Methods and compositions for activating tumor cell cytotoxicity via human gamma-delta t cells

Abstract

To provide methods and compositions for activating tumor cell cytotoxicity via human gamma-delta T cells.SOLUTION: The disclosure generally relates to methods and compositions for activating gamma-delta (GD) T cells. Such methods and compositions can be used to treat cancer. Disclosed is a virus vector comprising a first and second encoded genetic elements, where the first encoded genetic element comprises at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second genetic element comprises one of a butyrophilin family member, a cytokine or a chemokine.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 521,274, entitled "Methods and Compositions for the Activation of Tumor Cytotoxicity Via Human Gamma - Delta T - Cells", filed on June 16, 2017, and U.S. Provisional Patent Application No. 62 / 633,461, entitled "Methods and Compositions for the Activation of Tumor Cytotoxicity Via Human Gamma - Delta T - Cells", filed on February 21, 2018, and these provisional applications are hereby incorporated by reference into this specification, respectively.

[0002] Field The present disclosure generally relates to the fields of gene therapy and immunotherapy, and specifically to the fields of gene therapy and immunotherapy related to increased activation and effector cell function of gamma - delta ("GD") T cells.

Background Art

[0003] Human T cells are distinguished based on the structure of the T cell receptor. The major populations, including the CD4+ and CD8+ subsets, express receptors composed of an alpha chain and a beta chain. A smaller subset expresses T cell receptors made from a gamma chain and a delta chain. Gamma delta (γδ, "GD") T cells constitute 3 - 10% of circulating lymphocytes, and the Vδ2+ subset makes up 75% of the GD T cells in the blood. Vδ2+ cells recognize non - peptide epitopes and do not require antigen presentation by the major histocompatibility complex ("MHC") or human leukocyte antigen ("HLA"). Most Vδ2+ T cells also express the Vγ9 chain and are stimulated by exposure to 5 - carbon pyrophosphate compounds, which are intermediates in the mevalonate and non - mevalonate sterol / isoprenoid synthetic pathways. The response to isopentenyl pyrophosphate (5 - carbon) is nearly universal in healthy humans.

[0004] Another subset of GD T cells, Vδ1+, constitutes a much smaller percentage of the T cells circulating in the blood, but Vδ1+ cells are most commonly found in epithelial mucosa and the skin. Small cell populations express other Vδ chains and can be associated with specific responses between allergy, transplantation, or viral and bacterial diseases.

[0005] Generally, GD T cells have several functions such as the killing of tumor cells and pathogen - infected cells. Stimulation through their unique T cell receptor ("TCR"), which is composed of two glycoprotein chains, gamma and delta, interacts with the CD3 complex proteins to generate a functional TCR and enhance the ability for cytotoxicity, cytokine secretion, and other effector functions. The TCR of GD T cells has unique specificities and, because the cells themselves occur with a high clonal frequency, allows for a rapid innate - like response to tumors and pathogens.

[0006] Bisphosphonate drugs, and other inhibitors of farnesyl diphosphate synthase ("FDPS") downstream of isopentenyl pyrophosphate ("IPP") in the mevalonate pathway (see, e.g., FIG. 1), have been used to treat various diseases, such as cancer, specifically cancer with bone metastases. Examples of bisphosphonate drugs include trade names such as Zometa® (Novartis), Actonel® (Procter & Gamble), Aredia® (Novartis) and Fosamax® (Merck).

[0007] Certain bisphosphonates have also been studied for their ability to stimulate γδ T cells. This is because inhibition of FDPS in myeloid cells or tumor cells blocks the conversion of IPP to farnesyl diphosphate, causing the accumulation of IPP, while at the same time reducing the levels of geranylgeranyl pyrophosphate ("GGPP"), a downstream product of FDPS that normally suppresses the activation of the NLRP3 inflammasome pathway. The reduction of GGPP removes an inhibitor of the caspase-dependent inflammasome pathway, allowing the secretion of cytokines such as interleukin-1 beta and interleukin-18, and interleukin-18 is particularly important for γδ T cell activation.

[0008] Thus, when FDPS is blocked, the increased IPP and decreased GGPP modify bone marrow cells or tumor cells, and the modified cells acquire an increased ability to activate γδ T cells, specifically the Vδ2+ subset. The activated Vδ2+ cells can rapidly proliferate, express a number of cytokines and chemokines, and function to cytolytically destroy tumor cells or pathogen-infected cells. γδ T cell effector activities include the secretion of IFN-γ that activates macrophages and antigen-presenting cells, the secretion of TNF-α among other cytokines and chemokines that activate other innate and adaptive immune mechanisms, the activation of granzyme B that attacks and destroys target cells, and the cell surface expression of FasL that induces apoptosis in Fas+ target cells.

[0009] A major problem associated with traditional cancer treatment is that patients become insensitive to chemotherapy treatment. Chemotherapy-resistant tumor cells are particularly difficult to treat. As an alternative therapy for treating chemotherapy-resistant patients or as a primary therapy instead of chemotherapy and / or radiotherapy, the present application proposes the use of recombinant lentivirus for expressing a gene at the tumor site, and manipulation of proteins that affect γδ T cell activity can slow tumor growth and activate the patient's own innate immune response to recognize and kill cancer.

Summary of the Invention

Means for Solving the Problems

[0010] In one aspect of the present disclosure, a viral vector is disclosed that includes first and second encoded gene elements. The first encoded gene element includes at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second encoded gene element includes one of a butyrophilin family member, a cytokine, or a chemokine. In embodiments, the viral vector also includes a third encoded gene element, which includes one of a butyrophilin family member, a cytokine, or a chemokine. In embodiments, the viral vector also includes a fourth encoded gene element, which includes one of a butyrophilin family member, a cytokine, or a chemokine. In embodiments, the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta isomerase 1 (IDI1), or farnesyl transferase (F-Tase). In embodiments, the first encoded gene element includes a microRNA or shRNA.

[0011] In embodiments, the microRNA

Chemical formula

[0012] In embodiments, the microRNA

Chemical formula

[0013] In embodiments, the shRNA GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); It includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% or more than 95% identity percentage with GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 4). In an embodiment, the shRNA includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% or more than 95% identity percentage with SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 76.

[0014] In an embodiment, the shRNA is GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or It contains GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 4). In an embodiment, the shRNA contains SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 76.

[0015] In an embodiment, the butyrophilin family member contains BTN3A3, BTN3A2, or BTN3A1 or variants thereof. In an embodiment, the butyrophilin family member contains BTN3A3 (R381H). In an embodiment, the cytokine contains IL-1, IL-1β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, TNF-α, or interferon-γ. In an embodiment, the chemokine contains a CC chemokine, a CXC chemokine, a CX3C chemokine, a C chemokine, or an XC chemokine. In a further embodiment, the CC chemokine contains RANTES. In an embodiment, the viral vector is a lentiviral vector.

[0016] In another aspect, a lentiviral vector system for expressing lentiviral particles is disclosed. The system contains a lentiviral vector as detailed herein; at least one envelope plasmid for expressing an envelope protein optimized for infecting target cells; and at least one helper plasmid for expressing the gag, pol, and rev genes, and when the lentiviral vector, at least one envelope plasmid, and at least one helper plasmid are transfected into packaging cells, lentiviral particles are produced by the packaging cells, and the lentiviral particles can infect target cells and inhibit at least one enzyme involved in the mevalonate pathway within the target cells.

[0017] In another aspect, lentiviral particles capable of infecting target cells are disclosed. The lentiviral particles include an envelope protein optimized for infecting the target cells and a lentiviral vector as detailed herein. In embodiments, the target cells are cancer cells.

[0018] In another aspect, a method of activating gamma delta (GD) T cells is disclosed. The method includes infecting or having infected target cells with lentiviral particles in the presence of GD T cells, the lentiviral particles including a viral vector comprising first and second encoded gene elements, the first encoded gene element including at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, the second encoded gene element including one of a butyrophilin family member, a cytokine, or a chemokine, wherein the target cells activate the GD T cells when at least one enzyme is inhibited in the target cells. In embodiments, the target cells are cancer cells. In embodiments, the method further includes contacting or having contacted the target cells and the GD T cells with an amount of an aminobisphosphonate drug. In embodiments, the aminobisphosphonate drug is zoledronic acid. In embodiments, the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta-isomerase 1 (IDI1), or farnesyl transferase (F-Tase).

[0019] In another aspect, a method of treating cancer in a subject is disclosed. The method comprises administering or having administered to the subject a therapeutically effective amount of lentiviral particles, wherein the lentiviral particles comprise a viral vector containing first and second encoded gene elements, the first encoded gene element comprising at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, the second encoded gene element comprising one of a butyrophilin family member, a cytokine, or a chemokine, wherein when at least one enzyme is inhibited in cancer cells in the presence of γδ T cells, the target cells activate the γδ T cells, thereby treating the cancer. In embodiments, the method further comprises contacting or having contacted the target cells and γδ T cells with an amount of an aminobisphosphonate drug. In embodiments, the aminobisphosphonate drug is zoledronic acid. In embodiments, the butyrophilin family member comprises BTN3A3 (SEQ ID NO: 17) or BTN3A3(R381H) (SEQ ID NO: 54). In further embodiments, the cytokine comprises IL-1, IL-2, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36.

[0020] In another aspect, a viral vector is disclosed. The viral vector includes a first small RNA capable of targeting a first target of the mevalonate pathway to increase a first product of the mevalonate pathway, and a second small RNA capable of targeting a second target of the mevalonate pathway to decrease a second product of the mevalonate pathway. In embodiments, the first target is a first enzyme of the mevalonate pathway, and the second target is a second enzyme of the mevalonate pathway. In embodiments, at least one of the first enzyme and the second enzyme includes farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta-isomerase 1 (IDI1), or farnesyl transferase (F-Tase). In embodiments, the first product of the mevalonate pathway includes isopentenyl pyrophosphate (IPP). In embodiments, the second product of the mevalonate pathway includes geranylgeranyl pyrophosphate (GGPP).

[0021] In another aspect, a method of treating cancer in a subject is disclosed. The method includes administering or having administered to the subject a therapeutically effective amount of lentiviral particles, the lentiviral particles including a viral vector as described herein. In embodiments, the method further includes administering or having administered to the subject a therapeutically effective amount of an aminobisphosphonate drug. In certain embodiments, for example, the following are provided: (Item 1) A viral vector comprising first and second encoded gene elements, wherein the first encoded gene element comprises at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second encoded gene element comprises one of a butyrophilin family member, a cytokine, or a chemokine. (Item 2) Further comprising a third encoded gene element, wherein the third encoded gene element comprises one of butyrophilin family members, cytokines, or chemokines, the viral vector according to item 1. (Item 3) Further comprising a fourth encoded gene element, wherein the fourth encoded gene element comprises one of butyrophilin family members, cytokines, or chemokines, the viral vector according to item 2. (Item 4) The at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta isomerase 1 (IDI1), or farnesyl transferase (F-Tase), the viral vector according to item 1. (Item 5) The first encoded gene element comprises microRNA or shRNA, the viral vector according to item 1. (Item 6) The microRNA is a) AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 68); or b) AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 69) And having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity, the viral vector according to item 5. (Item 7) The microRNA is a) AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 68); or b) AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 69) The viral vector according to item 6, comprising the same. (Item 8) The shRNA is a) GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); b) GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); c) GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); d) GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 4); e) ACTTTCTCAGCCTCCTTCTGCCTCGAGGCAGAAGGAGGCTGAGAAAGTTTTTT (SEQ ID NO: 64); f) GCAGAAGGAGGCTGAGAAAGTGAGCTCACTTTCTCAGCCTCCTTCTG (SEQ ID NO: 65); g) GCAGAAGGAGGCTGAGAAAGTTTACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 66); or h) GCAGAAGGAGGCTGAGAAAGTACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 67) The viral vector according to item 5, comprising an array having an identity percentage of at least 80%, or at least 85%, or at least 90%, or at least 95%. (Item 9) wherein the shRNA is a) GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); b) GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); c) GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); d) GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 4); e) ACTTTCTCAGCCTCCTTCTGCCTCGAGGCAGAAGGAGGCTGAGAAAGTTTTTT (SEQ ID NO: 64); f) GCAGAAGGAGGCTGAGAAAGTGAGCTCACTTTCTCAGCCTCCTTCTG (SEQ ID NO: 65); g) GCAGAAGGAGGCTGAGAAAGTTTACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 66); or h) GCAGAAGGAGGCTGAGAAAGTACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 67) The viral vector according to item 8, comprising (Item 10) The viral vector according to item 1, wherein the butyrophilin family member comprises BTN3A3, BTN3A2, or BTN3A1. (Item 11) The viral vector according to item 1, wherein the butyrophilin family member comprises BTN3A3 (R381H). (Item 12) The viral vector according to item 1, wherein the cytokine comprises IL-1, IL-1β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, TNF-α, or interferon-γ. (Item 13) The viral vector according to item 1, wherein the chemokine comprises a CC chemokine, a CXC chemokine, a CX3C chemokine, a C chemokine, or an XC chemokine. (Item 14) The viral vector according to item 13, wherein the CC chemokine comprises RANTES. (Item 15) The viral vector according to any one of item 1, which is a lentiviral vector. (Item 16) A lentiviral vector system for expressing lentiviral particles, comprising: The lentiviral vector according to item 15; At least one envelope plasmid for expressing an envelope protein optimized for infecting target cells; and At least one helper plasmid for expressing the gag, pol, and rev genes wherein when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into packaging cells, the lentiviral particles are produced by the packaging cells, the lentiviral particles can infect the target cells, and the lentiviral particles can inhibit the at least one enzyme involved in the mevalonate pathway in the target cells. Lentiviral vector system. (Item 17) A lentiviral particle capable of infecting a target cell, comprising an envelope protein optimized for infecting the target cell and the lentiviral vector according to item 15. (Item 18) The lentiviral particle according to item 17, wherein the target cell is a cancer cell. (Item 19) A method for activating gamma-delta (GD) T cells, comprising: in the presence of the GD T cells, infecting or having infected a target cell with a lentiviral particle, wherein the lentiviral particle comprises a viral vector containing first and second encoded gene elements, wherein the first encoded gene element comprises at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second encoded gene element comprises one of a butyrophilin family member, a cytokine, or a chemokine, wherein when the at least one enzyme is inhibited in the target cell, the target cell activates the GD T cells. Method. (Item 20) The method according to item 19, wherein the target cell is a cancer cell. (Item 21) The method according to item 19, further comprising contacting or having contacted the target cell and the GD T cells with an amount of an aminobisphosphonate drug. (Item 22) The method according to item 21, wherein the aminobisphosphonate drug is zoledronic acid. (Item 23) The method according to item 19 or item 21, wherein the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta-isomerase 1 (IDI1), or farnesyl transferase (F-Tase). (Item 24) A method of treating cancer in a subject, the method comprising administering or having administered to the subject a therapeutically effective amount of lentiviral particles, the lentiviral particles comprising a viral vector comprising first and second encoded gene elements, the first encoded gene element comprising at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, the second encoded gene element comprising one of a butyrophilin family member, a cytokine, or a chemokine, wherein when the at least one enzyme is inhibited in cancer cells in the presence of γδ T cells, the target cells activate the γδ T cells, thereby treating the cancer. (Item 25) The method according to item 24, further comprising administering or having administered to the subject a therapeutically effective amount of an aminobisphosphonate drug. (Item 26) The method according to item 25, wherein the aminobisphosphonate drug is zoledronic acid. (Item 27) The method according to item 24 or item 25, wherein the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta isomerase 1 (IDI1), or farnesyl transferase (F-Tase). (Item 28) The method according to item 24, wherein the butyrophilin family member comprises BTN3A3 or BTN3A3(R381H). (Item 29) A first small RNA capable of increasing a first product of the mevalonate pathway by targeting a first target of the mevalonate pathway; and A second small RNA capable of decreasing a second product of the mevalonate pathway by targeting a second target of the mevalonate pathway comprising a viral vector. (Item 30) The viral vector according to item 29, wherein the first target is the first enzyme of the mevalonate pathway and the second target is the second enzyme of the mevalonate pathway. (Item 31) The viral vector according to item 30, wherein at least one of the first enzyme and the second enzyme comprises farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1 (GGPS1), isopentenyl diphosphate delta isomerase 1 (IDI1), or farnesyl transferase (F-Tase). (Item 32) The viral vector according to item 29, wherein the first product of the mevalonate pathway comprises isopentenyl pyrophosphate (IPP). (Item 33) The viral vector according to item 29, wherein the second product of the mevalonate pathway comprises geranylgeranyl pyrophosphate (GGPP). (Item 34) A method of treating cancer in a subject, the method comprising administering or having administered to the subject a therapeutically effective amount of lentiviral particles, wherein the lentiviral particles comprise the viral vector according to item 29. (Item 35) The method according to item 34, further comprising administering or having administered to the subject a therapeutically effective amount of an aminobisphosphonate drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0022]

Figure 1

[0023]

Figure 2

[0024]

Figure 3

[0025]

Figure 4

[0026]

Figure 5

[0027]

Figure 6

[0028]

Figure 7

[0029]

Figure 8

[0030]

Figure 9

[0031]

Figure 10

[0032]

Figure 11

[0033]

Figure 12

[0034]

Figure 13

[0035]

Figure 14

[0036]

Figure 15

[0037]

Figure 16

[0038]

Figure 17

[0039]

Figure 18

[0040]

Figure 19A

Figure 19B

[0041]

Figure 20

[0042]

Figure 21

[0043]

Figure 22

[0044]

Figure 23

[0045]

Figure 24

[0046]

Figure 25

[0047]

Figure 26

[0048]

Figure 27

[0049]

Figure 28

[0050]

Figure 29

[0051]

Figure 30

Mode for Carrying Out the Invention

[0052] Summary of the Disclosure The present disclosure relates to constructs for gene therapy and delivery of such constructs to cells, where the delivery results in suppression of farnesyl diphosphate synthase (“FDPS”) or other enzymes of the mevalonate pathway necessary to convert isopentenyl phosphate (IPP) to farnesyl diphosphate (FDP) and other downstream products of the mevalonate pathway, as shown, for example, in FIG. 1. In embodiments, one or more viral vectors are provided having microRNAs or short hairpin RNAs (shRNAs) that target one or more of FDPS, GGPS1, IDI1, F-Tase, or squalene synthase, thereby reducing the expression levels of these enzymes. Viral vectors include lentiviral vectors and AAV vectors. The consequence of modulating the expression of FDPS and other enzymes of the mevalonate pathway is to increase the accumulation of IPP, a stimulator of γδ T cell proliferation and differentiation. The consequence of modulating the expression of GGPS1 and other enzymes of the mevalonate pathway is to decrease GGPP levels and enable the secretion of cytokines such as interleukin-1 beta and interleukin-18. Thus, the constructs provided herein are used to activate γδ T cells and are used to treat cancer and infectious diseases.

