Cells, tissues, organs, and / or animals having one or more modified genes for enhanced xenograft survival and / or tolerance

Abstract

To provide cells, tissues, organs, and / or animals having one or more modified genes for enhanced xenograft survival and / or tolerance; and to provide methods of producing and using the cells, tissues, organs, and / or animals.SOLUTION: The present disclosure provides cells, tissues, organs, and animals comprising genetic modifications that result in enhanced immunological compatibility, as well as vectors and methods for use in generating these cells, tissues, organs, and animals, and the use of these cells, tissues, organs, and animals in xenotransplantation. In certain embodiments, the genetic modifications giving rise to enhanced immunological compatibility include one or more complement response genes, coagulation response genes, inflammatory response genes, immune response genes, and / or immunomodulator genes.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is filed on May 16, 2019, and is incorporated herein by reference in its entirety. No. PCT / CN19 / 87314 filed May 16, 2019, filed October 18, 2019 No. PCT / CN19 / 112038 filed on October 18, 2019, and PCT / CN The disclosure of US Pat. No. 19 / 112039 is incorporated in its entirety for all purposes.

[0002] CROSS REFERENCE TO SEQUENCE LISTING

[0002] The contents of electronically submitted text files are incorporated herein by reference in their entirety. Incorporated into the document: A computer readable form of the sequence listing (file name: EGEN_037_00WO_SeqL ist_ST25.txt, Recorded date: May 14, 2020, File size: 189 KB to). [Background technology]

[0003] background

[0003] The shortage of human organs and tissues for transplantation has increased over the past several decades. Xenotransplantation is one of the most significant unmet medical needs in the world today. It has the potential to provide a nearly unlimited supply of transplant organs for patients with The similarity of physiology, coupled with genetic engineering to eliminate molecular incompatibilities, has led to the development of pigs with renal allografts. Preclinical studies have demonstrated that porcine renal xenografts are the gonadal xenograft of choice in non-human primate recipients. It has been demonstrated that the endothelial cells can sustain life for weeks to months in patients with endothelial cell carcinoma (Higginbotham 2015, wase 2015b). However, as a result of the evolutionary distance between pigs and humans, pig organs (i) Hyperacute rejection, (ii) acute humoral rejection consisting of type II endothelial cell ( EC) activation with disordered thrombus regulation and leukocyte recruitment, (iii) thrombotic microangiopathy consisting of intravascular thrombosis, fibrin deposition, and thrombosis due to lack of thrombomodulation, and (iv) rejection induced by the human immune system in many forms including chronic vascular damage. These adverse events are, at least partially, due to molecular incompatibility between donor and recipient, particularly with respect to genes involved in the complement, coagulation, inflammation, and immune response systems. The clinical use of xenogeneic organs (e.g., porcine) is hampered by these immunological incompatibilities, and to date, this has precluded the use of porcine

[0004] cells, tissues, and vascularized porcine organs in clinical xenotransplantation.

[0004] Over the past 20 years, several genetic modifications that reduce interspecies incompatibility between pigs and humans have been identified. However, these previously identified genetic modifications have not achieved long-term xenograft survival. Furthermore, due to the technical limitations of large-scale genomics, it has been prevented from integrating these modifications into a single animal.

[0005] Summary

[0005] There is a need to develop porcine cells, tissues, organs, and / or porcine animals having novel combinations of genetic modifications for use in xenotransplantation and to develop related methods.

Means for Solving the Problems

[0006]

[0006] Accordingly, the present disclosure provides cells, tissues, organs, and animals that contain genetic modifications that result in improved immunocompatibility, and vectors and methods for making these cells, tissues, organs, and animals, as well as the use of these cells, tissues, organs, and animals in xenotransplantation. In certain embodiments, the genetic modifications that result in improved immunocompatibility include one or more complement response genes (also referred to interchangeably herein as complement toxicity genes), coagulation response genes (also referred to interchangeably herein as coagulation genes), inflammatory response genes (also referred to interchangeably herein as apoptosis / inflammation genes), immune response genes (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes. Cells, tissues, organs, and animals, and vectors and methods for making these cells, tissues, organs, and animals, as well as the use of these cells, tissues, organs, and animals in xenotransplantation are provided. In certain embodiments, the genetic modifications that result in improved immunocompatibility include one or more complement response genes (also referred to interchangeably herein as complement toxicity genes), coagulation response genes (also referred to interchangeably herein as coagulation genes), inflammatory response genes (also referred to interchangeably herein as apoptosis / inflammation genes), immune response genes (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes. In certain embodiments, the genetic modifications that result in improved immunocompatibility include one or more complement response genes (also referred to interchangeably herein as complement toxicity genes), coagulation response genes (also referred to interchangeably herein as coagulation genes), inflammatory response genes (also referred to interchangeably herein as apoptosis / inflammation genes), immune response genes (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes. In certain embodiments, the genetic modifications that result in improved immunocompatibility include one or more complement response genes (also referred to interchangeably herein as complement toxicity genes), coagulation response genes (also referred to interchangeably herein as coagulation genes), inflammatory response genes (also referred to interchangeably herein as apoptosis / inflammation genes), immune response genes (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes. (also referred to interchangeably herein as coagulation genes), inflammatory response genes (also referred to interchangeably herein as apoptosis / inflammation genes), immune response genes (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes. (also referred to interchangeably herein as apoptosis / inflammation genes), immune response genes (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes. (also referred to interchangeably herein as cytotoxicity genes), and / or immunomodulatory substance genes.

[0007]

[0007] In some aspects, the present disclosure provides isolated cells, tissues, organs, and animals that contain a plurality of transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some aspects, the present disclosure provides isolated cells, tissues, organs, or animals that contain a plurality of transgenes, the plurality of transgenes including at least one inflammatory response transgene, at least one immune response transgene, and at least one immunomodulatory substance transgene. In some embodiments, the plurality of transgenes includes at least three transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some embodiments, the inflammatory response transgene is tumor necrosis factor alpha-induced protein 3 (A20), heme oxygenase (HO-1 or HMO In some aspects, the present disclosure provides isolated cells, tissues, organs, and animals that contain a plurality of transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some aspects, the present disclosure provides isolated cells, tissues, organs, and animals that contain a plurality of transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some aspects, the present disclosure provides isolated cells, tissues, organs, and animals that contain a plurality of transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some aspects, the present disclosure provides isolated cells, tissues, organs, or animals that contain a plurality of transgenes, the plurality of transgenes including at least one inflammatory response transgene, at least one immune response transgene, and at least one immunomodulatory substance transgene. In some aspects, the present disclosure provides isolated cells, tissues, organs, or animals that contain a plurality of transgenes, the plurality of transgenes including at least one inflammatory response transgene, at least one immune response transgene, and at least one immunomodulatory substance transgene. In some aspects, the present disclosure provides isolated cells, tissues, organs, or animals that contain a plurality of transgenes, the plurality of transgenes including at least one inflammatory response transgene, at least one immune response transgene, and at least one immunomodulatory substance transgene. In some embodiments, the plurality of transgenes includes at least three transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some embodiments, the plurality of transgenes includes at least three transgenes selected from the group consisting of inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, or combinations thereof. In some embodiments, the inflammatory response transgene is tumor necrosis factor alpha-induced protein 3 (A20), heme oxygenase (HO-1 or HMO X1), Cluster of Differentiation 47 (CD47), and combinations thereof. In some embodiments, the immune response transgene is selected from the group consisting of human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof. In some embodiments, the immunomodulatory substance transgene is selected from the group consisting of programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof. In some embodiments, the plurality of transgenes further comprises at least one coagulation response transgene. In some embodiments, the coagulation response transgene is selected from the group consisting of Cluster of Differentiation 39 (CD39), thrombomodulin (THBD , TBM, or TM), tissue factor pathway inhibitor (TFPI), and combinations thereof. In some embodiments, the plurality of transgenes further comprises at least one complement response transgene. In some embodiments, the complement response transgene is human membrane cofactor protein (hCD46 or simply CD46); human complement decay-accelerating factor (hC D55 or simply CD55), human MAC-inhibitory factor (hCD59 or simply CD59),

[0008] and combinations thereof.

[0008] In one aspect, the present disclosure provides a complement response transgene (e.g., CD46, CD5 5, CD59); a coagulation response transgene (e.g., CD39, THBD or TBM, TFP I); an inflammatory response transgene (e.g., A20, HO-1, CD47); an immune response transgene e.g., HLA-E, B2M); and / or an immunomodulatory substance transgene (e.g., PD One or more transgenes independently selected from the group consisting of -L1, FasL) Provided are isolated cells, tissues, organs, and animals comprising. In certain embodiments, the cells, tissue, organ, or animal can further comprise one or more additional transgenes from other gene categories.

[0009]

[0009] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more complement response transgenes selected from the group consisting of hCD46, hCD55, and hCD59. In some of these embodiments, the expression of one or more of the complement response transgenes is driven by a ubiquitous promoter.

[0010]

[0010] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more coagulation response transgenes selected from the group consisting of CD39, THBD, and TFPI. In some of these embodiments, the expression of one or more of the coagulation response transgenes is driven by a tissue-specific promoter. In certain ones of these embodiments, the tissue-specific promoter is an endothelium-specific promoter, and in certain ones of these embodiments, the endothelium-specific promoter is a low-expression endothelium-specific promoter.

[0011]

[0011] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more inflammatory response transgenes selected from the group consisting of A20, HO-1, and CD47. In some of these embodiments, the expression of one or more of the inflammatory response transgenes is driven by a tissue-specific promoter such as a ubiquitous promoter or an endothelium-specific promoter. ​​​​​​​​​、or driven by any combination thereof.

[0012]

[0012] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more immune response transgenes selected from the group consisting of HLA-E and B2M. In some of these embodiments, the expression of one or more of the immune response transgenes is driven by a ubiquitous promoter.

[0013]

[0013] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more immune regulatory substance transgenes including, but not limited to, PD-L1, FasL, or both.

[0014]

[0014] Expression of at least 6 of these transgenes at clinically effective levels in cells, tissues, organs, or animals results in improved immunocompatibility. Thus, in certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise 6 or more transgenes, for example, 6, 7, 8, 9, 10, 11, or 12 transgenes selected from the group consisting of complement response, coagulation response, inflammatory response, immune genes, and immune regulatory substance transgenes. In certain of these embodiments, the cells, tissues, organs, or animals can comprise at least one transgene from each category. In other embodiments a particular category of transgenes can be excluded. In certain embodiments, the complement response, coagulation response, inflammatory response, immune response, and / or immune regulatory substance transgenes can all be expressed simultaneously at detectable and / or clinically effective levels. In other embodiments, the transgenes Only a specific subset may be expressed at a clinically effective level at a specific time point or in response to a specific signal. In these embodiments, the expression of one or more of the transgenes may decrease to levels below detectable and / or clinically effective levels at specific

[0015]

[0015] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD and TFPI.

[0016]

[0016] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise the transgenes CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, and TFPI.

[0017]

[0017] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise the transgenes CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1.

[0018]

[0018] The proteins or genes referred to herein may be as set forth in the following table. The sequences are incorporated by reference.

[0019]

Table 1

[0020]

Table 2

[0021]

[0019] In certain embodiments, the isolated cells, tissues, organs, and animals disclosed herein further comprise one or more modifications to complement response genes, coagulation response genes, inflammatory response genes, immune response genes, and / or immune regulatory substance genes. For example, in certain embodiments where the cell, tissue, organ, or animal is a pig, the cell, tissue, organ, or animal can comprise a modification of the von Willebrand factor (vWF) gene (including, where applicable, a modification that results in humanization of the gene).

[0022]

[0020] In certain embodiments, the cells, tissues, organs, and animals disclosed herein further comprise one or more modifications to other categories of genes. These modifications can include, for example, deletion or excision (i.e., knockout) of all or part of a gene, or any other inactivation, disruption, or alteration. For example, in certain embodiments, the cells, tissues, organs, and animals can comprise knockout, inactivation, or disruption of asialoglycoprotein receptor 1 (ASGR1). In certain embodiments, the cells, tissues, organs, and animals can be genetically modified to exhibit a reduced carbohydrate antigen response. For example, the cell, tissue, organ, or animal can comprise knockout, inactivation, or disruption of one or more carbohydrate antigen-producing genes (e.g., glycoprotein α- galactosyltransferase 1 (GGTA), β1,4 N-acetylgalactosaminyl transferase 2 (B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH)).

[0023]

[0021] In certain embodiments, the isolated cells, tissues, organs, and and the animal comprises the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD , and TFPI, and further comprises the knockout, inactivation, or disruption of GGTA, B4GalNT2, and CMAH. In certain embodiments, the isolated cells, tissues, organs, and animals further comprise the transgenes CD59 and B2M, and in certain ones of those embodiments the isolated cells, tissues, organs, and animals further comprise the transgenes A20, PD-L1, and HO-1. In certain embodiments, these cells, tissues, organs, and animals exhibit improved immunological compatibility, including a reduced carbohydrate antigen response, and an improved coagulation, complement, inflammatory, and / or immune response .

[0024]

[0022] In some embodiments, the isolated cells, tissues, organs and animals provided herein are pigs, i.e., porcine cells, porcine tissues, porcine organs, or swine or their progeny . In certain ones of these embodiments, the cells, tissues, organs, or animals are free of porcine endogenous retroviruses (``PERV-free''). In certain ones of these embodiments , the ``PERV-free'' cells, tissues, organs, or animals do not produce xenotropic PERV virions . In certain ones of these embodiments, the ``PERV-free'' cells, tissues, organs, or animals do not produce PERV virions. In certain ones of these embodiments, the ``P ERV-free'' cells, tissues, organs, or animals do not produce infectious PERV virions . In certain ones of these embodiments, the PERV-free cells, tissues, organs, and animals comprise the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD, and TFPI . ​I, and optionally knockout of GGTA, B4GalNT2, and / or CMAH. In another embodiment, the method further comprises inactivating, inactivating, or destroying a PERV-free cell, tissue, or The organs and animals were transfected with the following genes: CD46, CD55, CD59, HLA-E, B2M, C D47, CD39, THBD, and TFPI, and optionally GGTA, B4Gal Further included are knockout, inactivation, or disruption of NT2 and / or CMAH. In other embodiments, the PERV-free cells, tissues, organs, and animals contain the transgene CD46 , CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI , A20, PD-L1, and HO-1, and optionally GGTA, B4GalNT2 or knocking out, inactivating, or disrupting CMAH.

[0025]

[0023] In certain embodiments of the isolated cells and tissues provided herein, the cells or tissues The tissue may be a kidney or liver cell or tissue. In certain embodiments, the organ is the kidney or liver.

[0026] In another aspect, the present disclosure provides an inflammatory response transgene, an immune response transgene, an immune regulation transgene, At least two types of genes selected from the group consisting of a gene for a gene encoding a chromosome, ... In some embodiments, the vector comprises a plurality of transgenes. The transgene may be an inflammatory response transgene, an immune response transgene, an immunomodulatory substance transgene, or In some embodiments, the present invention comprises three types selected from the group consisting of: The present disclosure provides a vector comprising a plurality of transgenes, the plurality of transgenes comprising at least At least one inflammation response transgene, at least one immune response transgene, and at least one immune regulatory substance transgene. In some embodiments, the inflammation response transgene is selected from the group consisting of A20, HO-1, CD47, and combinations thereof. In some embodiments, the immune response transgene is selected from the group consisting of HLA-E, B2M, and combinations thereof. In some embodiments, the immune regulatory substance transgene is selected from the group consisting of PD- L1, FasL, and combinations thereof. In some embodiments the plurality of transgenes further comprises at least one coagulation response transgene. In some embodiments, the coagulation response transgene is selected from the group consisting of CD39, THBD, TFPI, and combinations thereof. In some embodiments, the plurality of transgenes further comprises at least one complement response transgene. In some embodiments, the complement response transgene is selected from the group consisting of CD46, CD55, CD59, and combinations thereof.

[0027]

[0025] In other aspects, the present disclosure provides vectors (e.g., vectors for inserting (i.e., knocking in) at least one complement response, coagulation response, inflammation response, immune response, and / or immune regulatory substance transgene) used to genetically modify cells, tissues, organs, or animals to produce the cells, tissues, organs, or animals provided herein. In certain ones of these embodiments, the vector comprises at least 6, 7, 8 , 9, 10, 11, or 12 of the transgenes. In some of these embodiments, at least 6 of the transgenes are expressed from a single locus. To produce cells, tissues, organs, or animals . In some of these embodiments, at least 6 of the transgenes are expressed from a single locus. To produce cells, tissues, organs, or animals ​To this end, other components (e.g., guide RNA (gRNA) or endonucleases, including CRISPR-based editing components) used to genetically modify the cells, tissues, organs, or animals provided herein are also provided herein.

[0028]

[0026] In certain embodiments, the vectors provided herein include the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD, and TFPI. In certain of these embodiments, the vector further includes the transgenes CD59 and B2M. In certain of these embodiments, the vector further includes the transgenes A20, PD-L1, and HO-1, and in certain of these embodiments, the vector includes the components shown in FIGS. 17-20, 31, or 48-50. In certain embodiments, the vector includes a sequence shown in any of SEQ ID NOs: 212-214.

[0029]

[0027] In certain embodiments, methods for producing the isolated cells, tissues, organs, and animals provided herein are also provided herein. In certain of these embodiments, the method includes introducing one or more of the vectors provided herein. Thus, in certain embodiments, the cells, tissues, organs, and animals provided herein include one or more of the vectors disclosed herein.

[0030]

[0028] In some embodiments, the methods disclosed and described herein include single-copy polycistronic transgene integration via translocation, mono-allelic site-specific integration via recombinase-mediated cassette exchange (RMCE), genome substitution, endogenous gene humanization ​​​​​​​​​​​including, or any combination thereof.

[0031]

[0029] In certain embodiments of the methods provided herein, the cells, tissues, organs, and animals produced are pigs. In certain embodiments of the method, the method further comprises knocking out or otherwise disrupting or inactivating one or more PERV genes, such as PERV pol In certain of these embodiments, the resulting pig cells, tissues, organs, or animals are PERV-free.

[0032]

[0030] In another aspect, the disclosure provides a transgenic porcine liver that has reduced liver injury and / or stable clotting when exposed to non-porcine blood, where the reduced liver injury is evaluated by determining bile production, one or more metabolic enzymes, and / or the levels of one or more serum electrolytes, and the stable clotting is evaluated by determining prothrombin time (PT) and international normalized ratio (PT-INR), fibrinogen level (FIB), and / or levels of activated partial thromboplastin time (APTT). In some embodiments, the metabolic enzymes are selected from the group consisting of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB). In some embodiments, the serum electrolytes are potassium (K) and / or sodium (Na).

[0033]

[0031] In some embodiments, the transgenic porcine liver disclosed and described herein comprises a native metabolic enzyme selected from the group consisting of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB). None.

Brief Description of the Drawings

[0034] Brief Description of the Drawings

Figure 1A

[0032] A chart showing the results of genotyping of complement factor 3 knockout (“C3-KO”) pigs. It shows the size of the introduced deletion.

Figure 1B

[0032] A chart showing the results of genotyping of complement factor 3 knockout (“C3-KO”) pigs. It shows the position of the indel.

Figure 1C

[0032] A chart showing the results of genotyping of complement factor 3 knockout (“C3-KO”) pigs. It lists the sequences of the generated indels (SEQ ID NOs: 253 - 289).

Figure 1C-2

Figure 2

[0033] A block diagram of a scheme depicting the major histocompatibility complex class I (“MHC class I”) replacement strategy in which the loci containing the SLA-1, SLA-2, and SLA-3 genes are adjacent to the loxP sites.

Figure 3A

[0034] A chart showing the results of genotyping of major histocompatibility complex (MHC) class II knockout (“MHCII-KO”) pigs, particularly the genotype of the MHCII gene DQA. It shows the position, size, and indel with two 1-bp insertions at positions 126 and 127 of the amplicon.

Figure 3B

[0034] A chart showing the results of genotyping of major histocompatibility complex (MHC) class II knockout (“MHCII-KO”) pigs, particularly the genotype of the MHCII gene DQA. It shows one position of the insertion.

Figure 3B-2

Figure 3B-3

Figure 3B-4

Figure 4A

[0035] A chart showing the results of genotyping another MHC class II-KO pig genotype, particularly the genotype of the MHCII gene DRA. The positions, sizes, and indels with two 1bp insertions at positions 106 and 107 of the amplicon are shown.

Figure 4B

[0035] A chart showing the results of genotyping another MHC class II-KO pig genotype, particularly the genotype of the MHCII gene DRA. The position of one of the insertions (SEQ ID NOs: 290-327) is shown.

Figure 4B-2

Figure 4B-3

Figure 4B-4

Figure 5

[0036] Six charts showing the results of fluorescence-activated cell sorting (FACS) analysis of MHCII-KO pigs ("H3-9P01") and wild-type ("WT") pigs.

Figure 6

[0037] A series of images depicting one or more phenotypes associated with the MHCII-KO phenotype.

Figure 7

[0038] A series of block diagrams showing a scheme for modifying the PD-L1 gene.

Figure 8

[0039] A chart showing the expression of PD-L1 measured by qPCR using two amplicons.

Figure 9

[0040] A sequence listing showing the alignment of porcine (SEQ ID NO: 329) and human (SEQ ID NO: 328) vWF proteins. The A1 domain is highlighted in a box, while potential glycosylation sites in the adjacent region are labeled with dashes. Human-specific residues deleted in pvWF are labeled with a horizontal line. The humanized A1 and adjacent regions are labeled with half brackets.

Figure 10

[0041] Shows the design of a homologous recombination repair ("HDR") vector targeting pvWF and two sgRNAs (SEQ ID NOs: 5 and 6).

Figure 11

[0042] Shows the screening results of HDR by digestion with SphI and BspEI.

Figure 12A

[0043] Shows the sequencing results of allelic HDR clones obtained from Figure 11 where vWF was targeted (SEQ ID NOs: 330 - 333). The chromatography of both sequencing results is explained using one line of the overlapping sequences. The humanized A1 and adjacent regions are labeled with half brackets.

Figure 12B

[0043] Shows the sequencing results of allelic HDR clones obtained from Figure 11 where vWF was targeted (SEQ ID NOs: 330 - 333). The chromatography of both sequencing results is explained using one line of the overlapping sequences. The humanized A1 and adjacent regions are labeled with half brackets.

Figure 13

[0044] Graph showing species - specific platelet aggregation responses monitored by light transmission for platelets isolated from WT (porcine A1 domain) or HDR - targeted (human A1 domain) pigs induced by shear stress.

Figure 14

[0045] Schematic diagram of the porcine MHC class I locus. All classical MHC I genes are color - coded. The unique adjacent regions immediately adjacent to the UTR of the MHC I genes are labeled with green brackets. Four highly active sgRNAs (SEQ ID NOs: 1 - 4) selected from these regions are also shown.

Figure 15

[0046] Shows the fragmental deletions of the MHC I classical cluster induced using the sgRNAs of Figure 14. Figure 15A shows the PCR amplicons across unique regions of the MHC I 5’, 3’ and 5’ - 3’ deletion junctions in a population of sgRNA - transfected cells. Figure 15B shows that the 5’ - 3’ junction PCR was TOPO - cloned and aligned to the predicted MHC I 5’ - 3’ junction where the sequencing results were generated by MHC5’_sg1 and MHC3’_sg2 (SEQ ID NOs: 335 - 343).

Figure 15-2

Figure 16

[0047] Shows the enrichment of MHC I-negative cells using a porcine-specific SLA-1 antibody.

Figure 17

[0048] Shows a transgene expression vector for expressing a plurality of transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 5 (Pig 2.1): 12 transgenes, ubiquitous expression.

Figure 18

[0049] Shows a transgene expression vector for expressing a plurality of transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 9 (Pig 2.2): 12 transgenes, endothelial-specific.

Figure 19

[0050] Shows a transgene expression vector for expressing a plurality of transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 10 (Pig 2.3): 12 transgenes, endothelial / islet-specific.

Figure 20

[0051] Shows a transgene expression vector for expressing a plurality of transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 10-Exo (Pig 2.4): 12 transgenes, endothelial / islet-specific, with pancreatic exocrine gland resection.

Figure 21

[0052] Is a schematic diagram showing the line of genetically engineered donor pigs described herein.

Figure 22

[0053] Shows that genetically engineered porcine fibroblasts with enhanced compatibility with human tissues exhibit a significantly reduced binding affinity for human antibodies.

Figure 23

[0054] It shows tissue-specific mRNA expression from genetically engineered porcine primary fibroblasts or endothelial cells described herein. Figure 23A is a schematic diagram of a gene transfer construct assembled using molecular cloning techniques. The CD46, CD55, and CD59 cassettes were placed under the control of the ubiquitous EF1α promoter, the HLA-E, B2M, and CD47 cassettes were placed under the control of the ubiquitous CAG promoter, the A20, PD-L1, HO-1 cassettes were placed under the control of the islet-specific NeuroD promoter, and the THBD, TFPI, and CD39 cassettes were placed under the control of the endothelial-specific ICAM2 promoter. The gene transfer construct was electroporated into porcine primary fibroblasts (Figure 23B) or immortalized porcine aortic endothelial cell line (PEC-A) (Figure 23C), and mRNA expression was determined by qRT-PCR.

Figure 24

[0055] It shows transgene protein expression in the spleen and fibroblasts of Pig 2.0 ("3KO + 12TG").

Figure 25

[0056] It shows that genetically engineered porcine fibroblasts with enhanced compatibility with human cells showed significantly lower levels of complement-mediated cell death.

Figure 26

[0057] Figure 26 shows that porcine fibroblasts genetically engineered to express human HLA-E show a decrease in susceptibility to NK-mediated lysis.

Figure 27

[0058] It shows that endothelial cells derived from GGTAKO + CD55KI pigs show a decrease in the formation of thrombin-antithrombin III (TAT) complexes.

Figure 28

[0059] It shows that livers isolated from 4 - 7 pigs and perfused with human blood have increased bile production compared to wild-type (WT) livers.

Figure 29

[0060] It shows that livers isolated from 4 - 7 pigs and perfused with human blood have improved liver function as evaluated by markers of liver injury and serum electrolyte levels compared to WT livers.

Figure 30

[0061] It is shown that the liver isolated from 4 - 7 pigs and perfused with human blood has improved coagulation compared to the WT liver.

Figure 31

[0062] Shows the transgene expression vector according to the embodiments disclosed and described herein. Payload 13 (Pig 2.5): 10 transgenes, bicistronic.

Figure 32A

[0063] It is shown that host monkeys transplanted with kidneys isolated from Payload 9 donor pigs show stable serum creatinine levels.

Figure 32B

[0063] It is shown that host monkeys transplanted with kidneys isolated from Payload 10 donor pigs show stable serum creatinine levels.

Figure 33A

[0064] Shows the hematocrit levels in host monkeys transplanted with kidneys isolated from Payload 9 donor pigs.

Figure 33B

[0064] Shows the hematocrit levels in host monkeys transplanted with kidneys isolated from Payload 10 donor pigs.

Figure 34A

[0065] Shows the platelet counts in host monkeys transplanted with kidneys isolated from Payload 9 donor pigs.

Figure 34B

[0065] Shows the platelet counts in host monkeys transplanted with kidneys isolated from Payload 10 donor pigs.

Figure 35A

[0066] Shows the variation in white blood cell (WBC) counts in host monkeys transplanted with kidneys isolated from Payload 9 donor pigs.

Figure 35B

[0066] Shows the variation in white blood cell (WBC) counts in host monkeys transplanted with kidneys isolated from Payload 10 donor pigs.

Figure 36

[0067] Shows RNAseq expression data indicating that complement and cytotoxicity genes are expressed in samples collected from Payload 9 and Payload 10 pigs.

Figure 37

[0068] FACS data showing complement and cytotoxic proteins expressed in samples collected from pigs, including Payload 5, Payload 9, and Payload 10, are presented.

Figure 37-2

Figure 38A

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38B

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38C

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38D

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38E

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38F

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38G

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38H

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 38I

[0069] Clinical tests after orthotopic liver xenotransplantation (OLTx) from pigs to baboons are shown.

Figure 39

[0070] Figure 39A is a representative image of an H&E stained liver sample from OLTx.

[0070] Figure 39B is a representative image of an H&E stained liver sample from OLTx.

[0070] Figure 39C is a representative image of an H&E stained liver sample from OLTx.

[0070] Figure 39D is a representative image of an H&E stained liver sample from OLTx.

[0070] Figure 39E is a representative image of an H&E stained liver sample from OLTx.

[0070] Figure 39F is a representative image of an H&E stained liver sample from OLTx.

Figure 40A

[0071] Shows the clinical tests after ex vivo heterologous perfusion of a genetically engineered pig liver with human whole blood.

Figure 40B

[0071] Shows the clinical tests after ex vivo heterologous perfusion of a genetically engineered pig liver with human whole blood.

Figure 40C

[0071] Shows the clinical tests after ex vivo heterologous perfusion of a genetically engineered pig liver with human whole blood.

Figure 40D

[0071] Shows the clinical tests after ex vivo heterologous perfusion of a genetically engineered pig liver with human whole blood.

Figure 40E

[0071] Shows the clinical tests after ex vivo heterologous perfusion of a genetically engineered pig liver with human whole blood.

Figure 41

[0072] Figure 41A is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41B is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41C is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41D is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41E is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41F is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41G is a representative image of H&E staining of the heterologously perfused pig liver.

[0072] Figure 41H is a representative image of H&E staining of the heterologously perfused pig liver.

Figure 42

[0073] Compared with the GalTKO.hCD55 lung, it shows that in the "untreated" Pig 2.0 ("3KO + 12TG") lung perfused with human blood, the increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed.

Figure 43

[0074] Figure 43A shows the binding of a panel of human sera to human T cells, and high PRA sera are more likely to stain human cells than low PRA.

[0074] Figure 43B shows the binding of a panel of human sera to porcine T cells. Sera from both low PRA patients and high PRA patients show high levels of binding to porcine targets.

[0074] Figure 43C shows the binding of a panel of human sera to human B cells, and high PRA sera are more likely to stain human cells than low PRA.

[0074] Figure 43D shows the binding of a panel of human sera to porcine B cells. Sera from both low PRA patients and high PRA patients show high levels of binding to porcine targets.

Figure 44

[0075] A panel of high PRA human sera shows significantly lower levels of binding to genetically modified porcine aortic endothelial cells (Pig 2.0 ("3KO + 12TG") pAEC) compared to wild-type cells (WT pAEC). Pig 2.0 cells lack aGal, Neu5Gc, and Sda.

Figure 45

[0076] Figure 45A shows the staining of Pig 2.0 ("3KO + 12TG") pAEC with sera collected from kidney xenograft recipient animals at various time points. Serum samples collected after transplantation show a decrease in binding levels, particularly after liver xenotransplantation.

[0076] Figure 45B shows the staining of Pig 2.0 ("3KO + 12TG") pAEC with sera collected from heart xenograft recipient animals at various time points. Serum samples collected after transplantation show a decrease in binding levels, particularly after liver xenotransplantation.

[0076] Figure 45C shows the staining of Pig 2.0 ("3KO + 12TG") pAEC with sera collected from liver xenograft recipient animals at various time points. Serum samples collected after transplantation show a decrease in binding levels, particularly after liver xenotransplantation.

Figure 46

[0077] Figure 46A shows the binding of human serum, wild-type (WT) and Pig 2.0 ("3KO + 12TG") pAECs, before and after IdeS treatment. IdeS effectively reduces the binding of human and cynomolgus monkey IgG, while having no effect on the binding of intact IgM.

[0077] Figure 46B shows the binding of human serum to pAECs before and after IdeS treatment. IdeS effectively reduces the binding of human and cynomolgus monkey IgG, while having no effect on the binding of intact IgM.

[0077] Figure 46C shows the binding of cynomolgus monkey serum to pAECs before and after IdeS treatment. IdeS effectively reduces the binding of human and cynomolgus monkey IgG, while having no effect on the binding of intact IgM.

Figure 47

[0078] Shows a transgene expression vector according to the embodiments disclosed and described herein (SEQ ID NOs: 344 and 345). Payload 12F: 12 transgenes.

Figure 48

[0079] Shows a transgene expression vector according to the embodiments disclosed and described herein. Payload 12G: 12 transgenes.

Figure 49

[0080] Shows a transgene expression vector according to the embodiments disclosed and described herein. Payload 13A: 10 transgenes.

Figure 50

[0081] Shows the results of RNAseq demonstrating the expression of complement and cytotoxicity genes.

Figure 51A

[0082] Shows a scheme for CRISPR gene knockout and PiggyBac integration. 3KO was generated using CRISPR / Cas9 targeting 2 copies of the GGTA1 gene, 2 copies of the CMAH gene, and 4 copies of the B4GALNT2 gene, and PERV-KO cells were generated using CRISPR / Cas9 targeting the copy of PERV in Pig 2.0 ("3KO + 9TG"). Nine transgenes were inserted into the porcine genome using PiggyBac-mediated random integration. The transgenes were expressed in 3 cassettes, and each cassette expressed 3 genes linked by the porcine 2A (P2A) peptide.

Figure 51B

[0083] Sequencing results of GGTA1 (SEQ ID NOs: 346 - 348), CMAH (SEQ ID NOs: 349 - 351), and B4GALNT2 (SEQ ID NOs: 352 - 356) knockouts are shown. Whole - genome sequence analysis showed that in Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG), i) the GGTA1 gene had a - 10bp deletion in one allele and a transgene vector insertion in another gene, ii) the CMAH gene had a - 391bp deletion in one allele and a 2bp (AA) insertion in another allele, and iii) B4GALNT2 had - 13, - 14, - 13, - 14 in each of the four alleles of the B4GALNT2 gene. All modifications occurred at the gRNA target sites, indicating that the modifications were mediated by the on - target activity of the CRISPR / Cas9 used.

Figure 51C

[0084] Sequencing analysis results of PERV knockout are shown. Raw reads for Pig 2.0 (3KO + 9TG) (about 2,000X) and 3.0 (about 20,000X) are shown below the schematic PERV gene structure. Reads are grouped by their sequence composition and shown proportional to their coverage. The red, blue, green, and orange vertical lines in the coverage track represent single - nucleotide changes from the reference allele to T, C, A, G, respectively.

Figure 51D

[0085] PCR analysis of 9TG integration is shown. Transgene integration in Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) has been verified at the genomic DNA (gDNA) level by PCR. The PCR gel image shows the presence of nine human transgenes in gDNA from Pig 2.0 and Pig 3.0 fetal fibroblasts, while the WT porcine fetal fibroblasts and NTC (no gDNA added) groups serve as negative controls.

Figure 51E

[0086] Shows the normal karyotypes for Pig 2.0 (3KO + 9TG) and 3.0 (3KO + 9TG) cells. Karyotype analysis of Pig 2.0 (A) and Pig 3.0 (B) fibroblasts was performed using the G-banding method based on Giemsa staining. Metaphase spreads were analyzed using SmartType software. Both Pig 2.0 and Pig 3.0 show a normal [36 + XY] karyotype.

Figure 52A

[0087] Shows the heatmap of the expression of 9 transgenes. Transgene expression was measured by RNA-Seq in HUVEC endothelium, PUVEC endothelium, Pig 2.0 (3KO + 9TG) PUVEC endothelium, Pig 2.0 ear fibroblasts, and Pig 3.0 fetal fibroblasts. Each row represents one transgene, and each column represents one sample. The expression levels are color-coded in blue-yellow-red to represent low-medium-high. The tissue type and payload information for each sample are labeled above the heatmap as a color bar.

Figure 52B

[0088] Shows the analysis of 3KO and 9TG expression by FACS. The genetic modifications (KO and TG) of Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) have been verified at the protein level by FACS. Pig 2.0 and Pig 3.0 PUVEC generally show TG expression levels equivalent to human endogenous (HUVEC), except for hCD39 (higher than human endogenous) and hTHBD (lower than human endogenous).

Figure 52C

[0089] Shows the immunofluorescence analysis of 3KO and 9TG expression. The genetic modifications (KO and TG) of Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) have been verified at the protein level in kidney frozen sections by immunofluorescence (IF).

Figure 53A

[0090] Binding of human antibodies to Pig 2.0 (3KO + 9TG) and 3.0 (3KO + 9TG) cells is shown. Pig 2.0 and Pig 3.0 PUVECs substantially attenuate antibody binding to human IgG and IgM compared to their WT counterparts. Antibody binding of pooled human serum to PUVECs and HUVECs (positive control) was measured by FACS, respectively. Error bars indicate mean ± standard deviation (n = 3).

Figure 53B

[0091] Complement toxicity to WT pigs, Pig 2.0 (3KO + 9TG), Pig 3.0 (3KO + 9TG) and HUVEC cells is shown. Pig 2.0 and Pig 3.0 PUVECs show comparable antibody-dependent complement toxicity compared to HUVECs, which is significantly lower compared to WT PUVECs. Error bars indicate mean ± standard deviation (n = 4).

Figure 53C

[0092] NK-mediated cytotoxicity to WT pigs, Pig 2.0 (3KO + 9TG), Pig 3.0 (3KO + 9TG) and HUVEC cells is shown. Pig 2.0 and Pig 3.0 PUVECs reveal significantly lower NK-mediated cytotoxicity compared to their WT counterparts. Error bars indicate mean ± standard deviation (n = 3).

Figure 53D

[0093] Phagocytosis of Pig 2.0 (3KO + 9TG) and 3.0 (3KO + 9TG) splenocytes by human macrophages is shown. Splenocytes of Pig 2.0 and Pig 3.0 show a decrease in phagocytosis by the human macrophage cell line. CFSE-labeled Pig 2.0 and Pig 3.0 splenocytes (target cells, T) were incubated with CD11b-labeled human macrophage cell line (effector cells, E) at 37 °C for 4 hours, respectively. Two different E:T ratios, 1:1 and 1:5 were performed. Phagocytosis of the CFSE-labeled targets was measured by FACS. In FACS, the region of non-phagocytic macrophages is shown in the upper left quadrant (Q1), and the region of phagocytic macrophages is shown in the upper right quadrant (Q2). Phagocytic activity was calculated as Q2 / (Q1 + Q2) × 100%.

Figure 53E

[0094] Levels of thrombin - antithrombin (TAT) formation by WT pigs, Pig 2.0 (3KO + 9TG), Pig 3.0 (3KO + 9TG) and HUVEC cells are shown. Pig 2.0 and Pig 3.0 PUVEC mediate very low levels of thrombin - antithrombin (TAT) formation, which are significantly lower than WT PUVEC and equivalent to HUVEC during incubation with human whole blood for the indicated times. Error bars indicate mean ± standard deviation (n = 4).

Figure 53F

[0095] Shows the ADPase activity of the CD39 transgene. Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) PUVEC show significantly higher CD39 ADPase biochemical activity compared to WT PUVEC and HUVEC. (A) Human transgene CD39 mRNA is highly expressed in Pig 2.0 and Pig 3.0 compared to endogenous CD39. (B) FACS revealed that Pig 2.0 and Pig 3.0 have higher human CD39 protein expression than WT PUVEC and HUVEC. (C) Pig 2.0 and Pig 3.0 PUVEC have significantly higher ADPase biochemical activity of CD39 as measured by the phosphate concentration when incubated with ADP. The higher CD39 ADPase biochemical activity correlates with their higher CD39 protein expression levels in Pig 2.0 and Pig 3.0. Error bars indicate standard deviation (n = 6).

Figure 53G

[0096] 3.0 cells show TFPI function. Activated Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) PUVECs express human TFPI on the cell surface and show significantly higher binding ability to human Xa compared to WT PUVECs and HUVECs in vitro. (A) RNA-Seq revealed that Pig 2.0 PUVECs express more human TFPI than its endogenous level in HUVECs and express porcine TFPI levels in WT PUVECs (n = 2). (B) Activated Pig 2.0 PUVECs show significantly higher Xa binding ability compared to WT PUVECs and HUVECs in vitro. Left panel: The standard curve measures the linear regression between the concentration of human recombinant TFPI (rTFPI) protein and the unbound Xa level. Right panel: The tTFPI levels predicted from the unbound Xa levels using the left standard curve measure the TFPI Xa binding ability in Pig 2.0 EC, WT PUVEC, and HUVEC, regardless of the presence or absence of PMA activation. PMA (1 μM): PUVECs and HUVECs were activated by PMA for 6 hours, which led to the translocation of hTFPI from the cytosol to the cell membrane. Error bars indicate the standard deviation (n = 4).

Figure 54A

[0097] Pig 1.0 and 2.0 pigs (3KO + 9TG) show normal phenotypes. Pig 1.0 and Pig 2.0 show similar pathophysiology regarding total blood cell count (A) compared to WT pigs. The sample numbers of Pig 1.0, Pig 2.0, and WT pigs are 18, 16, and 21, respectively. "no sig" indicates no statistical significance between the Pig 1.0, Pig 2.0, and WT groups by Student's t-test.

Figure 54B

[0097] Pig 1.0 and 2.0 pigs (3KO + 9TG) show normal phenotypes. Pig 1.0 and Pig 2.0 show similar pathophysiology regarding the liver (B) compared to WT pigs. The sample numbers of Pig 1.0, Pig 2.0, and WT pigs are 18, 16, and 21, respectively. "no sig" indicates no statistical significance between the Pig 1.0, Pig 2.0, and WT groups by Student's t-test.

Figure 54C

[0097] Pig 1.0 and 2.0 pigs (3KO + 9TG) exhibit normal phenotypes. Pig 1.0 and Pig 2.0 show similar pathophysiology with respect to the heart (C) compared to WT pigs. The sample numbers for Pig 1.0, Pig 2.0, and WT pigs are 18, 16, and 21, respectively. "no sig" indicates that there is no statistical significance among the Pig 1.0, Pig 2.0, and WT groups by Student's t-test.

Figure 54D

[0097] Pig 1.0 and 2.0 pigs (3KO + 9TG) exhibit normal phenotypes. Pig 1.0 and Pig 2.0 show similar pathophysiology with respect to kidney function (D) compared to WT pigs. The sample numbers for Pig 1.0, Pig 2.0, and WT pigs are 18, 16, and 21, respectively. "no sig" indicates that there is no statistical significance among the Pig 1.0, Pig 2.0, and WT groups by Student's t-test.

Figure 54E

[0097] Pig 1.0 and 2.0 pigs (3KO + 9TG) exhibit normal phenotypes. Pig 1.0 and Pig 2.0 show similar pathophysiology with respect to coagulation function (E) compared to WT pigs. The sample numbers for Pig 1.0, Pig 2.0, and WT pigs are 18, 16, and 21, respectively. "no sig" indicates that there is no statistical significance among the Pig 1.0, Pig 2.0, and WT groups by Student's t-test.

Figure 55

[0098] Shows the Mendelian inheritance of PERV-KO. The genetic modification of PERV-KO may be inherited according to Mendelian genetics during natural mating production. The x-axis represents the total number of shifted bases calculated as the total of insertions minus the total of deletions. The y-axis represents the percentage of reads. Red and green indicate whether or not a frameshift is shown, respectively. One Pig 1.0 pig was mated with a wild-type Bama pig, and 11 piglets were born. Liver, kidney, and heart tissues of one of the offspring piglets were analyzed by high-throughput DNA sequencing together with the parental fibroblasts to evaluate the inheritance of the PERV-KO modification. Pig 1.0 has 100% of the PERV copies to be knocked out, while the WT pig has approximately 80% of the PERV copies of the same size as the WT length (insertion-deletion = 0). Notably, some of the PERV copies in the WT samples may not be functional or may carry KO. In contrast, the liver, kidney, and heart of the offspring piglets have only approximately 50% of the PERV copies carrying the knockout. This pattern is similar among tissues, indicating that the modification of PERV-KO is stably inherited according to Mendelian genetics among different tissues.

Figure 56A

[0099] Shows the Mendelian inheritance of the 9TG construct and 3KO through breeding. The genetic modification (3KO and 9TG) of this iteration of Pig 2.0 can be transmitted to the next generation according to Mendelian genetics through natural mating production, as verified at the genomic DNA (A), mRNA (B), and protein levels (C). The inventors mated 9 WT pigs with Pig 2.0 and 11 3KO pigs with Pig 2.0, respectively, and detected the presence of 3KO and 9TG in the F1 offspring. (A) For 9TG, approximately half of the offspring of Pig 2.0xWT pigs and Pig 2.0x3KO pigs carry the transgene in their genomes. For GGTA1, CMAH, and B4GALNT2, the offspring of Pig 2.0 X WT pigs are all heterozygous knockouts, and the offspring of Pig 2.0 X 3KO pigs are all homozygous knockouts. Notably, B4GALNT2 was analyzed as having four alleles because it contains its highly homologous pseudogene.

Figure 56B

[0099] The Mendelian inheritance of the 9TG construct and 3KO through breeding is shown. This iterative gene modification (3KO and 9TG) of Pig 2.0 can be transmitted to the next generation according to Mendelian genetics through natural mating production, as verified at the genomic DNA (A), mRNA (B), and protein levels (C). The inventors mated 9 WT pigs with Pig 2.0 and 11 3KO pigs with Pig 2.0, respectively, and detected the presence of 3KO and 9TG in the F1 progeny. (B) Approximately half (5 / 11) of the progeny of Pig 2.0 X 3KO pigs carry mRNA corresponding to 9TG in their mRNA transcripts.

Figure 56C

[0099] The Mendelian inheritance of the 9TG construct and 3KO through breeding is shown. This iterative gene modification (3KO and 9TG) of Pig 2.0 can be transmitted to the next generation according to Mendelian genetics through natural mating production, as verified at the genomic DNA (A), mRNA (B), and protein levels (C). The inventors mated 9 WT pigs with Pig 2.0 and 11 3KO pigs with Pig 2.0, respectively, and detected the presence of 3KO and 9TG in the F1 progeny. (C) By FACS analysis, the inheritance of 3KO and 9TG in Pig 2.0 X 3KO and Pig 2.0 X WT pigs was verified as a decrease or absence of cell surface glycans or the presence of human proteins.

Mode for Carrying Out the Invention

[0035] Detailed Description I. Definitions

[0100] The terms "pig", "swine", and "porcine" as used herein refer interchangeably to all those related to various breeds of domestic pigs, the wild boar (Sus scrofa) species. The term "biologically active" refers to a fragment or derivative of a protein or polypeptide that...

[0036]

[0101] that has... When used to refer to a fragment or derivative, it is understood that the fragment or derivative is a portion of a reference full-length protein or polypeptide. It means that the compound possesses at least one measurable and / or detectable biological activity. For example, a biologically active fragment or derivative of a CRISPR / Cas9 protein can be The guide RNA (sgRNA) is a nucleic acid that binds to a gRNA, sometimes referred to herein as a single guide RNA (sgRNA). When complexed with a target RNA, it binds to a target DNA sequence and / or fragments one or more DNA strands. It may be possible to cleave.

[0037]

[0102] The terms "treatment," "treating," "alleviating," and the like, are used in conjunction with the term "treatment," "treatment," "alleviating," and the like. When used in the present context, it generally refers to a compound that provides a desired pharmacological and / or physiological effect. is used to mean improving the severity of one or more symptoms of the condition being treated. Effect can also be used to refer to reducing, ameliorating, and / or alleviating a disease, condition, or may be prophylactic in that it delays, completely or partially, the onset or recurrence of the condition, and and / or to partially alleviate the disease or condition and / or adverse effects that may be attributable to the disease or condition. As used herein, "treatment" refers to the treatment of a mammal. The present invention includes any treatment of a disease or condition, particularly in humans, including (a) a disease or condition that is predisposed to the disease or condition. A subject who may have, but has not yet been diagnosed with, a disease or condition may develop (b) inhibiting a disease or condition (e.g., arresting its occurrence); (c) alleviating the disease or condition (e.g., causing regression of the disease or condition); (causing and providing relief of one or more symptoms).

[0038]

[0103] The term "simultaneously" as used herein means occurring within seconds, within milliseconds, within microseconds, or less than that, when compared to the occurrence of another event, for example, simultaneously with another event. It is used to refer to an event that occurs.

[0039]

[0104] The term "knockout" ("KO") or "knocking out" as used herein refers to the deletion, inactivation, or disappearance of a gene, or a defective gene, in a pig or other animal, or in any cell in a pig or other animal. The KO used herein can also refer to a method of deleting, inactivating, or disappearing a gene or a part thereof, or the fact that those have been performed.

[0040]

[0105] The term "knockin" ("KI") or "knocking in" as used herein refers to the addition, substitution, or mutation of nucleotides of a gene in a pig or other animal, or in any cell in a pig or other animal. The KI used herein can also refer to a method of adding, substituting, or mutating nucleotides of a gene or a part thereof, or the fact that those have been performed.

[0041] II. Cells, Tissues, Organs, and Animals

[0106] Porcine xenografts are widely compatible with the size and physiology of human organs and are ethically acceptable to the general population in the United States. However, xenotransplanted porcine tissues induce a complex series of events leading to graft rejection: hyperacute rejection due to the presence of preformed antibodies against porcine antigens, complement activation and coagulation enhancement, and enhanced natural and adaptive immune responses due to molecular incompatibility. The present disclosure uses a genetic engineering approach to address the current drawbacks of xenotransplantation. ​​​​​​​

[0042]

[0107] In particular, there are many immunological and functional challenges, including natural and adaptive immune functions. . Dysfunctions through complement and coagulation result from molecular incompatibilities between donor pig tissues and human physiological functions, leading to acute xenograft failure. Pre-formed antibodies against the α-1,3-galactosyl-galactose (αGal) epitope initiate hyperacute graft rejection via complement activation. Genetic inactivation of the glycoprotein α-galactosyltransferase 1 gene (GGTA1) can reduce this rapid graft destruction. Further protection is achieved through overexpression of the genes of human complement regulatory proteins (hCRP) CD46 (membrane cofactor protein), CD55 ( complement decay-accelerating factor), and CD59 (MAC-inhibitory protein).

[0043]

[0108] Most non-Gal xenoantibodies recognize sialic acid N-glycolylneuraminic acid (Neu5Gc) synthesized by the cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene. This gene is inactive in humans, so porcine Neu5Gc is immunogenic in humans. Therefore, it is highly likely that porcine CMAH must be inactivated for clinical success in xenotransplantation. Expression of complement regulatory factors and knockout of GGTA1 (GTKO) reduce hyperacute rejection, but these genetic modifications do not affect acute vascular rejection (AVR).

[0044]

[0109] Coagulation dysfunctions, including thrombotic microangiopathy and systemic consumptive coagulopathy, are mainly due to molecular incompatibilities in the coagulation system between pigs and non-human primates (NHP) in GTKO and hCRP over- ​ It persists even in overexpression.

[0045]

[0110] Despite attempts by others to generate transgenic pigs for safe xenotransplantation, However, these transgenic pigs have limited potential due to construction capacity constraints and transcriptional interference between transgenes. These methods have overcome the incompatibility of xenografts. For example, U.S. Patent Application Publication No. 2018 / 024 No. 9688 utilizes multicistronic expression vectors carrying different combinations of transgenes. Importantly, these multicistronic vectors contained only four transgenes. It is used to create pigs with six genetic modifications, including αGal KO (GTKO). In this disclosure, a combination of KO, KI, and genome replacement strategies is utilized. For the first time, PERV-free pigs expressing more than six transgenes from the follicular locus have been produced.

[0046]

[0111] The embodiments described and disclosed herein are directed to porcine complement factors that may be KO'd. and inactivation of one or more modified MHC class I genes, MHC class II genes. , KI of PD-L1 to reduce adaptive immune-based rejection, and regulating platelet aggregation. We have developed a modified porcine vWF for the purpose of generating viable pigs with deletions of porcine MHC class I genes. These examples demonstrate that it is possible to achieve more genetic modifications within the same pig. This study provided a platform for transfecting pig cells with more than six transgenes. Genetically modified to produce immunologically compatible cells, tissues, organs, pigs, and offspring. CR Using ISPR-Cas9, we identified multiple genes including GGTA1, CMAH, and B4GALNT2. Functionally knockout the gene and remove the glycans recognized by preformed anti-pig antibodies in humans. Furthermore, either 9 or 12 human transgenes were incorporated into a single multi-transgene cassette in the pig genome. Specifically, the 9 transgenes CD46, CD55, CD59, CD39, CD47, HLA-E, B2M THBD, and TFPI, or the 12 transgenes (CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1) were combined with random integration via PiggyBAC of three major xeno genic carbohydrate antigen-producing genes ("3KO"; GGTA1, B4GALNT2, and CMAH) To disrupt, pigs were produced using CRISPR-mediated non-homologous end joining (NHEJ). Further progress is to use donor pigs with 3KO and 9T or 12T modifications in a PERV-free background. From there, the donor pigs will also be genetically engineered to carry further genetic modifications, including, among other things, humanization of the vWF gene and deletion or disruption of the asialoglycoprotein receptor 1 (ASGR1) and the endogenous B2M gene.

[0047]

[0112] The present disclosure provides cells, tissues, organs, and animals having multiple modified genes, and methods for making them. In some embodiments, the cells, tissues, organs are obtained from an animal or are an animal. In some embodiments, the animal is a mammal. In some embodiments, the mammal is a non-human mammal, such as a horse, a primate, a pig, a cow, a sheep, a goat, a dog, or a cat. In some embodiments, the mammal is a pig. ​ occurs.

[0048]

[0113] Modification of the gene according to the present disclosure improves the molecular compatibility between the donor and the recipient and plays a role in reducing adverse events including hyperacute rejection, acute humoral rejection, thrombotic microangiopathy, and chronic vascular disorders. For example, hyperacute rejection occurs within a very short period, typically within a few minutes to a few hours after transplantation, activates complement and graft endothelial cells, which in turn causes procoagulant changes leading to congestion and ultimately destruction of the transplanted organ, and results from preformed antibodies. In certain embodiments, cells, tissues, organs, and animals exhibit a reduced hyperacute rejection reaction.

[0049]

[0114] In some embodiments, the present disclosure provides one or more cells, tissues, organs, or animals having multiple modified genes. In some embodiments, the cells, tissues, organs, or animals are genetically modified such that multiple genes are added, deleted, inactivated, disrupted, partially excised, or the gene sequences are altered. In some embodiments, the cells, tissues, organs, or animals have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified genes. In some embodiments, the 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified genes are expressed from a single locus. In some embodiments, the 5, 10, or 12 modified genes are expressed from a single locus. In some embodiments, the 12 modified genes are expressed from a single locus. In some embodiments, the cells, tissues, organs, or animals have more than 20 modified genes. ​ having more than 5, more than 10, more than 5, more than 3, or 2 genes. In some embodiments, the cell, tissue, organ, or animal has more than 10, more than 5 modified, more than 3, more than 2, or more than 1 gene. In some embodiments, the cell, tissue, organ, or animal has 1 copy of the modified gene, and in other embodiments, the cell tissue, organ, or animal has more than 1 copy of one or more modified genes, e.g., more than 2, more than 3 more than 4, more than 5, more than 6, more than 7, more than 8 more than 9, more than 10, more than 15, more than 20, more than 25, 3 more than 0, more than 35, more than 40, more than 50, more than 60, more than 70 more than 80, more than 90, or more than 100 copies. In some embodiments the cell has from about 1 copy to 100 copies of one or more modified genes, from about 1 copy to 90 copies from about 1 copy to 80 copies, from about 1 copy to about 70 copies, from about 1 copy to 60 copies from about 1 copy to about 50 copies, from about 1 copy to about 40 copies, from about 1 copy to about 30 copies, from about 5 copies to about 20 copies, from about 10 copies to about 15 copies, or from about 1 copy to about 5 copies .

[0050]

[0115] In some embodiments, the present disclosure provides one or more cells, tissues, organs, or animals having one or more copies of a modified gene. For example, the cell, tissue, organ, or animal can have one or more of 2, 3, 4, 5, 6, 7, 8, 9, about 10, about 15 about 20, about 25, about 30, or more of the modified gene.

[0051]

[0116] In some embodiments, one or more cells are primary cells. In some embodiments, one or more cells are somatic cells. In some embodiments, one or more cells are postnatal cells. In some embodiments, one or more cells are adult cells (e.g., , adult ear fibroblasts). In some embodiments, one or more cells are fetal / embryonic cells (e.g., blastomeres). In some embodiments, one or more cells are germline cells. In some embodiments, one or more cells are oocytes. In some embodiments, one or more cells are stem cells. In some embodiments, one or more cells are cells from a primary cell line. In some embodiments, one or more cells are selected from the group consisting of: epithelial cells, liver cells, granulosa cells, adipocytes. In certain embodiments , one or more cells are fibroblasts. In some embodiments, the fibroblasts are female fetal fibroblasts. In some embodiments, one or more cells are in vitro. In some embodiments, one or more cells are in vivo. In some embodiments, one or more cells are a single cell. In some embodiments, one or more cells are members of a cell colony.

[0052]

[0117] In some embodiments, one or more cells are porcine cells. Non-limiting examples of porcine cell lines of origin or derivation include any of the following swine breeds: American Landrace, American Yorkshire , Aksai Black Pied, Angeln Saddleback (An Geln saddleback), Appalachian English, Arapawa Island, Auckland Island, Australian Yorkshire, Babi Kampung , Ba Xuyen, Bantu, Basque, Bazna, Beijing Black, Belarus Black Pied, Belgian Landrace, Bengal Brown Shannaj, Bentheim Black Pied, Berkshire, Bisaro, Bangur, Black Slavonian, Black Canarian, Breitovo, British Landrace, British Lop, British Saddleback, Bulgarian White, Cambrough, Cantonese, Celtic, Chato Murciano, Chester White, Chiangmai Blackpig, Choctaw Hog, Creole, Czech Imp Proved White), Danish Landrace, Danish Protest , Dermantsi Pied, Li Yan , Duroc, Dutch Landrace, East Landrace , East Balkan, Essex , Estonian Bacon, Fengjing, Finnish Landrace , Forest Mountain, French Landrace , Gascon, German Landrace , Gloucestershire Old Spots, Gottingen minipig, Grice , Guinea Hog, Hampshire, Hante, Hereford , Hezuo, Hogan Hog, Huntington Black Hog , Iberian, Italian Landrace , Japanese Landrace), Jeju Black, Jinhua, Kakhetian , Kele, Kemerovo, Korean Native, K , Kele, Kemerovo, Korean Native, K ​Krskopolje, Kunekune, Lamcombe, Large Black, Large Black-White, Large White, Latvian White, Leic oma, Lithuanian Native, Lithuanian White , Lincolnshire Curly-Coated ), Livny, Malhado de Alcobaca, Mangali tza, Meishan, Middle White, Minzhu, Minokawa Buta, Mong Cai, Mora Romagnola, Moura, Mukota, Mule foot, Murom, Myrhorod, Nero dei Nebrodi , Neijiang, New Zealand ), Ningxiang, North Caucasian, North Siberian , Norwegian Landrace, Norwegian Yorkshire, Ossabaw Island, Oxford Sandy and Black, Pakchong 5 ), and Pakchong , Philippine Native, Pietrain, Poland China, Red Wattle, Saddle back, Semirechensk, Siberian Black Pied , Small Black, Small White e, Spots, Surabaya Babi, Swabian-Hall , Swedish Landrace, Swallow Belied Mangalitza , Taihu pig, Tamworth , Thuoc Nhieu, Tibetan, Tokyo -X, Tsivilsk, Turopolje, Ukrainian Spotted Steppe, Ukrainian White Steppe, Urzhum, Vietnamese Potbelly (Vietnamese Potbelly), Welsh, Wessex Saddleback , West French White, Windsnyer , Wuzhishanm, Yanan, Yorkshire ire and Yorkshire Blue and White. Some ​In some embodiments, the porcine cells are Yorkshire and Yucatan pigs cells.

[0053]

[0118] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have one or more genes that have been modified by addition, deletion, inactivation, disruption, excision of a portion thereof, or are genetically modified such that a portion of the gene sequence has been altered.

[0054]

[0119] In some embodiments, the cells, tissues, organs, or animals of the present disclosure contain one or more mutations that inactivate one or more genes. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the expression of one or more genes having one or more mutations. In some embodiments, one or more genes are inactivated by genetically modifying the nucleic acids present in the cells, tissues, organs, or animals thereby. In some embodiments, inactivation of one or more genes is confirmed by an assay . In some embodiments, the assay is an infectivity assay, reverse transcriptase PCR assay, RNA-seq, real-time PCR, or junction PCR mapping assay. is.

[0055] Specific genotype

[0120] To ensure that the cells, tissues, organs, and animals are safe and effective for human clinical use, the cells, tissues, organs, and animals (e.g., donor pigs) of the present disclosure have an improved complement (i.e., complement toxicity), coagulation, inflammatory (i.e., apoptosis / inflammation), immune (i.e., cytotoxicity), and / or immunomodulatory system that makes them compatible in humans hosts. sis / inflammation), immune (i.e., cytotoxicity), and / or immunomodulatory system so as to have It is sub-operated. Novel combinations of knockout (KO), knock-in (KI) (or, as referred to herein, transgene (TG)), and / or genome replacement strategies provide improved complement, coagulation, inflammatory, immune, and / or immunoregulatory systems. For example, by genetic KO, cells, tissues, organs, and animals lacking the expression of major xeno-carbohydrate antigens reduce or eliminate humoral rejection during xenotransplantation. Three of the major xeno-carbohydrate antigens include those produced by glycosyltransferase / glycosyl hydrolase GGTA1, CMAH, and B4GALNT2. The purpose of the loss of function of these genes is to reduce and / or eliminate the binding of pre-formed anti-pig antibodies to the endothelium of pig grafts.

[0056]

[0056]

[0121] For example, by genetic KO, cells, tissues, organs, and animals lacking the expression of major xeno-carbohydrate antigens reduce or eliminate humoral rejection during xenotransplantation. Three of the major xeno-carbohydrate antigens include those produced by glycosyltransferase / glycosyl hydrolase GGTA1, CMAH, and B4GALNT2. The purpose of the loss of function of these genes is to reduce and / or eliminate the binding of pre-formed anti-pig antibodies to the endothelium of pig grafts. Three of the major xeno-carbohydrate antigens include those produced by glycosyltransferase / glycosyl hydrolase GGTA1, CMAH, and B4GALNT2. The purpose of the loss of function of these genes is to reduce and / or eliminate the binding of pre-formed anti-pig antibodies to the endothelium of pig grafts. The purpose of the loss of function of these genes is to reduce and / or eliminate the binding of pre-formed anti-pig antibodies to the endothelium of pig grafts. The purpose of the loss of function of these genes is to reduce and / or eliminate the binding of pre-formed anti-pig antibodies to the endothelium of pig grafts.

[0057]

[0122] Insertion of important complement, coagulation, inflammatory, immune, and / or immunoregulatory factors into one or more genomic loci, such as safe harbor genomic loci like AAVS1, will assist in the regulation of the human complement system and the functions of natural killer (NK), macrophage, and T cells. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants. Insertion of important complement, coagulation, inflammatory, immune, and / or immunoregulatory factors into one or more genomic loci, such as safe harbor genomic loci like AAVS1, will assist in the regulation of the human complement system and the functions of natural killer (NK), macrophage, and T cells. Insertion of important complement, coagulation, inflammatory, immune, and / or immunoregulatory factors into one or more genomic loci, such as safe harbor genomic loci like AAVS1, will assist in the regulation of the human complement system and the functions of natural killer (NK), macrophage, and T cells. Insertion of important complement, coagulation, inflammatory, immune, and / or immunoregulatory factors into one or more genomic loci, such as safe harbor genomic loci like AAVS1, will assist in the regulation of the human complement system and the functions of natural killer (NK), macrophage, and T cells. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent disordered platelet sequestration and thrombotic microangiopathy by humanization of the A1 domain and / or adjacent regions of the porcine vWF sequence; KI of B2M-HLA-E SCT to provide protection against the cytotoxicity of human NK cells and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to function as immunosuppressive agents, immunomodulatory substances, and / or anticoagulants.

[0058]

[0123] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have one or more genes that have been modified by addition, deletion, inactivation, disruption, excision of a portion thereof, or are genetically modified such that a portion of the gene sequence is altered. In some embodiments , the present disclosure provides isolated cells, tissues, organs, or animals having multiple modified genes. In some embodiments, the modified genes include one or more of α1,3-galactosyltransferase (GGTA), β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH), THBD, TFPI, CD39, HO-1, CD46, CD55, CD5 9, major histocompatibility complex, class I, E single-chain trimer (HLA-E SCT), A20, PD-L1, CD47, swine leukocyte antigen 1 (SLA-1), SLA-2, SLA-3, vW F, B2M, DQA, DRA, and CD47.

[0059]

[0124] In some embodiments, the modified gene is GGTA, B4GalNT2, CM AH, or any combination thereof. In some embodiments, GGTA, B4Ga lNT2, and / or CMAH are genetically KO. In some embodiments, the modified gene is THBD, TFPI, CD39, HO-1, or any combination thereof . In some embodiments, THBD, TFPI, CD39, and / or HO-1 are genetically KI. In some embodiments, the modified gene is CD46, CD55, CD 59, B2M-HLA-E SCT, A20, PD-L1, CD47, or any combination thereof.is a combination. In some embodiments, CD46, CD55, CD59, B2M-H LA-E SCT, A20, PD-L1, and / or CD47 are genetically KI. In some embodiments, the modified gene is SLA-1, SLA-2, SLA-3, B2M , or any combination thereof. In some embodiments, the modified gene is DQA and / or DRA. In some embodiments, the modified gene is PD-L1, exogenous v WF, HLA-E, HLA-G, B2M, CIITA-DN, and / or any combination thereof. In some embodiments, the modified gene is TBM, PD-L1, HLA-E , CD47, or any combination thereof. In some embodiments, TBM, PD -L1, HLA-E, and / or CD47 are genetically KI. In some embodiments the modified gene is the MHC-I genes SLA-1, SLA-2, and SLA-3, MH C-II genes DQA and DRA, endogenous vWF, CD9, asialoglycoprotein receptor , at least one complement inhibitor gene (e.g., C3, CD46, CD55, and CD5 9), and any combination thereof. In some embodiments, CD46, CD55 and / or CD59 are genetically KI.

[0060]

[0125] In one embodiment, the cells, tissues, organs or animals of the present disclosure are genetically modified with a transgene expression vector comprising B2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD-L1, FasL, CD46, CD55, CD59, or any combination thereof. In one embodiment, the cells, tissues, organs or animals of the present disclosure are B ​2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD- A transgene expression vector containing each of L1, FasL, CD46, CD55, and CD59 is genetically modified. One embodiment of the transgene expression vector is shown in FIG. 17. In one embodiment, the cells, tissues, organs, or animals of the present disclosure are, for example, by genetic KO, such that the expression of GGTA, B4GalNT2, CMAH, or any combination thereof is reduced or absent, and are further genetically modified.

[0061]

[0126] In one embodiment, the cells, tissues, organs, or animals of the present disclosure are B2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD-L1, HO-1, genetically modified with a transgene expression vector containing CD46, CD55, CD59, or any combination thereof. In one embodiment, the cells, tissues, organs, or animals of the present disclosure are B 2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD- genetically modified with a transgene expression vector containing each of L1, HO-1, CD46, CD55, and CD59. One embodiment of the transgene expression vector is shown in FIG. 18. In one embodiment, the cells, tissues, organs, or animals of the present disclosure are, for example, by genetic KO, such that the expression of GGTA, B4GalNT2, CMAH, or any combination thereof is reduced or absent, and are further genetically modified.

[0062]

[0127] In one embodiment, the cells, tissues, organs, or animals of the present disclosure are B2M, HLA-E SCT, CD47, PD-L1, HO-1, THBD, TFPI, CD39, A20, A transgene expression vector comprising CD46, CD55, CD59, or any combination thereof is genetically modified. In one embodiment, the cells, tissues, organs or animals of the present disclosure are B 2M, HLA-E SCT, CD47, PD-L1, HO-1, THBD, TFPI, C is genetically modified with a transgene expression vector comprising each of D39, A20, CD46, CD55, and CD59 vector. One embodiment of the transgene expression vector is shown in FIG. 19 In one embodiment, the cells, tissues, organs or animals of the present disclosure are, for example, by genetic KO such that the expression of GGTA, B4GalNT2, CMAH, or any combination thereof is reduced or absent, and is further genetically modified.

[0063]

[0128] In one embodiment, the cells, tissues, organs or animals of the present disclosure are CD46, CD55 , CD59, A20, THBD, TFPI, CD39, HO-1, 2xFKBP (a fusion of FK5 06 binding protein), hCaspase8, PD-L1, B2M, HLA-E SCT, CD47, or a transgene expression vector comprising any combination thereof is genetically modified. In one embodiment, the cells, tissues, organs or animals of the present disclosure are CD46, C D55, CD59, A20, THBD, TFPI, CD39, HO-1, 2xFKBP, hCaspase8, PD-L1, B2M, HLA-E SCT, and each of CD47 is genetically modified with a transgene expression vector comprising them. One embodiment of the transgene expression vector is shown in FIG. 20. In one embodiment, the cells, tissues, organs or animals of the present disclosure have reduced expression of GGTA, B4GalNT2, CMAH, or any combination thereof is present or has been further genetically modified such that, for example by genetic KO, there is no expression is present.

[0064]

[0129] The cells, tissues, organs or animals of the present disclosure can be genetically modified by any method that is possible. Non-limiting examples of suitable methods for the knockout (KO), knock-in (KI), and / or or genome replacement strategies disclosed and described herein include Cas9, Cas12a (C pf1), or other CRISPR endonucleases, Argonaute endonucleases, transcription activator-like (TAL) effector and nuclease (TALEN), zinc finger nuclease (ZFN), expression vectors, transposon systems (e.g., PiggyBac transposase), or CRISPR-mediated genetic modification using any combination thereof.

[0065] The cells, tissues, organs or animals of the present disclosure can be further modified to be PERV-free. The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally deleted from their genomes. The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally inactivated in their genomes. PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies

[0065]

[0130] The cells, tissues, organs or animals of the present disclosure can be further modified to be PERV-free. The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally deleted from their genomes. The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally inactivated in their genomes. PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally deleted from their genomes. The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally inactivated in their genomes. PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally inactivated in their genomes. PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies The cells, tissues, organs or animals of the present disclosure can be further modified to have PERV copies that have been functionally inactivated in their genomes. PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies PERV represents a risk factor when porcine cells, tissues, or organs are to be transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies PERV-A and PERV-B are polytropic viruses that infect several cell types, including human cells (e.g., they are xenotropic); while PERV-C is an ecotropic virus that infects only porcine cells. Functionally deleted PERV copies Functionally deleted PERV copies Non-limiting methods are both Niu, the entireties of which are incorporated herein by reference Disclosed and described in 2017 and WIPO Publication No. WO 2018 / 195402 In some embodiments, pigs are genetically engineered to be free of PERV-A, PERV-B, or PERV-C ( or any combination thereof).

[0066]

[0131] In some embodiments, additional genes of the cells, tissues, organs or animals of the present disclosure are modified by addition, deletion, inactivation, disruption, excision of a part thereof, or a part of the gene sequence is changed. In some embodiments, the modified gene comprises deletion of one or more of the following genes : MHC-I genes SLA-1, SLA-2, and SLA-3, MHC-I I genes DQA and DRA, endogenous vWF, CD9, asialoglycoprotein receptor, and C3, and expresses one or more of the following introduced genes: PD-L1, exogenous vWF, H LA-E, HLA-G, B2M, and CIITA-DN. In some embodiments, the modified gene comprises deletion of one or more of the following genes: alpha galactosyltransferase 1 , beta1,4 N-acetylgalactosaminyltransferase, and cytidine monophosphate -N-acetylneuraminic acid hydroxylase, and expresses one or more of the following introduced genes : CD46, CD55, CD59, CD47, HO-1, A20, TNFR1- Ig, CD39, THBD, TFPI, EPCR, PD-1, CTLA-Ig, CD73 , SOD3, CXCL12, FasL, CXCR3, CD39L1, GLP-1R, M3 R, IL35, IL12A and EB13. In some embodiments, the modified gene is CD 46, CD55, CD59, CD47, HO-1, A20, TNFR1-Ig, CD39 , THBD, TFPI, EPCR, PD-1, CTLA-Ig, CD73, SOD3, C XCL12, FasL, CXCR3, CD39L1, GLP-1R, M3R, IL35, IL12A and EB13.

[0067]

[0132] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have one or more genes that have been modified by addition, deletion, inactivation, disruption, excision of a portion thereof, a portion of the gene sequence has been altered, or the gene has been genetically modified to introduce a transgene or a portion thereof. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is an MHC class I gene. In some embodiments, the modified MHC class I gene comprises one or more of the following: SLA-1, SLA-2, SLA-3, and B2M. In some embodiments, the modified gene is SLA-1, SLA-2, and / or SLA-3. In some embodiments, the modified gene is B2M. In some embodiments, the modified MHC class I gene comprises one or more of the following: SLA-1, SLA-2, SLA-3, and B2 M. In some embodiments, the modified B2M, SLA-1, SLA-2, and / or SLA-3 gene, and / or a portion thereof, is replaced with a human HLA-E gene, a human HLA-G gene, a human B2M gene, and / or a human (dominant negative mutant class II transactivator) CIITA-DN gene, and / or a portion thereof. In some embodiments, the modified gene is conditionally and / or inducibly modified. A-G gene, a human B2M gene, and / or a human (dominant negative mutant class II transactivator) CIITA-DN gene, and / or a portion thereof. In some embodiments, the modified gene is conditionally and / or inducibly modified. ​ It is. In some embodiments, the conditional promoter and / or inducible promoter is used to conditionally and / or inducibly modify one or more modified genes. In some embodiments, the isolated cell, tissue, organ, or animal conditionally modifies the B2M, SLA-1, SLA-2, or SLA-3 gene, or any combination thereof, and conditionally modifies the modified gene with at least a portion of the human HLA-E gene, human HLA-G gene, human B2M gene, and / or human CIITA-DN gene.

[0068]

[0133] In some embodiments, one or more genes of the cells, tissues, organs, or animals of the present disclosure have been modified by addition, deletion, inactivation, disruption, excision of a portion thereof, the gene sequence has been changed, or the gene has been genetically modified to introduce a transgene or a portion thereof. In some embodiments, the present disclosure provides an isolated cell, tissue, organ, or animal having one or more modified genes. In some embodiments, the modified gene is an MHC class II gene. In some embodiments, the modified MHC class II gene is DRQ, DRA, or any combination thereof. In some embodiments Alternatively, the cell, tissue, organ or animal conditionally modifies the DRQ and / or DRA gene, or any combination thereof. This includes doing so.

[0069]

[0134] In some embodiments, the cells, tissues, organs or animals of the present disclosure have one or more genes modified by addition, deletion, inactivation, disruption, excision of a portion thereof, with a portion of the gene sequence changed, or genetically modified to introduce a transgene or a portion thereof. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having a modified vWF gene. In some embodiments, the modified gene is the vWF gene and vWF-related genes. In some embodiments, the modified vWF gene and / or a portion thereof is replaced with the human vWF gene and / or a portion thereof. In some embodiments, the modified vWF gene, modified vWF-related gene, and / or a portion thereof is replaced with the human vWF gene, one or more human vWF-related genes, and / or a portion thereof. In some embodiments, the modified vWF gene and / or vWF-related gene is conditionally and / or inducibly modified. In some embodiments, a conditional promoter and / or inducible promoter is used to conditionally and / or inducibly modify one or more modified genes. In some embodiments, the isolated cells, tissues, organs, or animals conditionally modify vWF, vWF-related genes, a portion thereof, or any combination thereof, and conditionally modify the modified gene with the human vWF gene, at least a portion of the human vWF gene, one or more other human vWF-related genes, at least a portion of one or more human vWF-related genes, or any combination thereof. In some embodiments, vW ​​The F gene is modified using a gRNA designed to initiate HDR substitution in the endogenous porcine genome and cleave near the region to be replaced with the human sequence. Non-limiting examples of suitable gRNAs are any one or more of SEQ ID NOs: 5 to 157. In some embodiments, the cells, tissues, organs, or animals of the present disclosure have one or more genes that are modified by addition, deletion, inactivation, disruption, excision of a part thereof, or a part of the gene sequence is changed, or are genetically modified to introduce a transgene or a part thereof. In some embodiments, the cells, tissues, organs, or animals of the present disclosure

[0070]

[0135] are genetically modified by introducing one or more foreign genes, or a part thereof, such as a transgene, into the cells, tissues, organs, or animals. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a programmed death gene. In some embodiments, the modified gene is PD-L1. In some embodiments, the cells, tissues, organs, or animals are modified to express a foreign PD-L1 gene, or a part thereof, such as a transgene. In some embodiments, the modified gene is modified conditionally and / or inducibly. In some embodiments, a conditional promoter and / or an inducible promoter is used to modify one or more modified genes conditionally and / or inducibly. In some embodiments, the isolated cells, tissues, organs, or animals include conditionally altering PD- L1. In some embodiments, PD-L1 is SEQ ID NO In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a programmed death gene. In some embodiments, the modified gene is PD-L1. In some embodiments, the cells, tissues, organs, or animals are modified to express a foreign PD-L1 gene, or a part thereof, such as a transgene. In some embodiments, the modified gene is modified conditionally and / or inducibly. In some embodiments, a conditional promoter and / or an inducible promoter is used to modify one or more modified genes conditionally and / or inducibly. In some embodiments, the isolated cells, tissues, organs, or animals include conditionally altering PD- L1. In some embodiments, PD-L1 is SEQ ID NO In some embodiments, the cells, tissues, organs, or animals are modified to express a foreign PD-L1 gene, or a part thereof, such as a transgene. In some embodiments, the modified gene is modified conditionally and / or inducibly. In some embodiments, a conditional promoter and / or an inducible promoter is used to modify one or more modified genes conditionally and / or inducibly. In some embodiments, the isolated cells, tissues, organs, or animals include conditionally altering PD- L1. In some embodiments, PD-L1 is SEQ ID NO promoter is used to modify one or more modified genes conditionally and / or inducibly. In some embodiments, the isolated cells, tissues, organs, or animals include conditionally altering PD- L1. In some embodiments, PD-L1 is SEQ ID NO L1 is conditionally altered. In some embodiments, PD-L1 is SEQ ID NO comprises the sequence described in 211, or any variant or part thereof.

[0071]

[0136] In some embodiments, the cells, tissues, organs or animals of the present disclosure have one or more genes that have been modified by addition, deletion, inactivation, disruption, excision of a part thereof, and a part of the gene sequence has been changed, or the gene has been genetically modified to introduce a transgene or a part thereof. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a complement gene. In some embodiments, the modified gene is C3. In some embodiments, C3 has been modified by addition, deletion, inactivation, disruption, excision of a part thereof, and a part of the gene sequence has been changed. In some embodiments, the modified C3 gene and / or complement-related genes are modified conditionally and / or inductively. In some embodiments, a conditional promoter and / or an inducible promoter are used to modify one or more modified genes conditionally and / or inductively. In some embodiments, the isolated cells, tissues, organs, or animals comprise conditionally altering C3, complement-related genes, parts thereof, or any combination thereof. In some embodiments, the C3 gene is modified using gRNA. Non-limiting examples of suitable gRNAs include any one or more of SEQ ID NOs: 158 to 2 10.

[0072] In some embodiments, the modified gene is a knockout of C3. In some embodiments, the modified gene is a knock-in of PD-L1. In some embodiments is modified using gRNA. Non-limiting examples of suitable gRNAs include any one or more of SEQ ID NOs: 158 to 2 110.

[0072]

[0137] In some embodiments, the modified gene is a knockout of C3. In some embodiments, the modified gene is a knock-in of PD-L1. In some embodiments In this case, the modified gene is a humanized vWF of porcine vWF. In some embodiments, the modification gene is a conditional knock-in of MHC-I genes SLA-1, SLA-2, and SLA-3 is.

[0073]

[0138] In some embodiments, the immune response by the host against the genetically modified cells, tissues or organs is not induced or is substantially not induced.

[0074]

[0139] In some embodiments, the present disclosure provides nucleic acids obtainable from any of the cells disclosed herein. In some embodiments, the nucleic acids in the cells are genetically modified such that one or more genes in the cells are altered or the genome of the cells is otherwise modified. In some embodiments, the gene, or a part thereof, is genetically modified using any of the gene modification systems known in the art and / or disclosed herein. In some embodiments, the gene modification system is a TALEN, zinc finger nuclease, and / or or a CRISPR-based system. In some embodiments, the gene modification system is a CRISPR-Cas9 system. In some embodiments, the gene modification system is a class II, type II CRISPR system. In some embodiments the gene modification system is a class II, type V CRISPR system. In some embodiments, the cells are genetically modified such that one or more genes or parts thereof in the cells are inactivated, and the cells are further genetically modified such that the expression of one or more genes or parts thereof that would induce an immune response if the cells (or tissues or organs cloned / derived from the cells) were transplanted into humans is reduced. In some embodiments ​ The cells are genetically modified such that the expression of one or more human genes, or a part thereof, is increased. In some embodiments, the cells are genetically modified such that the expression of one or more humanized genes, or a part thereof, is increased. In some embodiments, the cells are genetically modified such that one or more genes in the cells, or a part thereof, are inactivated, and the cells are further genetically modified such that the expression of one or more genes that would suppress the immune response when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human is increased. In some embodiments, the cells are genetically modified such that one or more genes in the cells, or a part thereof, are inactivated, and the cells are further genetically modified such that the expression of one or more genes that would induce an immune response when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human is decreased, and the cells are further genetically modified such that the expression of one or more genes that would suppress the immune response when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human is increased. when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human will suppress the immune response In some embodiments, the cells are genetically modified such that one or more genes in the cells, or a part thereof, are inactivated. and the cells are further genetically modified such that the expression of one or more genes that will suppress the immune response when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human is increased. when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human will induce an immune response when the cells (or tissues or organs cloned / derived from the cells) are transplanted into a human will suppress the immune response

[0075]

[0140] In some embodiments, the disclosure provides embryos cloned from genetically modified cells. In some embodiments, the genetically modified nucleic acid is extracted from the genetically modified cells and cloned into different cells. For example, in somatic cell nuclear transfer, the genetically modified nucleic acid from the genetically modified cells is introduced into enucleated oocytes. In some embodiments, the oocytes can be enucleated by partial zona dissection near the polar body and then extruding the cytoplasm in the dissected area. In some embodiments, the injection pipette has a sharp beveled tip. and then extruding the cytoplasm in the dissected area to enucleate it. Use a to inject genetically modified cells into enucleated oocytes arrested at the second meiosis. The first Oocytes arrested at the second meiosis are often referred to as "eggs". In some embodiments, the embryo is generated by fusing and activating the oocyte. Such an embryo may be referred to herein as a "genetically modified embryo". In some embodiments, the genetically modified embryo is transferred to the oviduct of a recipient female pig. In some embodiments, the genetically modified embryo is transferred to the oviduct of the recipient female 20-24 hours after activation. See, for example, Cibelli 1998 and U.S. Patent No. 6,548,741. In some embodiments, the recipient female is checked for pregnancy about 20-21 days after transfer of the genetically modified embryo.

[0076]

[0141] In some embodiments, the genetically modified embryo grows into a postnatal genetically modified animal. In some embodiments, the postnatal genetically modified animal is a neonatal genetically modified animal. In some embodiments, the genetically modified pig is a juvenile genetically modified animal. In some embodiments the genetically modified animal is an adult genetically modified animal (e.g., over 5-6 months old). In some embodiments, the genetically modified animal is a female genetically modified animal. In some embodiments the animal is a male genetically modified animal. In some embodiments, the genetically modified animal is mated with a non-genetically modified animal. In some embodiments, the genetically modified animal is mated with another genetically modified animal. In some embodiments, the genetically modified pig is mated with another genetically modified animal having a reduced or absent active virus. In some embodiments, the genetically modified animal has cells, tissues or organs from a second genetically modified animal that are human Genetically modified so as to be less likely to induce an immune response when transplanted into a recipient, the second is mated with a genetically modified animal.

[0077]

[0142] In some embodiments, the genetically modified animal has one or more modified genes and maintains expression or inactivation of the modified gene at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy, at the same or similar level. In some embodiments, the genetically modified animal remains in a genetically modified state having one or more modified genes even after parturition from a non-viral inactivating agent, or after being housed with other non-viral inactivated animals in a facility / space.

[0078]

[0143] In some embodiments, the disclosure provides cells, tissues, or organs obtained from any of the postnatally genetically modified pigs described herein. In some embodiments, the cells, tissues, or organs are selected from the group consisting of liver, kidney, lung, heart, pancreas, muscle, blood, and bone. In certain embodiments, the organ is liver, kidney, lung, or heart. In some embodiments, cells from postnatally genetically modified pigs are: pancreatic islets, lung epithelial cells, cardiac muscle cells, skeletal muscle cells, smooth muscle cells, hepatocytes, non-parenchymal liver cells, gallbladder epithelial cells, gallbladder endothelial cells, bile duct epithelial cells, bile duct endothelial cells, hepatic vascular epithelial cells, hepatic vascular endothelial cells, sinusoidal cells, choroid plexus cells, fibroblasts, Sertoli cells, neurons, stem cells, and adrenal chromaffin cells. In some embodiments, the genetically modified organs, tissues, or cells are isolated from their native environment (i.e., isolated from the pig in which they grew internally). In some embodiments, separation from the natural environment is the overall physical separation from the natural environment, for example, removal from a genetically modified donor animal, and alteration (e.g., by dissociation) of the association of the genetically modified organ, tissue, or cell with adjacent cells with which they are in direct contact.

[0079] III. Method for Producing Cells, Tissues, Organs, or Animals

[0144] The present disclosure provides a method for producing any of cells, tissues, organs, or animals having one or more of the modified genes disclosed herein. In some embodiments, the present disclosure provides a method for inactivating, deleting, or otherwise disrupting one or more genes or portions thereof in any of the cells disclosed herein, the method comprising administering to the cell a gene editing agent specific for the gene, where the agent interferes with transcription and / or translation of the gene. In some embodiments, the agent targets the start codon of the gene and inhibits transcription of the gene. In some embodiments, the agent targets an exon in the gene and the agent induces a frameshift mutation in the gene. In some embodiments, the agent introduces an inactivating mutation into the gene. In some embodiments, the agent blocks transcription of the gene.

[0080]

[0145] In some embodiments, the present disclosure provides a method for altering one or more genes or portions thereof in vivo, the method comprising administering to the cell a gene editing agent specific for the gene, where the agent alters the sequence of the gene, for example, by humanizing the gene or otherwise altering the natural (e.g., wild-type) sequence of the gene.

[0081]

[0146] In some embodiments, the present disclosure provides one or more genes or portions thereof, for example​​​​​​​​​ Provided is a method for expressing a transgene (e.g., a non-natural gene), the method comprising administering to a cell a gene editing agent specific for the transgene, wherein the agent introduces the sequence of the transgene. In some embodiments, the agent is a nucleic acid sequence, such as a plasmid, vector, etc. In some embodiments, the nucleic acid sequence comprises one or more nucleic acid sequences, such as a promoter, a transgene, and / or an additional gene. In some embodiments, the nucleic acid sequence or a portion thereof is derived from one or more species and / or one or more sources. In some embodiments, the species is a species that will receive the genetically modified cell, tissue, or organ. In some embodiments, the species is human. In other embodiments, the species is non-human, such as a mammal, an animal, a bacterium, and / or a virus.

[0082]

[0147] In some embodiments, any of the agents disclosed herein is a polynucleotide. In some embodiments, the polynucleotide encodes one or more of the nucleases and / or nickases and / or RNA or DNA molecules described herein. In some embodiments, the polynucleotide agent is introduced into one or more cells. In some embodiments, the polynucleotide is introduced into one or more cells such that the polynucleotide is transiently expressed by the one or more cells. In some embodiments, the polynucleotide is introduced into one or more cells such that the polynucleotide is stably expressed by the one or more cells. In some embodiments, the polynucleotide is introduced in such a way that it is stably integrated into the cell genome. In this state, the polynucleotide is introduced together with one or more transposable elements. In some embodiments In this state, the transposable element is a polynucleotide sequence encoding a transposase. In some embodiments, the transposable element is a polynucleotide sequence encoding PiggyBac transposase. In some embodiments, the transposable element is inducible. In some embodiments, the transposable element is doxycycline inducible. In some embodiments the polynucleotide further comprises a selectable marker. In some embodiments, the selectable marker is a puromycin resistance marker. In some embodiments, the selectable marker is a fluorescent protein (e.g., GFP).

[0083]

[0148] In some embodiments, the agent is a nuclease or nickase used to target DNA in cells. In some embodiments, the agent specifically targets a gene and suppresses the expression of the gene. In some embodiments, the agent comprises a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain is a Kruppel-associated box (KRAB).

[0084]

[0149] In some embodiments, the agent is any programmable nuclease. In some embodiments, the agent is a naturally occurring homing meganuclease. In some embodiments, the agent is a TALEN-based agent, a ZFN-based agent, or a CRISPR -based agent, or any biologically active fragment, fusion, derivative, or combination thereof. CRISPR-based agents include, for example, various such as Cas9 and Cpf1 ​​​​​​Included are Class II Type II and Type V systems, including certain variants. In some embodiments, the agent is a deaminase or a nucleic acid encoding a deaminase. In some embodiments, the cell is genetically engineered to stably and / or transiently express a TALEN-based agent, a ZFN-based agent, and / or a CRISPR-based agent.

[0085]

[0150] IV. Methods of Treatment

[0151] In some embodiments, any of the genetically modified cells, tissues or organs disclosed herein can be used for treating a subject of a different species as a genetically modified cell. In some embodiments, the present disclosure provides a method of transplanting any of the genetically modified cells, tissues or organs described herein into a subject in need thereof. In some embodiments the subject is a human. In some embodiments, the subject is a non-human primate.

[0086]

[0152] In some embodiments, the genetically modified organ for use in any of the methods disclosed herein can be selected from a genetically modified porcine heart, lung, liver, eye, pituitary gland, thyroid gland, parathyroid gland, esophagus, thymus, adrenal gland, appendix, bladder, gallbladder, small intestine, large intestine, small intestine, kidney, pancreas, spleen, stomach, skin and / or prostate. In some embodiments, the genetically modified tissue for use in any of the methods disclosed herein can be selected from genetically modified porcine cartilage (e.g., esophageal cartilage, knee cartilage, ear cartilage, nasal cartilage), muscle, e.g., non-limiting smooth muscle and cardiac muscle (e.g., heart valve), tendon, ligament, bone (e.g., bone marrow), cornea, middle ear and vein. In some embodiments, the genetically modified cells for use in any of the methods disclosed herein include blood cells, skin follicles, hair follicles, and / or stem cells. Any part of an organ or tissue (e.g., a part of the eye such as the cornea) can be used for administration of the compositions of the present disclosure. In some embodiments, the heart, lung, liver, kidney, pancreas, or spleen is isolated from a pig that has been genetically modified to include (a) deletion or disruption of GGTA1, CMAH, and B4GALNT2; (b) addition of CD46, CD55, CD59, CD39, CD47, A20, PD-L1, HLA-E, B2M, THBD, TFPI, and HO transgenes (e.g., human or humanized copies thereof) expressed from a single multi-transgene cassette of the pig genome; and (c) functional deletion of all PERV copies. In some embodiments, the heart, lung, liver, kidney, pancreas, or spleen is isolated from a pig that has been genetically modified to include (a) functional disruption of GGTA1, CMAH, and B4GALNT2; (b) addition of CD46, CD55, CD59, CD39, CD47, A20, PD-L1, HLA-E, B2M, THBD, TFPI, and HO transgenes (e.g., humanized copies thereof) expressed from a single multi-transgene cassette of the pig genome; and (c) functional inactivation of all PERV copies. In certain embodiments, the pig is further genetically modified to have humanized vWF, deletion of ASGR1, and / or deletion of the B2M gene. In some embodiments, the xenotransplanted organ (e.g., heart, lung, liver, kidney .

[0087]

[0153] In some embodiments, the heart, lung, liver, kidney, pancreas, or spleen is, (a) deletion or disruption of GGTA1, CMAH, and B4GALNT2; (b) addition of CD46, CD55, CD59, CD39, C D47, A20, PD-L1, HLA-E, B2M, THBD, TFPI, and HO transgenes (e.g., human or humanized copies thereof); and (c) functional deletion of all PERV copies. In some embodiments , the heart, lung, liver, kidney, pancreas, or spleen is, (a) functional disruption of GGTA1, CMAH, and B4G ALNT2; (b) addition of CD46, CD55, CD59, CD39, CD47, A20, PD-L1, HLA -E, B2M, THBD, TFPI, and HO transgenes (e.g., humanized copies thereof) ; and (c) functional inactivation of all PERV copies. In certain embodiments, the pig is further genetically modified to have humanized vWF, deletion of ASGR1, and / or deletion of the B2M gene.

[0088]

[0154] In some embodiments, the xenotransplanted organ (e.g., heart, lung, liver, kidney After being xenotransplanted into a human or non-human primate, the liver, pancreas, spleen, etc. show a continuous function exceeding about 300 days, exceeding about 1 year, exceeding about 1.5 years, exceeding about 2 years, exceeding about 2.5 years, exceeding about 3 years exceeding about 3.5 years, exceeding about 4 years, exceeding about 4.5 years, exceeding about 5 years, exceeding about 5.5 years, exceeding about 6 years, exceeding about 6.5 years, exceeding about 7 years, exceeding about 7.5 years, exceeding about 8 years, exceeding about 8.5 years, about 9 years, exceeding about 9.5 years, or exceeding about 10 years.

[0089]

[0155] In some embodiments, the present disclosure provides treatment for a subject having a disease, disorder or injury that results in damaged, missing or non-existent organ , tissue or cell function. In some embodiments, the subject has an injury or trauma (e.g., a motor vehicle accident) that results in damage to one or more cells, tissues or organs of the subject. In some embodiments, the subject has a burn caused by fire or acid. In some embodiments, the subject has a disease or disorder that results in damaged, missing or non-existent organ, tissue or cell function. In some embodiments, the subject has an autoimmune disease. In some embodiments, the disease is : heart disease (e.g., atherosclerosis), dilated cardiomyopathy, severe coronary artery disease, scarred heart tissue, congenital heart defects, type I or type II diabetes, hepatitis, cystic fibrosis, cirrhosis, renal failure, lupus, scleroderma, IgA nephropathy, polycystic kidney disease, myocardial infarction, emphysema, chronic bronchitis, bronchiolitis obliterans, pulmonary hypertension, congenital diaphragmatic hernia, congenital surfactant protein B deficiency, and congenital cystic emphysematous lung disease, primary biliary cholangitis, sclerosing cholangitis, biliary atresia, alcohol dependence, Wilson's disease, hemochromatosis , cirrhosis, renal failure, lupus, scleroderma, IgA nephropathy, polycystic kidney disease, myocardial infarction, emphysema, chronic bronchitis, bronchiolitis obliterans, pulmonary hypertension, congenital diaphragmatic hernia, congenital surfactant protein B deficiency, and congenital cystic emphysematous lung disease, primary biliary cholangitis, sclerosing cholangitis, biliary atresia, alcohol dependence, Wilson's disease, hemochromatosis It is selected from the group consisting of S, and / or alpha-1 antitrypsin deficiency.

[0090]

[0156] In some embodiments, any of the genetically modified cells, tissues and / or organs of the present disclosure are separated from the genetic modification donor and administered to a non-donor subject host. As used in this context, "administer" or "administration" includes, but is not limited to, introducing, applying, injecting, implanting, grafting, conjugating, and transplanting. According to the present disclosure, the genetically modified cells, tissues and / or organs are administered by a method or route that results in localization to the desired site of the organs, tissues, cells or compositions of the present disclosure. The organs, tissues, cells or compositions of the present disclosure can be administered to a subject by any suitable route that results in delivery of the cells to the desired location within the subject such that at least a portion of the cells remain viable. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the cells (regardless of whether administered separately or as part of a tissue or organ) remain viable after administration to the subject. Methods of administering the organs, tissues, cells or compositions of the present disclosure are well known in the art. In some embodiments, the cells, tissues and / or organs are transplanted into the host. In some embodiments, the cells, tissues and / or organs are injected into the host. In some embodiments, the cells, tissues and / or organs are grafted onto the surface of the host (e.g., bone or skin).

[0091]

[0157] In some embodiments, the deficiencies of GGTA1, CMAH, and B4GALNT2 Loss or disruption of CD46, CD55, and C from a single multi-transgene cassette in the pig genome D39, CD47, HLA-E, THBD, and TFPI, and optionally CD59, Expression of one or more of B2M, A20, PD-L1, and HO-1; absence of all PERV copies a heart, lung, liver, kidney, pancreas, or spleen that has been genetically modified to have a In some embodiments, GGTA1, CMAH, and B4G are transplanted into the host. Deletion of ALNT2;CD46,CD5 from a single multi-transgene cassette in the pig genome 5, CD39, CD47, HLA-E, THBD and TFPI, and optionally CD5 9, expression of one or more of B2M, A20, PD-L1, and HO-1; and total PERV cohort The heart, lungs, liver, kidneys, and pancreas have been genetically modified to have functional inactivation of the In some embodiments, the transplanted heart, lung, or spleen is transplanted into the host. The liver, kidney, pancreas, spleen, or any part thereof is viable and can be maintained for about 1 day, about 1 week, about 2 weeks, or about 3 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, About 9 months, about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years , about 8 years, about 9 years, about 10 years, or more.

[0092]

[0158] In some embodiments, the genetically modified cells, tissues, or organs are In some cases, the tissue or organ may need to be protected from the immune system of the host to which it is administered. For example, In some embodiments, the genetically modified cells, tissues or organs are The genetically modified cells, tissues, or organs may be administered together with a coating (e.g., gelatin) to the host. Protect from the immune response therefrom. In some embodiments, the matrix or coating is , a biodegradable matrix or coating. In some embodiments, the matrix or coating is natural. In other embodiments, the matrix or coating is synthetic.

[0093]

[0159] In some embodiments, the genetically modified cells, tissues or organs are administered together with an immunosuppressive compound . In some embodiments, the immunosuppressive compound is a small molecule, peptide, antibody, and / or nucleic acid (e.g., antisense or siRNA molecule). In some embodiments, the immunosuppressive compound is a small molecule. In some embodiments, the small molecule is a steroid, mTOR inhibitor, calcineurin inhibitor, antiproliferative agent or IMDH inhibitor . In some embodiments, the small molecule is a corticosteroid (e.g., prednisone , budesonide, prednisolone), a calcineurin inhibitor (e.g., cyclosporine , tacrolimus), an mTOR inhibitor (e.g., sirolimus, everolimus), an IMDH inhibitor (azathioprine, leflunomide, mycophenolate), an antibiotic (e.g., dactinomycin , anthracycline, mitomycin C, bleomycin, mitramycin ), and methotrexate, or a salt or derivative thereof, selected from the group consisting of. In some embodiments, the immunosuppressive compound is: CTLA4, anti-b7 antibody, abatacept, adalimumab , anakinra, certolizumab, etanercept, golimumab, infliximab , ixekizumab, natalizumab, rituximab, secukinumab, tocilizumab, ustekinumab , vedolizumab, basiliximab, daclizumab, and muromonab, selected from the group consisting of It is a polypeptide selected therefrom.

[0094]

[0160] In some embodiments, the genetically modified cells, tissues or organs to be administered to the subject are further genetically modified such that they are less likely to induce an immune response in the subject. In some embodiments, the genetically modified cells, tissues or organs are further genetically modified such that they do not express functional immune activating molecules.

[0095]

[0161] The following examples are provided to illustrate the disclosure and are for illustrative purposes only and should not be construed as limiting the scope of the disclosure.

Examples

[0096] Example

[0162] The disclosure is generally described herein, but is included for the purpose of merely illustrating specific aspects and embodiments of the disclosure and is not intended to limit the disclosure. It will be more readily understood by reference to the following examples. For example, the specific constructs and experimental designs disclosed in this specification represent exemplary tools and methods for verifying appropriate functions. Thus, it will be readily apparent that any of the specific constructs and experimental plans disclosed can be substituted within the scope of the disclosure.

[0097] Example 1: Knockout of porcine complement component 3 (C3) to inhibit the complement system

[0163] A highly conserved region of C3 was selected and two sgRNAs targeting the C3 domain were designed. The sequences of the two gRNA sequences are TCTCCAGACGCAGGACGTTG (SEQ ID NO: 158) and GGAGGCCCACGAAGGGCAAG (SEQ ID NO: 1 ​ 59). The C3 sgRNA was co-transfected into porcine fetal fibroblasts together with the GGTA sgRNA (GAGAAAATAATG AATGTCAA (SEQ ID NO: 210)) plasmid and the cas9 plasmid using a Neon transfection machine and reagents. Cells lacking C3 ("C3-KO") were selected using the GGTA antibody counter-selection method to co-enrich the C3-KO cells, which were then single-cell sorted and genotyped to determine the efficiency of knocking down the C3 target using deep sequencing.

[0098]

[0164] Of the 156 clones screened, 108 clones were homozygous C3-KO. The knockdown efficiency of the homozygous C3-KO cells was 69%. Using the obtained C3-KO cell line, pigs were produced using somatic cell nuclear transfer. The C3-KO pigs survived for 63 days and died due to liver and lung infections. As shown in FIGS. 1A-C, the C3-KO pigs were 100% NHEJ knockout. FIG. 1A shows the size of the deletions introduced into C3, FIG. 1B shows the positions of the indels, and FIG. 1C shows the sequences of the indels generated in the C3-KO pigs.

[0099]

[0165] It is expected that the described C3-KO pigs would not produce any functional C3 protein. Since the functional C3 protein is absent, the complement system of the C3-KO pigs is not activated, thereby reducing the innate immune system of the C3-KO pigs. Furthermore, it is expected that C3-KO pigs may be more prone to bacterial and / or viral infections compared to wild-type pigs. Furthermore, the cells, tissues, and / or organs of C3-KO pigs ​ Xenotransplantation to pigs is not expected to activate the human complement system. Therefore, this should minimize the human innate immune response against C3-KO pig xenografts.

[0100] Example 2: Pigs with one or more modified MHC class I genes

[0166] The porcine MHC major class I alleles were conditionally replaced with human MHC minor class I alleles (「MHC-I pigs」). To do this, the regions of the porcine genome containing the SLA-1, SLA- 2, and SLA-3 genes were replaced with a modified version of the human minor allele HLA- E.

[0101]

[0167] Figure 2 shows the scheme of the MHC class I replacement strategy: The loci containing the SLA-1, SLA-2 , and SLA-3 genes were adjacent to the loxP sites. After treatment with Cre, SLA-1, SLA-2, and SLA-3 were excised and replaced with human HLA-E, such as various combinations of HLA-G, B2M, and CIITA-DN genes. MHC-I pigs were viable and in a severely immunodeficient state. Therefore, instead of universally replacing the SLA-1 , SLA-2, and SLA-3 genes with human genes, conditional knockout was used to replace the SLA-1, S LA-2, and SLA-3 genes with human HLA-E and other human genes before harvesting cells, tissues, and / or organs.

[0102]

[0168] The porcine MHC I region was sequenced using long-read technology. Probes were designed to capture the SL A-1, SLA-2, and SLA-3 genes and used to capture the MHC -I gene region. To accurately determine the MHC-I gene region PacBio sequencing and 10X sequencing were used. The compositions of SLA-1, SLA -2, and SLA-3 are shown in FIG. 9. Two cassettes having loxP sites adjacent to the MHC-I region were designed. Cassette 1 contains a promoter, a loxP site, and a selectable agent (i.e., puromycin). Cassette 2 contains a second marker (GFP), a loxP site, and a promoter of a gene containing HLA-E, B2M, and CIITA-DN, but does not contain a cassette. Cassette 1 contains a promoter, a loxP site, and a selectable agent (i.e., puromycin). Cassette 2 contains a second marker (GFP), a loxP site, and a promoter of a gene containing HLA-E, B2M, and CIITA-DN, but does not contain a cassette. Cassette 1 contains a promoter, a loxP site, and a selectable agent (i.e., puromycin). Cassette 2 contains a second marker (GFP), a loxP site, and a promoter of a gene containing HLA-E, B2M, and CIITA-DN, but does not contain a cassette. Cassette 1 contains a promoter, a loxP site, and a selectable agent (i.e., puromycin). Cassette 2 contains a second marker (GFP), a loxP site, and a promoter of a gene containing HLA-E, B2M, and CIITA-DN, but does not contain a cassette.

[0103]

[0169] Cassettes 1 and 2 were synthesized from individual components using the Golden Gate Assembly strategy (New England BioLabs) and were adjacent to an 800 bp homologous sequence corresponding to the insertion site. Two consecutive CRISPR-cas9 rounds were used to insert both sites. Cassettes 1 and 2 were synthesized from individual components using the Golden Gate Assembly strategy (New England BioLabs) and were adjacent to an 800 bp homologous sequence corresponding to the insertion site. Two consecutive CRISPR-cas9 rounds were used to insert both sites. Cassettes 1 and 2 were synthesized from individual components using the Golden Gate Assembly strategy (New England BioLabs) and were adjacent to an 800 bp homologous sequence corresponding to the insertion site. Two consecutive CRISPR-cas9 rounds were used to insert both sites. Cassettes 1 and 2 were synthesized from individual components using the Golden Gate Assembly strategy (New England BioLabs) and were adjacent to an 800 bp homologous sequence corresponding to the insertion site. Two consecutive CRISPR-cas9 rounds were used to insert both sites. 17 Clones were isolated using puromycin selection and GFP FACS sorting, and the insertions were verified using junction PCR. Clones were isolated using puromycin selection and GFP FACS sorting, and the insertions were verified using junction PCR.

[0104]

[0170] Cells were transfected with Cre recombinase, and the expression of Cre recombinase was induced. Single cell sorting was performed, and the sorted cells were screened using junction PCR to isolate cells in which SLA-1, SLA-2, and SLA-3 were allelically replaced with human MHC-1. Cells were transfected with Cre recombinase, and the expression of Cre recombinase was induced. Single cell sorting was performed, and the sorted cells were screened using junction PCR to isolate cells in which SLA-1, SLA-2, and SLA-3 were allelically replaced with human MHC-1. Cells were transfected with Cre recombinase, and the expression of Cre recombinase was induced. Single cell sorting was performed, and the sorted cells were screened using junction PCR to isolate cells in which SLA-1, SLA-2, and SLA-3 were allelically replaced with human MHC-1. Cells were transfected with Cre recombinase, and the expression of Cre recombinase was induced. Single cell sorting was performed, and the sorted cells were screened using junction PCR to isolate cells in which SLA-1, SLA-2, and SLA-3 were allelically replaced with human MHC-1.

[0105]

[0171] For in vivo Cre excision, an alternative cassette 1 has been designed and contains Cre recombinase under the control of a tissue-specific promoter or an inducible promoter. By using a tissue-specific promoter or an inducible promoter, SLA- For in vivo Cre excision, an alternative cassette 1 has been designed and contains Cre recombinase under the control of a tissue-specific promoter or an inducible promoter. By using a tissue-specific promoter or an inducible promoter, SLA- For in vivo Cre excision, an alternative cassette 1 has been designed and contains Cre recombinase under the control of a tissue-specific promoter or an inducible promoter. By using a tissue-specific promoter or an inducible promoter, SLA- 1. The SLA-2 and SLA-3 genes can be excised in the target cells, tissues, and / or organs before the cells, tissues, and / or organs are harvested, or the excision can be induced in an animal. Pigs having SLA-1, SLA-2, and SLA-3 replaced with human MHC-I can be produced by somatic cell nuclear transfer (SCNT), and piglets encoding conditional and / or tissue-specific conditional replacement genes can be produced. , or the excision can be induced in an animal. Pigs having SLA-1, SLA-2, and SLA-3 replaced with human MHC-I can be produced by somatic cell nuclear transfer (SCNT), and piglets encoding conditional and / or tissue-specific conditional replacement genes can be produced.

[0106] Example 3: MHC Class II Inactivation

[0172] Pigs lacking the expression of the MHC-IIα chain (''MHC-II KO pigs'') were produced by using established gRNA technology in porcine cells to excise the DQA gene and inactivate the DRA gene, and then transferred into host pigs via SCNT. Briefly, after the transfer of gRNA into porcine cells, the genome was sequenced to identify mutations at the MHC-II locus. Cas9 was delivered into these cells, and then these were sorted to isolate single cells. These single cells were sequenced to determine the genotypes of the targeted DQA and DRA genes. In single cells having DQA and DRA inactivation, embryos were generated after SCNT and then implanted into pigs to produce MHC-II KO pigs. At 4 weeks after birth, the MHC-II KO pigs remained healthy. , and then transferred into host pigs via SCNT. Briefly, after the transfer of gRNA into porcine cells, the genome was sequenced to identify mutations at the MHC-II locus. Cas9 was delivered into these cells, and then these were sorted to isolate single cells. These single cells were sequenced to determine the genotypes of the targeted DQA and DRA genes. In single cells having DQA and DRA inactivation, embryos were generated after SCNT and then implanted into pigs to produce MHC-II KO pigs. At 4 weeks after birth, the MHC-II KO pigs remained healthy. After the transfer of gRNA into porcine cells, the genome was sequenced to identify mutations at the MHC-II locus. Cas9 was delivered into these cells, and then these were sorted to isolate single cells. These single cells were sequenced to determine the genotypes of the targeted DQA and DRA genes. In single cells having DQA and DRA inactivation, embryos were generated after SCNT and then implanted into pigs to produce MHC-II KO pigs. At 4 weeks after birth, the MHC-II KO pigs remained healthy. These single cells were sequenced to determine the genotypes of the targeted DQA and DRA genes. In single cells having DQA and DRA inactivation, embryos were generated after SCNT and then implanted into pigs to produce MHC-II KO pigs. At 4 weeks after birth, the MHC-II KO pigs remained healthy. In single cells having DQA and DRA inactivation, embryos were generated after SCNT and then implanted into pigs to produce MHC-II KO pigs. At 4 weeks after birth, the MHC-II KO pigs remained healthy. At 4 weeks after birth, the MHC-II KO pigs remained healthy.

[0107]

[0173] Figures 3A and 3B show the genotypes of MHC-II KO based on the DQA gene. The genotypes of the MHC-II KO pigs were determined by amplification and sequencing based on exon targeting of the DQA gene and sequencing of the DRA gene. As shown in the left panel, the size and position of the indel are located in the DRA gene Figures 3A and 3B show the genotypes of MHC-II KO based on the DQA gene. The genotypes of the MHC-II KO pigs were determined by amplification and sequencing based on exon targeting of the DQA gene and sequencing of the DRA gene. As shown in the left panel, the size and position of the indel are located in the DRA gene Figures 3A and 3B show the genotypes of MHC-II KO based on the DQA gene. The genotypes of the MHC-II KO pigs were determined by amplification and sequencing based on exon targeting of the DQA gene and sequencing of the DRA gene. As shown in the left panel, the size and position of the indel are located in the DRA gene Figures 3A and 3B show the genotypes of MHC-II KO based on the DQA gene. The genotypes of the MHC-II KO pigs were determined by amplification and sequencing based on exon targeting of the DQA gene and sequencing of the DRA gene. As shown in the left panel, the size and position of the indel are located in the DRA gene It is carried out. Inactivation of the DRA gene is caused by two single nucleotide insertions at positions 126 and 127 in the DRA amplicon, as shown in the right panel. It is caused by two single nucleotide insertions at positions 126 and 127 in the DRA amplicon, respectively. It is caused.

[0108]

[0174] Figures 4A and 4B show another genotype of MHC-II KO pigs. The DR A genotype was determined using amplification and sequencing based on exon targeting of the DRA gene. The exon-targeted region from DRA was amplified and sequenced. As shown in the left panel, the size and position of the indel are located in the DRA gene. Inactivation of the DRA gene is caused by two single nucleotide insertions at positions 106 and 107 in the DRA amplicon, as shown in the right panel. The DR A genotype was determined using amplification and sequencing based on exon targeting of the DRA gene. The exon-targeted region from DRA was amplified and sequenced. As shown in the left panel, the size and position of the indel are located in the DRA gene. Inactivation of the DRA gene is caused by two single nucleotide insertions at positions 106 and 107 in the DRA amplicon, as shown in the right panel. Inactivation of the DRA gene is caused by two single nucleotide insertions at positions 106 and 107 in the DRA amplicon, respectively. It is caused by two single nucleotide insertions at positions 106 and 107 in the DRA amplicon, respectively.

[0109]

[0175] Similar to humans lacking MHC-II expression, MHC-II KO pigs have a reduced population of CD4 T cells, while the CD8 T cell population remains intact (Figure 5). + Similar to humans lacking MHC-II expression, MHC-II KO pigs have a reduced population of CD4 T cells, while the CD8 T cell population remains intact (Figure 5). + Similar to humans lacking MHC-II expression, MHC-II KO pigs have a reduced population of CD4 T cells, while the CD8 T cell population remains intact (Figure 5). Furthermore, MHC-II KO pigs are immunosuppressed and have increased autoimmunity and lymphoid deficiencies, among other problems. These phenotypes are known to be associated with the MHC-II KO phenotype and have been observed in mice lacking MHC-II expression. From these similarities, it is confirmed that MHC-II KO pigs are effective MHC-II KO rather than active gene modification (Figure 6). Furthermore, MHC-II KO pigs are immunosuppressed and have increased autoimmunity and lymphoid deficiencies, among other problems. These phenotypes are known to be associated with the MHC-II KO phenotype and have been observed in mice lacking MHC-II expression. From these similarities, it is confirmed that MHC-II KO pigs are effective MHC-II KO rather than active gene modification (Figure 6). These phenotypes are known to be associated with the MHC-II KO phenotype and have been observed in mice lacking MHC-II expression. From these similarities, it is confirmed that MHC-II KO pigs are effective MHC-II KO rather than active gene modification (Figure 6).

[0110] Example 4: PD-L1 Knock-in to Reduce Rejection Based on Adaptive Immunity

[0176] The human PD-L1 gene (e.g., the PD-L1 transgene) is delivered to the pig genome. Please refer to the scheme having the structure of FIG. 7. The expression of the human PD-L1 transgene was confirmed by qPCR using two different PD-L1 amplicons (FIG. 8). The expression of the human PD-L1 transgene was confirmed by qPCR using two different PD-L1 amplicons (FIG. 8).

[0111]

[0177] Porcine tissues expressing PD-L1 may have reduced rejection responses by hosts such as humans after xenotransplantation. Porcine tissues expressing PD-L1 may have reduced rejection responses by hosts such as humans after xenotransplantation.

[0112] Example 5: Genetic modification of porcine von Willebrand factor that regulates platelet aggregation

[0178] An HDR vector containing specific residues in the homologous arm derived from pvWF, the A1 domain, and the adjacent region derived from hvWF was designed and constructed (FIG. 10). Two sgRNAs were also designed to initiate HDR substitution in the endogenous porcine genome and cleave near the region to be replaced by the human sequences: TCTCACCTGTGAAGCCTGCG (SEQ ID NO: 5) and CACAGTGACTTGGGCCACTA (SEQ ID NO: 6). An HDR vector containing specific residues in the homologous arm derived from pvWF, the A1 domain, and the adjacent region derived from hvWF was designed and constructed (FIG. 10). Two sgRNAs were also designed to initiate HDR substitution in the endogenous porcine genome and cleave near the region to be replaced by the human sequences: TCTCACCTGTGAAGCCTGCG (SEQ ID NO: 5) and CACAGTGACTTGGGCCACTA (SEQ ID NO: 6). An HDR vector containing specific residues in the homologous arm derived from pvWF, the A1 domain, and the adjacent region derived from hvWF was designed and constructed (FIG. 10). Two sgRNAs were also designed to initiate HDR substitution in the endogenous porcine genome and cleave near the region to be replaced by the human sequences: TCTCACCTGTGAAGCCTGCG (SEQ ID NO: 5) and CACAGTGACTTGGGCCACTA (SEQ ID NO: 6). GAAGCCTGCG (SEQ ID NO: 5) and CACAGTGACTTGGGCCACTA ( SEQ ID NO: 6).

[0113]

[0179] The HDR vector consists of approximately 1 kb homologous arms from porcine vWF and human A1 and adjacent domains, as well as inactivating mutations at the sgRNA cleavage sites to prevent the sgRNA from cleaving the donor and the modified porcine genome. The HDR vector also contains SphI and BspEI sites that can distinguish the HDR vector from the endogenous porcine genome near the sgRNA cleavage site. The HDR vector consists of approximately 1 kb homologous arms from porcine vWF and human A1 and adjacent domains, as well as inactivating mutations at the sgRNA cleavage sites to prevent the sgRNA from cleaving the donor and the modified porcine genome. The HDR vector also contains SphI and BspEI sites that can distinguish the HDR vector from the endogenous porcine genome near the sgRNA cleavage site. The HDR vector consists of approximately 1 kb homologous arms from porcine vWF and human A1 and adjacent domains, as well as inactivating mutations at the sgRNA cleavage sites to prevent the sgRNA from cleaving the donor and the modified porcine genome. The HDR vector also contains SphI and BspEI sites that can distinguish the HDR vector from the endogenous porcine genome near the sgRNA cleavage site. The HDR vector consists of approximately 1 kb homologous arms from porcine vWF and human A1 and adjacent domains, as well as inactivating mutations at the sgRNA cleavage sites to prevent the sgRNA from cleaving the donor and the modified porcine genome. The HDR vector also contains SphI and BspEI sites that can distinguish the HDR vector from the endogenous porcine genome near the sgRNA cleavage site. The HDR vector consists of approximately 1 kb homologous arms from porcine vWF and human A1 and adjacent domains, as well as inactivating mutations at the sgRNA cleavage sites to prevent the sgRNA from cleaving the donor and the modified porcine genome. The HDR vector also contains SphI and BspEI sites that can distinguish the HDR vector from the endogenous porcine genome near the sgRNA cleavage site.

[0114]

[0180] Porcine primary fibroblasts were transfected using the Neon Transfection System (Invitrogen) with 8 μg of Cas9, 1 μg of sgRNA1, and 1 μg of sgRNA2, and 10 μ Porcine primary fibroblasts were transfected using the Neon Transfection System (Invitrogen) with 8 μg of Cas9, 1 μg of sgRNA1, and 1 μg of sgRNA2, and 10 μ Transfected with the HDR vector of g. Two days after transfection, the cells were F Single cell subcloning was performed using ACS. Single cells were further cultured for an additional 12 days until the episomal form of the HDR vector was lost during cell division. The A1 and adjacent regions of hvWF were amplified using adjacent primers. The PCR product was subjected to sequential digestion with SphI and BspEI to add new SphI and BspEI sites to the PCR product having fragments of sizes 700 bp, 323 bp, and 258 bp after sequential digestion. Clones with HDR substitutions were screened (Figure 11). Complete allelic HDR excludes the 1281 bp wild-type product and any partial digestion products larger than 700 bp. Cells with allelic HDR were isolated from approximately 150 single cell colonies (Figure 11). As confirmed by sequencing, the alleles of the porcine A1 domain and adjacent regions were both replaced with their human counterparts (Figures 12A and 12B). The A1 domain is highlighted, while potential glycosylation sites in the adjacent region are labeled with dashes. Human-specific residues deleted in pvWF are labeled with bars, and the humanized A1 domain and adjacent regions are labeled with parentheses. These isolated cells can be expanded into cell lines and used to generate gene-modified pigs by SCNT. Cells expressing A1-humanized pvWF had a significantly reduced aggregation response to human platelets during the platelet activation assay (Figure 13). Briefly, cells were incubated with human platelets and aggregation was induced by shear stress. A1-humanized pvW

[0115]

[0181]

[0116]

[0182] ​​​​​​​​​​​​​​Cells expressing F showed a more gentle and inducible aggregation curve, while wild-type pvWF -expressing cells had a stronger aggregation response to human platelets. Thus, A1 Porcine organs with hvWF may induce a milder coagulation response in human blood compared to porcine organs expressing pvWF, and may improve the vascular incompatibility observed in xenotransplantation from pigs to humans.

[0117]

[0183] Together, these data indicate that substitution of the A1 domain and specific residues in one or more adjacent domains of endogenous porcine pvWF with the corresponding residues from the human counterpart (hvWF) can modulate the platelet aggregation response that occurs during xenotransplantation (Figure 9).

[0118] Example 6: Genomic deletion of porcine classical MHC I antigens that prevent

[0184] CD8+ T cell activation MHC class I molecules play an important role in the rejection of allografts through peptide presentation to CD8+ T cells. Here, we tested whether deletion of approximately 200 kb of the entire classical MHC class I locus in porcine primary fibroblasts prevented CD8+ T cell-mediated toxicity

[0185] in xenotransplantation. Classical MHC class I genes encode highly polymorphic proteins that are widely expressed on the cell surface. These present foreign peptides to CD8+ T lymphocytes, resulting in lysis of target cells. Also, mismatched MHC I molecules also act as antigens in transplantation. Various strategies for Using RNA, exon 4 of the conserved SLA-1, SLA-2, and SLA-3 molecules was knocked out (Reyes 2014). However, this exon is also shared by other classical and non- classical MHCI molecules, which may produce unanticipated off-target effects. Also, the remaining exons 1-3 can still be presented as cell surface antigens. In another attempt, the heterodimerization partner B2M was knocked out using TALEN (Wang 2016). This method can also affect non-classical MHCI molecules, and the remaining MHCI can still be presented as unstructured proteins on the cell surface. In the context of xenotransplantation, human HLA-E / B2M molecules are usually complemented in MHCI-deficient cells to prevent NK cell-mediated toxicity. Human B2M may form dimers with porcine SLA in B2M knockout pigs and restore its antigenicity.

[0120]

[0186] In this example, to specifically and completely remove classical MHCI antigens, an MHC classical class I cluster with unique flanking sequences in the porcine genome was first identified (Figure 14). This approximately 200 kb cluster contains all eight classical MHCI genes that do not have other protein-coding genes. Next, sgRNAs (sequence numbers 1-4) in the unique flanking regions were identified to induce a fragment deletion of the entire gene cluster. Since the frequency of the approximately 200 kb fragment deletion is relatively low, an enrichment strategy was also designed to isolate biallelic deletion clones.

[0121]

[0187] ​​​​​​​​​​​​​​Porcine primary fibroblasts were transfected with 1.25 μg of TrueCut Cas9 protein and 7.5 nmole of crRNA / tracrRNA duplex (Invitrogen) using the Neon transfection system (Invitrogen). Three days after transfection, genomic DNA was recovered from the transfected cells and subjected to PCR using the primer pairs indicated in Fig. 15A. Deletion mutations were detected using primers adjacent to the predicted deletion junctions. This PCR product was subcloned using topoisomerase-based cloning ("TOPO cloning"), and individual TOPO clones were sequenced by Sanger sequencing to confirm the sequence of the deletion junction. The sequences were aligned to the predicted junctions shown in Fig. 15B. At the same time, an aliquot of the cells was stained with a porcine-specific SLA-1 antibody. The portion of MHCI-negative cells is shown in Fig. 16.

[0122]

[0188] After single-cell subcloning, cells containing biallelic deletions can be used to generate classical MHCI knockout pigs via somatic cell nuclear transfer. The pigs are thought to be completely deficient in all classical MHCI molecules and proficient in non-classical MHCI molecules that may be involved in fertility and other physiological functions. The remaining B2M molecules are non-polymorphic and highly conserved with their human counterparts, so they are likely not antigenic. Also, exogenous expression of human HLA-E / B2M cannot rescue the deficiency of classical MHCI molecules. The resulting pigs should have the cleanest classical MHCI knockout background compared to previous reports.

[0123] Example 7: Generation of Immunologically Compatible Porcine Cells, Tissues, Organs, Pigs, and Progeny

[0189] Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities. Despite many attempts by other researchers to generate transgenic pigs for safe xenotransplantation, to date, the most advanced transgenic pigs for xenotransplantation have had a limited number of transgenes due to the complexity of the constructs and transcriptional interference between the transgenes. Here, several iterations of donor pigs were generated using a combination of KO, KI, and genomic replacement. Figure 21 outlines the progression of donor pig generation by sequential gene editing. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits included three knockouts and 12 transgene knock-ins designed to address immunological, coagulation, and species incompatibilities.

[0124]

[0190] Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. Using CRISPR-Cas9-mediated NHEJ, three major carbohydrate-producing glycosyltransferase / glycosylhydrolase genes, GGTA1, CMAH, and B4GALNT2, were functionally knocked out. Pre-formed antibodies that bind to wild-type porcine tissue are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as the main cause of the production of xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Therefore, loss of function of these genes was predicted to almost eliminate the binding of pre-formed anti-porcine antibodies to the endothelium of porcine grafts. This was confirmed by flow cytometry results showing a decrease in the binding of host antibodies to target Pig 2.0 (3KO + 12TG) fibroblasts. obtained (Figure 22). To demonstrate the reduction of antibody binding, genetically engineered porcine fibroblasts were pooled and incubated with pooled human sera, and the bound human IgM and IgG were detected with secondary anti-human antibodies and analyzed by flow cytometry. In contrast to wild-type porcine fibroblasts ( red contour plot), elimination of the three genes resulted in a significant reduction in antibody binding (green and brown contour plots, approximately 98% reduction).

[0125]

[0191] Twelve human transgenes (CD46, CD55, CD59, CD39, CD4 7, A20, PD-L1, HLA-E, B2M, THBD, TFPI, HO-1) were incorporated into a single multi-transgene cassette in the porcine genome via PiggyBAC transposon-mediated random integration to generate the first iteration of Pig 2.0 (3KO + 12TG) (Figures 17 - 20, 31, 47 - 49; see SEQ ID NOs: 212 - 214). The transgenes were placed in four different cistrons with the desired ubiquitous or tissue-specific promoters. The transgenes within each cistron were separated by ribosome-skipping 2A peptides to ensure expression at similar molar ratios. Additionally, combinations of cis elements such as ubiquitous chromatin opening elements (UCOE) were introduced to prevent transgene silencing, and insulators with strong polyadenylation sites and terminators were introduced to minimize interactions between transgenes and between transgenes and adjacent chromosomes.

[0126] Transgene expression levels and tissue-specific promoter-driven expression were determined using qPCR (Figure 23), and integration sites and copy numbers were determined using inverse PCR-based junction capture using

[0192] and (Figure 23), and integration sites and copy numbers were determined using inverse PCR-based junction capture and determined. As a proof of principle, all transgenes of adjacent cis - trons showed the desired tissue - specificity in fibroblast and endothelial cell lines without detectable transcriptional interference. Furthermore , all transgenes showed highly consistent expression levels across clones with various genomic integration positions, indicating that transgene expression is independent of chromosomal context . As expected, six genes containing complement regulatory genes (CD46, CD55, and CD59; EF1 α promoter) and B2M, HLA - E, and CD47 (CAG promoter), inserted under the control of ubiquitous promoters, were expressed in both fibroblasts and endothelial cells . In contrast, six genes (A20, PD - L1, HO1, THBD, TFPI, and CD39) expressed under the regulation of tissue - specific promoters (NeuroD or ICAM2) showed lower expression levels in fibroblasts compared to their expression in endothelial cells . Consistent with the qPCR data, cell - surface expression of proteins was observed to be expressed by the inserted human transgenes in porcine spleen cells and porcine fibroblasts (Figure 24). Briefly, Pig 2.0 (3KO + 12TG) spleen cells or fibroblasts were isolated and incubated with antibodies recognizing specific human proteins as shown , and stained cells were analyzed using flow cytometry. In each panel of Figure 24, the left peak represents cells stained with isotype control, and the right peak represents cells stained with specific antibody . .

[0127]

[0193] In pre - clinical experiments, transgene knock - ins were randomly integrated into the genome using PiggyBac transposase , with single copies integrated into intergenic regions and predictable Clones that do not have a viable outcome are used for pig production. For clinical development, homozygous female / male pigs are generated by biallelic site-specific transgene integration into a safe harbor (e.g., AAV S1 genomic locus) prior to large-scale breeding and production of the sourced donor pigs.

[0128]

[0194] Further in vitro evaluation of natural and adaptive immune cell functions and complement and coagulation cascades includes antibody reactivity profiling, mixed lymphocyte reaction, complement-dependent cytotoxicity, NK cell cytotoxicity, macrophage phagocytosis, and effects on coagulation factors and platelet aggregation.

[0129] are included.

[0129]

[0195] To maintain pig graft function and protect donor organs from complement-mediated toxicity, human complement regulatory proteins were overexpressed. Briefly, genetically engineered pig fibroblasts and pig splenocytes were incubated with 25% human complement for 1 hour. Cells were stained with propidium iodide and analyzed by flow cytometry to quantify cell death. Wild-type fibroblasts and splenocytes had the highest rates of cell death after culture with human complement. 4-7P and 4-7 H cells are derived from Pig 2.0 (3KO + 12TG) piglets, and 4-7F cells (3KO + 12TG) are derived from Pig 2.0 (3KO + 12TG) fetuses. 3-9 are three carbohydrate antigen-producing enzyme KOs, HLA-DQA KO, HLA-DRA KO, and human complement regulatory factor C3 KO. As shown in Figure 25, pig fibroblasts and splenocytes genetically engineered to express human CD46, CD55, and CD 59 had significantly lower levels of complement-mediated cell death compared to control human fibroblasts.

[0130]

[0196] Ligation of MHC I on target cells to killer inhibitory receptors (KIR) on natural killer (NK) cells inhibits killing of target cells via NK cells. Porcine MHC I cannot transmit signals via human NK KIR, so porcine cells are susceptible to NK cell-mediated target cell killing. To overcome NK-mediated cell death, human HLA-E, which ligates human NK KIR receptors, was overexpressed in porcine cells. 70% of WT porcine fibroblasts and K562 cells (a human MHC-deficient cell line) were targeted for killing by NK cells. As shown in Figure 26, human HLA-E + engineered porcine fibroblasts showed significantly lower NK-mediated cell killing. In contrast, HLA-E + porcine fibroblasts showed significantly lower killing by NK cells, suggesting that expression of HLA-E protects these cells from lysis.

[0131]

[0197] Overexpression of human CD55 in porcine cells reduces complement-mediated toxicity, which may reduce clotting and improve the survival of xenografts. Activation of clotting ultimately leads to the formation of thrombin, which is inactivated by binding to antithrombin in a stable thrombin-antithrombin (TAT) complex. Briefly, wild-type, CD55 KI+GGTA1-deficient cells, and human endothelial cells were cultured with human blood. As shown in Figure 27, human blood alone or human blood incubated with human endothelial cells for 60 minutes produced approximately 10 ng / mL of TAT protein. Furthermore, co-culture of human blood with wild-type porcine endothelial cells activated clotting and increased TAT complex formation to 58 ng / mL. In contrast, co-culture with CD55 KI+GGTA-deficient porcine endothelial cells resulted in TAT complex formation that was... resulted in a significant decrease in formation. These data suggest that human CD55 expression can modulate coagulation activation.

[0132]

[0198] Samples isolated from pigs genetically modified with Payload 9 or Payload 10 were subjected to RNAseq. From the results, increased expression of the payload immune-modifying transgene, namely the complement transgene, was shown along with cytotoxic genes (B2M, HLA-E, CD47) (Figure 36).

[0133] Example 8: Possibility of Enzymatic Cleavage to Prevent Antibody and Functional Binding in Xenotransplantation

[0199] Antibody-mediated rejection has historically been a major obstacle to the development of xenotransplantation as a viable treatment for end-stage organ failure. However, recent genetic advances have enabled the development of multiple gene knockout pigs lacking established xenogeneic antigen targets. Knockout of aGal, Neu5Gc, and SDa has been associated with improved graft survival. However, further research is needed to fully understand the impact of residual antibody binding to other xenogeneic antigen targets and whether removal of these antigens protects tissues from highly sensitized human sera. Here, we investigated whether xenogeneic antigen knockout reduces high PRA serum binding and whether enzymatic degradation reduces functional antibody binding.

[0134]

[0200] Human and porcine PBMCs were collected from peripheral blood using Ficoll separation. Porcine aortic endothelial cells (pAEC) were processed from WT pigs and the genetically modified Pig 2.0 (3KO + 12TG) of Example 7. From the HLA Laboratory of Massachusetts General Hospital, without Name-matched high and low PRA serum samples were generously provided. Serum was collected from xenograft recipients of the heart, liver, and kidney. Serum antibodies were enzymatically cleaved by IdeS (Genovis Inc.).

[0135]

[0201] Low PRA human serum shows minimal binding to human PBMC target cells, while high PR A human serum binds to the same human PBMC at high levels (Figure 43A). In contrast, both high PR A serum and low PRA serum bind strongly to porcine PBMC (Figure 43B). High PRA blood serum also shows significant binding to porcine aortic endothelial cells (pAEC). Genetic modification dramatically (>95%) reduces the binding of all human sera (Figure 44). Importantly, in vivo xenotransplantation experiments using heart, liver, and kidney xenografts from Pig 2. 0 (3KO + 12TG) demonstrate the isolation of antibody specific to the graft through the decrease in antibody binding from recipient sera collected after transplantation (Figure 45). These data suggest the presence of low levels of residual xenoantibodies. Figures 46A - 46C show that the IgG-specific protease, IdeS, effectively reduces the binding of functional IgG from human and cynomolgus monkey sera to background levels.

[0136]

[0202] Genetic modification that removes known xenoantigen targets reduces the binding of human and primate sera to porcine cells, but low levels of xenoantibody binding remain. High PRA serum and low PRA serum are similar, suggesting that the binding may not be related to HLA - SLA cross-reactivity. Treatment of sera from highly sensitized patients with IdeS resulted in negative cross-compatibility with Pig 2.0 (3KO + 12TG) cells. Antibodies with Other approaches to protecting the target are to use additional genetic modifications to prevent downstream sequelae such as complement activation and thrombosis. This data shows for the first time that enzymatic antibody cleavage can successfully reduce the functional binding of residual IgG, and suggests that this treatment may also be an approach to reducing the effects of preformed heterologous antibody binding.

[0137] Example 9: Generation of PERV-free immunocompatible porcine cells, tissues, organs, pigs, and progeny

[0203] Porcine organs are similar in size and function to human organs, and since pigs can be bred in large numbers, they are considered an advantageous resource for xenotransplantation. However, the potential risk of porcine endogenous retrovirus (PERV) transmission and immunological incompatibility have hindered the clinical use of porcine organs. PERV is a gamma-retrovirus found in the genomes of all pig strains. The pig genome contains several to dozens of copies of the PERV element (Lee 2011). Unlike other zoonotic pathogens, PERV is an essential part of the pig genome. Thus, they cannot be eliminated by biological safety breeding (Schuurman 2009). To date, no studies have shown PERV transmission to humans in the clinical setting, but PERV has been shown to be able to infect and proliferate in human cells via a "copy & paste" mechanism. In cell culture, virus particles can be released, infect human cells, and randomly integrate into the human genome, preferentially in intragenic regions and in regions of active chromatin remodeling (Armstrong 1971 , Moalic 2006, Niu 2017, Patience 1997). Also, both PERV-A and PERV-B have been shown to be able to infect human cells. PERV-C is ecotropic, but the recombinant virus type (A / C) shows the greatest infectivity. Furthermore, once PERV adapts to a new host genomic environment via elongation of the LTR sequence, its infectivity may increase. PERV can also horizontally transmit from infected human cells to other human cells that have never been in contact with porcine cells. In immunodeficient mice in vivo, it has been shown that PERV can transmit from porcine cells to mouse cells (Clemenceau 2002). PERV integration may lead to immunodeficiency and tumor formation, as reported for other retroviruses. Recent breakthroughs in genetic engineering have shown the complete inactivation of the entire PERV genome in immortalized porcine cell lines (Yang 2015; PCT Publication No. WO 2017 / 062723) and the production of PERV-free pigs (Niu 2017; PCT Publication No. WO 2018 / 195402). PERV can also horizontally transmit from infected human cells to other human cells that have never been in contact with porcine cells. In immunodeficient mice in vivo, it has been shown that PERV can transmit from porcine cells to mouse cells (Clemenceau 2002). PERV integration may lead to immunodeficiency and tumor formation, as reported for other retroviruses. Recent breakthroughs in genetic engineering have shown the complete inactivation of the entire PERV genome in immortalized porcine cell lines (Yang 2015; PCT Publication No. WO 2017 / 062723) and the production of PERV-free pigs (Niu 2017; PCT Publication No. WO 2018 / 195402). In immunodeficient mice in vivo, it has been shown that PERV can transmit from porcine cells to mouse cells (Clemenceau 2002). PERV integration may lead to immunodeficiency and tumor formation, as reported for other retroviruses. Recent breakthroughs in genetic engineering have shown the complete inactivation of the entire PERV genome in immortalized porcine cell lines (Yang 2015; PCT Publication No. WO 2017 / 062723) and the production of PERV-free pigs (Niu 2017; PCT Publication No. WO 2018 / 195402). PERV integration may lead to immunodeficiency and tumor formation, as reported for other retroviruses. Recent breakthroughs in genetic engineering have shown the complete inactivation of the entire PERV genome in immortalized porcine cell lines (Yang 2015; PCT Publication No. WO 2017 / 062723) and the production of PERV-free pigs (Niu 2017; PCT Publication No. WO 2018 / 195402). Recent breakthroughs in genetic engineering have shown the complete inactivation of the entire PERV genome in immortalized porcine cell lines (Yang 2015; PCT Publication No. WO 2017 / 062723) and the production of PERV-free pigs (Niu 2017; PCT Publication No. WO 2018 / 195402).

[0138] Using CRISPR-Cas9 technology, the complete elimination of all 62 copies of the PERV element from the PK15 porcine kidney epithelial cell genome (Yang 2015), and all 25 copies from porcine fetal fibroblasts, and the subsequent production of live pigs with all PERV elements inactivated (Niu 2017) have been achieved. This success now indicates that it is possible to derive PERV-free pigs, which may provide a safe donor pool for xenotransplantation.

[0139]

[0139]

[0204] Using CRISPR-Cas9 technology, the complete elimination of all 62 copies of the PERV element from the PK15 porcine kidney epithelial cell genome (Yang 2015), and all 25 copies from porcine fetal fibroblasts, and the subsequent production of live pigs with all PERV elements inactivated (Niu 2017) have been achieved. This success now indicates that it is possible to derive PERV-free pigs, which may provide a safe donor pool for xenotransplantation.

[0139] (Niu 2017) have been achieved. This success now indicates that it is possible to derive PERV-free pigs, which may provide a safe donor pool for xenotransplantation. This success now indicates that it is possible to derive PERV-free pigs, which may provide a safe donor pool for xenotransplantation.

[0139]

[0139]

[0205] To determine whether PERV is still active and spreading in human cells, PERV copy numbers were monitored for over four months in both populations and clones of PERV-infected HEK293T-GFP cells (iHEK293T-GFP). As measured by ddPCR (Pinheiro 2012), PERV copy numbers were observed to increase over time. Both populations and clones of PERV-infected HEK293T-GFP cells (iHEK293T-GFP) were monitored for over four months for PERV copy numbers. As measured by ddPCR (Pinheiro 2012), PERV copy numbers were observed to increase over time. As measured by ddPCR (Pinheiro 2012), PERV copy numbers were observed to increase over time. As measured by ddPCR (Pinheiro 2012), PERV copy numbers were observed to increase over time.

[0140]

[0206] Studies are underway to determine whether disrupting all copies of PERV pol in the pig genome can eliminate in vitro transmission of PERV from pigs to human cells (Niu 2017). Reverse transcriptase activity could not be detected in the cell culture supernatants of highly engineered PERV fetal fibroblast clones, suggesting that even if the modified cells produced PERV particles, it was minimal. PK15 clones targeting over 97% of PERV pol showed a maximum 1000-fold decrease in PERV infection similar to background levels. These results were confirmed by PCR amplification of serial dilutions of human embryonic kidney 293 (HEK293) cells with a history of contact with PK15 clones. Total RNA isolated from various tissues of pigs confirmed approximately 100% PERV inactivation at the mRNA level. Studies are underway to determine whether disrupting all copies of PERV pol in the pig genome can eliminate in vitro transmission of PERV from pigs to human cells (Niu 2017). Reverse transcriptase activity could not be detected in the cell culture supernatants of highly engineered PERV fetal fibroblast clones, suggesting that even if the modified cells produced PERV particles, it was minimal. Reverse transcriptase activity could not be detected in the cell culture supernatants of highly engineered PERV fetal fibroblast clones, suggesting that even if the modified cells produced PERV particles, it was minimal. Reverse transcriptase activity could not be detected in the cell culture supernatants of highly engineered PERV fetal fibroblast clones, suggesting that even if the modified cells produced PERV particles, it was minimal. PK15 clones targeting over 97% of PERV pol showed a maximum 1000-fold decrease in PERV infection similar to background levels. PK15 clones targeting over 97% of PERV pol showed a maximum 1000-fold decrease in PERV infection similar to background levels. These results were confirmed by PCR amplification of serial dilutions of human embryonic kidney 293 (HEK293) cells with a history of contact with PK15 clones. Total RNA isolated from various tissues of pigs confirmed approximately 100% PERV inactivation at the mRNA level. Total RNA isolated from various tissues of pigs confirmed approximately 100% PERV inactivation at the mRNA level.

[0141]

[0207] To date, multiple clones with 100% PERV KO from Yorkshire breed have been generated and pig cloning is underway. PERV-inactivated pig production is robust, with 63 PERV-inactivated piglets produced, 47 of which are female and 16 are male. To date, the oldest healthy animals have survived for two years. 43 To date, multiple clones with 100% PERV KO from Yorkshire breed have been generated and pig cloning is underway. PERV-inactivated pig production is robust, with 63 PERV-inactivated piglets produced, 47 of which are female and 16 are male. To date, the oldest healthy animals have survived for two years. 43 PERV-inactivated pigs are currently aging for breeding. Cells used for pig cloning In line with the normal karyotype of, no abnormal chromosomal structural changes were detected in PERV-inactivated pigs are present.

[0142]

[0208] Long-term studies are being conducted to monitor the effects of PERV inactivation and gene editing on large animals This technology has been applied to additional pig lines, including the Yorkshire and Yucatan pig lines in the United States (Yorkshire) and Yucatan (Yucatan). Source Donor pigs will have all PERV elements inactivated and be genetically engineered in the background line will be.

[0143]

[0209] Repeated versions of PERV-free and immunologically compatible pigs. Donor pigs that do not carry active PERV in their genomes, as well as pigs with enhanced immune, inflammatory, and coagulation systems that are compatible with human tissues, are being genetically engineered For the former, all functions of PERV in the pig genome have been eradicated using CRISPR-Cas9 engineering to disrupt the catalytic domain of the reverse transcriptase gene (pol ) in the PERV element (using the methods described in Niu 2017 and WIPO Publication No. WO 2018 / 195402), as well as knockouts ( KO), knock-ins (KI), and combinations of genome substitutions to provide human tissue-compatible organs. For the latter, ) of three of the major xeno-carbohydrate antigen-producing genes / enzymes that induce humoral rejection, GGTA 1, CMAH, and β1,4-N-acetylgalactosaminyltransferase 2 (B4 ) are used. KO), knock-ins (KI), and combinations of genome substitutions to provide human tissue-compatible organs. For the latter, Of the three major xeno-carbohydrate antigen-producing genes / enzymes that induce humoral rejection, GGTA 1, CMAH, and β1,4-N-acetylgalactosaminyltransferase 2 (B4 Pigs in which GALNT2 was genetically inactivated were generated as described herein. Loss of function of these genes was intended to substantially eliminate the binding of preformed anti-pig antibodies to the endothelium of pig grafts. Furthermore, for example, important immunomodulatory factors were inserted into a single locus within the PERV-free pig genome to regulate the human complement system (hCD46, hCD55, and hCD59), the coagulation system (e.g., hCD39, hTHBD, and hTFPI), the inflammatory response (e.g., hA-20, hCD47, and hHO-1), and NK (e.g., PD -L1) and T cell responses (e.g., hHLA-E, hB2M). These humanized genes were knocked in using single-copy polycistronic transgene integration via translocation.

[0144] Pigs that do not contain PERV and have an immunocompatible payload can be generated, and this pig was intended to have various desired properties. Towards this goal, donor pigs were created through several iterations of genetic modification. Figure 21 outlines the progress of donor pig generation by sequential gene editing. In the first iteration, Pig 1.0, porcine fibroblasts were genetically engineered using CRISPR-Cas9-mediated non-homologous end joining (NHEJ) such that all PERV copies were either functionally deleted from the genome or inactivated within the genome. Pig 2.0 was generated by combining the random integration of up to 12 transgenes or knock-ins selected from CD46, CD55, C D59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD

[0210] -L1, and HO-1, which modify various components of the xenogeneic immune response, with the random integration of Piggy BAC into the porcine genome to modify three major xeno-carbohydrates Figure 21 outlines the progress of donor pig generation by sequential gene editing. In the first iteration, Pig 1.0, porcine fibroblasts were genetically engineered using CRISPR-Cas9-mediated non-homologous end joining (NHEJ) such that all PERV copies were either functionally deleted from the genome or inactivated within the genome. Pig 2.0 was generated by combining the random integration of up to 12 transgenes or knock-ins selected from CD46, CD55, C D59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD -L1, and HO-1, which modify various components of the xenogeneic immune response, with the random integration of Piggy BAC into the porcine genome to modify three major xeno-carbohydrates D59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD -L1, and HO-1, which modify various components of the xenogeneic immune response, with the random integration of Piggy BAC into the porcine genome to modify three major xeno-carbohydrates To delete the antigen-producing genes (3KO; GGTA1, B4GALNT2, CMAH) it was generated by NHEJ via CRISPR. Regarding the Pig 3.0 repeat, subsequently, source donor pigs carrying 3KO and up to 12 specific transgenes on a PERV-free background were generated. The next generation of source donor pigs (Pig 3.1, 3.2 etc.) will likely be genetically engineered to carry additional modifications such as humanization of the vWF gene and deletion of the asialoglycoprotein receptor 1 (ASGR1) and the endogenous B2M gene.

[0145]

[0211] After genetically engineering PERV-free 3KO+TG pigs (Pig 3.0, Figure 21), these pigs were crossed to produce pig offspring and / or drift, drove ), littermates, and / or sounder.

[0146]

[0212] Cell engineering and SCNT for producing Pig 3.0 incorporating immunocompatibility payload, xenoantigen disruption, and PERV disruption

[0213] For the production of PERV-free Pig 3.0, Pig 2.0 (3KO+9TG) with xenocompatibility modifications was first produced. Pig 2.0 (3KO+9TG) contained the transgenes hCD46, hCD55, hCD59, hB2M, hHLA-E, hCD 47, hTHBD, hTFPI, and hCD39. To generate donor cells for somatic cell nuclear transfer (SCNT) to produce Pig 2.0, wild-type porcine ear fibroblasts were first electroporated with both of the following: a) GGTA, CMAH, and B4 GALNT2-specific guide RNAs and b) a plasmid expressing Cas9 nuclease ​CRISPR-Cas9 reagents targeting the GALNT2 gene; and b) (i) Pigg yBac transposase cassette (ii) A gene transfer construct consisting of nine human transgenes (hCD46, hCD55, hCD59, hB2M, hHLA-E organized into three expressible cistrons hCD47, hTHBD, hTFPI, and hCD39) (see Figure 51). Single cell clones of fibroblasts were generated and screened by a) fragment analysis / whole genome sequencing (see Figure 51C) and b) conventional PCR (see Figure 51D) to identify clones with the desired genomic modifications . Subsequently, clones with the desired modifications were used as donors to generate Pi g 2.0 by SCNT .

[0147]

[0214] Cells isolated from Pig 2.0 (3KO + 9TG) were used to generate cells with xenocompatibility modifications that are also PERV-free using PERV engineering with the CRISPR-Cas9 system . Pig 2.0 fibroblasts were electroporated with a CRISPR-C as9 reagent targeting the reverse transcriptase (Pol) gene common to all genomic copies of the PERV element . Single cell clones of the electroporated cells were generated and these clones were screened by deep sequencing to identify clones in which the catalytic core of the Pol gene was disrupted (see Figure 51C) . Subsequently, clones with the desired disruption in Pol were subjected to karyotype analysis (see Figure 51E); then, clones with a normal karyotype were used in SCNT to generate Pig 3.0 (3KO + 9TG) embryos and pigs .

[0148]

[0215] ​​​​​Genomic, biochemical and phenotypic characterization of Pig 3.0

[0216] A) Assessment of transgene and knockout integrity

[0217] Having created Pig 3.0 (3KO+9TG), the inventors then We seek to closely examine the on-target and off-target effects of gene modifications in this study. To this end, the present inventors used WT fibroblasts and the Pig 2 10X Whole Genome Sequencing (WGS) for Pig 3.0 and Pig 3.0 fibroblasts In line with the deep sequencing performed for screening, S contains the genomic copies of the PERV pol and GGTA / B4GALNT2 / CMAH genes. Any mutations introduced into the gene are translated into a functional knockout of the modified gene copy. The results confirmed that the predicted frameshift insertion or deletion was the same as that in the control (Figures 51A and 51B). Furthermore, the present inventors confirmed the presence of all nine transgenes in the pig genome. We confirmed, and surprisingly, that the transgene constructs were GG at the CRISPR-Cas9 target site. It was found to be integrated into one of the TA1 alleles.

[0149]

[0218] Regarding potentially confounding off-target effects of CRISPR editing, the inventors They found that there were artifacts that were expected to interfere with the function of the editing that we wanted, or Observe artifacts that may be expected to interfere with the expected detrimental effects on pig health. We did not find any differences between WT and Pig 2.0 (3KO+9TG) or between Pi Structural mutations between g 2.0 (3KO+9TG) and Pig 3.0 (3KO+9TG) The difference was not observed, indicating the overall genomic stability of these pigs. For smaller genomic changes such as small indels, the inventors examined all 1,211 predicted off-target sites of the guide RNAs used and found two small insertions at the B4GALNT2 gRNA off-target sites of Pig 2.0 compared to WT; however, neither affected the protein coding sequence. Furthermore, when the inventors compared Pig 3.0 cells with Pig 2.0 cells, no additional genomic alterations were observed as expected. The inventors identified only two deletions and one insertion within two PERV gRNA off-target sites, both of which occurred outside the protein coding region and may actually represent somatic mutations (see Kim 2014). Without functional significance and considering the normal pathophysiological data of most of the inventors' pigs, the inventors concluded that the selected Pig 3.0 maintains genomic stability. For smaller genomic changes such as smaller indels, the inventors examined all 1,211 predicted off-target sites of the guide RNAs used. and found two small insertions at the B4GALNT2 gRNA off-target sites of Pig 2.0 compared to WT; however, neither affected the protein coding sequence. Furthermore, when the inventors compared Pig 3.0 cells with Pig 2.0 cells, no additional genomic alterations were observed as expected. The inventors identified only two deletions and one insertion within two PERV gRNA off-target sites, both of which occurred outside the protein coding region and may actually represent somatic mutations (see Kim 2014). Without functional significance and considering the normal pathophysiological data of most of the inventors' pigs, the inventors concluded that the selected Pig 3.0 maintains genomic stability.

[0150] Since genomic modifications were confirmed at the DNA level, the inventors further examined whether Pig 3.0 (3KO + 9TG) has appropriate triple knockout and 9TG expression using RNA expression and immunoassay methods. The inventors first performed RNA-seq and found that both Pig 2.0 and Pig 3.0 express all transgenes at levels equivalent to those from human umbilical vein endothelial cells (HUVEC) (Figure 52A). Furthermore, the inventors observed equivalent transgene expression profiles and levels in both porcine umbilical vein endothelial cells (PUVEC) and fibroblasts, indicating that the transgenes are expressed equivalently between these cell types.

[0150]

[0219] Since genomic modifications were confirmed at the DNA level, the inventors further examined whether Pig 3.0 (3KO + 9TG) has appropriate triple knockout and 9TG expression using RNA expression and immunoassay methods. The inventors first performed RNA-seq and found that both Pig 2.0 and Pig 3.0 express all transgenes at levels equivalent to those from human umbilical vein endothelial cells (HUVEC) (Figure 52A). Furthermore, the inventors observed equivalent transgene expression profiles and levels in both porcine umbilical vein endothelial cells (PUVEC) and fibroblasts, indicating that the transgenes are expressed equivalently between these cell types. The inventors first performed RNA-seq and found that both Pig 2.0 and Pig 3.0 express all transgenes at levels equivalent to those from human umbilical vein endothelial cells (HUVEC) (Figure 52A). Furthermore, the inventors observed equivalent transgene expression profiles and levels in both porcine umbilical vein endothelial cells (PUVEC) and fibroblasts, indicating that the transgenes are expressed equivalently between these cell types. ) Furthermore, the inventors observed equivalent transgene expression profiles and levels in both porcine umbilical vein endothelial cells (PUVEC) and fibroblasts, indicating that the transgenes are expressed equivalently between these cell types. suggested ubiquitous expression. Next, the inventors examined the characteristics of protein expression in genetically engineered pigs. The inventors observed a decrease in the glycan markers of α-Gal, Neu5GC, and SDa on the cell surface, which suggests the functional elimination of three genes (GGTA, CMAH, and B4GALNT2, respectively) involved in the synthesis of these glycan epitopes in both Pig 2.0 cells (3KO + 9T G) and Pig 3.0 cells (Figure 52B). By FACS analysis of PUVEC, the inventors found that both Pig 2.0 and Pig 3.0 express all the transgenes at the protein level. Indeed, 8 out of 9 transgenes are strongly and firmly expressed at levels comparable to those in HUVEC. Interestingly, THBD expression is detectable but at a much lower level. Consistent with the FACS analysis, IHC studies showed that Pig 3.0 kidneys lack the three gly can antigens (Figure 52C). Also consistent with the FACS staining, the inventors detected the expression of 8 transgenes in Pig 3.0 kidneys, excluding THBD (Figure 52C). In summary, the inventors concluded from the RNA expression and immunoassay data that their triple knockout and 9TG genetic modifications led to successful RNA and protein expression at the cell and tissue levels in genetically engineered pigs. (Figure 52C). In summary, the inventors concluded from the RNA expression and immunoassay data that their triple knockout and 9TG genetic modifications led to successful RNA and protein expression at the cell and tissue levels in genetically engineered pigs. B) Evaluation of the characteristics of xenocompatibility of Pig 3.0 cells Next, the inventors examined whether the genome-modified pigs had acquired xenocompatibility functions. The inventors first determined that the modified pig cells avoid pre-formed human antibody binding (Figure 52C). Also consistent with the FACS staining, the inventors detected the expression of 8 transgenes in Pig 3.0 kidneys, excluding THBD (Figure 52C). In summary, the inventors concluded from the RNA expression and immunoassay data that their triple knockout and 9TG genetic modifications led to successful RNA and protein expression at the cell and tissue levels in genetically engineered pigs. (Figure 52C). In summary, the inventors concluded from the RNA expression and immunoassay data that their triple knockout and 9TG genetic modifications led to successful RNA and protein expression at the cell and tissue levels in genetically engineered pigs.

[0151]

[0220] B) Evaluation of the characteristics of xenocompatibility of Pig 3.0 cells

[0221] Next, the inventors examined whether the genome-modified pigs had acquired xenocompatibility functions. The inventors first determined that the modified pig cells avoid pre-formed human antibody binding (Figure 52C). In summary, the inventors concluded from the RNA expression and immunoassay data that their triple knockout and 9TG genetic modifications led to successful RNA and protein expression at the cell and tissue levels in genetically engineered pigs. Tested whether gene modification was possible. Pig 2.0 and Pig 3.0 PU VEC showed a reduction exceeding 90% in antibody binding to human IgG and IgM compared to WT PUVEC, indicating that the antibody barrier to xenotransplantation can be significantly reduced by 3KO (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation (Figure 53A). Furthermore, when incubated with human complement derived from pooled human sera, Pig 3.0 PUVECs with triple knockout expressing human complement regulators CD46, CD55, and CD59 showed minimal in vitro human complement toxicity similar to their human HUVEC counterparts (Figure 53B). In summary, these results suggest that Pig 3.0-derived xenografts are expected to be less susceptible to humoral injury and hyperacute rejection as a result of significantly reduced antibody binding and complement activation upon transplantation

[0152]

[0222] Furthermore, the inventors examined whether Pig 3.0 is more resistant to damage mediated by human natural cellular immunity. When subjected to ex vivo assays, Pig 3.0 expressing HLA-E / B2M showed significantly stronger resistance to NK-mediated cell killing compared to that of WT PUVEC (Figure 53C). In summary, these results suggest that upon transplantation, Pig 3.0 cells are expected to be more resistant to attack by human natural immunity (Figure 53C). In summary, these results suggest that upon transplantation, Pig 3.0 cells are expected to be more resistant to attack by human natural immunity (Figure 53C). In summary, these results suggest that upon transplantation, Pig 3.0 cells are expected to be more resistant to attack by human natural immunity (Figure 53C). In summary, these results suggest that upon transplantation, Pig 3.0 cells are expected to be more resistant to attack by human natural immunity (Figure 53C). In summary, these results suggest that upon transplantation, Pig 3.0 cells are expected to be more resistant to attack by human natural immunity

[0153]

[0223] Finally, the inventors examined whether Pig 3.0 (3KO + 9TG) can attenuate platelet activation and coagulation cascade dysregulation frequently observed in xenotransplantation (Figure 53C). In summary, these results suggest that upon transplantation, Pig 3.0 cells are expected to be more resistant to attack by human natural immunity done. When the neovascularized WT pig organs are transplanted into humans, pre-formed antibodies, complement, and natural immune cells can induce endothelial cell activation and trigger coagulation and inflammation. From porcine endothelial cells The incompatibility between the coagulation regulators and human blood leads to abnormal platelet activation and thrombin formation, causing damage to worsen. Furthermore, the molecular incompatibility of coagulation regulators (e.g., tissue factor pathway inhibitor , TFPI) between pigs and humans renders extrinsic coagulation regulation ineffective.

[0154]

[0224] To address these xenogeneic coagulation problems, the inventors, as part of their multi-transgene construct for Pig 3.0, overexpressed both of the following in Pig 3.0: a) human CD39 (an ADP hydrolase that abrogates the thrombotic effect of ADP in the coagulation cascade) and b) human TFPI (a factor that translocates to the cell surface after endothelial cell activation). Next, the inventors performed various in vitro and ex vivo assays to verify the ability of these transgenes to function correctly and regulate the coagulation pathway when transplanted into porcine cells. The in vitro ADPase biochemical assay showed significantly higher CD39 activity in Pig 3.0 PUVEC compared to WT PUVEC and HUVEC, consistent with its higher mRNA and protein expression from the transgene (Figure 53F). Similarly, activated Pig 3.0 PUVEC showed the ability to effectively bind to and neutralize human X a, which can reduce coagulation and decrease the formation of the thrombin-antithrombin (TAT) complex (Figure 53G). Finally, an ex vivo coagulation assay using human whole blood co-cultured with Pig 3.0 PUVEC was performed. The in vitro ADPase biochemical assay showed significantly higher CD39 activity in Pig 3.0 PUVEC compared to WT PUVEC and HUVEC, consistent with its higher mRNA and protein expression from the transgene (Figure 53F). Similarly, activated Pig 3.0 PUVEC showed the ability to effectively bind to and neutralize human X a, which can reduce coagulation and decrease the formation of the thrombin-antithrombin (TAT) complex (Figure 53G). Finally, an ex vivo coagulation assay using human whole blood co-cultured with Pig 3.0 PUVEC showed the ability to effectively bind to and neutralize human X a, which can reduce coagulation and decrease the formation of the thrombin-antithrombin (TAT) complex (Figure 53G). Finally, an ex vivo coagulation assay using human whole blood co-cultured with Pig 3.0 PUVEC showed the ability to effectively bind to and neutralize human X In this case, the least amount of TAT (thrombin - antithrombin) is formed, and the level of TAT formation is similar to that of HUVEC (Figure 53E), suggesting that Pig 3.0 has acquired enhanced coagulability with human factors.

[0155]

[0225] In summary, from the results of these xenocompatibility experiments, as is clear from the attenuation of human antibody binding, complement toxicity, NK cell toxicity, phagocytosis, and the restoration of coagulation regulation, Pig 3.0 (3 KO + 9TG) was shown to have acquired enhanced compatibility with the human immune system.

[0156]

[0226] C) Physiological phenotype / Proof - of - concept pigs of Pig 3.0 ancestors

[0227] To evaluate the overall fitness of the genetically engineered pigs, the inventors examined the physiology, fertility, and transmission of the genetic modification to the offspring of the genetically engineered pigs. The inventors extensively engineered on PERV elements, immune pathways, and coagulation pathways, but both Pig 1.0 and 2.0 (3KO + 9TG) were observed to show normal blood cell counts including total white blood cells and platelets, monocytes, neutrophils, and eosinophils (Figure 54A). The inventors also observed normal organ functions (liver, kidney, and heart) in the engineered pigs (Figure 54B, 54C, and 54D). Furthermore, the engineered pigs had similar prothrombin and thrombin times compared to WT pigs (Figure 54E).

[0157]

[0228] Furthermore, the inventors found that Pig 1.0 and 2.0 are fertile and produce 7 normal average litter sizes. The offspring of Pig 1.0 breeding with WT pigs carry approximately 50% PERV - inactivated alleles in their liver, kidney, and heart tissues and , This indicates that the PERV-KO allele is stably inherited according to Mendelian genetics (Figure 55). Similarly, all offspring of Pig 2.0 and WT pigs were heterozygous for 3KO (Figure 56A), approximately half had 9TG, and expression was confirmed at both the mRNA (Figure 56B) and protein levels (Figure 56C). This suggests that the genetic modification has not been eliminated by normal breeding. Therefore, the inventors conclude that the genetically engineered pigs exhibit normal physiology, fertility, and germline transmission of the edited allele.

[0158]

[0229] D) Conclusion

[0230] Genetically engineered pigs are very promising in addressing the unresolved need for organ shortage. In this report, the inventors engineered Pig 3.0 (3KO + 9TG) with 42 genomic loci modified to eliminate PERV activity and enhance human immunocompatibility . Extensive analysis of Pig 3.0 showed that the engineered pig cells exhibited reduced human antibody binding, complement toxicity, NK cell toxicity, and coagulation dysregulation. The inventors also examined and verified the normal pathophysiology, fertility, and heredity of their genetically engineered pigs . The success of generating Pig 3.0 enhances the ability to provide safe and effective organs for clinical transplantation .

[0159]

[0231] The success of generating Pig 3.0 (3KO + 9TG) demonstrates the power of synthetic biology to extensively manipulate the genome and confer new functions to large animals. In Pig 3.0, the inventors deleted 25 copies of the PERV element and 8 alleles of the heterologous gene . , nine human transgenes were simultaneously expressed to physiologically appropriate levels. This extends the record of genomic modification in large animal models to 42. With the ability to perform complex genetic engineering on this scale, the inventors are in a position to manipulate additional edits and ultimately select pigs in a combination most suitable for xenotransplantation. Furthermore, the inventors believe they can further manipulate Pig 3.0 using tools to achieve additional novel functions such as immune tolerance, organ lifespan, and viral immunity.

[0160] E) Method

[0161]

[0160]

[0232] E) Method

[0233] CRISPR-Cas9 gRNA Design

[0234] The inventors used the R library DECIPHER to design specific gRNAs (PERV- 3N: 5’-TCTGGCGGGAGCCACCAAAC-3’, PERV-5N: 5’ -GGCTTCGTCAAAGATGGTCG-3’, PERV-9N: 5’-TTCT AAGCAGTCCTGTTTGG-3’) to specifically target all pol catalytic sequences in the Pig 2.0 genome. Furthermore, the inventors used specific gRNAs (GGTA1: 5’-GCTGCTTGTCTCAACTGTAA-3’, CM AH: 5’-GAAGCTGCCAATCTCAAGGA-3’, B4GALTN2: 5 ’GATGCCCGAAGGCGTCACAT-3’) to target GGTA1, CMAH and B4GALNT2 respectively.

[0161]

[0161]

[0235] Cell Culture

[0236] Porcine fetal fibroblasts and fibroblast FFF3 were cultured in 15% fetal bovine serum (Invitr ogen), 1% penicillin / streptomycin (Pen / Strep, Invitrogen), and sodium pyruvate supplemented with 1% HEPES (Thermo Fisher Scientific) was maintained in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen) high glucose. All cells were maintained in a humidified tri-gas incubator at 38 °C, 5% CO2, 90% N2, and 5% O2.

[0162]

[0237] Porcine umbilical vein endothelial cells (PUVEC) were freshly isolated from umbilical veins and cultured in PriGrow II medium (abm) supplemented with 10% fetal bovine serum (Gibco), 1% penicillin / streptomycin (Pen / Strep, Invitrogen), and 1% HEPES (Thermo Fisher Scientific). Human umbilical vein endothelial cells (HUVEC, ATCC, PCS-100-010) were cultured in vascular cell basal medium (ATCC) supplemented with Endothelial Cell Growth Kit-BBE (ECG kit, ATCC). The human NK-92 cell line was cultured in Minimum Essential Medium Alpha (α-MEM, Gibco) supplemented with 12.5% fetal bovine serum (Gibco), 12.5% fetal horse serum (FES, Solarbio), and 1% penicillin / streptomycin (Pen / Strep, Invitrogen). The human macrophage cell line THP-1 was cultured in RPMI 1640 (BI) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin / streptomycin (Pen / Strep, Invitrogen). Differentiation of THP-1 cells itrogen) and 1% HEPES (Thermo Fisher Scientific). 0-010) in vitrogen). Differentiation of THP-1 cells Differentiation was achieved in 62.5 nM phorbol-12-myristate-13-acetate (PMA , Sigma) for 3 days and was confirmed by the attachment of these cells to tissue culture plastic .

[0163]

[0238] Construction of PiggyBac-Cas9 / 2gRNA and establishment of cell lines

[0239] Similar to the previously described procedure (Yang 2015), the inventors synthesized a DNA fragment encoding U6 -gRNA1-U6-gRNA2 (Genewiz) and incorporated it into the previously constructed PiggyBac-cas9 plasmid. To establish the FFF3 cell line with PiggyBac-Cas9 / 2gRNA integration, the inventors used the Neon transfection system and transfected 5×105 FFF3 cells with 14.3 μg of PiggyBac-C as9 / 2gRNA plasmid and 5.7 μg of Super PiggyBac Transposase plasmid (System Biosciences) according to the instructions provided by the vendor (Thermo Fisher Scientific). To select cells with the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control in which the inventors applied puromycin to wild-type FF3 cells, the inventors determined that puromycin selection was completed in 4 days. Subsequently, the FFF3-PiggyBac cell line was maintained in 2 μg / mL puromycin and 2 μg / ml doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF 3-PiggyBac cell line for 1 week . .

[0164] ​​​​​

[0240] To avoid constitutive Cas9 expression in the FFF3 cell line, the inventors , transfected 5 × 105 cells with 3 μg of PiggyBac Excision-On ly Transposase vector using Lipofectamine 2000 reagent, thereby performing PiggyBac-Cas9 / 2gRNA excision from the FFF3 genome. Next, the PiggyBac-Cas9 / 2gRNA-excised FF3 cells were single-cell sorted into 96-well plates for clonal expansion and genotyping.

[0165]

[0241] Genotyping of single cells and single cell clones

[0242] First, for the FFF3-PiggyBac-Cas9 / 2gRNA cell line, puromycin selection and subsequent PiggyBac excision were performed. Then, the cells were single-cell sorted into both 96-well PCR plates for direct genotyping and 96-well cell culture plates for colony expansion. To perform genotyping of single FF cells without clonal expansion, the inventors directly amplified the PERV locus from the sorted single cells. The inventors also performed genotyping on clones grown from the sorted single cells. The genotyping procedure followed the method of Yang et al. (6). Briefly, the inventors placed single cells into 96-well PCR plates having 5 μl of lysis mixture containing 0.5 μl of 10× KAPA expression extraction buffer (KAPA Biosystems), 0.1 μl of 1 U / μl of KAPA Express Extract Enzyme, and 4.4 μl of water. The inventors incubated the lysis reaction at 75 °C for 15 minutes and the reaction at 95 °C for 5 Inactivated. Then, all the reactants were added to a 20 μl PCR reaction containing 1×KAPA 2G fast (KAPA Biosystems) and 0 .2 μM PERV Illumina primer (Method Table 2). The reaction was incubated at 95°C for 3 minutes, followed by 30 cycles at 95°C (for single cells) or 25 cycles (for single cell clones), 20 seconds; 59°C, 20 seconds and 72°C, 10 seconds. To add the Illumina sequencing adapter, 3 μl of the reaction product was then added to a 20 μl PCR mix containing 1×KAPA 2G fast (KAPA Biosystems) and 0.3 μM primer with the Illumina sequencing adapter . The reaction was incubated at 95°C for 3 minutes, followed by 20 (for single cells) or 10 (for single cell clones) cycles at 95°C, 20 seconds; 59°C, 20 seconds and 72°C, 10 seconds. The PCR products were tested on a 2% EX gel (Invitrogen), and then approximately 360 bp of the target product was recovered from the gel. These products were then mixed in approximately equal amounts and purified (QIAquick Gel Extraction Kit) and sequenced on a MiSeq Personal Sequencer (Illumina). The inventors then analyzed the deep sequencing data and determined the PERV editing efficiency using CRISPR-GA (5). The primers used for PERV pol genotyping Illumina_PERV_pol forward: 5’-ACACTCTTT CCCTACACGACGCTCTTCCGATCTCGACTGCCCCAAGGGT TCAA-3’

[0166]

[0243]

[0244] ​

[0245] Illumina_PERV_pol reverse: 5’-GTGACTGGAG TTCAGACGTGTGCTCTTCCGATCTTCTCTCCTGCAAATCT GGGCC-3’

[0167]

[0246] Somatic cell microinjection for generating SCNT embryos and embryo transfer for porcine cloning

[0247] The somatic cell microinjection procedure was by Wei et al. All animal experiments were conducted with the approval of the Animal Care Committee of Yunnan Agricultural University, China. All chemicals were purchased from Sigma Chemical Co. (St. Louis, MO , USA), unless otherwise specified. Porcine ovaries were collected from Hongteng Abattoir (Chenggong Ruide Food Co, Ltd , Kunming, Yunnan Province, China). The ovaries were transferred to the laboratory at 25°C - 30°C in 0.9% (w / v) NaCl solution supplemented with 75 mg / mL potassium penicillin G and 50 mg / mL streptomycin sulfate. Cumulus cell-oocyte complexes (C OC) were isolated from follicles 3 - 6 mm in diameter and then cultured in 200 μL of TCM-199 medium supplemented with 0.1 mg / mL pyruvate, 0. 1 mg / mL L-cysteine hydrochloride hydrate, 10 ng / mL epidermal growth factor, 10% (v / v) porcine follicular fluid, 75 mg / mL potassium penicillin G, 50 mg / mL strept omycin, and 10 IU / mL of eCG and hCG (Teikoku Zoki Co., Ltd., Tokyo, Japan ) in a 5% CO2 humidified atmosphere at 38. ) Cultured at 5°C (APC30D, ASTEC, Japan). After 38 - 42 hours of in vitro o maturation, the cumulus cells that had grown on the COC were removed by repeatedly pipetting the CO C in 0.1% (w / v) hyaluronidase.

[0168]

[0248] SCNT was performed as described above. Briefly, oocytes extruding the first polar body with an intact membrane were cultured for 0.5 - 1 hour for nuclear extrusion in NCSU23 medium supplemented with 0.1 mg / mL dexamethasone, 0.05 M sucrose, and 4 mg / mL bovine serum albumin (BSA). Then, the extruded nucleus was removed together with the polar body using a beveled pipette (about 2 0 μm in diameter) in Tyrode's lactate medium supplemented with 10 μM hydroxyethylpiperazineethanesulfonic acid (HEPES), 0.3% (w / v) polyvinylpyrrolidone, and 10% FBS in the presence of 0.1 mg / mL dexamethasone and 5 mg / mL cytochalasin B. WT or PERV - free fibro blasts were used as nuclear donors. A single donor cell was injected into the perivitelline space of the enucleated oocyte. .

[0169]

[0249] The donor cells were fused with the recipient cytoplasts with a single DC pulse of 200 V / mm for 20 μs using an embryo cell fusion system (ET3, Fujiplan Co., Ltd., Tokyo, Japan) in a fusion medium containing 0.25 M D - sorbitol, 0.05 mM Mg( (C2H3O2)2, 20 mg / mL BSA, and 0.5 mM HEPES (free acid). The reconstructed embryos were cultured in PZM - 3 solution (van’t Veer 1997) for 2 Cultured for a period of time to enable nuclear reprogramming, and then in an activation medium containing 0.25 M D-sorbitol, 0.01 mM Ca(C2H3O2)2, 0.05 mM Mg(C2H3O2) 2 and 0.1 mg / mL BSA, activated with a single pulse of 150 V / mm for 100 μs. Subsequently, the activated embryos were placed in PZM-3 supplemented with 5 mg / mL cytochalasin B, and cultured at 38.5 °C for 2 hours in a humidified atmosphere with 5% CO2, 5% O2, and 90% N2 (APM30D, ASTEC, Japan for further activation). Then, the reconstructed embryos were transferred to fresh PZM-3 medium and cultured at 38.5 °C for 2 days and 7 days in humidified air with 5% CO2, 5% O 2, and 90% N2 to detect the cleavage rate and blastocyst development rate of the embryos respectively.

[0170]

[0250] Crossbred (Large White / Landrace Duroc) female pigs with one parity were used as surrogate mothers for the constructed embryos. Estrus was examined at 9:00 am and 6:00 pm every day. SCNT embryos cultured for 6 hours after activation were surgically transplanted into the oviducts of the surrogates. Twenty-three days after embryo transfer, pregnancy was examined using an ultrasonic scanner (HS-101 V, Honda Electronics Co., Ltd., Yamazuka, Japan).

[0171]

[0251] Characterization of protein expression by immunofluorescence

[0252] Neonatal (3 - 6 days old) pig kidneys of WT, Pig 2.0, and Pig 3.0 were subjected to immunofluorescence on frozen sections to evaluate the characteristics of gene modification (3KO and 9TG) at the tissue level. The frozen sections were fixed with ice-cold acetone, blocked, and then either directly in one step or in two steps Staining was performed using any of the indirect immunofluorescence techniques. The primary and secondary antibodies used are summarized in Supplementary Table 2 Nuclear staining was performed using ProLong Gold DAPI (Thermo Fisher, P36931). Sections were imaged using a Leica Fluorescence Microscope and analyzed using ImageJ software All photographs were taken under the same conditions to enable an accurate comparison of fluorescence intensity between WT, Pig 2.0, and Pig 3.0 frozen sections.

[0172]

[0253] Binding of human antibodies to porcine endothelial cells

[0254] Antibody binding of human IgG and IgM antibodies to porcine and human endothelial cells was evaluated by flow cytometry as previously described (Xenotransplantation, Methods and Protocols, Editors: Costa, Cristina, Manez, Rafael, ISBN 978 - 1 - 61779 - 845 - 0 ). Briefly, Pig 2.0, Pig 3.0, WT PUVEC, and HUVEC were harvested, washed twice, and resuspended in staining buffer (PBS containing 1% BSA). Normal human type AB male serum (Innovative Research, IPLA - SERAB - H26227) was heat - inactivated at 56 °C for 30 minutes and diluted 1:4 with staining buffer. Pig 2.0, Pig 3.0, WT PUVEC, and HUVEC (1×105 cells per test) were incubated with diluted human serum at 37 °C for 30 minutes each. The cells were then washed with cold staining buffer and incubated with goat anti - human IgG Alexa Fluor 488 (Invitrogen, A11013, ​1:200 dilution) and goat anti-human IgM Alexa Fluor 647 (Invitrogen, A21249 and incubated at 4°C for 30 minutes with 1:200 dilution). After washing with cold staining buffer the cells were resuspended in staining buffer containing 7-AAD (BD, 559925, 1 :100 dilution) to include dead / live gating. Fluorescence was acquired on a CytoFLEX S flow cytometer and data were analyzed using FlowJo analysis software. For each sample 5,000 events were collected in the live cell gate and plotted as the specific median fluorescence intensity (MFI) generated by "Test MFI (IgG or IgM) - Control (secondary antibody only) MFI".

[0173]

[0255] Human complement cytotoxicity assay

[0256] Pig 2.0, Pig 3.0, WT PUVEC and HUVEC were harvested washed twice with PBS and resuspended in serum-free culture medium. Cells (1×10 5 cells per test ) were incubated with a uniform pool of human serum complement (Quidel, A11 3) at various concentrations (0%, 25%, 50% and 75%) for 45 minutes at 37°C and 5% CO2. Thereafter, the cells were stained with propidium iodide (Invitrogen, P3566, 1:500 dilution) for 5 minutes and analyzed by using a CytoFLEX S flow cytometer. 5,00 0 events were collected for each sample and the percentage of PI-positive cells was used as the percentage of cell death mediated by human complement .

[0174]

[0257] NK cell cytotoxicity assay

[0258] PUVEC and HUVEC were used as target cells, and anti-pig CD31-​ Labeled with FITC antibody (Bio-Rad) and anti-human CD31-FITC antibody (BD). On the other hand , human NK 92 cells were used as effector cells and labeled with anti-human CD56-APC antibody ( eBioscience). Effector (E) and target cells (T) were co-cultured at 37 °C and 5% CO2 for 4 hours at an E / T ratio of 3. The cells were stained with propidium iodide for 5 minutes and then subjected to FACS analysis. The percentage of PI-positive cells in the CD31+ gate was used to calculate the percentage of dead target cells.

[0175]

[0259] Phagocytosis assay

[0260] Differentiation of the human macrophage cell line THP-1 was achieved by 62.5 μM myristic acid phorbol phosphate (PMA) for 3 days and confirmed by their attachment to tissue culture plastic flasks. Porcine spleen cells (target cells) were stained with the fluorescent dye 5 / 6-CFSE (Molecular Probes) according to the manufacturer's protocol . CFSE-labeled target cells were incubated with human differentiated THP-1 cells (effector cells) at E / T ratios of 1:1 and 1:5 respectively for 4 hours at 37 °C. Macrophages were counterstained with anti-human CD11b antibody and the phagocytosis of CFSE-labeled targets was measured by FACS. Phagocytosis activity was calculated as previously described (Ide 2007).

[0176]

[0261] CD39 biochemical ADPase assay

[0262] Pig 2.0, Pig 3.0 and WT PUVEC and HUVEC were seeded at 2 × 104 per well in 96-well plates one day before the assay. Cells The cells were incubated with 500 μM ADP (Chrono-Log Corp, # 384) at 37 °C and 5% CO2 for 30 minutes. Malachite green (Sigma, MAK307) was added to stop the reaction, and the absorbance was measured at 630 nm to determine the phosphate production level relative to the standard curve of KH2PO4.

[0177]

[0263] TFPI Activity and Human Factor Xa Binding Assay

[0264] Prior to the assay, the cells were treated with 1 μM PMA for 6 hours to induce hTFPI expression on the cell surface of Pig 2.0 and Pig 3.0 PUVEC. Then, the TFPI activity and human factor Xa binding assay were performed as previously described (Xenotr ansplantation, Methods and Protocols, Editors: Costa, Cristina, Manez, Rafael, I SBN 978 - 1 - 61779 - 845 - 0). All assays were performed in quadruplicate.

[0178]

[0265] TAT Formation Assay

[0266] Pig 2.0, Pig 3.0, and WT PUVEC and HUVEC were seeded at 3 × 105 per well in a 6 - well plate. After 1 day, the cells were incubated with 1 mL of fresh human whole blood (containing 0.5 U / mL heparin) at 37 °C with gentle shaking. At the indicated different time points, the blood was aspirated and plasma was isolated from it. The TAT content in the plasma was measured using a Thrombin - Antithrombin Com plex Human ELISA kit (Abcam, ab108907).

[0179]

[0267] Variant calling from whole-genome sequencing data

[0268] Paired reads were mapped by BWA (v0.7.17-r1188) to the Sus Scrofa 11.1 genome (ftp: / / ftp.ensembl.org / p ub / release-91 / fasta / sus_scrofa / dna / ). Variants (SNPs and INDELs) were called using GATK (v4.0.7.0) according to the GATK best practices recommendations that require a minimum depth of 10 in addition to standard filters

[0180]

[0269] In silico prediction of on- / off-target sites

[0270] Using CRISPRSeek (v1.22.1) in R (v3.5.0), allowing up to 6 mismatches, on-target and off-target sites across the genome were predicted. The input genome is either of Sus Scrofa 11.1 (ftp: / / ftp.ensembl .org / pub / release-91 / fasta / sus_scrofa / dna / )

[0181]

[0271] Off-target calling from whole-genome sequencing data

[0272] Filtered variants from GATK that are within 20 bp adjacent to the PAM site of the off-targets predicted by CRISPRSeek (v1.22.1) were called as potential off-target modifications. If parental line WGS data are available, variants with a significantly higher or lower allele frequency than 0.5 in the parental line were identified using in-house developed ​​​​​​​​Filter using statistical tests. The assumption of this test is that off-target mutations are rare events so the probability that both alleles are modified simultaneously is extremely low.

[0182]

[0273] Functional impact analysis of mutations

[0274] Whether the variant is a target or germline mutation, annotations are made for sequence changes at the transcriptional level and amino acid changes at the protein level in order to evaluate its potential functional impact using VEP( Variant Effect Predictor, v93.3). Mutations with high impact are specifically selected if they can result in frameshift, start gain / loss, stop gain / loss, splice donor / acceptor shift or splice region changes. Whenever available, mutations are annotated using the APPRIS data base to indicate whether it affects the principal or alternative transcript.

[0183]

[0275] Transcriptional analysis from RNA-Seq

[0276] Align RNA-Seq reads to the Sus Scrofa 11.1 genome using STAR (v2.6. 1a) in splicing recognition mode. Expression levels are quantified as TPM (transcripts per million) using Salmon (v0.11.3) with both the porcine transcriptome and the transgene as input transcripts.

[0184]

[0277] Analysis of PERV knockout efficiency by Amplicon-Seq

[0278] After trimming low-quality bases at the 3' end with less than Q20, their duplicates are 100 ​​​​​If it exceeds the base, merge the paired reads into fragments. The merged fragments are further scanned to hard mask low-quality bases less than Q2 and aligned to the PERV amplicon target sequence using STAR (v2.6.1a) in splicing recognition mode. Subsequently, the output BAM file is analyzed by an in-house R script (v3.5.0) to digest the alignment pattern and evaluate the distribution of INDELs within the PERV amplicon target sequence (relative to the catalytic center) to derive the knockout efficiency.

[0185]

[0279] PERV Knockout Efficiency Analysis by Capture-Seq

[0280] The paired reads are first aligned to the PERV target sequence using STAR (v 2.6.1a) in splicing recognition mode, followed by alignment position-dependent duplicate removal by Picard (v2. 18.14). Subsequently, the duplicate-removed paired reads are merged into fragments by an in-house script. Then, the merged fragments are realigned to the PERV capture target sequence using STAR (v2.6.1a) in splicing recognition mode. Subsequently, the output BAM file is analyzed by an in-house R script (v3.5.0) to digest the alignment pattern and evaluate the distribution of INDELs within the capture target sequence and derive the knockout efficiency.

[0186] PERV Haplotype Analysis by Capture-Seq

[0281] The paired reads are first aligned to the PERV target sequence using STAR (v 2.6.1a) in splicing recognition mode. Mutect2 (v4.1.

[0282] ​​​​​Call somatic variants using GATK (v4.1.2.0) and filter for variants with a minor allele frequency greater than a given threshold (MAF>0.01). Merge the filtered variants from multiple samples to derive a collection of variant sites for haplotype typing. Next, properly aligned paired reads were merged into fragments by in-house scripts. The merged fragments were then realigned to the PERV target sequence using STAR (v2.6.1a) in splicing-aware mode. For each fragment covering the region of interest, we extracted alleles for collection of modification sites and defined the haplotype of the fragment. Finally, the haplotype distribution was derived by counting all fragments covering the region of interest. Align paired reads to a reference library consisting of the Sus Scrofa 11.1 genome, PERV haplotypes, and payload plasmid sequences using STAR (v2.6.1a) in splicing-aware mode. Structural variants (SVs) are called from the BAM file using Lumpy (v0.2.13) to detect DNA fusion points. Next, we screen for SVs that bridge the porcine genome and the payload sequence with mismatched reads at the integration site.

[0187]

[0283] Identification of Payload Integration Sites Using Whole-Genome Sequencing Data

[0284] (v2.6.1a) to align the paired reads. Structural variants (SVs) are called from the BAM file using Lumpy (v0.2.13) to detect DNA fusion points. Next, we screen for SVs that bridge the porcine genome and the payload sequence with mismatched reads at the integration site.

[0188]

[0285] Statistical Analysis

[0286] All statistical analyses were performed using R (v3.5.0) and Excel (v2016). It is applied. Unless otherwise specified, a p-value < 0.05 is significant. When multiple tests are included simultaneously, p-value correction is performed according to the Benjamini-Ho chberg procedure to control the overall false discovery rate (FDR). Unless otherwise specified, FDR < 0.0 5 is typically used.

[0189] Example 10: Perfusion of Immunologically Compatible Porcine Liver with Human Blood

[0287] As a surrogate experiment for xenotransplantation for organ function analysis, a liver perfusion experiment was conducted using an immunologically compatible porcine liver isolated from Pig 2.0 (4-7; 3KO+12TG). Wild-type liver and 4-7 liver (about 80 kg) were isolated from 12-month-old pigs. The liver was perfused with human whole blood and human fresh frozen plasma (FFP). An overview of the simple liver perfusion protocol is shown in Table 1 shown below. shown below.

[0190]

Table 3

[0191]

[0288] Bile was collected from the liver at various time points and analyzed. As shown in Figure 28, total bile production increased by approximately twofold in the 4-7 liver compared to the WT liver. Furthermore, the 4-7 liver showed stable serum levels of metabolic enzymes that are markers of liver injury, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB) (Figure 29A-C). Additionally, the 4-7 liver showed stable serum electrolyte levels including potassium (K) and sodium (Na) (Figure 29D-E). The 4 -7 and WT livers showed higher and more stable levels in the 4-7 liver compared to the WT liver. Complement (C3) expression sustained at the level was also tested (Figure 29F). When analyzed for coagulation, 4-7 livers showed stable prothrombin time (PT) and international normalized ratio (PT -NIR), fibrinogen level (FIB), and lower activated partial thromboplastin time (APTT) (Figure 30A-D). Collectively, these data indicate that 4-7 livers have improved liver function.

[0192] Example 11: Kidney Transplantation from Pig to Non-Human Primate (NHP)

[0289] Prior to 2014, the longest survival of kidney xenografts from pigs to non-human primates (NHPs) was 90 days, and graft engraftment periods >30 days were extremely rare. Coupled with the increased availability of donor pigs with genetic modifications targeting the host's innate and adaptive immune responses, and recent advancements in induction and maintenance immunosuppressive therapy regimens, the graft engraftment period has been extended to >125 days (Higginbotham 2015, Iwase 2015b). Further genetic engineering to compensate for molecular incompatibilities in the immune, coagulation, complement, and inflammatory response pathways has begun to advance the field of xenotransplantation. Despite the genetic modification to create GTKO and the overexpression of one hCRP, coagulation dysfunction, including thrombotic microangiopathy and systemic consumptive coagulopathy, persisted mainly due to molecular incompatibilities between pigs and NHPs.

[0193]

[0290] Preclinical kidney transplantation studies. For preclinical kidney transplantation studies, safety and efficacy trials are conducted in NHPs. For safety and efficacy testing, kidneys from 8- to 10-week-old Pig 2.0 donors are transplanted into NHP (cynomolgus monkey) recipients who undergo bilateral nephrectomy at the time of transplantation. It is monitored by serum creatinine levels, complete blood counts, and urinalysis of proteins, as well as serial biopsies and examinations of body weight and general condition. Immunosuppression consists of clinically relevant reagents in combinations and strengths that are tolerated in allotransplantation. These include steroids, anti-NHP thymocyte globulin, induction treatment with anti-CD20, and maintenance immunosuppression with steroids, anti-CD40, MMF, and rapamycin. Prophylactic antiviral therapy, antibacterial therapy, and anticoagulant therapy are implemented, and Epogen supplementation is performed as needed based on hematocrit values. Survival of a xenograft that functions well for 6 months, demonstrated by normal creatinine, no or low-level proteinuria, and biopsies showing no acute antibody or cell-mediated injury, is considered sufficient evidence of efficacy. By analogy with allotransplantation, the period with the highest risk of preformed antibody-mediated injury is the first few weeks after transplantation, and acute cell-mediated rejection is most likely to occur during the first 3 months after transplantation, after which the risk is expected to attenuate (Cowan 2014). Allograft rejection. In accordance with the draft guidance "Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans" revised in December 2016 (FDA 2016), rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. There is a possibility that rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. Based on the guidance "Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans" revised in December 2016 (FDA 2016), rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. According to the guidance "Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans" revised in December 2016 (FDA 2016), rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts.

[0194]

[0291] Survival of a xenograft that functions well for 6 months, demonstrated by normal creatinine, no or low-level proteinuria, and biopsies showing no acute antibody or cell-mediated injury, is considered sufficient evidence of efficacy. Survival of a xenograft that functions well for 6 months, demonstrated by normal creatinine, no or low-level proteinuria, and biopsies showing no acute antibody or cell-mediated injury, is considered sufficient evidence of efficacy. Survival of a xenograft that functions well for 6 months, demonstrated by normal creatinine, no or low-level proteinuria, and biopsies showing no acute antibody or cell-mediated injury, is considered sufficient evidence of efficacy.

[0195]

[0292] By analogy with allotransplantation, the period with the highest risk of preformed antibody-mediated injury is the first few weeks after transplantation, and acute cell-mediated rejection is most likely to occur during the first 3 months after transplantation, after which the risk is expected to attenuate (Cowan 2014). By analogy with allotransplantation, the period with the highest risk of preformed antibody-mediated injury is the first few weeks after transplantation, and acute cell-mediated rejection is most likely to occur during the first 3 months after transplantation, after which the risk is expected to attenuate (Cowan 2014). By analogy with allotransplantation, the period with the highest risk of preformed antibody-mediated injury is the first few weeks after transplantation, and acute cell-mediated rejection is most likely to occur during the first 3 months after transplantation, after which the risk is expected to attenuate (Cowan 2014).

[0196]

[0293] Allograft rejection. In accordance with the draft guidance "Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans" revised in December 2016 (FDA 2016), rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. According to the guidance "Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans" revised in December 2016 (FDA 2016), rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. In accordance with the draft guidance "Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans" revised in December 2016 (FDA 2016), rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. There is a possibility that rejection of xenotransplantation products may precede the recipient's subsequent rejection of xenotransplantation products or allografts. (Section IX.C.1.g).

[0197]

[0294] Using in vitro antibody reactivity and mixed lymphocyte reaction (MLR) assays To demonstrate lack of reactivity following xenograft transplantation in preclinical models. To test for possible cross-reactivity between the responses to the allografts, flow cytometry was performed. The Lee crossmatch test was performed on normal pigs and Pig 2.0 donors receiving kidney transplants as described above. The study was performed using serum from male NHP donors. The reactivity of the serum against lymphocytes from the donor is tested. The reaction against pig cells is detected by anti-pig antibodies. Elevated levels confirm that a heterologous sensitization event has occurred. ) compared with post-rejection samples to measure changes in antibody binding to a panel of NHP lymphocytes. In parallel, we will evaluate the efficacy of pre- and post-transplant (post-rejection) NHP recipients in response to a panel of allogeneic stimulators. