as defined herein) are preferred, and ScolMc (and its derivatives as defined herein) is most preferred . ScolMc (and its derivatives) combines a broad antibacterial activity spectrum against Salmonella strains with ideal handling characteristics and high antibacterial activity. Treatment with a low amount of colicin (e.g., less than 10 mg of colicin per kg of food product to be treated) reduces the bacterial load of various pathogenic strains by 3 to >6 log in the assays used. In spike experiments using poultry meat spiked with 2 to 4 pathogen serotypes, colicins (colicin M, Ia, and 5) reduced the titer of pathogenic bacteria

[0012] was efficiently reduced. Therefore, against the S. enterica ssp. enter ica serotypes, thurmosin having higher antibacterial activity than the mentioned colicins is expected to further effectively reduce the titer of Salmonella contamination in poultry.

[0013] The experimental data of the present invention show that the antibacterial thurmosin, a non-antibiotic, can be expressed at very high levels in plants such as Nicotiana benthamiana, which is the standard production host of multiple biologics currently undergoing clinical trials. The protein expressed in plants is apparently sufficiently active. In most cases, the expression level reaches 37% of the total soluble protein or 1.74 g / kg of fresh leaf biomass without optimization of the method, which means that thurmosin is not toxic to plants and that optimized industrial procedures for transfection or induction in inexpensive, transgenic hosts can be developed. In contrast, attempts to express bacteriocin proteins at high levels in bacterial hosts usually encounter the general toxicity of this bacteriocin class even in species other than the homologous bacterial species (e.g., Medina et al., PLoS One, 2 011;6(8):e23055; Diaz et al., 1994). Therefore, plants are excellent hosts for producing thurmosin.

[0014] The data of the present invention show that thurmosin can efficiently control most or all of the major pathogenic serotypes of Salmonella enterica ssp. enterica under actual exposure modeling. ​​​​​​​​​​Among the salmonellosins, the diversity is limited. The salmonellosins studied have rather diverse structures within the common three-domain (translocation, receptor, and cytotoxic domain) composition similar to the more studied colicins of E. coli. Surprisingly, virtually all tested salmonellosins and colicins are very well expressed in plants, either alone or together with antitoxins (immune proteins). This can be explained by the low toxicity of salmonellosins and colicins to plant cells, as well as the fact that these bacteriocin proteins, which are classical representatives of "inherently disordered proteins" (a characteristic essential for the ability to unfold / refold during translocation to the bacterial cell wall and membrane), presumably do not impose abnormal requirements on the translation and post-translational machinery of plant cells. Unlike the list of major E. coli strains defined by the FDA based on the historical analysis of E. coli food poisoning, the list of major Salmonella strains from food is not defined by regulatory authorities, mainly because the diversity of pathogenic types involved in major outbreaks is higher. Faced with the lack of this guidance in the prior art, the inventors decided to pool three current major studies that ranked pathogenic types based on their prevalence and poisoning severity. In the inventors' study, 36 serotypes were selected for analysis, 29 of which were the cause of at least 100 occurrences reported to the Centers for Disease Control and Prevention from 2003 to 2012 (National Enteric Disease Surveillance: Salmonella Annual Report, 2

[0015] coli strains, the list of major Salmonella strains from food is not defined by regulatory authorities, mainly because the diversity of pathogenic types involved in major outbreaks is higher. Faced with the lack of this guidance in the prior art, the inventors decided to pool three current major studies that ranked pathogenic types based on their prevalence and poisoning severity. In the inventors' study, 36 serotypes were selected for analysis, 29 of which were the cause of at least 100 occurrences reported to the Centers for Disease Control and Prevention from 2003 to 2012 (National Enteric Disease Surveillance: Salmonella Annual Report, 2 Among the salmonellosins, the diversity is limited. The salmonellosins studied have rather diverse structures within the common three-domain (translocation, receptor, and cytotoxic domain) composition similar to the more studied colicins of E. coli. Surprisingly, virtually all tested salmonellosins and colicins are very well expressed in plants, either alone or together with antitoxins (immune proteins). This can be explained by the low toxicity of salmonellosins and colicins to plant cells, as well as the fact that these bacteriocin proteins, which are classical representatives of "inherently disordered proteins" (a characteristic essential for the ability to unfold / refold during translocation to the bacterial cell wall and membrane), 013 (CDC, June 2016): Human Salmonella infections confirmed in laboratories reported to the CDC from 2003 to 2012 (United States). Seventeen of them are the most well-known pathogenic types in the top 20 lists of the CDC, and the number is more than five times that of the E. coli pathogenic types determined by the FDA (7). The data presented herein is based on their ability to control the main pathogenic Salmonella strains, and five different Salmonella salmosins, ScolE1a, ScolE1b, ScolE2, ScolE3, and ScolE7, are classified into three groups as shown. Salmonella salmosins E1a and E1b are found to be universally active, and each can kill all the pathogenic types tested and show the highest

[0016] average activity. The average activity of the two salmosins against all the strains tested exceeded 10 AU / μg. For example, the individual activity of salmosin E1a was >10 AU / μg for 35 out of 36 strains, >10 AU / μg for 24 out of 36 strains, and >10 AU / μg for 13 out of 36 strains. The remaining salmosins fall into two 7 groups. Salmosins E2 and E7 were inhibitory for more than 80% of the strains but had an average activity 100 times lower (<10 AU / μg), while salmosin E3 inhibited approximately 60% of the strains with a lower average activity (about 10 3 AU / μg). The inventors further 4 found that salmosins ScolE1c, ScolE1d, ScolE1e, and Scol E1f 6 also have low activities. The remaining salmosins fall into two groups. Salmosins E2 and E7 were inhibitory for more than 80% of the strains but had an average activity 100 times lower (<10 AU / μg), while salmosin E3 5 inhibited approximately 60% of the strains with a lower average activity (about 10 AU / μg). The inventors further 2 found that salmosins ScolE1c, ScolE1d, ScolE1e, and Scol E1f It has been discovered that Ma exhibits significant antibacterial activity. ScolE1b and ScolE1d were found to have surprisingly good handling characteristics, especially with respect to purification. Sco lE1d was surprisingly found to have excellent storage stability as a solution (especially an aqueous solution when cooled below room temperature, such as between 0 °C and 10 °C, preferably between 3 °C and 7 °C, or at about 4 °C). Among the colicins (salmonicin analogs produced by E. coli cells), ScolMb and ScolM c, especially ScolMc, were found to have surprisingly good handling characteristics, especially with respect to purification, and high antibacterial activity against Salmonella species.

[0017] Colicins (salmonicin analogs produced by E. coli cells) show a much narrower antibacterial activity spectrum against 7 E. coli pathotypes, and these results are unexpected because a mixture of 2 - 5 colicins is preferably required to efficiently inhibit all 7 STEC serotypes defined by the FDA. Colicins also showed much higher activity against the strain H104:H4 that caused a large - scale outbreak in Europe in 2011 (> 10 AU / μg) and common laboratory strains, but much lower average activity 5 against the "Big Seven" STEC strains (< 10 AU / μg on average). (average < 10 3 AU / μg).

[0018] The inventors' analysis of the cross - specific activities of salmonicins and colicins against E. coli and Salmonella respectively showed low activity against bacteria of different genera / species. In particular, some salmonicins (such as E2, E7, and E1b, but surprisingly ​Not E1a) was quite active against H104:H4 (10 3 AU / μg) and the laboratory strain DH10B( 10 5 AU / μg), but the activity of salmocins against the "Big Seven" STEC strains was low (less than 10 AU / μg). Similarly, the activity of colicins against Salmonella 2 a virulence prototypes was low, and colicins Ia and Ib were active against more than 80% of the strains, but the average activity of colicin Ia alone was higher than 3×10 AU / μg( 3 or three to four orders of magnitude lower than that of salmocins E1a / b). The inventors concluded from these studies that a mixture of colicins and salmocins must be used to fight both pathogenic species. These results also seem to be inconsistent in part with recent studies on the ecological effects of colicin-like proteins in competition between bacteria of different genera (Nedialkova et al., PLoS Pathog. January 2014;10(1):e1003844). The present invention provides novel agents and compositions for controlling Salmonella . The salmocins of the present invention have the advantage that they can be obtained marketing authorization in a straightforward manner

[0019] . For example, the FDA recently approved GRAS (Generally Regarded As Safe status for a plant-produced colicin (G RN573, FDA website). Due to the still unaddressed need for natural non-antibiotic antimicrobial agents for the control of Salmonella, the inventors conceived of exploring Salmonella bacteriocins ("salmocins"). Thereby ​​Thus, the present invention has been achieved.

Brief Description of the Drawings

[0020]

Figure 1A

Figure 1B

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20A

Figure 20B

Figure 20C

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32A

Figure 32B

Figure 33A

Figure 33B

Figure 33C

Figure 34

Figure 35

Figure 36

Figure 37

Figure 38A

Figure 38B

Figure 39

Figure 40A

Figure 40B

Figure 41

Figure 42

Figure 43

Figure 44

Mode for Carrying Out the Invention

[0021] The protein of the present invention is a protein having a cytotoxic effect on Salmonella and is referred to herein as "salmosin". Salmosin generally has at least a binding domain (also referred to as "receptor binding domain") that enables the binding of salmosin to the surface receptor structure of target Salmonella cells. Salmosin further has a cytotoxic domain, which may be a catalytic domain or a pore-forming domain. The catalytic domain may have RNase or DNase catalytic activity, inhibitory activity against cell wall peptidoglycan (murein) biosynthesis, or be able to degrade the cell wall structure of Salmonella. Furthermore, salmosin migrates to the compartment where salmosin exerts its cytotoxic function. The protein of the present invention is a protein having a cytotoxic effect on Salmonella and is referred to herein as "salmosin". Salmosin generally has at least a binding domain (also referred to as "receptor binding domain") that enables the binding of salmosin to the surface receptor structure of target Salmonella cells. Salmosin generally has at least a binding domain (also referred to as "receptor binding domain") that enables the binding of salmosin to the surface receptor structure of target Salmonella cells. (also referred to as "receptor binding domain") and at least has a binding domain that enables the binding of salmosin to the surface receptor structure of target Salmonella cells. Salmosin further has a cytotoxic domain, which may be a catalytic domain or a pore-forming domain. The catalytic domain may have RNase or DNase catalytic activity, inhibitory activity against cell wall peptidoglycan (murein) biosynthesis, or be able to degrade the cell wall structure of Salmonella. The catalytic domain may have RNase or DNase catalytic activity, inhibitory activity against cell wall peptidoglycan (murein) biosynthesis, or be able to degrade the cell wall structure of Salmonella. The catalytic domain may have RNase or DNase catalytic activity, inhibitory activity against cell wall peptidoglycan (murein) biosynthesis, or be able to degrade the cell wall structure of Salmonella. Furthermore, salmosin migrates to the compartment where salmosin exerts its cytotoxic function. be able to interact with the membrane proteins of the target Salmonella cells may have a translocation domain.

[0022] The inventors of the present invention have found that the M-type salmosin (ScolM or SalM) of the present invention has a lipid moiety and is located on the periplasmic side of the inner membrane, and the pi of peptidoglycan lipid I and lipid II intermediates is hypothesized to be a peptidoglycanase that specifically cleaves the bond between the phosphoryl group and (by analogy with Gross and Braun, Mol. Gen. Genet. 251 (1996) 38 8 - 396; Barreteau et al., Microbial Drug Resistan ce 18 (2012), 222 - 229). The released C55 - polyisoprenol can no longer translocate MurNac - pentapeptide - GlcNAc across the cell membrane. ScolM salmosin is taken up into the periplasm across the outer membrane and then kills the susceptible Salmonella strain. The mechanism of action of ScolM involves adsorption to the FhuA outer membrane receptor, energy - dependent translocation from the cell outer membrane to the periplasm by the TonB transport machinery (TonB, ExbB, and ExbD), and the catalytic steps of its substrate and is thought to include. Each of these steps is carried out by specific protein domains and is thought to include. Each of these steps is carried out by specific protein domains. Therefore, ScolM salmosin also shares the three - domain structure and narrow antibacterial spectrum in that its antibacterial activity against bacteria other than Salmonella is limited and the catalytic steps of its substrate. Each of these steps is carried out by specific protein domains. Therefore, ScolM salmosin also shares the three - domain structure and narrow antibacterial spectrum in that its antibacterial activity against bacteria other than Salmonella is limited and the catalytic steps of its substrate. Each of these steps is carried out by specific protein domains. Therefore, ScolM salmosin also shares the three - domain structure and narrow antibacterial spectrum in that its antibacterial activity against bacteria other than Salmonella is limited and narrow antibacterial spectrum.

[0023] For the specificity against Salmonella, the binding domain is important and (in particular) distinguishes salmosin from other similar colicins. Therefore, the protein of the present invention Any one of the above item (1) or the amino acid sequence segment defined in claim 1 having at least a binding domain comprising, consisting of, or contained in them may be defined by. Item (1) or items (a-i) to (a-v) of claim 1 define the binding domains of salmosins ScolE2, ScolE3, ScolE7, ScolE1a and ScolE1b, respectively. Items (a-vii) to (a-x), (a-xi) and (a-xii) of the above item (1) define the binding domains of salmosins ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and ScolMc, respectively. The binding domain of Spst is contained in the amino acid sequence segment defined in item (a-vi) of the above item (1). The amino acid sequences of salmosins ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, and Spst are given as SEQ ID NOs: 1 to 6, respectively. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and ScolMc are given as SEQ ID NOs: 25 to 28, 33, and 34, respectively. Items (b) to (d) of the above item (1) define derivatives of ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and ScolMc that have or contain a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, and Sp st are given as SEQ ID NOs: 1 to 6, respectively. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and Sc olMc are given as SEQ ID NOs: 25 to 28, 33, and 34, respectively. Items (b) to (d) of the above item (1) define derivatives of ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and ScolMc that have or contain a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE1c, ScolE1d, Sco lE1e, ScolMa, ScolMb, and ScolMc having or containing a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst Items (b) to (d) of the above item (1) define derivatives of ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and ScolMc that have or contain a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst having or containing a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE1c, ScolE1d, Sco lE1e, ScolMa, ScolMb, and ScolMc having or containing a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE1c, ScolE1d, Sco lE1e, ScolMa, ScolMb, and ScolMc having or containing a derivative binding domain (or amino acid sequence segment). Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst Similarly, items (B) to (E) and items (α) to (δ) (defined below) are for ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, ScolE2, ScolE3, ScolE7, ScolE1a, ScolE1b, Spst, Define derivatives of ScolE1c, ScolE1d, ScolE1e, ScolMa, ScolMb, and also ScolMc. ScolE2, ScolE3, ScolE7, Sc olE1a, ScolE1b, Spst, ScolE1c, ScolE1d, ScolE 1e, ScolMa, ScolMb, and derivatives of ScolMc can preferably exert a cytotoxic effect on Salmonella.

[0024] In the present invention, the salmosins ScolE1c, ScolE1d, ScolE1e, Scol Ma, ScolMb, and ScolMc (and their derivatives as defined) are preferred; ScolMa, ScolMb, and ScolMc (and their derivatives as defined herein) are more preferred. ScolMb, particularly ScolMc (and their derivatives as defined herein) are most preferred due to their very excellent ease of purification after expression and their antibacterial activity. ScolMc (and its derivatives as defined herein) is also preferred due to its very excellent high antibacterial activity (see, for example, Example 23). ScolE1a and ScolE1b and Sco lE1D as well as their derivatives as defined herein are preferred for use in combination with the ScolM salmosins (such as ScolMa, ScolMb,

[0025] and ScolMc) as defined herein and their derivatives. In this specification, an amino acid sequence segment (or, briefly, a Refers to continuous amino acid residues. In this specification, a domain is also referred to as an "amino acid sequence segment" or briefly as a "segment". The terms "protein" and "polypeptide" are used interchangeably in this specification.

[0026] The protein of the present invention contains at least a binding domain. Each of the following items (i) to (v), (vii) to (x), (xi), and (xii) of items (b) to (d) defines a preferred binding domain. The most preferred binding domain is that of items (a-i) to (a-v), (a-vii) to (a-x), (a-xi), and (a-xii). Each item (vi) of the following items (b) to (d), that is, sub-items (b-vi), (c-vi), and (d-vi) contains a binding domain and defines a preferred amino acid sequence segment that is a derivative of salmosin Sp st. The protein of the present invention preferably contains any one of the following amino acid sequence segments: (b-i) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1), (b-ii) A segment having at least 75%, preferably 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 315 to 483 of ScolE3 (SEQ ID NO: 2), (b-iii) A segment having at least 80%, preferably at least 85%, more preferably at least 9 (b-iv) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 317 to 447 of ScolE4 (SEQ ID NO: 4), (b-v) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 319 to 453 of ScolE5 (SEQ ID NO: 5), (b-vii) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 316 to 448 of ScolE6 (SEQ ID NO: 6), (b-viii) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 318 to 452 of ScolE8 (SEQ ID NO: 8), (b-ix) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 317 to 447 of ScolE9 (SEQ ID NO: 9), (b-x) A segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 319 to 453 of ScolE10 (SEQ ID NO: 10), (b-xi) A segment having at least 80%, preferably at least 85%, more preferably at least 9 a segment having at least 0%, most preferably at least 95% sequence identity, (b-iv) a segment of amino acid residues 174-297 of ScolE1a (SEQ ID NO: 4) having at least 80%, preferably at least 85%, more preferably at least 9 0%, most preferably at least 95% sequence identity, (b-v) to a segment of amino acid residues 198-322 of ScolE1b (SEQ ID NO: 5) having at least 80%, preferably at least 85%, more preferably at least 90 %, most preferably at least 95% sequence identity, (b-vi) comprising at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6 having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity; in one embodiment, at least 250 consecutive amino acid residues of Spst of SEQ ID NO: 6 having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity; in a further embodiment; in a further embodiment, the protein has at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the (entire) amino acid sequence of SEQ ID NO: 6 and comprises, consists of, or is composed of an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity thereto, (b-vii) a segment of amino acid residues 195-319 of ScolE1c (SEQ ID NO: 25) having at least 80%, preferably at least 85%, more preferably at least 80% a segment having at least 90%, most preferably at least 95% sequence identity, (b-viii) a segment of amino acid residues 195 to 319 of ScolE1d (SEQ ID NO: 26) having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment, (b-ix) a segment of amino acid residues 193 to 317 of ScolE1e (SEQ ID NO: 27) having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment, (b-x) to a segment of amino acid residues 38 to 138 of ScolMa (SEQ ID NO: 28) having at least 80%, preferably at least 85%, more preferably at least 90% and most preferably at least 95% sequence identity to the segment, (b-xi) to a segment of amino acid residues 38 to 138 of ScolMb (SEQ ID NO: 33) having at least 80%, preferably at least 85%, more preferably at least 90 %, even more preferably at least 95%, most preferably at least 97% sequence iden tity to the segment, or (b-xii) a segment of amino acid residues 38 to 138 of ScolMc (SEQ ID NO: 34) having at least 80%, preferably at least 85%, more preferably at least 9 0%, even more preferably at least 95%, most preferably at least 97% sequence identity to the segment, or (c-i) having at least 90%, preferably at least 95% sequence similarity to a segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1) to the segment, (c-ii) a segment of amino acid residues 315 to 483 of ScolE3 (SEQ ID NO: 2) with at least 85%, preferably at least 90%, more preferably at least 95 % sequence similarity, (c-iii) a segment of amino acid residues 318 to 451 of ScolE7 (SEQ ID NO: 3) with at least 90%, preferably at least 95% sequence similarity, segment, (c-iv) a segment of amino acid residues 174 to 297 of ScolE1a (SEQ ID NO: 4) with at least 90%, preferably at least 95% sequence similarity, segment, (c-v) a segment of amino acid residues 198 to 322 of ScolE1b (SEQ ID NO: 5) with at least 90%, preferably at least 95% sequence similarity, , (c-vi) containing at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6 with at least 90%, preferably at least 95% sequence similarity, segment; in one embodiment, at least 250 consecutive amino acid residues of Spst of SEQ ID NO: 6 with at least 90%, preferably at least 95% sequence similarity; in a further embodiment, the protein comprises, or consists of, an amino acid sequence having at least 80%, preferably at least 90%, most preferably at least 95% sequence similarity to the (entire) amino acid sequence of SEQ ID NO: 6, (c-vii) a segment of amino acid residues 195 to 319 of ScolE1c (SEQ ID NO: 25) with at least 90%, preferably at least 95% sequence similarity, segment, ment, (c-viii) A segment of amino acid residues 195 to 319 of ScolE1d (SEQ ID NO: 26) having at least 90%, preferably at least 95% sequence similarity to the segment ment, (c-ix) A segment of amino acid residues 193 to 317 of ScolE1e (SEQ ID NO: 27) having at least 90%, preferably at least 95% sequence similarity to the segment nt, (c-x) A segment having at least 90%, preferably at least 95% sequence similarity to the segment of amino acid residues 38 to 138 of ScolMa (SEQ ID NO: 28) (c-xi) A segment having at least 90%, preferably at least 95%, more preferably at least 97 % sequence similarity to the segment of amino acid residues 38 to 138 of ScolMb (SEQ ID NO: 33), or (c-xii) A segment having at least 90%, preferably at least 95%, more preferably at least 9 7% sequence similarity to the segment of amino acid residues 38 to 138 of ScolMc (SEQ ID NO: 34), or (d-i) A segment having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1) (d-ii) A segment having 1 to 30, preferably 1 to 29, more preferably 1 to 10 amino acid substitutions with respect to the segment of amino acid residues 315 to 483 of ScolE3 (SEQ ID NO: 2), additions, insertions or deletions (d-iii) A segment of amino acid residues 318 to 451 of ScolE7 (SEQ ID NO: 3) For the segment having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-iv) For the segment of amino acid residues 174 to 297 of ScolE1a (SEQ ID NO: 4), (d-iv) For the segment of amino acid residues 174 to 297 of ScolE1a (SEQ ID NO: 4), there is a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-v) For the segment of amino acid residues 198 to 322 of ScolE1b (SEQ ID NO: 5), there is a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-vi) For the segment containing at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6, there is a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions; in one embodiment, for the segment containing at least 250 consecutive amino acid residues of Spst of SEQ ID NO: 6, there is a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions; in a further embodiment, the protein comprises or consists of an amino acid sequence having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions with respect to the (entire) amino acid sequence of SEQ ID NO: 6, (d-vii) For the segment of amino acid residues 195 to 319 of ScolE1c (SEQ ID NO: 25), there is a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, (d-vii) For the segment of amino acid residues 195 to 319 of ScolE1c (SEQ ID NO: 25), there is a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, a segment having preferably 1 to 10 amino acid substitutions, additions, insertions or deletions , (d-viii) with respect to the segment of amino acid residues 195 to 319 of ScolE1d (SEQ ID NO: 26) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions , (d-ix) with respect to the segment of amino acid residues 193 to 317 of ScolE1e (SEQ ID NO: 27) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions, (d-x) with respect to the segment of amino acid residues 38 to 138 of ScolMa (SEQ ID NO: 28) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10, most preferably 1 to 5 amino acid substitutions, additions, insertions or deletions having, (d-xi) with respect to the segment of amino acid residues 38 to 138 of ScolMb (SEQ ID NO: 33) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10, most preferably 1 to 5 substitutions, additions, insertions or deletions of amino acid residues having, or (d-xii) with respect to the segment of amino acid residues 38 to 138 of ScolMc (SEQ ID NO: 34) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10, most preferably 1 to 5 substitutions, additions, insertions or deletions of amino acid residues having. Among the above proteins (or polypeptides), the numbers ( Those of the subclass specified by (vii) to (xii) are preferred (in all of classes (a) to (d)), and those of subclasses (x), (xi) and (xii) are more preferred.

