Integrin αv and β3 production promoter

Abstract

To provide an integrin αV and β3 production promoter, a lymphatic capillary function improver, and an interstitial fluid absorption promoter through lymphatic capillaries, characterized by containing juniper berry extract.SOLUTION: The present invention provides a cosmetic, pharmaceutical, quasi-drug, or food product for improving lymphatic capillary function and promoting interstitial fluid absorption through lymphatic capillaries, characterized by containing juniper berry extract. The juniper berry extract of the present invention offers an integrin αV and β3 production-promoting effect, and are effective in improving lymphatic capillary function and promoting interstitial fluid absorption through lymphatic capillaries.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to an integrin αV and β3 production promoter, a lymphatic capillary function improver, and an interstitial fluid absorption promoter via lymphatic capillaries, which are characterized by containing an extract of juniper berry.

Background Art

[0002] Lymphatic vessels are tubular tissues that play a role in discharging lymph fluid from tissues throughout the body. Lymphatic vessels are distributed in a position close to blood vessels and have functions such as maintaining the homeostasis of body fluids, lipid absorption, immune response, and removal of foreign substances and metabolic products (Non-Patent Document 1). Lymphatic vessels are roughly classified into lymphatic capillaries and collecting lymphatic vessels. The lymph fluid sucked up by lymphatic capillaries is collected into the thoracic duct and the right lymphatic trunk through collecting lymphatic vessels and is poured into veins from the left and right venous angles. Lymph nodes are present in collecting lymphatic vessels, and white blood cells, especially lymphocytes, recognize bacteria, viruses, and cancer cells that have entered the lymph fluid and activate the immune function.

[0003] Lymphatic capillaries are located as microcirculation pathways together with capillaries in connective tissues throughout the body, such as the lower part of the dermal papillary layer of the skin. The lumen diameter is 40 to 100 μm, and the shape of the lumen is irregular (Non-Patent Document 2). Lymphatic capillaries consist of a single layer of lymphatic endothelial cells and a basement membrane, and smooth muscle cells are not observed in the wall, nor do they have a valve function. In addition, compared with vascular endothelial cells, the basement membrane of lymphatic capillaries is extremely underdeveloped, and the cells are loosely adhered to each other. Tie filaments are present on the outermost plasma membrane of lymphatic capillary endothelial cells and are strongly bound to collagen fibers and elastic fibers of the extracellular matrix.

[0004] The main component of the tethering filament is fibrin, which connects the extracellular matrix and the cytoskeleton of lymphatic endothelial cells via transmembrane integrins (mainly integrin αVβ3) and focal adhesions (Non-Patent Document 3). When interstitial fluid accumulates in the tissue stroma, the tethering filament acts to pull the endothelial cells in the circumferential direction. Therefore, the open junctions in the gaps between endothelial cells that make up the capillary lymphatic wall widen, and interstitial fluid flows from the surrounding stroma with increased hydrostatic pressure due to liquid retention into the lymphatic vessels (Non-Patent Document 4). When an abnormality occurs in such a reabsorption action of interstitial fluid, interstitial fluid accumulates in the tissue stroma, leading to lymphedema (Non-Patent Document 5).

[0005] Integrins are a major family of cell surface receptors that mediate cell-cell or cell-matrix adhesion and are adhesion molecules unique to multicellular organisms. They play a central role in cell migration, movement, transient cell aggregation, and cell adhesion-detachment mechanisms. As protein molecules, they are heterodimers composed of two subunits, an α-chain and a β-chain. There are many different α-chains and β-chains, and various combinations are possible.

[0006] Integrin αVβ3 is a subunit composed of integrin αV chain and integrin β3 chain, and is highly expressed in vascular constituent cells such as endothelial cells and smooth muscle cells. In lymphatic vessels, it is expressed at the adhesion site between the tethering filament and lymphatic endothelial cells, and it has been reported to be involved in the uptake of interstitial fluid through the tethering filament (Non-Patent Document 3). Therefore, enhancing the expression of integrin αV and β3 is very important in maintaining and improving such functions.