[0053] Definitions and Interpretations Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure have the meanings commonly understood by one of ordinary skill in the art. Further, unless the context otherwise requires, the singular terms shall include the plural and the plural shall include the singular. In general, the academic terms and techniques used in connection with the culturing of cells and tissues, molecular biology, immunology, microbiology, genetics, and the chemistry and hybridization of proteins and nucleic acids described herein are well known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods described in various general and more specific references cited and discussed throughout this specification, which are well known in the art, unless otherwise described. For example, Sambrook J. and Russell D., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John&Sons, Inc. (2002); Harlow and Lane, Using Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John&Sons, Inc. (2003). Any enzyme reaction or purification technique is performed according to the manufacturer's specifications, as commonly practiced in the art or as described herein. The academic terms, as well as the experimental procedures and techniques, used in connection with analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry described herein are well known and commonly used in the art.

[0054] As used in this specification and the appended claims, the singular forms "a", "an", and "the" are used interchangeably and are intended to include the plural forms as well, and to be included within the scope of each meaning, unless the context clearly indicates otherwise. Also, as used herein, "and / or" refers to all possible combinations of one or more of the listed items, as well as, when interpreted as an option ("or"), not to be combined, and includes these.

[0055] For example, all numerical specifications such as ranges, such as pH, temperature, time, concentration, and molecular weight, are approximate values that vary by increments of 0.1 in either the positive (+) or negative (-) direction. Although not always explicitly stated, it should be understood that all numerical specifications are preceded by the term "about". The term "about" includes not only small increments of "X" such as "X + 0.1" or "X - 0.1", but also the exact value of "X". Although not always explicitly stated, it should also be understood that the reagents described herein are merely exemplary, and that equivalents of such are known in the art.

[0056] As used herein, the term "about" is understood by those skilled in the art and varies to some extent depending on the context in which it is used. When a term that is not clear to those skilled in the art is used considering the context in which it is used, "about" means plus or minus 10% of the particular term.

[0057] As used herein, the term "administer" or "administering" refers to giving an active agent to a subject in need of treatment in a therapeutically useful form and in a form that can be introduced into the body of that individual in a therapeutically effective amount.

[0058] As used herein, the term "butyrophilin 3A" may also be referred to as "BTN3A" herein. Further, "butyrophilin 3A1" may also be referred to as "BTN3A1" herein and may include the BTN3A1 portion of SEQ ID NO: 53. Butyrophilin 3A3 may also be referred to as "BTN3A3" (SEQ ID NO: 17) herein. Variants of BTN3A3 include, but are not limited to, BTN3A3(R381H) and may include the BTN3A3 portion of SEQ ID NO: 54 or SEQ ID NO: 55 or SEQ ID NO: 59. Reference to "R381H" is a reference to an arginine (R) amino acid substituted by a histidine (H) amino acid at amino acid position 381. This convention for defining amino acid substitutions may be used for other positions and other amino acids herein.

[0059] As used herein, the term "CA19-9" refers to carbohydrate antigen 19-9. As used herein, the term "CC chemokine" refers to a class of chemokine proteins characterized by having two adjacent cysteines near the amino terminus. The term "CXC chemokine" refers to a class of chemokine proteins characterized by having two cysteines separated by only 1 amino acid near the amino terminus. The term "CX3C chemokine" refers to a class of chemokine proteins characterized by having two cysteines separated by 3 amino acids near the amino terminus. The term "XC chemokine" refers to a class of chemokine proteins characterized by having one cysteine adjacent to an amino acid near the amino terminus.

[0060] As used herein, the term "CD" refers to cluster of differentiation protein. Examples of such proteins include, but are not limited to, CD4 and CD8. For example, reference to CD4+ indicates that the expression of the CD4 protein is positive.

[0061] As used herein, the term "CEA" refers to carcinoembryonic antigen.

[0062] As used herein, the terms "bisphosphonate" and "bisphosphonate drug" refer to therapeutic agents of various embodiments, including aminobisphosphonates, diphosphonates, biphosphonic acids, and diphosphonic acid and, in addition to any of these, their pharmaceutically acceptable salts and derivatives. The use of a particular nomenclature in referring to bisphosphonates is not intended to limit the scope of the invention unless specifically indicated.

[0063] As used herein, terms such as "co - administration" or "combined administration" or "combination" or "combination therapy" refer to the administration of a therapeutic vector or lentiviral particle and a bisphosphonate drug or any combination thereof, as utilized herein, to a single subject (e.g., patient) in need thereof, including treatment regimens where the agents are not necessarily administered by the same route of administration and / or simultaneously.

[0064] As used herein, the term "fixed combination" refers to two or more active ingredients or components, e.g., a therapeutic vector or lentiviral particle and a bisphosphonate drug or any combination thereof, which are administered to a patient essentially in combination, e.g., essentially simultaneously, in the form of a single entity or dosage or a combined entity or dosage, such as in one tablet or one capsule or a combined tablet or capsule or a combined liquid form.

[0065] As used herein, the term "non-fixed combination" refers to two or more active ingredients or active components, such as a therapeutic vector or lentiviral particle and a bisphosphonate drug or any combination thereof, which are administered to a patient as separate entities either simultaneously, concurrently or sequentially without a specific time limit, and such administration provides a therapeutically effective level of the active ingredient(s) in the patient. The non-fixed combination can be administered independently of each other or, for example, by using different fixed combinations simultaneously or at different times. The active ingredients can be administered as separate pharmaceutical dosage forms or pharmaceutical formulations that can be sold independently of each other, with or without label instructions regarding the possibility of combination, such as in a package insert like a leaflet or in other information provided, for example, to physicians and medical staff. Each active ingredient or active component, or portions thereof, including any of the non-fixed combination, each composition, formulation or pharmaceutical form, can be administered simultaneously or at staggered time intervals, for example, at equal or different time intervals for any portion of the administration at different times. Such time intervals can be selected such that the effect on the disease being treated is more effective when treated in combination than when obtained by using only any one of the active ingredients.

[0066] As used herein, the terms "combination", "in combination" and "combination therapy" can generally refer to either or both of the above definitions and embodiments of "fixed combination" and "non-fixed combination".

[0067] As used herein, the transitional term "comprising", when used to define compositions and methods, means that the compositions and methods include the recited elements but do not exclude others. As used herein, "consisting essentially of", when used to define compositions and methods, means that the compositions and methods include those additional elements only when the additional elements do not substantially affect the basic and novel characteristics of the composition or method. As used herein, "consisting of", when used to define compositions and methods, means that the compositions and methods exclude more than trace amounts of elements of other components for the composition and the physical method steps. Embodiments defined by each of these transitional phrases are within the scope of the present disclosure. For example, methods and compositions are intended to include additional steps and components (comprising), or to include non-essential steps and compositions (consisting essentially of), or to contemplate only the recited method steps or compositions (consisting of).

[0068] As used herein, the terms "expression", "expressed", or "encoding" refer to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Expression can include splicing of mRNA in eukaryotic cells or other forms such as post-transcriptional or post-translational modifications.

[0069] As used herein, the term "farnesyl diphosphate synthase" may also be referred to herein as FDPS and may also be referred to herein as farnesyl pyrophosphate synthase or FPPS.

[0070] As used herein, the term "gamma delta T cell" is referred to herein as γδ It can also be referred to as T cells, Vγ9Vδ2 T cells, V gamma 9V delta 2 T cells, Vγ2Vδ2 T cells, V gamma 2V delta 2 T cells, or further as GD T cells. The term "gamma delta T cell activation" refers to a representative measurable biological phenomenon of activated gamma delta T cells and any such T cells. Non-limiting examples of such biological phenomena include an increase in cytokine production, a qualitative or quantitative change in the composition of cell surface proteins, an increase in T cell proliferation, and / or an increase in T cell effector functions such as killing target cells or assisting other effector cells in killing target cells.

[0071] As used herein, the term "F-Tase" refers to farnesyl transferase.

[0072] As used herein, the term "GGPP" refers to geranylgeranyl pyrophosphate and may also be referred to as geranylgeranyl diphosphate herein.

[0073] As used herein, the terms "GGDPS", "GGPPS", "GGDPS1", "GGPS1" and "GGPPS1" refer to geranylgeranyl diphosphate synthase 1 and may also be referred to as geranylgeranyl pyrophosphate synthase or geranylgeranyl diphosphate synthase herein.

[0074] As used herein, the term "HER-2" refers to human epidermal growth factor receptor 2.

[0075] As used herein, cytokines such as "interleukin 2" may also be referred to as "IL-2", "IL2", etc. IL-2 may also include a reference to SEQ ID NO: 56. In a related manner, "interleukin 15" may also include a reference to SEQ ID NO: 57. In a related manner, "interleukin 18" may also include a reference to SEQ ID NO: 58. In a related manner, "interleukin 23" may also include a reference to SEQ ID NO: 60. In a related manner, "interleukin 36" may also include a reference to any of SEQ ID NOS: 61-63. Generally, the prefix "IL" refers to interleukin.

[0076] As used herein, the term "IDI1" refers to isopentenyl diphosphate delta isomerase 1.

[0077] As used herein, the term "IFN" refers to interferon, and the terms "IFN-gamma" and "IFN-γ" refer to interferon-gamma.

[0078] As used herein, the terms "individual", "subject", and "patient" are used interchangeably herein and refer to any individual mammalian subject, e.g., bovine, canine, feline, equine, and / or human.

[0079] As used herein, the term "IPP" refers to isopentenyl pyrophosphate.

[0080] As used herein, the term "M2-PK" refers to pyruvate kinase isoenzyme M2.

[0081] As used herein, the term "MHC" refers to the major histocompatibility complex.

[0082] As used herein, the term "miRNA" refers to microRNA and may also be referred to as "miR" herein.

[0083] As used herein, the terms "NK cell" or "NK receptor family" refer to "natural killer cell" or "natural killer cell receptor family", respectively.

[0084] As used herein, the term "packaging cell line" refers to any cell line that can be used to express lentiviral particles.

[0085] As used herein, the term "PBMC" refers to peripheral blood mononuclear cells.

[0086] As used herein, the term "homology" refers to the percentage of amino acids, nucleic acids, or analogs thereof that are identical or that constitute conservative substitutions. Homology can be determined using a sequence comparison program such as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this method, sequences of similar or substantially different lengths as the sequences cited herein may be compared by insertion of gaps into the alignment, and such gaps are determined, for example, by the comparison algorithm used by GAP.

[0087] As used herein, the term "sequence identity" can be seen, as well as in similar phrasings used herein, in the non-limiting context of a "sequence 50% identical" to a given sequence and a given sequence having "at least 80%, or at least 85%, or at least 90%, or at least 95% identity", and refers to the degree to which the sequences are identical on a per nucleotide or per amino acid basis over a comparison window. Thus, the "percentage of sequence identity" can be calculated by comparing two optimally aligned sequences over a comparison window, determining the number of positions at which the same nucleic acid base (e.g., A, T, C, G, I) or the same amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., window size), and multiplying the result by 100 to obtain the percentage of sequence identity. The optimal alignment of sequences for aligning the comparison window can be performed by a computer implementation of an algorithm (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetic Computer Group, 575 Science Drive Madison, Wis., USA) or by the best alignment (i.e., the one that yields the highest percentage of homology over the comparison window) generated by any of a variety of methods examined and selected. Reference may also be made to programs of the BLAST family, such as those disclosed by Altschul et al., Nucl. Acids Res. 25: 3389, 1997.

[0088] As used herein, the term "percent identity," which may be used interchangeably with the term "sequence identity" in the context of two or more nucleic acid or polypeptide sequences, refers to the percentage of specified nucleotides or amino acid residues that are the same when two or more sequences or subsequences are compared and aligned for maximum correspondence as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, "percent identity" may exist over a region of the sequences being compared (e.g., over a functional domain) or over the full length of the two sequences being compared. For sequence comparison, typically one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, subsequence coordinates are designated, and sequence algorithm program parameters are designated as necessary. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence relative to the reference sequence based on the designated program parameters.

[0089] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by the computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA; Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (generally see Ausubel et al., infra).

[0090] Suitable algorithms for determining the percent sequence identity include the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analysis is publicly available through the website of the National Center for Biotechnology Information.

[0091] The percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http: / / www.gcg.com), the NWSgapdna.CMP matrix, and gap weightings of 40, 50, 60, 70, or 80, and length weightings of 1, 2, 3, 4, 5, or 6. Also, the percent identity between two nucleotide sequences or amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-17, (1989)) incorporated into the ALIGN program (version 2.0), using the PAM120 weighted residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) incorporated into the GAP program in the GCG software package (available at http: / / www.gcg.com), using either the Blossum 62 matrix or the PAM250 matrix, and gap weightings of 16, 14, 12, 10, 8, 6, or 4, and length weightings of 1, 2, 3, 4, 5, or 6.

[0092] The nucleic acid and protein sequences of the present disclosure can be further used as "query sequences" for performing searches against public databases, for example, to identify related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990), J. Mol. Biol. 215:403-10. The BLAST nucleotide search can be performed using the NBLAST program with a score = 100 and word length = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules provided in the present disclosure. The BLAST protein search can be performed using the XBLAST program with a score = 50 and word length = 3 to obtain amino acid sequences homologous to the protein molecules of the present disclosure. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402 (1997). When using the BLAST program and the Gapped BLAST program, the default parameters of each program (e.g., XBLAST and NBLAST) can be used. See http: / / www.ncbi.nlm.nih.gov.

[0093] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms suitable for use in contact with human and animal tissues, organs, and / or body fluids within the scope of sound medical judgment, without undue toxicity, irritation, allergic reaction, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0094] As used herein, "pharmaceutically acceptable carrier" refers to and includes all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, absorption delaying agents, and the like. The compositions can include pharmaceutically acceptable salts, such as acid addition salts or base addition salts (e.g., Berge et al., J Pharm Sci See 66:1-19 (1977).

[0095] As used herein, the term "pharmaceutically acceptable salt" refers to a derivative of a compound or other active ingredient in which the parent compound or active ingredient is modified by converting an existing acidic or basic moiety into its salt form. Non-limiting examples of pharmaceutically acceptable salts include mineral salts or organic acid salts of basic residues such as amines; alkali salts or organic salts of acidic residues such as carboxylic acids; alkali metals, alkaline metals, ammonium, and mono-, di-, tri-, or tetra-C1-C30-alkyl substituted ammonium, among others. Pharmaceutically acceptable salts of various embodiments include, for example, conventional non-toxic salts of a compound or active ingredient formed from non-toxic inorganic or organic acids. Suitable organic acids are, for example, carboxylic acids or sulfonic acids, such as acetic acid, succinic acid, fumaric acid or methanesulfonic acid. Pharmaceutically acceptable salts herein can be synthesized from the parent compound or active ingredient containing a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting these compounds in the free acid or free base form with a stoichiometric amount of the appropriate base or acid in water or an organic solvent, or a mixture of the two, and generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p.1418 and Journal of Pharmaceutical Science, 66, 2(1977) (each of which is hereby incorporated by reference in its entirety). is incorporated herein by reference in its entirety).

[0096] As used herein, the term "PSA" refers to prostate specific antigen.

[0097] As used herein, the term "RANTES" is synonymous with chemokine (C-C motif) ligand 5, which is also synonymous with CCL5.

[0098] As used herein, the term "sequence identifier (SEQ ID NO)" is synonymous with the term "sequence ID number (Sequence ID No.)".