[0027] In another embodiment, the present invention preferably provides a protein capable of exerting a cytotoxic effect against Salmonella, and the amino acid sequence of the protein is as described above in items (a-i) to (a-vi), (a-vii) to (a-x), (a-xi), ( a-xii), (b-i) to (b-vi), (b-vii) to (b-x), (b-x i), (b-xii), (c-i) to (c-vi), (c-vii) to (c-x), (c-xi), (c-xii), (d-i) to (d-vi), or from (d-vii) to (d-x), (d-xi), (d-xii), defined by any one of them, or defined by including any one of their segments. In a preferred embodiment , the amino acid sequence of the protein (or polypeptide) is the item defined above from (a-vii) to (a-x), (a-xi), (a-xii), (b-vii) to (b-x), (b-xi), (b-xii), (c-vii) to (c-x), (c-x i), (c-xii), or from (d-vii) to (d-x), (d-xi), (d-x ii), defined by any one of them, or defined by including any one of their segments . In a more preferred embodiment, the amino acid sequence of the protein is the item (a-x), (a-xi), (a-xii), (b-x) defined above, (b-xi), (b-xii), (c-x), (c-xi), (c-xii), or (d-x), (d-xi), (d-xii), or It is defined by any one of (d-x), (d-xi), (d-xii), or is defined by including any one segment thereof.

[0028] Preferably, alternatively or additionally, the protein is (b-x), (c-x), (d- x), (b-xi), (c-xi), (d-xi), (b-xii), (c-xii), as defined by any one of (d-xii), and the amino acid residue corresponding to residue 155 of SEQ ID NO: 33 is Pro, and / or the amino acid residue corresponding to residue 246 of SEQ ID NO: 33 is Arg or Lys, preferably Arg. Alternatively or additionally, the amino acid residues corresponding to residues 76 and 84 of SEQ ID NO: 33 may be Gln.

[0029] As used herein, the expression "the amino acid residue corresponding to residue xx... of SEQ ID NO: yy" means that the amino acid sequence of the aforementioned protein has the amino acid residue shown at the position corresponding to residue xx of SEQ ID NO: yy. Here, xx represents the number of amino acid residues (from the N-terminus) in the amino acid sequence of the protein, and yy represents the indicated SEQ ID NO:

[0030] The corresponding amino acid residue can be determined by aligning the protein with the amino acid sequence of SEQ ID NO: 33 to obtain the most suitable alignment (e.g., as performed and shown in FIG. 34). The expression "the amino acid residue(s) corresponding to residue..." refers to the alignment shown in FIG. 34, and has the same position (i.e., written one above the other) as the indicated amino acid residue of SEQ ID NO: yy (here, SEQ ID NO: 33) in the said alignment.

[0031] When a protein is defined by the number or range of numbers of amino acid substitutions, additions, insertions or deletions in this specification, the amino acid substitutions, additions, insertions or deletions may be combined, but a given number or range of numbers refers to the sum of all amino acid substitutions, additions, insertions and deletions. Among amino acid substitutions, additions, insertions and deletions, amino acid substitutions, additions and deletions are preferred. The term "insertion" relates to an insertion within the amino acid sequence of the reference sequence, i.e., excluding additions at the C or N terminus. The term "addition" means an addition at the C or N terminus of the amino acid sequence of the reference sequence. A deletion may be a deletion of an amino acid residue at the terminus or within the reference sequence. In this specification, when a protein or any domain thereof is defined by the number or range of numbers of amino acid substitutions, additions, insertions or deletions with respect to the indicated amino acid sequence of a segment, in a further embodiment, the protein or domain has one to several amino acid substitutions, additions, insertions or deletions with respect to the indicated amino acid sequence of the segment.

[0032] The cytotoxic domain or catalytic domain of the protein of the present invention may be as defined in item (3) above. In a preferred embodiment, the protein of the present invention comprises, or consists of, a cytotoxic domain or a catalytic domain comprising any one of the following amino acid sequence segments: (b-i) A segment having at least 80%, preferably at least 85%, more preferably at least 90 %, most preferably at least 95% sequence identity to the segment of amino acid residues 453 to 582 of 'ScolE2 (SEQ ID NO: 1), ​(b-ii) A segment of amino acid residues 501 to 584 of ScolE3 (SEQ ID NO: 2) having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment, (b-iii) A segment of amino acid residues 455 to 584 of ScolE7 (SEQ ID NO: 3) having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment, (b-iv) A segment of amino acid residues 306 to 478 of ScolE1a (SEQ ID NO: 4) having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment, (b-v) A segment of amino acid residues 350 to 522 of ScolE1b (SEQ ID NO: 5) having at least 80%, preferably at least 85%, more preferably at least 9 0%, and most preferably at least 95% sequence identity to the segment, (b-vi) A segment having at least 80%, preferably at least 85%, more preferably at least 90% and most preferably at least 95% sequence identity to the segment of amino acid residues 112 to 288 of Spst (SEQ ID NO: 6), (b-vii) A segment of amino acid residues 347 to 519 of ScolE1c (SEQ ID NO: 25) having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment, (b-viii) A segment of amino acid residues 347 to 519 of ScolE1d (SEQ ID NO: 26) ​Segments having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the (b-ix) segment of amino acid residues 347-517 of 'ScolE1e (SEQ ID NO: 27), Segments having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the (b-x) segment of amino acid residues 139-269 of 'ScolMa (SEQ ID NO: 28) Segments having at least 80%, preferably at least 85%, more preferably at least 9 0%, and most preferably at least 95% sequence identity to the (b-xi) segment of amino acid residues 139-269 of 'ScolMb (SEQ ID NO: 33) Segments having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 97% sequence identity, or (b-xii) segment of amino acid residues 139-269 of 'ScolMc (SEQ ID NO: 34) Segments having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 97% sequence identity, or (c-i) segments having at least 90%, preferably at least 95% sequence similarity to the segment of amino acid residues 453-582 of 'ScolE2 (SEQ ID NO: 1) , (c-ii) segment of amino acid residues 501-584 of 'ScolE3 (SEQ ID NO: 2) Segments having at least 90%, preferably at least 95% sequence similarity to and (c-iii) the segment of amino acid residues 455 - 584 of ’ScolE7 (SEQ ID NO: 3) Segments having at least 90%, preferably at least 95% sequence similarity to and (c-iv) the segment of amino acid residues 306 - 478 of ’ScolE1a (SEQ ID NO: 4) Segments having at least 90%, preferably at least 95% sequence similarity to and (c-v) the segment of amino acid residues 350 - 522 of ’ScolE1b (SEQ ID NO: 5) Segments having at least 90%, preferably at least 95% sequence similarity to and (c-vi) Segments having at least 90%, preferably at least 95% sequence similarity to the segment of amino acid residues 112 - 288 of ’Spst (SEQ ID NO: 6) and (c-vii) the segment of amino acid residues 347 - 519 of ’ScolE1c (SEQ ID NO: 25) Segments having at least 90%, preferably at least 95% sequence similarity to this segment (c-viii) the segment of amino acid residues 347 - 519 of ’ScolE1d (SEQ ID NO: 26) Segments having at least 90%, preferably at least 95% sequence similarity to this segment (c-ix) the segment of amino acid residues 345 - 517 of ’ScolE1e (SEQ ID NO: 27) Segments having at least 90%, preferably at least 95% sequence similarity to this segment (c-x) the segment of amino acid residues 139 - 269 of ’ScolMa (SEQ ID NO: 28) Segments having at least 90%, preferably at least 95% sequence similarity to and (c-xi) Segment of amino acid residues 139 - 269 of ScolMb (SEQ ID NO: 33) Segments having at least 90%, preferably at least 95%, more preferably at least 97% sequence similarity to, or (c-xii) Segment of amino acid residues 139 - 269 of ScolMc (SEQ ID NO: 34) Segments having at least 90%, preferably at least 95%, more preferably at least also 97% sequence similarity to, or (d-i) Segment of amino acid residues 453 - 582 of ScolE2 (SEQ ID NO: 1) having 1 - 20, preferably 1 - 15, more preferably 1 - 10 amino acid substitutions, additions, insertions or deletions relative to (d-ii) Segment of amino acid residues 501 - 584 of ScolE3 (SEQ ID NO: 2) having 1 - 20, preferably 1 - 15, preferably 1 - 10 amino acid substitutions, additions, insertions or deletions relative to (d-iii) Segment of amino acid residues 455 - 584 of ScolE7 (SEQ ID NO: 3) having 1 - 20, preferably 1 - 15, preferably 1 - 10 amino acid substitutions, additions, insertions or deletions relative to (d-iv) Segment of amino acid residues 306 - 478 of ScolE1a (SEQ ID NO: 4) having 1 - 30, preferably 1 - 20, more preferably 1 - 15, preferably 1 - 10 amino acid substitutions, additions, insertions or deletions relative to (d-v) Segment of amino acid residues 350 - 522 of ScolE1b (SEQ ID NO: 5) 1 to 30, preferably 1 to 20, more preferably 1 to 15, preferably 1 ~10 amino acid substitutions, additions, insertions or deletions in the segment, (d-vi)’ For the segment of amino acid residues 112 to 288 of Spst (SEQ ID NO: 6) 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions insertions or deletions in the segment, (d-vii)’ For the segment of amino acid residues 347 to 519 of ScolE1c (SEQ ID NO: 25) 1 to 30, preferably 1 to 20, more preferably 1 to 15, preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the segment, (d-viii)’ For the segment of amino acid residues 347 to 519 of ScolE1d (SEQ ID NO: 26) 1 to 30, preferably 1 to 20, more preferably 1 to 15, preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the segment, (d-ix)’ For the segment of amino acid residues 345 to 517 of ScolE1e (SEQ ID NO: 27) 1 to 30, preferably 1 to 20, more preferably 1 to 15, preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the segment, (d-x)’ For the segment of amino acid residues 139 to 269 of ScolMa (SEQ ID NO: 28) 1 to 30, preferably 1 to 20, more preferably 1 to 15, preferably 1 ~10 amino acid substitutions, additions, insertions or deletions in the segment, (d-xi)’ For the segment of amino acid residues 139 to 269 of ScolMb (SEQ ID NO: 33) 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10, most preferably at least 1 to 5 substitutions, additions of amino acid residues A segment having an insertion or deletion, (d-xii)' A segment of amino acid residues 139 to 269 of ScolMc (SEQ ID NO: 34) having 1 to 30, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10, and most preferably at least 1 to 5 amino acid residue substitutions, additions, insertions or deletions. A segment having an insertion or deletion.

[0033] In a more preferred embodiment, the protein of the present invention comprises a cytotoxic domain or a catalytic domain comprising any one of sequence segments (a-vii)' to (a-x)', (a-xi)' or (a-xii)'. It consists of or contains a cytotoxic domain or a catalytic domain.

[0034] The protein can be as defined in any one of (b-x)', (c-x)', (d-x)', (b-xi)', (c- xi)', (d-xi)', (b-xii)', (c-xii)', or (d-xii )', and the amino acid residue corresponding to residue 155 of SEQ ID NO: 33 in the previous mentioned protein is Pro, and / or the amino acid residue corresponding to residue 246 of SEQ ID NO: 33 is Arg or Lys, preferably Arg. Alternatively or further, the amino acid residues corresponding to residues 76 and 84 of SEQ ID NO: 33 can be Gln. It can be obtained.

[0035] In this specification, in any item (x-y)' (where x represents any one of a, b, c, or d, and y represents any Roman numeral from i to xii), the prime ' indicates a catalytic domain or segment. The item (x-y) without a prime indicates a binding domain or segment. The item (x-y)'' having a double prime '' indicates a metastasis ​Indicates a domain or segment. Among items (a) to (d), those of items (a), (b) and (d) are preferred, and items (a) and (d) are more preferred. Similarly, among items ( a)' to (d)', those of items (a)', (b)' and (d)' are preferred, and items (a)' and (d)' are more preferred. Similarly, among items (a)'' to (d)'' , those of items (a)'', (b)'' and (d)'' are preferred, and items (a)'' and (d)'' are more preferred.

[0036] When the protein of the present invention contains a binding domain defined herein and a catalytic domain defined herein, any binding domain (or segment) defined above may be combined with any catalytic domain (or segment). In a preferred embodiment, the binding domain of any sub-item from (i) to (x) is, in the protein of the present invention, each combined with the catalytic domain of sub-items (i)' to (x)' respectively (for example, the binding domain of item (iii) is combined with the catalytic domain of item (iii)'), whereby the catalytic domain may be present on the C-terminal side of the protein. In one embodiment, the binding domain of any of items (a) to (d) is combined with the catalytic domain of items (a)' to (d)' respectively, whereby the catalytic domain may be present on the C-terminal side of the protein. In certain embodiments, the protein of the present invention may be capable of exerting a cytotoxic effect against Salmonella, and the protein comprises at least any one of the following combinations of amino acid sequence segments, preferably in a given order from the N-terminus to the C-terminus of the protein.

[0037] In certain embodiments, the protein of the present invention may be capable of exerting a cytotoxic effect against Salmonella, and the protein comprises at least any one of the following combinations of amino acid sequence segments, preferably in a given order from the N-terminus to the C-terminus of the protein. at least any one of the following combinations of amino acid sequence segments, preferably in a given ​Included in order: (α-i) A segment of amino acid residues 316 - 449 of SEQ ID NO: 1 and the segment of amino acid residues 453 - 582 of SEQ ID NO: 1, (α-ii) A segment of amino acid residues 315 - 483 of ScolE3 of SEQ ID NO: 2 and also the segment of amino acid residues 501 - 584 of SEQ ID NO: 2, (α-iii) A segment of amino acid residues 318 - 451 of SEQ ID NO: 3 and the segment of amino acid residues 455 - 584 of SEQ ID NO: 3, (α-iv) A segment of amino acid residues 174 - 297 of SEQ ID NO: 4 and the segment of amino acid residues 306 - 478 of SEQ ID NO: 4, (α-v) A segment of amino acid residues 198 - 322 of SEQ ID NO: 5 and the segment of amino acid residues 350 - 522 of SEQ ID NO: 5, (α-vi) A segment containing amino acid residues 112 - 288 of SEQ ID NO: 6, a segment containing at least 200 consecutive amino acid residues of SEQ ID NO: 6, (α-vii) A segment of amino acid residues 195 - 319 of SEQ ID NO: 25 and the segment of amino acid residues 347 - 519 of SEQ ID NO: 25, (α-viii) A segment of amino acid residues 195 - 319 of SEQ ID NO: 26 and the segment of amino acid residues 347 - 519 of SEQ ID NO: 26, (α-ix) A segment of amino acid residues 193 - 317 of SEQ ID NO: 27 and the segment of amino acid residues 345 - 517 of SEQ ID NO: 27, (α-x) A segment of amino acid residues 38 - 138 of SEQ ID NO: 28 and the segment of amino acid residues 139 - 269 of SEQ ID NO: 28, (α-xi) A segment of amino acid residues 38 - 138 of SEQ ID NO: 33 and the segment of amino acid residues 139 - 269 of SEQ ID NO: 33, or (α-xii) A segment of amino acid residues 38 to 138 of SEQ ID NO: 34 and SEQ ID NO: 3 A segment of amino acid residues 139 to 269 of 4, or (β-i) At least 7 A segment having 5% sequence identity to the segment of amino acid residues 316 to 449 of SEQ ID NO: 1 and at least 70% Sequence identity to the segment of amino acid residues 453 to 582 of SEQ ID NO: 1, (β-ii) At least A segment having 70% sequence identity to the segment of amino acid residues 315 to 483 of SEQ ID NO: 2 and at least 70% Sequence identity to the segment of amino acid residues 501 to 584 of SEQ ID NO: 2, (β-iii) At least A segment having 77% sequence identity to the segment of amino acid residues 318 to 451 of SEQ ID NO: 3 and at least 70% Sequence identity to the segment of amino acid residues 455 to 584 of SEQ ID NO: 3, (β-iv) At least A segment having 70% sequence identity to the segment of amino acid residues 174 to 297 of SEQ ID NO: 4 and at least 70% Sequence identity to the segment of amino acid residues 306 to 478 of SEQ ID NO: 4, (β-v) At least 7 A segment having 0% sequence identity to the segment of amino acid residues 198 to 322 of SEQ ID NO: 5 and at least 70% Sequence identity to the segment of amino acid residues 350 to 522 of SEQ ID NO: 5, (β-vi) At least A segment having 70% sequence identity to the segment of amino acid residues 112 to 288 of SEQ ID NO: 6, including at least 200 consecutive Segments having at least 70% sequence identity to segments containing the amino acid residues in question segment, (β-vii) A segment having at least 70% sequence identity to the segment of amino acid residues 195 to 319 of SEQ ID NO: 25 and a segment having at least 70% sequence identity to the segment of amino acid residues 347 to 519 of SEQ ID NO: 25, (β-viii) A segment having at least 70% sequence identity to the segment of amino acid residues 195 to 319 of SEQ ID NO: 26 and a segment having at least 70% sequence identity to the amino acid residues 347 to 519 of SEQ ID NO: 26, (β-ix) A segment having at least 70% sequence identity to the segment of amino acid residues 193 to 317 of SEQ ID NO: 27 and a segment having at least 70% sequence identity to the amino acid residues 345 to 5 17 of SEQ ID NO: 27, (β-x) A segment having at least 7 0% sequence identity to the segment of amino acid residues 38 to 138 of SEQ ID NO: 28 and a segment having at least 70% sequence identity to the segment of amino acid residues 139 to 269 of SEQ ID NO: 28, (β-xi) A segment having at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 38 to 138 of SEQ ID NO: 33 and a segment having at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 139 to 269 of SEQ ID NO: 33, a segment having, (β-xii) A segment having at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 38-138 of SEQ ID NO: 34 and a segment having at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 139-269 of SEQ ID NO: 34, or or (χ-i) A segment having at least 8 5% sequence similarity to the segment of amino acid residues 316-449 of SEQ ID NO: 1 and a segment having at least 80% sequence similarity to the segment of amino acid residues 453-582 of SEQ ID NO: 1, (χ-ii) A segment having at least 80% sequence similarity to the segment of amino acid residues 315-483 of SEQ ID NO: 2 and a segment having at least 80% sequence similarity to the segment of amino acid residues 501-584 of SEQ ID NO: 2, (χ-iii) A segment having at least 85% sequence similarity to the segment of amino acid residues 318-451 of SEQ ID NO: 3 and a segment having at least 80% sequence similarity to the segment of amino acid residues 455-58 4 of SEQ ID NO: 3, (χ-iv) A segment having at least 80% sequence similarity to the segment of amino acid residues 174-297 of SEQ ID NO: 4 and a segment having at least 80% sequence similarity to the segment of amino acid residues 306-478 of SEQ ID NO: 4, (χ-v) A segment having at least 8 Segments having 0% sequence similarity and amino acid residues 350 to 522 of SEQ ID NO: 5 Segments having at least 80% sequence similarity to the segment, (χ-vi) At least 80% sequence similarity to the segment of amino acid residues 112 to 288 of SEQ ID NO: 6, including at least 200 consecutive Segments having at least 80% sequence similarity to the segment containing amino acid residues, Segments, (χ-vii) At least 80% sequence similarity to the segment of amino acid residues 195 to 319 of SEQ ID NO: 25 and at least 80% sequence similarity to the segment of amino acid residues 347 to 519 of SEQ ID NO: 25, (χ-viii) At least 80% sequence similarity to the segment of amino acid residues 195 to 319 of SEQ ID NO: 26 and at least 80% sequence similarity to the segment of amino acid residues 347 ~519 of SEQ ID NO: 26, (χ-ix) At least 80% sequence similarity to the segment of amino acid residues 193 to 317 of SEQ ID NO: 27 and at least 80% sequence similarity to the segment of amino acid residues 345 to 5 17 of SEQ ID NO: 27, or (χ-x) At least 80% sequence similarity to the segment of amino acid residues 38 to 138 of SEQ ID NO: 28 and at least 80% sequence similarity to the segment of amino acid residues 139 to 269 of SEQ ID NO: 28, (χ-xi) At least 80%, preferably at least 90%, most preferably at least 95% sequence similarity a segment having and a segment of amino acid residues 139 to 269 of SEQ ID NO: 33 with at least 80%, preferably at least 90%, most preferably at least 95% sequence similarity, (χ-xii) a segment having at least 80% with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34, preferably at least 90%, most preferably at least 95% sequence similarity a segment having and a segment of amino acid residues 139 to 269 of SEQ ID NO: 34 with at least 80%, preferably at least 90%, most preferably at least 95% sequence similarity, or (δ-i) a segment having 1 to 25 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 316 to 449 of SEQ ID NO: 1 and a segment of amino acid residues 453 to 582 of SEQ ID NO: 1 having 1 to 30 amino acid substitutions, additions, insertions or deletions, a segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 315 to 483 of SEQ ID NO: 2 and a segment of amino acid (δ-ii) residues 501 to 584 of SEQ ID NO: 2 having 1 to 30 amino acid substitutions, additions, insertions or deletions, (δ-iii) a segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 318 to 451 of SEQ ID NO: 3 and a segment of amino acid residues 455 to 584 of SEQ ID NO: 3 having 1 to 30 amino acid substitutions, additions, insertions or (δ-iv) a segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 174 to 297 of SEQ ID NO: 4 or deletions, a segment having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 318 to 451 of SEQ ID NO: 3 and a segment of amino acid (δ-iv) a segment having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 174 to 297 of SEQ ID NO: 4 Segments having amino acid substitutions, additions, insertions or deletions, and amino acids of SEQ ID NO: 4 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 306 to 478 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 306 to 478 of SEQ ID NO: 4, (δ-v) Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 198 to 322 of SEQ ID NO: 5 and amino acids of SEQ ID NO: 5 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 198 to 322 of SEQ ID NO: 5 and amino acids of SEQ ID NO: 5 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 350 to 522 of SEQ ID NO: 5 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 350 to 522 of SEQ ID NO: 5, (δ-vi) Segments having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 112 to 288 of SEQ ID NO: 6, including segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to a segment of at least 200 consecutive amino acid residues of SEQ ID NO: 6 Segments having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 112 to 288 of SEQ ID NO: 6, including segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to a segment of at least 200 consecutive amino acid residues of SEQ ID NO: 6 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to a segment of at least 200 consecutive amino acid residues of SEQ ID NO: 6 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to a segment of at least 200 consecutive amino acid residues of SEQ ID NO: 6, (δ-vii) Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of SEQ ID NO: 25 and amino acids of SEQ ID NO: 25 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of SEQ ID NO: 25 and amino acids of SEQ ID NO: 25 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of SEQ ID NO: 25 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of SEQ ID NO: 25, (δ-viii) Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of SEQ ID NO: 26 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of SEQ ID NO: 26 and amino acids of SEQ ID NO: 26 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 195 to 319 of SEQ ID NO: 26 and amino acids of SEQ ID NO: 26 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 347 to 519 of SEQ ID NO: 26 (δ-ix) Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 193 to 317 of SEQ ID NO: 27 and amino acids of SEQ ID NO: 27 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 193 to 317 of SEQ ID NO: 27 and amino acids of SEQ ID NO: 27 Segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 345 to 517 or segments having deletions, or (δ-x) Segments having 1 to 30 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 28 and segments having 1 to 40 amino acid substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 28 or segments having deletions, (δ-xi) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 33 and segments having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 33 (δ-xii) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34 and segments having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 34 (δ-xii) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34 and segments having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 34 (δ-xii) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34 and segments having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 34 (δ-xii) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34 and segments having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 34 (δ-xii) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34 and segments having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 139 to 269 of SEQ ID NO: 34 (δ-xii) Segments having 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions with respect to the segment of amino acid residues 38 to 138 of SEQ ID NO: 34

[0038] The protein preferably comprises a combination of amino acid sequence segments defined by subclasses (vii) to (xii), even more preferably by (x), (xi), or (xii). It includes at least any one of them.

[0039] All of these embodiments are the minimum arrays of their respective segments defined herein with preferred values for identity or similarity, or may be combined with preferred numbers of amino acid substitutions, additions, insertions or deletions.

[0040] Item (4) of the above (Summary of the Invention) is for the translocation domains of ScolE2, ScolE3, ScolE7, S colE1a, ScolE1b, ScolE1c, ScolE1d, ScolE1e, S colMa, ScolMb, and ScolMc and their derivatives are defined. The definition of the translocation domains and their derivatives may be combined with the definition of the cytotoxic domain and the binding domain or their derivatives. The definition of the translocation domains and those derivatives may be combined in particular with the definition of the proteins defined below.

