Oncolytic herpes simplex type i viruses for treatment of brain tumors
Genetically engineered oHSV-1 with a modified genome, lacking γ34.5 gene and internal inverted repeat region, addresses the challenge of insufficient viral spread in GBM treatment, achieving enhanced antitumor activity specifically against brain tumors.
Patent Information
- Application Number
- JP2025028739
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-12-04
- Filing Date
- 2025-02-26
- Publication Date
- 2025-06-17
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current treatments for glioblastoma multiforme (GBM) are inadequate due to insufficient viral spread after tumor resection, leading to limited therapeutic efficacy of oncolytic herpes simplex virus (oHSV) in clinical trials.
Development of a genetically engineered oncolytic herpes simplex virus type I (oHSV-1) with a modified genome, lacking both copies of the γ34.5 gene and the internal inverted repeat region, which enhances antitumor activity specifically against brain tumors.
The modified oHSV-1 demonstrates unexpectedly excellent antitumor activity against brain tumors compared to non-brain tumors, with improved targeting and killing of glioblastoma cells while sparing normal cells.
Smart Images

Figure 2025090623000005 
Figure 2025090623000006 
Figure 2025090623000007
Abstract
Description
Technical Field
[0001] The present disclosure relates to oncolytic viruses for the treatment of tumors, and particularly to genetically engineered oncolytic herpes simplex virus type I (oHSV-1) for the treatment of brain tumors. The present disclosure further relates to methods of treating brain tumors using the recombinant oncolytic viruses disclosed herein, as well as pharmaceutical compositions and uses thereof.
Background Art
[0002] Primary tumors of the brain can originate from various types of cells in the central nervous system. Medulloblastoma is derived from neural cell precursors, astrocytoma is derived from the stellate cell subset of glial cells, and oligodendroglioma is derived from the oligodendrocyte precursor cell subset of glial cells. Other types of primary tumors, such as ependymoma from ependymal cells and meningioma from cells that form the meninges, are derived from cells that form the inner and outer layers of the brain, respectively. Glioblastoma multiforme (GBM), which is derived from astrocytes, is classified as a WHO grade IV astrocytoma because it is the most common and lethal primary brain tumor.
[0003] The current treatment regimen for malignant glioblastoma multiforme (GBM) is tumor resection, followed by chemotherapy and radiotherapy. Despite the demonstrated safety of oncolytic herpes simplex virus (oHSV) in clinical trials for GBM, its efficacy is not optimal mainly due to insufficient viral spread after tumor resection. Glioblastoma multiforme (GBM) is the most common brain tumor in adults and remains one of the most difficult malignant tumors to treat despite significant progress in its molecular understanding. GBM tumor resection is an important therapeutic intervention, but standard treatment with radiotherapy and temozolomide chemotherapy after tumor resection has not provided much clinical benefit. Therefore, the development of novel local therapies that enable direct administration into the GBM tumor resection cavity after tumor debulking is an urgent need.
[0004] In previous studies attempting to use Gliadel wafers, a clinically approved polyanhydride wafer containing the chemotherapeutic agent BCNU, for local therapy in the cavities of resected GBM, the therapeutic effect has been shown to be limited. In the ongoing search for therapies capable of eliminating such tumor remnants after tumor resection, oncolytic viruses have shown great promise in preclinical studies. These viruses are generally genetically engineered to replicate only in tumor cells and kill them, which is a way of fitting well with the brain, which consists of normal cells that are not actively growing or are growing slowly. Among therapeutic viruses, oHSV is an essentially neurotropic virus and is one of the most promising candidates for the treatment of GBM because its oncolytic effect has a low dependence on specific host cell receptors, mutations, or intracellular pathways. In addition, oHSV has a well-studied genome and a large gene insertion capacity for inserting additional therapeutic genes to further enhance its oncolytic power. In phase I and Ib oHSV clinical trials conducted so far on GBM, signs of antitumor activity have been shown, but the clinical response rate has not been optimal.
Summary of the Invention
[0005] The inventors have found the surprising fact that an oHSV-1 lacking both copies of the γ34.5 gene and the inverted repeat region has unexpectedly excellent antitumor activity against brain tumors compared to non-brain tumors, as compared to existing oHSV-1 viruses.
[0006] In one aspect, the present specification provides an oncolytic herpes simplex virus type I (oHSV-1) comprising a modified genome, wherein the modification comprises: (a) a change in a copy of the γ34.5 gene in the terminal repeat of the genome such that the copy of the γ34.5 gene cannot express a functional ICP34.5 protein; and (b) a deletion of the internal inverted repeat region of the genome that causes a deletion of one copy of each of the double-copy genes and one copy of the duplicated non-coding sequence within the internal inverted repeat region, wherein the double-copy genes comprise genes encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O, and all single-copy genes in both the U L and U S components are intact so that they can each express a functional protein.
[0007] In some embodiments, the change comprises a deletion of all or part of the coding region or regulatory region of the copy of the γ34.5 gene.
[0008] In some embodiments, the duplicated non-coding sequence comprises the intron of ICP0, the LAT domain, and the "a" sequence.
[0009] In some embodiments, U L and U S all single-copy genes in both components are the U L U in the component L 1 to U L 56 genes and U S U in the component S 1 to U S 12 genes.
[0010] In some embodiments, the oHSV-1 is selected from the group consisting of the F strain, the KOS strain, and the 17 strain. In some embodiments, the deletion of the internal inverted repeat region causes an excision of nucleotide positions 117005 to 132096 in the genome of the F strain.
[0011] In some embodiments, the oHSV-1 is a prototype (P) genomic isomer, and UL the last gene in the component (e.g., U L 56) from the stop codon to U S the first gene in the component (e.g., U S 1) has a deletion of the internal inverted repeat region up to the promoter of
[0012] In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent is incorporated into oHSV-1, and the incorporation does not interfere with the expression of the native genes of the HSV-1 genome. In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and an immunotherapeutic agent is incorporated into oHSV-1.
[0013] In some embodiments, the immunostimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24, and IL-27. In some embodiments, the immunostimulant is IL-12.
[0014] In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent, an anti-CTLA-4 agent, or both. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent. In some embodiments, the anti-PD-1 agent includes an anti-PD-1 antibody or an antigen-binding fragment thereof, such as Fab, scFv, (scFv)2, Fab’, or F(ab’)2. In some embodiments, the anti-CTLA-4 agent includes an anti-CTLA-4 antibody or an antigen-binding fragment thereof, such as Fab, scFv, (scFv)2, Fab’, or F(ab’)2. In some embodiments, the anti-PD-1 antibody or anti-CTLA-4 antibody includes a modified form of the antibody, such as an antibody-drug conjugate (ADC), a bispecific antibody, or a nanobody (or VHH).
[0015] In some embodiments, the heterologous nucleic acid sequence is incorporated within the internal inverted repeat region and / or between the U L U in the component L 3 and U L 4 genes.
[0016] In some embodiments, heterologous nucleic acid sequences encoding IL-12 and an anti-PD-1 agent are incorporated into oHSV-1. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 is incorporated into the internal inverted repeat region, and the heterologous nucleic acid sequence encoding the anti-PD-1 agent is U L U in the component L 3 and U L It is incorporated between the 4 genes.
[0017] In another aspect, there is provided a pharmaceutical composition for the treatment of brain tumors comprising an effective amount of any of the oHSV-1s disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the brain tumor is selected from the group consisting of glioma, glioblastoma, oligodendroglioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma. In some embodiments, the brain tumor is glioblastoma multiforme.
[0018] In another aspect, there is provided the use of any of the oHSV-1s disclosed herein in the manufacture of a medicament for the treatment of brain tumors. In some embodiments, the brain tumor is selected from the group consisting of glioma, glioblastoma, oligodendroglioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma. In some embodiments, the brain tumor is glioblastoma multiforme.
[0019] In another aspect, there is provided the use of any of the oHSV-1s disclosed herein for the treatment of brain tumors. In some embodiments, the brain tumor is selected from the group consisting of glioma, glioblastoma, oligodendroglioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma. In some embodiments, the brain tumor is glioblastoma multiforme.
[0020] In another aspect, there is provided a method for treating a brain tumor in a subject comprising administering to the subject a therapeutically effective amount of any of the oHSV-1s disclosed herein or any of the pharmaceutical compositions disclosed herein.
[0021] In some embodiments, a second therapy is administered to the subject before, simultaneously with, or after the administration of the oHSV-1 disclosed herein or the pharmaceutical composition disclosed herein. In some embodiments, the second therapy is chemotherapy, radiation therapy, immunotherapy, and / or a surgical intervention. In some embodiments, the subject is a human. In some embodiments, the brain tumor is selected from the group consisting of glioma, glioblastoma, anaplastic glioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma. In some embodiments, the brain tumor is glioblastoma multiforme.
Brief Description of the Drawings
[0022] These and other aspects and advantages of the present disclosure will become apparent from the following detailed description with reference to the accompanying drawings. Here,
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
[0023] (Detailed description) (Definition) Note that the entity of the term "one" or "a" or "a kind" refers to one or more or one kind or more kinds of the entity. For example, "oncolytic HSV-1" is understood to represent one or more kinds of oncolytic HSV-1 viruses. Therefore, the terms "one" or "a kind", "one or more" or "one kind or more kinds" and "at least one" or "at least one kind" can be used interchangeably herein.
[0024] "Homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology may be determined by comparing the positions of each sequence aligned for comparison. When the positions of the sequences being compared are occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. "Unrelated" or "non-homologous" sequences have less than 40% identity, preferably less than 25% identity, with one of the sequences of the present disclosure.
[0025] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) has a certain percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" to another sequence means that when aligned, that percentage of bases (or amino acids) is the same when comparing the two sequences. Such alignment and percentage homology or sequence identity may be determined using software programs known in the art.
[0026] As used herein, "antibody" or "antigen-binding polypeptide" refers to a polypeptide or polypeptide complex that specifically recognizes and binds one or more antigens. An antibody may be the whole antibody and any of its antigen-binding fragments or its single chains. Thus, the term "antibody" includes any protein or peptide-containing molecule that includes at least a portion of an immunoglobulin molecule having biological activity to bind an antigen. Such examples include, but are not limited to, the complementarity-determining regions (CDRs) of the heavy or light chains or the ligand-binding portions thereof, the variable regions of the heavy or light chains, the constant regions of the heavy or light chains, the framework (FR) regions or any portion thereof, or at least a portion of a binding protein. The term antibody further includes a polypeptide or polypeptide complex that has antigen-binding ability when activated.
[0027] As used herein, the term "antibody fragment" or "antigen-binding fragment" is a part of an antibody, such as F(ab’)2, F(ab)2, Fab’, Fab, Fv, scFv, etc. Antibody fragments bind the same antigens as recognized by the intact antibody, regardless of structure. The term "antibody fragment" includes aptamers, Spiegelmers, diabodies. The term "antibody fragment" includes any synthetic or genetically engineered protein that acts like an antibody by binding to a specific antigen to form a complex.
[0028] The antibodies, antigen-binding polypeptides, variants or derivatives thereof of the present disclosure include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized, or chimeric antibodies, single-chain antibodies, epitope-binding fragments (e.g., Fab, Fab’, and F(ab’)2, Fd, Fvs, single-chain Fvs (scFv), single-chain antibodies, Fvs linked by disulfide bonds (sdFv)), fragments containing VK or VH domains, fragments generated by Fab expression libraries, and anti-idiotypic (anti-Id) antibodies (e.g., including anti-Id antibodies against the LIGHT antibodies disclosed herein). The immunoglobulins or antibody molecules of the present disclosure can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules. For example, an anti-PD-1 antibody may refer to a Fab fragment or its scFv.
[0029] "Specifically binds" or "has specificity for" generally means that an antibody binds to an epitope via its antigen-binding domain and that the binding involves some complementarity between the antigen-binding domain and the epitope. According to this definition, an antibody is said to "specifically bind" to an epitope if it binds to the epitope via its antigen-binding domain more readily than to a random and unrelated epitope. The term "specificity" is used herein to quantify the relative affinity of a particular antibody for binding to a particular epitope. For example, antibody "A" can be considered to have higher specificity for a given epitope than antibody "B", or it can be said that antibody "A" binds to epitope "C" with higher specificity than to a related epitope "D".
[0030] As used herein, the terms “cancer” or “tumor,” which are used interchangeably herein, refer to a series of diseases that can be treated according to the present disclosure, are capable of invading or spreading to other parts of the body, and are accompanied by abnormal cell growth. Not all tumors are cancerous; benign tumors do not spread to other parts of the body. Possible signs and symptoms include new lumps, abnormal bleeding, persistent cough, unexplained weight loss, changes in bowel movements, and the like. There are more than 100 known cancers that affect humans. The present disclosure is preferably applied to solid tumors, and more preferably to brain tumors.
[0031] As used herein, the term “treat” or “treatment” refers to both therapeutic treatment and prophylactic measures, the purpose of which is to prevent or delay (mitigate) undesirable physiological changes or disorders such as the progression of cancer. Beneficial or desirable clinical outcomes include, but are not limited to, alleviation of symptoms, reduction in the degree of the disease, stabilization of the disease state (i.e., not getting worse), delay or deceleration of the progression of the disease, improvement or alleviation of the disease state, and remission (partial or complete), whether detectable or undetectable. “Treatment” also means extending the survival period as compared to the expected survival period without treatment. Those in need of treatment include those who already have a disease or disorder, those who tend to have a disease or disorder, or those in whom a disease or disorder should be prevented.
[0032] The terms “subject” or “individual” or “animal” or “patient” or “mammal” mean any subject for which diagnosis, prognosis, or treatment is desired, particularly a mammalian subject. Mammalian subjects include humans, domestic animals, farm animals, and zoo animals, sports animals or pets, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, dairy cows, and the like.
[0033] As used herein, phrases such as “to a patient in need of treatment” or “to a subject in need of treatment” include subjects who are considered to benefit from the administration of the oHSV-1 or composition of the present disclosure, for example, for detection, diagnostic procedures, and / or treatment, such as mammalian subjects.
[0034] It will be understood by those skilled in the art that the modified genomes disclosed herein may be modified such that the nucleotide sequences from the modified polynucleotides from which they are derived are different. For example, a polynucleotide or nucleotide sequence derived from a specified DNA sequence may be similar, e.g., having a certain percentage identity to the starting sequence, e.g., it may be 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the starting sequence.
[0035] Furthermore, substitutions, deletions or insertions of nucleotides or amino acids can be made that result in conservative substitutions or changes in the "non-essential" amino acid regions. For example, a polypeptide or amino acid sequence derived from a specified protein may be the same as the starting sequence in the remainder, except for substitution, insertion or deletion of one or more individual amino acids (e.g., substitution, insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more individual amino acids). In certain embodiments, a polypeptide or amino acid sequence derived from a specified protein has 1 to 5, 1 to 10, 1 to 15 or 1 to 20 individual amino acid substitutions, insertions or deletions relative to the starting sequence.
[0036] Oncolytic herpes simplex virus type I: The HSV-1 genome consists of two covalently linked components called L and S. Each component has a unique sequence (the L component is U L , the S component is U SIt consists of , and both sides of the unique sequence are inverted repeats that are terminal repeats and internal repeats. The inverted repeats of the L component are shown as ab and b’a’. The inverted repeats of the S component are shown as a’c’ and ca. The inverted repeats b’a’ and a’c’ constitute the internal inverted repeat region. The inverted repeat regions of both the L and S components are transcribed with both copies of five genes encoding proteins called ICP0, ICP4, ICP34.5, ORF P, and OFR O, but are known to contain large stretches of DNA that do not encode proteins. The DNA includes, for example, the intron of ICP0, the LAT domain, the “a” sequence, and the like.
[0037] By homologous recombination between the terminal repeats, the L and S components of the HSV-1 genome are inverted, and four equimolar linear isomers are obtained. The isomers are P (prototype), I L (inversion of the L component), I S (inversion of the S component), and I SL (inversion of both the L and S components). The HSV-1 genome encodes approximately 90 unique transcription units (genes), and about half of them are essential for virus replication in a permissive tissue culture environment. The rest are unnecessary for the growth of cells in culture. However, it is highly likely that those so-called “non-essential” genes are not unnecessary for replication in the animal system. They often encode functions involved in virus-host interactions, such as immune evasion and induction of host cell shut-off.
[0038] Infected cell protein 34.5 (ICP34.5) is a protein encoded by the γ34.5 gene (also known as γ134.5) that blocks the cellular stress response to virus infection. When a cell is infected with HSV, protein kinase R is activated by the virus's double-stranded RNA. Protein kinase R then phosphorylates a protein called eukaryotic initiation factor 2A (eIF-2A), inactivating eIF-2A. Since eIF-2A is required for translation, shutting down eIF-2A prevents the cell from allowing the virus to hijack its own protein production machinery. The virus then evolved ICP34.5 to overcome this defense. It activates protein phosphatase 1A, which dephosphorylates eIF-2A, to resume translation. HSV lacking the γ34.5 gene cannot replicate in normal cells because it cannot make proteins. The HSV-1 genome has two copies of the γ34.5 gene, one located on either side of the U L component, one in the terminal repeat and the other in the internal repeat.
[0039] In one aspect, the present disclosure provides an oncolytic herpes simplex virus type I (oHSV-1) that is genetically modified such that both copies of the γ34.5 gene cannot express a functional ICP34.5 protein and is further modified to lack the internal inverted repeat region of the genome. Deletion of the internal inverted repeat region causes deletion of one copy of each of the double-copy genes encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O within the internal inverted repeat region and one copy of the non-coding sequence that overlaps with each of these genes. However, since all single-copy genes (including U L and U S in the U L 1 to U L 56 and U S 1 to U S 12) in the component are intact, each can express its functional protein.
[0040] In some embodiments, the modification comprises a change in a copy of the γ34.5 gene in the terminal repeat of the genome such that the copy of the γ34.5 gene cannot express a functional ICP34.5 protein. "Cannot express a functional ICP34.5 protein" means that γ34.5 cannot be detected at the protein or mRNA level from the engineered virus, or that the ICP34.5 protein is expressed by the virus but does not function or functions partially. Means for achieving the above are readily available in the field of genetic engineering and are also known to those skilled in the art. For example, the change may include the insertion, mutation or addition of one or more nucleotides in the coding or regulatory region of the said copy of the γ34.5 gene, or the deletion of all or part of the coding or regulatory region of the said copy of the γ34.5 gene. In some embodiments, the change comprises the deletion of all or part of the coding or regulatory region of the said copy of the γ34.5 gene.
