Digital amplification for protein detection

Abstract

To provide a method of measuring the quantity of analyte molecules.SOLUTION: In some aspects, a method comprises compartmentalizing a sample with binding molecules conjugated to synthetic nucleic acid molecules such that interaction of the binding molecules with analyte molecules brings nucleic acid molecules into proximity. Proximity triggers reactions that result in an optical signal, such as fluorescence, in analyte-containing compartments which can be counted to determine a quantity of analyte present. The present disclosure provides methods, systems, and compositions for performing assays. In various aspects, the present disclosure relates to digital assays, and in particular aspects protein assays, that can be performed using an amplification reaction and / or in a single step or single container.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 62 / 736,972, filed on September 26, 2018, which is hereby incorporated by reference in its entirety.

[0002] Sequence Listing This application is electronically filed in ASCII format and includes a sequence listing that is hereby incorporated by reference in its entirety. The ASCII copy created on September 24, 2019, is named 39355 - 701_601_SL.txt and is 2,585 bytes in size.

Background Art

[0003] Digital assays in which measurements are made based on the count of binary yes or no responses are becoming increasingly important in biology due to their robustness, sensitivity, and accuracy. In analog measurements, calibration using an execution standard is often required, while digital measurements do not require calibration and can be faster, easier to perform, more accurate, and more robust than analog measurements.

[0004] Considering the limitations inherent in analog assays and the technical limitations of existing digital assays, it is clear that there is a need to provide improved methods and apparatuses for performing digital protein assays. The present invention described herein addresses this need and more.

Summary of the Invention

Means for Solving the Problems

[0005] The present disclosure provides methods, systems, and compositions for performing assays. In various aspects, the present disclosure relates to digital assays that can be performed using amplification reactions and / or in a single step or single container, particularly protein assays in certain aspects. In some aspects, the amplification reaction is an isothermal amplification reaction. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reaction is PCR amplification. In certain aspects, the PCR amplification is digital PCR amplification. In many aspects, the assays disclosed herein are performed without a washing step. The present disclosure further relates to homogeneous assays, i.e., assays that can be performed without attaching reagents to a solid support. In many embodiments, the homogeneous assay uses a homogeneous solution, which can be a solution in which all inputs to the proximity-induced amplification reaction are smaller than about 50 nm. Optionally, the homogeneous solution can contain an analyte and / or a light probe larger than 50 nm.

[0006] In various aspects, the present disclosure provides a method for digital detection of an analyte. A fluid is divided into a plurality of compartmentalized fluid volumes to form a homogeneous assay, such that some volumes contain the analyte and some do not. A light signal is induced by proximity-induced interactions in the analyte-containing volumes that contain the analyte and components of the compartmentalized volumes. The presence of the analyte is detected in the analyte-containing volumes based on the light signals from those volumes. During detection, each fluid of the plurality of compartmentalized fluid volumes consists essentially of each compartmentalized fluid volume generated by the partitioning step and the reaction products generated therefrom.

[0007] That is, after the fluid is divided into each compartmentalized volume, the reactants of the reaction are either maintained in the fluid of each volume or consumed to produce reaction products, but are not removed, and no additional reaction products or reactants are added. On the other hand, substances that are not substantially involved in the reaction can be added or removed. For example, some of the liquid can evaporate or be added.

[0008] In many embodiments, the analyte is a protein.

[0009] In many embodiments, each fluid volume of the plurality of compartmentalized fluid volumes includes a first probe and a second probe. The first probe includes a first binding moiety configured to bind to the analyte, and the first binding moiety binds to a first nucleic acid molecule. The second probe includes a second binding moiety configured to bind to the analyte, and the second binding moiety binds to a second nucleic acid molecule. In many embodiments, a proximity-induced interaction occurs between the first probe and the second probe when binding to the analyte, inducing an amplification reaction. The optical signal can be a fluorescence signal induced by the amplification reaction in the analyte-containing volume.

[0010] In many embodiments, the first and second nucleic acids are DNA strands. For example, each can be a single DNA strand optionally conjugated to another nucleic acid molecule.

[0011] In some embodiments, the method can include counting the number of volumes in which fluorescence is generated, thereby generating an analyte count of the sample. For example, the analyte count can be generated based on Poisson statistics.

[0012] In some embodiments, the amplification reaction is an isothermal reaction. In certain embodiments, the isothermal amplification is digital isothermal amplification. In some embodiments, the amplification reaction is PCR amplification. In certain embodiments, the amplification reaction is digital PCR amplification. In some embodiments, the method is performed without ligase.

[0013] In some embodiments, while detecting the presence of an analyte using an optical signal, each of a plurality of compartmentalized volumes consists of a respective compartmentalized fluid volume generated by a splitting step and a reaction product generated therefrom. That is, the detection step is performed on the fluid of the same compartmentalized volume generated in the splitting step. For example, when the fluid is split, each fluid volume can be maintained as a closed system. In some embodiments, the fluid is split into a plurality of closed containers, and each fluid volume is contained within a single container throughout the remainder of the method until an analyte is detected using an optical signal.

[0014] In many embodiments, this method is performed without a washing step. In some embodiments, the optical signal is an absorption signal or an emission signal.

[0015] In some embodiments, at least one of the proximity-induced interaction and the amplification reaction is an isothermal reaction. In certain embodiments, the proximity-induced interaction is an isothermal reaction. In certain embodiments, the amplification reaction is an isothermal reaction. In certain embodiments, the isothermal reaction is digital isothermal amplification. In some embodiments, the amplification reaction is a PCR reaction. In certain embodiments, the amplification reaction is a digital PCR reaction. In many embodiments, both the proximity-induced interaction and the amplification reaction are isothermal reactions.

[0016] In many embodiments, the proximity-induced interaction is a strand displacement interaction. In some embodiments, prior to the proximity-induced interaction, a second nucleic acid molecule binds to a non-extendable blocker oligonucleotide. The proximity-induced interaction displaces the blocker oligonucleotide into the solution by a first and the interaction between the first and second nucleic acids, and the amplification reaction includes inducing template polymerization to extend the first nucleic acid molecule after displacement of the blocker oligonucleotide. The second nucleic acid can be, for example, a template for the extension of the first nucleic acid. Each fluid volume can include a nicking endonuclease configured to cleave the extended first nucleic acid and allow release of the nicked portion into solution. The nicking endonuclease can be an enzyme such as a version of Cas9 or a ribozyme or an RNA-guided endonuclease. The optical signal can be induced based on the release of the nicked portion within the analyte-containing volume.

[0017] In some embodiments, the amplification reaction repeatedly extends the first nucleic acid, and the nicking endonuclease repeatedly cleaves the extended first nucleic acid, thereby causing accumulation of the nicked nucleic acid strands. In some embodiments, each fluid volume includes a plurality of fluorescent moieties configured to bind to the accumulated nicked nucleic acid strands, and fluorescence is induced by binding of the fluorescent moieties to the accumulated nicked nucleic acid strands and by irradiating with resonant light close to the fluorescent moieties bound to the plurality of volumes, thereby inducing fluorescence from the bound fluorescent moieties.

[0018] In some embodiments, the fluorescent moiety is a dye. In some embodiments, the fluorescent moiety is a protein. In some embodiments, the fluorescent moiety is a polymer dot.

[0019] In some embodiments, each fluid volume comprises a plurality of auxiliary substrates. In some embodiments, each of the auxiliary substrates comprises an auxiliary nucleic acid strand, and at least some of the auxiliary substrates are bound to an auxiliary non-extendable blocker oligonucleotide. In some embodiments, each of the auxiliary substrates comprises an auxiliary nucleic acid strand, and none of the auxiliary substrates are bound to an auxiliary non-extendable blocker oligonucleotide. The auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide and forming an auxiliary nucleic acid complex in solution. The auxiliary nucleic acid complex comprises the nicked portion and the auxiliary nucleic acid strand, and is configured to repeatedly induce extension of the nicked portion and removal of a portion of the extended nicked portion by a nicking endonuclease or polymerase. The removed extended nicked portion comprises a copy of the first removed nicked portion. This process can produce exponential amplification for the accumulation of nucleic acid products.

[0020] In many embodiments, the amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification.

[0021] In some embodiments, the amplification reaction is rolling circle amplification, and the second probe comprises a rolling circle amplification substrate bound to a second nucleic acid molecule. The rolling circle substrate comprises a circular nucleic acid strand. The circular nucleic acid strand comprises a first binding site for binding to the first nucleic acid molecule and a second binding site for binding to the second nucleic acid molecule. These sites can optionally overlap partially or entirely, for example, one site can be a subset of the other site. The circular nucleic acid strand can have an affinity for the first nucleic acid molecule that is equal to or greater than that between the second binding site and the second nucleic acid molecule, thereby facilitating transfer of the circular nucleic acid strand to the first nucleic acid molecule. In some cases, the second binding site comprises one or more mismatched nucleic acids that are not complementary to the corresponding nucleic acid of the second nucleic acid molecule.

[0022] In various aspects, the present disclosure provides a method for digital detection of protein analytes. A fluid is divided into a plurality of compartmentalized fluid volumes to form homogeneous assays, such that some volumes contain the analyte and some do not. Each compartmentalized fluid volume further comprises a first probe comprising a first binding moiety bound to a first nucleic acid molecule and a second probe comprising a second binding moiety bound to a second nucleic acid molecule. Each binding moiety is configured to bind to the analyte, e.g., configured to bind to different loci on a common protein molecule. When a proximity-induced interaction occurs upon binding to the analyte, it occurs between the first and second nucleic acid molecules, and an amplification reaction results in a compartmentalized analyte-containing volume. The presence of the analyte within the analyte-containing volume is detected based on the amplification reaction. In some aspects, the amplification reaction is an isothermal amplification reaction. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reaction is PCR amplification. In certain aspects, the amplification reaction is digital PCR amplification.

[0023] In some aspects, detection is performed by irradiating the plurality of compartmentalized volumes with light and detecting fluorescence from the compartmentalized analyte-containing volumes.

[0024] In some aspects, the partitioning step comprises placing each compartmentalized fluid volume into a respective one of a plurality of containers. Each compartmentalized fluid volume can remain in its respective container until the detection step is performed.

[0025] In many aspects, the proximity-induced interaction induces an amplification reaction in which the second nucleic acid molecule is extended. In some aspects, the second nucleic acid molecule is extended using the first nucleic acid as a template. Optionally, the first nucleic acid molecule is bound to a rolling circle substrate prior to the proximity-induced interaction, and the proximity-induced interaction induces the extension of the second nucleic acid molecule using the rolling circle substrate as a template.

[0026] In many embodiments, the first nucleic acid binds to an extensible substrate prior to the proximity-induced interaction, and the proximity-induced interaction releases the extensible substrate into solution. In some embodiments, the release of the extensible substrate induces an exponential amplification reaction.

[0027] In some embodiments, the proximity-induced interaction induces a hairpin assembly reaction. In some embodiments, the proximity-induced interaction generates a catalytic surface composed of a portion of the first and second nucleic acid molecules. Optionally, the fluid contains an auxiliary substrate bound to an auxiliary non-extensible blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extensible blocker oligonucleotide, thereby inducing an amplification reaction that includes the auxiliary substrate. Optionally, the fluid contains a rolling circle substrate bound to an auxiliary non-extensible blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extensible blocker oligonucleotide, thereby inducing an amplification reaction that includes the rolling circle substrate. Optionally, the fluid contains a plurality of folded hairpin molecules, and the catalytic surface catalyzes the unfolding of at least one of the plurality of folded hairpin molecules.

[0028] In various embodiments, methods are provided for detecting the presence of an analyte in a fluid via strand displacement amplification. A first probe and a second probe are provided in solution. The first probe includes a first binding portion configured to bind to the analyte, and the binding portion is conjugated to a first nucleic acid molecule. The second probe includes a second binding portion configured to bind to the analyte, and the binding portion is conjugated to a first nucleic acid molecule. A second nucleic acid molecule is bound to a non-extensible blocker oligonucleotide. The non-extensible blocker oligonucleotide is displaced into solution by a proximity-induced interaction between the first probe and the second probe, which can occur when each binds to a single analyte. Template-directed polymerization is induced to extend the first nucleic acid molecule, and this extension is used to induce an optical signal for detecting the analyte in the fluid. In some embodiments, the optical signal is fluorescence.

[0029] In many embodiments, displacing a non-extendible blocker oligonucleotide comprises binding a first nucleic acid molecule to a second nucleic acid molecule. Further, extending the first nucleic acid molecule may comprise using the second nucleic acid molecule as a template. In some embodiments, a nicking endonuclease configured to cleave the extended first nucleic acid and enable release of the nicked portion into solution is provided in the fluid.

[0030] In some embodiments, the fluid comprises a plurality of auxiliary substrates. In some embodiments, each of the auxiliary substrates comprises an auxiliary nucleic acid strand, and at least some of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. In some embodiments, each of the auxiliary substrates comprises an auxiliary nucleic acid strand, and none of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. The auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendible blocker oligonucleotide and forming an auxiliary nucleic acid complex comprising the nicked portion and the auxiliary nucleic acid strand in solution. The auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of a portion of the extended nicked portion using the nicking endonuclease or polymerase, wherein the removed extended nicked portion comprises a copy of the initially removed nicked portion. For example, the nicking endonuclease can cleave the extended nicked portion, which can be removed into solution by a polymerase that performs additional extension.

[0031] In many embodiments, the analyte is a protein. In various embodiments, the nucleic acid molecule is DNA.

[0032] In various aspects, the present disclosure provides a composition for use in detecting an analyte. The composition includes a solution comprising a first probe that includes a first binding moiety bound to a first nucleic acid molecule, and a second probe that includes a second binding moiety bound to a second nucleic acid molecule. Each of the first and second binding moieties is configured to bind to the analyte. The second nucleic acid molecule is also bound to a non-extendable blocker oligonucleotide. The first and second nucleic acid strands include corresponding sections of nucleic acid such that when the first and second probes bind to the analyte and come into proximity, the non-extendable blocker oligonucleotide is displaced into the solution by a proximity-induced interaction between the first and second probes. Further, the participants in the proximity-induced interaction do not bind directly or indirectly to a solid support.

[0033] In many embodiments, the solution further comprises a polymerase for extending the first nucleic acid upon displacement of the non-extendable blocker oligonucleotide by proximity-induced interaction. In some embodiments, the solution further comprises a nicking endonuclease configured to cleave the nicked portion of the extended first nucleic acid and release the nicked portion into the solution. The solution can further comprise a fluorescent moiety configured to fluoresce in response to accumulation of nucleic acids when irradiated. In some embodiments, the fluid further comprises a plurality of auxiliary substrates. In some embodiments, each of the auxiliary substrates comprises an auxiliary nucleic acid strand, and at least some of the auxiliary substrates are bound to an auxiliary non-extendable blocker oligonucleotide. In some embodiments, each of the auxiliary substrates comprises an auxiliary nucleic acid strand, and none of the auxiliary substrates are bound to an auxiliary non-extendable blocker oligonucleotide. The auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide and forming an auxiliary nucleic acid complex comprising the nicked portion and the auxiliary nucleic acid strand in the solution. The auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of a portion of the extended nicked portion by the nicking endonuclease or polymerase. The removed extended nicked portion can include a copy of the initially removed nicked portion.

[0034] In various aspects, the present disclosure provides a system for digital detection of an analyte. The system includes a plurality of fluid volumes disposed in respective compartments. Some of the plurality of fluid volumes are compartmentalized non-analyte-containing volumes and others are compartmentalized analyte-containing volumes. Each fluid volume includes a first probe that includes a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first nucleic acid molecule. Each fluid volume further includes a second probe that includes a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second nucleic acid molecule. The system further includes a light source configured to irradiate the fluid volumes within the compartments and induce fluorescence in response to an amplification reaction induced by a proximity-induced interaction between the first probe and the second probe. In some aspects, the amplification reaction is an isothermal amplification reaction. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reaction is PCR amplification. In certain aspects, the amplification reaction is digital PCR amplification. The interaction occurs when the first and second probes bind to the analyte in the solution within the compartment.

[0035] In many aspects, the system further includes a detector configured to detect fluorescence from the compartmentalized analyte-containing volumes and generate a count of the analyte sample based on the detection of the fluorescence.

[0036] In many aspects, the amplification reaction includes template-directed polymerization or a cascade dequenching reaction. In some aspects, the amplification reaction that includes template-directed polymerization or a cascade dequenching reaction is an isothermal amplification reaction. In certain aspects, the amplification reaction that includes template-directed polymerization or a cascade dequenching reaction is digital isothermal amplification. In some aspects, the amplification reaction that includes template-directed polymerization or a cascade dequenching reaction is PCR amplification. In certain aspects, the amplification reaction that includes template-directed polymerization or a cascade dequenching reaction is digital PCR amplification.

[0037] In many embodiments, the proximity-induced interaction is a strand displacement interaction. In many embodiments, the proximity-induced interaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification.

[0038] In some embodiments, the system is configured to divide a fluid to generate a plurality of fluid volumes. The system can be further configured to maintain each of the plurality of fluid volumes as an essentially closed fluid system when dividing the fluid until detection of fluorescence induction. An essentially closed fluid system can allow for the addition or removal of substances that are not important for interactions or reactions, such as the acquisition or loss of fluid by addition or evaporation. Alternatively, the essentially closed fluid system can be completely closed to maintain the original fluid components of each volume and any reaction products.

[0039] In some embodiments, the system can include essentially closed fluid compartments, except that certain reaction products, such as nucleotide triphosphates, are allowed to flow into and out of individual compartments. In such embodiments, when used as a digital assay for analyte detection, it is necessary to prevent both the analyte and the reaction products (e.g., nucleic acid strands generated by an amplification reaction) from moving between compartments.

[0040] In various aspects, methods for analyte detection are provided. A fluid is provided that includes an analyte, a first probe, and a second probe. The first probe includes a first binding moiety conjugated to a first DNA molecule. The second probe includes a second binding moiety conjugated to a second DNA molecule. Each of the first and second binding moieties is configured to bind to the analyte. The second DNA molecule includes an RNA polymerase binding site and binds to a blocker oligonucleotide that blocks the RNA polymerase binding site. The first and second binding moieties can bind to a common molecule of the analyte, thereby bringing the first and second probes into proximity. A proximity-induced interaction occurs between the DNA molecules of the probes, resulting in displacement of the blocker oligonucleotide into solution. RNA polymerase then induces transcription of RNA from the second DNA molecule, and the presence of the analyte in the liquid is detected based on the transcription. In many aspects, the transcription of RNA induces the generation of an optical signal, such as fluorescence, that is used for detection. In some aspects, the fluorescence is induced by the accumulation of RNA.

[0041] In some aspects, the transcribed RNA is further amplified using nucleic acid sequence-based amplification. In some aspects, the method is performed using a homogeneous assay. For example, the method can be a digital assay.

[0042] In various aspects, compositions for the detection of an analyte are provided. The composition includes a homogeneous fluid containing a first probe and a second probe. The first probe is configured to bind to the analyte and includes a first binding moiety that binds to a first DNA molecule. The second probe is configured to bind to the analyte and includes a second binding moiety that binds to a second DNA molecule. The second DNA molecule includes an RNA polymerase binding site, and the second DNA molecule binds to a blocker oligonucleotide that blocks the RNA polymerase binding site. The fluid further includes RNA polymerase and a fluorescent moiety. The first and second binding DNA molecules are configured to generate a proximity-based interaction when the first and second binding moieties bind to a common molecule of the analyte and are in proximity. The proximity-based interaction displaces the blocker oligonucleotide into solution, enabling RNA polymerase to use the second DNA molecule as a template to transcribe RNA.

[0043] In many aspects, the composition further includes one or more components selected from the group consisting of reverse transcriptase, RNAse H, nucleotide triphosphates, deoxynucleotide triphosphates, and DNA primers for amplifying the RNA transcribed using nucleic acid sequence-based amplification. For example, the composition can include all of the components listed above.

[0044] In some aspects, the fluorescent moiety is a fluorescent dye, fluorescent nanoparticle, or fluorescent protein.

[0045] In various aspects, the amplification reactions disclosed herein are attachment reactions that occur in proximity to the analyte. In other aspects, the amplification reactions disclosed herein are separation reactions that occur in solution and are not necessarily in proximity to the analyte. In certain aspects, the amplification reactions disclosed herein are partial attachment reactions in which some amplification occurs in proximity to the analyte and some occurs in solution away from the proximity of the analyte.

[0046] In various aspects, the amplification reactions disclosed herein are polymerization reactions. For example, the amplification reaction can include nucleic acid polymerization such as DNA or RNA polymerization. In various aspects, the amplification reactions disclosed herein are non-polymerization reactions such as dequenching reactions. For example, the reaction can include the dissociation of self-bound nucleic acid strands or pairs of bound strands. In some embodiments, dequenching can include the dissociation and aggregation of DNA hairpin molecules.

[0047] In various aspects, the detection can be optical detection. In some embodiments, fluorescence can be used for optical detection. In some embodiments, luminescence can be used for optical detection. In some embodiments, optical detection can include absorbance detection. In various aspects, the detection of an analyte can include non-optical detection methods.

[0048] In various aspects, the methods and systems disclosed herein can use digital assays for analyte detection. In other aspects, non-digital (e.g., analog) detection can be used.

[0049] In various aspects, the amplification reactions disclosed herein proceed as exponential amplification reactions. In other aspects, the amplification reaction proceeds as a linear reaction. In some aspects, the reaction can proceed substantially as a linear reaction. That is, the reaction rate grows at a rate similar to or faster than a linear reaction but slower than an exponential reaction, e.g., by a polynomial growth rate. Substantially linear reactions include linear reactions unless otherwise specified.

[0050] In various embodiments, the amplification reactions disclosed herein are isothermal reactions. In certain embodiments, the isothermal amplification is digital isothermal amplification. In some embodiments, the amplification reactions disclosed herein are polymerase chain reaction amplification reactions. In certain embodiments, the amplification reaction is digital PCR amplification. The proximity-based interactions disclosed herein are preferably also isothermal reactions. In some embodiments, the proximity-based interactions disclosed herein include digital PCR reactions. In certain embodiments, the proximity-based interactions and the amplification reaction are digital isothermal reactions. In some cases, the methods and systems perform under isothermal conditions and / or interaction steps, which are at a substantially constant temperature. The heating step can be performed prior to the isothermal reaction, for example, by exceeding a temperature threshold value to induce the start of the reaction. In some cases, the methods and systems for performing the amplification and / or interaction steps are performed under conditions that include PCR amplification, which is by thermal cycling.

[0051] In various embodiments, the binding moieties disclosed herein include an antibody or a portion thereof. The antibody can include an antigen-binding site that binds to an antigen. The analyte can include a site to which the antibody binds, which can be, for example, multiple binding sites that each bind to a specific antibody corresponding to a specific probe.

[0052] In various embodiments, the methods and systems disclosed herein detect the analyte without the need for a washing step. In various embodiments, the proximity-based interactions and the amplification reaction are performed in a single container. In various embodiments, the methods and systems disclosed herein include only a single step for detection, the step beginning with a proximity-based interaction between fluid components (e.g., probes) and proceeding to induce an amplification reaction that is used to detect the presence of the analyte by optical or other means.

[0053] In various aspects, the methods and systems disclosed herein include a plurality of compartmentalized volumes that include threshold oligonucleotides. In some aspects, the methods and systems disclosed herein include a plurality of compartmentalized volumes that include a plurality of auxiliary substrates. In certain aspects, the plurality of auxiliary substrates include threshold oligonucleotides. In some aspects, the plurality of compartmentalized fluid volumes include a plurality of auxiliary substrates. In certain aspects, the plurality of auxiliary substrates include auxiliary substrates that bind to amplification product oligonucleotides. In some aspects, the auxiliary substrates that bind to amplification product oligonucleotides inactivate it. In certain aspects, inactivation of the amplification product oligonucleotide includes binding to the amplification product oligonucleotide. In some aspects, binding to the amplification product oligonucleotide creates a threshold for exponential growth. In certain aspects, inactivation of the amplification product oligonucleotide includes non-productively extending the amplification product oligonucleotide. In some aspects, non-productively extending the amplification product oligonucleotide creates a threshold for exponential growth. In certain aspects, the plurality of auxiliary substrates include auxiliary substrates that bind to amplification product oligonucleotides to create a threshold for exponential growth. In certain aspects, the plurality of auxiliary substrates include auxiliary substrates that bind to amplification product oligonucleotides, inactivate the amplification product oligonucleotides by non-productively extending the amplification product oligonucleotides, and create a threshold for exponential growth.

[0054] This abstract is provided to introduce a selection of concepts in a simplified form that are further described in the following detailed description. This abstract is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0055] Incorporation by reference All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference herein.

[0056] The novel features described in this specification are particularly pointed out in the appended claims. A better understanding of the features and advantages of the present invention will be obtained from the following detailed description which illustrates exemplary embodiments in which the principles of the invention are utilized, and from the accompanying drawings thereof.

Brief Description of the Drawings

[0057]

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12A

Figure 12B

Figure 12C

Figure 12D

Figure 12E

Figure 13A

Figure 13B

Figure 13C

DETAILED DESCRIPTION OF THE INVENTION

[0058] The present disclosure generally relates to compositions, systems, and methods for detecting analytes, particularly protein analytes, using assays that include proximity-based interactions.

[0059] The most commonly used method for detecting amplified biomarkers in a sample is the polymerase chain reaction (PCR). Here, DNA is amplified in a temperature-sensitive reaction catalyzed by a DNA polymerase. In PCR, the sample is typically cycled between two or three temperatures in the range of about 60°C to about 95°C by a thermal cycling device. By using PCR to amplify DNA, a wide range of fields, from basic biology to clinical diagnosis and forensic medicine, have advanced significantly. PCR has also been modified to detect DNA within droplets for a "digital" readout. This enables the absolute quantification or counting of individual nucleic acid molecules. However, while some progress has been made regarding the digital detection of nucleic acids, there remains a need for the development of techniques for the detection of proteins.

[0060] There is a need for amplification methods for detecting proteins, particularly methods that do not require a washing step. In particular, there is a need for isothermal amplification methods for detecting proteins, particularly methods that do not require a washing step. Isothermal protein detection has a wide range of applications, such as point-of-care diagnostics and personalized precision medicine. Isothermal amplification for protein detection offers at least two substantial advantages over PCR. There is no need to precisely change the temperature to achieve amplification (i.e., this technique can be performed under isothermal conditions), and it can be applied to protein analytes (PCR is mainly useful for the detection of DNA). The isothermal techniques for protein detection disclosed herein provide isothermal amplification-based detection of proteins and can be performed as part of a digital assay.

[0061] The digital assays described herein can include separating a sample (or derivative thereof) into multiple compartmentalized volumes, dispensing, or otherwise isolating them, individually evaluating the multiple compartmentalized volumes for the presence or absence of a detectable signal or code (e.g., detecting a detectable signal or code generated by a fluorescent probe), and assigning a binary value to each evaluated compartmentalized volume. Optionally, a value can be assigned to a compartmentalized volume based on the presence, absence, wavelength, intensity, and / or lifetime of a detectable signal or code (or a portion thereof) within the compartmentalized volume. The characteristics of a target molecule within each compartmentalized volume can be determined using the values assigned to the evaluated compartmentalized volumes. For example, detecting or failing to detect a detectable signal (e.g., a detectable code or aspect thereof) within a compartmentalized volume can indicate the presence or absence of a target molecule within the compartmentalized volume and can be used to determine the concentration of the target molecule in the sample. Optionally, detecting or being unable to detect a detectable signal within a compartmentalized volume can be used to determine what protein molecule or the amount thereof is in the sample.

[0062] One reference reports an isothermal digital protein ELISA based on bead capture of the enzyme, beta-galactosidase. However, this type of heterogeneous technique (i.e., one that depends on capture rather than proceeding in solution) has significant limitations. The protein detector needs to be washed to remove background analytes that would result in false positive signals. This required wash step is a major drawback. Further, the need for bead capture prevents the technique from being performed in a homogeneous solution, further limiting the technique. The detection techniques disclosed herein can be performed in a mix-and-read manner without the required wash steps and they can be performed in solution without using a support such as beads.

[0063] Conventional methods for the digital analysis of protein analytes in homogeneous solutions also have several drawbacks compared to the techniques disclosed herein. For example, techniques for detecting a specific protein toxin using proximity ligation assay and PCR have been reported. However, this technique is hampered by the need for steps involving a significant range of controlled temperature changes that prevent isothermal detection of the analyte. Further, this technique requires a centrifugation step, which involves movement between containers. This prevents the technique from being performed in a one-pot or single-step manner. In contrast, the isothermal techniques disclosed herein enable the detection of protein analytes in an isothermal process and can be performed within a single container without additional steps such as centrifugation.

[0064] Finally, certain techniques for use in analog assays, such as proximity-induced rolling circle amplification and hairpin assembly reactions, have been developed. However, these techniques are limited by their reliance on analog solution reactions that require calibration and are susceptible to errors that are difficult to correct or quantify. For example, uncertainties in amplification efficiency can result in very large errors when processing reactions that result in exponential growth.

[0065] In some embodiments, polymerase chain reaction amplification (also referred to herein as "PCR amplification", etc.) can be used for the detection of proteins. In certain embodiments, PCR amplification does not require a washing step. PCR amplification can be achieved using portable machinery and provides advantageous uses of the polymerase chain amplification reaction (also referred to herein as "PCR amplification reaction", "PCR reaction", etc.) disclosed herein. PCR amplification for protein detection disclosed herein provides protein PCR amplification-based detection and can be performed as part of a digital assay. In some embodiments, the PCR amplification technique includes digital PCR amplification.

[0066] Figure 1A shows a method 100 for analyte detection. This method can be implemented to detect analytes dissolved or dispersed in a fluid. For example, this method can be used to detect proteins in a fluid. Preferably, this method is implemented as a homogeneous assay. That is, this method is implemented without relying on the attachment of particles to beads or other forms of solid supports. This feature improves flexibility and efficiency. For example, unlike heterogeneous assays, there is no need to use a washing step.

[0067] In step 112, a fluid containing an analyte is provided. Preferably, the analyte is a protein and the fluid contains many analyte protein molecules. Additional fluid components that can interact with each other through proximity-based interactions can be provided for the analyte. For example, the components can include a first probe and a second probe each configured to bind to the analyte. In some embodiments, the first probe includes a first binding moiety bound to a first nucleic acid molecule. The first binding moiety can be an antibody having an affinity for the analyte. Similarly, the second probe can include a second binding moiety bound to a second nucleic acid. The second binding moiety can also be an antibody having an affinity for the analyte. In some embodiments, the first and second binding moieties are different antibodies configured to bind to different respective portions of a common protein molecule. The fluid components can also include additional reaction components such as polymerase and endonuclease molecules, as well as appropriate nucleobases for use in nucleic acid synthesis, and non-reactive components such as a solvent (e.g., water), buffer, etc. The first and second nucleic acids are preferably DNA molecules.

[0068] In step 114, the fluid is divided into compartmentalized volumes to generate a digital assay. The compartmentalized volumes can be, for example, droplets or wells each containing a single droplet. Other methods of dividing the fluid can also be used. For example, the compartmentalized volumes can be generated in situ by introducing a membrane or other fluid barrier into a larger fluid volume, thereby dividing the fluid components into their respective compartmentalized volumes. Preferably, the compartmentalized volumes contain a homogeneous fluid that undergoes reactions without relying on the presence of a support structure such as beads. The fluid can be appropriately diluted so that some of the compartmentalized volumes do not contain the analyte and some of the compartmentalized volumes contain some of the analyte. When the fluid is homogeneous and the analyte is fully diffused in the fluid, the splitting step tends to randomly assign analyte molecules to each compartmentalized volume. When each compartmentalized volume is similar to the other volumes, the splitting step typically loads the analyte into the compartmentalized volumes according to a Poisson distribution. Since digital assays usually rely on distinguishing volumes that contain the analyte from volumes that do not, assays where a significant fraction of the compartmentalized volumes are expected to be free of the analyte can achieve the best signal-to-noise ratio. Although the use of splitting step 114 is preferred for forming the digital assay, in some embodiments, the splitting step can be omitted. For example, in some embodiments, method 100 can be performed to generate an analog (i.e., non-digital) measurement in a single fluid volume.

[0069] Various fluid components can be introduced into the fluid before the step of adding the analyte to the fluid, or simultaneously or later, for example, during splitting step 114. In some cases, different components can be added at different times. For example, one or more reagents can be withheld until the fluid is divided into compartments, so that the reaction proceeds only within the compartmentalized volumes and protection from cross-contamination can be achieved.

[0070] In step 116, proximity-based interactions can occur between fluid components. The interactions can occur spontaneously, for example, from the presence of an analyte and other fluid components in a solution, or the interactions can be induced. For example, the interaction and / or subsequent amplification reaction (e.g., dequenching or enzyme amplification) can be induced by raising the temperature of the fluid above a critical temperature. Preferably, the amplification reaction is an isothermal reaction. Optionally, the proximity-based interaction is also an isothermal reaction. More preferably, all isothermal amplifications are digital isothermal amplifications. An isothermal reaction can be induced by setting the temperature to a certain level, but it is not necessary to change the temperature to complete the reaction. As used herein, an isothermal reaction is a reaction that proceeds until completion at a constant temperature. The term "isothermal" characterizes the reaction, not the conditions under which the reaction occurs. Thus, an isothermal reaction remains an isothermal reaction as long as the reaction occurs even if the temperature of the system changes during the reaction as long as the temperature is kept constant. In contrast, a polymerase chain reaction (PCR) is not isothermal because it requires multiple cycles at various temperatures to complete. On the other hand, the amplification reactions and other interactions discussed herein may require a temperature within a certain range and may proceed at slightly different rates as a function of temperature, but are typically isothermal because it is not necessary to change the temperature during the course of the reaction to complete it. In some embodiments, the amplification reaction is a PCR reaction, and in some embodiments, the amplification reaction is a digital PCR reaction. In certain embodiments, the amplification is a PCR reaction (e.g., a digital PCR reaction), and the proximity-based interaction is an isothermal reaction (e.g., a digital isothermal reaction). As used herein, a PCR reaction is one that proceeds until completion using thermal cycling to enable different temperature-dependent reactions. In some embodiments, the amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification.In some embodiments, the amplification reaction includes an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification, or any combination thereof. In some embodiments, the amplification reaction is selected from the group consisting of a hairpin assembly reaction, a catalytic hairpin reaction, a hybridization chain reaction, and proximity-induced rolling circle amplification. In some embodiments, the amplification reaction includes a hairpin assembly reaction, a catalytic hairpin reaction, a hybridization chain reaction, and proximity-induced rolling circle amplification, or any combination thereof.

[0071] In certain embodiments, the amplification reaction uses digital isothermal amplification such as NASBA (Nucleic Acid Sequence Based Amplification), LAMP (Loop-mediated AMPlification), SDA (Strand Displacement Amplificationl), EXPAR (EXPonential Amplification Reaction), and rolling circle amplification (RCA), and the use of digitized volumes of arrays is used to perform digital NASBA, digital LAMP, digital SDA, digital EXPAR, and digital rolling circle amplification, similar to digital PCR.

[0072] In some embodiments, the proximity-based interaction involves an interaction between first and second nucleic acid molecules bound to first and second binding moieties (e.g., antigens), forming first and second probes that each bind to a protein analyte. When the two probes bind to a common analyte, the two probes are brought into proximity, allowing the nucleic acid strands to interact. In some embodiments, the proximity-based interaction involves a pairing interaction between the first and second nucleic acid molecules. For example, the nucleic acid molecules can pair to enable transcription of RNA, extension of one of the two nucleic acid molecules by polymerase, or formation of a catalyst by partial pairing of portions of the two nucleic acid molecules. Various ways to promote the proximity-based interaction will be described in more detail with respect to the remaining figures. In some cases, the proximity-based interaction may result in the generation of reaction products, such as the accumulation of nucleic acid strands in solution in a fluid. In some cases, these by-products can interact with other fluid components to generate additional reaction products, for example, in an exponential amplification reaction.

[0073] In step 118, the analyte is detected based on proximity-based interactions. Optical detection by fluorescence, absorbance, luminescence, or similar methods that generate an optical signal is a preferred detection method. In some embodiments, a fluorescent moiety (e.g., a fluorescent probe such as a dye, nanoparticle, protein, or polymer dot (PDot)) is provided in the fluid, and the fluorescent moiety interacts with the accumulated product of the proximity-based interaction. The fluorescent moiety that interacts with the accumulated product can fluoresce in response to irradiation with light of an appropriate wavelength. For example, SyBr Green I (or SyBr GreenII or SyBrGold in the case of single-stranded DNA) can be used to detect DNA molecules accumulated in solution using standard fluorescence detection. Alternatively or additionally, other detection mechanisms can be used to detect the analyte. In some embodiments, detection of nucleic acid strands generated or modified by proximity-based interactions can be performed using absorbance detection, colorimetric detection, or various forms of chemical, electrical, or magnetic detection. For example, in some embodiments, an intercalating dye can be used to detect the accumulation of nucleic acid molecules such as double-stranded DNA generated by polymerase. In some embodiments, the accumulation of DNA or other nucleic acid products is detected by a dye that interacts with single-stranded products through backbone interactions or interactions between a light-up aptamer and its target. In some embodiments, the accumulation of DNA of other nucleic acid products is detected by molecular beacons. In some embodiments, the accumulation of nucleic acid products is detected by the formation of a G-quadruplex structure in the product's nucleic acid (e.g., DNA), which can then catalyze further fluorescent or colored products. In some embodiments, the accumulation of nucleic acid products is detected by chemiluminescence or bioluminescence associated with the product or polymerization of the product. In some embodiments, the product is detected by electrochemical changes in the solution, such as changes in capacitance, conductivity, or electron transfer rate.

[0074] In an analog assay embodiment, detection can include determining a signal intensity that correlates to the number or concentration of an analyte in a fluid. In a digital embodiment, detection can include determining, for a plurality of compartmentalized volumes, whether they contain the analyte or not. For example, in a fluorescence-based embodiment, fluorescence can be detected from one type of volume (e.g., a volume containing the analyte) and not from the other type (e.g., a volume not containing the analyte). Alternatively, if the reaction in the analyte-containing volume serves to quench rather than enable fluorescence, the readout can be reversed. Based on the determination of which volumes contain the analyte, characteristics of the analyte such as the total number of analytes can be measured. This measurement can be performed by comparing the number of volumes containing zero and non-zero analytes to a Poisson distribution. For example, Poisson statistics can be used to generate an average amount of analyte per container. The total number or amount of analyte can be generated by multiplying this average by the number of volumes.

[0075] Method 100 can be performed by a system configured to perform a digital assay. The system can divide a fluid into a plurality of fluid volumes each disposed in a respective one of a plurality of compartments. For example, in some embodiments, the system can include an array of wells, droplets, or other compartmentalized volumes, each of which can have a portion of the analyte-containing fluid deposited therein. The fluid within the compartmentalized volume can include one or more of each of the first and second probes, as well as appropriate additional components such as polymerase, endonuclease, base pairs, etc. to support an amplification reaction and subsequent detection. Preferably, the system optically detects the presence of an analyte in a well, such as by inducing and measuring fluorescence or by measuring a change in absorbance. Alternatively or additionally, the system can use methods such as chemical or electrical detection to determine which wells contain an analyte. The system can further generate a measurement of the analyte, such as a count of the analyte or a concentration of the analyte, based on the detection of the analyte in the well.

[0076] For example, the system can include a computer-controlled digital assay system that automatically divides an analyte-containing fluid into a plurality of compartmentalized fluid volumes and controls reaction conditions (e.g., temperature) to facilitate proximity-based interactions in the analyte-containing volumes. The system can then detect (e.g., using fluorescence or other detection) which volumes contain the analyte and which do not, and based on this measurement, the system can generate a count of the number of analyte molecules present in the fluid. For example, using Poisson statistics, the measured ratio x of volumes without the analyte of interest and the ratio (1 - x) of volumes containing the analyte of interest can be correlated to the total ratio of the analyte -ln(x) (where ln is the natural logarithm), or to the total number of analytes -ln(x)*N (where N is the number of volumes). The system can include a processor that executes instructions to control each step performed by the digital assay system, including the calculations necessary to generate the analyte count. The number of volumes (e.g., the number of wells) can be selected to provide a desired level of accuracy in the overall measurement. For example, the fluid can be divided into 10 or more, 20 or more, 50 or more, 100 or more, 200 or more, 500 or more, 1000 or more, 10,000 or more, or 100,000 or more volumes, and more volumes provide progressively higher accuracy. Non-uniform division is possible and can be statistically accounted for, but the fluid is preferably divided evenly.

[0077] Figure 1B shows a composition 120 for the detection of an analyte according to various embodiments. The composition 120 can include a fluid having various fluid components. For example, the composition can be an aqueous solution. Preferably, the composition is a homogeneous fluid. That is, the various fluid components involved in the reaction within the fluid are not attached to macroscopic structures such as beads that may require a washing step before or during the detection process. The components of the fluid can include various biomolecules and structures depending on the particular detection method used. For example, the detection methods discussed in FIGS. 2-11 employ various proximity-based analyte detection methods, and the fluid components can be appropriately selected to perform any one or more of the illustrated methods.

[0078] Exemplary composition 120 includes various components shown in a similar format in the remaining drawings for ease of illustration. For example, composition 120 can be any of a variety of biological structures to which other biomolecules can bind, such as protein molecules, or protein complexes, metabolites, carbohydrates, lipid structures, drugs, viruses, nucleic acid structures, or larger structures such as bacteria and other cells. The composition includes an analyte 122 that can be any of a variety of biological structures to which other biomolecules can bind. The composition further includes a binding moiety 124 that includes a binding site for binding to a given location (e.g., an epitope) on analyte 122. For example, binding moiety 124 can be an antibody or a portion thereof, and analyte 122 can constitute an antigen that matches the antibody such that binding moiety 124 binds to analyte 122 as a target. Further, analyte 122 can include multiple sites to which different antibodies can bind, and by simultaneously binding to appropriate sites (e.g., different epitopes) of a common analyte, the antibodies can bring themselves (and other molecules to which they are attached) into proximity to induce proximity-based interactions. The composition further includes a nucleic acid molecule 126, e.g., a strand of DNA or RNA. Nucleic acid molecule 126 is shown with a dot at its 5' end and an arrow at its 3' end, indicating the direction in which polymerization of the molecule is possible using polymerase. The binding moiety and the nucleic acid molecule can be joined together to form a probe 128 that can be used to induce proximity-based interactions with another probe when bound to an analyte. When two nucleic acid molecules are involved in proximity-based interactions, they can form a double-stranded nucleic acid complex such as double-stranded DNA complex 130. In double-stranded DNA complex 130, only a portion of the two DNA molecules is shown as binding together (e.g., via base pairing). The remaining portions of the DNA molecules can be separated as they are attached to respective binding moieties attached to different sites of the analyte, for example. In some embodiments, a "blocker" 132 that can bind to the nucleic acid molecule to inhibit polymerization, transcription, or binding is included. The blocker can be a non-extendable oligonucleotide that can be formed by including a modification at its 3' end.For example, blocker 132 may have an inverted 3’ end, or another similar modification, such that elongation templated by polymerase is inhibited at its end. Blocker 132 can have an inverted 3’ end, or another similar modification alone or in combination, such that nicking by an endonuclease or elongation templated by polymerase is inhibited at its end. Other modifications that can prevent elongation include dideoxy bases, phosphate modifications, elongation mismatches, or other modifications that inhibit one or more of the enzymes required for amplification. The blocker can include multiple complementary bases to another nucleic acid molecule such that the blocker binds to the nucleic acid molecule to result in an inactivated complex. Additional fluid components that can optionally be included in the composition are shown in FIGS. 2-11 below.

[0079] FIGS. 1C and 1D show two general schemes for using proximity-based interactions to detect an analyte in a fluid.

[0080] FIG. 1C shows an “attached” detection scheme 140 for analyte detection. In the attached detection scheme 140, a first probe 142 and a second probe 144 each bind to a common analyte 141. This brings the two probes into proximity such that they can undergo proximity-based interactions with each other. The two probes include nucleic acid molecules that interact to form a nucleic acid complex 146. This complex then participates in further reactions. For example, one of the nucleic acid molecules forming the complex can be elongated by a polymerase, ultimately resulting in further reactions that generate a detectable signal that the analyte is present in the fluid.

[0081] FIG. 1D shows an alternative “separated” analyte detection scheme 150. Similar to detection scheme 140, in detection scheme 150, the first probe 152 and the second probe 154 each bind to a common analyte 151 and then undergo proximity-based interactions to form a complex 156. However, while the complex 146 of the attached scheme 140 is involved in further amplification reactions, the formation of complex 156 instead induces a reaction away from the analyte. For example, the formation of complex 156 can remove the active nucleic acid strand 158 from one of the first and second probes, which can then form an active complex with other fluid components and result in an amplification reaction in solution away from the analyte. In many embodiments, the separation reaction is used as part of an exponential amplification reaction.

[0082] In addition to the above-described strict “attached” and “separated” schemes, some schemes employ “partially attached” reactions, where amplification involving attached complexes occurs, but other parts of the reaction occur away from the analyte in solution. For example, many of the attached reactions described herein can be used to generate free nucleic acid strands that can interact with other substrates in solution to induce an exponential amplification reaction.

[0083] FIGS. 2-11 show in more detail how various proximity-based interactions can be used to generate measurements of analytes according to the methods disclosed herein. Each of the processes shown in FIGS. 2-11 can be performed under isothermal conditions (e.g., using isothermal assembly and amplification reactions) and can be performed either in a single fluid solution (e.g., as an analog assay) or in a plurality of compartmentalized solution volumes (e.g., as a digital assay). Alternatively, each of the processes shown in FIGS. 2-11 can be performed under conditions that include PCR amplification (e.g., using PCR amplification reactions such as thermal cycling assembly and digital PCR) and can be performed either in a single fluid solution (e.g., as an analog assay) or in a plurality of compartmentalized fluid volumes (e.g., as a digital assay).

[0084] Figure 2 shows a method 200 for analyte detection using attached strand displacement amplification. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 201 is provided in the fluid. For example, the analyte may be a protein molecule. Method 200 can be characterized as an "attached" method in that it involves a reaction (amplification reaction) that occurs with a complex attached to the analyte.

[0085] The fluid can further include a first probe 210 and a second probe 220. The first probe includes a first binding portion 212 bound to a first interaction portion that includes a first nucleic acid molecule 214. The first binding portion 212 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 201. The first nucleic acid molecule 214 is bound to a non-extendable blocker oligonucleotide 216. The first nucleic acid molecule 214 and the non-extendable blocker oligonucleotide 216 can be, for example, DNA molecules bound together by base pairing interactions. The non-extendable blocker oligonucleotide 216 can include a modification at its 3' end (e.g., an inverted 3' end), such that template-directed extension by DNA polymerase is inhibited at that end (as well as at the native 5' end that is not extended by DNA polymerase). If the first nucleic acid molecule 214 is bound to the first binding portion 212 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 214 and the non-extendable blocker oligonucleotide 216.

[0086] The second probe 220 can include a second binding portion 222 and a second interaction portion that includes a second nucleic acid molecule 224. The second binding portion 222 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 201. The second nucleic acid molecule 224 can be, for example, a DNA molecule and can be bound to the binding portion 222 at its 5' end. Thus, the second nucleic acid molecule 224 can be extended by a polymerase (e.g., DNA polymerase) when an appropriate template is provided.

[0087] In the first step 202, the first probe 210, the second probe 220, and the analyte 201 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 201, and this binding brings the two probes into proximity and enables the interaction portions of the probes to interact.

[0088] This interaction occurs in the second step 204, where the first nucleic acid molecule 214 and the second nucleic acid molecule 224 interact to form a complex 230. The first and second nucleic acid molecules can contain a plurality of complementary base pairs such that they can interact to form a double-stranded nucleic acid complex 230 when they are in proximity. The interaction can displace the non-extendable blocker oligonucleotide 216, which can then be released into the solution as waste. The remaining complex 230 can include a length mismatch between the two nucleic acid molecules. That is, the first nucleic acid molecule 214 can extend beyond the corresponding portion of the second nucleic acid molecule 224 to which it is complementary, such that the first nucleic acid molecule 214 provides a template for base pair polymerization that enables the extension of the second nucleic acid molecule 224.

[0089] The formation of the nucleic acid complex between the first and second nucleic acid molecules 214 and 224 can establish an iterative cycle of nucleic acid amplification. The starting point of such a cycle is shown in step 206. The first and second nucleic acid molecules 214 and 224 each remain bound to the binding portions 212 and 222, which in turn remain bound to the analyte 201. The ends of the binding portions 212 and 222 are shown by dotted lines in step 206 but are omitted from the remainder of the illustration of the amplification process steps for clarity.

[0090] The amplification process proceeds from step 206 to step 207 when a polymerase such as DNA polymerase binds to complex 230. The polymerase uses the first nucleic acid molecule 212 as a template to extend the second nucleic acid molecule 224. The extension can continue, for example, until reaching the 5' end of the first nucleic acid molecule 212.

[0091] After the extension of the second nucleic acid molecule 224 in step 207, in step 208, the binding of the nicking endonuclease to the extended portion of the second nucleic acid molecule can continue. For example, the extended portion of the second nucleic acid molecule can include a plurality of base pairs that form a binding site for an endonuclease configured to cleave the second nucleic acid molecule at point 252. In some embodiments, point 252 is at or near the original 3' end of the second nucleic acid molecule 224. The action of the endonuclease produces a nicked nucleic acid molecule 254.

[0092] In step 209, the nicked nucleic acid molecule 254 is released into the solution and a polymerase acts to produce a nucleic acid complex that can undergo another templated extension. This extension causes the process to return to step 207 and the cycle can repeat. In some embodiments, the release of the nicked nucleic acid molecule 254 is mediated by extension by the polymerase. The repeated action of this nucleic acid amplification cycle can result in the accumulation of the nicked nucleic acid molecule 254 in the solution, which can be used for detection. For example, fluorescence imaging can be used to detect the accumulation of the nicked nucleic acid molecule by providing in the fluid a fluorescent moiety that fluoresces when irradiated with light of an appropriate wavelength in the presence of (e.g., upon binding to) the nicked nucleic acid molecule.

[0093] The amplification process 200 depends on the presence of analyte 201 and is carried out until completion (by bringing the proximity of the first and second probes through binding to a common analyte, thereby initiating a proximity-based interaction). Thus, the generation of nicked nucleic acid molecules 254 in solution indicates the presence of the analyte. Accordingly, the presence or absence of fluorescence (or other property) based on the accumulation or non-accumulation of nicked nucleic acid molecules in solution can detect which fluid volume contains or does not contain the analyte. Thus, by using method 200 as part of a digital assay, the number of nucleic acid molecules in a fluid and measurements of other properties such as, correspondingly, analyte concentration can be generated. Alternatively, process 200 can be used to perform an analog measurement of the analyte. The rate of generation of nicked nucleic acid molecules 254 in solution increases with the number of analyte particles present in the solution. Thus, an analog measurement of the amount of analyte in the fluid can be generated using a measurement of the amount of nicked nucleic acid produced (e.g., by measuring fluorescence intensity, measuring the time to reach a given intensity, etc.). The measurement can include, for example, comparing the measured signal to a calibrated scale to determine the measured amount of the analyte.

[0094] Figure 3 shows a method 300 for analyte detection using attached strand displacement amplification. This method can be carried out in a fluid. For example, it can be carried out in each of a plurality of compartmentalized fluid-containing volumes. An analyte 301 is provided in the fluid. For example, the analyte can be a protein molecule. Method 300 involves a reaction (amplification reaction) that occurs in a complex attached to the analyte and can be characterized as a "partially attached" method in that the attached reaction induces a further reaction step that occurs in solution.

[0095] The fluid can further include a first probe 310 and a second probe 320. The first probe includes a first binding portion 312 bound to a first interaction portion including a first nucleic acid molecule 314. The first binding portion 312 can be, for example, an antibody or a portion thereof having a binding site for binding to an analyte 301. The first nucleic acid molecule 314 can include consecutive nucleic acid sequences in the order of 3 * , 2 * , 1 * , where sequence x * represents a sequence complementary to sequence x. The first nucleic acid molecule 314 is bound to a non-extendable blocker oligonucleotide 316. The first nucleic acid molecule 314 and the non-extendable blocker oligonucleotide 316 can be DNA molecules bound together by base-pairing interactions, for example, by binding the base-pair sequence 3 on the blocker to the base-pair sequence 3 * on the first nucleic acid molecule. The non-extendable blocker oligonucleotide 316 can include a modification at its 3' end (e.g., the inverted 3'), such that template-directed extension by DNA polymerase is inhibited at that end (as well as the 5' end that is not naturally extended by DNA polymerase). When the first nucleic acid molecule 314 is bound to the first binding portion 312 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 314 and the non-extendable blocker oligonucleotide 316.

[0096] The second probe 320 can include a second binding portion 322 and a second interaction portion including a second nucleic acid molecule 324. The second binding portion 322 can be, for example, an antibody or a portion thereof having a binding site for binding to an analyte 301. The second nucleic acid molecule 324 can be, for example, a DNA molecule and can be bound to the binding portion 322 at its 5' end. Thus, the second nucleic acid molecule 324 can be extended by a polymerase (e.g., DNA polymerase) when an appropriate template is provided. Further, the second nucleic acid molecule 324 can include a base-pair sequence 3 complementary to the base-pair sequence 3 * of the first nucleic acid molecule.

[0097] In the first step 302, the first probe 310, the second probe 320, and the analyte 301 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 301, and this binding brings the two probes into proximity, enabling the interaction portions of the probes to interact.