[0041] The protein of the present invention may have a binding domain (or binding segment) according to any one of items (a-i) to (a-x), (a-xi) and (a-x ii), or according to any one of items (b-i) to (b-x), (b-xi) and (b -xii), (c-i) to (c-x), (c-xi) and (c-xii), or derivatives of (d-i) to (d-x), (d-xi) and (d-xii). Preferably, the protein of the present invention has a binding domain (or binding segment) according to any one of items (a-vii) to (a-x), (a-xi) and (a-xii), or according to any one of items (b-vii) to (b-x), (b-xi) and (b -xii), (c-vii) to (c-x), (c-xi) and (c-xii), or (d-vii) to (d-x), (d-xi) and (d-xii). or a derivative of (d-vii) to (d-x), (d-xi) and (d-xii). It may have a binding domain (or binding segment) by any of these. Any such binding do main may be combined with a catalytic / cytotoxic domain by any one of items (a-i)' to (a-x)', (a- xii)', (b-i)' to (b-x)', (b-xi)', (b-xii)', (c -i)' to (c-x)', (c-xi)', (c-xii)', or (d-i)' to (d-x), (d-xi)', or (d-xii)'. Preferably, any such binding domain is any one of items (a-vii)' to (a-x)', (a- xi)', (a-xii)', (b -vii)' to (b-x)', (b-xi)', (b-xii)', (c-vii)' to (c-x)', (c-xi)', (c-xii)', or (d-i)' to (d- x), (d-xi)', (d-xii)' and may be combined with a catalytic / cytotoxic domain, and this preferred embodiment is preferably combined with the preferred binding domain given above in this paragraph. The domain structure of salmosin enables the establishment of artificial salmosin, in which various salmosin-derived domains of the present invention or derivatives thereof defined in this specification are combined to form a novel salmosin (chimeric salmosin). In such a chimeric salmosin, the domain sequence of the natural salmosin of the translocation domain (if present), the binding domain and the catalytic or active do main from the N-terminus to the C-terminus may or may not be maintained, preferably

[0042] it is maintained. Thus, the protein of the present invention has, from the N-terminus to the C-terminus, items from the N-terminus to the C-terminus, the translocation domain (if any), the binding domain and the catalytic or active domain, and the domain sequence of the natural salmosin may or may not be maintained, preferably it is maintained. Thus, the protein of the present invention has, from the N-terminus to the C-terminus, items from the N-terminus to the C-terminus, the translocation domain (if present), the binding domain and the catalytic or active domain, and the domain sequence of the natural salmosin may or may not be maintained, preferably it is maintained. Thus, the protein of the present invention has, from the N-terminus to the C-terminus, items from the N-terminus to the C-terminus, the translocation domain (if present), the binding domain and the catalytic or active domain, and the domain sequence of the natural salmosin may or may not be maintained, preferably Any one of (a-i) through (a-x), (a-xi), and (a-xii), or any one of items (b-i) through (b-x), (b-xi), (b-xii), (c-i) through (c-x), (c-xi), (c-xii), or any one of items (d-i) through (d-x), (d- xi), (d-xii) derivatives of the binding domain, and items (a-i )’ through (a-x)’, (a-xi)’, (a-xii)’, (b-i)’ through (b-x ’)’, (b-xi)’, (b-xii)’, (c-i) through (c-x)’, (c-xi) ’), (c-xii)’ or any one of items (d-i)’ through (d-x)’, (d-xi)’, (d-x ii)’ of any one of the catalytic domain (segment). In a preferred embodiment the protein of the present invention, from the N-terminus to the C-terminus, items (a-i)’’ through (a-ix) ’’, (b-i)’’ through (b-ix)’’, (c-i)’’ through (c-ix)’’ or is any one of items (d-i)’’ through (d-ix)’’ of the transfer domain, items (a-i) any one of through (a-x), or any one of items (b-i) through (b-x), (c-i) or any one of derivatives of through (c-x) or (d-i) through (d-x) binding domain , and items (a-i)’ through (a-x)’, (b-i)’ through (b-x)’, (c-i )’ through (c-x)’ or any one of items (d-i)’ through (d-x)’ of any one of the catalytic domain (segment).

[0043] Among the three cytotoxic activities of salmocins, nuclease, pore formation and muramidase (Table 1 ), the domains can be exchanged between salmocins of the same type of cytotoxic activity. For example , The novel sarmocine having RNase-type cytotoxicity may be formed from the translocation domain and binding domain of ScolE2 or Sco lE7 (or derivatives of these domains), and may also be formed from the cytotoxic domain of ScolE3. However, preferably, any one of the binding domains in sub-items (i) to (x) is combined with any one of the catalytic domains in sub-items (i)' to (x)' respectively, in order to enhance the similarity to natural sarmocine and, preferably, with any one of items (a) to (d) respectively. However, more preferably, any one of the binding domains in sub-items (i) to (v) or (vii) to (x) is combined with, preferably, any one of items (a) to (d) respectively, any one of the catalytic domains in sub-items (i)' to (v)' or (vii)' to (x)', and any one of the translocation domains in sub-items (i)'' to (v)'' or (vii)'' to (x)'' respectively, in order to enhance the similarity to natural sarmocine. In another embodiment, the binding domains in sub-items (i) to (v) are combined with, preferably, any one of items (a) to (d) respectively, any one of the catalytic domains in sub-items (i)' to (vi)' (preferably (i)' to (v)') in order to enhance the similarity to natural sarmocine. In a further embodiment, any one of the binding domains in sub-items (i) to (v) is combined with, preferably, any one of items (a) to (d) respectively, any one of the catalytic domains in sub-items (i)' to (v)' and any one of the translocation domains in sub-items (i)'' to (v)'' respectively, in order to enhance the similarity to natural sarmocine.

[0044] In another embodiment, the binding domains in sub-items (i) to (v) are combined with, preferably, any one of items (a) to (d) respectively, any one of the catalytic domains in sub-items (i)' to (v)' (preferably (i)' to (v)') in order to enhance the similarity to natural sarmocine. In a further embodiment, any one of the binding domains in sub-items (i) to (v) is combined with, preferably, any one of items (a) to (d) respectively, any one of the catalytic domains in sub-items (i)' to (v)' and any one of the translocation domains in sub-items (i)'' to (v)'' respectively, in order to enhance the similarity to natural sarmocine. In a further embodiment, any one of the binding domains in sub-items (i) to (v) is combined with, preferably, any one of items (a) to (d) respectively, any one of the catalytic domains in sub-items (i)' to (v)' and any one of the translocation domains in sub-items (i)'' to (v)'' respectively, in order to enhance the similarity to natural sarmocine. is combined with.

[0045] The present invention also provides a protein that can preferably exert a cytotoxic effect against Salmonella, and the protein includes the following amino acid sequences or consists of the following: : (A-i) SEQ ID NO: 1, (A-ii) SEQ ID NO: 2, (A-iii) SEQ ID NO: 3, (A-iv) SEQ ID NO: 4, (A-v) SEQ ID NO: 5, (A-vi) SEQ ID NO: 6, (A-vii) SEQ ID NO: 25, (A-viii) SEQ ID NO: 26, (A-ix) SEQ ID NO: 27, (A-x) SEQ ID NO: 28, (A-x) SEQ ID NO: 33, or (A-x) SEQ ID NO: 34, or (B-i) an amino acid sequence having at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, even more preferably at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 1, (B-ii) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 93%, even more preferably at least 96% sequence identity to the amino acid sequence of SEQ ID NO: 2, (B-iii) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 3, (B-iv) an amino acid sequence having at least 70%, preferably at least also 80%, more preferably at least 85%, even more preferably at least 90%, and an amino acid sequence having at least 95% sequence identity, (B-v) at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 5, (B-vi) at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 6, (B-vii) at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90% and even more preferably an amino acid sequence having at least 95% sequence identity, (B-viii) at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90 %, and even more preferably an amino acid sequence having at least 95% sequence identity, (B-ix) at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and even more preferably an amino acid sequence having at least 95% sequence identity, (B-x) at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and more preferably having at least 95%, most preferably having at least 97% sequence identity amino acid sequence, (B-xi) having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, even more preferably at least 95%, most preferably at least 97% sequence identity with the amino acid sequence of SEQ ID NO: 33, or (B-xii) having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90% , even more preferably at least 95%, most preferably at least 97% sequence identity with the amino acid sequence, or (C-i) having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 1, (C-ii) having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 2, (C-iii) having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 3, (C-iv) having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 4, (C-v) having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence An amino acid sequence having similarity, (C-vi) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95% amino acid sequence having sequence similarity, (C-vii) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95% amino acid sequence having sequence similarity, (C-viii) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95 % amino acid sequence having sequence similarity, (C-ix) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95% of amino acid sequence having sequence similarity, (C-x) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95%, most preferably at least 97% amino acid sequence having sequence similarity, (C-xi) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95%, most preferably at least 97% amino acid sequence having sequence similarity, or (C-xii) At least 80%, preferably at least also 85%, more preferably at least 90%, even more preferably at least 95% , an amino acid sequence having at least 97% sequence similarity, most preferably or (D-i) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 1, (D-ii) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 2, (D-iii) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 3, (D-iv) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 4, (D-v) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 5, (D-vi) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 6, (D-vii) 1 to 40, preferably 1 to 30 , more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 25, (D-viii) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 26, (D-ix) 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 27, (D-x) 1 to 40, preferably 1 to 30, more preferably 1 to 20, even more preferably 1 to 10, and most preferably 1 to 5 amino acid substitutions, additions, insertions or deletions in the amino acid sequence of SEQ ID NO: 28, (D-xi) 1 to 40, preferably 1 to 30, more preferably 1 to 20, even more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions in the amino acid sequence, or (D-xii) 1 to 40, preferably 1 to 30 , more preferably 1 to 20, even more preferably 1 to 10, and most preferably 1 to 5 amino acid residue substitutions, additions, insertions or deletions in the amino acid sequence, or (E-i) an amino acid sequence comprising, or consisting of, at least 470, preferably at least 525, more preferably at least 555 consecutive amino acid residues of SEQ ID NO: 1 , (E-ii) an amino acid sequence comprising, or consisting of, at least 470, preferably at least 525, more preferably at least 555 consecutive amino acid residues of SEQ ID NO: 2 sequence, (E-iii) at least 470, preferably at least 525, more preferably at least 555 consecutive amino acid residues, or consisting of an amino acid sequence, (E-iv) at least 390, preferably at least 435, more preferably at least 460 consecutive amino acid residues, or consisting of an amino acid sequence sequence, (E-v) at least 425, preferably at least 475, more preferably at least 500 consecutive amino acid residues, or consisting of an amino acid sequence , (E-vi) at least 250, preferably at least 270, more preferably at least 282 consecutive amino acid residues, or consisting of an amino acid sequence sequence, (E-vii) at least 425, preferably at least 475, more preferably at least 500 consecutive amino acid residues, or consisting of an amino acid sequence, (E-viii) at least 425, preferably at least 475, more preferably at least 500 consecutive amino acid residues, or consisting of an ami no acid sequence, (E-ix) at least 425, preferably at least 475, more preferably at least 500 consecutive amino acid residues, or consisting of an amino acid sequence, (E-x) at least 215, preferably at least 240, more preferably at least 260 consecutive amino acid residues, or consisting of an amino acid sequence sequence, (E-xi) at least 215, preferably at least 240, more preferably at least 260 consecutive amino acid residues, or consisting of, an amino acid sequence, or (E-xii) at least 215, preferably at least 240, more preferably at least 260 consecutive amino acid residues, or consisting of, an amino acid sequence.

[0046] As is generally understood, and to avoid any doubt, the expression "a protein comprising any one of the following amino acid sequences" means that the amino acid sequence of said protein may contain additional amino acid residues or sequence stretches (such as purification tags or other tags) other than those defined. The expression "a protein consisting of any one of the following amino acid sequences" means that the amino acid sequence of said protein has no additional amino acid residues other than those defined. As described above, among the above proteins (or polypeptides), those of the subclass identified by numbers (vii) to (xii) are preferred (in all classes (a) to (d)), and those of subclasses (x), (xi) and (xii) are more preferred. This also applies to the preferred embodiments described below.

[0047] In another embodiment, the present invention provides a protein that can preferably exert a cytotoxic effect against Salmonella, and the amino acid sequence of said protein is as described in items

[0047] (A-i) to (A-x), (A-xi), (A-xii), (B-i) to (B-x) (A-i) to (A-x), (A-xi), (A-xii), (B-i) to (B-x), (B-xi), (B-xii), (C-i) to (C-x), (C-xi), (C-x (A-i) to (A-x), (A-xi), (A-xii), (B-i) to (B-x), (B-xi), (B-xii), (C-i) to (C-x), (C-xi), (C-xii). 、(B-xi)、(B-xii)、(C-i)から(C-x)、(C-xi)、(C-xii). ii), (D-i) to (D-x), (D-xi), (D-xii), or (E-i) as defined by any one of (E-x), (E-xi), or (E-xii). In a preferred embodiment, the present invention preferably provides a protein capable of exerting a cytotoxic effect against Salmonella, and the amino acid sequence of said protein is as defined by any one of items (A-vii) to (A-x), (A-xi), (A-xii), (B-v ii) to (B-x), (B-xi), (B-xii), (C-vii) to (C-x) , (C-xi), (C-xii), (D-vii) to (D-x), (D-xi), (D -xii), or (E-vii) to (E-x), (E-xi), or (E-xi i). The above definition of the protein related to the entire sequences of SEQ ID NOs: 1 to 6, 25 to 28, 33 or 34, if available, is based on one or more specific domains, such as binding and / or catalytic or cytotoxic domains and / or translocation domains, and may be combined with the above definition of the protein. In this specification, the determination of sequence identity and similarity is performed using Align Sequences

[0048] Protein BLAST (BLASTP2.6.1+) (Stephen F. Al tschul, Thomas L. Madden, Alejandro A. Schaf fer, Jinghui Zhang, Zheng Zhang, Webb Mille r and David J. Lipman (1997), "Gapped BLAST a

[0049] In this specification, the determination of sequence identity and similarity is performed using Align Sequences Protein BLAST (BLASTP2.6.1+) (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller and David J. Lipman (1997), "Gapped BLAST a nd PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). nd PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). nd PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25: 3389~3402.) is used for this purpose.

[0050] Items (b) to (d), (b)' to (d)', (b)'' to (d)'', or items (B) to (D) or (E) of the domain and / or derivative of the protein of the present invention defined above can retain the amino acid residues defined below despite the sequence diversity enabled by the embodiments defined above. In a preferred embodiment, the amino acid residue(s) correspond to the following. Residue 125 of SEQ ID NO: 4 is Asn or Ser; Residue 145 of SEQ ID NO: 4 is Lys or Arg; Residue 151 of SEQ ID NO: 4 is Ala or Gly; Residue 154 of SEQ ID NO: 4 is Ala, Ser or Gly; Residue 155 of SEQ ID NO: 4 is Phe, Leu or Ile; Residue 158 of SEQ ID NO: 4 is Ala or Gly; Residue 163 of SEQ ID NO: 4 is Glu, Asp, Ser, Leu or Ile, preferably Gl u, Asp or Ser; Residue 165 of SEQ ID NO: 4 is Ala, Thr, Val or Ser, preferably Ala, T hr or Val; Residue 167 of SEQ ID NO: 4 is Arg; Residue 172 of SEQ ID NO: 4 is Thr, Ala or Ser; Residue 175 of SEQ ID NO: 4 is Gln; Residue 176 of SEQ ID NO: 4 is Val or Leu; Residue 178 of SEQ ID NO: 4 is Gln or Leu, preferably Gln; The residue 181 of SEQ ID NO: 4 is Glu or Asp, preferably Glu; The residue 184 of SEQ ID NO: 4 is Arg or Gln, preferably Arg; The residue 192 of SEQ ID NO: 4 is Ala or Thr; The residue 195 of SEQ ID NO: 4 is Ala or Val; The residue 196 of SEQ ID NO: 4 is Glu or Gln, preferably Glu; The residue 198 of SEQ ID NO: 4 is Ala or Thr; The residue 209 of SEQ ID NO: 4 is Leu or Ile, preferably Leu; The residue 273 of SEQ ID NO: 4 is Leu or Ile; The residue 280 of SEQ ID NO: 4 is Arg; The residue 283 of SEQ ID NO: 4 is Lys; The residue 286 of SEQ ID NO: 4 is Gln or Lys; The residue 290 of SEQ ID NO: 4 is Ala or Thr; The residue 299 of SEQ ID NO: 4 is Asp, Asn or Glu; The residue 301 of SEQ ID NO: 4 is Leu; The residue 302 of SEQ ID NO: 4 is Asn or Asp; The residue 346 of SEQ ID NO: 4 is Asn, Asp or Glu; The residue 363 of SEQ ID NO: 4 is Lys, Asn or Arg; The residue 364 of SEQ ID NO: 4 is Lys or Gln.

[0051] The expression "the amino acid residue(s) corresponding to the amino acid residue..." refers to the alignment shown in FIGS. 20A - C and FIG. 26, and means the amino acid residue of SEQ ID NO: 4 (ScolE1a), or also the amino acid residue of SEQ ID NOs: 1 - 3, 5, 6, 2 5, 26 or 27 that has the same position (i.e., written one above the other) as the amino acid residue shown for SEQ ID NO: 4 (ScolE1a) in the said alignment.

[0052] Derivatives of ScolE1a and ScolE1b and / or derivative domains of ScolE1a and ScolE1b are such that corresponding amino acid residues that are the same during the alignment of ScolE1a and ScolE1b in Figure 20 can be the same amino acid residues as in ScolE1a and ScolE1b, and / or where corresponding to different amino acid residues in ScolE1a and ScolE1b, some or all of such different amino acid residues can be amino acid residues similar to those in ScolE1a or ScolE1b ( however, not other amino acid residues).

[0053] Derivatives of ScolE2 and ScolE7 and / or derivative domains of ScolE2 and ScolE7 are such that corresponding amino acid residues that are the same during the alignment of ScolE2 and ScolE7 in Figure 20 can be the same amino acid residues as in ScolE2 or ScolE7, and / or where corresponding to different amino acid residues in ScolE2 and ScolE7, some or all of such different amino acid residues can be amino acid residues similar to those in ScolE2 or ScolE7 ( however, not other amino acid residues).

[0054] The salmosin according to the present invention can contain an additional N-terminal or C-terminal amino acid sequence stretch, for example a purification tag, for example as a His tag of 6 or more consecutive histidine residues, and the derivative preferably has no N-terminal amino acid residue addition.

[0055] The protein (salmosin) of the present invention preferably is from Salmonella, in particular, ​​​​​It can exert a cytotoxic effect against Salmonella enterica, more preferably Salmonella ente rica ssp.enterica. Whether this condition is met can be experimentally tested using a radial diffusion assay by the spot-on-lawn method. The cytotoxicity of the protein being tested against Salmonella enterica is determined by spotting 5 microliters of the solution of the protein being tested and the protein of SEQ ID NO: 1 onto a soft agar overlay plate inoculated with 0.14 mL of a bacterial solution of approximately 1×10 cfu / mL of a sensitive Salmonella enteri ca strain per cm 2 and then incubating the agar plate at 37°C. After 12 hours, the protein and the protein of SEQ ID NO: 1 produce spots 7 containing no viable bacteria of Salmonella enterica ssp.enterica serotype Newport strain ATCC® 6962™ of the same diameter, and the concentration of the protein being tested is at most 5 times that of the comparative solution of the protein of SEQ ID NO: 1. In a preferred embodiment, the reference point is the protein of SEQ ID NO: 4 or 5 under otherwise identical conditions rather than the protein of SEQ ID NO: 1 . After incubating the agar plate at 37°C and then after 12 hours, the protein and the protein of SEQ ID NO: 1 produce spots containing no viable bacteria of Salmonella enterica ssp.enterica serotype Newport strain ATCC® 6962™ of the same diameter . * The composition of the present invention contains the above protein (salmosin) and optionally, further components such as a carrier if necessary. The composition preferably contains ScolE1a and / or ScolE1b or derivatives thereof as described above, and optionally, a carrier etc. if necessary . In a preferred embodiment, the reference point is not the protein of SEQ ID NO: 1, but the protein of SEQ ID NO: 4 or 5 under otherwise identical conditions .

[0056] The composition of the present invention contains the above protein (salmosin) and optionally, further components such as a carrier if necessary. The composition preferably contains ScolE1a and / or ScolE1b or derivatives thereof as described above, and optionally, a carrier etc. if necessary including, and optionally, a carrier or the like as necessary It contains further components. The composition comprises one or more different types of thrombin (salmosin), for example, two, three or four different types of thrombin (salmosin). "Different" means that the proteins differ by at least one amino acid residue. The composition may comprise two, three or more salmosins from the same subclass represented by any one of the above items (i) to (x), ( xi) or (xii), or preferably, from different classes represented by any one of the above items (i) to (x). The composition may further comprise one or more E. coli colicins or their derivatives as described in EP3097783A1, for example, to simultaneously control pathogenic E. coli such as EHEC. The proteins of the present invention are preferably produced by expression in plants or their cells, so the composition may be plant material or an extract thereof. The plant material is a plant that expresses the protein, preferably Nicotiana or a material derived from an edible plant that expresses the protein. The extract of the plant material is an aqueous solution containing water-soluble proteins including the salmosin of the present invention present in or expressed in the plant material, or a dried product of such an aqueous solution. The extract preferably has water-insoluble components of the plant material removed, for example, by filtration or centrifugation. The plant material may be a material derived from a plant selected from the group consisting of spinach, purslane, beetroot, carrot, sugar beet, leaf beet, amaranth, Nic

[0057] otiana, and / or the above-mentioned plant and / or an extract thereof. The plant material is preferably a plant that expresses the protein, preferably Nicotiana or a material derived from an edible plant. The extract of the plant material is an aqueous solution containing water-soluble proteins including the salmosin of the present invention present in or expressed in the plant material, or a dried product of such an aqueous solution. The extract preferably has water-insoluble components of the plant material removed, for example, by filtration or centrifugation. The plant material may be a material derived from a plant selected from the group consisting of spinach, purslane, beetroot, carrot, sugar beet, leaf beet, amaranth, Nic otiana, and / or an extract thereof. The plant material may be a material derived from a plant selected from the group consisting of spinach, purslane, beetroot, carrot, sugar beet, leaf beet, amaranth, Nic otiana, and / or the above-mentioned plant The plant material is one or more leaves, roots, tubers or seeds, or a crushed, milled or ground product of said leaves, roots, tubers or seeds. or seeds.

[0058] The extract from the composition or plant material may be a solid or liquid composition, for example, a solution or dispersion, containing said salmosin(s). The liquid composition may be aqueous, for example, an aqueous solution. The concentration of the protein in the aqueous dispersion or solution may be from 0.0001 to 1 mg / ml, preferably from 0.001 to 0.1 mg / ml, more preferably from 0.005 to 0. 05 mg / ml. When more than one salmosin capable of exerting a cytotoxic effect against Salmonella is used, these concentrations relate to the total concentration of all such salmosins. g / ml, preferably 0.001 - 0.1 mg / ml, more preferably 0.005 - 0. 05 mg / ml. When more than one salmosin that can exert a cytotoxic effect against Salmonella is used, these concentrations are for the total concentration of all such salmosins.