[0041] The oHSV-1 disclosed herein lacks both copies of the γ34.5 gene. U L The other copy of the γ34.5 gene located within the internal repeat of the component is deleted by deletion of the internal inverted repeat region of the genome. As described above, the internal inverted repeat region is U L the internal repeat of the component and U SIt consists of internal repeats. One copy of the double-copy gene containing the genes encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O and one copy of the duplicated non-coding sequence are located within the internal inverted repeat region. Thus, deletion of the internal inverted repeat region causes deletion of one copy of the double-copy gene containing the other copy of the γ34.5 gene and one copy of the duplicated non-coding sequence. In some embodiments, the duplicated non-coding sequence includes, for example, the intron of ICP0, the LAT domain, and the "a" sequence. Thus, in some embodiments, deletion of the internal inverted repeat region of the genome results in deletion of one copy each of ICP0, ICP4, ICP34.5, ORF P, and ORF O and one copy each of the intron of ICP0, the LAT domain, and the "a" sequence. Thus, the other copies of ICP0, ICP4, ORF P, and ORF O and the other copies of the intron of ICP0, the LAT domain, and the "a" sequence are preserved in the engineered oHSV-1 genome.
[0042] In the present disclosure, the deletion of the internal inverted repeat region is such that all single-copy genes, including U L and U S in the U L 1 to U L 56 and U S 1 to U S 12, are intact so that they can each express their functional proteins and are performed in an exact manner. In this context, "the U of the genome L and U SThe phrase "all single-copy genes in the component are intact" means that for each ORF of these single-copy genes, as well as the promoters, enhancers, and other regulatory sequences necessary for the expression of each ORF, the expression of the ORF is successful and the protein translated from the ORF is ensured to function, and they are intact. "Intact" means that the coding sequence of each single-copy gene is at least functional, but it does not mean that the sequence must be 100% identical to the naturally occurring sequence. The "non-essential" region may include, for example, conservative substitutions or changes, so that the nucleotide sequence of the sequence may be slightly different from the naturally occurring sequence. In this context, the sequence may be 90%, 95%, 98% or 99% identical to the naturally occurring sequence.
[0043] The position of each single-copy gene in the HSV-1 genome is known in the art. Considering that it depends on the strain and genomic variant of the HSV-1 virus, the exact start and end positions of the nucleotides deleted in the internal inverted repeat region vary from strain to strain or variant to variant, but those skilled in the art will understand that it can be easily determined by techniques known in the art. It should be understood that the present disclosure is not intended to be limited to any particular genomic variant or strain of the HSV-1 virus. Rather, in the present disclosure, all strains and variants of the HSV-1 virus are presumed to be useful.
[0044] For example, in an embodiment where the HSV-1 F strain is used, its genome is available under GenBank accession number GU734771.1, and the deletion of the internal inverted repeat region causes the excision of nucleotides 117005 to 132096 in the genome. It will be understood by those skilled in the art that other strains will also be available if the genomic DNA is sequenced. Sequencing techniques are readily available from the literature and the market. For example, in another embodiment, the deletion can be performed in the HSV-1 strain 17, whose genome is available under GenBank accession number NC_001806.2. In another embodiment, the deletion can be performed in the KOS1.1 strain, whose genome is available under GenBank accession number KT899744.
[0045] In some embodiments, by accurately performing the deletion at a predetermined position, the excision of the DNA fragment from the last gene of the L component (in the case of the P isomer, U L 56, etc.) to the first gene of the S component (in the case of the P isomer, U S 1) is achieved. Considering that there are four different isomers in HSV-1 (i.e., isomers P, I S , I L and I SL ), the names of the first and last genes vary depending on the isomer. In the context of the present disclosure, the numbering of the genes in the U L component (i.e., the first and last) is defined in the direction from the terminal repeat of the U L component to the internal repeat of the U L component, and the numbering of the genes in the U S component is defined in the direction from the internal repeat of the U S component to the terminal repeat of the U S component. Thus, in the case of the isomer prototype (P), the first gene in the U L component is, for example, the U L 1 gene, and the last gene in the U L component is, for example, the U L 56, and the first gene in the U S component is, for example, the U S 1 gene, and the US The last gene in the component is, for example, U S becomes 12. Isomer I S In the case of, U L The first gene in the component is, for example, U L becomes 1 gene, and U L The last gene in the component is, for example, U L becomes 56, and U S The first gene in the component is, for example, U S becomes 12 genes, and U S The last gene in the component is, for example, U S becomes 1. Isomer I L In the case of, U L The first gene in the component is, for example, U L becomes 56 genes, and U L The last gene in the component is, for example, U L becomes 1, and U S The first gene in the component is, for example, U S becomes 1 gene, and U S The last gene in the component is, for example, U S becomes 12. Isomer I SL In the case of, U L The first gene in the component is, for example, U L becomes 56 genes, and U L The last gene in the component is, for example, U L becomes 1, and U S The first gene in the component is, for example, U S becomes 12 genes, and U S The last gene in the component is, for example, U S becomes 1.
[0046] Deletion of the internal inverted repeat region does not cause damage to the single-copy genes in the U S or U L component, so the coding and regulatory sequences of the single-copy genes containing the promoter sequences necessary for the expression of the single-copy genes remain intact. For example, in the case of isomer P, the deletion causes U L excision of a DNA fragment from the end of a stop codon such as the 56 gene to U S the start of a promoter sequence such as the 1 gene. For example, in the case of isomer I LIn the case of, the deletion is U L from the start of the promoter sequence such as 1 gene to U S causes excision of the DNA fragment from the start of the promoter sequence such as 1 gene to the end.
[0047] Retention of all single-copy genes in the engineered oHSV-1 genome, as well as the other copy of each of ICP0, ICP4, ORF P, and ORF O, and the other copy of each of the intron, LAT domain, and "a" sequence of ICP0 provides a more potent virus, either before or after incorporation of the inserted foreign gene. Thus, oHSV-1 has maximum resistance to environmental factors such as temperature, pressure, and ultraviolet light. Also, oncolytic HSV-1 maximizes the range of effective cancer cells.
[0048] Using various genetic engineering methods known in the art, the modified HSV-1 vectors described in the present disclosure can be obtained. For example, bacterial artificial chromosome (BAC) technology is used. As another example, COS plasmids can be used in the present disclosure. WO2017 / 181420 discloses an oHSV-1 vector constructed by BAC technology, the entire content of which is incorporated herein by reference.
[0049] The amount of foreign DNA sequence that can be inserted into the wild-type virus is limited because it interferes with the packaging of DNA into virions. An exact deletion in a specified region provides an ideal space for the insertion of a foreign DNA sequence. According to one embodiment of the present disclosure, the deletion removes at least 15 kbp of the oncolytic viral vector, allowing the accommodation of a similar amount of foreign DNA sequence. Other studies have shown that an additional 7 kB of DNA is tolerated in the wild-type genome.
[0050] In some embodiments, the genetically engineered oHSV-1 incorporates a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent. In the present disclosure, the incorporation of the heterologous nucleic acid sequence does not interfere with the expression of natural genes of the HSV-1 genome, such as any of the single-copy genes described above or other double-copy genes.
[0051] In some embodiments, the heterologous nucleic acid sequence is incorporated into the internal inverted repeat region. In some embodiments, the heterologous nucleic acid sequence is incorporated L between adjacent single-copy genes in the U S or U L components. In some embodiments, the heterologous nucleic acid sequence is incorporated within the internal inverted repeat region and between adjacent single-copy genes in the U S or U L components. In some embodiments, the heterologous nucleic acid sequence is incorporated within the internal inverted repeat region and between the U L 3 and U
[0052] In some embodiments, oHSV-1 contains a heterologous nucleic acid sequence encoding an immunostimulant. In some embodiments, the immunostimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24, and IL-27. In one embodiment, the immunostimulant is IL-12. In one embodiment, the immunostimulant is human IL-12 or humanized IL-12.
[0053] In some embodiments, oHSV-1 contains a heterologous nucleic acid sequence encoding an immunotherapeutic agent. In some embodiments, the immunotherapeutic agent is selected from an anti-PD-1 agent, an anti-CTLA-4 agent, or both. In one embodiment, the immunotherapeutic agent is an anti-PD-1 agent.
[0054] In some embodiments, oHSV-1 comprises a heterologous nucleic acid sequence encoding both an immunostimulatory agent and an immunotherapeutic agent. In some embodiments, the immunostimulatory agent is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24, and IL-27. In one embodiment, the immunostimulatory agent is IL-12. In one embodiment, the immunostimulatory agent is human or humanized IL-12. In some embodiments, the immunotherapeutic agent is selected from an anti-PD-1 agent, an anti-CTLA-4 agent, or both. In one embodiment, the immunotherapeutic agent is an anti-PD-1 agent.
[0055] In embodiments where only one heterologous nucleic acid sequence encoding an immunostimulatory agent or an immunotherapeutic agent is inserted, the heterologous nucleic acid sequence is preferably integrated into the deleted internal inverted repeat region of the genome. In one embodiment, the heterologous nucleic acid sequence has a length similar to the deleted fragment. In one embodiment, the heterologous nucleic acid sequence has a length 20% longer or shorter than the length of the deleted fragment. In another embodiment, the heterologous nucleic acid sequence has a length 15%, 10%, 5%, 4%, 3%, 2%, or 1% longer or shorter than the deleted fragment.
[0056] In one embodiment, the heterologous nucleic acid sequence has a length of less than about 18 kbp, about 17 kbp, or about 16 kbp. In one embodiment, the heterologous nucleic acid sequence has a length greater than about 10 kbp, 11 kbp, 12 kbp, 13 kbp, or 14 kbp. In one embodiment, the heterologous nucleic acid sequence has a length between about 14 kbp and about 16 kbp. In one embodiment, the heterologous nucleic acid sequence has a length of about 15 kbp.
[0057] In some embodiments, oHSV-1 comprises at least two heterologous nucleic acid sequences encoding an immunostimulant and / or an immunotherapeutic agent. In some embodiments, oHSV-1 comprises heterologous nucleic acid sequences encoding two different immunostimulants. For example, in one embodiment, oHSV-1 comprises heterologous nucleic acid sequences encoding both IL-12 and GM-CSF. In another embodiment, oHSV-1 comprises heterologous nucleic acid sequences encoding both IL-15 and GM-CSF. In another embodiment, oHSV-1 comprises heterologous nucleic acid sequences encoding both IL-12 and IL-15.
[0058] In some embodiments, oHSV-1 comprises heterologous nucleic acid sequences encoding two different immunotherapeutic agents. In one embodiment, for example, oHSV-1 comprises heterologous nucleic acid sequences encoding both an anti-PD-1 agent and an anti-CTLA-4 agent.
[0059] In embodiments in which one or more heterologous nucleic acid sequences encoding an immunostimulant and / or an immunotherapeutic agent are incorporated, the first heterologous nucleic acid sequence is preferably inserted into the deleted internal repeat region of the genome. The second or further heterologous nucleic acid sequence may be inserted into the L component of the genome. In one embodiment, the second heterologous nucleic acid sequence is inserted between the U L 3 and U L 4 genes. In one embodiment, the second heterologous nucleic acid sequence is inserted between the U L 37 and U L 38 genes.
[0060] In one embodiment, the first heterologous nucleic acid sequence encodes IL-12 inserted into the deleted internal repeat region of the genome. In one embodiment, the second heterologous nucleic acid sequence encodes an anti-PD-1 agent inserted between the U L 3 and U L 4 genes.
[0061] Insertion of one or more heterologous nucleic acid sequences into the genome of oncolytic HSV-1 is understood to stably integrate the heterologous nucleic acid sequences into the modified HSV-1 genome without interfering with the expression of native HSV-1 genes and such that functional expression of the heterologous nucleic acid sequences can be expected.
[0062] Heterologous nucleic acid sequences encoding immunostimulatory and / or immunotherapeutic agents contain nucleic acids encoding peptides or proteins together with regulatory elements for expression. Generally, regulatory elements selected based on the host cell used for expression, which are present in and operably linked to the nucleic acid sequences present in and expressed by the recombinant gene, include transcriptional promoters, ribosome binding sites, and terminators. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is linked to the regulatory sequences in a manner that enables expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the virus is introduced into the host cell). The term "regulatory sequences" is intended to include promoters, enhancers, and other expression regulatory elements (e.g., polyadenylation signals). Regulatory sequences include those that direct constitutive expression of nucleotide sequences in many types of host cells and those that direct expression of nucleotide sequences only in specific host cells (e.g., tissue-specific regulatory sequences).
[0063] One of ordinary skill in the art can select appropriate regulatory elements, for example, based on the desired tissue specificity and expression level. For example, a cell type-specific or tumor-specific promoter can be used to limit expression of the gene product to a specific cell type. In addition to the use of tissue-specific promoters, local administration of the virus provides local expression and effects. Examples of non-tissue-specific promoters that can be used include the immediate early cytomegalovirus (CMV) promoter (U.S. Patent No. 4,168,062) and the Rous Sarcoma Virus promoter. Also, HSV promoters such as the HSV-1 IE promoter may be used.
[0064] For example, examples of tissue-specific promoters that can be used in the present technology include the prostate-specific antigen (PSA) promoter specific to prostate cells, the desmin promoter specific to muscle cells, the enolase promoter specific to neurons, the beta-globin promoter specific to erythroid cells, and the tau-globin promoter specific to erythroid cells, the growth hormone promoter specific to pituitary cells, the insulin promoter specific to pancreatic beta cells, the glial fibrillary acidic protein promoter specific to astrocytes, the tyrosine hydroxylase promoter specific to catecholaminergic neurons, the amyloid precursor protein promoter specific to neurons, the dopamine beta-hydroxylase promoter specific to noradrenergic and adrenergic neurons, the tryptophan hydroxylase promoter specific to 5-hydroxytryptamine / pinealocytes, the choline acetyltransferase promoter specific to cholinergic neurons, the aromatic L-amino acid decarboxylase (AADC) promoter specific to catecholaminergic / 5-HT / D-type cells, the proenkephalin promoter specific to neurons / spermatogenic Sertoli cells, the reg (pancreatic stone protein) promoter specific to colon and rectal tumors and pancreatic and kidney cells, and the parathyroid hormone-related peptide (PTHrP) promoter specific to liver and cecal tumors and schwannomas, kidney cells, pancreatic cells, and adrenal cells.
[0065] Examples of promoters that function specifically in tumor cells include the stromelysin 3 promoter specific for breast cancer cells, the surfactant protein A promoter specific for non-small cell lung cancer cells, the secretory leukoprotease inhibitor (SLPI) promoter specific for SLPI-expressing cancers, the tyrosinase promoter specific for melanoma cells, the stress-inducible grp78 / BiP promoter specific for fibrosarcoma / tumorigenic cells, the AP2 adipose enhancer specific for adipocytes, the α-1 antitrypsin transthyretin promoter specific for hepatocytes, the interleukin-10 promoter specific for glioblastoma multiforme, the c-erbB-2 promoter specific for pancreatic, breast, gastric, ovarian and non-small cell lung cancer cells, the α-B-crystallin / heat shock protein 27 promoter specific for brain tumor cells, the basic fibroblast growth factor promoter specific for glioma and meningioma cells, the epidermal growth factor receptor promoter specific for squamous cell carcinoma, glioma and breast tumor cells, the mucin-like glycoprotein (DF3, MUC1) promoter specific for breast cancer cells, the mts1 promoter specific for metastatic tumors, the NSE promoter specific for small cell lung cancer cells, the somatostatin receptor promoter specific for small cell lung cancer cells, the c-erbB-3 and c-erbB-2 promoters specific for breast cancer cells, the c-erbB4 promoter specific for breast and gastric cancers, the thyroglobulin promoter specific for thyroid cancer cells, the α-fetoprotein (AFP) promoter specific for hepatocellular carcinoma cells, the villin promoter specific for gastric cancer cells, and the albumin promoter specific for hepatocellular carcinoma cells. In another embodiment, the TERT promoter or the survivin promoter is used.
[0066] For example, in some embodiments, the heterologous nucleic acid sequence is operably linked to a promoter such as, for example, the CMV promoter or the Egr-1 promoter. In one embodiment, the nucleotide sequence encoding IL-12 is operably linked to the Egr-1 promoter. In another embodiment, the nucleotide sequence encoding scFv-anti-hPD1 is operably linked to the CMV promoter.
[0067] In certain embodiments, the oHSV-1 of the present disclosure encodes one or more immunostimulants (also referred to as immunostimulatory molecules) including cytokines such as IL-2, IL4, IL-12, GM-CSF, IFNγ, chemokines such as MIP-1, MCP-1, IL-8, and growth factors.
[0068] Alternatively or additionally, the oHSV-1 of the present disclosure encodes one or more immunotherapeutic agents, for example, a PD-1 binder (or anti-PD-1 agent) or a CTLA-4 binder (or anti-CTLA-4 agent), which includes an antibody or a fragment thereof, such as an anti-PD1 antibody that specifically binds to PD-1 or an anti-CTLA-4 antibody that specifically binds to CTLA-4. The anti-PD-1 antibody may be a single-chain antibody that antagonizes PD-1 activity. In other embodiments, the oncolytic virus expresses an agent that antagonizes the binding of the PD-1 ligand and receptor, for example, an anti-PD-L1 and / or PD-L2 antibody, a PD-L1 and / or PD-L2 decoy, or a soluble PD-1 receptor.
[0069] The PD-1 signaling pathway plays an important role in tumor-associated immune dysfunction. Infection and lysis of tumor cells can trigger a highly specific anti-tumor immune response that kills not only the cells of the inoculated tumor but also the cells of distant established non-inoculated tumors. Tumors and their microenvironment have developed mechanisms to evade, inhibit, and inactivate the natural anti-tumor immune response. For example, tumors can downregulate target receptors, surround themselves with a fibrous extracellular matrix, or upregulate host receptors or ligands involved in the activation or recruitment of regulatory immune cells. Natural and / or adaptive regulatory T cells (Tregs) are involved in tumor-mediated immune inhibition. Without wishing to be bound by theory, PD-1 blockade may inhibit Treg activity and improve the effectiveness of tumor-reactive CTLs. Further aspects of the art are described in more detail below. PD-1 blockade may also stimulate the anti-tumor immune response by blocking the inactivation of T cells (CTLs and helpers) and B cells.
[0070] In one aspect, the present technology provides an oncolytic virus comprising a gene encoding a PD-1 binder. Programmed cell death 1 (PD-1) is a 50-55 kDa type I transmembrane receptor first identified by subtractive hybridization of mouse T cell lines undergoing apoptosis. PD-1, a member of the CD28 gene family, is expressed in activated T, B, and myeloid cells. Human and mouse PD-1 have approximately 60% amino acid identity with four potential N-glycosylation sites defining the Ig-V domain and residues conserved. As two ligands of PD-1, PD ligand 1 (PD-L1) and ligand 2 (PD-L2) have been identified, both of which belong to the B7 superfamily. PD-L1 is expressed in many cell types such as T, B, endothelial cells, epithelial cells, antigen-presenting cells, etc. In contrast, PD-L2 is expressed limitedly in specialized antigen-presenting cells such as dendritic cells and macrophages.
[0071] PD-1 negatively regulates T cell activation, and this inhibitory function is related to the immunoreceptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain. Disruption of this inhibitory function of PD-1 may lead to autoimmunity. The opposite case may also be harmful. The persistent negative signal by PD-1 is involved in T cell dysfunction in many pathological situations such as tumor immune evasion and chronic viral infection.