[0098] This interaction occurs in the second step 304, where the first nucleic acid molecule 314 and the second nucleic acid molecule 324 interact to form a complex 330. The first and second nucleic acid molecules can each include a plurality of complementary base pairs that form complementary sequences 3 * and 3, such that when in proximity they interact to form a double-stranded nucleic acid complex 330 while displacing the non-extendable blocker oligonucleotide 316 from its binding to the same 3 * sequence of the first nucleic acid molecule. The non-extendable blocker oligonucleotide 316 can then be released into the solution as waste. The remaining complex 330 can include a length mismatch between the two nucleic acid molecules. That is, the first nucleic acid molecule 314 has a base pair sequence 3 that binds to the base pair sequence 3 of the second nucleic acid molecule 324 to which it is complementary, and the first nucleic acid molecule has 2 * sequences followed by 1 * sequence and then 1 *It further includes the continuity of that strand in the form of an array. Thus, the first nucleic acid molecule 314 provides a template that allows base pair polymerization to extend the second nucleic acid molecule 324 into regions 2 and 1. Optionally, the length and sequence of 3 can be substantially or completely identical to one domain. Optionally, domain 3 on the second nucleic acid molecule can initially contain fewer or more base pairs than the 3 sequence on the first nucleic acid molecule. For example, the second nucleic acid molecule can initially contain region 3 and then contain a part of region 2 or a part but not all of region 1. The non-extendable blocker oligonucleotide 316 can also vary in length and can contain more or less than region 3. This variability allows the strength of proximity-based interactions between the first and second nucleic acid molecules to be varied compared to the non-extendable blocker oligonucleotide, which can be used to increase or (e.g., to reduce the reaction rate generated by accidental collisions of the first and second probes in solution) decrease the reaction rate. Furthermore, both the first nucleic acid and the second nucleic acid strand can contain multiple nucleic acids between the identified region and the binding portion. Since these additional nucleic acids do not need to undergo pairing interactions, they can vary freely and can contain complementary or non-complementary base pair sequences.

[0099] The fluid further includes an auxiliary complex 332 that includes an auxiliary substrate 334 optionally bound to an auxiliary non-extendable blocker oligonucleotide 336. In some embodiments, the auxiliary substrate is bound to the auxiliary non-extendable blocker oligonucleotide 336. In some embodiments, each of the auxiliary substrates includes an auxiliary nucleic acid strand and none of the auxiliary substrates are bound to the auxiliary non-extendable blocker oligonucleotide 336. The auxiliary substrate 334 has a continuous nucleic acid sequence 1 read from the 5' end * , 2 * , 1 * , 2 * and can thus result in the auxiliary substrate 334 being at least partially similar to the first nucleic acid 314. In some embodiments, the two are identical. In such cases, an additional 2 of the first nucleic acid molecule *The portion crosslinks the gap between two probes that bind to the analyte, thus avoiding involvement in base pairing with a second nucleic acid molecule during proximity-based interactions. One or both strands of the auxiliary substrate can be modified (e.g., at the inverted 3') to avoid polymerase extension of the auxiliary substrate.

[0100] Complex 330 and auxiliary substrate 334 can participate in repeated amplification cycles, and the product can induce more auxiliary substrates to participate in the amplification reaction cycle, exponentially growing the production of nucleic acid strands in solution. This process can start from the configuration of complex 330 shown in step 304. The second nucleic acid molecule 324 is extended by a polymerase using the first nucleic acid as a template to reach the configuration shown in step 306. The complex is shown partially as a dotted line because a similar process involving auxiliary substrate 334 occurs, which will be described later. The extension of the second nucleic acid generates a binding site for a nicking endonuclease, similar to the site discussed with respect to Figure 2, for example. The nicking endonuclease binds to the extended complex, nicks the extended portion of the second nucleic acid at point 354, allowing the nucleic acid strand after that point to be released into the solution. Since the second nucleic acid was extended using the first as a template, the nicked extended portion 338 has nucleic acid sequences 2 and 1 when read from 5' to 3', which are * complementary to the 2 * and 1 * of the first nucleic acid molecule after its sequences base pair with the 3 sequences of the second nucleic acid molecule. (Although the second nucleic acid molecule may interact with the 1 * sequence of the first nucleic acid molecule, this arrangement results in the alignment of the respective 5' and 3' ends of the first and second nucleic acid molecules, preventing further polymerization. Finally, through random thermal separation and movement, the appropriate portions of the first and second nucleic acid molecules come into contact in the appropriate configuration, and this process proceeds relatively quickly when the molecules are in proximity.) After the nicked portion 338 moves into the solution, complex 330 can repeat the cycle and extend again in step 306.

[0101] Furthermore, the nicked portion 338 released into the solution may ultimately collide with the auxiliary complex 332. The nicked portion 338 has sequences 2 and 1 when read from its 5' end and is complementary to 2 and 1 of the auxiliary substrate 334 read from its 3' end. Thus, the nicked portion 338 can base pair with the auxiliary substrate 334 at one end (and in the middle, for the same reasons discussed above for the first and second nucleic acid molecules, although such base pairing is a temporary dead end and requires heat - re - equilibration). When the nicked portion 338 binds to the auxiliary substrate 334, it displaces the auxiliary non - extendible blocker oligonucleotide 336 into the solution. This forms the active complex in step 309. In step 305, the active complex containing the nicked portion 338 and the auxiliary substrate 334 is extended by polymerase using the auxiliary substrate 334 as a template. This produces an extended nicked portion similar to the extended second nucleic acid strand as shown in step 206. The two complexes differ in the dotted regions. The extended nicked substrate has sequences 2, 1, 2, 1 that base pair with the complementary sequence of the auxiliary substrate when read from 5' to 3', while the second nucleic acid has a portion that does not base pair with the first nucleic acid and is followed by the 3, 2, 1 sequence. In step 307, the nicking endonuclease binds to the active complex and nicks the extended nicked portion to produce an identical copy of the nicked portion, which is released into the solution in step 308 or during subsequent activity by polymerase. The active complex can then continue cycling in step 306, while the newly released nicked portion leads to yet another auxiliary complex, forms another active complex, which then enters the cycle. This process grows exponentially, adding more and more complexes to the cycle and generating exponentially more nicked portions.

[0102] The repeated cycles result in an increasing accumulation of nucleic acid molecules 338 in solution, and this accumulation can be used for detection. For example, an optical signal can be generated based on the accumulation. In many embodiments, fluorescence imaging is provided in the fluid by providing a fluorescent probe (e.g., a dye or protein) that fluoresces upon irradiation with light of an appropriate wavelength in the presence of (e.g., when bound to) nucleic acid molecules, to detect the accumulation of nucleic acid molecules (e.g., nicked double-stranded or single-stranded nucleic acid molecules). Since the amplification process 300 depends on the presence of the analyte 301 being carried out until completion (by bringing the proximity of the first and second probes through binding to a common analyte, thereby initiating a proximity-based interaction and further inducing the activation of the auxiliary complex), the generation of nucleic acid molecules 338 in solution indicates the presence of the analyte. Thus, the presence or absence of fluorescence (or other properties) based on the accumulation or non-accumulation of nucleic acid molecules in solution can detect which fluid volume contains or does not contain the analyte. Thus, by using method 300 as part of a digital assay, measurements of the number of nucleic acid molecules in the fluid and, correspondingly, other properties such as analyte concentration can be generated. Alternatively, process 300 can be used to perform an analog measurement of the analyte. The rate of generation of nucleic acid molecules 338 in solution increases with the number of analyte particles present in the solution. Thus, measurements of the amount of nucleic acid generated (e.g., by measuring fluorescence intensity, measuring the time to reach a given intensity, etc.) can be used to generate an analog measurement of the amount of analyte in the fluid. The measurement can include, for example, comparing the measured signal to a calibrated scale to determine the measured amount of the analyte.

[0103] Figure 4 shows an analyte detection method 400 that uses an attached hairpin assembly reaction. This method can be carried out in a fluid. For example, it can be carried out in each of a plurality of compartmentalized fluid-containing volumes. An analyte 401 is provided in the fluid. For example, the analyte can be a protein molecule. Method 200 can be characterized as an "attached" method in that it involves a reaction (assembly reaction) that occurs with a complex attached to the analyte.

[0104] The fluid can further include a first probe 410 and a second probe 420. The first probe includes a first binding portion 412 bound to a first interaction portion that includes a first nucleic acid molecule 414. The first binding portion 412 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 401. The first nucleic acid molecule 414 can include a sequence of base pairs configured to bind to a hairpin configuration. For example, the first portion 411 can include a plurality of base pairs complementary to the second portion 413, and there is a non-complementary region between the two such that the first portion and the second portion bind together in a hairpin shape. Since the first nucleic acid molecule is bound to itself, pairing with a complementary hairpin molecule 432 in solution is inhibited. In some embodiments, the 3' end of the first nucleic acid molecule binds to the binding portion, thereby inhibiting polymerization. However, method 400 does not require polymerization and can therefore be carried out in the absence of polymerase, so the 5' and 3' ends shown in Figure 4 can vary optionally. However, for consistency with the drawings, the first portion of the first nucleic acid molecule is referred to as the 3' portion 411 and the second portion is referred to as the 5' portion 413.

[0105] The second probe 420 can include a second binding portion 422 and a second interacting portion including a second nucleic acid molecule 424. The second binding portion 422 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 401. The second nucleic acid molecule 424 can be, for example, a DNA molecule and can bind to the binding portion 422 at the 5' end. The second nucleic acid molecule 424 can include a base pair sequence complementary to the base pair sequence of the first nucleic acid molecule for at least a portion of the second nucleic acid molecule, for example, the 3' portion 411 corresponding to the self-binding portion of the first nucleic acid molecule. However, the second nucleic acid molecule can also include a portion that is not complementary to the first nucleic acid molecule towards the 3' end, such that when the two molecules are paired together, they bind to each other only at the central portion of each strand, with one end of each binding to its respective binding portion and one end of each being thermally free to move.

[0106] In a first step 402, the first probe 410, the second probe 420, and the analyte 401 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 401, which binding brings the two probes into proximity and enables the interacting portions of the probes to interact.

[0107] This interaction occurs in a second step 404, where the 3' position 411 of the first nucleic acid molecule 414 and the second nucleic acid molecule 424 interact to form a complex 430. The first and second nucleic acid molecules can include a plurality of complementary base pairs that form their respective complementary sequences, such that when in proximity they interact to form a double-stranded nucleic acid complex in a portion of the two molecules, while on the other hand, unfolding the first nucleic acid from its closed hairpin configuration. Subsequently, the 5' portion 413 of the first nucleic acid molecule 414 moves freely in solution (optionally, similar to the remaining sequence at the end of the second nucleic acid molecule 424). Since the 5' portion 413 of the first nucleic acid molecule was complementary to the 3' portion 411, it has base pairs that match those of the second nucleic acid molecule 412 (the match need not be perfect, but the two sequences should be substantially identical such that each binds sufficiently to the 3' portion 411).

[0108] The fluid further comprises a plurality of free hairpin molecules including hairpin molecule 432. The hairpin molecule 432 includes, at each end, a sequence of base pairs that are complementary to each other in the same way as the corresponding ends of the first nucleic acid molecule 414, but in reverse order, with the 3' end of the hairpin molecule 432 being complementary to a part of the first nucleic acid molecule near the hairpin turn. Since the free hairpin 432 includes a 3' end that is reverse complementary to the 5' end 411 of the first nucleic acid molecule, two of them can bind to unfold the free hairpin 432 and form a two-molecule hairpin complex 440.

[0109] In step 408, a second free hairpin molecule 434 that includes an end that is reverse complementary to the 5' end of the two-molecule hairpin complex 440 is drawn from the solution, unfolded by base-pairing interactions, and bound to the complex to form a three-molecule hairpin complex 450. The end of this new complex is then reverse complementary to the second molecule, the first free hairpin 432, allowing for further unfolding and elongation of the complex. This process can potentially continue indefinitely as a runaway hairpin assembly reaction even if the original binding to the analyte is broken. Fluorescence or other imaging can then be used to detect the assembly reaction in the analyte-containing volume using similar analytical techniques as described above for FIGS. 2 and 3 to determine properties such as, for example, the number or concentration of the analyte. For example, a fluorescent moiety may be included in the fluorescence of the solution in the presence of the unfolded hairpin but not in the presence of the folded hairpin. The fluorescence is thus quenched while the hairpin remains folded, but the hairpin assembly reaction causes a cascade dequenching of the fluorescence as many hairpins are unfolded.

[0110] FIG. 5 shows an analyte detection method 500 that uses a junction to catalyze a hairpin assembly reaction. This method can be carried out in a fluid. For example, it can be carried out in each of a plurality of compartmentalized fluid-containing volumes. An analyte 501 is provided in the fluid. For example, the analyte may be a protein molecule. Method 500 is characterized as a "separated" method in the sense that a proximity-based interaction occurs while the fluid components are attached to the analyte, and the interaction is used to generate a catalyst for a reaction that occurs in solution separated from the junction. Further, method 500 does not require an enzyme. Thus, for example, there is no need for nucleic acid polymerization.

[0111] The fluid can further include a first probe 510 and a second probe 520. The first probe includes a first binding portion 512 bound to a first interaction portion that includes a first nucleic acid molecule 514. The first binding portion 512 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 501. The second probe includes a second binding portion 522 bound to a second nucleic acid molecule 524. The second binding portion 522 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 501.

[0112] In a first step 502, the first probe 510, the second probe 520, and the analyte 501 are each provided together in the fluid. The first and second probes each bind to a common analyte molecule 501, and this binding brings the two probes into proximity and enables the interaction portions of the probes to interact.

[0113] This interaction occurs in a second step 504, where a first nucleic acid molecule 514 and a second nucleic acid molecule 524 interact to form a complex 530. The first and second nucleic acid molecules can each contain a plurality of complementary base pairs for a portion of each molecule such that they can interact when in proximity to form a double-stranded nucleic acid complex 530. The remaining non-complementary portions of the first and second nucleic acids can then form a catalytic surface 532 to which other nucleic acid molecules can interact.

[0114] As an example of such a catalytic interaction, in step 506, the catalytic surface 532 of complex 530 can catalyze the unfolding of a first hairpin molecule 534 and a second hairpin molecule 536 provided in solution. The catalysis can occur through base pairing between the portions of the first and second nucleic acid molecules forming the catalytic surface 532 and portions of one or both of the hairpin molecules. These unfolded hairpin molecules can have complementary base pair sequences such that they form double-stranded nucleic acid complexes in step 508. Further, since the catalytic surface 532 catalyzes the unfolding of additional pairs of hairpin molecules, resulting in depletion of the hairpin molecules from solution and accumulation of double-stranded nucleic acids, steps 506 and 508 can be repeated. These double-stranded accumulations in the analyte-containing volume can then be detected using fluorescence or other imaging in a manner similar to that described above for FIGS. 2 and 3, and similar analytical techniques can be used to determine properties such as, for example, the number or concentration of the analyte. Thus, the unfolding of the hairpins can be detected by fluorescence cascade dequenching similar to that discussed above with respect to FIG. 4.

[0115] Figure 6 shows an analyte detection method 600 that uses a triple junction to catalyze strand displacement amplification. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 601 is provided in the fluid. For example, the analyte may be a protein molecule. Method 600 can be characterized as a method that is at least partially attached in the sense that proximity-based interactions occur while the fluid component is attached to the analyte, and the interactions polymerize in an amplification reaction while attached to the analyte. As discussed below, the amplification reaction can optionally include an exponential amplification reaction that proceeds separately from the analyte.

[0116] The fluid can further include a first probe 610 and a second probe 620. The first probe includes a first binding portion 612 bound to a first interaction portion that includes a first nucleic acid molecule 614. The first binding portion 612 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 601. The second probe includes a second binding portion 622 bound to a second nucleic acid molecule 624. The second binding portion 622 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 601.

[0117] In the first step 602, the first probe 610, the second probe 620, and the analyte 601 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 601, and this binding brings the two probes into proximity and enables the interaction portions of the probes to interact. Also present in the solution is an auxiliary substrate 634 bound to an auxiliary extender blocker oligonucleotide 636. The auxiliary non - extender blocker oligonucleotide 636 binds to the auxiliary substrate 634 and inhibits polymerization. The auxiliary substrate 634 includes a first portion complementary to a sequence at or near the end of the first nucleic acid molecule, and the auxiliary substrate includes a second portion complementary to a sequence at the end of the second nucleic acid molecule. The non - extender blocker oligonucleotide 636 is complementary to and can bind to at least a portion of the first and second portions of the auxiliary substrate 634. Thus, the first or second nucleic acid molecule can include a sequence that competes with the blocker to bind to a portion of the auxiliary substrate, but the blocker can bind more strongly (e.g., to a more complementary nucleic acid) than either the first or second nucleic acid molecule. Thus, with all molecules in solution and without binding to the analyte, there is little likelihood that the blocker will come off.

[0118] However, when the first and second probes bind to the analyte, this relationship can change due to proximity-based interactions between the first and second nucleic acid molecules. This interaction occurs in the second step 604, where the first nucleic acid molecule 614 and the second nucleic acid molecule 624 interact to form a complex 630. The first and second nucleic acid molecules can contain a plurality of complementary base pairs for a portion of each molecule such that they can interact when in proximity to form a double-stranded nucleic acid complex 630. The remaining non-complementary portions of the first and second nucleic acids can then form a catalytic surface 632 to which other nucleic acid molecules can interact. The portions of the first and second nucleic acid molecules that form the catalytic surface 632 can contain portions complementary to the first and second portions of the co-substrate. Either portion alone may not be sufficient to reliably overcome the binding of the blocker 636 to the co-substrate 634, but the two nucleic acid molecules together can form a catalytic surface that binds strongly enough to the co-substrate to reliably displace the blocker. This displacement occurs in step 606, releasing the blocker 636 into solution.

[0119] This forms an active complex 640 in which the 3' end of the second nucleic acid molecule can be extended using the co-substrate as a template. The extension can be nicked by a nicking endonuclease using a process similar to that shown in Figure 2, releasing the nicked portion into solution. In some embodiments, the nicking endonuclease includes sgRNA-guided CRISPR-Cas9. In some embodiments, this process is simply repeated and the nicked portions accumulate in solution at an approximately linear rate. Alternatively, the co-substrate can be configured to participate in an exponential amplification reaction. For example, the co-substrate can have a pattern of base pairs similar to that shown in Figure 3, e.g., reading from 5' to 3', region 1 * , 2 * , 1 * , 2 *It can have. Subsequently, the portions of the first and second nucleic acids can each provide complementary sequences 1 and 2 that form the catalytic surface 632. The nicked extension into the solution can be a copy of this surface and have sequences 1 and 2 from 5' to 3'. The nicked portion functions as a freely moving catalytic surface, displacing the blocker from additional auxiliary substrates in the solution and then extending and nicking to generate further nicked portions with the same 1, 2 sequences. This process can then be similar to the process shown in FIG. 3, resulting in an exponentially growing accumulation of nicked portions in the solution.