[0099] As used herein, "small RNA" generally refers to non-coding RNA having a silencing or interfering function and a length of about 200 nucleotides or less. In embodiments, the small RNA has a length of about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less. Such RNAs include microRNA (miRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA), and short hairpin RNA (shRNA). In embodiments, "small RNA" can generally inhibit or knockdown gene expression of a target gene through a pathway that results in destruction of the target gene's mRNA.

[0100] As used herein, the term "TCR" refers to the T cell receptor, and the term "TCRs" refers to its plural form.

[0101] As used herein, the term "therapeutically effective amount" refers to a sufficient amount of an active agent of the present disclosure in a suitable composition and in a suitable dosage form to treat or prevent the onset of symptoms, progression, or complications found in a patient suffering from a given disease, injury, disorder, or condition. The therapeutically effective amount will vary depending upon the circumstances or severity of the patient's condition, and the age, weight, etc. of the subject being treated. The therapeutically effective amount can vary depending on, for example, any of several factors such as the route of administration, the condition of the subject, as well as other factors understood by those of ordinary skill in the art.

[0102] As used herein, the term "therapeutic vector" includes, but is not limited to, references to lentiviral vectors such as those described in FIGS. 2 and 3 of the present specification, and lentiviral plasmids.

[0103] As used herein, the term "TNF" refers to tumor necrosis factor, and references to TNF-alpha or TNF-α refer to tumor necrosis factor alpha.

[0104] As used herein, the terms "treatment" and "treating" refer to the intended targeting and combating of a disease state, i.e., to improve or prevent the disease state. Specific treatments will thus depend on the disease state targeted as well as the current or future state of medical therapies and treatment approaches. Treatments can have associated toxicities.

[0105] As used herein, the term "treatment" or "treating" generally refers to an intervention that attempts to alter the natural course of the subject being treated and can be done for prevention or during the course of clinical pathology. Desirable effects include, but are not limited to, prevention of the occurrence or recurrence of a disease, alleviation of symptoms, suppression, reduction, or inhibition of any direct or indirect pathological consequences of the disease, improvement or alleviation of the disease state, and induction of remission or improved prognosis.

[0106] As used herein, the term "VSVG" or "VSV-G" refers to the vesicular stomatitis virus G envelope glycoprotein.

[0107] Description of aspects of the disclosure In one aspect of the disclosure, a viral vector is disclosed that includes first and second encoded gene elements. The first encoded gene element includes a small RNA that can inhibit the production of an enzyme involved in the mevalonate pathway, and the second encoded gene element includes one of a butyrophilin family member, a cytokine, or a chemokine. In embodiments, the viral vector includes a third encoded gene element, and the third encoded gene element includes one of a butyrophilin family member, a cytokine, or a chemokine. In embodiments, the viral vector includes a fourth encoded gene element, and the fourth encoded gene element includes one of a butyrophilin family member, a cytokine, or a chemokine. In embodiments, the enzyme is farnesyl diphosphate synthase (FDPS) or a functional variant thereof. In embodiments, the first encoded gene element includes a microRNA or shRNA. In embodiments, the shRNA is GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or It includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% or a higher percentage of identity with [[SEQ ID NO:4]] GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT.

[0108] In an embodiment, the shRNA is GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO:1); GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO:2); GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO:3); or GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO:4).

[0109] In an embodiment, the shRNA includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity with SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67.

[0110] In an embodiment, the miRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 68 or SEQ ID NO: 69.

[0111] In an embodiment, the enzyme is GGPS1 or a functional variant thereof. In an embodiment, the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 70, SEQ ID NO: 71, or SEQ ID NO: 72.

[0112] In an embodiment, the enzyme is IDI1 or a functional variant thereof. In an embodiment, the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 76.

[0113] In an embodiment, the enzyme is F-Tase, or squalene synthase, or a functional variant thereof.

[0114] In embodiments, butyrophilin family members include BTN3A3, BTN3A3, or BTN3A1. In embodiments, butyrophilin family members include BTN3A3(R381H). In embodiments, butyrophilin family members include butyrophilin-like molecules. In embodiments, butyrophilin-like molecules include BTNL3 or BTNL8. In embodiments, cytokines include IL-1, IL-1β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, TNF-α, or interferon-γ.

[0115] In embodiments, chemokines include CC chemokines, CXC chemokines, CX3C chemokines, C chemokines, or XC chemokines. In further embodiments, CC chemokines include RANTES. In embodiments, the viral vector is a lentiviral vector. In further embodiments, C chemokines include XCL1 (lymphotactin).

[0116] In another aspect, a lentiviral vector system for expressing lentiviral particles is disclosed. The system includes a lentiviral vector as detailed herein; at least one envelope plasmid for expressing an envelope protein optimized for infecting target cells; and at least one helper plasmid for expressing the gag, pol, and rev genes, or functional variants thereof, wherein when the lentiviral vector, at least one envelope plasmid, and at least one helper plasmid are transfected into packaging cells, lentiviral particles are produced by the packaging cells, and the lentiviral particles can infect target cells and inhibit enzymes involved in the mevalonate pathway within the target cells.

[0117] In embodiments, the lentiviral particles can cause an increase in the level of a first product of the mevalonate pathway. In embodiments, the first product includes IPP. In embodiments, the lentiviral particles can cause a decrease in the level of a second product of the mevalonate pathway. In embodiments, the second product includes GGPP. In embodiments, the lentiviral product increases the first product and decreases the second product.

[0118] In embodiments, the lentiviral particles encode a small RNA that can target a first target of the mevalonate pathway. In embodiments, the lentiviral particles further encode a small RNA that can target a second target of the mevalonate pathway. In embodiments, at least one of the first target and the second target is an enzyme. In embodiments, at least one of the first target and the second target is FDPS, GGPS1, IDI1, F-Tase, or squalene synthase.

[0119] In embodiments, targeting of a first target by a small RNA causes an increase in the presence, level, or concentration of a first product of the mevalonate pathway. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by up to 10% relative to a control of the first product, where the control of the first product can mean the presence, level, or concentration of the first product when the first target is not targeted by the small RNA. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by from up to 10% to up to 20% relative to a control of the first product as described herein. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by from up to 20% to up to 30% relative to a control of the first product as described herein. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by from up to 30% to up to 40% relative to a control of the first product as described herein. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by from up to 40% to up to 50% relative to a control of the first product as described herein. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by more than 50% relative to a control of the first product as described herein. In embodiments, the first product of the mevalonate pathway comprises IPP.

[0120] In embodiments, targeting of the second target by the small RNA causes a decrease in the presence, level, or concentration of a second product of the mevalonate pathway. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased by up to 10% of the control of the second product, where the control of the second product can mean the presence, level, or concentration of the second product when the second target is not targeted by the small RNA. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased from up to 10% to up to 20% of the control of the second product as described herein. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased from up to 20% to up to 30% of the control of the second product as described herein. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased from up to 30% to up to 40% of the control of the second product as described herein. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased from up to 40% to up to 50% of the control of the second product as described herein. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased by more than 50% of the control of the second product as described herein. In embodiments, the second product of the mevalonate pathway includes GGPP.

[0121] In embodiments, an increase in the presence, level, or concentration of a first product of the mevalonate pathway causes an increase in gamma delta (GD) T cell activation. In embodiments, GD T cell activation increases up to 10% relative to a control of the first activation, where the control of the first activation may mean the level of GD T cell activation when the first target is not targeted by small RNA. In embodiments, GD T cell activation caused by modulation of the first product increases from up to 10% to up to 20% relative to a control of the first activation as described herein. In embodiments, GD T cell activation caused by modulation of the first product increases from up to 20% to up to 30% relative to a control of the first activation as described herein. In embodiments, GD T cell activation caused by modulation of the first product increases from up to 30% to up to 40% relative to a control of the first activation as described herein. In embodiments, GD T cell activation caused by modulation of the first product increases from up to 40% to up to 50% relative to a control of the first activation as described herein. In embodiments, GD T cell activation caused by modulation of the first product increases 50% or more relative to a control of the first activation as described herein.

[0122] In embodiments, a decrease in the presence, level, or concentration of a second product of the mevalonate pathway causes an increase in gamma delta (GD) T cell activation. In embodiments, the GD T cell activation caused by modulation of the second product increases by up to 10% relative to a control of the second activation, where the control of the second activation may mean the level of GD T cell activation when the second target is not targeted by small RNA. In embodiments, the GD T cell activation caused by modulation of the second product increases by up to 10% to up to 20% relative to a control of the second activation as described herein. In embodiments, the GD T cell activation caused by modulation of the second product increases by up to 20% to up to 30% relative to a control of the second activation as described herein. In embodiments, the GD T cell activation caused by modulation of the second product increases by up to 30% to up to 40% relative to a control of the second activation as described herein. In embodiments, the GD T cell activation caused by modulation of the second product increases by up to 40% to up to 50% relative to a control of the second activation as described herein. In embodiments, the GD T cell activation caused by modulation of the second product increases by 50% or more relative to a control of the second activation as described herein.

[0123] In another aspect, lentiviral particles capable of infecting target cells are disclosed. The lentiviral particles include an envelope protein optimized for infecting the target cells and a lentiviral vector as detailed herein. In embodiments, the target cells are cancer cells.

[0124] In another aspect, a method of activating gamma delta (GD) T cells is disclosed. The method includes infecting target cells with lentiviral particles in the presence of GD T cells, where the lentiviral particles include a viral vector containing first and second encoded gene elements, the first encoded gene element includes a small RNA capable of inhibiting the production of an enzyme involved in the mevalonate pathway, the second encoded gene element includes one of a butyrophilin family member, a cytokine, or a chemokine, and when the enzyme is inhibited in the target cells, the target cells activate GD T cells. In embodiments, the enzyme includes at least one of FDPS, GGPS1, IDI1, F-Tase, and / or squalene synthase, or a functional variant thereof.

[0125] In embodiments, the target cells are cancer cells. In embodiments, the method further includes contacting the target cells and GD T cells with an amount of an aminobisphosphonate drug. In embodiments, the aminobisphosphonate drug is zoledronic acid.

[0126] In another aspect, a method of treating cancer in a subject is disclosed. The method includes administering to the subject a therapeutically effective amount of lentiviral particles, where the lentiviral particles include a viral vector containing first and second encoded gene elements, the first encoded gene element includes a small RNA capable of inhibiting the production of an enzyme involved in the mevalonate pathway, the second encoded gene element includes one of a butyrophilin family member, a cytokine, or a chemokine, and when the enzyme is inhibited in cancer cells in the presence of GD T cells, the target cells activate GD T cells, thereby treating cancer. In embodiments, the enzyme includes at least one of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or a functional variant thereof.

[0127] In an embodiment, the method further includes contacting the target cells and the γδ T cells with an amount of an aminobisphosphonate drug. In an embodiment, the method includes administering to a subject a therapeutically effective amount of lentiviral particles, the lentiviral particles including a viral vector including first, second, and third encoded gene elements, the first encoded gene element including one or more small RNAs capable of inhibiting the production of one or more enzymes involved in the mevalonate pathway, the second encoded gene element including a butyrophilin family member, the third gene element encoding a cytokine or chemokine, wherein when the enzyme is inhibited in cancer cells in the presence of γδ T cells, the target cells activate the γδ T cells, the butyrophilin increases the efficiency of activating the γδ T cells, the cytokine increases the activation and proliferation of the γδ T cells, the chemokine increases the presence of γδ T cells at the tumor site, thereby treating cancer. In an embodiment, the method further includes exposing the target cells and the γδ T cells to an amount of an aminobisphosphonate drug. In an embodiment, the aminobisphosphonate drug is zoledronic acid.

[0128] In an embodiment, the butyrophilin family member includes BTN3A3 (SEQ ID NO: 17) or BTN3A3 (R381H) (SEQ ID NO: 54). In an embodiment, the cytokine includes IL-2, IL-12, IL-15, IL-18, IL-23, or IL-36, but may also include other cytokines known to activate immune cells such as T cells. In an embodiment, the chemokine includes chemokine (C-C motif) ligand 5 encoded by the CCL5 gene, or other chemokines known to be recognized by the γδ T cell receptor and known to be able to attract γδ T cells to the site of tumor growth.

[0129] Cancer The compositions and methods provided herein are used to treat cancer. The cell, tissue, or target can be a cancer cell, a cancerous tissue, can have a cancerous tissue, or can be a subject or patient diagnosed with or at risk of developing a disease or condition. In certain embodiments, the cell can be an epithelial cell, an endothelial cell, a mesothelial cell, a glial cell, a stromal cell, or a mucosal cell. The cancer cell population can include, but is not limited to, brain cells, nerve cells, blood cells, endometrial cells, meningeal cells, esophageal cells, lung cells, cardiovascular cells, liver cells, lymphocytes, breast cells, bone cells, connective tissue cells, fat cells, retinal cells, thyroid cells, glandular cells, adrenal cells, pancreatic cells, stomach cells, intestinal cells, kidney cells, bladder cells, colon cells, prostate cells, uterine cells, ovarian cells, cervical cells, testicular cells, spleen cells, skin cells, smooth muscle cells, myocardial cells, or skeletal muscle cells, and can include a cancer cell population from any of the foregoing, and can be associated with cancer, sarcoma, myeloma, leukemia, lymphoma, a mixed type or one or more of the foregoing mixtures. In still further embodiments, cancers include astrocytoma, acute myeloid leukemia, anaplastic large cell lymphoma, acute lymphoblastic leukemia, angiosarcoma, B cell lymphoma, Burkitt lymphoma, breast cancer, bladder cancer, head and neck cancer, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colorectal cancer, endometrial cancer, esophageal squamous cell carcinoma, Ewing sarcoma, fibrosarcoma, glioma, glioblastoma, gastrinoma, gastric cancer, germinoma, hepatocellular carcinoma, Kaposi sarcoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, laryngeal cancer, leukemia, leiomyosarcoma, lipoma, liposarcoma, melanoma, mantle cell lymphoma, medulloblastoma, mesothelioma, myxofibrosarcoma, myeloid leukemia, mucosa-associated lymphoid tissue B cell lymphoma, multiple myeloma, high-risk myelodysplastic syndrome, nasopharyngeal cancer, neuroblastoma, neurofibroma, high-grade non-Hodgkin lymphoma, non-Hodgkin lymphoma, lung cancer, non-small cell lung cancer, ovarian cancer, esophageal cancer, osteosarcoma, pancreatic cancer, pheochromocytoma, prostate cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, schwannoma, small cell lung cancer, squamous cell carcinoma of the head and neck, testicular tumor, thyroid cancer, urothelial cancer, and Wilms tumor, but are not limited thereto.

[0130] The compositions and methods provided herein are also used to treat NSCLC (non-small cell lung cancer), pediatric malignancies, cervical and other tumors caused or promoted by human papillomavirus (HPV), melanoma, Barrett's esophagus (pre-malignant syndrome), adrenal cancer, and skin cancer, as well as autoimmune diseases and neoplastic skin diseases.

[0131] Infectious diseases The compositions and methods disclosed herein can be used to treat infectious diseases. The term "infectious disease" includes any disease caused by an infectious agent. Examples of "infectious agents" include, but are not limited to, any exogenous pathogen such as bacteria, fungi, viruses, mycoplasma, and parasites. Infectious agents that can be treated using the compositions provided in the present disclosure include any recognized infectious organism in the art that causes pathogenesis in animals, including bacteria that are gram-negative or gram-positive cocci or bacilli, DNA viruses and RNA viruses, such as, but not limited to, DNA viruses such as papillomavirus, parvovirus, adenovirus, herpesvirus, and vaccinia virus, and arenavirus, coronavirus, rhinovirus, respiratory syncytial virus, influenza virus, picornavirus, paramyxovirus, reovirus, retrov Biological entities include viruses, such as RNA viruses like rubella virus. Examples of fungi that can be treated using the compositions and methods of the present disclosure include those that grow as molds or yeast-like fungi, such as fungi that cause diseases such as tinea, histoplasmosis, blastomycosis, aspergillosis, cryptococcosis, sporotrichosis, coccidioides, paracoccidioides, and candidiasis. The compositions and methods provided herein can be utilized to treat parasitic infections, including somatic tapeworm, schistosoma, tissue roundworm, amoeba, and infections caused by Plasmodium, Trypanosoma, Leishmania, and Toxoplasma species, among others.

[0132] Method for activating γδ T cells In addition to compositions and methods for activating γδ T cells in an individual, methods for treating tumors and infectious diseases are provided herein. For example, in embodiments, the compositions and methods provided herein can be used in methods for treating all known cancers, because activated γδ T cells include natural mechanisms for tumor immunosurveillance (see, e.g., Pauza et al. Frontiers in Immunol. 5: 687 (2014)). Similarly, in embodiments, the compositions and methods provided herein can be used to treat infectious diseases, including, but not limited to, flavivirus, influenza virus, human retrovirus, mycobacterium, plasmodium, and various other viral, fungal, and bacterial infections (see, e.g., Pauza and Cairo, 2015 Cell Immunol. 296(1)).

[0133] Generally, to reduce the expression of FDPS and, in other embodiments, to increase the expression of chemokines or cytokines, the vector system is administered to an individual for transfecting or transducing a target cell population using the disclosed constructs. Administration and transfection / transduction can be performed in vivo or ex vivo, and in the latter scenario, the transfected cells are later administered back into the subject.