[0072] The host's anti-tumor immunity is mainly affected by tumor-infiltrating lymphocytes (TILs). Multiple lines of evidence indicate that TILs are subject to PD-1 inhibitory regulation. First, the expression of PD-L1 has been confirmed in many human and mouse tumor strains, and its expression may be further upregulated by IFN-γ in vitro. Second, the expression of PD-L1 by tumor cells is directly related to resistance to lysis by anti-tumor T cells in vitro. Third, PD-1 knockout mice are resistant to tumor challenge, and T cells from PD-1 knockout mice are highly effective in tumor rejection when adoptively transferred into tumor-bearing mice. Fourth, blockade of the PD-1 inhibitory signal by monoclonal antibodies can enhance the host's anti-tumor immunity in mice. Fifth, high levels of PD-L1 expression in tumors (detected by immunohistochemical staining) are associated with poor prognosis in many human cancer types.
[0073] Oncolytic virus therapy is an effective way to shape the host immune system by expanding T or B cell populations specific for tumor-specific antigens released after tumor lysis. The immunogenicity of tumor-specific antigens depends largely on the affinity of the host immune receptors (B cell receptor or T cell receptor) for the antigen epitopes and the host tolerance threshold. High-affinity interactions drive host immune cells to become long-term memory cells through multiple rounds of proliferation and differentiation. The host tolerance mechanism counteracts such proliferation and expansion to minimize potential tissue damage resulting from local immune activation. The PD-1 inhibitory signal is part of such a host tolerance mechanism, as evidenced by the following lines of evidence. First, PD-1 expression is elevated in actively proliferating T cells, particularly those with a terminally differentiated phenotype, i.e., an effector phenotype. Effector cells are often associated with strong cytotoxic functions and cytokine production. Second, PD-L1 is important in maintaining peripheral tolerance and locally restricting over-activated T cells. Therefore, PD-1 inhibition using PD-1 binders expressed in the tumor microenvironment can be an effective way to enhance the activity of TILs and stimulate an effective and sustained anti-tumor immune response.
[0074] In one aspect, the present technology provides an oncolytic virus comprising a heterologous nucleic acid encoding an anti-PD-1 agent. In some embodiments, the anti-PD-1 agent comprises an antibody variable region that provides specific binding to a PD-1 epitope. The antibody variable region may be present, for example, in a complete antibody, an antibody fragment, and a recombinant derivative of an antibody or an antibody fragment. The term "antibody" refers to an immunoglobulin, whether natural or produced in part or completely synthetically. Thus, the anti-PD-1 agents of the present technology include any polypeptide or protein having a binding domain specific for binding to a PD-1 epitope.
[0075] Antibodies of different classes have different structures. The different antibody regions can be described with reference to IgG. An IgG molecule contains four polypeptide chains, two long heavy chains and two short light chains interconnected by disulfide bonds. The heavy and light chains each contain a constant region and a variable region. The heavy chain is composed of a heavy chain variable region (VH) and heavy chain constant regions (CH1, CH2, and CH3). The light chain is composed of a light chain variable region (VL) and a light chain constant region (CL). There are three hypervariable regions within the variable region involved in antigen specificity.
[0076] The hypervariable regions are generally referred to as complementarity-determining regions ("CDRs") and are inserted between more conserved adjacent regions called framework regions ("FWs"). Four FW regions and three CDRs, FW1, CDR1, FW2, CDR2, FW3, CDR3, FW4, are arranged from the NH2 terminus to the COOH terminus. For example, the framework regions and CDRs can be identified considering both the Kabat and Chothia definitions. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The two heavy chain carboxy regions are constant regions that are connected by disulfide bonds to form the Fc region. The Fc region is important in providing effector functions. Each of the two heavy chains constituting the Fc region extends to a different Fab region via a hinge region.
[0077] An anti-PD-1 agent or an anti-CTLA-4 agent generally contains an antibody variable region. Such antibody fragments include (i) a Fab fragment which is a monovalent fragment consisting of VH, VL, CH, and CL domains, (ii) a Fab2 fragment which is a divalent fragment containing two Fab fragments linked by a disulfide bond in the hinge region, (iii) an Fd fragment consisting of VH and CH1 domains, (iv) an Fv fragment consisting of the VH domain and the VL domain of a single arm of the antibody, (v) a dAb fragment containing a VH or VL domain, (vi) an scAb which is an antibody fragment containing VH, VL, and C1 or CH1, (vii) protein scaffold-based artificial antibodies including, but not limited to, fibronectin type III polypeptide antibodies. Further, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they may be connected using a recombinant method with a synthetic linker so that the VL and VH regions pair to form a single protein chain known as a single-chain Fv (scFv). Thus, the antibody variable region may be present in a recombinant derivative. Examples of recombinant derivatives include single-chain antibodies, diabodies, triabodies, tetra-bodies, and miniantibodies. An anti-PD-1 agent or an anti-CTLA-4 agent may contain one or more variable regions that recognize the same or different epitopes.
[0078] In some embodiments, the anti-PD-1 agent or anti-CTLA-4 agent is encoded by an oncolytic virus generated using recombinant nucleic acid technology. For example, different anti-PD-1 agents can be generated by different techniques, including single-chain proteins such as scFv containing a VH region and a VL region connected by a linker sequence, and antibodies or fragments thereof, and multi-chain proteins containing VH and VL regions on separate polypeptides. Recombinant nucleic acid technology relates to the construction of nucleic acid templates for protein synthesis. Appropriate recombinant nucleic acid techniques are well known in the art. The recombinant nucleic acid encoding the anti-PD-1 antibody or anti-CTLA-4 antibody may be expressed in cells that are infected with the oncolytic virus and released into the tumor microenvironment after virus lysis. The cells function as factories for the actually encoded protein.
[0079] A complete protein / polypeptide that binds to PD-1 / CTLA-4 may be generated using a nucleic acid comprising one or more recombinant genes encoding either or both of the VH region or VL region of the anti-PD-1 or anti-CTLA-4 agent. For example, a single gene encoding a single-chain protein such as scFv containing a VH region and a VL region connected by a linker may be used, or multiple recombinant regions may be used, for example, by generating both the VH and VL regions, to provide a complete binder.
[0080] Exemplary anti-PD-1 antibodies or anti-CTLA-4 antibodies or fragments or derivatives thereof useful in the present disclosure are available in the art. See, for example, WO2006 / 121168, WO2014 / 055648, WO2008 / 156712, US2014 / 0234296 or U.S. Patent No. 6,984,720.
[0081] Pharmaceutical composition: In another aspect, the present disclosure provides a pharmaceutical composition for the treatment of tumors comprising an effective amount of the genetically engineered oHSV-1 described herein and a pharmaceutically acceptable carrier.
[0082] In some embodiments, a pharmaceutical composition for the treatment of tumors comprises an effective amount of genetically engineered oHSV-1 and a pharmaceutically acceptable carrier, wherein the genetically engineered oHSV-1 comprises a modified genome, and the modification comprises: (a) a change in a copy of the γ34.5 gene in the terminal repeat of the genome such that the copy of the γ34.5 gene cannot express a functional ICP34.5 protein; and (b) a deletion of the internal inverted repeat region of the genome that causes a deletion of one copy of each of the double copy genes in the internal inverted repeat region and one copy of the duplicated non-coding sequence, wherein the double copy genes comprise genes encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O, and all single copy genes in both the U L and U S components are intact such that they can each express a functional protein.
[0083] In some embodiments, the change comprises a deletion of all or part of the coding region or regulatory region of the copy of the γ34.5 gene. In some embodiments, the duplicated non-coding sequence comprises the intron of ICP0, the LAT domain, and the "a" sequence. In some embodiments, U L and U S all single copy genes in both components are the U L U in the component L 1 to U L 56 genes and the U S U in the component S 1 to U S 12 genes.
[0084] In some embodiments, oHSV-1 is selected from the group consisting of the F strain, the KOS strain, and the 17 strain. In some embodiments, the deletion of the internal inverted repeat region causes an excision of nucleotide positions 117005 to 132096 in the genome of the F strain.
[0085] In some embodiments, oHSV-1 is a prototype (P) genomic isomer, and the last gene in the U L component (e.g., U Lfrom the stop codon of 56) to U S has a deletion of the internal inverted repeat region up to the promoter of the first gene in the component (e.g., U S 1).
[0086] In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent is incorporated into oHSV-1, and the incorporation does not interfere with the expression of the native genes of the HSV-1 genome. In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent is incorporated into oHSV-1.
[0087] In some embodiments, the immunostimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24, and IL-27. In some embodiments, the immunostimulant is IL-12. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent, an anti-CTLA-4 agent, or both. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent.
[0088] In some embodiments, the heterologous nucleic acid sequence is within the internal inverted repeat region and / or U L in the U L 3 and U L is incorporated between the 4 genes. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 and an anti-PD-1 agent is incorporated into oHSV-1. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 is incorporated into the internal inverted repeat region, and the heterologous nucleic acid sequence encoding the anti-PD-1 agent is between U L in the U L 3 and U L 4 genes.
[0089] Oncolytic viruses can be formulated in a suitable pharmaceutically acceptable carrier or excipient. Under normal storage and use conditions, these formulations contain preservatives to prevent the growth of microorganisms. Pharmaceutically suitable forms for injectable use include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In each case, the form must be sterile and must be fluid to the extent that easy injection is possible. The form must be stable under the conditions of manufacture and storage and must be protected against the contaminating action of microorganisms such as bacteria and fungi.