[0120] Regardless of which amplification method is selected, the amplification reaction in the analyte-containing volume can then be detected using fluorescence or other imaging in a manner similar to that described above for FIGS. 2 and 3, and characteristics such as the number or concentration of the analyte can be determined using similar analytical techniques.

[0121] In some embodiments of the present disclosure, the fluid volume comprises a plurality of auxiliary substrates. In certain embodiments, at least some of the auxiliary substrates are bound to auxiliary non-extendable blocker oligonucleotides. In some embodiments, none of the auxiliary substrates are bound to auxiliary non-extendable blocker oligonucleotides. In some embodiments, the fluid volume comprises a nicking endonuclease configured to cleave an extended nucleic acid, and the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended nucleic acid. In some embodiments, the plurality of auxiliary substrates includes an auxiliary substrate designed to bind to the extended nicked portion of the nucleic acid and inactivate it. In certain embodiments, the auxiliary substrate designed to bind to the extended nicked portion of the nucleic acid inactivates it by non-productively extending it, creating a threshold for exponential growth. An auxiliary substrate designed to bind to and inactivate the extended nicked portion of the nucleic acid (referred to herein as a "threshold oligonucleotide" and a "leakage threshold oligonucleotide") can be added to any of the fluid volumes disclosed herein. The leakage threshold oligonucleotide can react with the product and inactivate it, suppressing spontaneous exponential initiation in the absence of the target protein.

[0122] In some embodiments of the present disclosure, the fluid volume includes a plurality of auxiliary substrates. In certain embodiments, at least a portion of the auxiliary substrates are bound to auxiliary non-extendable blocker oligonucleotides. In some embodiments, none of the auxiliary substrates are bound to auxiliary non-extendable blocker oligonucleotides. In some embodiments, the fluid volume includes an amplification reaction that produces amplification product oligonucleotides (e.g., from digital isothermal amplification or digital EXPAR or digital PCR). In some embodiments, the plurality of auxiliary substrates includes auxiliary substrates designed to bind to and inactivate amplification product oligonucleotides (or product oligonucleotides). In certain embodiments, the auxiliary substrate is designed to create a threshold for growth by binding to and inactivating the amplification product oligonucleotide. In certain embodiments, the auxiliary substrate is designed to create a threshold for exponential growth by binding to and inactivating the amplification product oligonucleotide. In certain embodiments, the auxiliary substrate is designed to inactivate the amplification product oligonucleotide by binding to it and non-productively extending it, creating a threshold for growth. In certain embodiments, the auxiliary substrate is designed to inactivate the amplification product oligonucleotide by binding to it and non-productively extending it, creating a threshold for exponential growth. Auxiliary substrates designed to bind to amplification product oligonucleotides (referred to herein as "threshold oligonucleotides" and "leakage threshold oligonucleotides") can be added to any of the fluid volumes disclosed herein. The leakage threshold oligonucleotide can react with and inactivate the product oligonucleotide to suppress spontaneous initiation in the absence of the target. The leakage threshold oligonucleotide can react with and inactivate the product oligonucleotide to suppress spontaneous initiation and exponential growth in the absence of the target.

[0123] In some embodiments, the plurality of auxiliary substrates include an auxiliary substrate that binds to and inactivates the amplification product oligonucleotide. In some embodiments, the plurality of auxiliary substrates include an auxiliary substrate that binds to and inactivates the product oligonucleotide. In certain embodiments, the plurality of auxiliary substrates include an auxiliary substrate that creates a threshold for growth by binding to the amplification product oligonucleotide. In certain embodiments, the plurality of auxiliary substrates include an auxiliary substrate that creates a threshold for exponential growth by binding to the amplification product oligonucleotide. In certain embodiments, the plurality of auxiliary substrates include an auxiliary substrate that binds to the amplification product oligonucleotide, inactivates it by non-productively extending it, and creates a threshold for growth. In certain embodiments, the plurality of auxiliary substrates include an auxiliary substrate that binds to the amplification product oligonucleotide, inactivates it by non-productively extending it, and creates a threshold for exponential growth. Auxiliary substrates that bind to the amplification product oligonucleotide (referred to herein as "threshold oligonucleotides" and "leakage threshold oligonucleotides") can be added to any of the fluid volumes disclosed herein.

[0124] Figure 7 shows a method 700 for analyte detection using attached rolling circle amplification. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 701 is provided in the fluid. For example, the analyte can be a protein molecule. Method 700 can be characterized as an "attached" method in that it involves a reaction (amplification reaction) that occurs with a complex attached to the analyte.

[0125] The fluid can further include a first probe 710 and a second probe 720. The first probe includes a first binding portion 712 bound to a first interaction portion that includes a first nucleic acid molecule 714. The first binding portion 712 can be, for example, an antibody or a portion thereof having a binding site for binding to an analyte 701. The first nucleic acid molecule 714 is bound to a rolling circle substrate 738 (e.g., a circular nucleic acid molecule). The first nucleic acid molecule 714 and the rolling circle substrate 738 can be, for example, DNA molecules bound together by base pairing interactions. The rolling circle substrate 738 can include a plurality of nucleic acids that are chained together to form a loop. Since the loop lacks ends, elongation by DNA polymerase is inhibited. The rolling circle substrate 738 includes a first binding site 734 that is complementary to a first binding sequence 716 on the first nucleic acid molecule. If the first nucleic acid molecule 714 is bound to the first binding portion 712 at its 3' end, or if the first nucleic acid molecule is modified to prevent elongation (e.g., by inverted nucleotides), polymerization of the first nucleic acid molecule 714 can be inhibited as well.

[0126] The second probe 720 can include a second binding portion 722 and a second interaction portion that includes a second nucleic acid molecule 724. The second binding portion 722 can be, for example, an antibody or a portion thereof having a binding site for binding to an analyte 701. The second nucleic acid molecule 724 can be, for example, a DNA molecule and can be bound to the binding portion 722 at its 5' end. Thus, the second nucleic acid molecule 724 can be extended by a polymerase (e.g., a DNA polymerase) when an appropriate template is provided.

[0127] In a first step 702, the first probe 710, the second probe 720, and the analyte 701 are each provided together in the fluid. The first and second probes each bind to a common analyte molecule 701, and this binding brings the two probes into proximity and enables the interaction portions of the probes to interact.

[0128] This interaction occurs in a second step 704, where the first nucleic acid molecule 714 transfers the rolling circle substrate 738 to the second nucleic acid molecule 724. The second nucleic acid molecule has a base pair sequence complementary to the second binding portion 736 of the rolling circle substrate 738, which may overlap wholly or partially with the binding portion 734. In some embodiments, the second nucleic acid molecule 724 can have a higher affinity for the second binding site 736 than the first nucleic acid molecule 714 has for the first binding site 734. In alternative embodiments, the second nucleic acid has an equivalent or even weaker affinity for the first nucleic acid and relies on thermal equilibrium to ultimately transfer the rolling circle substrate. The affinity can be varied, for example, by having complementary base pair sequences of different lengths or by including some mismatched base pairs in one or both of the nucleic acid molecules. Once bound to the rolling circle substrate, the second nucleic acid molecule 724 can use the rolling circle substrate as a template and extend from its 3' end.

[0129] Polymerization continues in step 706, ultimately extending the second nucleic acid molecule 724 to form a loop complementary to the rolling circle substrate 738. The reaction can continue to extend the 3' end of the second nucleic acid molecule, unwind the second nucleic acid molecule as needed, and remove the polymerization site 728 for further extension. As the process continues with runaway amplification, the second nucleic acid molecule grows larger and larger. The production of this large strand can be detected using fluorescence or other imaging. Since the reaction tends to complete only in the analyte-containing volume, such a volume can thus be detected in the same way as described above for Figures 2 and 3, and the same analytical techniques can be used to determine characteristics such as the number or concentration of the analyte.

[0130] Figure 8 shows an analyte detection method 800 that uses a three-way junction to activate isolated rolling circle amplification. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 801 is provided in the fluid. For example, the analyte may be a protein molecule. Method 800 can be characterized as an "attached" method in that it involves a reaction (amplification reaction) that occurs with a complex attached to the analyte.

[0131] The fluid can further include a first probe 810 and a second probe 820. The first probe includes a first binding portion 812 bound to a first interaction portion that includes a first nucleic acid molecule 814. The first binding portion 812 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 801. The second probe includes a second binding portion 822 bound to a second nucleic acid molecule 824. The second binding portion 822 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 801.

[0132] In a first step 802, a first probe 810, a second probe 820, and an analyte 801 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 801, this binding bringing the two probes into proximity and enabling the interacting portions of the probes to interact. Also in the solution is a rolling circle substrate 838 bound to a non-extendable blocker oligonucleotide 816. The non-extendable blocker oligonucleotide 816 binds to the rolling circle substrate 838 and inhibits polymerization. The rolling circle substrate 838 includes a first portion complementary to a sequence at or near the end of a first nucleic acid molecule, and the rolling circle substrate 838 includes a second portion complementary to a sequence at the end of a second nucleic acid molecule. The non-extendable blocker oligonucleotide 816 is complementary to and can bind to at least a portion of the first and second portions of the rolling circle substrate 838. Thus, either the first or the second nucleic acid molecule can include a sequence that competes with the blocker to bind to a portion of the rolling circle substrate 838, but the blocker can bind more strongly (e.g., to a more complementary nucleic acid) than either the first or the second nucleic acid molecule. Thus, with all the molecules in solution and without binding to the analyte, there is little likelihood that the blocker will come off.

[0133] However, when the first and second probes bind to the analyte, this relationship can change due to proximity-based interactions between the first and second nucleic acid molecules. This interaction occurs in the second step 804, where the first nucleic acid molecule 814 and the second nucleic acid molecule 824 interact to form a complex 830. The first and second nucleic acid molecules can contain a plurality of complementary base pairs for a portion of each molecule such that they can interact when in proximity to form a double-stranded nucleic acid complex 830. The remaining non-complementary portions of the first and second nucleic acids can then form a catalytic surface 832 to which other nucleic acid molecules can interact. The portions of the first and second nucleic acid molecules that form the catalytic surface 832 can include portions complementary to the first and second portions of the rolling circle substrate 838. Each portion alone may not be sufficient to reliably overcome the binding of the blocker 816 to the rolling circle substrate 838, but the two nucleic acid molecules together can form a catalytic surface that binds strongly enough to the rolling circle substrate 838 to reliably displace the blocker.

[0134] This displacement occurs at step 806 and releases the blocker 816 into the solution. This forms an active complex 830 where the 3' end of the second nucleic acid molecule can be extended using the rolling circle substrate 838 as a template. As polymerization continues, it ultimately extends the second nucleic acid molecule 824 to form a loop complementary to the rolling circle substrate 838 (see, e.g., FIG. 7, step 706). The reaction can continue to extend the 3' end of the second nucleic acid molecule, unwind the second nucleic acid molecule as needed, and remove the polymerization site for further extension. Once the polymerization process is initiated, the first nucleic acid molecule need not remain bound to the rolling circle substrate. In fact, once polymerization has gone around once, the first nucleic acid molecule needs to be separated in order to continue using the rolling circle substrate as a template. The complex 830 can be disassembled as needed, but as the process moves far enough along, the configuration of the first and second molecules near the analyte becomes irrelevant. In fact, the two probes can freely separate from the analyte while the process continues. As the process continues with runaway amplification, the second nucleic acid molecule gets larger and larger. The production of this large strand can be detected using fluorescence or other detection methods (e.g., other optical or non-optical detection methods). The reaction tends to complete only in the analyte-containing volume, so such a volume can be detected in a manner similar to that described above for FIGS. 2 and 3, and similar analytical techniques can be used to determine characteristics such as the number or concentration of the analyte.

[0135] FIG. 9 shows a method 900 for analyte detection using separated strand displacement amplification. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 901 is provided in the fluid. For example, the analyte can be a protein molecule. The method 900 can be characterized as a "separated" method in that a proximity-based interaction occurs that involves fluid components attached to the analyte, but this interaction only serves to trigger the initiation of an amplification reaction involving components separated from the analyte.

[0136] The fluid can further include a first probe 910 and a second probe 920. The first probe includes a first binding portion 912 bound to a first interaction portion including a first nucleic acid molecule 914. The first binding portion 912 can be, for example, an antibody or a portion thereof having a binding site for binding to an analyte 901. The first nucleic acid molecule 914 is bound to a stretchable substrate 916. The first nucleic acid molecule 914 and the stretchable substrate 916 can be, for example, DNA molecules bound together by base-pairing interactions. The stretchable substrate 916 can have its 3' end attached and bound to the 5' end of the first nucleic acid molecule 914, and thus does not provide a template for DNA polymerase to function at its end. If the first nucleic acid molecule 914 is bound to the first binding portion 912 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 914 and the stretchable substrate 916.

[0137] The second probe 920 can include a second binding portion 922 and a second interaction portion including a second nucleic acid molecule 924. The second binding portion 922 can be, for example, an antibody or a portion thereof having a binding site for binding to an analyte 901. The second nucleic acid molecule 924 can be, for example, a DNA molecule and can bind to the binding portion 922. The second nucleic acid molecule 924 can inhibit elongation at both ends. The end bound to the binding portion is naturally inhibited from elongation by the binding and can be either the 3' or 5' end. The other end can be either the 5' end or the 3' end of the second nucleic acid molecule while moving freely in the solution, and can be prevented from elongating by including a modification (e.g., inverted 3' end) to prevent polymerization.

[0138] The fluid can further include an auxiliary substrate 926 that includes a base pair sequence complementary to the extensible substrate 916 and a plurality of additional bases located adjacent to the complementary base pair sequence. As a result, when the extensible substrate 916 base pairs with the corresponding sequence of the auxiliary substrate 926, the extensible substrate 916 can be extended by a polymerase using the auxiliary substrate 926 as a template. In some embodiments, the relative affinities of the auxiliary substrate 926, the extensible substrate 916, the first nucleic acid molecule 914, and the second nucleic acid molecule 924 are selected to inhibit removal of the extensible substrate 916 from the first nucleic acid molecule 914 until it is in proximity to the second nucleic acid molecule 924. For example, the extensible substrate 916 can have a greater (or similar) affinity for the first nucleic acid molecule 914 than for the auxiliary substrate 926, but the first nucleic acid molecule 914 can have a greater (or similar) affinity for the second nucleic acid molecule 924 than for the extensible substrate 916. The affinity can be varied, for example, by varying the respective lengths of the matching base pairs of each molecule and (optionally) by including one or more mismatched base pairs to reduce the binding affinity.

[0139] In a first step 902, a first probe 910, a second probe 920, and an analyte 901 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 901, and this binding brings the two probes into proximity and enables the interaction portions of the probes to interact.

[0140] This interaction occurs in the second step 904, where the first nucleic acid molecule 914 and the second nucleic acid molecule 924 interact to form a complex 930. The first and second nucleic acid molecules can contain a plurality of complementary base pairs such that they can interact, for example, when in proximity, to form a double-stranded nucleic acid complex 930. The interaction can displace the extensible substrate 916, which can then be released into the solution. The extensible substrate 916 is released into the solution and can conjugate with an auxiliary substrate 926 in the solution. In step 906, the extensible substrate 916 binds to the auxiliary substrate 926 by complementary base pairing and is subsequently extended by a polymerase (e.g., DNA polymerase) using the auxiliary substrate 926 as a template. The extension can then be nicked by a nicking endonuclease, resulting in the accumulation of nicked nucleic acid portions, similar to the process described in FIG. 2, by repeating the process. Further, when a plurality of auxiliary substrates 926 are present in the solution and the base pair sequence of the auxiliary substrate 926 contains a repetitive sequence complementary to the extensible substrate 916 (e.g., the 1 * 、2 * 、1 * 、2 * sequence where the extensible substrate 916 has a 1, 2 sequence, or more simply a 1 * 、1 * sequence and the extensible substrate 916 has a 1 sequence), the amplification reaction can be extended to include additional auxiliary substrates in an exponential amplification reaction, similar to the process described for FIG. 3.

[0141] Regardless of which amplification method is selected, the amplification reaction in the analyte-containing volume can then be detected using fluorescence or other imaging in a manner similar to that described above for FIGS. 2 and 3, and characteristics such as the number or concentration of the analyte can be determined using similar analytical techniques.

[0142] FIG. 10 shows a method 1000 for analyte detection using isolated rolling circle amplification. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 1001 is provided in the fluid. For example, the analyte may be a protein molecule. The method 1000 is characterized as a "separated" method in that a proximity-based interaction occurs that involves a fluid component attached to the analyte, but this interaction only serves to trigger the initiation of an amplification reaction that involves components separated from the analyte.

[0143] The fluid can further include a first probe 1010 and a second probe 1020. The first probe includes a first binding portion 1012 bound to a first interaction portion that includes a first nucleic acid molecule 1014. The first binding portion 1012 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 1001. The first nucleic acid molecule 1014 is bound to an extensible substrate 1016. The first nucleic acid molecule 1014 and the extensible substrate 1016 can be, for example, DNA molecules bound together by base-pairing interactions. The extensible substrate 1016 can have its 3' end attached and bound to the 5' end of the first nucleic acid molecule 1014, and thus does not provide a template for DNA polymerase to function at its end. If the first nucleic acid molecule 1014 is bound to the first binding portion 1012 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 1014 and the extensible substrate 1016.

[0144] The second probe 1020 can include a second binding portion 1022 and a second interacting portion including a second nucleic acid molecule 1024. The second binding portion 1022 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 1001. The second nucleic acid molecule 1024 can be, for example, a DNA molecule and can bind to the binding portion 1022. The second nucleic acid molecule 1024 can inhibit elongation at both ends. The end bound to the binding portion is naturally inhibited from elongation by the binding and can be either the 3' or 5' end. The other end can be either the 5' end or the 3' end of the second nucleic acid molecule while moving freely in solution, but can be prevented from elongating by including a modification (e.g., inverted 3' end) to prevent polymerization.