[0134] Administration of the disclosed vectors to the cells of a subject and transfection or transduction of the disclosed constructs result in a decrease in the expression of FDPS, an increase in the expression of cytokines or chemokines, the accumulation of IPP, and often a reduction in the growth rate of genetically modified tumor cells. All of these features work together to activate γδ T cells and co-localize them to the site of the tumor or infection.

[0135] The disclosed methods can also increase the ability of NK cells to recognize and destroy tumor cells and / or infected cells. Cross-talk between γδ T cells and NK cells is an important aspect in regulating the immune response and inflammatory response. Furthermore, γδ T cells can induce the maturation of dendritic cells, mobilize B cells and macrophages, and participate in various cytolytic activities such as the secretion of interferon-γ and TNF-α.

[0136] In embodiments, the disclosed compositions and methods provided herein include a form of gene therapy for activating γδ T cells at the site of a tumor. In one aspect, the compositions and methods provided herein activate γδ T cells by promoting the production of specific cytokines required for cytolytic activity capable of killing cancer cells or treating infectious diseases, and support their proliferation, differentiation, and functional capabilities.

[0137] In an embodiment, the gene therapy sequence (e.g., FDPS shRNA, FDPS miRNA, GGPS1 shRNA, IDI1 shRNA, F-Tase small RNA, or squalene synthase small RNA) is carried by a therapeutic vector, and examples of the therapeutic vector include, but are not limited to, viral vectors such as lentivirus or adeno-associated virus, and other viral vectors may also be suitable. The gene therapy construct can also be delivered in the form of DNA or RNA, including, but not limited to, plasmid form. In an embodiment, the disclosed gene therapy construct can also be delivered in the form of a protein-nucleic acid complex or a lipid-nucleic acid complex and mixtures of these formulations. For example, the protein-nucleic acid complex can contain the nucleic acid of interest in a complex with a cationic peptide such as lysine and arginine. The lipid-nucleic acid complex can include lipid emulsions, micelles, liposomes, and / or mixtures of neutral and cationic lipids such as DOTMA, DOSPA, DOTAP, and DMRIE.

[0138] In an embodiment, the therapeutic vector can contain a single construct or at least two, at least three, at least four, or at least five different constructs. If more than one construct is present in the vector, the constructs can be identical or they can be different. For example, the constructs can differ with respect to the promoter, the presence or absence of integration elements, and / or the sequence.

[0139] In an embodiment, the therapeutic vector comprises at least one construct encoding a small RNA capable of knocking down the expression of at least one of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or functional variants thereof. In an embodiment, the therapeutic vector also encodes specific cytokine(s) and / or chemokine(s) including, but not limited to, TNF-α, interferon-γ, IL-1, IL-1β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or RANTES. In an embodiment, a single construct can encode both small RNAs capable of knocking down the expression of FDPS and specific cytokines or chemokines including, but not limited to, TNF-α, interferon-γ, IL-1, IL-1β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or RANTES.

[0140] In an embodiment, the viral vector can introduce a nucleic acid construct that integrates into the host chromosome. Alternatively, a transient delivery vector can be used to prevent integration into the chromosome and limit the lifespan of the gene therapy construct.

[0141] In an embodiment, the disclosed constructs and vectors include short hairpin RNA ("shRNA"), microRNA ("miRNA"), or siRNA capable of reducing or knocking down the expression of the FDPS, geranylgeranyl pyrophosphate synthase ("GPPS"), farnesyl transferase ("F-Tase"), IDI1, and / or squalene synthase genes. By downregulating these genes that control the synthesis of steroids and isoprenoids, the level of isopentenyl pyrophosphate ("IPP") increases and / or the level of GGPP decreases. The increase and accumulation of IPP are GD It is a mechanism for increasing T cell activation. Furthermore, the downregulation of these pyrophosphate synthase genes removes an important negative regulator of inflammasome function, which then results in an increase in the expression of cytokines important for γδ T cell activation and effector cell function. Higher cytoplasmic levels of BTN3A3 and IPP on the cancer cell surface strongly stimulate Vγ9Vδ2 T cells (also referred to herein as γδ T cells).

[0142] In embodiments, the disclosed constructs are regulated by specific promoters capable of producing interleukin-2 and / or interleukin-15 to maintain γδ T cell proliferation. However, as described herein, other cytokines such as IL-18, IL-23, and IL-36 can also be selected and used. In addition, the disclosed constructs can be regulated by specific promoters capable of producing interleukin-1 beta and / or interleukin-18 and / or interferon-gamma required for γδ T cell differentiation and acquisition of all effector cell functions. Desirable effector cell functions include direct cytotoxic cell killing of tumors and / or infected cells, secretion of beneficial cytokines and / or chemokines, increased expression of NK receptors required for recognition of cancerous or cells, and the ability for increased expression of Fc receptors required for binding to targeting antibodies to co-localize γδ T cells with cancerous or infected cell targets. Increased expression of receptors, as well as the ability for increased expression of Fc receptors required for binding to targeting antibodies to co-localize γδ T cells with cancerous or infected cell targets.

[0143] In an embodiment, the disclosed method has an indirect effect of activating γδ T cells to increase the ability of NK cells to attack and destroy cancerous cells, tumors, or infected cells. Activation of NK cells requires γδ T cells, which are stimulated to proliferate and differentiate and express the 4-1BBL co-stimulatory ligand required to bind to the 4-1BB co-stimulatory receptor on NK cells. This form of crosstalk is known as an important mechanism for activating NK cells and is achieved through the actions of the methods and compositions disclosed herein.

[0144] In another aspect, the crosstalk between γδ T cells and NK cells is an important mechanism for removing inflammatory dendritic cells that accumulate in diseased tissues. Alone, neither γδ T cells nor NK cells can destroy dendritic cells, but when the above-described crosstalk interaction occurs, NK cells change and become cytotoxic to inflammatory dendritic cells. This immunomodulatory mechanism depends on strong activation and proliferation of γδ T cells.

[0145] In an embodiment, the disclosed method for activating γδ T cells further includes suppressing a pathological inflammatory response, which can include cell proliferation leading to atherosclerosis, chronic immune activation that stimulates tumor growth, autoimmune diseases such as psoriasis and other manifestations in the epidermis, inflammatory diseases of the central nervous system, and other diseases such as arthritis and unregulated immune responses.

[0146] In an embodiment, the therapeutic vector is administered in parallel with a bisphosphonate drug to achieve synergistic activation of gamma delta T cells. The synergistic effect can enable alternating, modified, or reduced doses of the bisphosphonate drug and can reduce adverse reactions to the bisphosphonate such as acute inflammatory responses and chronic diseases.

[0147] In an embodiment, the therapeutic vector is administered in combination with a bisphosphonate drug. In various embodiments, such a combination achieves a synergistic, positive or enhanced activation of gamma delta T cells. Such positive activation can enable alternate, modified or reduced dosages of the bisphosphonate and can reduce adverse reactions to the bisphosphonate such as acute inflammatory responses and chronic diseases. The combination of the therapeutic vector with the bisphosphonate can exist together or separately, with or without instructions for co-administration or for a combination product. The therapeutic vector and / or the bisphosphonate may be administered completely separately or formulated in completely separate pharmaceutical dosage forms. The therapeutic vector and / or the bisphosphonate can be sold independently of each other, with or without instructions according to the indication regarding the possibility of co-administration. Such instructions can also be provided, for example, in package inserts such as leaflets, or in other information provided to, for example, physicians and medical staff (e.g., communication orally, in writing, etc.). Such labels or other instructions can refer to either a fixed combination in one dosage unit form, or a non-fixed combination as a partial kit for co-administration where the therapeutic vector can be administered simultaneously, or separately, independently of the bisphosphonate drug within a certain time interval. In various embodiments, the combination exhibits a synergistic or cooperative effect, or a reduction in the toxicity or complications of the treatment. In one embodiment, the effect of the combination is synergistic. A synergistic effect is achieved when the active ingredients used together are greater than the sum of the effects resulting from using the compounds separately. A synergistic effect can be obtained when the active ingredients are (1) formulated together and administered or delivered simultaneously in a unit dosage formulation for combination; (2) delivered alternately or in parallel as separate formulations; or (3) by some other regimen. When delivered by alternate therapy, a synergistic effect can be obtained when the compounds are administered or delivered sequentially, for example, by different injections with separate syringes.Generally, during alternative therapy, effective doses of each active ingredient are administered sequentially, i.e., continuously, while in combination therapy, two or more active ingredients in effective doses are administered together, although subject to potential timing variations as detailed herein.

[0148] The combinations herein can be manufactured and / or formulated by the same or different manufacturers. The active ingredients can be combined (i) before shipment of the combination product to a physician (e.g., in the case of a kit containing a compound of the disclosure and other therapeutic agents); (ii) by the treating physician (or under the direction of a physician) immediately prior to administration; or (iii) in the actual patient, for example, during sequential administration of the active ingredients disclosed herein, into a combination therapy.

[0149] In embodiments, each combination in a therapeutically effective amount can be administered simultaneously or sequentially and in any order, and the components can be administered together or separately. For example, a method of treating a proliferative disease according to the disclosure can include (i) administration of a first agent such as a therapeutic vector that forms a portion of lentiviral particles and / or (ii) administration of a second agent such as a bisphosphonate drug in free or pharmaceutically acceptable salt form. Administration of agent (i) and / or (ii) can be at a therapeutically effective amount, preferably in a synergistic, co-effective, and / or multiplicative amount, e.g., a daily or intermittent dosage corresponding to the amounts described herein, simultaneously or in any order sequentially. The combination can be administered separately or in a divided or single pharmaceutical form in parallel at different times during the course of the therapy. Further, the term "administering" also encompasses using a prodrug of a combination partner that converts itself in vivo to the combination partner. The disclosure should thus be understood to encompass all such regimens of simultaneous or alternating treatment, and the term "administering" should be construed accordingly.

[0150] In embodiments, the agents (i) and (ii) can be administered using any pharmaceutically acceptable method, such as intranasal administration, buccal administration, sublingual administration, oral administration, rectal administration, ocular administration, parenteral (intravenous, intradermal, intramuscular, subcutaneous, intraperitoneal) administration, pulmonary administration, intravaginal administration, topical administration, local administration, topical administration after excision, mucosal administration, via an aerosol, in a semi-solid medium such as agarose or gelatin, or via a buccal or nasal spray formulation. For example, the therapeutic vector and / or the bisphosphonate drug can be administered intravenously. Further, the agents (i) and (ii) can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semi-solid dosage form, solution, emulsion, and suspension. For example, the bisphosphonate drug can be formulated into a tablet and administered orally.

[0151] The combination therapy according to the present disclosure can also or in addition be administered, in particular for cancer therapy, in combination with chemotherapy, radiotherapy, immunotherapy, surgical intervention, or combinations thereof. Long-term therapy is also possible as adjuvant therapy in the context of other treatment strategies as described above. Other possible treatments are therapies for maintaining the patient's condition after tumor regression, or even chemoprevention therapy, for example, in at-risk patients.

[0152] Construct for activating gd T cells Inhibition of FDPS, GGPS1, IDI1, and / or functional variants thereof may result in the accumulation of IPP and / or a decrease in GGPP levels, which leads to the activation of V delta 2+ GD T cells and the expression of interferon-gamma, TNF-alpha, and IL-18, which are also important in the activation of GD T cells. Inhibition of farnesyl transferase and / or squalene synthase results in a decrease in protein prenylation. The disclosed constructs can be transfected or transduced into specific target cells such as tumor cells or infected cells, where they can express RNA sequences (i.e., siRNA, shRNA or microRNA) that inhibit the translation of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or functional variants thereof, and in addition, can encode and express cytotoxic cytokines or chemokines.

[0153] Constructs for decreasing the expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or functional variants thereof, increasing the expression of cytokines, and increasing the expression of chemokines such as RANTES are disclosed herein. For example, in embodiments, the construct may encode interferon-gamma, IL-1, IL-1β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or TNF-α.

[0154] The expression of cytokines and chemokines such as those listed above results in the localized cytotoxic destruction of tumor cells or cells infected with pathogenic organisms. Thus, the expression of such constructs by tumor cells can result in activating an immune mechanism by which the tumor cells assist in their own destruction and can destroy other tumor cells that have not been genetically modified by a lentiviral vector. The ability of genetically modified cells to activate γδ T cells involves γδ T cell receptor, butyrophilin recognition, and activation of the γδ T cell receptor for common γ-chain cytokines. Tumor cell killing relies on a family of γδ T cell surface receptors that are generally described as members of the NK receptor family that distinguish tumor cells from normal cells and provide selectivity to the cell killing process. As a result, a small number of genetically modified tumor cells can activate a sufficient number of γδ T cells to achieve large-scale destruction of tumors, including the killing of both genetically modified and non-genetically modified cells in the same or distal tumors. Thus, the expression of such constructs by tumor cells or infected cells results in the unwanted cells assisting in their own destruction.

[0155] Similarly, when the disclosed constructs are expressed in tumor cells or infected cells, a decrease in the expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or functional variants thereof can result in the activation of γδ T cells and the mobilization of γδ T cells to the tumor site at the site of cell infection. An increase in the expression of RANTES further attracts γδ T cells to the intended tissue location. γδ T cells can kill many leukemias and lymphomas in addition to tumors of broad epithelial origin, and the production of high levels of the anti-tumor cytokine, IFNγ, is also possible, so the mobilization of γδ T cells to the tumor site can be a particularly effective means of inducing anti-tumor immunity.

[0156] Reduction of the expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or functional variants thereof can be achieved via shRNA, microRNA, siRNA, or other means known in the art. For example, shRNA according to SEQ ID NO: 1, 2, 3, or 4, or variants thereof can be used in the disclosed constructs and methods, but this example is not limiting. shRNA according to SEQ ID NO: 64-67, 70-72, 76, or variants thereof can be used in the disclosed constructs and methods, but this example is not limiting. miRNA according to SEQ ID NO: 68 or 69, or variants thereof can be used in the disclosed constructs and methods, but this example is not limiting. The coding regions of RNAs for reducing the expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and / or functional variants thereof, as well as the coding regions of cytokines and chemokines, may be on the same construct or on different constructs.

[0157] Classical approaches for producing gene regulatory molecules such as recombinant polypeptides or small RNAs are to use stable expression constructs. These constructs are also based on chromosomal integration of the transduced expression plasmid (or at least a portion thereof) into the genome of the host cell, short-duration plasmid transfection, or non-integrating viral vectors with limited half-lives. The site of gene integration is generally random, and the number and ratio of genes integrated into any particular site are often unpredictable. Similarly, non-integrating plasmids or viral vectors also produce nuclear DNA, but these species usually lack the sequences required for DNA replication and continuous maintenance. Thus, constructs that rely on chromosomal integration result in the permanent maintenance of recombinant genes, which can be beyond the treatment interval.

[0158] As an alternative to stable expression constructs for gene expression, there are transient expression constructs. The expression of the latter gene expression constructs is based on non-integrating plasmids, and thus, the expression is typically lost when the cells divide or the plasmid vector is destroyed by endogenous nucleases.

[0159] The disclosed constructs are preferably episomal constructs that are transiently expressed. Episomal constructs do not permanently alter the subject's genome and are degraded or diluted over time so as not to integrate into the chromosomes of the target cells. The process of episomal replication typically incorporates both the host cell's replication machinery and viral trans-acting factors.

[0160] Avoidance of chromosomal integration reduces certain barriers to in vivo gene delivery. However, even integration-deficient constructs can have background frequencies of integration, and any DNA molecule can have rare homologies for recombination with host sequences, but these integration rates are exceptionally rare and generally not clinically significant.

[0161] Thus, in embodiments, the disclosed vectors support the delivery of active genes and / or small RNAs over a period of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks. In embodiments, the disclosed vectors support the delivery of active genes and / or small RNAs over a period of about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. For example, any combination of these periods, such as 1 month and 1 week, or 3 months and 2 weeks, can also be used in the methods of the invention.

[0162] However, in embodiments, the construct comprises an integration element that depends on a retroviral integrase gene, whereby the construct is integrated into the subject's chromosome. Retrotranslocation and translocation are additional examples of mechanisms by which mobile genetic elements are integrated into or inserted into a chromosome. A plasmid may be integrated into a chromosome by recombination, and gene editing techniques such as CRISPR and TALEN utilize guide RNA sequences to alter chromosomal loci by gene deletion or gene conversion mechanisms.

[0163] The construct may include a specific promoter for expressing a cytokine involved in the maintenance of GD T cells (i.e., IL-2, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36). For example, promoters that may be incorporated into the disclosed constructs include, but are not limited to, TATA box promoter, CpG box promoter, CCAAT box promoter, TTGACA box promoter, BRE box promoter, INR box promoter, AT-based promoter, CG-based promoter, ATCG small promoter, ATCG balanced promoter, ATCG medium promoter, ATCG less promoter, AT less promoter, CG less promoter, AT spike promoter, and CG spike promoter. See, e.g., Gagniuc and Ionescu-Tirgoviste, Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters, BMC GENOMICS 13: 512 (2012).

[0164] Therapeutic vector The construct can be delivered via, but is not limited to, known transfection vectors and / or transduction vectors such as lentiviral vectors, adeno-associated virus vectors, poxvirus vectors, herpesvirus vectors, proteins and / or lipid complexes, liposomes, micelles, vesicles produced by bacteria, vesicles produced by eukaryotes, exosomes, etc.