[0059] The aqueous solution may contain a buffer in addition to one or more salmosins. The buffer may be an inorganic acid or an organic acid or their salts. Examples of inorganic acids are phosphoric acid or its salts. Examples of organic acids are HEPES, acetic acid, succinic acid, tartaric acid, malic acid, benzoic acid, cinnamic acid, glycolic acid, lactic acid, citric acid and ascorbic acid. Preferred organic acids are malic acid, lactic acid, citric acid and ascorbic acid. The pH of the solution is generally from 4 to 8, preferably from 5 to 8, more preferably from 6.0 to 7.5. When the object to which the composition is applied is meat, the pH of the solution is generally from 4 to 8, preferably from 4.5 to 7, more preferably from 5.0 to 6.5, even more preferably from 5.0 to 6.0. Further, the solution may contain an isotonic agent such as glycerol or a salt. Preferred salts for use are is malic acid, lactic acid, citric acid and ascorbic acid. The pH of the solution is generally 4 ~8, preferably 5~8, more preferably 6.0~7.5. When the object to which the composition is applied is meat, the pH of the solution is generally 4~8, preferably 4.5~7, more preferably ~8, preferably 5~8, more preferably 6.0~7.5. When the object to which the composition is applied is meat, the pH of the solution is generally 4~8, preferably 4.5~7, more preferably 4~8, preferably 4.5~7, more preferably 5.0~6.5, even more preferably 5.0~6.0. Further, the solution can contain an isotonic agent such as glycerol or a salt. Preferred salts for use are It is sodium chloride. An aqueous solution containing one or more salmosins may further contain additional solutes, such as for example salts, such as 50 - 400 mM NaCl, preferably 100 - 200 mM NaC l, and may be a buffered aqueous solution. The aqueous solution may further contain a sulfhydryl compound, such as dithiothreitol (DTT), dithioerythritol, thioethanol or glutathione, preferably DTT. The total concentration of sulfhydryl compounds in the aqueous solution may be 1 - 50 mM, preferably 2 - 20 mM, more preferably 4 - 10 mM.

[0060] When the composition of the present invention is a solid composition, it may be a powder such as a lyophilized solid composition obtained by lyophilizing the above-described extract or solution. The powder may contain additional solid components such as those described above for the aqueous solution. Before use, this can be reconstituted with a suitable liquid, for example water or a buffer. The solid composition may contain a buffer, salt or other components as described above, so that upon reconstitution or dissolution of the solid composition, the concentrations described above can be achieved.

[0061] Examples of carriers for the composition are solvents such as water or aqueous buffers (as described above), salts, sugars, for example monosaccharides and disaccharides, sugar alcohols, and other carriers such as those known in pharmaceutical compositions. Examples of the latter are starch, cellulose and other proteins, such as albumin. Examples of sugars are glucose, fructose, lactose, sucrose and maltose.

[0062] The composition of the present invention is at least 10% by weight based on the total weight of the proteins in the composition. ​​​​​​, preferably at least 20% by weight, more preferably at least 30% by weight, even more preferably at least 50% by weight, and even more preferably at least 75% by weight of one or more of the salmosins of the present invention can be included. The content of salmosin(s) in the composition can be determined by subjecting the composition to SDS-PAGE, and after staining, analyzing the resulting gel by determining the intensity of the bands of the gel. Thereby, the intensity of the band due to salmosin can be determined relative to the sum of the intensities of the bands due to all the proteins in the composition. The total protein content in the composition can be determined using the well-known Bradford protein assay.

[0063] In one embodiment, the composition of the present invention is a pharmaceutical composition. The pharmaceutical composition can optionally contain, in addition to one or more of the salmosins(s) of the present invention, E. coli colicin and / or one or more suitable pharmaceutically acceptable excipients.

[0064] The present invention provides a method for preventing or reducing infection or contamination of an object by Salmonella comprising contacting the object with one or more of the above-mentioned proteins (salmosins) or the above-mentioned composition. The object can be any non-organic object or organic object, such as the surface of food. Contamination of an object by Salmonella means the attachment of viable Salmonella cells to the object. Reducing contamination by Salmonella means reducing the number of viable Salmonella cells attached to the object. Contamination of an object by Salmonella ​​​Verification is part of general knowledge. For example, dilution plating of a solution or dispersion of a homogenized food product, as carried out in the examples, or dilution plating of a washing solution of other objects can be used, followed by counting the bacterial colonies. Preferably , the object is food or animal feed. The food can be meat, for example, an entire poultry carcass, raw meat, processed meat and minced meat, eggs, for example, raw eggs, whole eggs, cooked eggs without the shell, fried eggs, omelets, raw fruits, or raw or cooked vegetables.

[0065] To treat the object with the protein or composition, or to bring it into contact with the protein or composition, the solution or liquid composition of the above protein is generally brought into contact with the object. For example, the object is sprayed with an aqueous solution as the composition of the present invention or immersed in an aqueous solution. The object may be immersed in the aqueous solution for at least 10 seconds, preferably at least 1 minute, preferably at least 5 minutes. Contacting the object with the liquid composition helps to distribute the composition on the surface of the object. If a sufficiently uniform distribution can be achieved, for example, when the meat is cut into small pieces, it is possible to contact the object with the solid composition according to the present invention.

[0066] The present invention also provides a method for treating an object in need thereof for Salmonella infection, comprising administering to the object one or more of the above proteins (salmosin) or the above composition. The object can be a human or a mammal, for example, a domestic animal. Examples of domestic animals are poultry and cows. Generally, salmosin(s) and optionally The liquid or solid pharmaceutical composition containing the above additional components is prepared for administration to animals or humans. The liquid composition may be the above aqueous solution. The solid composition may be, for example, a powder containing at least one salmosin(s) in freeze-dried form, or a tablet obtained from such a powder, or a capsule filled with such a powder. Administration may be oral. In this case, the pharmaceutical preparation should allow passage through the stomach without being attacked by the acidic medium of the stomach. Subsequently, the salmosin(s) must be released from the pharmaceutical preparation in the intestine. Such pharmaceutical preparations are known in the art. Examples are tablets and capsules resistant to the acidic medium of the stomach. It is further possible to orally administer to the patient a biological material, for example, E. coli or plant material containing the expressed salmosin(s). Salmosin(s) can be administered to human adults in an amount of 1 mg to 1000 mg per day, preferably 10 mg to 250 mg per day. Such amounts may also be administered to animals. In a probiotic approach, the patient can be treated by administering to the patient a genetically modified microorganism expressing at least one salmosin(s). The genetically modified microorganism may be a genetically modified non-pathogenic E. coli or a lactic acid-producing microorganism commonly used in the fermentation of dairy products. Examples of lactic acid-producing microorganisms are bacteria of the genus Lactobacillus such as Lactobacillus lactis, and also Bifidobacterium such as Bifidobacterium bifidum or Bifidobacterium breve. Another route of administration is by injection into the patient's bloodstream for the prevention of infection by Salmonella. For this purpose ​ For this purpose, salmocins (plural) may be dissolved in physiological saline, and this solution is sterilized to be

[0067] In the above method, Salmonella is Salmonella enterica, preferably Salmonella enterica ssp. enterica .

[0068] Salmocins ScolE1a and ScolE1b, as demonstrated in the following examples , have particularly broad activity against many different serotypes of Salmonella, particularly Salmonella enterica, preferably Salmonella enterica ssp. enterica. Therefore, ScolE1a and ScolE1 b or their derivatives are preferably used for treating infections by any Salmonella enteric a, preferably any Salmonella enterica ssp. enteri ca, or for preventing or reducing contamination by these. Salmocins E2, E3, E7 and Spst also have broad activity against the target Salmonella . However, ScolE2 and their derivatives can preferably be used against strains 1, 3, 4, 15, 20, 22 - 30 defined in Tables 5A and 5B. ScolE3 and their derivatives can preferably be used against strains 1, 3, 4 defined in Tables 5A and 5B, 17 and 20 - 25. ScolE7 and their derivatives can preferably be used against strains 1, 3, 4, 5, 15, 20, 22 - 30 and 32 defined in Tables 5A and 5B.

[0069] ​​The salmosin according to the present invention may be produced by known methods of protein expression in standard expression systems. To produce salmosin, the nucleotide sequence encoding it can be expressed in a suitable host organism. Methods possible for producing and purifying the protein of interest are described in the prior art, and any such method can be used. For example, an E. coli expression system generally known in the art can be used. When a eukaryotic expression system is used, one or more introns may be inserted into the coding sequence of salmosin to prevent toxicity to the bacterial organism used for cloning. Particularly efficient expression methods are plant expression systems also known in the prior art. The plant expression systems that can be used to express the salmosin according to the present invention are described in the examples. A possible method for achieving the expression of the nucleotide sequence of interest in plants is the use of a self-replicating (viral) replicon containing the nucleotide sequence encoding salmosin. The coding sequence of salmosin may be codon-optimized for expression in a particular plant used as a plant or expression host. Plant virus expression systems are described in many publications, such as WO2012019660, WO2008028661, WO2006003018, WO2005071090, WO2005049839, WO2006012906, WO02101006, WO2007137788 or WO02068664, and many further publications are cited in these documents. For transient expression, various methods for introducing nucleic acid molecules such as DNA molecules into plants or plant parts are known. Agrobacterium

[0070] ​​​​​​​​​​​​​​​​The rear part can be used to transfect a plant with a nucleic acid molecule (vector) or a nucleic acid construct, for example, by agroinfiltration or spraying with an Agrobacterium suspension. For references, see WO2012019660, WO2014 187571, or WO2013149726.

[0071] In embodiments where strong expression of salmosin as the protein of interest is desired, a nucleic acid construct containing a nucleotide sequence encoding salmosin can encode a viral vector that can replicate in a plant cell to form a replicon of the viral vector. To replicate, the viral vector and the replicon can contain an origin of replication that can be recognized by a nucleic acid polymerase present in the plant cell, for example, a viral polymerase expressed from the replicon. In the case of an RNA viral vector (referred to as an "RNA replicon"), the replicon can be formed from a DNA construct by transcription under the control of a promoter activity in the plant cell after the DNA construct has been introduced into the nucleus of the plant cell. In the case of a DNA replicon, the replicon can be formed by recombination between two recombination sites flanking the sequence encoding the viral replicon in the DNA construct, as described, for example, in WO00 / 17365 and WO99 / 22003. When the replicon is encoded by a DNA construct, an RNA replicon is preferred. The use of DNA and RNA viral vectors (DNA or RNA replicons) has been widely described in the literature for many years. The said embodiment is the following patent gazettes: WO2008028661, WO20071377 88, WO2006003018, WO2005071090, WO200504983 9, WO02097080, WO02088369, WO02068664. Examples of DNA virus vectors are those based on geminivirus. For the present invention, virus vectors or replicons may preferably be those based on plant RNA viruses, particularly plus-sense single-stranded RNA viruses. Thus, the viral replicon may be a plus-sense single-stranded RNA replicon. Examples of such viral vectors are those based on tobacco mosaic virus (TMV) and potato virus X (PVX). "Based on" means that the viral vector uses a replication system such as replicase and / or other proteins involved in the replication of these viruses. Viral vectors and expression systems based on potato virus are described in EP2061890 or WO20 08 / 028661. Salmosin can be expressed in multicellular plants or parts thereof, particularly higher plants or parts thereof. Both monocotyledonous and dicotyledonous (crop) plants can be used. Common plants that can be used to express the protein of interest include Nicotiana benthamiana a, Nicotiana tabacum, spinach, Brassica camp estris, B. juncea, beet (Beta vulgaris), cress, alugra, mustard, strawberry, Chenopodium capitatum, lettuce,

[0072] sunflower, cucumber, Chinese cabbage, cabbage, carrot, leek, onion, radish, lettuce can be used. As general plants that can be used to express the protein of interest, there are Nicotiana benthamiana a, Nicotiana tabacum, spinach, Brassica camp estris, B. juncea, beet (Beta vulgaris), cress, alugra, mustard, strawberry, Chenopodium capitatum, lettuce, sunflower, cucumber, Chinese cabbage, cabbage, carrot, leek, onion, radish, lettuce Turnips, field peas, cauliflower, broccoli, burdock, turnips, tomatoes, eggplants, cabbages Examples include tea, watermelon, prince melon and melon. Preferred plants are spinach Spinach, mustard spinach, beet roots, carrots, sweet radishes, Nicotiana tab acum and Nicotiana benthamiana. Expression in edible plants can prevent contamination of plants or foods made from them by Salmonella and can be used for this purpose. In one embodiment, plants that do not normally enter the human or animal food chain, such as Nicotiana species such as N. tabacum and N. benthamiana, are used plants, such as Nicotiana species such as N. tabacum and N. benthamiana, which do not normally enter the human or animal food chain, are used

[0073] Generally, salmosin as the protein of interest is expressed in the cytosol of plant or plant parts cells. In this case, a signal peptide that directs the protein of interest to a specific compartment is not added to the protein. Alternatively, the protein of interest can be expressed in the chloroplasts of plants or targeted thereto, in the latter case, a plastid transit peptide or an N-terminal presequence generally referred to as a chloroplast targeting peptide is added to the N-terminus or C-terminus, preferably the N-terminus, of salmosin as the protein of interest cells, or targeted thereto, in the latter case, a plastid transit peptide or a chloroplast targeting peptide generally referred to as an N-terminal presequence is added to the N-terminus or C-terminus, preferably the N-terminus, of salmosin as the protein of interest

[0074] Salmosin can be co-expressed with the immune proteins described in the experimental section to prevent toxicity to plant tissues, especially when salmosin has nuclease activity Appropriate immune proteins that can be co-expressed are those shown in Table 2 below

[0075] In a method for producing a composition containing at least one salmosin, salmosin is the first step ​​​​​​In step, it is expressed in a plant or a plant cell, such as an edible plant. In the next step , plant material containing the expressed salmosin is collected from the plant expressing salmosin. The plant material may be, for example, leaves, roots, tubers or seeds, or crushed , milled or ground products of leaves, roots, tubers or seeds. In step (iii), salmosin is extracted from the plant material using an aqueous buffer . This can include the plant material being homogenized and the removal of insoluble substances by centrifugation or filtration . The soluble components containing salmosin are extracted into the aqueous buffer, resulting in a salmosin solution in the aqueous buffer . The aqueous buffer can contain an inorganic acid or an organic acid or their salts and can have the pH defined above for the aqueous solution as a composition of the present invention . Further, the aqueous buffer can similarly contain the salts and / or sulfhydryl compounds described above for the aqueous solution as a composition of the present invention . If a relatively pure salmosin composition is desired, the salmosin solution in the aqueous buffer can be further purified by removing unwanted components in step (iv) according to known methods of protein purification .

[0076] Accordingly, the present invention provides a method for producing a composition containing a protein according to the present invention , said method comprising (i) expressing said protein in a plant as described above, preferably an edible plant or Nicotiana , (ii) collecting plant material containing the expressed protein from said plant, (iii) extracting said protein from said plant material using an aqueous buffer, and said The step of obtaining a composition containing a protein Optionally, the step of removing unwanted contaminants from the composition comprising

[0077] When salmosin is expressed in plants, the plant or its tissue expressing the protein is collected and the tissue may be homogenized, and insoluble substances may be removed by centrifugation or filtration If relatively pure salmosin is desired, salmosin is removed from other host cell proteins and plant metabolites, such as alkaloids and polyphenols by generally known methods of protein purification that can do so, for example, by chromatography methods and may be further purified. The purified salmosin solution may be concentrated and / or lyophilized

[0078] When salmosin is expressed in edible plants, crude protein extracts or semi-purified concentrates from the edible plants can be used to prevent or reduce contamination of objects such as food by Salmonella

[0079] Preferred embodiments A protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-x), (B-x), (C-x), (D-x), or (E-x)

[0080] A protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xi), (B-xi), (C-xi), (D-xi), or (E-xi) A protein whose amino acid sequence comprises or consists of the amino acid sequence (A-xii), (B-xii), (C-xii), ( D-xii), or (E-xii) ​​

[0081] The protein according to any one of the above three preferred embodiments (sentences). wherein the protein is (B-x), (C-x), (D-x), (E-x), (B-xi) , (C-xi), (D-xi), (E-xi), (B-xii), (C-xii), (D -xii), or (E-xii) as defined by any one of them, preferably , (B-xi), (C-xi), (D-xi), (E-xi), (B-xii), (C- xii), (D-xii), or (E-xii) as defined by any one of them ; the amino acid residue of the protein corresponding to residue 155 of SEQ ID NO: 33 is Pro, and / or the amino acid residue corresponding to residue 246 of SEQ ID NO: 33 is Arg or Ly s, preferably Arg, the protein wherein the amino acid residues corresponding to residues 76 and 84 of SEQ ID NO: 33 are both Gln .

[0082] The amino acid sequence contains, or consists of, any one of the amino acid sequences (A-viii), (B-viii), (C-viii ), (D-viii), or (E-viii), and optionally, further as defined above for the amino acid residues corresponding to SEQ ID NO: 4 is a protein (ScolE1d of SEQ ID NO: 26 or a derivative thereof).

[0083] The amino acid sequence contains, or consists of, any one of the amino acid sequences (A-x), (B-x), (C-x), (D-x), or (E-x), and optionally, further as defined above for specific amino acid residues, and a protein whose amino acid sequence contains, or consists of, any one of the amino acid ​A composition comprising a protein comprising any one of the arrays (A-v), (B-v), (C-v), (D-v), or (E-v); or consisting of such; a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xi), (B-xi), (C-xi), (D-xi), or (E-xi), and optionally further is as defined above with respect to specific amino acid residues, and a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-v), (B-v), (C-v), (D-v), or (E-v); A composition comprising a protein comprising any one of the arrays (A-v), (B-v), (C-v), (D-v), or (E-v); or consisting of such; a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xii), (B-xii), (C-xii), (D-xii), or (E-xii), and optionally further is as defined above with respect to specific amino acid residues, and a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-v), (B-v), (C-v), (D-v), or (E-v); A composition comprising a protein comprising any one of the arrays (A-v), (B-v), (C-v), (D-v), or (E-v); or consisting of such; a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-x), (B-x), (C-x), (D-x), or (E-x), and optionally further is as defined above with respect to specific amino acid residues, and a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-iv), (B-iv), (C-iv), (D-iv), or (E-iv); A composition comprising a protein comprising any one of the arrays (A-v), (B-v), (C-v), (D-v), or (E-v); or consisting of such; a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xi), (B-xi), (C-xi), (D-xi), or (E-xi), and optionally further is as defined above with respect to specific amino acid residues; A protein that is as defined above with respect to a specific amino acid residue, and an amino acid sequence is , a protein comprising or consisting of any one of amino acid sequences (A-iv), (B-iv), (C-iv), (D-iv), or (E -iv); a composition comprising the same; An amino acid sequence comprising or consisting of any one of amino acid sequences (A-xii), (B-xii), (C-xii), ( D-xii), or (E-xii), and optionally, further a protein that is as defined above with respect to a specific amino acid residue, and an amino acid sequence comprising or consisting of any one of amino acid sequences (A-iv), (B-iv), (C-iv), (D-iv), or (E-iv); a composition comprising the same. A protein or composition according to any one of the above sentences for use in a method of treating an infection of a subject by Salmonella.

[0084] A method of preventing or reducing an infection or contamination of a subject by Salmonella, the method comprising contacting the subject with a protein defined by any one of the above sentences or a composition defined by any one of the above sentences. A method of preventing or reducing an infection or contamination of a subject by Salmonella, the method comprising contacting the subject with a protein comprising or consisting of any one of amino acid sequences (A-x), (B-x), (C-x), (D-x), or ( E-x) (optionally further as defined above with respect to a specific amino acid residue), or contacting the subject with an amino acid sequence comprising or consisting of any one of amino acid sequences (A-x), (B-x), (C-x), (D-x), or ( E-x).

[0085] A method of preventing or reducing an infection or contamination of a subject by Salmonella, the method comprising contacting the subject with a protein comprising or consisting of any one of amino acid sequences (A-x), (B-x), (C-x), (D-x), or ( E-x) (optionally further as defined above with respect to a specific amino acid residue), or contacting the subject with an amino acid sequence comprising or consisting of any one of amino acid sequences (A-x), (B-x), (C-x), (D-x), or ( E-x). An amino acid sequence comprising or consisting of any one of amino acid sequences (A-x), (B-x), (C-x), (D-x), or ( Either (E-x) (optionally further defined as above with respect to specific amino acid residues) A protein comprising or consisting of one of the following, and a composition comprising a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-v) , (B-v), (C-v), (D-v), or (E-v), contacting the composition with the subject. A method comprising contacting the subject with a composition comprising a protein comprising or consisting of one of the following, and a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-v)

[0086] A method for preventing or reducing infection or contamination of a subject by Salmonella comprising contacting the subject with a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xi), (B-xi), (C-xi) , (D-xi), or (E-xi) (optionally further defined as above with respect to specific amino acid residues) or contacting the subject with a composition comprising a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xi), (B-xi), (C-xi) , (D-xi), or (E-xi) (optionally further defined as above with respect to specific amino acid residues), and a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-v) , (B-v), (C-v), (D-v), or (E-v) (optionally further defined as above with respect to specific amino acid residues) A method comprising contacting the subject with a composition comprising a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xi), (B-xi), (C-xi) , (D-xi), or (E-xi) (optionally further defined as above with respect to specific amino acid residues), and a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-v) , (B-v), (C-v), (D-v), or (E-v) (optionally further defined as above with respect to specific amino acid residues). A method for preventing or reducing infection or contamination of a subject by Salmonella

[0087] comprising contacting the subject with a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xii), (B-xii), (C-xii) , (D-xii), or (E-xii) (optionally further defined as above with respect to specific amino acid residues) or contacting the subject with a composition comprising a protein whose amino acid sequence comprises or consists of any one of the amino acid sequences (A-xii), (B-xii), (C-xii) , (D-xii), or (E-xii) (optionally further defined as above with respect to specific amino acid residues), and the subject. contacting an object, or the amino acid sequence comprises any one of amino acid sequences (A-xii), (B- xii), (C-xii), (D-xii), or (E-xii) (optionally further defined as above for specific amino acid residues), or a protein consisting thereof, and contacting the object with a composition comprising a protein whose amino acid sequence comprises any one of amino acid sequences (A-v), (B-v), (C-v) , (D-v), or (E-v), or consisting thereof. A method comprising A method for treating an infection of a subject in need thereof by Salmonella, comprising administering to the subject a protein defined in any one of the above sentences or a composition defined in any one of the above sentences.

[0088] These preferred embodiments may be combined with other embodiments or preferred embodiments described herein.

[0089] These preferred embodiments may be combined with other embodiments or preferred embodiments described herein.

Examples

[0090] Example 1: Plasmid construct (Salmosin) Six salmosins representing four active groups were selected (Table 1).

[0091]

Table 1

[0092] This list includes salmosins ScolE2, ScolE3, ScolE7, ScolE1 a, ScolE1b and Spst. The respective amino acid sequences were obtained from GenBank and codon usage optimized for Nicotiana benthamiana ​​​The corresponding nucleotide sequences having usage frequencies were synthesized by Thermo Fisher Scien tific Inc. In the case of salmosins ScolE2, ScolE3 and Sco lE7, to prevent cytotoxicity in Escherichia coli cells used for cloning, the coding sequence was interrupted by the insertion of the cat1 intron (the first intron of the Ricinus communis cat1 gene for catalase Cat1 (GenBa nk: D21161.1, nucleotide positions 679 to 867)). The coding sequence of salmosin was inserted into the TMV-based assembled viral vector pNMD 035 (described in detail in WO2012 / 019660) to obtain the plasmid constructs depicted in FIGS. 1A - B nk:D21161.1, nucleotide positions 679 to 867)) to obtain the plasmid constructs depicted in FIGS. 1A - B In preliminary expression studies, bacteriocins having nuclease (RNase and DNase) activity were found to be very toxic to the plant tissues in which they were expressed 035 (described in detail in WO2012 / 019660) to obtain the plasmid constructs depicted in FIGS. 1A - B . Their expression resulted in tissue necrosis and insufficient accumulation of recombinant proteins

[0093] . However, co-expression with appropriate immune proteins reduced the toxic effects and dramatically increased the accumulation of these bacteriocins . The salmosin immune proteins used in the studies of the present inventors are listed in Table 2 . Their expression resulted in tissue necrosis and insufficient accumulation of recombinant proteins . However, co-expression with appropriate immune proteins reduced the toxic effects and dramatically increased the accumulation of these bacteriocins . The salmosin immune proteins used in the studies of the present inventors are listed in Table 2 . The salmosin immune proteins used in the studies of the present inventors are listed in Table 2

[0094]

Table 2

[0095] The immune proteins SImm E2 and SImmE7 for salmosins ScolE2 and ScolE7, respectively. The amino acid sequences of the immune proteins were obtained from GenBank Having a codon usage frequency optimized for Nicotiana benthamiana The corresponding nucleotide sequence was synthesized by Thermo Fisher Scientific Inc. and subcloned into the PVX-based vector pNMD670 described in WO2012 / 019660. The resulting plasmid construct is shown in Figure 1A.