[0007] Juniper berry, with the scientific name Juniperus communis, is a coniferous tree belonging to the genus Juniper in the cypress family. It has drought tolerance, grows naturally in cold regions, and can be found in Hokkaido, Japan, etc. The fruit is a black-purple berry, and the leaves are evergreen needles. It is known to exhibit MMP inhibitory activity (Patent Document 1), inhibitory activity on the differentiation of preadipocytes (Patent Document 2), trypsin inhibitory activity (Patent Document 3), and proteasome activation activity (Patent Document 4).

[0008] However, nothing is known regarding an integrin αV and β3 production promoter, a lymphatic capillary function improver, and an interstitial fluid absorption promoter via lymphatic capillaries, which are characterized by containing an extract of juniper berries.

Prior Art Documents

Patent Documents

[0009]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Non-Patent Documents

[0010]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0011] Therefore, the problem to be solved by the present invention is to provide an excellent integrin αV and β3 production promoter, a lymphatic capillary function improver, and an interstitial fluid absorption promoter through lymphatic capillaries.

Means for Solving the Problem

[0012] As a result of intensive studies to solve the above problems, the present inventors have found that the extract of Juniperus communis has excellent effects of promoting the production of integrin αV and β3, improving the function of lymphatic capillaries, and promoting the absorption of interstitial fluid through lymphatic capillaries, and have completed the present invention.

[0013] That is, the present invention relates to an integrin αV and β3 production promoter, a lymphatic capillary function improver, and an interstitial fluid absorption promoter through lymphatic capillaries, which are characterized by containing an extract of Juniperus communis.

[0014] The present invention includes the following inventions. (1) An integrin αV and / or β3 production promoter for lymphatic capillary endothelial cells, which is characterized by containing an extract of Juniperus communis. (2) A lymphatic capillary function improver, which is characterized by containing an extract of Juniperus communis. (3) An interstitial fluid absorption promoter through lymphatic capillaries, which is characterized by containing an extract of Juniperus communis.

Effects of the Invention

[0015] The extract of Juniperus communis of the present invention was excellent in promoting the production of integrin αV and β3. In addition, the integrin αV and β3 production promoter for lymphatic capillary endothelial cells, which is characterized by containing this extract, improves the function of lymphatic capillaries. The integrin αV and β3 production promoter for lymphatic capillary endothelial cells of the present invention has an extract of a plant with a mild action as an active ingredient, so it has no side effects and high safety. Therefore, it can be safely used in pharmaceuticals, quasi-drugs, cosmetics, and foods and drinks.

Modes for Carrying Out the Invention

[0016] Integrin αV and β3 in the present invention are subunits composed of an integrin αV chain and an integrin β3 chain, are expressed at the adhesion site between the tethering filament and the lymphatic endothelial cell, and are involved in the uptake of interstitial fluid through the tethering filament. Integrin αV is also known as vitronectin receptor subunit α, CD51, MSK8, VNRA, ITGAV, and integrin β3 is also known as CD61, GP3A, GPIIIa, ITGB3.

[0017] The lymphatic capillary function in the present invention is the maintenance of body fluid homeostasis, mainly referring to the interstitial fluid absorption function, but also includes functions such as lipid absorption, immune response, and removal of foreign substances and metabolic products.

[0018] The interstitial fluid absorption in the present invention refers to the process of taking up interstitial fluid containing water, proteins, fats, and foreign substances such as cellular waste products, bacteria, and viruses leaked from capillaries into lymphatic capillaries. Due to the function of the tethering filaments present in the lymphatic capillaries, a gap is generated between the lymphatic endothelial cells that make up the lymphatic capillaries, and the interstitial fluid is taken in. The taken-in interstitial fluid, as lymph fluid, passes through the collecting lymphatic vessels, and after foreign substances are eliminated by the immune action in the lymph nodes, it flows into the subclavian vein. Malfunction of such interstitial fluid absorption leads to the onset of lymphedema and ultimately also has an adverse effect on the immune function.

[0019] The juniper berry used in the present invention can be Juniperus communis, a plant of the genus Vaccinium in the family Ericaceae, also known as Sabina vulgaris, Chinese juniper, or prickly juniper. In the present invention, juniper berry refers to the whole plant (whole herb), or a part of the plant such as fruits, leaves, stems, flowers, buds, seeds, roots, or a mixture thereof, with fruits being preferred. These plant bodies can be used as they are, or those subjected to treatments such as drying, pulverization, or mincing can also be used. Furthermore, it is preferable to perform dry heat treatment before extraction for the purpose of enhancing the effect.