[0145] The fluid can further include a rolling circle substrate 1038 that includes a base pair sequence complementary to the extensible substrate 1016 and a plurality of additional bases located adjacent to the complementary base pair sequence. As a result, when the extensible substrate 1016 base pairs with the corresponding sequence of the rolling circle substrate 1038, the extensible substrate 1016 can be extended by a polymerase using the rolling circle substrate 1038 as a template. In some embodiments, the relative affinities of the rolling circle substrate 1038, the extensible substrate 1016, the first nucleic acid molecule 1014, and the second nucleic acid molecule 924 are selected to inhibit removal of the extensible substrate 1016 from the first nucleic acid molecule 1014 until it is in proximity to the second nucleic acid molecule 1024. For example, the extensible substrate 1016 substrate can have a greater (or similar) affinity for the first nucleic acid molecule 1014 than the rolling circle substrate 1038, but the first nucleic acid molecule 1014 can have a greater (or similar) affinity for the second nucleic acid molecule 1024 than the extensible substrate substrate 1016. The affinity can be varied, for example, by varying the respective lengths of the matching base pairs of each molecule and (optionally) including one or more mismatched base pairs to reduce the binding affinity.

[0146] In a first step 1002, a first probe 1010, a second probe 1020, and an analyte 1001 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 1001, and this binding brings the two probes into proximity and enables the interacting portions of the probes to interact.

[0147] This interaction occurs in a second step 1004, where a first nucleic acid molecule 1014 and a second nucleic acid molecule 1024 interact to form a complex 1030. The first and second nucleic acid molecules can include a plurality of complementary base pairs 1032 such that they can interact, for example, when in proximity, to form a double-stranded nucleic acid complex 1030. The interaction can displace an extensible substrate 1016, which can then be released into the solution. The extensible substrate 1016 is released into the solution and can conjugate with a rolling circle substrate 1038 in the solution. After being released from the first nucleic acid molecule, the extensible substrate 1016 can conjugate with the rolling circle substrate 1038 in the solution. The extensible substrate 1016 binds to the rolling circle substrate 1038 by complementary base pairing and is subsequently extended by a polymerase (e.g., DNA polymerase) using the rolling circle substrate 1038 as a template.

[0148] Polymerization continues in step 1006 and ultimately extends the extensible substrate 1016 to form a loop complementary to the rolling circle substrate 1038. The reaction can continue to extend the 3' end of the second nucleic acid molecule, unwind the extensible substrate 1016 as needed, and remove the polymerization site 1028 for further extension. As the process continues with a runaway amplification reaction, the extensible substrate 1016 grows larger and larger. The production of this large strand can be detected using fluorescence or other imaging. Since the reaction tends to complete only in the analyte-containing volume, such a volume can thus be detected in a similar manner as described above for FIGS. 2 and 3, and similar analytical techniques can be used to determine characteristics such as the number or concentration of the analyte.

[0149] Figure 11 shows a method 1100 for analyte detection that uses strand displacement of a blocking oligonucleotide to induce RNA polymerization. This method can be performed in a fluid. For example, it can be performed in each of a plurality of compartmentalized fluid-containing volumes. An analyte 1101 is provided in the fluid. For example, the analyte can be a protein molecule. Method 1100 can be characterized as an "attached" method in that it involves a reaction (RNA polymerization) that occurs with a complex attached to the analyte.

[0150] The fluid can further include a first probe 1110 and a second probe 1120. The first probe includes a first binding portion 1112 bound to a first interaction portion that includes a first nucleic acid molecule 1114. The first binding portion 1112 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 1101. The first nucleic acid molecule 1114 is bound to a blocker oligonucleotide 1116. The first nucleic acid molecule 1114 and the blocker oligonucleotide 1116 can be, for example, DNA molecules bound together by base-pairing interactions. The blocker oligonucleotide 1116 can include a modification to its 3' end (e.g., an inverted 3' end), such that template-directed extension by DNA polymerase is inhibited at that end (as well as at the native 5' end that is not extended by DNA polymerase). If the first nucleic acid molecule 1114 is bound to the first binding portion 1112 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 1114 and the blocker oligonucleotide 1116. The blocker oligonucleotide 1116 and the first nucleic acid molecule 1114 can collectively constitute an inactive RNA polymerase substrate. For example, pairs of molecules can form double-stranded DNA complexes with modified bases or mismatches to disrupt the polymerase recognition site. Thus, the fluid can further include RNA polymerase, but RNA production is inhibited due to inactivation of the polymerase recognition site.

[0151] The second probe 1120 can include a second binding portion 1122 and a second interaction portion including a second nucleic acid molecule 1124. The second binding portion 1112 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 1101. The second nucleic acid molecule 1124 can be, for example, a DNA molecule and can bind to the binding portion 1122 at its 5' end.

[0152] In a first step 202, the first probe 1110, the second probe 1120, and the analyte 1101 are each provided together in a fluid along with RNA polymerase. The first and second probes each bind to a common analyte molecule 1101, which binding brings the two probes into proximity and enables the interaction portions of the probes to interact.

[0153] This interaction occurs in a second step 1104, where the first nucleic acid molecule 1114 and the second nucleic acid molecule 1124 interact to form a complex 1130. The first and second nucleic acid molecules can include a plurality of complementary base pairs such that they can interact to form a double-stranded nucleic acid complex 1130 when they are in proximity. The interaction can displace the blocker oligonucleotide 1116, which can then be released into the solution as waste. The complex including the blocker 1116 and the first nucleic acid molecule 1114 includes an inactive RNA polymerase substrate, while the new complex 1130 including the first and second nucleic acid molecules includes an active RNA polymerase substrate.

[0154] In step 1106, RNA polymerase interacts with the complex 1130 in the solution in the fluid and transcribes a plurality of RNA molecules 1136. The accumulation of the RNA molecules can be detected using techniques such as fluorescence imaging, which can be used to detect the accumulation of the RNA strands by providing a fluorescent moiety to the fluid that fluoresces when irradiated with light of an appropriate wavelength in the presence of (e.g., when bound to) the RNA strands.

[0155] The amplification process 1100 depends on the presence of analyte 1101, which is carried out until completion (by bringing the proximity of the first and second probes through binding to a common analyte, thereby initiating a proximity-based interaction). Therefore, the generation of RNA strands 1136 in the solution indicates the presence of the analyte. Thus, the presence or absence of fluorescence (or other properties) based on the accumulation or non-accumulation of RNA in the solution can detect which fluid volume contains or does not contain the analyte. Therefore, by using method 1100 as part of a digital assay, it is possible to generate measurements of the number of nucleic acid molecules in a fluid and, correspondingly, other properties such as analyte concentration. Alternatively, process 1100 can be used to perform an analog measurement of the analyte. The rate of RNA generation in the solution increases with the number of analyte particles present in the solution. Thus, an analog measurement of the amount of analyte in the fluid can be generated using a measurement of the amount of RNA produced (e.g., by measuring fluorescence intensity, measuring the time to reach a given intensity, etc.). The measurement can include, for example, comparing the measured signal to a calibrated scale to determine the measured amount of the analyte.

[0156] Optionally, the RNA generated by polymerization from the double-stranded DNA complex 1130 can be used to induce an exponential amplification process, thereby enhancing the signal intensity indicating the presence of the analyte (similar to the types of enhancements applicable to other exponential amplification reactions disclosed herein). For example, an exponential amplification reaction such as nucleic acid sequence-based amplification (NASBA) can be used. A detection mechanism for digital or analog measurement of an exponential reaction, such as that discussed in FIG. 3, can be used to generate a measurement of the amount of analyte in the fluid.

[0157] In some aspects, the systems described herein include a computer including one or more processors and a memory device storing executable instructions. In some aspects, the computer is used to execute the methods described herein. In various aspects, a computer can be used to implement any of the systems or methods illustrated and described above. In some aspects, the computer includes a processor that communicates with several peripheral subsystems via a bus subsystem. These peripheral subsystems can include a storage subsystem including a memory subsystem and a file storage subsystem, a user interface input device, a user interface output device, and a network interface subsystem.

[0158] In some aspects, the bus subsystem provides a mechanism for enabling the various components and subsystems of the computer to communicate with each other as intended. The bus subsystem can include a single bus or multiple buses.

[0159] In some aspects, the network interface subsystem provides an interface to other computers and networks. The network interface subsystem can function as an interface for sending and receiving data between the computer and other systems. For example, using the network interface subsystem, a computer can be connected to the Internet to facilitate communication using the Internet.

[0160] In some embodiments, the computer includes user interface input devices such as a pointing device (e.g., a keyboard, mouse, trackball, touchpad, or graphics tablet), a scanner, a barcode scanner, a touch screen incorporated into a display, an audio input device (e.g., a voice recognition system, microphone), and other types of input devices. Generally, the use of the term "input device" is intended to include all possible types of devices and mechanisms for inputting information into a computer.

[0161] In some embodiments, the computer includes user interface output devices such as a display subsystem, a printer, a fax machine, or a non-visual display (e.g., an audio output device). The display subsystem may include a cathode ray tube (CRT), a flat panel device such as a liquid crystal display (LCD), or a projection device. Generally, the use of the term "output device" is intended to include all possible types of devices and mechanisms for outputting information from a computer.

[0162] In some embodiments, the computer includes a storage subsystem that provides a computer-readable storage medium for storing basic programming and data constructs. In some embodiments, the storage subsystem stores software (programs, code modules, instructions) that, when executed by a processor, provides the functionality of the methods and systems described herein. These software modules or instructions can be executed on one or more processors. The storage subsystem can also provide a repository for storing data used in accordance with the present disclosure. The storage subsystem can include a memory subsystem and / or a storage subsystem.

[0163] In some aspects, a computer can include a memory subsystem that can include several memories, such as a main random access memory (RAM) for storing instructions and data during program execution and a read-only memory (ROM) for storing fixed instructions. A file storage subsystem provides non-temporary persistent (non-volatile) storage for program and data files and can include a hard disk drive, removable media associated with a floppy (registered trademark) disk drive, a compact disc read-only memory (CD-ROM) drive, an optical drive, a removable media cartridge, and other similar storage media.

[0164] The computer can be of various types, including a personal computer, a portable computer, a workstation, a network computer, a mainframe, a kiosk, a server, or any other arbitrary data processing system. Due to the constantly changing nature of computers and networks, the description of the computer included herein is intended only as a specific example for explaining aspects of the computer. Many other configurations with more or fewer components than the systems described herein are possible.

[0165] The specific dimensions of any of the devices, apparatuses, systems, and their components of the present disclosure can be readily varied according to the intended use, as will be apparent to those skilled in the art in view of the disclosure herein. Further, the examples and aspects described herein are for illustrative purposes only, and various modifications or changes can be suggested to those skilled in the art, and it is understood that they are included within the spirit and scope of the present application and the appended claims. Numerous different combinations of the aspects described herein are possible, and such combinations are considered to be part of the present disclosure.

[0166] As used herein, A and / or B includes one or more of A or B, as well as combinations thereof such as A and B.

[0167] All features discussed in connection with any aspect or aspects of this specification can be readily adapted for use in other aspects and uses of this specification. The use of different terms or reference numerals for like features in different aspects does not necessarily imply any difference other than those explicitly recited. Accordingly, this disclosure is not limited to the aspects disclosed herein and is intended to be defined only by reference to the appended claims.

[0168] Unless otherwise specified, the methods and processes currently being described can be performed in any order. For example, a method described with steps (a), (b), and (c) can be performed first with step (a), then step (b), and then step (c). Or, the method can be performed in a different order, for example, first step (b), then step (c), and then step (a). Further, these steps can be performed simultaneously or individually unless otherwise specified.

[0169] The details presented herein are for purposes of example only, for the purpose of providing an exemplary consideration of the preferred aspects of this disclosure, and are considered to provide the most useful and readily understandable explanation of the principles and conceptual aspects of the various aspects of the invention. In this regard, no attempt has been made to show more of the structural details of the invention than is necessary for a fundamental understanding of the invention, and the description, together with the drawings and / or examples, is to make apparent to those skilled in the art how some forms of the invention can be actually embodied.

[0170] Preferred aspects of this disclosure have been shown and described herein, but it should be understood that the disclosure is not limited to the specific aspects described, as modifications of the specific aspects can be made and still be within the scope of the appended claims. It should also be understood that the terms used are for the purpose of describing particular aspects of this disclosure only and are not intended to be limiting. Rather, the scope of this disclosure is established by the appended claims.

[0171] When a range of values is provided, unless the context clearly indicates otherwise, each intermediate value between the upper and lower limits of that range, and other recited values or intermediate values within that recited range, is to be understood as being included in the present disclosure provided herein to one tenth of the unit of the lower limit. The upper and lower limits of these smaller ranges may be included in a smaller range, and independently included in the present invention, provided that they have any specifically excluded limitations within the recited range. If the recited range includes one or both of the limits, ranges excluding either of those included limits are included in the present disclosure provided herein.

[0172] All features discussed in connection with an aspect or aspects of this specification can be readily adapted for use in other aspects and uses of this specification. The use of different terms or reference numerals for similar features in different aspects does not necessarily mean a difference other than that explicitly described. Accordingly, the present disclosure is not limited to the aspects disclosed herein and is intended to be defined only by reference to the appended claims.

Examples

[0173] The following examples are included to further illustrate some aspects of the present disclosure and should not be used to limit the scope of the present invention.

[0174] Example 1 Detection of an analyte by strand displacement amplification (SDA) This example describes the detection of an analyte in a process corresponding to the process described above and shown in FIG. 2. The DNA of the first probe is generated by synthesizing two parts using standard commercially available DNA synthesis methods. DNA A, which is the first strand of DNA, functions as an anchor attached to the binding part and is a 3'-amine-terminated oligonucleotide 60 nucleotides in length. This sequence is synthesized to contain a restriction site for Nb.BsrDI nicking endonuclease at the 25-nucleotide position from the 5'-end. Another strand that functions as a blocker is a 30-nucleotide oligonucleotide complementary to nucleotides 30 - 60 of the anchor. The melting temperature of the two DNA molecules is significantly higher than 65°C. The blocker is modified at its 3'-end with reverse dT to prevent elongation by polymerase.

[0175] The anchor and the blocker are placed at equimolar concentrations of about 1 μM in a suitable buffer (e.g., 40 mM Tris-HCl, 50 mM sodium chloride) and hybridized by slowly cooling to 80°C at 0.1°C / second. The two-component complex is then purified by gel electrophoresis to remove all remaining unbound single-stranded DNA.

[0176] The DNA of the second probe is generated by synthesizing a 5'-amine-terminated oligonucleotide 30 nucleotides in length with the same sequence as the blocker. This is synthesized to hybridize to the same anchor position as the blocker. There is no large energetic advantage for DNA B, which is the DNA strand of the second probe, to displace the blocker in solution, and the strand displacement reaction is slow. Therefore, DNA B has no tendency to bind to DNA A in solution.

[0177] One antibody AB against the target of interest (e.g., interleukin-2 or IL-2) is chemically linked to DNA A to form the first probe. AB B is chemically linked to DNA B to form a secondary probe. Both of these two antibodies bind to IL-2, but the epitopes are different. The DNA-antibody conjugate is purified by FPLC or a similar method to remove free DNA.

[0178] A sample containing IL-2 is treated with both DNA-antibody conjugates in a buffer containing Bst Large Fragment polymerase, Nb.BsrDI nicking endonuclease, and appropriate conditions for enzyme activity (e.g., 40 mM Tris-HCl, 5 mM DTT, 50 mM sodium chloride, 10 mM magnesium chloride, pH 8.8 at 25 °C, 0.5 mM each of dATP, dCTP, dTTP, and dGTP, and 1 / 100,000 diluted SYBR Green I). After appropriate incubation for 2 hours, the temperature is raised to 65 °C to initiate the reaction.

[0179] The IL-2 antibody binds to IL-2 in solution and brings DNA A and DNA B into proximity. DNA B displaces the blocker attached to DNA A. Thereby, an active substrate for Bst Large Fragment polymerase is created. When polymerization is complete, the newly generated double-stranded DNA product contains a recognition site for Nb.BsrDI nicking endonuclease. Nb.BsrDI creates a single-strand break, which can be recognized by the polymerase to displace the single-strand product. By cycling the endonuclease and polymerase, single-stranded DNA accumulates. This accumulation is detected by an increase in fluorescence from SYBR Green I using standard fluorescence detection.

[0180] Example 2 Detection of Analytes by SDA and Exponential Amplification Reaction (EXPAR) This example describes the detection of an analyte in a process corresponding to the process described above and shown in FIG. 3. Synthetic DNA is generated according to the scheme shown in FIG. 3. An efficient EXPAR template having domain 1-2-1 is used, and in this specific example, domain 1 is CTCACGCTAC (SEQ ID NO: 1) and domain 2 is GGACGACTC. A threshold oligonucleotide having domain 1 and subsequent mismatched bases may also be included to inhibit false reactions without an active substrate. Synthetic DNA having domains as shown in FIG. 3 is linked to each of two respective antibodies using the process described in Example 1 to form an antibody-DNA conjugate. Each antibody contains a binding site for binding to a different epitope of the target analyte.

[0181] The overall protocol includes dilution of the sample into a reaction buffer containing the antibody-DNA conjugate. When these conjugates bind to the target analyte, this can release the initiator of EXPAR, as shown in FIG. 3. The EXPAR enzyme, substrate DNA, and intercalating dye are added and the sample is divided into droplets. The reaction volume is heated to a temperature suitable for polymerase activity. At the activation temperature (55° C. for Bst polymerase), the reaction exponentially amplifies the released primer. No digestion or ligation is required, nor is a change in enzyme conditions (such as buffer exchange).

[0182] More specifically, the antibody is conjugated to DNA according to the protocol described in Example 1 above. The antigen and the DNA-modified antibody are mixed at nanomolar concentrations with all permutations of the control combinations. To each of these samples, a reaction mixture of 30 μL volume containing 6 units of the Nt.BstNBI nicking enzyme, 0.9 U of Bst DNA polymerase, 0.24 mM of each dNTP, 3 mM of MgCl2, 1×Evagreen, 20 mM of Tris-HCl, pH 7.9, 15 mM of ammonium sulfate, 30 mM of KCl, 0.005% Triton® X-100, and 50 nM of EXPAR substrate DNA (e.g., an oligonucleotide having the sequence CTCACGCTACGGACGACTCTCTCACGCTAC (SEQ ID NO: 2)) is added. This is a modified version of the ThermoPol buffer. The Thermopol buffer (20 mM of Tris-HCl, 0.1% Triton® X-100, 10 mM of (NH 4 ) 2 SO 4 , 2 mM of MgSO 4 , 10 mM of KCl, pH 8.8 at 25 °C) may be a suitable alternative and is provided by Nt.BstNBI. Serial dilutions of the EXPAR primer DNA (e.g., an oligonucleotide having the sequence GTAGCGTGAG (SEQ ID NO: 3)) from 50 nM to 0.5 pM are prepared. The reaction is then raised to 55 °C and needs to be monitored every minute for 120 minutes.