[0096] Example 2: Expression screening of salmosin Using a needleless syringe, a diluted Agrobacterium tumefacie ns culture carrying a TMV-based vector for cytosolic salmosin expression was infiltrated at a rate into 6-week-old Nicotiana benthamiana plants. In the case of salmosin ScolE2 and ScolE7, an Agrobacterium culture carrying a TMV-based vector for salmosin expression was mixed at an equal ratio with another culture carrying a PVX-based vector for the expression of the corresponding immune protein. Each overnight culture was adjusted to OD = 1.5 and further diluted 1 :100 with infiltration buffer containing 10 mM MES, pH 5.5 and 10 mM MgSO 600 4 4. The plasmid constructs used in this experiment are outlined in Table 3. To determine the optimal collection time point, plant material was collected at several time points after infiltration and used for protein extraction with 5 volumes of buffer containing 50 mM HEPES (pH 7.0), 10 mM potassium acetate, 5 mM magnesium acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween- 20 and 300 mM NaCl. ​​​​​​​ was used. The Bradford assay was used to determine the concentration of total soluble protein (TSP), and SDS-PAGE using Coomassie staining was used to analyze the TSP extract. In the experiments of the present inventors, all tested thionins were moderately highly expressed, varying between 1.2 and 1.8 mg recombinant colicin / g FW or between 18 and 47% of TSP, as determined by comparison with bovine serum albumin (BSA) protein (Table 4). In the experiments of the present inventors, all tested thionins were moderately highly expressed, varying between 1.2 and 1.8 mg recombinant colicin / g FW or between 18 and 47% of TSP, as determined by comparison with bovine serum albumin (BSA) protein (Table 4). (Table 4). (Table 4).

[0097] [Table 3]

[0098] [Table 4]

[0099] Example 3: Activity screening of thionin The present inventors analyzed the antibacterial activity of recombinant thionin produced in plants against 36 strains of 33 different serotypes of S. enterica ssp. enterica. The details of the strains used in this experiment are shown in Tables 5A and 5B. The present inventors analyzed the antibacterial activity of recombinant thionin produced in plants against 36 strains of 33 different serotypes of S. enterica ssp. enterica. The details of the strains used in this experiment are shown in Tables 5A and 5B. The details of the strains used in this experiment are shown in Tables 5A and 5B.

[0100] [Table 5]

[0101] The antibacterial activity of the recombinant thionin-containing plant extract was tested by a radial diffusion assay using the spot-on-lawn method. For this purpose, agar plates covered with soft agar containing cells of the Salmonella strain to be tested were prepared. 15-2 0 ml of LB agar medium (1.5% w / v agar) was poured into a 10×10 cm square Petri dish. LB soft agar medium (0.8% (w (Table 4). (Table 4). / v) Agar was dissolved, and 20 ml of a fixed amount was transferred to a 50 ml plastic tube, and its temperature was adjusted to 50 - 55 °C. Salmo 600 nella overnight culture adjusted to OD = 1.0 was added to the soft agar medium at a ratio of 1:100, and finally OD 600 = 0.01 or approximately 1×10 7 cells / ml, and 20 ml of LB soft agar containing the Salmonella test strain was poured onto the pre - poured LB plate, and cm per 1×10 2 cfu / mL of 0.14 mL bacterial solution was obtained. 7

[0102] Plant leaf materials were extracted as described in Example 2. Using the same extraction buffer, starting from undiluted samples, a 1:1 dilution series of the plant extract was prepared. 5 μl of a fixed amount of the TSP dilution series was added to the agar plate, and the plate was incubated overnight at 37 °C. The antibacterial activity was evaluated based on the clearing zone.

[0103] Among the six tested salmosins, one showed narrow antibacterial activity (inhibiting 12% of the Spst - strain), one salmosin had an intermediate activity spectrum (inhibiting 60% of the ScolE3 - strain), and the other four had a broad activity spectrum: ScolE2 and S colE7 - inhibited approximately 90% of the strains. ScolE1a and ScolE1b - inhibited 100% of the strains (Figure 3).

[0104] Salmosins ScolE1 and ScolE1b showed not only broad but also significantly high activity against the tested Salmonella strains (Figures 4, 5). For semi - quantitative comparison, the relative antibacterial activity of recombinant colicin in arbitrary units (AU) is shown , which is a protein that results in a detectable clearing effect in the radial diffusion assay and was calculated as the dilution factor relative to the highest dilution of the extract. The antibacterial activity of salmosin against Salmonella strains calculated in AU per mg FW of plant tissue was, respectively, for Sc olE2, ScolE3, ScolE7, ScolE1a and ScolE1b and is shown in Figures 6, 8, 10, 12 and 14. This reflects the yield of specific active agents per unit of biomass, i.e., the specific production capacity of the host .

[0105] Figures 7, 9, 11, 13 and 15 show, respectively, the same activity calculated in AU per μg of recombinant salmosin proteins Scol E2, ScolE3, ScolE7, ScolE1a and ScolE1b, which reflects the specific antibacterial potency of salmosin .

[0106] Example 4: Plasmid construct (colicin) Six colicins representing two active groups were selected (Table 6). This list includes colicins colS4, col5, col10, colIa, colIb and colM. The respective amino acid sequences were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana bentha miana were synthesized by Thermo Fisher Scientific Inc. The colicin coding sequences were inserted into the TMV - based assembled viral vector pNMD035 (described in detail in WO201 2 / 019660) to give the plasmid constructs depicted in Figure 16 . ​​​An instruction was obtained. The coding sequence of colicin M was interrupted by the insertion of the cat1 intron (the first intron of the Ricinus communis cat1 gene for catalase Ca t1 (GenBank:D21161.1, nucleotide positions 679 to 867)).

[0107]

Table 6

[0108] Example 5: Expression Screening of Colicin Using a needleless syringe, a diluted Agrobacterium tumefaciens culture solution containing a TMV-based assembled vector for cytosolic colicin expression was infiltrated into 6-week-old Nicotiana benthamiana plants. The Agrobacterium overnight culture was adjusted to OD 600 = 1.5 and further diluted 1:100 with an infiltration buffer containing 10 mM MES, pH 5.5 and 10 mM MgSO 4 The plasmid constructs used in this experiment are outlined in Table 7. To determine the optimal collection time point, plant materials were collected at several time points after infiltration and used for protein extraction with 5 volumes of buffer containing 50 mM HEPES (pH 7.0), 10 mM potassium acetate, 5 mM magnesium acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween-20 and 300 mM NaCl. The Bradford assay was used to determine the concentration of total soluble protein (TSP), and SDS-PAGE using Coomassie staining was used to analyze the TSP extract. The extracts were analyzed. In the experiments of the present inventors, all the colicins tested varied between 1.5 and 4.7 mg of recombinant colicin / g FW or between 16 and 41% of TSP as determined by comparison with bovine serum albumin (BSA) protein and were expressed at moderately high levels (Table 8). and varied between 1.5 and 4.7 mg of recombinant colicin / g FW or between 16 and 41% of TSP as determined by comparison with bovine serum albumin (BSA) protein and were expressed at moderately high levels (Table 8).

[0109]

Table 7

[0110]

Table 8

[0111] Example 6: Activity Screening of Colicin The present inventors analyzed the antibacterial activity of recombinant colicins produced in plants against 35 strains of 32 different serotypes of S. enterica ssp. enterica. The details of the strains used in the inventors' experiments are shown in Tables 5A and 5B (strain numbers 1 to 35). The antibacterial activity of the recombinant colicin-containing plant extracts was tested by a radial diffusion assay using the spot-on-lawn method described in Example 3. The details of the strains used in the inventors' experiments are shown in Tables 5A and 5B (strain numbers 1 to 35).

[0112] The antibacterial activity of the recombinant colicin-containing plant extracts was tested by a radial diffusion assay using the spot-on-lawn method described in Example 3. Among the six colicins tested, one showed narrow antibacterial activity (inhibiting 25% of the strains), three colicins had an intermediate activity spectrum (inhibiting 48%, 46%, and 42% of the strains, respectively), and two colicins had a broad activity spectrum: colIa and colIb - inhibiting 96% and 89% of the strains, respectively (Figure 17). and three colicins had an intermediate activity spectrum (col5, col10, and colM - inhibiting 48%, 46%, and 42% of the strains, respectively), and two colicins had a broad activity spectrum: colIa and colIb - inhibiting 96% and 89% of the strains, respectively (Figure 17). and three colicins had an intermediate activity spectrum (col5, col10, and colM - inhibiting 48%, 46%, and 42% of the strains, respectively), and two colicins had a broad activity spectrum: colIa and colIb - inhibiting 96% and 89% of the strains, respectively (Figure 17). Among the six colicins tested, one showed narrow antibacterial activity (inhibiting 25% of the strains), three colicins had an intermediate activity spectrum (col5, col10, and colM - inhibiting 48%, 46%, and 42% of the strains, respectively), and two colicins had a broad activity spectrum: colIa and colIb - inhibiting 96% and 89% of the strains, respectively (Figure 17).

[0113] ​​​Example 7: S. enterica ssp. enterica added to the meat matrix Determination of the effect of the bactericidal action of bacteriocin (colicin mixture) against pathogenic strains of Colicin produced in plants was tested for its antibacterial activity against samples of minced chicken breast meat contaminated with pathogenic Salmonella.

[0114] The evaluation of the effect included the analysis of the population of pathogenic S. enterica ssp. enterica in contaminated meat samples (subsequently treated with a control carrier solution consisting of a mixture of recombinant colicins made in plants or plant extracts from the same production host but without colicin, and the treated meat samples were stored at 4 °C for various periods).

[0115] To ensure that bacteriocin activity is evaluated in a representative consumer product, no special source of meat samples is used. Minced raw chicken breast meat is purchased at the retail store 1 day before the experiment (for these studies, ALDI supermarket, Halle, Germany). The meat is stored at 4 °C and not washed or pretreated before the experimental exposure.

[0116] The meat test matrix consists of serotypes Typhimurium and Enteritidis (ATCC® 9270 (TM), ATCC® 13076 * (TM) (TM) * ) or Typhimurium, Enteritidis, Newport and Anatum (ATCC® 9270 * (TM), ATCC® 13076 * (TM), ATCC® 6962 * and ATCC® Trademark) 9270 (Trademark) * ) represented by 2 or 4 Salmonella ente rica ssp. enterica strains in a 1:1 or 1:1:1:1 mixture, experimental contamination (Figure 18 and 19 respectively). Prior to meat contamination, these strains were grown individually to OD 6 00 = 0.3 and then mixed at 1:1 or 1:1:1:1. The strain mixture was used as a meat contamination suspension to obtain an initial inoculum of approximately 2×10 4 cfu / g of meat. To this end, the desired cell number (OD 600 = 0.005 - 0.001, 2×10 6 ~ 1.8×10 5 cfu / ml) was further diluted in LB broth. Three pieces of chicken breast meat trim (approx. 25 g weight) were immersed in 12 ml of the bacterial suspension, turned over and immersed again to inoculate both sides. The contaminated meat was dried for 30 minutes, and the bacteria were allowed to form colonies at room temperature on the matrix sample while the chicken breast meat trim was turned over every 15 minutes.

[0117] The contaminated meat was treated by low-pressure spraying (2 - 4 bar) using an atomizer flask with either a carrier or a colicin mixture solution (TSP extract prepared with 50 mM HEPES pH 7.0, 10 mM K acetate, 5 mM Mg acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween- 20, 300 mM NaCl) derived from either untreated plant material of N. benthamiana or plant material when inoculated with Agrobacterium by syringe for colicin expression. The proposed addition amounts are 3 mg / kg for colicin M and any other used in the mixture. ​​The colicins were 1 mg / kg (colicin Ia and colicin 5). The meat was stirred for 15 minutes. Incubate further at room temperature for 30 min, turning over and over.

[0118] Thirty minutes after addition of colicin, an aliquot of chicken breast trimmings (approximately 25 g) was The samples were then reconstituted and placed into sterile sample bags (BagFilter® 400P) to accurately measure the amount of each sample. The exact weight was recorded and the sample bag was closed using a clip (BagClip® 400). In total, meat samples were treated with colicin and immediately incubated at room temperature for 1 hour. The sealed meat samples are then stored at 4°C.

[0119] To determine the level of microbial contamination on the matrix, the plates were incubated at 4°C for 1 h, 48 h, and 4 h. Meat samples were sampled after 72 hours of storage. Pathogenic Salmonella was isolated from the meat samples. To recover, add approximately 100 ml of buffered peptone water to each approximately 25 g aliquot of meat sample. Laboratory blender (BagMixer® 400CC®); set Homogenize the sample in the following conditions: Gap 0, Time 30 seconds, Speed ​​4. Filter part of storage bag Microbial suspensions from the samples are collected and serially diluted 1:10. A 100 μl aliquot of the organism suspension is plated onto XLD agar. The plates are incubated at 37°C for 18 to 24 hours and the CFUs (colony forming units) are counted. Calculate the number of CFU per gram sample as follows: Total CFU = Actual CFU × Concentration coefficient × Dilution coefficient × Actual ml of peptone water g meat 0.1ml plating amount Actual g sample In reducing the number of viable pathogenic Salmonella in experimentally contaminated meat samples, The effect of colicin treatment on the expression of β-lactamase was analyzed using GraphPad Prism v.6.01. The results were analyzed using one-way ANOVA (Tukey's multiple comparison test) and independent parametric t-test. The results were evaluated by comparing the data obtained with carrier-treated control samples and colicin-treated samples. Worth it.

[0120] The bacterial count results for contamination with two or four Salmonella strains, respectively, are shown in Figure 1 8 and 19. The most significant reduction in bacterial population (1.8 log) was observed with colicin treatment. Immediately occurred already after 1 hour of storage.

[0121] In summary, there was a statistically significant reduction in Salmonella populations in contaminated meat. This can be achieved by treating the meat with a colicin mixture. Salmosin mixture or Salmosin / colicin mixture is a mixture of Salmonella from It has been tested for the decontamination of food products and has been shown to reduce Salmonella contamination in the food industry. It is planned to be used to reduce the 1b shows the broadest antibacterial activity against the Salmonella strains tested. These are used as the main components of the Salmosin cocktail for the control of Salmonella. It can be used.

[0122] Example 8: Production of Salmosin in a stable transgenic host For the expression of salmosin, detached leaves of T0 transgenic plants were soaked in EtOH. Agrobacterium using vectors for inducible transgene expression and induction Transformation of N. benthamiana by ium-mediated leaf disc transformation This was done as described by Schulz et al., Proc. Natl. Acad. Sci. USA 11 2, E5454 - E5460 (2015).

[0123] A TMV - based vector whose genome insertion can be doubly induced by ethanol for ScolE1b expression Stable transgenic Nicotiana bent hamiana plants (Figure 21) containing the genomic insertion of the vector showed normal growth and development, and the selected transgene enic lines accumulated salmosin up to the expected levels upon induction with ethanol ( Figure 22).

[0124] Example 9: Production of salmosin in spinach Spinacia oleracea cv. Fruhes Riesenblatt Plants were grown in a greenhouse (day and night temperatures of 19 - 23°C and 17 - 20°C, respectively, 12 - hour light and 35 - 70% humidity). Six - week - old plants were used for infiltration by the syringe described in Example 2 . Expression of the recombinant protein was confirmed using SDS - PAGE with Coomassie staining (Figure 23).

[0125] Example 10: Extended salmosin activity screening The inventors further analyzed the antibacterial activity of recombinant salmosin produced in plants against other strains of Salmonella, as described in Example 6 . To determine the antibacterial activity spectrum of salmosin, 109 strains representing 105 S. enterica ssp. enter ica serotypes were selected and screened (Table 9). The screening was performed on at least 100 isolates of human Salmonella infections from 2003 to 2012 ​As causing the outbreak, each strain of all serotypes (excluding serotype Typhi and I4,5:12:r:-), two strains of serotype Typhimurium, Enteritidis and Javiana, and six serotypes that caused less than 100 occurrences or were not reported to the CDC as described by the Centers for Disease Control and Prevention (CDC) (www.cdc.gov / nationalsurveillance / pdfs / salmonella-an nual-report-2013-508c.pdf) were included. Excluding serotype Typhi and I4,5:12:r:-), one strain of each of all serotypes, two strains of serotype Typhimurium, Enteritidis and Javiana, and six serotypes that caused less than 100 occurrences or were not reported to the CDC were included. To estimate the width of the activity spectrum, all strains were tested at least once, and subsequently, 36 or 35 strains were re-screened in triplicate experiments using thuricin and colicin, respectively (Figure 24). The broadest antibacterial activity spectrum was observed for thuricin ScolE1a and

[0126]

Table 9-1

[0127]

Table 9-2

[0128]

Table 9-3

[0129]

Table 9-4

[0130]

Table 10

[0131] To estimate the width of the activity spectrum, all strains were tested at least once, and subsequently, 36 or 35 strains were re-screened in triplicate experiments using thuricin and colicin, respectively (Figure 24). The broadest antibacterial activity spectrum was observed for thuricin ScolE1a and the widest antibacterial activity spectrum was observed for thuricin ScolE1a and Re - confirmed for Yobi ScolE1b, and these showed positive antibacterial activity against 100% and 99% of all the strains evaluated, respectively. The significant breadth of activity was reflected in their activity against the subset of 36 strains shown in Fig. 24e. Similar observations were also made for salmocins Sco lE2 (94%), ScolE3 (70%) and ScolE7 (95%).

[0132] The five salmocins analyzed were grouped into four groups based on their ability to control major pathogenic Salmonella strains. Salmocins ScolE1a and ScolE1b were universally active and were able to kill all the pathogenic types tested, respectively, with activity higher than 10 AU / μg recombinant protein for all the strains tested (Fig. 24a), and in most cases higher than 10 AU / μg protein for individual strains, showing the highest average activity. 5 3 The remaining salmocins fell into two groups. One group, salmocins ScolE2 and ScolE7, had an average activity 100 - fold lower (<10 AU / μg protein, Fig. 24a), and another group, ScolE3, had a substantially lower average activity (10 AU / μg, Fig. 24a). 5 2 )

[0133] In contrast to the high potency of salmocins in inhibiting enteropathogenic S. enterica strains, the specific activities of colicins Ia, Ib, M, 5, 10 and S4 (Table 6) were 2 - 4 orders of magnitude lower (2 - 3 log AU / μg, Fig. 24b), and many of the 109 strains were inhibited by colicin Ia (92%) and Ib (90%), and about one - third of the strains were inhibited by colicin S4 (45%), 5( ( ​​​​​​​​​​​​​​​​Inhibited by 25% (10), 10 (29%) and M (34%), which is also reflected in the sensitivity patterns of the 35 - strain subsets (Figure 24f). Generally, thuricin showed higher and broader activity against Salmonella than E. coli colicin. Conversely, thuricin showed low (less than 10 AU / μg) and narrow activity against E. coli STEC (Table 10) strains (Figure 24c, g). is also reflected in the sensitivity patterns of the 35 - strain subsets (Figure 24f). Generally, thuricin showed higher and broader activity against Salmonella than E. coli colicin. Conversely, thuricin showed low (less than 10 AU / μg) and narrow activity against E. coli STEC (Table 10) strains (Figure 24c, g). onella than E. coli colicin. Conversely, thuricin showed low (less than 10 AU / μg) and narrow activity against E. coli STEC (Table 10) strains (Figure 24c, g). rigin showed low (less than 10 AU / μg) and narrow activity against E. coli STEC (Table 10) strains (Figure 24c, g). 2 AU / μg) narrow activity against E. coli STEC (Table 10) strains (Figure 24c, g).

[0134] Example 11: Individual thuricin ScolE1a and thuricin mixtures control Salmonella in contaminated chicken meat matrix The bactericidal effects of plant - produced individual thuricin ScolE1a and thuricin mixtures for the control of Salmonella - contaminated meat surfaces were analyzed in a simulation study. The bactericidal effects of plant - produced individual thuricin ScolE1a and thuricin mixtures for the control of Salmonella - contaminated meat surfaces were analyzed in a simulation study. The bactericidal effects of plant - produced individual thuricin ScolE1a and thuricin mixtures for the control of Salmonella - contaminated meat surfaces were analyzed in a simulation study. .

[0135] Chicken breast fillets were purchased from a local supermarket. S. enterica a ssp. enterica serotype Enteritidis (strain ATCC® 13076® * ), Typhimurium (strain ATCC® 14028 ® * ), Newport (strain ATCC® 6962® * ), Jav iana (strain ATCC® 10721® * ), Heidelberg (strain ATCC® 8326® * ), Infantis (strain ATCC® ) BAA - 1675® * ) and Muenchen (strain ATCC® 83 88® *) nalidixic acid-resistant mutant strains were supplemented with 25 μg / ml nalidixic acid. They were individually grown to stationary phase in LB medium, diluted into fresh LB, and grown to log phase. For poultry contamination, bacterial cultures were grown in LB medium at OD 600 =0.001(approximately 2×10 5 cfu / ml) and mixed at a ratio of 1:1:1:1:1:1:1. A pool of chicken breast fillets cut into strips was used, with approximately 2 × 10 5 cfu A 1 ml mixture of seven S. enterica strains was inoculated at room temperature at a density of 1 ml / ml to give a total volume of approximately 3 l. og CFU / g of a mixture of seven serotypes of pathogenic S. enterica in meat matrices. An initial contamination level of the meat was obtained and the bacteria were allowed to attach to the meat surface for 30 minutes at room temperature. Extract control (50 mM HEPES pH 7.0, 10 mM K acetate, 5 mM g acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween-20 , WT N. benthamia without salmosin prepared with 300 mM NaCl na TSP extract of plant material) or Salmosin solution (same buffer as the plant extract control) Salmosins ScolE1a, ScolE1b, ScolE2 and ScolE3 were prepared in Individual TSP extracts of N. benthamiana plant material expressing lE7 or The subjects were administered either ScolE1a or a mixture of TSP extracts from are 3mg / kg ScolE1a, 1mg / kg ScolE1b, 1mg / kg Sc olE2, 1mg / kg ScolE7 or 0.3mg / kg ScolE1a, 0. 1mg / kg ScolE1b, 0.1mg / kg ScolE2 and 0.1mg / kg Spraying with g ScolE7 concentration (10 ml / kg) was used to treat the breast meat trimmings of chickens. The treated meat trimmings were further incubated at room temperature for 30 minutes . A fixed portion of the meat trimmings corresponding to about 40 g was packed into a BagFilter® 400P sterile bag (Interscience) and stored at 10 °C for 1 hour, 1 day, and 3 days , which corresponds to realistic industrial meat processing conditions that are acceptable but sub - optimal for bacterial growth.

[0136] Overall, the meat samples were incubated at room temperature for 1.5 hours during salmocine treatment, and then these were sealed and stored at 10 °C. For the analysis of the bacterial population, a Bag Mixer® 400CC® homogenizer (settings: gap 0, time 30 seconds, speed 4; Interscience) was used to homogenize a fixed portion of poultry in 4 - fold volume of peptone water, and after plating serial dilutions of the microbial suspension, the colony - forming units (CFU) of S. enterica on XLD medium (Sifin Diagnostics) supplemented with 25 μg / ml nalidixic acid were counted. Samples were analyzed in quadruplicate.

[0137] The effect of salmocine treatment on the reduction in the number of viable pathogenic Salmonella in experimentally contaminated meat samples was evaluated by comparing the data obtained from carrier - treated control samples and salmocine - treated samples using a two - sided independent parametric t - test with 6 degrees of freedom using GraphPad Prism v.6.01.