[0020] As described above, dry heat treatment refers to a processing method in which heat is applied to a material without adding water, through a medium such as fire, air, oil, or a metal plate. Generally, it is said that dry heat treatment causes changes in chemical components such as proteins, and it is possible to change the color, taste, aroma, etc. There are also differences in the changes of chemical components depending on the heating temperature and time.

[0021] The temperature of dry heat treatment of juniper berries is preferably 100 °C or higher, more preferably 120 - 300 °C. Further, 150 - 250 °C is particularly preferred. At 300 °C or higher, the carbonization of the plant progresses easily and it is not suitable for extraction. The time of dry heat treatment varies depending on the temperature, but is preferably 5 minutes or more, more preferably 5 - 30 minutes. If heated for 60 minutes or more, the carbonization of the plant often progresses and it is often not suitable for extraction. Also, these treatments can be carried out in divided numbers such as 2 to 5 times. The total time at that time is preferably the time described above.

[0022] As a method of dry heat treatment, a dryer, a roasting machine, a metal tray, a frying pan, a metal pot, a pressure cooker, a stone pot, an iron plate, roasting, a hot plate, a baking stone, aluminum foil, an oven toaster, a grill, etc. can be used, and stirring, etc. can also be carried out as necessary.

[0023] The extraction method is not particularly limited, and it can be carried out by using water or hot water, or a mixed solvent of water and an organic solvent, and stirring or column extraction. Examples of the extraction solvent include water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, liquid paraffin, etc.), and ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are good, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are good. These solvents may be used alone or in combination of two or more. There is no particular limitation on the amount of the solvent used. For example, it may be 10 times or more, preferably 20 times or more, based on the fruit of Juniperus communis (dry weight), but it is preferably 100 times or less for the convenience of the operation when concentrating or isolating after extraction. Also, the extraction temperature and time can be appropriately selected depending on the type of the solvent used, the pressure during extraction, etc.

[0024] The above extract may be used as the extracted solution as it is, but if necessary, within the range where the effects of the present invention are exhibited, it may be used after performing treatments such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, etc., deodorization, and ethanol precipitation. Further, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, and freeze drying, and used as a dried product.

[0025] The present invention may use the above extract as it is, and within the range not impairing the effects of the extract, components such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, acidulants, etc., which are components used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., may be contained.

[0026] The present invention can be used in any of cosmetics, quasi-drugs, pharmaceuticals, and foods. Examples of its dosage forms include, for example, lotions, creams, milky lotions, gel agents, aerosol agents, essences, packs, detergents, bath agents, foundations, face powders, lipsticks, ointments, cataplasms, tablet confections, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsule agents, syrup agents, pills, suspensions, liquid agents, emulsions, suppositories, injection solutions, and the like.

[0027] In the case of external use, the content of the above extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 - 10% by weight, in terms of solids. Further, 0.01 - 5% by weight is most preferable. If it is less than 0.0001% by weight, sufficient effects are hardly expected. If it exceeds 10% by weight, it is difficult to recognize an enhancement of the effect and it is uneconomical.

[0028] In the case of internal use, the intake amount varies depending on age, body weight, symptoms, treatment effect, administration method, treatment time, etc. Usually, as the daily intake amount per adult, 5 mg or more is preferable, 10 mg - 5 g is more preferable, and further, 20 mg - 2 g is most preferable.

[0029] Next, in order to explain the present invention in detail, production examples, formulation examples, and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. Unless otherwise specified, the % shown in the examples indicates % by weight.

Examples

[0030] Juniper berry extract was produced as follows. In Production Examples 1 - 4, the dried product of juniper berry fruits (dried at 60°C or lower) was used after being subjected to dry heat treatment at a temperature of 180°C for 10 minutes under blowing. In Production Examples 5 - 8, the dried product of juniper berry fruits (dried at 60°C or lower) was used without being subjected to dry heat treatment.