[0165] Viral vectors can be preferentially targeted to cell types useful for the methods of the present disclosure (i.e., tumor cells or myeloid cells or lymphocytes). Viral vectors can be used to transduce genes into target cells by the specific interaction of viral envelope-host cell receptors and the viral gene expression machinery. As a result, viral vectors have been used as vehicles for introducing genes into many different cell types such as whole embryos, fertilized eggs, isolated tissue samples, in situ tissue targets, and cultured cell lines. The ability to introduce and express foreign genes in cells is useful in gene expression studies and cell lineage elucidation, as well as providing the possibility of therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy. Viral components derived from viruses such as the Papovaviridae family (e.g., bovine papillomavirus or BPV), or the Herpesviridae family (e.g., Epstein-Barr virus or EBV), or the Hepadnaviridae family (e.g., hepatitis B virus or HBV), or poxvirus vectors such as vaccinia can be used in the vectors of the present disclosure.

[0166] The present disclosure is not particularly limited to lentiviral vectors, but lentiviral vectors are a preferred type of vector for the compositions and methods of the present disclosure. Lentiviruses are a genus of viruses that can deliver significant amounts of viral nucleic acid into host cells. Lentiviruses are characterized as having the unique ability to infect / transduce non-dividing cells, and after transduction, the lentivirus integrates its nucleic acid into the host cell's chromosome.

[0167] An infectious lentivirus has three major genes encoding the virulence proteins gag, pol, and env, as well as two regulatory genes including tat and rev. Depending on the specific serotype and virus, additional accessory genes encoding proteins involved in the regulation, synthesis, and / or processing of viral nucleic acids, as well as other replication functions, may exist.

[0168] Furthermore, the lentivirus contains a long terminal repeat (LTR) region, which can be about 600 nt in length. The LTR can be divided into the U3 region, R region, and U5 region. The LTR can mediate the integration of retroviral DNA into the host chromosome via the action of integrase. Alternatively, without the function of integrase, the LTR can be used to circularize the viral nucleic acid.

[0169] Viral proteins involved in the early stages of lentivirus replication include reverse transcriptase and integrase. Reverse transcriptase is a virus-encoded RNA-dependent DNA polymerase. This enzyme uses the viral RNA genome as a template for the synthesis of a complementary DNA copy. Reverse transcriptase also has RNaseH activity for the destruction of the RNA template. Integrase binds to both the viral cDNA generated by reverse transcriptase and the host DNA. Integrase processes the LTR before inserting the viral genome into the host DNA. Tat acts as a trans-activating factor that enhances initiation and elongation during transcription. The rev response element acts post-transcriptionally and regulates mRNA splicing and transport to the cytoplasm.

[0170] Viral vectors generally contain glycoproteins, and various glycoproteins can provide specific affinity. For example, the vesicular stomatitis virus G (VSVG) peptide can increase transfection into bone marrow cells. Alternatively, viral vectors can also have targeting moieties such as antibodies attached to their capsid peptides. The targeting antibodies can be specific for antigens overexpressed in tumors such as, for example, HER-2, PSA, CEA, M2-PK, and CA19-9.

[0171] Other specificities of viral vectors are also known in the art and can be used to target specific populations of cells. For example, poxvirus vectors and herpesvirus vectors can target macrophages, dendritic cells, and epithelial cells, measles virus vectors can target B cells, and rabies virus vectors can target nerve cells.

[0172] Lentiviral vector system Lentiviral virions (particles) are expressed by a vector system that encodes the viral proteins necessary to produce the virions (viral particles). There is at least one vector containing a nucleic acid sequence encoding the lentiviral pol protein necessary for reverse transcription and integration, operably linked to a promoter. In another embodiment, the pol protein is expressed by multiple vectors. There is also a vector containing a nucleic acid sequence encoding the lentiviral gag protein necessary to form the viral capsid, operably linked to a promoter. In one embodiment, this gag nucleic acid sequence is on a vector separate from at least a portion of the pol nucleic acid sequence. In another embodiment, the gag nucleic acid is on a vector separate from all of the pol nucleic acid sequences encoding the pol protein.

[0173] A number of modifications can be made to the vector for use in the production of particles to further minimize the chance of obtaining wild-type revertants. These include, but are not limited to, deletions in the U3 region of the LTR, deletions of tat, and deletions of matrix (MA).

[0174] The gag, pol, and env vectors do not contain nucleotides from the lentiviral genome that package lentiviral RNA, referred to as the lentiviral packaging sequences.

[0175] The vector forming the particle preferably does not contain a nucleic acid sequence from the lentiviral genome that expresses an envelope protein. Preferably, another vector containing a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used. This env vector also does not contain lentiviral packaging sequences. In embodiments, the nucleic acid sequence of env encodes a lentiviral envelope protein.

[0176] In another embodiment, the envelope protein is not derived from a lentivirus, but from a different virus. The resulting particles are referred to as pseudotyped particles. By appropriate selection of the envelope, it is possible to "infect" virtually any cell. For example, an env gene encoding an envelope protein that targets the endocytic compartment can be used, and these include those from influenza virus, VSV-G, alphavirus (Semliki Forest virus, Sindbis virus), arenavirus (lymphocytic choriomeningitis virus), flavivirus (tick-borne encephalitis virus, dengue virus, hepatitis C virus, GB virus), rhabdovirus (vesicular stomatitis virus, rabies virus), paramyxovirus (mumps or measles), and orthomyxovirus (influenza virus). Other envelopes that can be preferably used include those derived from Moloney leukemia virus such as MLV-E, MLV-A, and GALV. These latter envelopes are particularly preferred when the host cell is a primary cell. Other envelope proteins can be selected according to the desired host cell. For example, targeting of specific receptors such as dopamine receptors can be used for delivery to the brain. Another target can be the vascular endothelium. These cells can be targeted using the envelope of filovirus. For example, the GP of Ebola that becomes GP by post-transcriptional modification, and GP 2 is a glycoprotein. In another embodiment, different lentiviral capsids with pseudotyped envelopes can be used (e.g., FIV or SHIV [U.S. Patent No. 5,654,195]). SHIV pseudotyped vectors can be readily used in animal models such as monkeys.

[0177] As detailed herein, the lentiviral vector system typically includes at least one helper plasmid containing at least one of the gag gene, the pol gene, or the rev gene, or a functional variant thereof. Each of the gag gene, the pol gene, and the rev gene, or a functional variant thereof, may be provided on an individual plasmid, or one or more genes may be provided together on the same plasmid. In one embodiment, the gag gene, the pol gene, and the rev gene are provided on the same plasmid (e.g., FIG. 2). In another embodiment, the gag gene and the pol gene are provided on a first plasmid and the rev gene is provided on a second plasmid (e.g., FIG. 3). Thus, both three-vector and four-vector systems can be used to produce lentiviruses as described in the Examples section herein and elsewhere. The therapeutic vector, the envelope plasmid, and at least one helper plasmid are transfected into a packaging cell line. A non-limiting example of a packaging cell line is the 293T / 17 HEK cell line. When the therapeutic vector, the envelope plasmid, and at least one helper plasmid are transfected into the packaging cell line, lentiviral particles are ultimately produced.

[0178] In another aspect, a lentiviral vector system for expressing lentiviral particles is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting cells; and at least one helper plasmid for expressing the gag, pol, and rev genes, or functional variants thereof, wherein when the lentiviral vector, the envelope plasmid, and at least one helper plasmid are transfected into a packaging cell line, lentiviral particles are produced by the packaging cell line, and the lentiviral particles can inhibit the production of the chemokine receptor CCR5 or target the HIV RNA sequence.

[0179] In another aspect, and as detailed in FIG. 2, the lentiviral vector, referred to herein as a therapeutic vector, may include the following elements: a hybrid 5' long terminal repeat (RSV / 5'LTR) (SEQ ID NOs: 5-6), the ψ sequence (RNA packaging site) (SEQ ID NO: 7), the RRE (Rev response element) (SEQ ID NO: 8), the cPPT (polypurine tract) (SEQ ID NO: 9), the H1 promoter (SEQ ID NO: 10), shFDPS (SEQ ID NOs: 1, 2, 3, 4), CMV (SEQ ID NO: 19), BTN3A3(R381H)-T2A-IL-2 (collectively SEQ ID NO: 55), the woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NO: 11), and the 3' delta LTR (SEQ ID NO: 12). In another aspect, sequence variations by substitution, deletion, addition, or mutation may be used to modify the sequences referred to herein. be used to modify the sequences referred to herein.

[0180] In another aspect, and as detailed herein, the helper plasmid is designed to include the following elements: the CMV (CAG) enhancer (SEQ ID NO: 21); the chicken beta-actin (CAG) promoter (SEQ ID NO: 13); the chicken beta-actin intron (SEQ ID NO: 22); HIV gag (SEQ ID NO: 14); HIV Pol (SEQ ID NO: 15); HIV Int (SEQ ID NO: 16); HIV RRE (SEQ ID NO: 8); HIV Rev (SEQ ID NO: 18); and the rabbit beta-globin polyA (SEQ ID NO: 23). In another aspect, the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, as well as a second separate plasmid for expressing the rev gene. In another aspect, sequence variations by substitution, deletion, addition, or mutation may be used to modify the sequences referred to herein.

[0181] In another aspect, as detailed herein, the envelope plasmid is designed to contain the following elements from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 19) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 20). In another aspect, sequence changes by substitution, deletion, addition, or mutation can be used to modify the sequences referred to herein.

[0182] In another aspect, the plasmids used for lentiviral packaging can be modified using similar elements, and the intron sequences can potentially be removed without losing vector function. For example, the following elements can replace similar elements in the plasmids that make up the packaging system: elongation factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace the CMV promoter or the CAG promoter. SV40 polyA and bGH polyA can replace the rabbit beta-globin polyA. The HIV sequences in the helper plasmid can be constructed from different HIV strains or clades. The VSV-G glycoprotein can be replaced with membrane glycoproteins derived from feline endogenous virus (RD114), gibbon ape leukemia virus (GALV), rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A fowl plague virus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).

[0183] Note that lentiviral packaging systems can be obtained commercially (e.g., Lenti-vpak packaging kit, OriGene Technologies, Inc., Rockville, MD) or designed as described herein. Furthermore, it is within the skill of the art to substitute or modify aspects of the lentiviral packaging system to improve several related factors such as the production efficiency of lentiviral particles.

[0184] Dosage and dosage form The vectors of the present disclosure enable short-term, medium-term, or long-term expression of the gene or sequence of interest, as well as episomal maintenance of the vectors of the present disclosure. Thus, the dosing regimen can vary based on the condition being treated and the method of administration.

[0185] In one embodiment, the transduction vector can be administered to a subject in need thereof at various dosages. Specifically, the subject can be administered an infectious dose of about 10 6 or more (where an average of 1 dose is required for transduction into 1 target cell). More specifically, the subject can be administered an infectious dose of about 10 7 or more, about 10 8 or more, about 10 9 or more, or about 10 10 or more, or any number of doses between these values. The upper limit of dosing of the transduction vector is determined for each disease indication and depends on the toxicity / safety profile of each individual product and product lot.

[0186] Furthermore, the vectors of the present disclosure can be administered once or twice a day, or at any other suitable interval. For example, the vector can be administered to a subject in need thereof once a week, once every two weeks, once every three weeks, once a month, every two months, every three months, every six months, every nine months, once a year, every 18 months, every two years, every 30 months, or every three years.

[0187] In one embodiment, the vector of the present disclosure is administered as a pharmaceutical composition. In embodiments, the pharmaceutical composition comprising the vector of the present disclosure can be formulated into various dosage forms, including, but not limited to, nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical applications. Each dosage form can include various solubilizers, disintegrants, surfactants, fillers, thickeners, binders, wetting agents, or other pharmaceutically acceptable excipients as diluents. The pharmaceutical composition comprising the vector can also be formulated for injection, insufflation, infusion, or intradermal exposure. For example, an injection formulation can contain the vector of the present disclosure in an aqueous or non-aqueous solution of suitable pH and tonicity.

[0188] The vector of the present disclosure can be administered to a subject via direct injection into the tumor site or at the site of infection. In embodiments, the vector can be administered systemically. In embodiments, the vector can be administered via guided cannula insertion into the tissue immediately surrounding the site of the tumor or infection.

[0189] The vector composition of the present disclosure can be administered using any pharmaceutically acceptable method, such as, for example, intranasal administration, buccal administration, sublingual administration, oral administration, rectal administration, ocular administration, parenteral (intravenous, intradermal, intramuscular, subcutaneous, intraperitoneal) administration, pulmonary administration, vaginal administration, topical administration, local administration, topical administration after excision, mucosal administration, via an aerosol, in a semi-solid medium such as agarose or gelatin, or via an oral or nasal spray formulation.

[0190] Furthermore, the vector composition of the present disclosure can be formulated into any pharmaceutically acceptable dosage form, such as, for example, solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersions, gels, aerosol formulations, pulmonary aerosol formulations, nasal aerosol formulations, ointments, creams, semi-solid dosage forms, solutions, emulsions, and suspensions. Furthermore, the composition can be a controlled release formulation, a sustained release formulation, an immediate release formulation, or any combination thereof. Furthermore, the composition can be a transdermal delivery system.

[0191] In an embodiment, the pharmaceutical composition containing the vector can be formulated as a solid dosage form for oral administration, and the solid dosage form can be a powder, granules, capsules, tablets, or pills. In an embodiment, the solid dosage form can contain one or more excipients such as, for example, calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose, or gelatin. In addition, the solid dosage form can contain a lubricant such as talc or magnesium stearate in addition to the excipient. In an embodiment, the oral dosage form can be an immediate release form or a modified release form. Examples of the modified release dosage form include controlled release or sustained release, and release in the intestinal tract. The excipients used in the modified release dosage form are generally known to those skilled in the art.

[0192] In a further embodiment, the pharmaceutical composition containing the vector can be formulated as a sublingual dosage form or an oral buccal dosage form. Such dosage forms include sublingual tablets or sublingual solution compositions administered sublingually, and oral buccal tablets placed between the cheek and the gum.

[0193] In an embodiment, the pharmaceutical composition containing the vector can be formulated as a nasal dosage form. Such dosage forms of the present invention include solution compositions, suspension compositions, and gel compositions for nasal delivery.

[0194] In an embodiment, the pharmaceutical composition containing the vector can be formulated as a liquid dosage form for oral administration such as a suspension, an emulsion, or a syrup. In an embodiment, the liquid dosage form can contain various excipients such as a humectant, a sweetening agent, a flavoring agent, or a preservative in addition to commonly used simple diluents such as water and liquid paraffin. In a specific embodiment, the composition containing the vector can be formulated to be suitable for administration to pediatric patients.

[0195] In an embodiment, the pharmaceutical composition can be formulated as a dosage form for parenteral administration such as a sterile aqueous solution, a suspension, an emulsion, a non-aqueous solution, or a suppository. In an embodiment, the solution or suspension can contain propylene glycol, polyethylene glycol, a vegetable oil such as olive oil, and an injectable ester such as ethyl oleate.

[0196] The dosage of the pharmaceutical composition can vary according to the patient's weight, age, gender, time and mode of administration, excretion rate, and severity of the disease.

[0197] In embodiments, the treatment of cancer is achieved by direct injection of the vector construct of the present disclosure into the tumor using a needle, or by intravascular cannulation. In embodiments, the vector of the present disclosure is administered into the cerebrospinal fluid, blood, or lymph circulation by cannulation or injection into a vein or artery, intradermal delivery, intramuscular delivery, or injection into a draining organ near the disease site.

[0198] The following examples are given to illustrate examples of the present invention. However, it should be understood that the present invention is not limited to the specific conditions or details described in these examples. All publications referred to in this specification are specifically incorporated by reference.

Examples

[0199] (Example 1: Development of a lentiviral vector system) As summarized in FIGS. 2 and 3, a lentiviral vector system was developed (showing the circular form). After transfection of the therapeutic vector, the envelope plasmid, and the helper plasmid, lentiviral particles were produced in 293T / 17 HEK cells (purchased from American Type Culture Collection, Manassas, VA). Functional viral particles were produced by transfection of 293T / 17 HEK cells. For this transfection, the reagent poly(ethyleneimine) (PEI) was used to increase the uptake efficiency of plasmid DNA. First, the plasmid and DNA were separately added in a 3:1 ratio (mass ratio of PEI to DNA) in serum-free culture medium. After 2 - 3 days, the cell culture medium was harvested and the lentiviral particles were purified by high-speed centrifugation and / or filtration followed by anion-exchange chromatography. The concentration of lentiviral particles can be expressed in transduction units / ml (TU / ml). The determination of TU was achieved by measuring the HIV p24 level in the culture fluid (the p24 protein is incorporated into lentiviral particles), measuring the number of viral DNA copies per cell by quantitative PCR, or by cell infection and use of light (when the vector encodes a luciferase or fluorescent protein marker).

[0200] As described above, a three-vector system (i.e., a two-vector lentiviral packaging system) was designed for the production of lentiviral particles. A schematic diagram of the three-vector system is shown in FIG. 2. Briefly with respect to FIG. 2, the top vector is the helper plasmid, which in this case contains Rev. The vector seen in the center of FIG. 2 is the envelope plasmid. The bottom vector is the therapeutic vector described herein.

[0201] More specifically with respect to Figure 2, the Helper Plus Rev plasmid contains the CMV (CAG) enhancer (SEQ ID NO: 21), the chicken beta-actin (CAG) promoter (SEQ ID NO: 13), the chicken beta-actin intron (SEQ ID NO: 22), HIV gag (SEQ ID NO: 14), HIV Pol (SEQ ID NO: 15), HIV Int (SEQ ID NO: 16), HIV RRE (SEQ ID NO: 8), HIV Rev (SEQ ID NO: 18), and rabbit beta-globin polyA (SEQ ID NO: 23).

[0202] The envelope plasmid contains the CMV promoter (SEQ ID NO: 19), the beta-globin intron (SEQ ID NO: 24), VSV-G (SEQ ID NO: 20), and rabbit beta-globin polyA (SEQ ID NO: 25).

[0203] Synthesis of a two-vector lentiviral packaging system containing the Helper (Plus Rev) plasmid and the envelope plasmid

[0204] Materials and Methods: Construction of the Helper Plasmid: The Helper plasmid was constructed by initial PCR amplification of DNA fragments from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing the Gag, Pol, and integrase genes. Primers were designed to amplify fragments with EcoRI and NotI restriction sites that could be used for insertion into the same sites in the pCDNA3.1 plasmid (Invitrogen). The forward primer was (5’-TAAGCAGAATTC ATGAATTTGCCAGGAAGAT-3’) (SEQ ID NO: 26), and the reverse primer was (5’-CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3’) (SEQ ID NO: 27).

[0205] The sequences of the Gag, Pol, and integrase fragments were as follows:

Chemical formula

Chemical formula

[0206] Next, a DNA fragment containing the sequences of Rev, RRE, and rabbit beta-globin polyA together with XbaI and XmaI flanking restriction sites was synthesized by Eurofins Genomics. Subsequently, the DNA fragment was inserted into the plasmid at the XbaI and XmaI restriction sites. The DNA sequence was as follows:

Chemical formula

[0207] Finally, the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer / promoter plus chicken beta-actin intron sequence. A DNA fragment containing the CAG enhancer / promoter / intron sequence together with MluI and EcoRI flanking restriction sites was synthesized by Eurofins Genomics. Subsequently, the DNA fragment was inserted into the plasmid at the MluI and EcoRI restriction sites. The DNA sequence was as follows:

Chemical formula

[0208] Construction of the VSV-G envelope plasmid: The vesicular stomatitis Indiana virus glycoprotein (VSV-G) sequence was synthesized by Eurofins Genomics using flanking EcoRI restriction sites. Subsequently, the DNA fragment was inserted into the pCDNA3.1 plasmid (Invitrogen) at the EcoRI restriction site, and its correct orientation was determined by sequencing using CMV-specific primers. The DNA sequence was as follows:

Chemical formula

[0209] Using the methods and materials described herein, a four-vector system (i.e., a three-vector lentiviral packaging system) was also designed and produced. A schematic diagram of the four-vector system is shown in FIG. 3. Briefly with respect to FIG. 3, the top vector is a helper plasmid, which in this case does not contain Rev. The second vector from the top is a separate Rev plasmid. The second vector from the bottom is an envelope plasmid. The bottom vector is the therapeutic vector described above.

[0210] With respect to part of FIG. 3, the helper plasmid contains the CMV (CAG) enhancer (SEQ ID NO: 21), the chicken beta-actin (CAG) promoter (SEQ ID NO: 13), the chicken beta-actin intron (SEQ ID NO: 22), HIV gag (SEQ ID NO: 14), HIV Pol (SEQ ID NO: 15), HIV Int (SEQ ID NO: 16), HIV RRE (SEQ ID NO: 8), and rabbit beta-globin polyA (SEQ ID NO: 23).

[0211] The Rev plasmid contains the RSV promoter and HIV Rev (SEQ ID NO: 33), and rabbit beta-globin polyA (SEQ ID NO: 23).

[0212] The envelope plasmid contains the CMV promoter (SEQ ID NO: 19), the beta-globin intron (SEQ ID NO: 24), VSV-G (SEQ ID NO: 20), and rabbit beta-globin polyA (SEQ ID NO: 23).

[0213] Synthesis of a three-vector lentiviral packaging system comprising a helper plasmid, a Rev plasmid, and an envelope plasmid Materials and Methods: Construction of a helper plasmid without Rev: A helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and rabbit beta-globin polyA sequences. This sequence was synthesized by Eurofins Genomics using adjacent XbaI and XmaI restriction sites. Subsequently, the RRE / rabbit polyA beta-globin sequence was inserted into the helper plasmid at the XbaI and XmaI restriction sites. The DNA sequence is as follows:

Chem.

Chem.

[0214] Construction of the Rev plasmid: The RSV promoter and the HIV Rev sequence were synthesized as a single DNA fragment by Eurofins Genomics using adjacent MfeI and XbaI restriction sites. Subsequently, the DNA fragment was inserted into the pCDNA3.1 plasmid (Invitrogen) at the MfeI and XbaI restriction sites where the CMV promoter was replaced by the RSV promoter. The DNA sequence was as follows:

Chem.

Chem.

[0215] Plasmids for the 2-vector packaging system and the 3-vector packaging system can be modified using similar elements, and the intron sequences can be removed without losing vector function. For example, the following elements could replace similar elements in the 2-vector packaging system and the 3-vector packaging system:

[0216] Promoters: The elongation factor-1 (EF-1) (SEQ ID NO: 34), phosphoglycerate kinase (PGK) (SEQ ID NO: 35), and ubiquitin C (UbC) (SEQ ID NO: 36) can replace the CMV promoter (SEQ ID NO: 19) or the chicken beta-actin (CAG) promoter (SEQ ID NO: 13). These sequences can also be further modified by addition, substitution, deletion, or mutation.

[0217] PolyA sequences: The SV40 polyA (SEQ ID NO: 37) and bGH polyA (SEQ ID NO: 38) can replace the rabbit beta-globin polyA (SEQ ID NO: 23). These sequences can also be further modified by addition, substitution, deletion, or mutation.

[0218] HIV Gag, Pol, and Integrase sequences: The HIV sequences in the helper plasmid can be constructed from different HIV strains or clades. For example, the HIV Gag (SEQ ID NO: 14), HIV Pol (SEQ ID NO: 15), and HIV Int (SEQ ID NO: 16) from the Bal strain can be exchanged with the gag, pol, and int sequences contained in the helper / helper plus Rev plasmid as outlined herein. These sequences can also be further modified by addition, substitution, deletion, or mutation.

[0219] Envelope: The VSV-G glycoprotein can be replaced with the membrane glycoprotein from feline endogenous virus (RD114) (SEQ ID NO: 39), gibbon ape leukemia virus (GALV) (SEQ ID NO: 40), rabies (FUG) (SEQ ID NO: 41), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 42), avian influenza A fowl pest virus (FPV) (SEQ ID NO: 43), Ross River alphavirus (RRV) (SEQ ID NO: 44), murine leukemia virus 10A1 (MLV) (SEQ ID NO: 45), or Ebola virus (EboV) (SEQ ID NO: 46). The sequences of these envelopes are specified as the sequence portions herein. Furthermore, these sequences can also be further modified by addition, substitution, deletion, or mutation.

[0220] In summary, in part, the 3-vector system and the 4-vector system can be compared and contrasted as follows. The 3-vector lentiviral vector system contains the following: 1. Helper plasmid: HIV Gag, Pol, Integrase, and Rev / Tat; 2. Envelope plasmid: VSV-G / FUG envelope; and 3. Therapeutic vector: RSV 5’LTR, psi packaging signal, RRE, cPPT, H1, shFDPS, CMV, BTN3A3(R381H)T2A IL-2, WPRE, and 3’δ LTR. The 4-vector lentiviral vector system contains the following: 1. Helper plasmid: HIV Gag, Pol, and Integrase; 2. Rev plasmid: Rev; 3. Envelope plasmid: VSV-G / FUG envelope; and 4. Therapeutic vector: RSV 5’LTR, psi packaging signal, RRE, cPPT, H1, shFDPS, CMV, BTN3A3(R381H)T2A IL-2, WPRE, and 3’δ LTR. The sequences corresponding to the above elements are specified as part of the sequence listing herein.

[0221] (Example 2) Development of a Lentiviral Vector That Inhibits FDPS The objective of this example was to develop an FDPS-inhibiting lentiviral vector, also referred to herein as LV-shFDPS.

[0222] Design of inhibitory RNAs: Using the sequence of Homo sapiens farnesyl diphosphate synthase (FDPS) mRNA (NM_002004.3), potential siRNA or shRNA candidates for knocking down FDPS levels in human cells were searched. Potential RNA interference sequences were identified by siRNA or shRNA design programs such as the GPP Web Portal (http: / / portals.broadinstitute.org / gpp / public / ) hosted by the Broad Institute or the BLOCK-iT RNAi Designer of Thermo Scientific (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). To regulate shRNA expression, individual selected shRNA sequences were inserted into lentiviral vectors immediately 3' to RNA polymerase III promoters such as H1 (SEQ ID NO: 10), U6 (SEQ ID NO: 47) or 7SK (SEQ ID NO: 48). These lentiviral shRNA constructs were used for cell transduction and changes in specific mRNA levels were measured. The most potent shRNAs for mRNA level reduction were individually embedded within a microRNA backbone to enable expression by either the EF1 alpha or CMV RNA polymerase II promoter. The microRNA backbone was selected from mirbase.org. RNA sequences were also synthesized as synthetic siRNA oligonucleotides and introduced directly into cells without using lentiviral vectors.

[0223] Construction of Lentiviral Vector: For FDPS shRNA, oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins Genomics. Overlapping sense and antisense oligonucleotide sequences were mixed and annealed while cooling from 70 °C to room temperature. The lentiviral vector was digested with restriction enzymes BamHI and EcoRI at 37 °C for 1 hour. The digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Thermo Scientific. The DNA concentration was determined, and the vector was mixed with the oligo (at a ratio of 3:1), annealed, and ligated. The ligation reaction was performed using T4 DNA ligase at room temperature for 30 minutes. 2.5 microliters of the ligation mixture was added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat shock at 42 °C. Bacterial cells were spread on agar plates containing ampicillin, and drug-resistant colonies (indicating the presence of the ampicillin-resistant plasmid) were recovered and grown in LB medium. To confirm the insertion of the oligo sequence, plasmid DNA was extracted from the recovered bacterial culture using a DNA miniprep kit from Thermo Scientific. The insertion of the shRNA sequence into the lentiviral vector was verified by DNA sequencing using specific primers for the promoter used to regulate the expression of shRNA. The following target sequences were used to determine exemplary shRNA sequences for knocking down FDPS: GTCCTGGAGTACAATGCCATT (FDPS target sequence #1; SEQ ID NO: 49); GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT (FDPS shRNA sequence #1; SEQ ID NO: 1); GCAGGATTTCGTTCAGCACTT (FDPS target sequence #2; SEQ ID NO: 50); GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (FDPS shRNA sequence #2; SEQ ID NO: 2); GCCATGTACATGGCAGGAATT (FDPS target sequence #3; SEQ ID NO: 51); GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (FDPS shRNA sequence #3; SEQ ID NO: 3); GCAGAAGGAGGCTGAGAAAGT (FDPS target sequence #4; SEQ ID NO: 52); and GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (FDPS shRNA sequence #4; SEQ ID NO: 4).

[0224] Without limitation to any of the foregoing, a therapeutic vector (also referred to herein as a lentiviral plasmid) can be constructed as detailed in FIGS. 2-4. Continuing with reference to FIG. 4, Vector 1 includes, from left to right, a 5' LTR sequence; a psi sequence; an RRE sequence; a CMV sequence; a BTN3A1 sequence; a WPRE sequence; and a 3' LTR sequence. Vector 2 includes, from left to right, a 5' LTR sequence; a psi sequence; an RRE sequence; a CMV sequence; a BTN3A3 sequence; a WPRE sequence; and a 3' LTR sequence. Vector 3 includes, from left to right, a 5' LTR sequence; a psi sequence; an RRE sequence; a CMV sequence; a BTN3A3 (R381H) sequence; a WPRE sequence; and a 3' LTR sequence. Vector 4 includes, from left to right, a 5' LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; a BTN3A1 sequence; a WPRE sequence; and a 3' LTR sequence. Vector 5 includes, from left to right, a 5' LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; a BTN3A3 sequence; a WPRE sequence; and a 3' LTR sequence. Vector 6 contains, from left to right, a 5’LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; a BTN3A3(R381H) sequence; a WPRE sequence; and a 3’LTR sequence. Vector 7 contains, from left to right, a 5’LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; an AFP sequence; a BTN3A3(R381H) sequence, a WPRE sequence; and a 3’LTR sequence. Vector 8 contains, from left to right, a 5’LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; an IL-2 sequence; a WPRE sequence; and a 3’LTR sequence. Vector 9 contains, from left to right, a 5’LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; an IL-15 sequence; a WPRE sequence; and a 3’LTR sequence. Vector 10 contains, from left to right, a 5’LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; an IL-18 sequence; a WPRE sequence; and a 3’LTR sequence. Vector 11 contains, from left to right, a 5’LTR sequence; a psi sequence; an RRE sequence; an H1 sequence; a shFDPS sequence; a CMV sequence; a BTN3A3(R381H) sequence; a T2A sequence; an IL-2 sequence; a WPRE sequence; and a 3’LTR sequence.

[0225] (Example 3) Expression of BTN3A3(R381H) or BTN3A3(WT) in PC3 prostate cancer cells As shown in Figure 5, this example demonstrates that the expression of BTN3A3(R381H) or BTN3A3(WT) in PC3 cells by lentivirus (LV) expressing BTN3A3(R381H) or BTN3A3(WT) stimulates TNF-α expression in GD T cells.

[0226] PC3 cells were transduced with either an LV vector, LV-BTN3A3(R381H), or LV-BTN3A3(WT). Three days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5×10 5 PBMC cells and IL-2 in round-bottom 96-well plates. PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were selected on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the percentages of Vγ9Vδ2 T cells expressing TNF-α were 0.37% for the LV vector, 26.7% for BTN3A3(R381H), and 0.44% for LV-BTN3A3(WT). In the presence of zoledronic acid, the percentages of Vγ9Vδ2 T cells expressing TNF-α were 8.91% for the LV vector, 35.2% for BTN3A3(R381H), and 8.76% for LV-BTN3A3(WT).

[0227] (Example 4) Expression of BTN3A3(R381H) and knockdown of FDPS in HepG2 liver cancer cells by shRNA #4 This example demonstrates, as shown in Figure 6, that lentivirus (LV)-expressed BTN3A3(R381H) and knockdown of BTN3A3(R381H) and FDPS cells by FDPS shRNA #4 stimulate TNF-α expression in γδ T cells.

[0228] HepG2 cells were transduced with an LV vector, LV-BTN3A3(R381H), or LV-shFDPS-BTN3A3(R381H). Three days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced HepG2 cells were co-cultured with 5×10 5 cells of PBMC and IL-2 in round-bottom 96-well plates. PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were selected on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the percentages of Vγ9Vδ2 T cells expressing TNF-α were 0.6% with the LV vector, 9.5% with BTN3A3(R381H), and 13.2% in combination with LV-shFDPS-BTN3A3(R381H). In the presence of zoledronic acid, the percentages of Vγ9Vδ2 T cells expressing TNF-α were 7.2% with the LV vector, 17.8% with BTN3A3(R381H), and 30.1% in combination with LV-shFDPS-BTN3A3(R381H).

[0229] (Example 5) Expression of BTN3A3(R381H) and knockdown of FDPS in PC3 prostate cancer cells by shRNA #4

[0230] This example, as shown in Figure 7, illustrates that lentivirus (LV)-expressed BTN3A3(R381H) and expression of BTN3A3(R381H) and knockdown of FDPS cells by FDPS shRNA #4 stimulate TNF-α expression in γδ T cells. PC3 cells were transduced with an LV vector, LV-BTN3A3(R381H), or LV-shFDPS-BTN3A3(R381H). Three days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5×10 5 PBMC cells and IL-2 in round-bottom 96-well plates. PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were selected on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 0.1% with the LV vector, 21.1% with BTN3A3(R381H), and 18.2% in combination with LV-shFDPS-BTN3A3(R381H). In the presence of zoledronic acid, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 13.6% with the LV vector, 25.5% with BTN3A3(R381H), and 39.6% in combination with LV-shFDPS-BTN3A3(R381H).

[0231] (Example 6) Expression of IL-2 and knockdown of FDPS in HepG2 liver cancer cells by shRNA #4 This example, as shown in Figure 8, demonstrates that expression of IL-2 and knockdown of FDPS cells by lentivirus (LV) expressing IL-2 and FDPS shRNA #4 stimulate TNF-α expression in GD T cells.

[0232] HepG2 cells were transduced with LV-shFDPS or LV-shFDPS-IL-2. Three days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced HepG2 cells were co-cultured for 4 hours with 5×10 5 PBMC cells in round-bottom 96-well plates, with or without IL-2. PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were selected on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. When using zoledronic acid alone, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 7.5% with LV-shFDPS and 20.1% with LV-shFDPS-IL-2. When using zoledronic acid and IL-2, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 27.8% with LV-shFDPS and 24.7% with LV-shFDPS-IL-2.