[0138] Samples treated with salmocine (individual ScolE1a with an addition amount of 3 mg / kg meat and each Salmocins mixture consisting of ScolE1a + ScolE1b + ScolE2 + ScolE7 added at 3 + 1 + 1 + 1 mg / kg meat) Effect of salmocin treatment on meat samples (both and plant extract control-treated meat) was evaluated in terms of the degree of reduction in the pathogenic bacterial population level, and a statistically significant net reduction in viable counts of 2 - 3 log CFU / g meat was found at all time points analyzed (Figure 25). The highest level of reduction in the bacterial population was observed for the mixture of 4 salmocins (at a concentration of 3 + 1 + 1 + 1 mg / kg meat), with a maximum of 3.39 mean log reduction versus carrier treatment after 4 hours of storage, which corresponds to a 99.6 mean percent reduction of bacteria. A single salmocin, ScolE1a (added at 3 mg / kg meat) was able to control Salmonella contamination in meat with a similar effect as the mixture of 4 salmocins added at twice the concentration (6 mg / kg meat total salmocin). Treatment with very low doses of salmocins (total salmocin 0.6 mg / kg meat; 0.3 + 0.1 + 0.1 + 0.1 mg / kg meat for the mixture of ScolE1a + ScolE1b + ScolE2 + ScolE7) also resulted in a statistically significant reduction in the bacterial population of about 1 log CFU for up to 48 hours of storage. After an initial reduction in bacterial contamination, regrowth of viable bacteria was observed after 72 hours, suggesting that salmocins act rapidly on food but do not have a long-term technological effect.

[0139] Example 12: Recombinant salmocins are accurately expressed by plants The secondary structure of the plant-expressed recombinant salmocins contained in plant TSP extracts, including post-translational modifications, was analyzed by matrix-assisted laser desorption / ionization ) It was analyzed by mass spectrometry (MS).

[0140] For protein digestion, 5 volumes of 20 mM Na citrate, 20 mM NaH 2 P O 4 , 30 mM NaCl, pH 5.5 were used to prepare the TSP extract from plant materials expressing salmosin and subjected it to SDS-PAGE. The Coomassie-stained SDS gel band containing 5 μg of protein was cut out and washed successively with 100 mM NH 4 HCO 3 and 100 mM N H 4 HCO 3 in an acetonitrile (ACN) / H 2 O (50;50, v / v) solution to de-stain it. The disulfide bonds were reduced with 10 mM DTT at 50 °C for 45 minutes, followed by alkylation with 10 mg / ml iodoacetamide for 60 minutes. Subsequently, different sequencing-grade endoproteinases ( Promega, Madison, USA) were used to subject the de-stained and alkylated gel bands to protein digestion. The protease:protein ratio of the digestion solution was adjusted to 1:20 ( w / w), and digestion was carried out at 25 °C for 12 hours (chymotrypsin) or 37 °C (Asp-N, Gl u-C, Lys-C, trypsin). The proteolytic peptides were extracted by successively washing with H O, ACN / H O / 2 O / 2 trifluoroacetic acid (50;45;5, v / v / v) and ACN. The extraction solutions were mixed and concentrated in a vacuum centrifuge, and then re-solubilized in H O / acetic acid (90;10, v / v). H 2 O / acetic acid (90;10, v / v).

[0141] The protein-decomposable salmonosin peptide obtained as described above or the intact salmonosin ScolE1a, ScolE1b, and ScolE7 proteins produced in plants were purified by solid-phase extraction using a C4 or C18-bonded silica material (ZipTip® , Millipore, Darmstadt, Germany) for mass spectrometry, and co-crystallized with the eluate on a MALDI ground steel target using 2,5-dihydroxyacetophenone and 2,5-dihydroxybenzoic acid matrix (Bruker Daltonics, Bremen, Germany). Mass spectra were obtained in positive polarity in linear mode for molecular weight determination and in reflector mode for protein sequencing by in-source decay (ISD) analysis on a MALDI-TOF / TOF mass spectrometer (Autoflex SpeedTM, Bruker Daltonics, Bremen, Germany). The matrix crystals were irradiated with a Nd:YAG laser (Smartbeam-IITM, Bruker Daltonics, Bremen, Germany)

[0142] at an emission wavelength of 355 nm and a pulse rate of 1 kHz.

[0143] The MS and MS / MS spectra were recorded with flexControl (version 3.4, Bruker Daltonics, Bremen, Germany) by accumulating at least 5000 or 10000 laser shots per sample spot, respectively. The laser energy was set slightly above the threshold for the MS experiment and The / MS analysis was set to maximum. The spectral processing was done by applying baseline subtraction using the TopHat algorithm, smoothing using the Savitzky-Golay algorithm, and peak detection using the SNAP algorithm in flexAnalysis( Version 3.4, Bruker Daltonics, Bremen, Germany ). The mass spectrometer was calibrated using a set of standard peptides and proteins with known masses (Pep tide Calibration Standard II, Protein Cal ibration Standard I and II, Bruker Dalton

[0144] ics, Bremen, Germany).

[0145] The determination of intact molecular weights was based on the mass-to-charge ratios (m / z ) of single and multiply charged molecular ions. Protein N-terminal sequencing was performed by ISD analysis. The annotation of ISD fragment spectra was done using BioTools (Version 3.2, Bruker D altonics, Bremen, Germany) by in-silico generation of m / z values for fragment ions and their comparison with the m / z values of the fragment signals observed in the obtained ISD spectra. This approach enabled the identification of the N-terminal amino acid sequence and the identification of the modifications present.

[0146] For protein sequencing analysis, only the fragment (MS / MS) spectra were used for the identification of proteolytic peptides, and the annotation was done with PEAKS St​​​​​​ udio (version 7.5, Bioinformatics Solutions I nc., Waterloo, Canada) was used. Protein identification and verification of its amino acid sequence were performed by searching the NCBI nr database and the UniProt / SwissProt database, respectively, which have the sequence of salmosin added, against MS / MS data. Database searches were carried out using a parent mass error tolerance of 50 ppm and a fragment mass error

[0147] tolerance of 0.5 Da. The maximum number of both incorrect cleavages and post-translational modifications for one proteolytic fragment was set to 3. Non-specific cleavage was permitted for both protein termini. The identity of each analyzed salmosin was confirmed by the search results of each MS / MS dataset from the tryptic peptides of salmosin against the UniProt / SwissProt database (Table 11). Using the ISD and molecular weight

[0148]

Table 11

[0149] Example 13: Identification of Salmonocins ScolE1c, ScolE1d, ScolE1e and Sc olMa As shown in Example 10, the two pore-forming salmonocins ScolE1a and ScolE 1b exhibited the highest and broadest antibacterial activity against all tested Salmonella strains To identify other salmonocins for controlling Salmonella, the present inventors performed a homology search in the NCBI database for Salmonella proteins that are similar to ScolE1a and ScolE1b but have an N-terminal portion different from colicin. This search revealed three new sequences, which the inventors named ScolE1c (SEQ ID NO: 25), ScolE1d (SEQ ID NO: 26) and ScolE1e (SEQ ID NO: 27) (Table 12). A CLUSTAL Omega alignment of these sequences is shown in Figure 26.

[0150] The inventors also searched for Salmonella proteins similar to colicin M to obtain another functional domain that expresses antibacterial activity and is not related to nuclease (since nuclease often requires co-expression of immune proteins, and most of these immune proteins are not easy to purify). This search yielded the ScolMa sequence (SEQ ID NO: 28) (Table 12).

[0151] [Table 12]

[0152] Example 14: Salmonocins ScolE1c, ScolE1d, ScolE1e and Sc Plasmid construct for olMa The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 29 encodes ScolE1c, SEQ ID NO: 30 encodes ScolE1d, SEQ ID NO: 31 encodes ScolE1e, and SEQ ID NO: 32 encodes ScolMa. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 29 encodes ScolE1c, SEQ ID NO: 30 encodes ScolE1d, SEQ ID NO: 31 encodes ScolE1e, and SEQ ID NO: 32 encodes ScolMa. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 29 encodes ScolE1c, SEQ ID NO: 30 encodes ScolE1d, SEQ ID NO: 31 encodes ScolE1e, and SEQ ID NO: 32 encodes ScolMa. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 29 encodes ScolE1c, SEQ ID NO: 30 encodes ScolE1d, SEQ ID NO: 31 encodes ScolE1e, and SEQ ID NO: 32 encodes ScolMa. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 29 encodes ScolE1c, SEQ ID NO: 30 encodes ScolE1d, SEQ ID NO: 31 encodes ScolE1e, and SEQ ID NO: 32 encodes ScolMa. The amino acid sequences of salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa were obtained from GenBank, and the corresponding nucleotide sequences with codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 29 encodes ScolE1c, SEQ ID NO: 30 encodes ScolE1d, SEQ ID NO: 31 encodes ScolE1e, and SEQ ID NO: 32 encodes ScolMa.

[0153] The coding sequences of salmosins were inserted into the TMV-based assembled viral vector pNMD035 (described in detail in WO2012 / 019660) to obtain the plasmid construct depicted in Figure 28. The coding sequences of salmosins were inserted into the TMV-based assembled viral vector pNMD035 (described in detail in WO2012 / 019660) to obtain the plasmid construct depicted in Figure 28. The coding sequences of salmosins were inserted into the TMV-based assembled viral vector pNMD035 (described in detail in WO2012 / 019660) to obtain the plasmid construct depicted in Figure 28.

[0154] Example 15: Expression screening for salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa The salmosin expression screening was carried out as described in Example 2. The accumulation of salmosins ScolE1c, ScolE1d and ScolMa in Nicotiana benthamiana leaves was high. In contrast, the expression of ScolE1e was low (Figure 29). The salmosin expression screening was carried out as described in Example 2. The accumulation of salmosins ScolE1c, ScolE1d and ScolMa in Nicotiana benthamiana leaves was high. In contrast, the expression of ScolE1e was low (Figure 29). The salmosin expression screening was carried out as described in Example 2. The accumulation of salmosins ScolE1c, ScolE1d and ScolMa in Nicotiana benthamiana leaves was high. In contrast, the expression of ScolE1e was low (Figure 29). The salmosin expression screening was carried out as described in Example 2. The accumulation of salmosins ScolE1c, ScolE1d and ScolMa in Nicotiana benthamiana leaves was high. In contrast, the expression of ScolE1e was low (Figure 29). The salmosin expression screening was carried out as described in Example 2. The accumulation of salmosins ScolE1c, ScolE1d and ScolMa in Nicotiana benthamiana leaves was high. In contrast, the expression of ScolE1e was low (Figure 29).

[0155] Example 16: Activity screening of salmosins for ScolE1c, ScolE1d, ScolE1e and ScolMa The inventors screened the antibacterial activities of recombinant salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa produced in plants against ScolE1a and ScolE1b. The inventors screened the antibacterial activities of recombinant salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa produced in plants against ScolE1a and ScolE1b. The inventors screened the antibacterial activities of recombinant salmosins ScolE1c, ScolE1d, ScolE1e and ScolMa produced in plants against ScolE1a and ScolE1b. were compared. For this comparison, the inventors used 10 Salmonella ente rica ssp. enterica strains (Table 13). The evaluation of the antibacterial activity in the plant extract containing thionin was carried out using the radiodiffusion spot-on-lawn assay described in Example 6. Extracts from untransformed plant tissue (Wt) were used as negative controls. All the new thionins tested were not superior to ScolE 1a and ScolEb, but showed significant antibacterial activity (Table 13) . Based on the expression and antibacterial activity levels, the inventors selected ScolE1d and ScolMa to generate ethanol-inducible stable trans .

[0156] genic Nicotiana benthamiana hosts.

[0157]

Table 13

[0158] Example 17: Production of thionins ScolE1d and ScolMa in stable transgenic hosts Agrobacterium-mediated leaf disk transformation using vectors for ethanol-inducible transgene expression (pNMD49621 for ScolE1d and pNMD49632 for ScolMa, Figure 30) was used to transform N. benthami ana. Ethanol induction of the separated leaves of the T0 generation transgenic plants for thionin expression was carried out. These experiments were performed as described in Example 8 ​​​​​transformed with the pNMD49621 construct used for analysis, 169 strains For the T0 transgenic lines of , 126 lines were positive for EtOH-induced SalE1d expression (Figure 31).

[0159] Example 18: Antibacterial activities of salmosins ScolE1b, ScolE1d and ScolMa Comparison The antibacterial activities of recombinant salmosins ScolE1b, ScolE1d and ScolMa produced in plants were analyzed as described in Example 3. In these experiments, the present inventors used a radial diffusion assay by the spot-on-lawn method to test plant extracts containing recombinant salmosins against 36 strains of 33 different serotypes of S. enterica a ssp. enterica. The bacterial strains are shown in Tables 5A and 5B.

[0160] For semi-quantitative comparison, the present inventors showed the relative antibacterial activity of recombinant salmosins in arbitrary units (AU) and calculated it as the dilution factor for the maximum dilution of the protein extract that gives a detectable clearing effect in the radial diffusion assay. The concentration of salmosin protein in the TSP extract was evaluated by visual comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis. The specific antibacterial activity was calculated as the average of three independent experiments in arbitrary units (AU) per μg of recombinant salmosin.

[0161] The present inventors found that ScolE1d has an antibacterial activity spectrum very similar to that of ScolE1b, but in most cases, the overall activity of ScolE1d is low and is equivalent to that of ScolE1b only in very few cases (Figures 32A and 32B).

[0162] The antibacterial activity of ScolMa was lower than that of ScolE1b in 20 strains, equivalent in 10 strains, and higher in 6 strains (Figs. 32A and 32B). Based on different (supplementary) antibacterial activity patterns and distinct antibacterial activity mechanisms, ScolMa can be considered a good candidate for the thurmosin cocktail in a mixture with ScolE1 thurmosin. and clear antibacterial activity mechanisms, ScolMa can be considered a good candidate for the thurmosin cocktail in a mixture with ScolE1 thurmosin. and clear antibacterial activity mechanisms, ScolMa can be considered a good candidate for the thurmosin cocktail in a mixture with ScolE1 thurmosin. and clear antibacterial activity mechanisms, ScolMa can be considered a good candidate for the thurmosin cocktail in a mixture with ScolE1 thurmosin.

[0163] Example 19: Stability of thurmosins ScolE1a, ScolE1b, and ScolE1 d during storage For the evaluation of stability, purified thurmosin protein samples were stored as lyophilized powder and solution at 4 °C and room temperature (20 ~25 °C). The stability of the protein was analyzed based on antibacterial activity over 93 days (ScolE1a), 387 days (ScolE1b), and 200 days (ScolE 1d). The antibacterial activity against susceptible bacteria was evaluated by the radial diffusion assay. All thurmosins were tested using the same bacterial strain, Salmonella Typhimurium ATCC® 14028.

[0164] The lyophilized protein samples were resuspended in distilled water (0.2 - 0.4 mg / ml). The soluble protein concentration for each sample was measured using the Bradford assay. The soluble protein concentration for each sample was measured using the Bradford assay. For the radial diffusion assay, serial 1:2 dilutions of the protein solubilized in PBS buffer were made. 5 μL of the protein dilutions (1 - 1.8 μg of protein before dilution) were spotted onto soft agar plates containing the susceptible bacterial strain. After incubating the plates overnight, the residual activity of the thurmosin was evaluated. The antibacterial activity was evaluated as specific activity units (AU), and the influence was evaluated as specific activity units (AU), and the influence The maximum dilution that results in a difference from the bacterial growth region that has not received it is determined by visual inspection of the plate for bacterial growth inhibition by holding the plate in front of the light source. This was determined by visual inspection of the plate for bacterial growth inhibition. The maximum dilution accompanied by growth inhibition was recorded as the activity of the thurmosin in AU / mg.

[0165] All three thurmosins remained stable throughout the study period when stored as dry powders either at room temperature or at 4 °C (Figs. 33A - C). In the case of solutions, all three thurmosins lost their activity within one week at room temperature (Figs. 33A - C). When the thurmosin solution was stored at 4 °C, ScolE1d was the most stable and retained sufficient antibacterial activity even 183 days after storage (Fig. 33C).

[0166] Example 20: Identification of Thurmosins ScolMb and ScolMc To identify additional thurmosins with phosphatase M activity, the inventors performed a homology search in the NCBI database for Salmonella proteins similar to ScolMa (SEQ ID NO: 28). As a result of this search, the inventors identified two proteins: ScolMb (SUF52254.1; SEQ ID NO: 33) and ScolMc (OIN38022.1; SEQ ID NO: 34). The CLUSTAL Omega (1.2.4) multiple sequence alignment of the ScolMa, ScolMb and ScolMc sequences is shown in Fig. 34. All three sequences have a high (97 - 98%) degree of identity with only minor amino acid mismatches.

[0167] Example 21: Plasmid Construction and Expression Screening for Thurmosins ScolMb and ScolMc The nucleotide sequences encoding ScolMb and ScolMc having codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 35 encodes ScolMb and SEQ ID NO: 36 encodes ScolMc. The nucleotide sequences encoding ScolMb and ScolMc having codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 35 encodes ScolMb and SEQ ID NO: 36 encodes ScolMc. The nucleotide sequences encoding ScolMb and ScolMc having codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 35 encodes ScolMb and SEQ ID NO: 36 encodes ScolMc. The nucleotide sequences encoding ScolMb and ScolMc having codon usage frequencies optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. SEQ ID NO: 35 encodes ScolMb and SEQ ID NO: 36 encodes ScolMc.

[0168] The coding sequence of salmosin was inserted into the TMV-based assembled viral vector pNMD035 (described in detail in WO2012 / 019660) to obtain the plasmid construct depicted in Figure 35. The coding sequence of salmosin was inserted into the TMV-based assembled viral vector pNMD035 (described in detail in WO2012 / 019660) to obtain the plasmid construct depicted in Figure 35. The coding sequence of salmosin was inserted into the TMV-based assembled viral vector pNMD035 (described in detail in WO2012 / 019660) to obtain the plasmid construct depicted in Figure 35.

[0169] ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP). ScolMb and ScolMc expression screening was performed as described in Example 2. At 7 dpi, plant tissue necrosis occurred, suggesting that earlier harvest time points are preferred. ScolMb and ScolMc recombinant proteins accumulated in Nicotiana benthamiana leaves at comparable levels (Figure 36). Based on visual evaluation by comparison with BSA standards on Coomassie-stained polyacrylamide gels after protein electrophoresis, the ScolMb expression yield was found to be approximately 2.6 mg / g FW plant material or 30% TSP. For ScolMc, the expression yield was 2.3 mg / g FW or 37.5% TSP. For both of these proteins, it was higher than that for ScolMa (1.6 mg / g FW or 18.8% TSP).

[0170] Example 22: Antibacterial Activity of Salmosins ScolMa, ScolMb, and ScolMc: Comparison For comparison, recombinant salmosins ScolMa, ScolMb, and S produced in plants The antibacterial activity of colMc was analyzed as described in Example 3. The inventors used a radiodiffusion assay by the spot-on-lawn method against 10 strains of 8 different serotypes of S. enterica ssp. enterica containing recombinant salmosin in plant extracts. The bacterial strains are shown in Tables 5A and 5B.

[0171] For semi-quantitative comparison, the inventors determined the relative antibacterial activity of recombinant salmosin in arbitrary units (AU), calculated as the dilution factor relative to the maximum dilution of the protein extract that showed a detectable clearing effect in the radiodiffusion assay. The concentration of salmosin protein in the TSP extract was evaluated by visual comparison with a BSA standard on a Coomassie-stained polyacrylamide gel after protein electrophoresis. The specific

[0172] antibacterial activity was calculated as the average of three independent experiments in arbitrary units (AU) per μg of recombinant salmosin. All three tested salmosins had very similar antibacterial patterns. They were active against the Typhimurium, Javiana, Muenchen, Heidelberg,

[0173] Dublin and Abony strains and showed little or very low activity against the Enteritidis and Newport strains (Figure 37). The minimum inhibitory concentration (MIC) is defined as the lowest concentration of bacteriocin that prevents visible growth of the corresponding ton Bouillon; Carl Roth GmbH& Co.KG, Karls ruhe, Germany) was used to determine the MIC of ScolE1b, ScolE7, Sc olE1d, ScolMb and ScolMc salmosins by the agar dilution method. The Salmonella strains tested (Enteritidis ATCC13076, Typhim urium ATCC14028, Typhimurium ATCC13311 and Dublin ATCC14028) were streaked as single colonies on MHB agar plates (0.75% (w / v) aga r, bacteriological grade (AppliChem GmbH, Darmstadt, Germany) supplemented MHB medium), and the plates were incubated at 37 °C for at least 16 hours . The main culture was prepared by picking eight equally sized colo nies for inoculation of 4 ml of MHB medium, and this was further incubated at 37 °C and 180 rpm for 2 - 3 hours until an OD600 of approximately 0.2 was reached . The bacterial culture was pre - diluted to OD 600 = 0.02 and subsequently further diluted to a potential 2×10 6 cfu / ml .

[0174] For the evaluation of MIC, the freeze - dried purified salmosin proteins tested were resuspended in PBS buffer (phosphate - buffered saline (137 mM NaCl, 2.7 mM KC l, 10 mM Na HPO 4, 2 mM KH 2 2PO 4 4)) supplemented with 0.1 mg / 2 ml BSA (AppliChem GmbH, Darmstadt, Germany). The protein concent 4 ration was adjusted to an appropriate amount (100 - fold higher than the concentration to be tested), and PBS + 0.1 mg / ml was used Eleven additional 1:1 protein dilutions were prepared in BSA. MHB agar was thawed, aliquoted into 5 ml portions, cooled to 50 °C, and then used to prepare MHB agar plates containing different salmosins in a 6-well sterile cell culture plate (TP P Techno Plastics Products AG, Trasadinge n, Switzerland). After addition of 50 μl of salmosin / 5 ml of MHB agar, one well of the 6-well plate was filled with the solution. After cooling the plate to room temperature, 4 spots of 5 μl of diluted Salmonell a culture were spotted into each well. The droplets were allowed to dry, and the plate was incubated at 37 °C for approximately 1 6 hours. After incubation, the plates were checked for bacterial growth at different concentrations. The MIC is defined as the lowest concentration of an antimicrobial agent that inhibits visible growth of the test microorganism. The MICs determined for the individual salmosins showed a certain batch-to-batch variation, which is related to batch quality, i.e., the presence of proteinaceous impurities or proteolytic products. In previous experiments by the inventors, ScolE1b and ScolE1d showed the broadest antibacterial activity (Example 3), and they also had very low MICs for the strains tested. SalE1b has a broader high activity as low MICs could also be detected for the second tested Typhimurium strain. ScolMc has higher activity against the tested ATCC14028 strain compared to ScolMb. The lowest MIC (<0 The MICs determined for the individual salmosins showed a certain batch-to-batch variation, which is related to batch quality, i.e., the presence of proteinaceous impurities or proteolytic products. In previous experiments by the inventors, ScolE1b and ScolE1d showed the broadest antibacterial

[0175]

Table 14

[0176] related to batch quality, i.e., the presence of proteinaceous impurities or proteolytic products. In previous experiments by the inventors, ScolE1b and ScolE1d showed the broadest antibacterial activity (Example 3), and they also had very low MICs for the strains tested. SalE1b has a broader high activity as low MICs could also be detected for the second tested Typhimurium strain. ScolMc has higher activity against the tested ATCC14028 strain compared to ScolMb. The lowest MIC (<0 The MICs determined for the individual salmosins showed a certain batch-to-batch variation, which is related to batch quality, i.e., the presence of proteinaceous impurities or proteolytic products. In previous experiments by the inventors, ScolE1b and ScolE1d showed the broadest antibacterial activity (Example 3), and they also had very low MICs for the strains tested. SalE1b has a broader high activity as low MICs could also be detected for the second tested Typhimurium strain. ScolMc has higher activity against the tested ATCC14028 strain compared to ScolMb. The lowest MIC (<0 The MICs determined for the individual salmosins showed a certain batch-to-batch variation, which is related to batch quality, i.e., the presence of proteinaceous impurities or proteolytic products. In previous experiments by the inventors, ScolE1b and ScolE1d showed the broadest antibacterial .98 ng / ml) was surprisingly detected by ScolMc. For example, refer to the data regarding Typhi murium strain ATCC13311.