[0090] The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof and / or vegetable oils. Suitable fluidity can be maintained, for example, by the use of coatings such as lecithin, by maintaining the required particle size in the case of dispersion, and by the use of surfactants. The action of microorganisms can be prevented by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is preferable to include isotonic agents such as sugars or sodium chloride. The use of agents that delay absorption, such as aluminum monostearate, gelatin, in the composition can achieve the long-term absorption of the injectable composition.
[0091] For parenteral administration in an aqueous solution, for example, if necessary, the solution should be appropriately buffered and it is necessary to first isotonicize the liquid diluent with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, intratumoral, and intraperitoneal administration. In this regard, the available sterile aqueous media are known to those skilled in the art in light of the present disclosure. For example, one dose can be dissolved in 1 mL of isotonic NaCl solution and added to 1000 mL of subcutaneous injection solution, or injected into the recommended injection site. Variations in dosage are necessarily incurred according to the condition of the treatment subject. In any case, the person responsible for administration determines the appropriate dosage for an individual subject. Further, in the case of administration to humans, the formulation must meet the standards of sterility, pyrogenicity, general safety, and purity required in the FDA's biological standards.
[0092] Sterile injectable solutions are prepared by incorporating the required amount of the active compound, along with various other ingredients enumerated above as appropriate, into a suitable solvent and then filtering and sterilizing. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile carrier containing a basic dispersion medium and the other ingredients required from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying techniques that produce a powder of any additional desired ingredient from the active ingredient and a pre-sterile filtered solution.
[0093] The compositions disclosed herein may be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of proteins), which are formed with, for example, inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxy groups may be derived from, for example, inorganic bases such as sodium, potassium, ammonium, calcium, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc. When formulating, the solution is administered in a therapeutically effective amount in a manner compatible with the dosage formulation. The formulation is easily administered in various dosage forms such as injectable solutions, drug release capsules, etc.
[0094] As used herein, "carrier" includes any solvent, dispersion medium, carrier, coating, diluent, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents with pharmaceutically active substances is well known in the art. Their use in therapeutic compositions is contemplated, except where conventional media or agents are incompatible with the active ingredient. Auxiliary active ingredients may be incorporated into the compositions.
[0095] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not cause an allergic reaction or similar adverse reaction when administered to a human. The preparation of aqueous compositions containing proteins as active ingredients is well understood in the art. Typically, such compositions are prepared either as liquid solutions or suspensions and are prepared as injectables. They may also be prepared in solid forms suitable for dissolution or suspension in a liquid prior to injection.
[0096] In some embodiments, the compositions disclosed herein are used for the treatment of tumors. In some embodiments, the compositions disclosed herein are used for the treatment of solid tumors. In some embodiments, the compositions disclosed herein are used for the treatment of brain tumors. In some embodiments, the compositions disclosed herein are used for the treatment of brain tumors, wherein the brain tumor is selected from the group consisting of glioma, glioblastoma, anaplastic glioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma. In some embodiments, the brain tumor is glioblastoma multiforme.
[0097] Use and Therapy: In another aspect, the present disclosure provides the genetically engineered oHSV-1 described herein for use in the treatment of tumors in a subject. In another aspect, the present disclosure provides the genetically engineered oHSV-1 described herein for use in the treatment of solid tumors in a subject. In another aspect, the present disclosure provides the genetically engineered oHSV-1 described herein for use in the treatment of brain tumors in a subject.
[0098] In some embodiments, the genetically engineered oHSV-1 contains a modified genome, and the modification includes (a) a change in a copy of the γ34.5 gene in the terminal repeat of the genome such that the copy of the γ34.5 gene cannot express a functional ICP34.5 protein, and (b) a deletion of the internal inverted repeat region of the genome that causes a deletion of one copy of each of the double-copy genes in the internal inverted repeat region and one copy of the duplicated non-coding sequence, wherein the double-copy genes include genes encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O, and all single-copy genes in both the U L and U S components are intact so that they can express their respective functional proteins.
[0099] In some embodiments, the change includes a deletion of all or part of the coding region or regulatory region of the copy of the γ34.5 gene. In some embodiments, the duplicated non-coding sequence includes the intron of ICP0, the LAT domain, and the "a" sequence. In some embodiments, U L and U S all single-copy genes in both components are U L the U in the component L 1 to U L 56 genes and U S the U in the component S 1 to U S 12 genes.
[0100] In some embodiments, oHSV-1 is selected from the group consisting of the F strain, the KOS strain, and the 17 strain. In some embodiments, the deletion of the internal inverted repeat region causes an excision of nucleotide positions 117005 to 132096 in the genome of the F strain.
[0101] In some embodiments, oHSV-1 is the prototype (P) genomic isomer, and from the stop codon of the last gene (e.g., U L 56) in the U L component to U Shas a deletion of the internal inverted repeat region up to the promoter of the first gene (e.g., U S 1) in the component.
[0102] In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent is incorporated into oHSV-1, and the incorporation does not interfere with the expression of the native genes of the HSV-1 genome. In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent is incorporated into oHSV-1.
[0103] In some embodiments, the immunostimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24 and IL-27. In some embodiments, the immunostimulant is IL-12. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent, an anti-CTLA-4 agent or both. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent.
[0104] In some embodiments, the heterologous nucleic acid sequence is within the internal inverted repeat region and / or between U L in the component and U L 3 and U L 4 genes in the component. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 and an anti-PD-1 agent is incorporated into oHSV-1. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 is incorporated into the internal inverted repeat region, and the heterologous nucleic acid sequence encoding the anti-PD-1 agent is between U L in the component and U L 3 and U L 4 genes in the component.
[0105] In another aspect, the present disclosure provides for the use of the genetically engineered oHSV-1 described herein in the manufacture of a medicament for treating tumors in a subject. In another aspect, the present disclosure provides for the use of the genetically engineered oHSV-1 described herein in the manufacture of a medicament for treating solid tumors in a subject. In another aspect, the present disclosure provides for the use of the genetically engineered oHSV-1 described herein in the manufacture of a medicament for treating brain tumors in a subject.
[0106] In some embodiments, the genetically engineered oHSV-1 comprises a modified genome, said modification comprising: (a) a change in a copy of the γ34.5 gene in the terminal repeat of the genome such that the copy of the γ34.5 gene cannot express a functional ICP34.5 protein; and (b) a deletion in the internal inverted repeat region of the genome that causes a deletion of one copy of each of the double-copy genes in the internal inverted repeat region and one copy of the duplicated non-coding sequence, said double-copy genes comprising genes encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O, and all single-copy genes in both the U L and U S components are intact such that they can each express a functional protein.
[0107] In some embodiments, the change comprises a deletion of all or part of the coding region or regulatory region of a copy of the γ34.5 gene. In some embodiments, the duplicated non-coding sequence comprises the intron, LAT domain, and "a" sequence of ICP0. In some embodiments, all single-copy genes in both the U L and U S components comprise the U L 1 to U L 56 genes in the U L component and the U S 1 to U S 12 genes in the U S component.
[0108] In some embodiments, oHSV-1 is selected from the group consisting of the F strain, the KOS strain, and the 17 strain. In some embodiments, the deletion of the internal inverted repeat region causes excision of nucleotides positions 117005 to 132096 in the genome of the F strain.
[0109] In some embodiments, oHSV-1 is a genomic isomer of the prototype (P), and the last gene in the U L component (e.g., U L 56) to the promoter of the first gene in the U S component (e.g., U S 1), having a deletion of the internal inverted repeat region.
[0110] In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and / or an immunotherapeutic agent is incorporated into oHSV-1, and the incorporation does not interfere with the expression of the native genes of the HSV-1 genome. In some embodiments, a heterologous nucleic acid sequence encoding an immunostimulant and an immunotherapeutic agent is incorporated into oHSV-1.
[0111] In some embodiments, the immunostimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24, and IL-27. In some embodiments, the immunostimulant is IL-12. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent, an anti-CTLA-4 agent, or both. In some embodiments, the immunotherapeutic agent is an anti-PD-1 agent.
[0112] In some embodiments, the heterologous nucleic acid sequence is incorporated within the internal inverted repeat region and / or between the U L in the U L 3 and the U L 4 genes. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 and an anti-PD-1 agent is incorporated into oHSV-1. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 is incorporated into the internal inverted repeat region, and the heterologous nucleic acid sequence encoding the anti-PD-1 agent is between the U L in the U L 3 and the U LIt is integrated between 4 genes.
[0113] In another aspect, the present disclosure provides a method of treating or alleviating a tumor in a subject in need thereof, comprising administering to the subject an effective amount of an oHSV-1 virus or a pharmaceutical composition comprising the above-described oHSV-1 virus. In certain embodiments, the tumor is a solid tumor. In certain embodiments, the tumor is a brain tumor. In some embodiments, the brain tumor is selected from the group consisting of glioma, glioblastoma, oligodendroglioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma. In some embodiments, the brain tumor is glioblastoma multiforme.
[0114] In certain embodiments, the oHSV-1 virus or the pharmaceutical composition is administered into the tumor. In one embodiment, the HSV-1 virus or the pharmaceutical composition is directly injected into the tumor mass in the form of an injectable solution.
[0115] The method of the present invention is useful for the treatment of brain tumors. This includes all tumors within the human skull (cranium) or within the central spinal canal. The tumor may originate from the brain itself, but may also originate from lymphoid tissue, blood vessels, cranial nerves, the brain envelope (meninges), the skull, the pituitary gland, or the pineal gland. Inside the brain itself, the cells involved include neurons or glial cells (including astrocytes, oligodendrocytes, and ependymal cells). The brain tumor may also be mainly a metastatic tumor that spreads from cancer in other organs.