[0031] (Production Example 1) Preparation of hot water extract of juniper berry fruits subjected to dry heat treatment 200 g of water was added to 10 g of dried juniper berries that had been subjected to dry heat treatment, and extraction was performed for 2 hours at 95 to 100° C. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 3.1 g of hot water extract of juniper berries that had been subjected to dry heat treatment.

[0032] (Production Example 2) Preparation of 50% ethanol extract of dry-heat-treated juniper berries 200g of 50% ethanol aqueous solution was added to 10g of dried juniper berries that had been subjected to dry heat treatment, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered, and the filtrate was concentrated and dried using an evaporator to obtain 3.5g of a 50% ethanol extract of dry-heat treated juniper berries.

[0033] (Production Example 3) Preparation of ethanol extract of dry-heat-treated juniper berries 200g of ethanol was added to 10g of dried juniper berries that had been subjected to dry heat treatment, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered, and the filtrate was concentrated and dried using an evaporator to obtain 2.0g of an ethanol extract of juniper berries that had been subjected to dry heat treatment.

[0034] (Production Example 4) Preparation of 1,3-butylene glycol extract of dry-heat-treated juniper berries 200g of 1,3-butylene glycol was added to 10g of dried juniper berries that had been subjected to dry heat treatment, and the mixture was soaked at room temperature for 7 days to perform extraction. The resulting extract was filtered to obtain 189g of 1,3-butylene glycol extract of dry-heat treated juniper berries.

[0035] (Production Example 5) Preparation of hot water extract of juniper berries 200 g of water was added to 10 g of dried juniper berry fruit, and the mixture was extracted for 2 hours at 95 to 100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 3.3 g of hot water extract of juniper berry fruit.

[0036] (Production Example 6) Preparation of 50% Ethanol Extract of Juniper Berry Fruit To 10 g of the dried product of juniper berry fruit, 200 g of a 50% ethanol aqueous solution was added, and the mixture was immersed at room temperature for 7 days for extraction. After filtering the obtained extract, the filtrate was concentrated to dryness by an evaporator to obtain 3.7 g of a 50% ethanol extract of juniper berry fruit.

[0037] (Production Example 7) Preparation of Ethanol Extract of Juniper Berry Fruit To 10 g of the dried product of juniper berry fruit, 200 g of ethanol was added, and the mixture was immersed at room temperature for 7 days for extraction. After filtering the obtained extract, the filtrate was concentrated to dryness by an evaporator to obtain 2.1 g of an ethanol extract of juniper berry fruit.

[0038] (Production Example 8) Preparation of 1,3-Butylene Glycol Extract of Juniper Berry Fruit To 10 g of the dried product of juniper berry fruit, 200 g of 1,3-butylene glycol was added, and the mixture was immersed at room temperature for 7 days for extraction. The obtained extract was filtered to obtain 192 g of a 1,3-butylene glycol extract of juniper berry fruit.

Examples

[0039] (Formulation Example 1) Lotion Formulation Content (%) 1. Hot water extract of juniper berry fruit subjected to dry heat treatment (Production Example 1) 2.0 2. 1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl paraben 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10. Perfume Appropriate amount 10. Perfume Appropriate amount 11. Make the total amount 100 with purified water. [Manufacturing method] Dissolve Components 1 to 6 and 11, and Components 7 to 10 uniformly respectively, mix the two, and filter to obtain the product.

[0040] (Formulation Example 2) Cream Formulation Content (%) 1. Fruit of Juniper berry subjected to dry heat treatment 50% ethanol extract (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10. Fragrance 0.1 11. Methyl paraben 0.2 12. 1,3 - Butylene glycol 8.5 13. Make the total amount 100 with purified water. [Manufacturing method] Heat and dissolve Components 2 to 9 and mix them, keep at 70 °C to obtain the oil phase. Heat and dissolve Components 1 and 11 to 13 and mix them, keep at 75 °C to obtain the water phase. Add the water phase to the oil phase for emulsification, cool while stirring, add Component 10 at 45 °C, and further cool to 30 °C to obtain the product.