[0177] Example 24: Purification of ScolMa Protein Salmosin Sc containing Nicotiana benthamiana leaf biomass olMa was produced using Agrobacterium -mediated delivery of the TMV-based viral vector pNMD47730 (Figure 28). The liquid culture of Agrobacterium tumefaciens strain ICF320 carrying the pNMD477390 plasmid was inoculated from a glycerol stock into LBS medium and incubated with shaking overnight at 28°C. The overnight culture of Agrobacterium was adjusted to OD 600 = 1.3 and further diluted 1:100 with LBS medium. The leaves of 4- to 6-week-old N. benthamiana plants were infiltrated using a needleless syringe. At 5 dpi, the plant material was harvested, frozen in liquid nitrogen, ground using a mortar and pestle, and stored at -80°C.

[0178] Regarding the isolation of ScolMa protein, the inventors tested various purification strategies. Extraction of the target recombinant protein from N. benthamiana leaf biomass at pH 4.0 - 5.5 is preferred. This is because in this pH range, the most abundant plant host protein, RUBISCO, precipitates and can be easily removed together with other solids. Unfortunately, at pH 4.0 - 5.5, the ScolMa extraction yield was very low. The resulting extract also contained a large amount of RUBISCO, but Sco The lMa yield was very high at pH 6.0. Such extracts were further subjected to column chromatography purification using various approaches. All protein purification experiments were carried out using an AKTA™ Pure chromatography system (Cytiva Europe GmbH, Freiburg im Breisgau, Germany). For example, the inventors tested hydrophobic interaction chromatography (HIC) using HiTrap™ Phenyl FF (LS) and HiTrap™ Butyl FF resins (Cytiva Europe GmbH, Freiburg im Breisgau, Germany). In both cases, a buffer consisting of 20 mM citrate (pH 6.0), 20 mM NaH PO and 2 M NaCl was used for extraction. This buffer was also used for column equilibration and column washing after sample loading. Elution was carried out using the same buffer with a 0 - 100% NaCl gradient. For both resins, effective separation between ScolMa and the host protein was not achieved (Figures .

[0179] HiTrap™ Capto™ MMC, HiTrap™ Capto™ Adhere, HiTrap™ Capto™ Q, HiTrap™ Capto™ Adhere, HiTrap™ Capto™ MMC, HiTrap™ Capto™ MMC, HiTrap™ Capto™ S, HiTrap™ Capto™ MMC and HiTrap™ C im Breisgau, Germany). In both cases, a buffer consisting of 20 mM citrate (pH 6.0), 20 mM NaH aH 2 PO 4 and 2 M NaCl was used for extraction. This buffer was also used for column equilibration and column washing after sample loading. Elution was carried out using the same buffer with a 0 - 100% NaCl gradient. For both resins, effective separation between ScolMa and the host protein was not achieved (Figures 38A and 38B). . For both resins, effective separation between ScolMa and the host protein was not achieved (Figures 38A and 38B).

[0180] HiTrap™ Capto™ MMC, HiTrap™ Capto™ Adhere, HiTrap™ Capto™ Q, HiTrap™ Capto™ Adhere, HiTrap™ Capto™ MMC, HiTrap™ Capto™ MMC, HiTrap™ Capto™ S, HiTrap™ Capto™ MMC and HiTrap™ C )Capto™ Adhere, HiTrap™ Capto™ MMC, HiTrap™ Capto™ MMC, HiTrap™ Capto™ S, HiTrap™ Capto™ MMC and HiTrap™ C apto™ S, HiTrap™ Capto™ MMC and HiTrap™ C A number of other purification attempts using Apto (trademark) DEAE resin (all from Cytiva Europe GmbH, Freiburg im Breisgau, Germany) did not result in satisfactory ScolMa yields and purities. The results of these experiments are summarized in Table 15 iburg im Breisgau, Germany) did not result in satisfactory ScolMa yields and purities. The results of these experiments are summarized in Table 15 iburg im Breisgau, Germany) did not result in satisfactory ScolMa yields and purities. The results of these experiments are summarized in Table 15 iburg im Breisgau, Germany) did not result in satisfactory ScolMa yields and purities. The results of these experiments are summarized in Table 15 iburg im Breisgau, Germany) did not result in satisfactory ScolMa yields and purities. The results of these experiments are summarized in Table 15 (pH 8.0), 0.05% Tween-80 were used for extraction. The column was washed with 20 mM T ris-HCl (pH 8.0). Elution was performed with a 0-100% linear gradient of elution buffer containing 20 mM Tris-HCl (pH 8.0), 1 M NaCl. ScolMa extraction was effective, but the protein did not bind properly to the resin, and the separation of RUBISCO was also not achieved. and the separation of RUBISCO was also not achieved.

[0181]

Table 15-1

[0182]

Table 15-2

[0183] Example 25: Purification of ScolMb and ScolMc Proteins We tested extracts of ScolMa, ScolM cotiana benthamiana leaf biomass at pH 4.0, pH 5.0 and pH 7.0 using buffers. Leaf biomass containing the recombinant protein of interest was produced as described in Example 26. pNMD47730 (Figure 28 cotiana benthamiana leaf biomass at pH 4.0, pH 5.0 and pH 7.0 using buffers. Leaf biomass containing the recombinant protein of interest was produced as described in Example 26. pNMD47730 (Figure 28 cotiana benthamiana leaf biomass at pH 4.0, pH 5.0 and pH 7.0 using buffers. Leaf biomass containing the recombinant protein of interest was produced as described in Example 26. pNMD47730 (Figure 28 ) The pNMD51280 and pNMD51290 (Figure 35) constructs were each used for the expression of the ScolMa, ScolMb, and ScolMc proteins. For extraction, the inventors tested the following buffers: 1) 50 mM HEPES (pH 7.0), 10 mM potassium acetate, 5 mM magnesium acetate, 10% glycerol, 0.05% Tween-20, 300 mM NaCl; 2) 15 mM sodium acetate (pH 5.0), 20 mM NaH 2 PO 4 , 30 mM NaCl, 0.05% Tween-80, and 3 ) 15 mM sodium acetate (pH 4.0), 20 mM NaH 2 PO 4 , 30 mM NaCl, 0.05% Tween-80.

[0184] Extractions were performed at 4 °C or room temperature (about 22 °C). For extraction at 4 °C, the frozen and ground plant material was thoroughly mixed with the extraction buffer and incubated on ice for 30 minutes. After centrifugation at 13,000 rpm for 10 minutes at 4 °C, the supernatant was transferred to a new tube (repeated 2 times). The resulting supernatant was analyzed using SDS-PAGE (15% gel). For extraction at room temperature, the frozen and ground plant material was thoroughly mixed with the extraction buffer and incubated at room temperature for 15 minutes. After centrifugation at 7100 g for 5 minutes at 22 °C, the supernatant was transferred to a new tube and centrifuged again at 7100 g for 20 minutes at 22 °C. The resulting supernatant was analyzed using SDS-PAGE (15% gel).

[0185] Figures 40A and 40B show the SDS-PAGE analysis of the extraction efficiency at 4 °C and room temperature, respectively. The recovery of ScolMa was efficient for the buffer at pH 7.0 at both temperatures ​ This was the case. The recovery of this protein was significantly less efficient when using buffers at pH 5.0 and pH 4.0 and was particularly low at room temperature, indicating that the protein is unstable under such conditions (Figure 40A). In contrast, ScolMb and ScolMc had very high yields with all three buffers tested and at both temperatures (Figures 40A and 40B). ScolMb was efficiently purified using HiTrap™ Capto™ MMC resin. N. benthamiana leaf material was extracted at room temperature with 5 volumes of extraction buffer (15 mM sodium acetate (pH 4.0), 20 mM NaH

[0186] PO (15 mM sodium acetate (pH 4.0), 20 mM NaH PO 2 30 mM NaCl, 0.05% Tween-80). The same buffer was used for column equilibration and column 4 washing. Elution of the protein was performed using a linear 0–100% gradient of elution buffer consisting of 10 mM sodium acetate (pH 7.5), 20 mM NaH PO 30 mM NaCl, 0.05% Tween-80). The protein samples were analyzed using SDS-PAGE (Figure 41). 2 PO 4 The elution fraction F18 was highly enriched in ScolMb protein. 50 mM NaCl. SDS-PAGE was used to analyze the protein samples (Figure 41). The elution fraction F18 was highly enriched in ScolMb protein. The elution fraction F18 was highly enriched in ScolMb protein.

[0187] ScolMb was also efficiently purified using HiTrap™ Phenyl FF (LS) resin. Plant biomass was extracted at room temperature with 5 volumes of extraction buffer (15 mM sodium acetate (pH 4.0), 20 mM NaH PO 2 30 mM NaCl, 0.05% Tween- 4 80). It was extracted at 80). The filtered plant extract was mixed with 50 mM sodium acetate (pH 4.0), 30 mM NaCl, 3 M (NH 4 ) 2 SO 4 to obtain a final concentration of 1 M (NH 4 ) 2 SO 4 . A buffer containing 15 mM sodium acetate (pH 4.0), 20 mM NaH PO 2 , 30 mM NaC 4 l, 0.05% Tween 80, 1 M (NH ) 4 ) 2 SO 4 was used to equilibrate and wash the column . A linear 0 - 100% gradient elution buffer containing 10 mM sodium acetate (pH 7.5), 20 mM NaH 2 PO 4 , 50 mM NaCl was used for protein elution. The protein sample was analyzed using SDS - PAGE (Figure 42) . The purified ScolMb protein was most efficiently concentrated in the elution fractions F11 - F14 .

[0188] ScolMc was purified using HiTrap™ Capto™ MMC resin following the same protocol as for ScolMb . The SDS - PAGE GE analysis of the protein purification fractions is shown in Figure 43. The ScolMb protein was highly concentrated in the elution fraction F18 .

[0189] Again, ScolMc was purified using HiTrap™ phenyl FF (LS) resin following the same protocol as for ScolMc. Figure 43 shows the SDS - PAGE GE analysis of the protein purification fractions. ScolMc was most highly concentrated in the elution fractions F10 - F15 . ​

[0190] Amino acid and nucleotide sequences SEQ ID NO:1 Amino acid sequence of salmosin ScolE2 MSGGDGIGHN SGAHSTGGVN GSSSGRGGSS SGGGNNPNSG PGWGTTHTPD GHDIHNYNPG EFGGGGHKPG GNG GNHSGGT GDGQPPGAAM AFGFPALVPA GAGGLAVTVS GDALAAAIAD VLAVLKGPFK FGAWGIALYG ILPTEI AKDD PRMMSKIVTS LPADAVTESP VSSLPLDQAT VSVTKRVTDV VKDERQHIAV VAGVPASIPV VDAKPTTHP G VFSVSVPGLP DLQVSTVKNA PAMTALPRGV TDEKDRTVHP AGFTFGGSSH EAVIRFPKES GQAPVYVSVT D VLTPEQVKQ RQDEENRRQQ EWDATHPVEV AERNYRLASD ELNRANVDVA GKQERQIQAA QAVAARKGEL DAAN KTFADA KEEIKKFERF AHDPMAGGHR MWQMAGLKAQ RAQNEVNQKQ AEFNAAEKEK ADADAALNVA LESRKQK EQK AKDASDKLDK ENKRNHPGKA TGKGQPVGDK WLEDAGKEAG APVPDRIADK LRDKEFKNFD DFRKKFWEEV SKDPELSKQF IPGNKKRMSQ GLAPRARNKD TVGGRRSFEL HHDKPISQDG GVYDMDNIRV TTPKLHIDIH RG K

[0191] SEQ ID NO:2 Amino acid sequence of salmosin ScolE3 MSGGDGRGHN TGAHSTSGNI NGGPTGLGVS GGASDGSGWS SENNPWGGGS GSGIHWGGGS GRGNGGGNGN SGG GSGTGGN LSAVAAPVAF GFPALSTPGA GGLAVSISAS ELSAAIAGII AKLKKVNLKF TPFGVVLSSL IPSEIA KDDP NMMSKIVTSL PADDITESPV SSLPLDKATV NVNVRVVDDV KDERQNISVV SGVPMSVPVV DAKPTERPG V FTASIPGAPV LNISVNNSTP AVQTLSPGVT NNTDKDVRPA GFTQGGNTRD AVIRFPKDSG HNAVYVSVSD V LSPDQVKQR QDEENRRQQE WDATHPVEVA EREYENARAE LEAENKNVHS LQVALDGLKN TAEGLALSDA GRHP LTSSES RFVAVPGYSG GGVHFDATAT VDSRDRLNSL LSLGGAAYVN NVLELGEVSA PTEDGLKVGN AIKNAMI EVY DKLRQRLITR QNEINHAQVS LNTAIESRNK KEEKKRSAEN KLNEERNKPR KGTKDYGHDY HPAPETEEIK GLGDIKKGIP KTPKQNGGGK RKRWIGDKGR KIYEWDSQHG ELEGYRASDG QHLGSFDPKT GKQLKGPDPK RN IKKYL

[0192] Sequence number 3 Amino acid sequence of salmosin ScolE7 MSGGDGIGHN SGAHSTGGVN GSSSGSGGSS SGSGNNPNSG PGWGTTHTPN GDIHNYNPGE FGGGGNKPGG HGG NSGNHDG SSGNGQPSAA PMAFGFPALA PAGAGSLAVT VSGEALSAAI ADIFAALKGP FKFGAWGIAL YGIMPT EIAK DDPNMMSKIM TSLPADTVTD TPVSSLPLDQ ATVSVTKRVA DVVKDERQHI AVVAGVPMSV PVVDAKPTT R PGIFSATVPG LPALEVSTGK SIPASTALPR GITEDKDRTE HPAGFTFGGS SHDAVIRFPK ESGQAPVYVS V TDVLTPEQV KQRQDEESRR QQEWDATHPV EVAERNYRLA SDELNRVNAD VAGKQERQAQ AGQAVAARKG ELDA ANKTFA DAKEEIKKFE HFARDPMAGG HRMWQMAGLK AQRAQNEVNQ KQAEFDAAEK EKADADAALN AALESRK QKE QKAKDTKERL DKENKRNQPG KATGKGQPVS DKWLEDAGKE SGSPIPDSIA DKLRDKEFRN FDDFRKKFWE EVSKDPELSK QFIKGNRDRM QVGKAPKSRK KDAAGKRTSF ELHHDKPVSQ DGGVYDMDNL RITTPKRHID IH RGQ

[0193] Amino acid sequence of salmosin ScolE1a, SEQ ID NO: 4 MADNTIAYYE DGVPHSADGK VVIVIDGKMP VDTGAGGTGG GGGGKVGGTS ESSAAIHATA KWSTAQLKKT LAE KAARERE TAAAMAAAKA KRDALTQHLK DIVNDVLRHN ASRTPSATDL AHANNMAMQA EAQRLGRAKA EEKARK EAEA AELAFQEAER QREEAVRQLA ETERQLKQAE EEKRLAALSD EARAVENARK NLDTAKSELA NVDSDIERQ R SQLSSLDADV KKAEENLRLT MRIKGRIGRK MQAKSQAIVD DKKRIYSDAE NVLNTMTVNR NLKAQQVTDA E NELKVAIDN LNSSQMKNAV DATVSFYQTL TEKYGEKYSL IAQELAEKSK GKKIGNVDEA LAAFEKYKDV LDKK FSKADR DAIVNALKSF NYDDWAKHLD QFAKYLKITG HVSFGYDVVS DVLKASETGD WKPLFITLEQ KVLDTGM SYL VVLMFSLIAG TTLGIFGVAI ITAILCSFVD KYILNALNDA LGI

[0194] Sequence number 5. Amino acid sequence of Sarmosin ScolE1b MSDNTIAYYE DGVPYSADGQ VVIVIDGKMP VDTGAGGTGG GGGGKVGGTS ESSAAIHATA KWSKAQLQKS LEE KAARERE TAAAMAAAKA KRDALTQHLK DIVNDVLRYN ASRTPSATDL AHANNMAMQA EAQRLGRAKA EEKARK EAEA AEKSLQEAER QREEAARQRA EAERQLKQAE AEEKRLAALS EEARAVEITQ KNLAAAQSEL SKMDGEIKS L NVRLSTSIHA RDAEMNSLSG KRNELAQESA KYKELDELVK KLEPRANDPL QNRPFFDATS RRARAGDTLA E KQKEVTASE TRINELNTEI NQVRGAISQA NNNRNLKVQQ VTETENALKV AIDNLNSSQM KNAVDATVSF YQTL TAKYGE KYSLIAQELA EQSKGKKISN VDEALAAFEK YKDVLDKKFS KADRDAIVNA LKSVDYADWA KHLDQFS RYL KISGRVSTGY DIYSDIRKGM DTNDWRPLFL TLEKLAVDAG VGYIVALGFS VIASTALGIW GVAIITGVIC SFVDKKDLEK LNEALGI

[0195] Amino acid sequence of salmocin Spst, Accession No. 6 MFIKSGGNLT IRTFGGLGVG GDFDSDTWRR RSTDSWVPYS EYIAIECIVA PNQLYQLLTD VAQVETVAAQ LAQ VGYQYLQ GRLRLVREDG SCTDFSGKAM LDNLLNKSKD ILDLDFLHVS EGYRSEAYWP GQSSGITIGY GVDIGH QSEE GLHKWGVPQS IIDKIKDYFG ITGEAANTLL KGLKDKTLGL SDREIKQFSD IVKKQATADI INKYNAATK G ITFDKIPYNT RTAIIDLFYQ YSAPKGAPKS WGFIINNDWN GFYNELMNFG DKHTTRRERE AALVLSDIVN N QYIYK

[0196] Amino acid sequence of salmocin ScolE2 immune protein SImmE2, Accession No. 7 MELKKSISDY TEAEFKKIIE AIINCEGDEK TQDDNLEFFI RVTEYPSGSD LIYYPEGDND GSTEAIIKEI KEW RAANGKP GFKQADSSYF VSFDYRDGDW

[0197] Amino acid sequence of salmocin ScolE7 immune protein SImmE7, Accession No. 8 MELKNSISDY TEAEFIEFMK EIDKENVAET DDKLDLLLNH FEQVTEHPDG TDLIYYAASD AESTPEAITK KIK EWRAANG KPGFKQG

[0198] Amino acid sequence of colicin S4, Accession No. 9 MAKELSVYGP TAGESMGGTG ANLNQQGGNN NSNSGVHWGG GSGSGNGGRE HGSQTGWGWS KTNNPDVPPY VDD NGQVRIT ITNGLVKTPV YGVPGAGGNS DVQGGYIPEN PNDEVARKWD KNNLPREIDV SIDGFKYRVT LNDNGR AIGI LRTGVRPYVG SEKAKAGIME KINHKTPEEI YEALGFNKDE SQRQEKAKQQ AEDAWDRLPP NVRKFDVDV E QFHYLVVLDD YGNVLSVTRT GVRPYVGSEK AKAGIMDKVD HKTPEEIYEA LGFNNEEPQR QNQAKKAAYD V FYSFSMNRD RIQSDVLNKA AEVISDIGNK VGDYLGDAYK SLAREIADDV KNFQGKTIRS YDDAMASLNK VLSN PGFKFN RADSDALANV WRSIDAQDMA NKLGNISKAF KFADVVMKVE KVREKSIEGY ETGNWGPLML EVESWVL SGI ASAVALGVFS ATLGAYALSL GAPAIAVGIV GILLAAVVGA LLDDKFADAL NKEIIKPAH

[0199] Amino acid sequence of colicin 5, SEQ ID NO: 10 MDKVTDNSPD VESTESTEGS FPTVGVDTGD TITATLATGT ENVGGGGGAF GGASESSAAI HATAKWSTAQ LKK HQAEQAA RAAAAEAALA KAKSQRDALT QRLKDIVNDA LRANAARSPS VTDLAHANNM AMQAEAERLR LAKAEQ KARE EAEAAEKALR EAERQRDEIA RQQAETAHLL AMAEAAEAEK NRQDSLDEEH RAVEVAEKKL AEAKAELAK A ESDVQSKQAI VSRVAGELEN AQKSVDVKVT GFPGWRDVQK KLERQLQDKK NEYSSVTNAL NSAVSIRDAK K TDVQNAEIK LKEAKDALEK SQVKDSVDTM VGFYQYITEQ YGEKYSRIAQ DLAEKAKGSK FSSVDEALAA FEKY KNVLDK KISKVDRDAI FNALESVNYD ELSKNLTKIS KSLKITSRVS FLYDVGSDFK NAIETGNWRP LFVTLEK SAV DVGVAKIVAL MFSFIVGVPL GFWGIAIVTG IVSSYIGDDE LNKLNELLGI

[0200] Sequence number 11 Amino acid sequence of colicin 10 MDKVTDNSPD VESTESTEGS FPTVGVDTGD TITATLATGT ENVGGGGGAF GGASESSAAI HATAKWSTAQ LKK HQAEQAA RAAAAEAALA KAKSQRDALT QRLKDIVNDA LRANAARSPS VTDLAHANNM AMQAEAERLR LAKAEQ KARE EAEAAEKALR EAERQRDEIA RQQAETAHLL AMAEAAEAEK NRQDSLDEEH RAVEVAEKKL AEAKAELAK A ESDVQSKQAI VSRVAGELEN AQKSVDVKVT GFPGWRDVQK KLERQLQDKK NEYSSVTNAL NSAVSIRDAK K TEVQNAEIK LKEAKDALEK SQVKDSVDTM VGFYQYITEQ YGEKYSRIAQ DLAEKAKGSK FNSVDEALAA FEKY KNVLDK KFSKVDRDDI FNALESITYD EWAKHLEKIS RALKVTGYLS FGYDVWDGTL KGLKTGDWKP LFVTLEK SAV DFGVAKIVAL MFSFIVGAPL GFWGIAIITG IVSSYIGDDE LNKLNELLGI

[0201] Sequence number 12 Amino acid sequence of colicin Ia MSDPVRITNP GAESLGYDSD GHEIMAVDIY VNPPRVDVFH GTPPAWSSFG NKTIWGGNEW VDDSPTRSDI EKR DKEITAY KNTLSAQQKE NENKRTEAGK RLSAAIAARE KDENTLKTLR AGNADAADIT RQEFRLLQAE LREYGF RTEI AGYDALRLHT ESRMLFADAD SLRISPREAR SLIEQAEKRQ KDAQNADKKA ADMLAEYERR KGILDTRLS E LEKNGGAALA VLDAQQARLL GQQTRNDRAI SEARNKLSSV TESLNTARNA LTRAEQQLTQ QKNTPDGKTI V SPEKFPGRS STNHSIVVSG DPRFAGTIKI TTSAVIDNRA NLNYLLTHSG LDYKRNILND RNPVVTEDVE GDKK IYNAEV AEWDKLRQRL LDARNKITSA ESAVNSARNN LSARTNEQKH ANDALNALLK EKENIRNQLA GINQKIA EEK RKQDELKATK DAINFTTEFL KSVSEKYGAK AEQLAREMAG QAKGKKIRNV EEALKTYEKY RADINKKINA KDRAAIAAAL ESVKLSDISS NLNRFSRGLG YAGKFTSLAD WITEFGKAVR TENWRPLFVK TETIIAGNAA TA LVALVFSI LTGSALGIIG YGLLMAVTGA LIDESLVEKA NKFWGI