[0233] (Example 7) Expression of IL-2 and knockdown of FDPS in PC3 cancer cells by shRNA #4 This example demonstrates, as shown in Figure 9, that the expression of IL-2 and knockdown of FDPS cells by lentivirus (LV) expressing IL-2 and FDPS shRNA #4 stimulate TNF-α expression in GD T cells.

[0234] PC3 cells were transduced with LV-shFDPS or LV-shFDPS-IL-2. Three days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured for 4 hours with 5×10 5Individual PBMC cells were co-cultured with or without IL-2. PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated and Vδ2+ and TNF-α+ cells were selected on a dot blot. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. When using zoledronic acid alone, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 24.6% for LV-shFDPS and 46.8% for LV-shFDPS-IL-2. When using zoledronic acid and IL-2, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 48.6% for LV-shFDPS and 41% for LV-shFDPS-IL-2.

[0235] (Example 8) Expression of IL-15 and knockdown of FDPS in PC3 cancer cells by shRNA #4 This example, as shown in Figure 10, illustrates that expression of IL-15 and knockdown of FDPS cells by lentivirus (LV) expressing IL-15 and FDPS shRNA #4 stimulates TNF-α expression in γδ T cells.

[0236] PC3 cells were transduced with an LV vector, LV-shFDPS, or LV-shFDPS-IL-15. Three days after transduction, the cells were treated with 1 μM zoledronic acid with or without. After 24 hours, the transduced PC3 cells were placed in a round-bottom 96-well plate for 4 hours at 5×10 5Individual PBMC cells were co-cultured with or without IL-2. PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were selected on a dot blot. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. When using zoledronic acid alone, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 10% with the LV vector, 13% with LV-shFDPS, and 14.6% with LV-shFDPS-IL-15. When using zoledronic acid and IL-2, the percentage of Vγ9Vδ2 T cells expressing TNF-α was 14.5% with the LV vector, 21.7% with LV-shFDPS, and 21% with LV-shFDPS-IL-15.

[0237] (Example 9) Expression of BTN3A3 in PC3 cancer cells and HepG2 cancer cells by LV-BTN3A3(R381H) and LV-shFDPS-BTN3A3(R381H) This example, as shown in Figure 11, illustrates that lentivirus (LV)-expressed BTN3A3(R381H), alone and together with shFDPS, increases BTN3A3 expression in PC3 cancer cells and HepG2 cancer cells.

[0238] As shown in FIGS. 11A and 11B, PC3 prostate cancer cells or HepG2 liver cancer cells were transduced with an LV vector or LV-BTN3A3(R381H) for 3 days. After staining BTN3A3 using an anti-BTN3A3(CD277) antibody conjugated to a fluorophore, the cells were analyzed by flow cytometry. There were increases in mean fluorescence intensity (MFI) from 6 to 21 and from 3 to 10 in PC3 cells and HepG2 cells, respectively. As shown in FIG. 11C, HepG2 liver cancer cells were transduced with an LV vector or LV-shFDPS-BTN3A3(R381H) for 3 days. There was an increase in mean fluorescence intensity (MFI) from 4 to 18.

[0239] (Example 10) Cytotoxicity of Lv-shFDPS-transduced cells and stimulation of Vγ2Vδ2 cells by zoledronic acid This example illustrates that, as shown in FIG. 12, the activation of cytotoxic Vγ2Vδ2 cells is increased by treatment with a lentivirus expressing shFDPS (LV-shFDPS) and zoledronic acid.

[0240] HepG2 liver cancer cells were transduced with Lv-shFDPS, Lv-FDPS-IL-15 (expressing both shRNAFDPS and human cytokine interleukin 15), or Lv control and cultured for 72 hours. Zoledronic acid (1 μM) was added to (1) cells transduced with Lv-shFDPS, (2) cells transduced with Lv-FDPS-IL-15, and (3) HepG2 cells transduced with Lv control. The treated cells were cultured for 24 hours. Lv-shFDPS-transduced cells, Lv-FDPS-IL-15-transduced cells, and Lv control-transduced cells were co-cultured with PBMC enriched for Vγ9Vδ2 cells and a protein transport inhibitor (BD GolgiStop) for 4 hours. After 4 hours of stimulation, the cells were harvested, labeled with Vδ2 phycoerythrin (PE) and TNFα allophycocyanin (APC), and the labeled cells were analyzed by flow cytometry.

[0241] The frequency of responsive Vγ9Vδ2 T cells (expressing TNF-α measured by intracellular cytokine staining) in the presence of 1 μM zoledronic acid was higher in Lv-FDPS than in the Lv control and was further increased by Lv-FDPS-IL-15. The addition of 100 units / mL of interleukin-2 (IL-2) increased the activation of Vγ9Vδ2 T cells by HepG2 transduced with Lv-FDPS compared to the Lv control, but IL-2 replaced IL-15 and reduced the difference between HepG2 treated with Lv-FDPS and HepG2 treated with Lv-FDPS-IL-15 with respect to the activation of Vγ9Vδ2 T cells.

[0242] (Example 11) Growth curves of Lv-shFDPS versus Lv control-transduced PC3 tumors in mice This example, as shown in Figure 13, illustrates that the tumor growth rate of human prostate cancer (PC3) cells in mice is slower after treatment with Lv-shFDPS.

[0243] Three million PC3 cells transduced with Matrigel® and either Lv-shFDPS or Lv control were subcutaneously injected into NSG™ mice. Tumors were monitored and measured twice a week. Tumor size was determined by measuring the vertical diameter of each tumor using calipers. The following formula: d 2 × (D / 2) (where d = shortest diameter, D = longest diameter) was used to calculate the tumor volume (mm 3 ).

[0244] Xenograft PC3 tumors treated and / or transduced with Lv-shFDPS showed slower growth compared to the growth of xenograft PC3 tumors treated and / or transduced with Lv control. For example, it took 21 days for Lv control xenograft PC3 tumors to grow to 300 mm 3 whereas it took 30 days for Lv-shFDPS xenograft PC3 tumors to grow to 300 mm 3 .

[0245] (Example 12) Tumor growth and survival of mice xenografted with Lv-FDPS or Lv control-transduced PC3 tumors when treated with or without Vγ9Vδ2 T cells and / or zoledronic acid This example demonstrates that treatment of xenografted PC3 tumors transduced with Lv-shFDPS and then treated with Vγ9Vδ2 T cells slows tumor growth and increases survival, with or without zoledronic acid treatment.

[0246] Three million PC3 cells transduced with either Matrigel® and Lv-shFDPS (also referred to as FDPS knockdown or "FDPS KD" in FIGS. 14 and 15) or Lv control (also referred to as "Lv" or "control" in FIGS. 14 and 15) were subcutaneously injected into the right flank of NSG™ mice. Tumors were monitored and measured until the tumor size reached approximately 300 mm 3 . Tumor size was determined by measuring the vertical diameter of each tumor using calipers. The following formula: d 2 × (D / 2) (where d = shortest diameter, D = longest diameter) was used to calculate the tumor volume (mm 3 ).

[0247] The resulting tumors were 300 mm 3When the size reached, the mice were randomized and grouped into 8 groups: 4 groups of Lv-shFDPS transfected mice and 4 groups of Lv control transfected mice. One group from each of the Lv-shFDPS transfected mice and Lv control transfected mice was treated with intraperitoneal injection of PBMC once a week for 4 weeks. One group from each of the Lv-shFDPS transfected mice and Lv control transfected mice was treated with 100 μg / kg of zoledronic acid. One group from each of the Lv-shFDPS transfected mice and Lv control transfected mice was treated with a combination of PBMC and zoledronic acid. One group from each of the Lv-shFDPS transfected mice and Lv control transfected mice was treated with intraperitoneal injection of PBS once a week for 4 weeks (control). The survival period of the mice was observed when the period was shorter than 95 days or the tumor size reached 2000 mm 3 and was observed when reached. At the end of the test, the tumors were resected and observed.

[0248] As shown in Figure 14, the Kaplan-Meier survival curve showed a significant survival advantage achieved by Lv-shFDPS PC3 xenograft mice compared to Lv control PC3 xenograft (scrambled) mice. The survival rate of Lv-shFDPS xenograft mice treated with PBMC (many of which were Vγ9Vδ2 cells) was higher than that of Lv-shFDPS xenograft mice not treated with PBMC. Treatment of Lv control PC3 xenograft mice with PBMC had no substantial effect on the survival period.

[0249] As shown in Figure 15, the macroscopic observation of Lv-shFDPS xenograft PC3 tumors showed a smaller tumor volume compared to the tumor volume of Lv control xenograft PC3 tumors. The tumor volume of Lv-shFDPS xenograft PC3 tumors treated with PBMC (many of which were Vγ9Vδ2 cells) decreased significantly compared to the tumor volume of Lv-shFDPS PC3 tumors not treated with PBMC. No significant difference was observed between Lv control xenograft mice treated or not treated with PBMC, and the tumor reached 2000 mm 3When they reached the size of , the constituents of these groups were culled. Lv- Treatment of Lv-

[0250] As shown in Figure 16, macroscopic observation of the appearance of Lv-shFDPS xenograft PC3 tumors showed that the volume of tumors treated with PBMC decreased significantly compared to the tumor volume of Lv-shFDPS PC3 tumors not treated with PBMC. Some Lv-shFDPS PC3 tumors treated with PBMC showed tumors that were not measurable.

[0251] (Example 13) Development of Lentiviral Vectors that Inhibit FDPS, GGPS1, and IDI1 This example describes the development of lentiviral vectors that inhibit FDPS, GGPS1, and IDI1, as shown in Figure 17.

[0252] Cloning of shRNA sequences: Potential RNA interference sequences were identified using the shRNA design program from the Broad Institute of Thermo Scientific's BLOCK-iT RNAi Designer (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ) (http: / / portals.broadinstitute.org / gpp / public / seq / search). Short hairpin oligonucleotide sequences containing BamHI and EcoRI restriction sites or microRNA sequences containing BsrGI and EcoRI restriction sites were synthesized by Eurofins Genomics. The oligonucleotide sequences were annealed by incubating at 70 °C and then cooling to room temperature for 1 hour. In parallel, the lentiviral vector was digested with the restriction enzymes BamHI and EcoRI or BsrGI and EcoRI at 37 °C for 1 hour. The digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit (Thermo Scientific). The DNA concentration was determined for each, and 50 ng of the vector was added to 2 microliters of the annealed oligo. A ligation reaction was performed at room temperature for 30 minutes using T4 DNA ligase. 2.5 microliters of the ligation mixture was added to 25 microliters of StbI3 competent bacterial cells. Transformation was performed using a heat shock step at 42 °C. Bacterial cells were streaked on agar plates containing ampicillin, and the selected colonies were grown in LB medium. To confirm the insertion of the oligo sequence, a DNA miniprep kit (Thermo Plasmid DNA was extracted from the recovered bacterial cultures using (Scientific). Insertion of the shRNA sequences into the lentiviral vectors was verified by DNA sequencing using H1 or EF-1 primers. Lentiviral particles were packaged to test their ability to knockdown mRNA using lentiviral vectors containing the correct shRNA sequences. Cells were transduced with the lentiviral particles and harvested 3 days later. Both protein and mRNA were analyzed.

[0253] Identification of FDPS shRNA sequences. Using the sequence of Homo sapiens farnesyl diphosphate synthase (FDPS) mRNA (NM_002004.3), potential shRNA candidates were searched for to reduce FDPS levels in human cells. In addition to FDPS shRNA sequences #1 - 4 as discussed above, the following exemplary shRNA and microRNA sequences for knocking down FDPS were determined: ACTTTCTCAGCCTCCTTCTGCCTCGAGGCAGAAGGAGGCTGAGAAAGTTTTTT (FDPS shRNA sequence #4A; SEQ ID NO: 64); GCAGAAGGAGGCTGAGAAAGTGAGCTCACTTTCTCAGCCTCCTTCTG (FPDS shRNA sequence #4R; SEQ ID NO: 65); GCAGAAGGAGGCTGAGAAAGTTTACTTTCTCAGCCTCCTTCTGCTTTTT (FDPS shRNA sequence #4TT; SEQ ID NO: 66); GCAGAAGGAGGCTGAGAAAGTACTTTCTCAGCCTCCTTCTGCTTTTT (FDPS shRNA sequence #4L; SEQ ID NO: 67); AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (FDPS miR30 sequence #1; SEQ ID NO: 68); AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (FDPS miR30 sequence #3; SEQ ID NO: 69).

[0254] Identification of GGPS1 shRNA sequences. Using the sequence of Homo sapiens geranylgeranyl pyrophosphate synthase (GGPS1) mRNA (NM_001037277.1), potential shRNA candidates for reducing GGPS1 in human cells were searched. Using the following target sequences, exemplary shRNA sequences for knocking down GGPS1 were determined: GCTTGAAGCTAAAGCCTATAA (GGPS1 target sequence #1; SEQ ID NO: 73); GCTTGAAGCTAAAGCCTATAACTCGAGTTATAGGCTTTAGCTTCAAGCTTTTT (GGPS1 shRNA sequence #1; SEQ ID NO: 70); GTACATTATCTTGAGGATGTA (GGPS1 target sequence #2; SEQ ID NO: 74); GTACATTATCTTGAGGATGTACTCGAGTACATCCTCAAGATAATGTACTTTTT (GGPS1 shRNA sequence #2; SEQ ID NO: 71); CCTGAGCTAGTAGCCTTAGTA (GGPS1 target sequence #3; SEQ ID NO: 75); and CCTGAGCTAGTAGCCTTAGTACTCGAGTACTAAGGCTACTAGCTCAGGTTTTT (GGPS1 shRNA sequence #3; SEQ ID NO: 72).

[0255] Identification of IDI1 shRNA sequences: Using the sequence of Homo sapiens isopentenyl diphosphate delta-isomerase 1 (IDI1) mRNA (NM_004508.3), potential shRNA candidates were searched for to reduce IDI1 levels in human cells. Using the following target sequences, exemplary shRNA sequences were determined to knockdown IDI1: GCCAGTGGTGAAATTAAGATA (IDI1 target sequence; SEQ ID NO: 77); and GCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTT (IDI1 shRNA sequence; SEQ ID NO: 76).

[0256] (Example 14) Expression of FDPS RNA and protein in HepG2 hepatocellular carcinoma cells transduced with lentivirus expressing shFDPS This example illustrates the reduction of FDPS RNA and protein expression by shFDPS in HepG2 cells.

[0257] Figure 18 shows that FDPS protein expression is reduced by shFDPS. HepG2 cells were infected at 5 MOI with a lentiviral vector containing either shCon or one of two different FDPS shRNA sequences, LV-shFDPS #1 (SEQ ID NO: 1) or LV-shFDPS #4 (SEQ ID NO: 4). After 48 hours, the cells were treated with 1 μM zoledronic acid (Zol) or not. After 72 hours, the cells were lysed and immunoblotted using an anti-FDPS antibody and an anti-actin antibody as a protein loading control. Densitometry of the immunoblot bands was quantified, setting the LV-sh control to 1 (100%). Reductions of 62% (LV-shFDPS #1 (SEQ ID NO: 1)), 48% (LV-shFDPS #1 + Zol (SEQ ID NO: 1)), 44% (LV-shFDPS #4 (SEQ ID NO: 4)), and 32% (LV-shFDPS #4 + Zol (SEQ ID NO: 4)) in FDPS protein expression were observed.

[0258] (Example 15) Expression of FDPS protein in PC3 prostate cancer cells transduced with a lentivirus expressing variations of the shFDPS hairpin loop This example demonstrates that variations of the shFDPS hairpin loop; A (antisense-loop-sense), R (sense-reverse loop-antisense), TT (sense-TT-antisense), and L (sense-antisense) are effective in reducing FDPS protein expression in PC3 cells.

[0259] PC3 cells were infected with a lentiviral vector containing a non-targeting sequence (shCon) or different variations of shFDPS, namely shFDPS #4 (SEQ ID NO: 4), shFDPS-A (SEQ ID NO: 64), shFDPS-R (SEQ ID NO: 65), shFDPS-TT (SEQ ID NO: 66), or shFDPS-L (SEQ ID NO: 67) at 5 MOI. After 72 hours, the cells were lysed and RNA was extracted using the RNeasy mini kit. cDNA was synthesized from the RNA using the SuperScript VILO cDNA Synthesis Kit. After performing a PCR reaction using TaqMan Fast Advanced Master Mix, the samples were analyzed by quantitative PCR (qPCR) using an Applied Biosystems QuantStudio3 qPCR instrument (Thermo Scientific).