[0041] (Formulation Example 3) Emulsion Formulation Content (%) 1. Fruit of Juniper berry subjected to dry heat treatment Ethanol extract (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20 E.O.) 2.0 9. Perfume 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl paraben 0.2 13. Make the total amount 100 with purified water [Manufacturing method] Heat and dissolve components 1 to 8 and mix them, keep at 70 °C to obtain an oil phase. Heat and dissolve components 10 to 13 and mix them, keep at 75 °C to obtain an aqueous phase. Add the aqueous phase to the oil phase for emulsification, cool while stirring, add component 9 at 45 °C, and further cool to 30 °C to obtain the product.

[0042] (Formulation Example 4) Gel Formulation Content (%) 1. 1,3-Butylene glycol extract of juniper berry fruit subjected to dry heat treatment (Production Example 4) 1.0 1,3-Butylene glycol extract of juniper berry fruit subjected to dry heat treatment (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl paraben 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5. Perfume Appropriate amount 6. 1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Make the total amount 100 with purified water [Manufacturing method] Dissolve components 2 to 5 and components 1 and 6 to 11 uniformly respectively, and mix the two to obtain the product.

[0043] (Formulation Example 5) Pack Formulation Content (%) 1. Ethanol extract of juniper berry fruit subjected to dry heat treatment (Production Example 3) 1.0 Ethanol extract of juniper berry fruit subjected to dry heat treatment (Production Example 3) 1.0 2. Juniper berry fruit 1,3 - Butylene glycol extract (Production Example 8) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5. 1,3 - Butylene glycol 8.0 6. Methyl paraben 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10. Fragrance appropriate amount 11. Make the total amount 100 with purified water [Production method] Dissolve components 1 - 11 uniformly to obtain the product.

[0044] (Formulation Example 6) Foundation Formulation Content (%) 1. Juniper berry fruit subjected to dry heat treatment 50% Ethanol extract (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethyl cellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl paraben 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Carmine 1.0 17. Yellow iron oxide 2.0 18. Fragrance appropriate amount Make the total amount 100 with purified water. [Manufacturing Method] Heat and dissolve Components 2 to 8 and maintain at 80°C to obtain an oil phase. Well swell Component 9 in Component 19, then add Components 1 and 10 to 13 and mix uniformly. Add Components 14 to 17, which have been pulverized and mixed with a pulverizer, stir with a homomixer, and maintain at 75°C to obtain an aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add Component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0045] (Formulation Example 7) Bath Agent Formulation Content (%) 1. Hot water extract of juniper berry fruit (Production Example 5) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) Appropriate amount 4. Perfume Appropriate amount 5. Make the total amount 100 with sodium sulfate. [Manufacturing Method] Uniformly mix Components 1 to 5 to obtain the product.

[0046] (Formulation Example 8) Ointment Formulation Content (%) 1. Hot water extract of juniper berry fruit subjected to dry heat treatment (Production Example 1) 5.0 2. 50% ethanol extract of juniper berry fruit subjected to dry heat treatment (Production Example 2) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetyl alcohol 6.0 7. Methyl paraben 0.1 8. Propylene glycol 10.0 9. Make the total amount 100 with purified water. [Manufacturing Method] Heat and dissolve Components 3 to 6 and mix them, and keep at 70°C to obtain an oil phase. Heat and dissolve Components 1, 2, and 7 to 9 and mix them, and keep at 75°C to obtain an aqueous phase. Add the aqueous phase to the oil phase for emulsification, and cool to 30°C while stirring to obtain the product.

[0047] (Formulation Example 9) Powder Formulation Content (%) 1. 50% Ethanol Extract of Juniper Berry Fruit (Manufacturing Example 6) 1.0 2. Dry Corn Starch 39.0 3. Microcrystalline Cellulose 60.0 [Manufacturing Method] Mix Components 1 to 3 to obtain a powder.

[0048] (Formulation Example 10) Tablet Formulation Content (%) 1. Ethanol Extract of Juniper Berry Fruit (Manufacturing Example 7) 5.0 2. Dry Corn Starch 25.0 3. Calcium Carboxymethylcellulose 20.0 4. Microcrystalline Cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix Components 1 to 4, then add an aqueous solution of Component 5 as a binder to form granules. Add Component 6 to the formed granules and tablet them. Each tablet weighs 0.52 g.

[0049] (Formulation Example 11) Chewable Tablet Formulation Content (%) 1. Ethanol Extract of Juniper Berry Fruit Subjected to Dry Heat Treatment (Manufacturing Example 3) 2.0 2. Dry Corn Starch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose Fatty Acid Ester 3.0 6. Flavor 0.1 7. Purified Water 0.1 [Manufacturing Method] Mix Components 1 to 4 and 7, and granulate. Add Components 5 and 6 to the formed granules and tableting. Make each tablet 1.0 g.

[0050] (Formulation Example 12) Beverage Formulation Content (%) 1. Hot water extract of Juniper berry fruits subjected to dry heat treatment (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4. Flavor 0.1 5. Make the total volume 100 with purified water [Manufacturing Method] Dissolve Components 1 to 3 in a small amount of water. Then, add Components 4 and 5 and mix.

[0051] Next, in order to explain the effects of the present invention in detail, experimental examples will be given.

[0052] Experimental Example 1 Promotion effect on integrin αV (ITGAV) and β3 (ITGB3) production The expression levels of ITGAV and ITGB3 mRNA were measured. Human normal lymphatic endothelial cells were seeded at 1×10 in a 6-well plate​Seeded and cultured in endothelial cell growth medium MV2 (Promocell) under the conditions of 37 °C and 5% CO2. When it reached a semi-confluent state, it was cultured for 24 hours in MV2 medium supplemented with a hot water extract of Juniperus berry fruit (Production Example 1) subjected to dry heat treatment so that the final concentrations were 100, 150, and 200 μg / mL, and then total RNA was extracted. The total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (NanoDrop). The measurement of mRNA expression level was performed by real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after reverse transcription reaction of 500 ng of total RNA, PCR reaction (95 °C: 15 seconds, 60 °C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the defined methods, and the expression levels of ITGAV and ITGB3 mRNAs were determined as the ratio to the expression level of GAPDH which was an internal standard. The promotion rates of ITGAV and ITGB3 expression were calculated as the ratios of the expression levels of ITGAV and ITGB3 mRNAs in the sample-added group to the expression levels of ITGAV and ITGB3 mRNAs in the control (sample-untreated) group. The primers used for measuring the expression levels of each gene are as follows.

[0053] Primer set for ITGAV GGCAGTGCCATAGCTCCTTT (SEQ ID NO: 1) CCCCATATGGAGCAGCAATT (SEQ ID NO: 2) Primer set for ITGB3 CGAAAATACCTGCAACCGTTACT (SEQ ID NO: 3) TTGCCAGTGTCCTTAAGCTCTTT (SEQ ID NO: 4) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 5) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 6)

[0054] The experimental results on the effects on ITGAV and ITGB3 mRNA expression are shown in Table 1. As a result, excellent ITGAV expression promoting action and ITGB3 expression promoting action were recognized in the hot water extract (Production Example 1) of the fruit of Juniperus communis subjected to the dry heat treatment of the present invention. In addition, the same effects were also recognized in the extracts of the fruit of Juniperus communis obtained by other extraction methods (Production Examples 2 to 8). Therefore, the extract of Juniperus communis was recognized to have an action of improving lymphatic capillary function and promoting interstitial fluid absorption through lymphatic capillaries.

[0055] [Table 1] [Industrial Applicability]

[0056] From the above, the integrin αV and β3 production promoter, lymphatic capillary function improver, and interstitial fluid absorption promoter through lymphatic capillaries, which contain the extract of Juniperus communis according to the present invention, exhibit excellent improvement effects for the purposes of each agent. Therefore, pharmaceuticals, quasi-drugs, cosmetics, and foods for the purpose of improving lymphatic capillary function and promoting interstitial fluid absorption through lymphatic capillaries can be provided.

Claims

1. An integrin αV and / or β3 production promoter for lymphatic endothelial cells, characterized by containing an extract of juniper berry.

2. A lymphatic function improver, characterized by containing an extract of juniper berry.

3. An interstitial fluid absorption promoter via lymphatic vessels, characterized by containing an extract of juniper berry.

Images