[0202] Sequence number 13 Amino acid sequence of colicin Ib MSDPVRITNP GAESLGYDSD GHEIMAVDIY VNPPRVDVFH GTPPAWSSFG NKTIWGGNEW VDDSPTRSDI EKR DKEITAY KNTLSAQQKE NENKRTEAGK RLSAAIAARE KDENTLKTLR AGNADAADIT RQEFRLLQAE LREYGF RTEI AGYDALRLHT ESRMLFADAD SLRISPREAR SLIEQAEKRQ KDAQNADKKA ADMLAEYERR KGILDTRLS E LEKNGGAALA VLDAQQARLL GQQTRNDRAI SEARNKLSSV TESLKTARNA LTRAEQQLTQ QKNTPDGKTI V SPEKFPGRS STNHSIVVSG DPRFAGTIKI TTSAVIDNRA NLNYLLTHSG LDYKRNILND RNPVVTEDVE GDKK IYNAEV AEWDKLRQRL LDARNKITSA ESAINSARNN VSARTNEQKH ANDALNALLK EKENIRSQLA DINQKIA EEK RKRDEINMVK DAIKLTSDFY RTIYDEFGKQ ASELAKELAS VSQGKQIKSV DDALNAFDKF RNNLNKKYNI QDRMAISKAL EAINQVHMAE NFKLFSKAFG FTGKVIERYD VAVELQKAVK TDNWRPFFVK LESLAAGRAA SA VTAWAFSV MLGTPVGILG FAIIMAAVSA LVNDKFIEQV NKLIGI

[0203] Sequence number 14 Amino acid sequence of colicin M METLTVHAPS PSTNLPSYGN GAFSLSAPHV PGAGPLLVQV VYSFFQSPNM CLQALTQLED YIKKHGASNP LTL QIISTNI GYFCNADRNL VLHPGISVYD AYHFAKPAPS QYDYRSMNMK QMSGNVTTPI VALAHYLWGN GAERSV NIAN IGLKISPMKI NQIKDIIKSG VVGTFPVSTK FTHATGDYNV ITGAYLGNIT LKTEGTLTIS ANGSWTYNG V VRSYDDKYDF NASTHRGIIG ESLTRLGAMF SGKEYQILLP GEIHIKESGK R

[0204] SEQ ID NO: 15 Nucleotide sequence used for the expression of Sarmosin ScolE2 in the example atgtctggtggtgatggtatcggtcacaatagcggtgctcattctactggtggtgtgaacggttcttcatctggtagggg tggtagttcttcaggtggtggtaacaaccctaactctggtcctggttggggtactactcatactcctgatggtcacgata tccacaactacaaccctggtgagtttggtggtggtggacataagcctggtggaaacggtggtaatcactctggtggtact ggtgatggacaacctcctggtgctgctatggcttttggtttccctgctcttgttcctgctggtgctggtggtcttgctgt tactgtttctggtgatgctctggctgctgcaattgctgatgtgcttgctgttctgaagggacctttcaagtttggtgctt ggggtatcgctctgtacggtattcttcctaccgagatcgctaaggatgatccaaggatgatgagcaagatcgtgacctct ttgcctgctgatgctgtgactgagtctcctgtgtcatctctgcctcttgatcaggctactgtgagcgttaccaagagggt taccgatgtggttaaggatgagaggcagcacattgctgttgttgctggtgtgcctgcttctatccctgttgttgatgcta agcctactacccaccctggtgtgttctctgtttctgttcctggtctgcctgatctgcaggtttcaactgtgaagaacgct cctgctatgactgctttgcctaggggtgttactgatgagaaggataggactgttcaccctgctggtttcaccttcggtgg ttcttctcatgaggctgtgatcaggttccctaaagagtctggtcaggctcctgtttacgtgtcagtgaccgatgttctta cccctgagcaggttaagcagagacaggatgaagagaatagaaggcagcaagagtgggatgctactcaccctgttgaagtg gctgagaggaattacaggctggcttctgatgagctgaacagggctaatgtggatgtggctggtaagcaagagaggcagat tcaagctgctcaagctgttgctgctagaaagggtgaactggatgctgctaacaagaccttcgctgatgctaaagaagaga tcaagaagttcgagaggttcgctcacgatcctatggctggtggacacagaatgtggcaaatggctggtcttaaggctcag agggctcagaatgaggttaaccagaaacaagctgagttcaacgctgctgagaaagaaaaggctgatgcagatgctgctct gaacgtggcacttgagtctaggaagcagaaagaacaaaaggcaaaggatgctagcgataagctggataaggaaaacaaga ggaaccaccctggaaaggctactggtaagggtcaacctgttggtgataagtggcttgaggatgctggtaaagaagctgga gcacctgttccagataggatcgctgataagctgagagataaggaattcaagaacttcgatgattttaggaagaagttctg ggaagaggtaaatttctagtttttctccttcattttcttggttaggacccttttctctttttatttttttgagctttgat ctttctttaaactgatctattttttaattgattggttatggtgtaaatattacatagctttaactgataatctgattact ttatttcgtgtgtctatgatgatgatgataactgcaggttagcaaggatcctgagctgagcaagcagttcatccctggta acaagaaaaggatgagccagggtcttgctcctagggctagaaacaaggatactgtgggtggtagaagatccttcgagctg catcacgataagccaatctctcaggatggtggtgtttacgatatggataacatcagggtgaccaccccaaagctgcacat cgatattcataggggaaagtaa

[0205] SEQ ID NO: 16 Nucleotide sequence used for the expression of salmosin ScolE3 in the examples atgtctggtggtgatggtaggggtcataataccggtgctcatagcaccagcggtaacattaacggtggtcctactggtct tggtgtgtcaggtggtgcttctgatggttctggttggtcctctgagaacaatccttggggtggtggtagcggttctggta ttcactggggaggtggaagtggtagaggtaatggtggtggaaacggtaacagtggtggtggttctggaactggtggtaac ctttctgctgttgctgctcctgttgctttcggtttccctgctctttctactcctggtgctggtggtttggctgtgtctat ttctgcttctgagctgagcgctgctatcgctggtattatcgctaagctgaagaaggtgaacctgaagttcacccctttcg gtgtggtgctgtcctctttgattcctagcgagatcgctaaggatgatcctaacatgatgagcaagatcgtgaccagcctg cctgctgatgatattaccgagtctcctgtgtcctctctgcctcttgataaggctactgtgaatgtgaacgtgagggtggt ggatgatgtgaaggatgagaggcagaacatcagcgttgtgtctggtgttcctatgtctgtgcctgttgtggatgctaagc ctactgaaaggcctggtgtgttcaccgcttctattccaggtgctcctgtgctgaacatctccgtgaacaattctacccct gctgtgcagactctttctcctggtgtgactaacaacaccgataaggatgttaggcctgctggtttcactcagggtggtaa taccagggatgctgtgatcaggttccctaaggattctggtcacaacgcagtgtacgtgtccgtgtctgatgtgttgtctc cagatcaggttaagcagaggcaggatgaagagaatagaaggcagcaagagtgggatgctactcaccctgttgaagttgct gagagagagtacgagaacgctagagctgaacttgaggctgaaaacaagaacgtgcacagccttcaggtggcacttgatgg tcttaagaataccgctgagggtctggctctttctgatgctggtagacatcctctgaccagcagcgagtctagatttgttg ctgtgcctggttactccggtggtggtgttcattttgatgctaccgctaccgtggatagcagggataggcttaactctctt ctgtctcttggtggtgctgcttacgtgaacaacgtgttggagcttggtgaggtgtcagctcctactgaggatggtttgaa ggtgggaaacgctatcaagaacgctatgatcgaggtgtacgataagctgaggcagaggcttattaccaggcagaacgaga tcaaccacgctcaggtgtcacttaacaccgctatcgagtctaggaacaagaaagaggaaaagaagaggtccgcagagaac aagctgaacgaagagagaaacaagcctagaaagggtactaaggattacggacacgattaccatcctgctccagagactga agaaatcaagggtctgggtgatatcaagaagggtatccctaagacccctaagcagaacggtggtggtaagagaaagagat ggatcggagataagggtagaaagatctacgagtgggatagccagcatggtgagcttgaaggtaaatttctagtttttctc cttcattttcttggttaggacccttttctctttttatttttttgagctttgatctttctttaaactgatctattttttaa ttgattggttatggtgtaaatattacatagctttaactgataatctgattactttatttcgtgtgtctatgatgatgatg ataactgcaggttatagggcttcagatggtcagcacctgggaagctttgatcctaagactggtaagcagctgaagggtcc tgatccaaagaggaacatcaagaagtacctttaa

[0206] SEQ ID NO:17 Nucleotide sequence used for the expression of salmosin ScolE7 in the examples atgtctggtggtgatggtatcggtcacaatagcggtgctcattctactggtggtgtgaacggttcctcttctggttctgg tggaagctcatctggaagcggtaacaaccctaattctggtcctggttggggtactactcatacccctaacggtgatatcc acaactacaaccctggtgagtttggtggtggtggaaacaagcctggtggacatggtggtaactctggtaaccacgatggt agctctggaaacggtcaaccttctgctgctcctatggcttttggtttccctgctcttgctcctgctggtgctggttctct tgctgttactgtttctggtgaggctctgtctgctgctatcgctgatattttcgctgctctgaagggacctttcaagttcg gtgcttggggtattgctctgtacggtattatgcctaccgagatcgctaaggatgatcctaacatgatgagcaagatcatg accagcctgcctgctgatactgtgactgatactcctgtgtcctctctgcctcttgatcaggctactgtgtctgtgactaa gagggttgcagatgtggtgaaggatgagaggcagcatattgctgttgttgctggtgtgcctatgtctgtgcctgttgttg atgctaagcctaccactaggcctggtatcttctctgctactgttcctggacttcctgctttggaggtgtcaaccggtaag tctattcctgcttctaccgctctgcctaggggtattactgaggataaggataggactgagcaccctgctggtttcacttt cggtggttcttctcacgatgctgtgatcaggttccctaaagagtctggtcaggctccagtttacgtgtcagtgactgatg tgcttacccctgagcaggttaagcagagacaggatgaagagtctagaaggcagcaagagtgggatgctactcatcctgtt gaagtggctgagaggaactacaggcttgcttctgatgagctgaacagggtgaacgctgatgtggctggtaagcaagaaag acaagctcaagctggacaggctgttgctgctagaaagggtgaacttgatgctgctaacaagaccttcgctgatgctaaag aagagatcaagaagttcgagcacttcgctagggatccaatggctggtggtcatagaatgtggcagatggctggtcttaag gctcagagggctcagaatgaggttaaccagaaacaagctgagttcgatgctgcagagaaagaaaaggctgatgctgatgc agctctgaacgctgctcttgaatctaggaagcagaaagagcagaaggctaaggataccaaagagaggctggataaggaaa acaagaggaatcagcctggtaaggctaccggtaagggtcagccagtttctgataagtggcttgaggatgctggtaaagag agcggttctcctatccctgatagcattgctgataagcttagagataaggaattcagaaacttcgatgattttaggaagaa gttctgggaggaagttagcaaggatcctgagctgagcaagcagttcatcaagggtaacagagataggatgcaggtaaatt tctagtttttctccttcattttcttggttaggacccttttctctttttatttttttgagctttgatctttctttaaactg atctattttttaattgattggttatggtgtaaatattacatagctttaactgataatctgattactttatttcgtgtgtc tatgatgatgatgataactgcaggttggaaaggctcctaagtccagaaagaaggatgctgctggtaagaggacctctttc gagcttcatcacgataagcctgtgagccaggatggtggtgtttacgatatggataacctgaggatcaccacccctaagag gcacatcgatattcataggggacagtaa

[0207] SEQ ID NO: 18. Nucleotide sequence used for the expression of salmochelin ScolE1a in the examples atggctgataacaccattgcttactacgaggatggtgtgcctcacagcgctgatggtaaggtggtgattgtgatcgatgg taagatgcctgtggataccggtgctggtggtactggtggtggtggaggtggtaaggttggaggaacttctgaaagctctg ctgctattcacgctaccgctaagtggtctaccgctcagcttaagaaaaccctggctgagaaggctgctagagagagagaa actgctgctgcaatggctgctgctaaggctaagagagatgctcttacccagcacctgaaggatatcgtgaacgatgtgct taggcacaacgcttctaggaccccttctgctactgatcttgctcacgctaacaacatggctatgcaggctgaagctcaga gacttggtagagctaaggctgaggaaaaggctagaaaagaggctgaggctgctgagcttgctttccaagaagctgaaaga cagagggaagaggctgttagacagcttgctgaaactgagaggcagcttaagcaagctgaggaagagaagaggcttgctgc tctttctgatgaggctagggctgttgagaacgctaggaagaatctggataccgcaaagtccgagctggctaatgtggatt ctgatatcgagaggcagaggtcccagctgtcatctcttgatgctgatgtgaagaaggctgaagagaacctgaggctgacc atgaggattaagggtaggatcggtaggaagatgcaggctaagtcacaggctatcgtggatgataagaaaaggatctactc cgatgctgagaacgtgctgaataccatgaccgtgaataggaacctgaaggctcagcaggttaccgatgcagagaatgagc ttaaggtggcaatcgataacctgaacagcagccagatgaagaacgctgtggatgctaccgtgtctttctaccagactctg accgagaagtacggtgagaagtacagccttatcgctcaagagctggcagagaagtccaagggtaagaaaatcggaaatgt ggatgaggctctggctgcattcgagaagtataaggatgtgctggataagaagttcagcaaggctgatagggatgctattg tgaacgctctgaagtccttcaactacgatgattgggctaagcacctggatcagttcgctaagtacctgaagatcaccggt cacgtgagcttcggttacgatgttgtgtctgatgtgctgaaggctagcgagactggtgattggaagcctctgttcattac ccttgagcagaaggtgttggatactggtatgagctacctggtggtgctgatgttctctcttattgctggaaccaccctgg gaatcttcggtgtggctattattaccgctatcctgtgcagcttcgtggataagtacatcctgaacgcactgaacgatgct ctgggaatctaa

[0208] SEQ ID NO: 19 Nucleotide sequence used for the expression of salmochelin ScolE1b in the example atgagcgataacaccattgcttactacgaggatggtgtgccttacagcgctgatggtcaagtggtgattgtgatcgatgg taagatgcctgtggataccggtgctggtggtactggtggtggtggaggtggtaaggttggaggaacttctgaaagctctg ctgctattcacgctaccgctaagtggtctaaggctcagcttcagaagtccctggaagagaaggctgctagagagagagaa actgctgctgcaatggctgctgctaaggctaagagagatgctcttacccagcacctgaaggatatcgtgaacgatgtgct gaggtacaacgcttctaggactccttctgctaccgatcttgctcacgctaacaacatggctatgcaggctgaagctcaga gacttggtagagctaaggctgaggaaaaggctagaaaagaggctgaggctgctgagaagtctcttcaagaagctgagaga cagagggaagaagctgctaggcaaagagctgaagcagagaggcaacttaagcaggcagaggctgaagagaagaggttggc tgctctttctgaagaggctagggcagttgagatcacccagaagaatcttgctgctgctcagagcgagctgtccaagatgg atggtgagatcaagagccttaacgtgaggctgtctacctctatccatgctagggatgctgagatgaacagcctgtctggt aagaggaacgagctggctcaagagagcgctaagtacaaagaactggatgagctggtgaagaagcttgagcctagggctaa tgatcctctgcagaacaggcctttcttcgatgctacatctagaagggcaagggctggtgatactttggctgagaagcaga aagaggtgaccgcttctgagactaggatcaacgagcttaacaccgagatcaaccaggtgaggggtgctatttcacaggca aacaacaataggaacctgaaggtgcagcaggttaccgagactgagaacgctcttaaggtggcaatcgataacctgaacag cagccagatgaagaacgctgtggatgctaccgtgtctttctaccagaccctgactgctaagtacggtgagaagtacagcc tgatcgctcaagaacttgctgagcagtccaagggtaagaaaatcagcaatgtggatgaggctctggctgcattcgagaag tataaggatgtgctggataagaagttcagcaaggctgatagggatgcaattgtgaacgctctgaagtccgtggattacgc tgattgggctaagcacctggatcagttcagcagatacctgaagatcagcggtagggtgtcaaccggttacgatatctaca gcgatatcagaaagggtatggataccaacgattggaggcctctgttcctgacccttgagaagcttgctgttgatgctggt gtgggttacatcgtggctcttggtttctctgtgatcgcttctaccgctcttggtatttggggtgtggctattatcaccgg tgtgatctgcagcttcgttgataagaaggatttggagaagctgaacgaggcactgggaatctaa

[0209] Nucleotide sequence used for the expression of salmosin Spst in the Example of SEQ ID NO: 20 atgttcatcaagagcggtggtaacctgaccatcaggacttttggtggtcttggtgtgggtggtgatttcgatagcgatac ttggagaagaaggtccaccgattcttgggtgccatacagcgagtacattgctatcgagtgcatcgtggctcctaaccagc tttaccagcttcttactgatgtggctcaggtggaaactgtggctgctcaacttgctcaggttggataccagtatcttcag ggtaggcttaggctggtgagagaggatggttcttgcaccga...

Claims

1. 1. A method for preventing or reducing infection or contamination of a subject with Salmonella, comprising: A method comprising contacting the subject with a protein comprising or consisting of any one of the following amino acid sequences: (A-x) SEQ ID NO: 28, (A-xi) SEQ ID NO: 33, (A-xii) SEQ ID NO: 34 (A-vii) SEQ ID NO: 25, (A-viii) SEQ ID NO: 26, or (A-ix) SEQ ID NO: 27 or (B-x) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 28; (B-xi) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 33; (B-xii) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 34; (B-vii) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 25; (B-viii) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 26, or (B-ix) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 27; or (C-x) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 28; (C-xi) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 33; (C-xii) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 34; (C-vii) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 25; (C-viii) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 26; or (C-ix) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 27; or (D-x) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 28; (D-xi) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 33; (D-xii) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 34; (D-vii) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 25; (D-viii) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 26; or (D-ix) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 27; or (E-x) an amino acid sequence comprising or consisting of at least 215 consecutive amino acid residues of SEQ ID NO: 28; (E-xi) an amino acid sequence comprising or consisting of at least 215 consecutive amino acid residues of SEQ ID NO: 33; (E-xii) an amino acid sequence comprising or consisting of at least 215 consecutive amino acid residues of SEQ ID NO: 34; (E-vii) an amino acid sequence comprising or consisting of at least 425 consecutive amino acid residues of SEQ ID NO: 25; (E-viii) an amino acid sequence comprising or consisting of at least 425 consecutive amino acid residues of SEQ ID NO: 26; or (E-ix) An amino acid sequence comprising or consisting of at least 425 consecutive amino acid residues of SEQ ID NO:

27.

2. the protein is as defined in any one of (B-x), (C-x), (D-x), (Ex-x), (B-xi), (C-xi), (D-xi), (E-xi), (B-xii), (C-xii), (D-xii), or (E-xii); 2. The method of claim 1, wherein the amino acid residue of the protein corresponding to residue 155 of SEQ ID NO: 33 is Pro and / or the amino acid residue corresponding to residue 246 of SEQ ID NO: 33 is Arg or Lys, preferably Arg.

3. 3. The method of claim 1 or 2, wherein the amino acid residues corresponding to residues 76 and 84 of SEQ ID NO:33 are both Gln.

4. The method of any one of claims 1 to 3, wherein the protein is capable of exerting a cytotoxic effect on Salmonella.

5. The toxicity of the proteins according to claim 1, in particular according to classes (b) to (d) of claim 1, against Salmonella enterica is determined by the expression of the cM of susceptible Salmonella enterica strains. ２ 1x10 per ７ Five microliters of the solutions of the proteins of classes (b) to (d) and the protein of SEQ ID NO: 1 were spotted onto a soft agar overlay plate inoculated with 0.14 mL of bacterial solution at 1000 cfu / mL, and the agar plate was then incubated at 37° C. for 12 hours, after which the proteins and the protein of SEQ ID NO: 1 were detected to be 1000 μg / mL of Salmonella enterica ssp. enterica serovar Newport strain ATCC® 6962™ with the same diameter. ＊ 5. The method of claim 1, wherein the concentration of proteins of classes (b) to (d) is up to 5 times that of a comparison solution of protein of sequence number 1, such that the concentration of proteins of classes (b) to (d) is up to 5 times that of a comparison solution of protein of sequence number 1.

6. 6. The method according to any one of claims 1 to 5, wherein the object is sprayed with or immersed in the aqueous solution or the object is immersed in the aqueous solution of the protein for at least 10 seconds, preferably at least 1 minute, preferably at least 5 minutes.

7. 7. The method of any one of claims 1 to 6, wherein the object is a food product or animal feed, or the food product is a whole animal carcass, meat, eggs, raw fruit or vegetables.

8. A composition comprising one or more proteins comprising or consisting of any one of the following amino acid sequences: (A-x) SEQ ID NO: 28, (A-xi) SEQ ID NO: 33, (A-xii) SEQ ID NO: 34 (A-vii) SEQ ID NO: 25, (A-viii) SEQ ID NO: 26, or (A-ix) SEQ ID NO: 27 or (B-x) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 28; (B-xi) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 33; (B-xii) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 34; (B-vii) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 25; (B-viii) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 26, or (B-ix) an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 27; or (C-x) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 28; (C-xi) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 33; (C-xii) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 34; (C-vii) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 25; (C-viii) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 26; or (C-ix) an amino acid sequence having at least 80% sequence similarity to the amino acid sequence of SEQ ID NO: 27; or (D-x) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 28; (D-xi) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 33; (D-xii) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 34; (D-vii) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 25; (D-viii) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 26; or (D-ix) an amino acid sequence having 1 to 40 amino acid substitutions, additions, insertions or deletions relative to the amino acid sequence of SEQ ID NO: 27; or (E-x) an amino acid sequence comprising or consisting of at least 215 consecutive amino acid residues of SEQ ID NO: 28; (E-xi) an amino acid sequence comprising or consisting of at least 215 consecutive amino acid residues of SEQ ID NO: 33; (E-xii) an amino acid sequence comprising or consisting of at least 215 consecutive amino acid residues of SEQ ID NO: 34; (E-vii) an amino acid sequence comprising or consisting of at least 425 consecutive amino acid residues of SEQ ID NO: 25; (E-viii) an amino acid sequence comprising or consisting of at least 425 consecutive amino acid residues of SEQ ID NO: 26; or (E-ix) An amino acid sequence comprising or consisting of at least 425 consecutive amino acid residues of SEQ ID NO:

27.

9. 9. The composition of claim 8, - a protein according to paragraph (A-iv), (B-iv), (C-iv), (D-iv) or (E-iv) and / or according to paragraph (A-v), (B-v), (C-v), (D-v) or (E-v); and - The composition comprising a protein according to item (A-x), (B-x), (C-x), (D-x) or (E-x), optionally further comprising a protein as defined in claim 2 or 3.

10. 9. The composition of claim 8, - a protein according to paragraph (A-iv), (B-iv), (C-iv), (D-iv) or (E-iv) and / or according to paragraph (A-v), (B-v), (C-v), (D-v) or (E-v); and - the composition comprising a protein according to item (A-xi), (B-xi), (C-xi), (D-xi) or (E-xi), optionally further comprising a protein as defined in claim 2 or 3.

11. 9. The composition of claim 8, - a protein according to paragraph (A-iv), (B-iv), (C-iv), (D-iv) or (E-iv) and / or according to paragraph (A-v), (B-v), (C-v), (D-v) or (E-v); and - The composition comprising a protein according to item (A-xii), (B-xii), (C-xii), (D-xii) or (E-xii), optionally further comprising a protein as defined in claim 2 or 3.

12. 9. The composition of claim 8, - a protein according to paragraph (A-x), (B-x), (C-x), (D-x) or (E-x) and / or according to paragraph (A-xi), (B-xi), (C-xi), (D-xi) or (E-xi) and / or according to paragraph (A-xii), (B-xii), (C-xii), (D-xii) or (E-xii); and - The composition comprising a protein according to item (A-viii), (B-viii), (C-viii), (D-viii) or (E-iii).

13. 13. The composition of claim 8, wherein the composition is a plant material or an extract thereof, the plant material being a raw material derived from a plant that expresses the protein; or the composition is an aqueous solution comprising the protein.

14. 10. A protein as defined in any one of claims 1 to 7 for use in a method of treating an infection by Salmonella in a subject in need thereof.

15. 14. A composition as defined in any one of claims 8 to 13 for use in a method of treating an infection by Salmonella in a subject in need thereof.

16. 16. The protein of claim 14 or the composition of claim 15, wherein the Salmonella is Salmonella enterica.

Images