[0260] The expression of FDPS cDNA was determined by quantitative PCR using TaqMan FDPS probes and FDPS primers. For Figure 19A, the expression of FDPS was detected using the Fam-labeled TaqMan probe (5’-TAGCATCTCCTATCTCTGGGTGCCC-3’) (SEQ ID NO: 78) with the FDPS forward primer (5’-GTGCTGACTGAGGATGAGATG-3’) (SEQ ID NO: 79) and the reverse primer (5’-CCGGTTATACTTGCCTCCAAT-3’) (SEQ ID NO: 80). Samples were normalized against the expression of actin. Actin was detected using the Fam-labeled TaqMan probe (5’-AGCGGGAAATCGTGCGTGAC-3’) (SEQ ID NO: 81) with the actin forward primer (5’-GGACCTGACTGACTACCTCAT-3’) (SEQ ID NO: 82) and the reverse primer (5’-CGTAGCACAGCTTCTCCTTAAT-3’) (SEQ ID NO: 83). The relative FDPS RNA expression of the shCon sample was set at 100%. As shown in Figure 19A, there were decreases in FDPS expression of 95% (shFDPS #4 (SEQ ID NO: 4)), 75% (shFDPS-A (SEQ ID NO: 64)), 95% (shFDPS-R (SEQ ID NO: 65)), 90% (shFDPS-TT (SEQ ID NO: 66)) and 72% (FDPS-L (SEQ ID NO: 67)).

[0261] To examine the effect of shFDPS variations on protein expression, PC3 cells were infected at 5 MOI with a lentiviral vector containing either the sh control or the shFDPS #4 variation. After 72 hours, the cells were lysed and immunoblotted using anti-FDPS and anti-actin antibodies as a protein loading control. The densitometry of the immunoblot bands was quantified, and LV-sh control was set to 1 (100%). As shown in Figure 19B, there were reductions in FDPS protein expression of 87% (LV-shFDPS #4 (SEQ ID NO: 4)), 13% (LV-shFDPS-A (SEQ ID NO: 64)), 88% (LV-shFDPS-R (SEQ ID NO: 65)), 81% (LV-FDPS-TT (SEQ ID NO: 66)), and 37% (LV-FDPS-L (SEQ ID NO: 67)).

[0262] (Example 16) Expression of FDPS protein in HepG2 hepatocellular carcinoma cells transduced with a lentivirus expressing miR30-FDPS This example illustrates the decrease in FDPS protein expression in cells transduced with a lentivirus expressing miR30-FDPS.

[0263] To measure the expression of FDPS protein, HepG2 human hepatocellular carcinoma cells were infected with lentiviral vectors containing either sh control, shFDPS #3 (SEQ ID NO: 3), miR30-FDPS #1 (SEQ ID NO: 68), or miR30-FDPS #3 (SEQ ID NO: 69) at 5 MOI. After 72 hours, the cells were lysed using NP-40 lysis buffer, and the protein was measured using Bio-Rad protein assay reagent. Fifty microgram protein samples were electrophoresed on a 4–12% bis-tris gel (Thermo Scientific) and transferred to a PVDF membrane. The blot was blocked in 5% blotting grade blocker. Immunoblotting was performed using an anti-FDPS antibody (Bethyl Laboratories) and an anti-actin antibody (Millipore Sigma) as a protein loading control. The antibody was conjugated with a secondary antibody conjugated with HRP (Thermo Scientific) and detected using an Immobilon Western ECL reagent (Millipore Sigma) with a Licor c-DiGit Blot scanner. The densitometry of the immunoblot bands was quantified using NIH Image software, and the LV control was set to 1 (100%). As shown in Figure 20, there were reductions of 85% (LV-shFDPS #4 (SEQ ID NO: 4)), 59% (LV-miR30-FDPS #1 (SEQ ID NO: 68)), and 53% (LV-miR30-FDPS #3 (SEQ ID NO: 69)) in the expression of the FDPS protein, respectively.

[0264] (Example 17) Activation of Vγ9Vδ2 T cells by THP-1 monocytic leukemia cancer cells transduced with a lentivirus expressing miR30-FDPS #1 This example demonstrates that, as shown in Figure 21, 7-day knockdown of FDPS in THP-1 monocytic leukemia cancer cells by treatment with LV expressing miR30-FDPS miRNA #1 (SEQ ID NO: 68) with or without zoledronic acid stimulates TNF-α expression in Vγ9Vδ2 T cells.

[0265] THP-1 cells (2×10 5 cells) were transduced with LV control or LV-miR30 FDPS #1 (SEQ ID NO: 68) for 7 days. The cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced THP-1 cells were co-cultured with 2×10 5 PBMC cells in a 5 mL round-bottom tube for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated and Vδ2+ and TNF-α+ cells were identified on a dot blot. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, LV control stimulated 2.44% of TNF-α-expressing Vγ9Vδ2 T cells, and LV-miR30 FDPS #1 (SEQ ID NO: 68) stimulated 28.4%. In the presence of zoledronic acid treatment, LV control stimulated 23.8% of TNF-α-expressing Vγ9Vδ2 T cells, and LV-miR30 FDPS #1 (SEQ ID NO: 68) stimulated 61.4%.

[0266] (Example 18) Expression of GGPS1 protein in HeLa cervical cancer cells transduced with lentivirus expressing shGGPS1 HeLa cells were infected with lentiviral vectors containing either sh control or three different GGPS1 shRNA sequences, namely, LV-shGGPS1 #1 (SEQ ID NO: 70), LV-shGGPS1 #2 (SEQ ID NO: 71), or LV-shGGPS1 #3 (SEQ ID NO: 73) at 5 MOI. After 72 hours, the cells were lysed and immunoblotted using an anti-GGPS1 antibody from Santa Cruz Biotechnology (product number sc-271680) and an anti-actin antibody as a protein loading control. The densitometry of the immunoblot bands was quantified, with LV-sh control set to 1 (100%). As shown in Figure 22, there were reductions of 54% (LV-shGGPS1 #1 (SEQ ID NO: 70)), 69% (LV-shGGPS1 #2 (SEQ ID NO: 71)), and 51% (LV-shGGPS1 #3 (SEQ ID NO: 72)) in the expression of the FDPS protein, respectively.

[0267] (Example 19) Activation of Vγ9Vδ2 T cells by PC3 prostate cancer cells transduced with lentiviruses expressing shFDPS or shGGPS1 and treated with zoledronic acid This example demonstrates, as shown in Figure 23, that 3-day knockdown of FDPS or GGPS1 and treatment with zoledronic acid in PC3 cells transduced with LV-expressing FDPS shRNA #4 (SEQ ID NO: 4) or GGPS1 shRNA #1 (SEQ ID NO: 1) stimulate TNF-α expression in Vγ9Vδ2 T cells.

[0268] PC3 cells were transduced with LV control or LV-FDPS shRNA #4 (SEQ ID NO: 4) or LV-GGPS1 shRNA #1 (SEQ ID NO: 70) for 3 days. Two days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced PC3 cells were placed in round-bottom 96-well plates at 5×10 5Co-cultured with individual PBMC cells. PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the LV control stimulated 2.78% of TNF-α-expressing Vγ9Vδ2 T cells, while LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 0.77% and LV-GGPS1 #1 shRNA (SEQ ID NO: 70) stimulated 1.23%. In the presence of zoledronic acid treatment, the LV control stimulated 5.71% of TNF-α-expressing Vγ9Vδ2 T cells, while LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 11.4% and LV-GGPS1 #1 shRNA (SEQ ID NO: 70) stimulated 10%.

[0269] (Example 20) Activation of Vδ2+ T cells by lentiviruses expressing shFDPS or shGGPS1 and treated with zoledronic acid in HepG2 hepatocellular carcinoma cells This example, as shown in Figure 24, illustrates that 3-day knockdown of FDPS or GGPS1 and treatment with zoledronic acid in HepG2 cells transduced with LV-expressing FDPS shRNA #4 (SEQ ID NO: 4) or GGPS1 shRNA #1 (SEQ ID NO: 70) stimulates TNF-α expression in Vγ9Vδ2 T cells.

[0270] HepG2 cells were transduced with LV control or LV-FDPS shRNA #4 (SEQ ID NO: 4) or LV-GGPS1 shRNA #1 (SEQ ID NO: 70) for 3 days. Two days after transduction, the cells were treated with 1 μM zoledronic acid with or without. After 24 hours, the transduced HepG2 cells were placed in a round-bottom 96-well plate for 4 hours at 5×10 5Cultured with individual PBMC cells. PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to increase Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the LV control stimulated 0.36% of TNF-α-expressing Vγ9Vδ2 T cells, while LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 0.9% and LV-GGPS1 #1 (SEQ ID NO: 70) shRNA stimulated 0.58%. In the presence of zoledronic acid treatment, the LV control stimulated 6.88% of TNF-α-expressing Vγ9Vδ2 T cells, while LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 21.1% and LV-GGPS1 #1 shRNA (SEQ ID NO: 70) stimulated 12%.

[0271] (Example 21) Activation of Vγ9Vδ2 T cells by THP-1 cells transduced with lentiviruses expressing shFDPS or shGGPS1 and treated with zoledronic acid This example, as shown in Figure 25, illustrates that 3-day knockdown of FDPS or GGPS1 and treatment with zoledronic acid in THP-1 cells transduced with Lv-expressing FDPS shRNA #4 (SEQ ID NO: 4) and / or GGPS1 shRNA #1 (SEQ ID NO: 70) stimulates TNF-α expression in Vγ9Vδ2 T cells.

[0272] THP-1 cells were transduced with LV control or LV-FDPS shRNA #4 (SEQ ID NO: 4) or Lv-GGPS1 shRNA #1 (SEQ ID NO: 70) for 3 days. Two days after transduction, the cells were treated with 1 μM zoledronic acid with or without. After 24 hours, the transduced THP-1 cells were placed in a round-bottom 96-well plate for 4 hours at 5×10 5They were co-cultured with individual PBMC cells. The PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to increase Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the LV control stimulated 1.33% of TNF-α-expressing Vγ9Vδ2 T cells, while Lv-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 2.49%, Lv-GGPS1 #1 shRNA (SEQ ID NO: 70) stimulated 1.22%, and the combination of both stimulated 1.91%. In the presence of zoledronic acid treatment, the LV control stimulated 5.74% of TNF-α-expressing Vγ9Vδ2 T cells, while Lv-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 10.8%, Lv-GGPS1 shRNA #1 (SEQ ID NO: 70) stimulated 4.5%, and the combination of both stimulated 11.5%.

[0273] (Example 22) Expression of IDI1 protein in PC3 prostate cancer cells transduced with lentivirus expressing shIDI1 This example illustrates the effect of transduction using a lentiviral vector encoding an IDI1 shRNA sequence on IDI1 expression determined by immunoblot analysis.

[0274] PC3 cells were infected with a lentiviral vector containing either the sh control or the IDI1 shRNA sequence (SEQ ID NO: 76) at 5 MOI. After 72 hours, the cells were lysed and immunoblotted using an anti-IDI1 antibody from Thermo Fisher (product number PA5-44207) and an anti-actin antibody as a protein loading control. The densitometry of the immunoblot bands was quantified, with Lv-sh control set to 1 (100%). As shown in Figure 26, there was an 88% reduction in the expression of the IDI1 protein.

[0275] (Example 23) Activation of Vγ9Vδ2 T cells by PC3 prostate cancer cells transduced with lentiviruses expressing shFDPS or shIDI1 and treated with zoledronic acid This example demonstrates that, as shown in Figure 27, three-day knockdown of FDPS or IDI1 and treatment with zoledronic acid in PC3 cells transduced with Lv-expressing FDPS shRNA #4 (SEQ ID NO: 4) or IDI1 shRNA #1 (SEQ ID NO: 76) stimulates TNF-α expression in Vγ9Vδ2 T cells.

[0276] PC3 cells were transduced with Lv control or Lv-FDPS shRNA #4 (SEQ ID NO: 4) or LV-IDI1 shRNA #1 (SEQ ID NO: 76) for 3 days. Two days after transduction, the cells were treated with or without 1 μM zoledronic acid. After 24 hours, the transduced PC3 cells were placed in a round-bottom 96-well plate at 5×10 5Cultured with individual PBMC cells. PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to increase Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In the absence of zoledronic acid, the LV control stimulated 3.82% of TNF-α-expressing Vγ9Vδ2 T cells, while LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 2.28% and LV-IDI1 shRNA #1 (SEQ ID NO: 76) stimulated 1.92%. In the presence of zoledronic acid treatment, the LV control stimulated 8.66% of TNF-α-expressing Vγ9Vδ2 T cells, while LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 36.9% and LV-IDI1 shRNA #1 (SEQ ID NO: 76) stimulated 12.9%.

[0277] (Example 24) Activation of Vγ9Vδ2 T cells by THP-1 acute monocytic leukemia cells treated with zoledronic acid (Zol), FTI277 (FTI), or zaragozic acid (ZA) This example illustrates that treatment with zoledronic acid stimulates TNF-α expression in Vγ9Vδ2 T cells, as shown in Figure 28.

[0278] ZA is a small molecule inhibitor of squalene synthase in the pathway involved in sterol synthesis. THP-1 cells were treated with either the FDPS inhibitor Zol (10 μM), the farnesyltransferase inhibitor FTI (10 μM), or ZA (50 μM) for 24 hours. THP-1 cells (2.5×10 5 ) were incubated in a round-bottom 96-well plate for 5 hours with 2.5×10 5They were co-cultured with individual PBMC cells. The PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. Untreated cells stimulated 3.08% of TNF-α-expressing Vγ9Vδ2 T cells, while zoledronic acid treatment stimulated 40.1%, FTI277 treatment stimulated 11.7%, and zaragozic acid stimulated 2.13%.

[0279] (Example 25) Activation of Vγ9Vδ2 T cells by PC3 prostate cancer cells transduced with lentivirus expressing shFDPS and treated with zoledronic acid (Zol), FTI277 (FTI), or zaragozic acid (ZA) This example, as shown in Figure 29, illustrates that treatment of PC3 cells transduced with LV-expressing FDPS shRNA #4 with zoledronic acid stimulates TNF-α expression in Vγ9Vδ2 T cells.

[0280] PC3 cells were transduced with LV control or LV-FDPS shRNA #4 (SEQ ID NO: 4) for 3 days. Two days after transduction, the cells were treated with or without 1 μM zoledronic acid, 1 μM FTI277, or 5 μM zaragozic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5×10 5 individual PBMC cells in round-bottom 96-well plates for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to expand Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on dot blots. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In LV control transduced cells, untreated cells stimulated 1.73% TNF-α-expressing Vγ9Vδ2 T cells, while zoledronic acid treatment stimulated 2.87%, FTI277 stimulated 1.64%, and zaragozic acid stimulated 1.57%. In LV-FDPS shRNA #4 (SEQ ID NO: 4) transduced cells, untreated cells stimulated 1.77% TNF-α-expressing Vγ9Vδ2 T cells, while zoledronic acid stimulated 50.3%, FTI277 stimulated 2.44%, and zaragozic acid stimulated 2.66%.

[0281] (Example 26) Activation of Vγ9Vδ2 T cells by HepG2 hepatocellular carcinoma cells transduced with lentivirus expressing shFDPS and treated with zoledronic acid (Zol), FTI277 (FTI), or zaragozic acid (ZA) This example demonstrates that treatment of HepG2 cells transduced with LV expressing FDPS shRNA #4 with zoledronic acid stimulates TNF-α expression in Vγ9Vδ2 T cells, as shown in Figure 30.

[0282] HepG2 cells were transduced with LV control or LV-FDPS shRNA #4 (SEQ ID NO: 4) for 3 days. Two days after transduction, the cells were treated with or without 1 μM zoledronic acid, 1 μM FTI277, or 5 μM zaragozic acid. After 24 hours, the transduced HepG2 cells were placed in a round-bottom 96-well plate at 5×10 5They were co-cultured with individual PBMC cells. The PBMC cells were pre-stimulated with zoledronic acid + IL-2 for at least 11 days to increase Vγ9Vδ2 T cells. After staining Vγ9Vδ2 and TNF-α using anti-TCR-Vδ2 antibody and anti-TNF-α antibody conjugated to fluorophores, the cells were analyzed by flow cytometry. Live cells were gated, and Vδ2+ and TNF-α+ cells were identified on a dot blot. Activated cytotoxic Vγ9Vδ2 T cells appeared in the upper right quadrant of the flow cytogram. In LV control transduced cells, untreated cells stimulated 1.82% of TNF-α-expressing Vγ9Vδ2 T cells, while zoledronic acid treatment stimulated 3.02%, FTI277 stimulated 1.72%, and zaragozic acid stimulated 1.63%. In LV-FDPS shRNA #4 (SEQ ID NO: 4) transduced cells, untreated cells stimulated 1.86% of TNF-α-expressing Vγ9Vδ2 T cells, while zoledronic acid stimulated 50.8%, FTI277 stimulated 2.69%, and zaragozic acid stimulated 2.82%.

[0283] Certain preferred embodiments of the present disclosure have been described and specifically exemplified above, but no invention is intended to be limited to such embodiments.

[0284] sequence The following sequences are referenced herein and incorporated into the present disclosure.

Table 1-1

Table 1-2

Table 1-3

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Table 1-8

Table 1-9

Table 1-10

Table 1-11

Table 1-12

Table 1-13

Table 1-14

Table 1-15

Table 1-16

Table 1-17

Table 1-18

Table 1-19

Table 1-20

Table 1-21

Table 1-22

Table 1-23

Table 1-24

Table 1-25

Table 1-26

Table 1-27

Table 1-28

Claims

[Claim 1] The invention as depicted in the drawings.

Images