[0183] Example 3 Detection of an analyte by an enzyme-free catalytic hairpin reaction This example describes the detection of an analyte in a process corresponding to the process described above and shown in FIG. 5. The DNA of the first probe is generated by synthesizing an oligonucleotide using standard commercially available DNA synthesis methods. DNA A, the first strand of DNA, functions as an anchor attached to the binding portion and is a 3'-amine-terminated oligonucleotide 60 nucleotides in length. This sequence is designed to include the binding region of DNA B.

[0184] The DNA of the second probe is generated by synthesizing a 5'-amine-terminal oligonucleotide with a length of 30 nucleotides and a sequence partially complementary to DNA A. The binding energy of DNA B, which is the second probe, is very weak, and its melting point is near or below room temperature. Therefore, DNA B has no tendency to bind to DNA A in solution.

[0185] One antibody ABA against the target of interest (e.g., interleukin-2 or IL-2) is chemically linked to DNA A to form the first probe. The secondary antibody AB B is chemically linked to DNA B to form the secondary probe. Both of these two antibodies bind to IL-2, but the epitopes are different. The DNA-antibody conjugate is purified by FPLC or a similar method to remove free DNA.

[0186] Hairpin DNA1 and hairpin DNA2 are designed to form a folded structure. Hairpin DNA2 is synthesized to contain a fluorophore and a quencher that function as a molecular beacon. The hairpin oligonucleotide is individually prepared in a reaction buffer (e.g., 40 mM Tris-HCl, 150 mM sodium chloride, 10 mM potassium chloride, pH 8 at 25 °C). The hairpin DNA is annealed by heating at 80 °C for 3 minutes and then quenching on ice. Then, hairpin DNA 1 and hairpin DNA 2 are diluted and mixed at a concentration of 200 nM each with 1 nM of each of the first and second probes in the reaction buffer. Then, a sample containing IL-2 is added to this mixture.

[0187] The IL-2 antibody binds to IL-2 in solution and brings DNA A and DNA B into proximity. DNA B binds to DNA A to create an active catalytic complex. The catalytic complex can hybridize to hairpin DNA 1 and disrupt the double-stranded stem. This makes available a single-stranded region that can hybridize to hairpin DNA 2. Hairpin DNA 2 then binds to hairpin DNA 1 and displaces the catalytic complex. This results in the accumulation of double-stranded products. This accumulation is detected by fluorescence that increases as the fluorophore and quencher of hairpin DNA 2 are separated.

[0188] Example 4 Detection of an analyte by a separated rolling circle amplification reaction This example describes the detection of an analyte in a process corresponding to the process described above and shown in FIG. 10. The DNA of the first probe is generated by synthesizing two parts using standard commercially available DNA synthesis methods. DNA A, which is the first strand of the DNA, functions as an anchor attached to the binding part and is a 3'-amine-terminated oligonucleotide 60 nucleotides in length. This sequence is synthesized to include a part (16 bases) of the circular template viral genome from bacteriophage M13 (M13 DNA). The other strand, which is the primer, is a 30-nucleotide oligonucleotide complementary to nucleotides 30 to 60 of the anchor. The melting temperature of the two DNA molecules is significantly higher than 65°C. The primer binds to DNA A at a position that is not easily subjected to elongation by polymerase.

[0189] The anchor and the primer are placed at an equimolar concentration of about 1 μM in an appropriate buffer (e.g., 40 mM Tris-HCl, 50 mM sodium chloride) and hybridized by slowly cooling to 80°C at 0.1°C / second. The two-component complex is then purified by gel electrophoresis to remove all remaining unbound single-stranded DNA.

[0190] DNA B, which is the DNA of the second probe, is generated by synthesizing a 5'-amine-terminated oligonucleotide that is 30 nucleotides in length and has the same sequence as the primer. The 3' end is also modified with reverse bases to prevent elongation by polymerase. This is synthesized to hybridize to the same anchor position as the primer. The DNA strand of the second probe, DNA B, has no significant energetic advantage for displacing the blocker in solution, and the strand displacement reaction is slow. Therefore, DNA B has no tendency to bind to DNA A in solution.

[0191] One antibody AB A against the target of interest (e.g., interleukin-2 or IL-2) is chemically linked to DNA A to form the first probe. The secondary antibody AB B is chemically linked to DNA B to form the secondary probe. Both of these two antibodies bind to IL-2, but the epitopes are different. The DNA-antibody conjugates are purified by FPLC or a similar method to remove free DNA.

[0192] A sample containing IL-2 is treated with both DNA-antibody conjugates in a buffer containing 1 nM of M13 DNA, Bst Large Fragment polymerase, and conditions suitable for enzyme activity (e.g., 40 mM Tris-HCl, 5 mM DTT, 50 mM sodium chloride, 10 mM magnesium chloride, pH 8.8 at 25°C, 0.5 mM each of dATP, dCTP, dTTP, and dGTP) and 50 nM molecular beacon designed to bind to the reverse complement of M13 DNA. After appropriate incubation for 2 hours, the temperature is raised to 65°C to initiate the reaction.

[0193] The IL-2 antibody binds to IL-2 in solution and brings DNA A and DNA B into proximity. DNA B displaces the primer attached to DNA A. This primer then binds to M13 DNA, generating a substrate for the active site of Bst Large Fragment polymerase. As polymerization proceeds, the newly generated rolling circle DNA product can bind to a molecular beacon in solution that is detected by increased fluorescence using standard fluorescence detection.

[0194] Example 5 Detection of Analyte by Strand Displacement Amplification (SDA) This example describes the detection of an analyte in a process corresponding to the process described above and shown in FIG. 2. The DNA of the first probe is generated by synthesizing two parts using standard commercially available DNA synthesis methods. DNA A, the first strand of DNA, functions as an anchor bound to the binding part and is a 3'-biotinylated oligonucleotide with a length of 60 nucleotides and the sequence CTTTAACTCACACTCACGCTACGGACGACTCTATGATGGTACCTGCTTCTGAATTCTAAA (SEQ ID NO: 4).

[0195] This sequence was synthesized to contain a template for the restriction site of Nb.BstNBI nicking endonuclease at the 22-nucleotide position from the 5'-end. Another strand that functions as a blocker is a 40-nucleotide oligonucleotide complementary to nucleotides 21-60 of the anchor (sequence TTTAGAATTCAGAAGCAGGTACCATCATAGAGTCGTCC * GinvdT (SEQ ID NO: 5)). The blocker was modified with a phosphorothioate ( * shown as) at the position of 1 base from the 3'-end and an inverted dT (shown as invdT) at the 3'-end to prevent cleavage by endonuclease or elongation by polymerase.

[0196] An anchor (measured by UV-Vis at 1 μM) and a blocker (measured by UV-Vis at 1.1 μM) were prepared in an appropriate buffer (in this case, 20 mM Tris-HCl, 10 mM (NH 4 ) 2 SO 4 4, 50 mM KCl, 2 mM MgSO 4 4, 1× NEB isothermal amplification buffer composed of 0.1% Tween® 20, pH 8.8 at 25 °C). The mixture was heated to 80 °C and annealed by slowly cooling at 0.1 °C / second. The blocker strand was added in a 10% molar excess to ensure complete coverage of all template strands. The two-component complex can optionally be separated by gel electrophoresis to remove any remaining unbound single-stranded DNA.

[0197] The DNA of the second probe was 39 nucleotides in length and was generated by synthesizing a 5'-biotinylated oligonucleotide with the same sequence as the blocker except for the modification (sequence TTTAGAATTCAGAAGCAGGTACCATCATAGAGTCGTCCG (SEQ ID NO: 6)). It was synthesized to hybridize to the same anchor position as the blocker. There is no significant energetic advantage for the DNA B, which is the DNA strand of the second probe, to displace the blocker in solution, and the strand displacement reaction is slow. Therefore, DNA B has no tendency to bind to DNA A in solution.

[0198] Both DNA complexes were bound to the probe (biotin). The sample can be assayed for the presence of the target protein that binds to the probe (avidin). A sample containing 1 μM avidin was added to a reaction buffer containing Bst Large Fragment polymerase and Nb.BsrDI nicking endonuclease, along with both DNA-probe complexes, under appropriate conditions for enzyme activity (e.g., appropriate buffer as described above, 0.5 mM each of dATP, dCTP, dTTP, and dGTP, and 1 / 50,000 diluted SYBR Green II). The temperature was raised to 55 °C to initiate the reaction. Control reactions were also prepared with the components of the reaction excluded (i.e., the template, primer, blocker, or avidin omitted).

[0199] The biotin moiety binds to avidin in solution, bringing DNA A and DNA B into proximity. DNA B displaces the blocker attached to DNA A. This creates an active substrate for Bst LargeFragment polymerase. When polymerization was complete, the newly generated double-stranded DNA product contained a recognition site for Nb.BstNBI nicking endonuclease. Nb.BstNBI created a single-strand break, which was recognized by Bst polymerase to displace the single-strand product. Cycling of the endonuclease and polymerase resulted in the accumulation of single-stranded DNA. This accumulation was detected by an increase in fluorescence from SYBR Green II using standard fluorescence detection. The results are shown in FIGS. 12A-E.

[0200] Figure 12A shows a schematic diagram of the reaction in which proximity induces strand displacement to generate active substrates for polymerase and nicking endonuclease. Figure 12B shows that fluorescence over time indicates the effect of proximity driven by the binding of DNA to protein. Samples were prepared as follows: 1. water only, 2. template only, 3. positive control (no block) containing template and primer, 4. negative control showing template block, 5. negative control showing template block + primer, 6. experimental sample containing template block, primer, and target protein. Sample 6, which contained template block, primer, and target protein, showed a significant increase in fluorescence over time. Figure 12C shows an endpoint fluorescence digital photograph depicting the relative fluorescence of Samples 1 - 6. The dotted line indicates the position of the null control vial. Figure 12D shows fluorescence over time performed in triplicate experiments with and without the target protein. The triplicate samples containing the target protein showed increased fluorescence over time compared to the triplicate samples without the target protein. Figure 12E shows an endpoint fluorescence digital photograph showing the relative fluorescence of triplicate samples with and without the target protein. According to the fluorescence digital photograph, the three samples containing the target protein showed an increase in fluorescence compared to the samples without the target protein.

[0201] Example 6 Detection of Analytes by EXPAR in Solutions and Droplets This example describes the detection of analytes in a process corresponding to the process described above and shown in Figure 3. The DNA of the first probe is generated by synthesizing two parts using standard commercially available DNA synthesis methods. DNA A, the first strand of DNA, functions as an anchor bound to the binding part and is a 3'-biotinylated oligonucleotide with a length of 60 nucleotides and the sequence CTTTAACTCACACTCACGCTACGGACGACTCTATGATGGTACCTGCTTCTGAATTCTAAA (SEQ ID NO: 4).

[0202] This array was synthesized to contain a template for the restriction site of Nb.BstNBI nicking endonuclease at the 22 - nucleotide position from the 5’ end. Another strand that functions as a blocker was a 32 - nucleotide oligonucleotide complementary to nucleotides 34 - 60 of the anchor (sequence TTTAGAATTCAGAAGCAGGTACCATCATTTT InvdT (SEQ ID NO: 7)). The blocker was extended with mismatched poly - T and a 3’ - terminal inverted dT (shown as invdT) to prevent elongation by polymerase.

[0203] The anchor (measured by UV - Vis at 1 μM) and the blocker (measured by UV - Vis at 1.1 μM) were prepared in an appropriate buffer (in this case, 1× NEB isothermal amplification buffer composed of 20 mM Tris - HCl, 10 mM (NH 4 ) 2 SO 4 , 50 mM KCl, 12 mM MgSO 4 , 0.1% Tween® 20, pH 8.8 at 25 °C). The mixture was heated to 80 °C and annealed by slowly cooling at 0.1 °C / second. The blocker strand was added in a 10% molar excess to ensure complete coverage of all template strands. The two - component complex can optionally be separated by gel electrophoresis to remove residual unbound single - stranded DNA.

[0204] The DNA of the second probe was 28 nucleotides in length and was generated by synthesizing a 5’ - biotinylated oligonucleotide (sequence TTTAGAATTCAGAAGCAGGTACCATCAT (SEQ ID NO: 8)) that was the same as the blocker sequence except for the removal of the mismatched poly - T and inverted dT modifications. It was synthesized to hybridize to the same anchor position as the blocker. The DNA B, which is the DNA strand of the second probe, had no significant energetic advantage for displacing the blocker in solution, and the strand - displacement reaction was slow. Therefore, DNA B had no tendency to bind to DNA A in solution.

[0205] Both DNA complexes were bound to the probe (biotin). The sample can be assayed for the presence of the target protein that binds to the probe (avidin). A sample containing 1 μM avidin is added to a reaction buffer containing Bst Large Fragment polymerase and Nb.BsrNBI nicking endonuclease, along with both DNA-probe complexes, under appropriate conditions for enzyme activity (e.g., an appropriate buffer as described above, 0.5 mM each of dATP, dCTP, dTTP, and dGTP, and 500 nM hairpin reporter). The hairpin reporter was an oligonucleotide (sequence ATTGTACTCACGCTACTACAAT (SEQ ID NO: 9)) modified with an AlexaFluor® 488 fluorophore at the 5' end and a BHQ-1® quencher at the 3' end. The hairpin reporter was designed to hybridize to the product, adopt a linear conformation, and increase fluorescence. The reaction buffer also contained 50 nM auxiliary template oligonucleotide (sequence CTCACGCTACGGACGACTCTCTCACGCTAC (SEQ ID NO: 2)). The auxiliary template was designed to reproduce the product exponentially. A leakage threshold oligonucleotide (sequence TTTTTCTCACGCTAC (SEQ ID NO: 10)) was also included at 10 nM. This reacts with the product and inactivates it, suppressing spontaneous exponential initiation in the absence of the target protein. The temperature was raised to 45 °C to initiate the reaction. Control reactions were also prepared in which the components of the reaction were excluded (i.e., the primer, blocker, or avidin was omitted).

[0206] The biotin moiety bound to avidin in solution, bringing DNA A and DNA B into proximity. DNA B displaced the blocker attached to DNA A. This created the active substrate for Bst LargeFragment polymerase. When polymerization was complete, the newly generated double-stranded DNA product contained the recognition site for Nb.BstNBI nicking endonuclease. Nb.BstNBI created a single-strand break, which was recognized by Bst polymerase to displace the single-strand product. Cycling of the endonuclease and polymerase accumulated single-stranded DNA. The single-strand product could function as a primer for the auxiliary template. The auxiliary template functioned in the same way as the template to catalytically generate single-stranded product DNA with the same sequence. As a result, the product accumulated exponentially. The product was detected by an increase in fluorescence due to the binding between the product and the hairpin reporter.

[0207] The reaction was also enclosed in droplets. After preparing the reaction mixture as described above, the sample and reaction buffer were emulsified by rapidly vortexing for 30 seconds in the oil phase (BioRad Droplet Generation Oil for Probes). This generated water-in-oil droplets containing all the reagent components. In some experiments, some droplets contained the target molecule, while some droplets did not contain the target molecule (also called the analyte molecule). The temperature was raised to 45 °C to initiate the reaction. The active substrate for Bst Large Fragment polymerase generated a fluorescent product within the isolated droplets. The inactive droplets showed that there was no active initiator for exponential growth and showed only low levels of fluorescent product. In the limited case where all droplets contained the reaction product, all droplets were fluorescent. The results are shown in Figures 13A - C.