[0116] In some embodiments, the brain tumor is a glioma such as an ependymoma, astrocytoma, oligodendroastrocytoma, oligodendroglioma, ganglioglioma, glioblastoma (also known as glioblastoma multiforme), or mixed glioma. Gliomas are primary brain tumors and are classified into four grades (I, II, III, and IV) based on their microscopic appearance, particularly the presence of atypical cells, mitosis, endothelial proliferation, and necrosis. Grade I and II tumors, called "low-grade gliomas," have none or only one of these features and include diffuse astrocytoma, pilocytic astrocytoma, low-grade astrocytoma, low-grade oligodendroastrocytoma, low-grade oligodendroglioma, ganglioglioma, embryonal dysplastic neuroepithelial tumor, pleomorphic xanthoastrocytoma, and mixed glioma. Grade III and IV tumors, called "high-grade gliomas," have two or more of these features and include anaplastic astrocytoma, anaplastic oligodendroglioma, anaplastic oligodendroastrocytoma, anaplastic ependymoma, and glioblastoma (including giant cell glioblastoma and gliosarcoma). In one aspect of these embodiments, the glioma is a low-grade glioma. In another aspect of these embodiments, the glioma is a high-grade glioma. In another aspect of these embodiments, the glioma is a glioblastoma.
[0117] In some embodiments, it may be desirable to combine oHSV-1 with other agents effective in the treatment of cancer. For example, the treatment of cancer may be carried out with oncolytic viruses and other anticancer therapies such as anticancer agents or surgery. In the context of the present technology, oncolytic virus therapy can be considered for use in combination with chemotherapy, radiotherapy, immunotherapy, or other biological interventions.
[0118] "Anti-cancer" agents can, for example, kill cancer cells, induce apoptosis of cancer cells, reduce the growth rate of cancer cells, reduce the incidence or number of metastases, shrink tumor size, inhibit tumor growth, reduce the blood supply to tumors or cancer cells, promote the immune response against cancer cells or tumors, prevent or inhibit the progression of cancer, or extend the lifespan of cancer patients, thereby having an adverse effect on the cancer of the subject. Anti-cancer agents include biological agents (biotherapy), chemotherapeutic agents, and radiotherapy agents. More generally, these other compositions are provided in an effective combination amount to kill or inhibit the growth of cells. The process may include contacting the cells simultaneously with an expression construct and a drug or a plurality of factors. This can be achieved by contacting the cells with a single composition or pharmaceutical formulation containing both drugs, or by contacting the cells simultaneously with two different compositions or formulations, one composition containing the expression construct and the other containing the second drug.
[0119] In some embodiments, the oHSV-1 disclosed herein is combined with an adjuvant. In one embodiment, the adjuvant is an oligonucleotide containing an unmethylated CpG motif. The unmethylated dinucleotide CpG motif of bacterial deoxyribonucleic acid (DNA) has the advantage of stimulating some immune cells to secrete cytokines for enhancing innate and adaptive immunity.
[0120] Viral therapy may be performed prior to or subsequent to other drug therapies at intervals ranging from a few minutes to a few weeks. In embodiments where other drugs and oncolytic viruses are applied to cells separately, generally, it is ensured that a significant length of time does not elapse between the times of each delivery so that the drugs and the virus can still advantageously exert a combined effect on the cells. In such cases, it is conceivable that the cells may be contacted with the two therapies at intervals within about 12 to 24 hours of each other. In some cases, however, when several days (2, 3, 4, 5, 6, or 7 days) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8 weeks) elapse between each administration, it may be desirable to significantly extend the treatment period.
[0121] In some embodiments, a second therapy is administered to the subject before, simultaneously with, or after the administration of the oHSV-1 disclosed herein or the pharmaceutical composition disclosed herein. In some embodiments, the second therapy is chemotherapy, radiation therapy, immunotherapy, and / or a surgical intervention. In some embodiments, the subject is human.
[0122] The sequences used in this disclosure are summarized below. JPEG2025090623000001.jpg217157
[0123] (Example) As shown in the following examples, the engineered oHSV-1 virus in which both copies of the γ34.5 gene are deleted and the internal inverted repeat region is further deleted showed surprisingly higher antitumor activity against various brain tumor cells than non-brain tumor cells or normal cells. These results show the surprising fact that oHSV-1 viruses with similar genomic structures known in the art (e.g., T3011, R3616, WT strain F) are less efficient than the oHSV-1 disclosed herein (i.e., C1212, C5252, C8282) in killing brain tumor cells.
[0124] Construction of oHSV-1 C5252, C8282, and C1212: Construction of oHSV-1 C5252: C5252 contains a deletion of the γ34.5 gene, the insertion of an anti-human PD-1 antibody expression cassette between U L 3 and U L 4, and a modified internal repeat (IR) region replaced by an IL-12 expression cassette. The recombinant virus was constructed in several steps using the bacterial artificial chromosome (BAC) system. A detailed description of the viral construct is as follows.
[0125] HSV-1 BAC (BAC-Δ34.5) having a deletion arrangement of both copies of the γ34.5 gene is used. In the context of handling the wild-type genome, an IL-12 expression cassette with the upstream adjacent to nucleotide 117005 and the downstream adjacent to nucleotide 132096 was PCR amplified from the HSV-1 viral genome by two sets of primers (GAAGATCTAATATTTTTATTGCAACTCCCTG (SEQ ID NO: 5), CTAGCTAGCTTATAAAAGGCGCGTCCCGTGG (SEQ ID NO: 6)) and (GCTCTAGATTGCGACGCCCCGGCTC (SEQ ID NO: 7), CCTTAATTAAGGTTACCACCCTGTAGCCCCGATGT (SEQ ID NO: 8)) respectively, and inserted into the gene replacement plasmid pKO5 to generate pKO1407. Next, pKO1407 was transfected into Escherichia coli with BAC-Δ34.5 by electroporation to generate BAC-Δ34.5-IL12. Next, in the context of handling the wild-type genome, a CMV promoter cassette driving the PD-1 Fab gene with the upstream adjacent to nucleotide 11658 and the downstream adjacent to nucleotide 11659 was PCR amplified from the HSV-1 viral genome by two sets of primers (TCCCATGGATTTAACAAACGGGGGGGTGTCG (SEQ ID NO: 9), GGCCCCCGAGGCCAGCATGACGTTATCT (SEQ ID NO: 10)) and (GAGTAACCGCCCCCCCCCCATGCCACCCTCAC (SEQ ID NO: 11), GTGTTTTACTGCCACTACACCCCCGGGGAAC (SEQ ID NO: 12)) respectively, and ligated to pKO5 at the BglII and PacI sites to generate the pKOE1002 plasmid. Next, the pKOE1002 plasmid was transfected into Escherichia coli with BAC-Δ34.5-IL12 by electroporation to generate BAC-5252. Identification of the virus by transfection of the BAC-5252 plasmid, followed by several steps of plaque purification and amplification in Vero cells, followed by detection of IL-12 and PD-1 Fab secretion (Table 1) and expression of the protein ICP34.5 encoding the γ34.5 gene (Figure 2) yielded the C5252 virus.
[0126] C8282 is a mouse version that is functionally identical to C5252, except that C8282 has the mouse version of IL-12 and a mouse anti-PD-1 antibody (a single-chain antibody fragment, scFv containing a heavy-chain variable region and a light-chain variable region having the sequences shown in SEQ ID NOs: 13 and 14, respectively) at the same position on the viral genome, and C5252 has human IL-12 and an anti-human PD-1 antibody.
[0127] C1212 is a version that is functionally identical to C5252, except that at the same position C1212 on the viral genome, it has a CMV promoter, followed by three overlapping stop codons and a green fluorescent protein (GFP), and C5252 has human IL-12 and an anti-human PD-1 antibody (a PD-1 Fab containing a heavy-chain variable region and a constant region and a light-chain variable region and a constant region of the sequences shown in SEQ ID NOs: 1-4, respectively).
[0128] Confirmation of the expression of IL-12 and anti-PD-1 antibodies and the expression of ICP34.5 protein by C5252, C8282, and C1212 viruses: Vero cells were seeded in 6-well plates at a density of 4×10 5 cells per well. After incubation overnight, the cells were either mock-infected or infected with 1 PFU of HSV-1 (F), R3616, C5252, C8282, or C1212 per cell. The cells were harvested at 6, 12, and 24 hours post-infection, respectively. Proteins were separated by electrophoresis on a 10% denaturing gel and reacted with the antibody ICP34.5 or GAPDH. GAPDH was used as a loading control (Figure 2). The cell supernatants collected 24 hours post-infection with C5252, C8282, and C1212 were used in an ELISA assay to detect the expression levels of IL-12 and anti-PD-1 antibodies. The results are shown in Table 1.
Table 1
[0129] As shown in Table 1, IL-12 and anti-PD-1 antibody expressed by C5252 and C8282 viruses were detected at equivalent levels. C1212, the backbone virus, did not detect IL-12, similar to the expression of anti-PD-1 antibody determined by ELISA assay.
[0130] As shown in Figure 2, the expression of ICP34.5 protein detected by immunoblotting indicated that ICP34.5 protein was absent in C5252, C8282, C1212, and R3616-infected samples but was expressed in wild-type (WT) F-infected samples.
[0131] All of the above results indicated that recombinant viruses C5252, C8282, and C1212 were confirmed by the expression of IL-12, anti-PD-1 antibody, and the lack of expression of ICP34.5 protein.