[0208] Figure 13A shows a schematic of the reaction where proximity induces strand displacement to generate an active substrate for polymerase and nickase, which then generates exponential growth. Figure 13B shows the fluorescence detected over time, indicating the proximity effect driven by the binding of the DNA / probe to the target molecule (or target protein). Samples were prepared as follows: 1. water only, 2. positive control (no block) containing template and primer, 3. negative control showing template block, 4. negative control showing template block + primer, 5. experimental sample containing template block, primer, and target protein. The positive control containing template and primer, and the experimental sample showed the highest levels of fluorescence over time. Figure 13C shows an image of the generated fluorescent droplets surrounding the samples. The top three images show brightfield images at the endpoint, and the bottom three images show fluorescent images at the endpoint. The images show the case of non-active template (left), active template (center), and limited cases including all droplets containing reaction products (right). In one embodiment, for example, the following items are provided. (Item 1) A method for digital detection of a protein analyte, comprising dividing a fluid into a plurality of compartmentalized fluid volumes to form a homogeneous assay, some of the plurality of volumes being compartmentalized non-analyte-containing volumes and others of the plurality of volumes being compartmentalized analyte-containing volumes, said dividing; detecting the presence of an analyte within the compartmentalized analyte-containing volume based on an optical signal from the plurality of compartmentalized volumes; wherein the optical signal is induced by a proximity-induced interaction in the compartmentalized analyte-containing volume comprising the analyte and components of the compartmentalized fluid volume While detecting the presence of the optical signal, each fluid of the plurality of compartmentalized fluid volumes consists essentially of the respective compartmentalized fluid volume generated by the partitioning step and the reaction products generated therefrom. The method. (Item 2) Each fluid volume of the plurality of compartmentalized fluid volumes comprises a first probe including a first binding moiety configured to bind to the analyte, the first binding moiety binding to a first nucleic acid molecule; a second probe including a second binding moiety configured to bind to the analyte, the second binding moiety binding to a second nucleic acid molecule; the proximity-induced interaction occurs between the first probe and the second probe when binding to the analyte; the proximity-induced interaction induces an amplification reaction; the optical signal is a fluorescence signal induced by the amplification reaction in the analyte-containing volume. The method according to item 1. (Item 3) The method according to any one of items 1 to 2, further comprising counting the number of volumes in which fluorescence is generated, thereby generating an analyte count of the sample. (Item 4) The method according to item 3, wherein the analyte count is generated based on Poisson statistics. (Item 5) The method according to any one of items 2 to 4, wherein the amplification reaction is an isothermal reaction. (Item 6) The method according to any one of items 2 to 5, wherein the amplification reaction is a digital isothermal reaction. (Item 7) The method according to any one of items 2 to 4, wherein the amplification reaction is a polymerase chain reaction. (Item 8) The method according to any one of items 2 to 4, wherein the amplification reaction is a digital polymerase chain reaction. (Item 9) The method according to any one of items 1 to 8, wherein the method is carried out without ligase. (Item 10) The method according to any one of items 1 to 9, wherein while detecting the presence of the analyte using the optical signal, each of the plurality of compartmentalized volumes consists of each compartmentalized fluid volume generated by the splitting step and the reaction product generated therefrom. (Item 11) The method according to any one of items 1 to 10, wherein after splitting the fluid into the plurality of compartmentalized fluid volumes, each fluid volume is contained within a single container throughout the remainder of the method until the detection of the analyte using the optical signal. (Item 12) The method according to any one of items 1 to 11, wherein the method is carried out without a washing step. (Item 13) The method according to any one of items 1 to 12, wherein the optical signal is an absorption signal or an emission signal. (Item 14) The method according to any one of items 2 to 6 or 8 to 13, wherein both the proximity-induced interaction and the amplification reaction are isothermal reactions. (Item 15) The method according to any one of items 2 to 6 or 8 to 14, wherein both the proximity-induced interaction and the amplification reaction are digital isothermal reactions. (Item 16) The method according to any one of items 2 to 4 or 6 to 13, wherein the proximity-induced interaction is an isothermal reaction and the amplification reaction is a polymerase chain reaction. (Item 17) The method according to any one of items 2 to 4 or 6 to 13, wherein the proximity-induced interaction is a digital isothermal reaction and the amplification reaction is a digital polymerase chain reaction. (Item 18) The method according to any one of items 2 to 13, wherein the proximity-induced interaction is a strand displacement interaction. (Item 19) Prior to said proximity-induced interaction, said second nucleic acid molecule is bound to a non-extendable blocker oligonucleotide, said proximity-induced interaction includes an interaction between said first and second nucleic acids that displaces the blocker oligonucleotide into solution, said amplification reaction includes inducing template polymerization that extends said first nucleic acid molecule after displacement of the blocker oligonucleotide, each fluid volume includes a nicking endonuclease configured to cleave the extended first nucleic acid, enabling release of the nicked portion into solution, The method according to item 18, wherein said fluorescence is induced based on said release of the nicked portion within said analyte-containing volume. (Item 20) said amplification reaction repeatedly extends said first nucleic acid, and said nicking endonuclease repeatedly cleaves the extended first nucleic acid, thereby causing accumulation of nicked nucleic acid strands, each fluid volume includes a plurality of fluorescent moieties configured to bind to the accumulated nicked nucleic acid strands, The method according to item 19, wherein said fluorescence is induced by binding of the fluorescent moieties to the accumulated nicked nucleic acid strands and by irradiating said plurality of volumes with resonance light close to the bound fluorescent moieties, thereby inducing fluorescence from the bound fluorescent moieties. (Item 21) each fluid volume includes a plurality of auxiliary substrates, each of said auxiliary substrates includes an auxiliary nucleic acid strand, said auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby forming an auxiliary nucleic acid complex in solution that includes the nicked portion and the auxiliary nucleic acid strand, The method according to item 19, wherein the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of a part of the extended nicked portion by the nicking endonuclease or polymerase, and the removed extended nicked portion contains a copy of the nicked portion removed first. (Item 22) The method according to item 21, wherein at least a part of the auxiliary substrates are each bound to an auxiliary non-extendable blocker oligonucleotide. (Item 23) The method according to item 22, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide. (Item 24) The method according to item 21, wherein the plurality of auxiliary substrates include an auxiliary substrate designed to bind to the extended nicked portion and non-productively extend it to create a threshold for exponential growth, thereby inactivating it. (Item 25) The method according to any one of items 2 to 4, wherein the amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification. (Item 26) The amplification reaction is rolling circle amplification, The second probe includes a rolling circle amplification substrate containing a circular nucleic acid strand bound to the second nucleic acid molecule, The circular nucleic acid strand includes a first binding site that binds to the first nucleic acid molecule and a second binding site that binds to the second nucleic acid molecule, and the circular nucleic acid strand has an affinity equal to or greater between the first binding site and the first nucleic acid molecule than between the second binding site and the second nucleic acid molecule. The method according to item 25. (Item 27) The method according to item 26, wherein the second binding site comprises one or more mismatched nucleic acids that are not complementary to the corresponding nucleic acid of the second nucleic acid molecule. (Item 28) A method for digital detection of a protein analyte, comprising: dividing a fluid into a plurality of compartmentalized fluid volumes to form a homologous assay, wherein some of the plurality of volumes are compartmentalized non-analyte-containing volumes and others of the plurality of volumes are compartmentalized analyte-containing volumes, and each compartmentalized fluid volume comprises: a first probe comprising a first binding moiety configured to bind to the analyte, wherein the first binding moiety binds to a first nucleic acid molecule, and a second binding moiety configured to bind to the analyte, a second probe comprising the second binding moiety, wherein the second binding moiety binds to a second nucleic acid molecule, further comprising said dividing; causing an amplification reaction in the compartmentalized analyte-containing volume by proximity-induced interaction between the first nucleic acid molecule and the second nucleic acid molecule; detecting the presence of the analyte in the analyte-containing volume based on the amplification reaction; A method comprising: (Item 29) The method according to item 28, wherein the amplification reaction is an isothermal reaction. (Item 30) The method according to item 28, wherein the amplification reaction is a digital isothermal reaction. (Item 31) The method according to item 28, wherein the amplification is a polymerase chain reaction. (Item 32) The method according to item 28, wherein the amplification is a digital polymerase chain reaction. (Item 33) Detecting the presence of the analyte comprises: irradiating the plurality of compartmentalized volumes with light; detecting fluorescence from the compartmentalized analyte-containing volume. The method according to items 28 to 32, comprising (Item 34) The method according to any one of items 28 to 33, wherein the dividing step comprises disposing each of the partitioned fluid volumes in a respective one of a plurality of containers, and each of the partitioned fluid volumes remains in its respective container until the detecting step is performed. (Item 35) The method according to any one of items 28 to 34, wherein the proximity-induced interaction induces an amplification reaction in which the second nucleic acid molecule is extended. (Item 36) The method according to item 35, wherein the second nucleic acid molecule is extended using the first nucleic acid as a template. (Item 37) The method according to item 36, wherein the first nucleic acid molecule binds to a rolling circle substrate prior to the proximity-induced interaction, and the proximity-induced interaction induces the extension of the second nucleic acid molecule using the rolling circle substrate as a template. (Item 38) The method according to any one of items 28 to 37, wherein the first nucleic acid binds to an extensible substrate prior to the proximity-induced interaction, and the proximity-induced interaction releases the extensible substrate into solution. (Item 39) The method according to item 38, wherein the release of the extensible substrate induces an exponential amplification reaction. (Item 40) The exponential amplification reaction is EXPonential Amplification R eaction, the method according to item 39. (Item 41) The method according to any one of items 28 to 40, wherein the proximity-induced interaction induces a hairpin assembly reaction. (Item 42) The method according to any one of items 28 to 41, wherein the proximity-induced interaction generates a catalytic surface composed of a part of the first nucleic acid molecule and the second nucleic acid molecule. (Item 43) The method according to item 42, wherein the fluid comprises an auxiliary substrate bound to an auxiliary non-extendable blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extendable blocker oligonucleotide, thereby inducing an amplification reaction comprising the auxiliary substrate. (Item 44) The method according to item 42, wherein the fluid comprises a rolling circle substrate bound to an auxiliary non-extendable blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extendable blocker oligonucleotide, thereby inducing an amplification reaction comprising the rolling circle substrate. (Item 45) The method according to item 42, wherein the fluid comprises a plurality of folded hairpin molecules, and the catalytic surface catalyzes the unfolding of at least one of the plurality of folded hairpin molecules. (Item 46) A method for detecting the presence of an analyte in a fluid via strand displacement amplification, providing a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first nucleic acid molecule, to a solution in the fluid; providing a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second nucleic acid molecule, to the solution in the fluid, wherein the second nucleic acid molecule binds to a non-extendable blocker oligonucleotide; displacing the non-extendable blocker oligonucleotide into solution by a proximity-induced interaction between the first probe and the second probe; inducing templated polymerization to induce extension of the first nucleic acid molecule; inducing the generation of fluorescence based on the extension of the first nucleic acid molecule; detecting the analyte in the fluid based on fluorescence; comprising the method. (Item 47) The method according to item 46, wherein displacing the non-extendable blocker oligonucleotide comprises binding the first nucleic acid molecule to the second nucleic acid molecule. (Item 48) The method according to item 47, wherein the first nucleic acid molecule is extended using the second nucleic acid as a template. (Item 49) The method according to item 48, further comprising providing in the fluid a nicking endonuclease configured to cleave the extended first nucleic acid and allow release of the nicked portion into the solution. (Item 50) The fluid comprises a plurality of auxiliary substrates, each of the auxiliary substrates comprising an auxiliary nucleic acid strand, the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, and an auxiliary nucleic acid complex is formed in solution comprising the nicked portion and the auxiliary nucleic acid strand, the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of a portion of the extended nicked portion using the nicking endonuclease, and the removed extended nicked portion comprises a copy of the initially removed nicked portion. The method according to item 48. (Item 51) The method according to item 50, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendable blocker oligonucleotide. (Item 52) The method according to item 51, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide. (Item 53) The method according to item 50, wherein the plurality of auxiliary substrates comprises auxiliary substrates designed to bind to the extended nicked portion and non-productively extend it to create a threshold for exponential growth to inactivate it. (Item 54) The method according to any one of items 46 to 53, wherein the analyte is a protein. (Item 55) The method according to any one of items 2 to 53, wherein the first nucleic acid and the second nucleic acid are DNA. (Item 56) A composition for detecting an analyte, a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first nucleic acid molecule, a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second nucleic acid molecule, and a solution containing the same, wherein the second nucleic acid molecule binds to a non-extendable blocker oligonucleotide, the first nucleic acid strand and the second nucleic acid strand comprise corresponding sections of nucleic acids, such that when the first probe and the second probe are brought into proximity by binding to the analyte, the non-extendable blocker oligonucleotide is displaced into the solution by a proximity-induced interaction between the first probe and the second probe, the composition, wherein the participants in the proximity-induced interaction do not bind directly or indirectly to a solid support. (Item 57) The composition according to item 56, wherein the solution further comprises a polymerase for extending the first nucleic acid upon displacement of the non-extendable blocker oligonucleotide by the proximity-induced interaction. (Item 58) The composition according to item 57, wherein the solution further comprises a nicking endonuclease configured to cleave the nicked portion of the extended first nucleic acid and release the nicked portion into the solution. (Item 59) The composition according to item 58, wherein the solution further comprises a fluorescent moiety configured to emit fluorescence in response to accumulation of nucleic acids when irradiated. (Item 60) The solution further comprises a plurality of auxiliary substrates, each of the auxiliary substrates comprising an auxiliary nucleic acid strand, the auxiliary nucleic acid strand being configured to bind to the nicked portion of the extended first nucleic acid so as to form an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand, the auxiliary nucleic acid complex being configured to extend the nicked portion and repeatedly induce removal of a portion of the extended nicked portion by the nicking endonuclease, the removed extended nicked portion comprising a copy of the initially removed nicked portion, The composition according to item 59. (Item 61) The composition according to item 60, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendable blocker oligonucleotide. (Item 62) The composition according to item 61, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide. (Item 63) The composition according to item 60, wherein the plurality of auxiliary substrates comprises an auxiliary substrate designed to bind to the extended nicked portion and non-productively extend it to create a threshold for exponential growth to inactivate it. (Item 64) A system for digital detection of an analyte, a plurality of fluid volumes each disposed in a plurality of compartments, some of the plurality of fluid volumes being compartmentalized non-analyte-containing volumes and others of the plurality of fluid volumes being compartmentalized analyte-containing volumes, the plurality of fluid volumes, and each of the fluid volumes comprising a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first nucleic acid molecule, Each second probe of the fluid volume, comprising a second binding moiety configured to bind to the analyte, wherein the second binding moiety is conjugated to a second nucleic acid molecule, A light source configured to irradiate the fluid volume within the image and induce fluorescence in response to an amplification reaction induced by a proximity-induced interaction between the first probe and the second probe, wherein the interaction occurs upon binding of the first probe and the second probe to the analyte sample in the solution within the compartment, The system comprising the same. (Item 65) The system according to item 64, wherein the amplification reaction is an isothermal reaction. (Item 66) The system according to item 64, wherein the amplification reaction is a digital isothermal reaction. (Item 67) The system according to item 64, wherein the amplification reaction is a polymerase chain amplification reaction. (Item 68) The system according to item 64, wherein the amplification reaction is a digital polymerase chain reaction. (Item 69) The system according to any one of items 64 to 68, further comprising a detector configured to detect the fluorescence from the compartmentalized analyte-containing volume and generate a count of the analyte sample based on the detection of the fluorescence. (Item 70) The system according to any one of items 64 to 69, wherein the amplification reaction comprises template-directed polymerization. (Item 71) The system according to any one of items 64 to 70, wherein the amplification reaction comprises a cascade dequenching reaction. (Item 72) The system according to any one of items 64 to 71, wherein the proximity-induced interaction is a strand displacement interaction. (Item 73) The method according to any one of items 64 to 71, wherein the proximity-induced interaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, and proximity-induced rolling circle amplification. (Item 74) The system according to any one of items 64 to 73, wherein the system is configured to divide a fluid to generate the plurality of fluid volumes, and the system is further configured to maintain each of the plurality of fluid volumes as an essentially closed fluid system until detection of fluorescence induction when the fluid is divided. (Item 75) A method for analyte detection, comprising: providing a fluid containing an analyte; providing a first probe, which includes a first binding moiety configured to bind to the analyte and the first binding moiety is conjugated to a first DNA molecule, into a solution in the fluid; providing a second probe, which includes a second binding moiety configured to bind to the analyte and the second binding moiety is conjugated to a second DNA molecule containing an RNA polymerase binding site, into a solution in the fluid, wherein the second DNA molecule binds to a blocker oligonucleotide that blocks the RNA polymerase binding site; binding the first binding moiety and the second binding moiety to a common analyte, thereby bringing the first probe and the second probe into proximity; displacing the blocker oligonucleotide into the solution by proximity-induced mutual binding of the first probe and the second probe; using RNA polymerase to induce transcription of RNA from the second DNA molecule; inducing generation of fluorescence based on the transcribed RNA; detecting the presence of the analyte in the fluid based on the fluorescence; and the method includes the above steps. (Item 76) The method according to item 75, further comprising amplifying the transcribed RNA using nucleic acid sequence-based amplification. (Item 77) The method according to any one of items 75 to 76, wherein the analyte is a protein. (Item 78) The method according to any one of items 75 to 77, wherein the method is performed as a homogeneous assay. (Item 79) The method according to item 78, wherein the method is performed as a digital assay. (Item 80) A composition for detecting an analyte, A first probe comprising a first binding moiety configured to bind to the analyte, wherein the first binding moiety conjugates to a first DNA molecule, A second probe comprising a second binding moiety configured to bind to the analyte, wherein the second binding moiety conjugates to a second DNA molecule comprising an RNA polymerase binding site, wherein the second DNA molecule binds to a blocker oligonucleotide that blocks the RNA polymerase binding site, the second probe, RNA polymerase, A fluorescent moiety, Comprising a solution containing, The first binding DNA and the second binding DNA molecule are configured to generate a proximity-based interaction when the first binding moiety and the second binding moiety bind to a common analyte and are in proximity, and the proximity-based interaction displaces the blocker oligonucleotide into the solution, enabling the RNA polymerase to transcribe RNA using the second DNA molecule as a template. The composition. (Item 81) The composition according to item 80, wherein the fluid further comprises reverse transcriptase, RNAse H, nucleotide triphosphates, deoxynucleotide triphosphates, and DNA primers for amplifying the RNA transcribed using nucleic acid sequence-based amplification. (Item 82) The composition according to any one of items 80 to 81, wherein the fluorescent moiety is a fluorescent dye. (Item 83) The composition according to any one of items 80 to 81, wherein the fluorescent moiety is a fluorescent nanoparticle. (Item 84) The composition according to any one of items 56 to 59 and 80 to 83, further comprising a threshold oligonucleotide. (Item 85) The method according to any one of items 1 to 45, wherein the plurality of compartmentalized fluid volumes comprise a plurality of auxiliary substrates. (Item 86) The method according to item 85, wherein the plurality of auxiliary substrates comprise an auxiliary substrate that binds to an amplification product oligonucleotide. (Item 87) The method according to item 86, wherein the auxiliary substrate that binds to the amplification product oligonucleotide inactivates the amplification product oligonucleotide. (Item 88) The method according to item 87, wherein the inactivation of the amplification product oligonucleotide comprises non-productively extending the amplification product oligonucleotide. (Item 89) The method according to item 88, wherein non-productively extending the amplification product oligonucleotide creates a threshold for exponential growth. (Item 90) The method according to item 85, wherein the plurality of auxiliary substrates comprise an auxiliary substrate that binds to an amplification product oligonucleotide, inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, and creates a threshold for exponential growth. (Item 91) The system according to any one of items 64 to 74, wherein the plurality of compartmentalized fluid volumes comprise a plurality of auxiliary substrates. (Item 92) The system according to item 91, wherein the plurality of auxiliary substrates comprise an auxiliary substrate that binds to an amplification product oligonucleotide. (Item 93) The system according to item 92, wherein the auxiliary substrate that binds to the amplification product oligonucleotide inactivates the amplification product oligonucleotide. (Item 94) The system according to item 93, wherein the inactivation of the amplification product oligonucleotide includes non-productively extending the amplification product oligonucleotide. (Item 95) The system according to item 94, wherein non-productively extending the amplification product oligonucleotide creates a threshold for exponential growth. (Item 96) The system according to item 91, wherein the plurality of auxiliary substrates includes an auxiliary substrate that binds to the amplification product oligonucleotide, inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, and creates a threshold for exponential growth.

Claims

[Claim 1] The invention described in this specification.

Images