[0132] In vitro cell killing activity - brain tumor cell lines: A172, D54-MG, U87-MG, U138-MG, and D458 cells were seeded in 96-well plates (4000 cells / well) and infected with F, R3616, T3011, and C5252 (0.1 and 1.0 PFU / cell). Forty-eight hours post-infection (48H p.i.), cell viability was determined using a CCK8-Kit. Inhibition rate = (OD of non-infected well - OD of oHSV-infected well) / (OD of non-infected well - OD of blank well) × 100%. The blank well contained only medium. All values in the experiment were shown as mean ± SEM. The results are shown in Table 2.
Table 2
[0133] As shown in Table 2, oHSV-1 C5252 was an effective cytotoxic agent in all tumor brain cells tested at 1.0 PFU / cell. Among the cell lines A172, D54-MG, and U138-MG, C5252 showed the highest cytotoxic ability among the tested oHSV-1 viruses. In the cell lines U87-MG and D458, the antitumor effect of C5252 was equivalent to that of T3011. Compared with R3616, which is also a γ34.5 gene-null oHSV-1, C5252 was 2- to 3-fold more effective in most of the tested cell lines.
[0134] In vitro cell killing activity - non-brain tumor cell lines: Cells were seeded in 96-well plates (4000 cells / well) and infected with F, T3011, and C5252 (0.1 and 1.0 PFU / cell). At 48 hours post-infection (48 h p.i.), cell viability was determined using a CCK8-Kit. Inhibition rate = (OD of non-infected well - OD of oHSV-infected well) / (OD of non-infected well - OD of blank well) × 100%. The blank well contained only medium. All values in the experiment were shown as mean ± SEM. The results are shown in Table 3.
Table 3
[0135] As shown in Table 3, when tested in non-brain tumor cell lines, both T3011 and C5252 were effective tumor-killing agents against various non-brain tumor cells. It was noted that the anti-tumor activity of C5252 was substantially equivalent to that of T3011 at lower or higher multiplicities of infection (MOI) in all 8 cell lines tested in this example. This was unexpected because C5252 is a further attenuated version of T3011 with the second copy of the γ34.5 gene deleted. However, as shown in Table 2, the deletion of the second copy of the γ34.5 gene did not show an adverse effect on the anti-tumor activity of the oHSV-1 virus against non-brain tumor cells, but significantly improved its tumor-killing effect against brain tumor cells. Therefore, the oHSV-1 virus disclosed herein is generally more effective in tumor killing than the oHSV-1 from which it is derived.
[0136] In vitro inhibition evaluation of C5252 on the proliferation of human malignant glioma cells: As shown in Figure 3, the sensitivity of C5252 to human glioma cell lines U87-MG, U138-MG, U373-MG, D54-MG and U251-MG was basically the same, and the IC 50 values of C5252 and C1212 against these glioma cells were less than 10 MOI. The inhibitory effect of C5252 was equivalent to that of the backbone C1212. The integration of heterologous genes into the virus genome did not substantially affect the replication of oHSV, and thus its inhibitory ability. However, in the case of in vivo administration, the nature of the immunostimulant (IL-12) and immunotherapeutic agent (anti-PD-1 antibody) expressed by the oHSV-1 virus significantly promoted the killing of tumor cells by the subject's immune system.
[0137] Inhibitory effect of C5252 on normal cells and tumor cells: As shown in Figure 4, the IC 50 values of C5252 against tumor cells U373-MG and ACHN were 6.890 and 9.102 MOI, respectively, and the IC 50All values exceeded 500 MOI. Under the conditions of this experiment, C5252 did not show an obvious inhibitory effect on normal cells, but showed a significant inhibitory effect on tumor cells. Compared with normal cells, the inhibitory effect of C5252 had a higher targeting effect on human tumor cells. This result indicated that C5252 selectively killed tumor cells while preserving normal cells.
[0138] Efficacy study of C8282 in the treatment of GL261 subcutaneous transplantation model in C57BL / 6 mice: C8282 is a mouse surrogate of C5252, and mouse IL-12 (m-IL-12) and anti-mouse PD-1 (m-PD-1) antibodies were introduced into the viral genome to replace the equivalent in humans. As shown in Figure 5, intratumoral injection of C8282 showed significant efficacy against the GL261 subcutaneous tumor model. When mice were treated with C8282 at a dose of 5×10 6 PFU / animal or less, it was well tolerated by the animals. The medium dose level of 5×10 5 PFU / animal showed the highest efficacy in the tested dose range.
[0139] Efficacy study of C5252 in the treatment of orthotopic U87 human glioma model in nude mice: As shown in Figure 6, intracerebral injection of C5252 showed significant efficacy against U87-MG cells in nude mice. No significant difference was seen at different dose levels.
[0140] Although the present disclosure is specifically disclosed by preferred embodiments and any features, it should be understood that corrections, improvements, and changes to the content disclosed herein are readily conceivable by those skilled in the art, and these corrections, improvements, and changes are considered to be within the scope of the present disclosure. The materials, methods, and examples provided herein are representative of the preferred embodiments and are illustrative, and are not intended as limitations to the scope of the present disclosure.
Claims
1. 1. An oncolytic herpes simplex virus type I (oHSV-1) comprising a modified genome, said modification comprising: a) an alteration in a copy of the γ34.5 gene located in the terminal repeat of the genome that renders that copy incapable of expressing a functional ICP34.5 protein; b) deletion of the internal inverted repeat region of the genome, resulting in the deletion of one copy of each of the double copy genes within the internal inverted repeat region and one copy of the duplicated non-coding sequence, said double copy genes including the genes encoding ICP0, ICP4, ICP34.5, ORFP and ORFO; and Genome U L and U S All single copy genes in both components oHSV-1 are intact so that they are able to express their respective functional proteins.
2. The oHSV-1 of claim 1, wherein the alteration comprises a deletion of all or part of the coding or regulatory region of the copy of the γ34.5 gene.
3. The oHSV-1 of claim 1 or 2, wherein the duplicated non-coding sequences include an intron, a LAT domain and an "a" sequence of ICP0.
4. U L and U S All single copy genes in both components are L U in the ingredients L 1~U L 56 genes and U S U in the ingredients S 1~U S 3. The oHSV-1 of claim 1 or 2, comprising 12 genes.
5. The oHSV-1 according to any one of claims 1 to 4, wherein the HSV-1 is selected from the group consisting of F strain, KOS strain and 17 strain.
6. The oHSV-1 according to any one of claims 1 to 5, wherein the HSV-1 has a prototype (P) genome isomer.
7. 7. The oHSV-1 of any one of claims 1 to 6, wherein the deletion of the internal inverted repeat region causes excision of nucleotide positions 117005 to 132096 in the genome of the F strain.
8. The deletion of the internal inverted repeat region is L U from the stop codon of the last gene in the component S The oHSV-1 of claim 6, up to the promoter of the first gene in the component.
9. U L The last gene in the component is U L The oHSV-1 of claim 8, which is 56 genes.
10. U S The first gene in the component is U S The oHSV-1 according to claim 8 or 9, which is a single gene.
11. The oHSV-1 of any one of claims 1 to 10, wherein a heterologous nucleic acid sequence encoding an immunostimulatory and / or immunotherapeutic agent is integrated into said oHSV-1, said integration not interfering with the expression of native genes of the HSV-1 genome.
12. The oHSV-1 of claim 11, wherein a heterologous nucleic acid sequence encoding an immunostimulatory and immunotherapeutic agent is incorporated into said oHSV-1.
13. The oHSV-1 of claim 11 or 12, wherein the immune stimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24 and IL-27.
14. The oHSV-1 of claim 13, wherein the immunostimulant is IL-12.
15. The oHSV-1 of any one of claims 11 to 14, wherein the immunotherapeutic agent is an anti-PD-1 agent, an anti-CTLA-4 agent, or both.
16. The oHSV-1 of claim 15, wherein the immunotherapeutic agent is an anti-PD-1 agent.
17. The heterologous nucleic acid sequence may be located within the internal inverted repeat region and / or L U in the ingredients L 3 and U L The oHSV-1 according to any one of claims 11 to 16, which is integrated between four genes.
18. The oHSV-1 of any one of claims 11 to 17, wherein heterologous nucleic acid sequences encoding IL-12 and an anti-PD-1 agent are incorporated into said oHSV-1.
19. A heterologous nucleic acid sequence encoding IL-12 is incorporated into the internal inverted repeat region, and a heterologous nucleic acid sequence encoding an anti-PD-1 agent is incorporated into the internal inverted repeat region. L U in the ingredients L 3 and U L The oHSV-1 of claim 18, which is integrated between four genes.
20. A pharmaceutical composition for the treatment of tumors comprising an effective amount of an oHSV-1 according to any one of claims 1 to 18 and a pharma- ceutically acceptable carrier.
21. The pharmaceutical composition of claim 20, wherein the tumor is a brain tumor.
22. 22. The pharmaceutical composition of claim 21, wherein the brain tumor is selected from the group consisting of glioma, glioblastoma, oligodendroglioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma, and neuroblastoma.
23. 23. The pharmaceutical composition of claim 22, wherein the brain tumor is glioblastoma multiforme.
24. Use of an oHSV-1 according to any one of claims 1 to 18 in the manufacture of a medicament for the treatment of a tumor.
25. The use according to claim 24, wherein the tumor is a brain tumor.
26. 26. The use according to claim 25, wherein the brain tumor is selected from the group consisting of glioma, glioblastoma, oligodendroglioma, astrocytoma, ependymoma, primitive neuroectodermal tumor, atypical meningioma, malignant meningioma and neuroblastoma.
27. 26. The use of claim 25, wherein the brain tumor is glioblastoma multiforme.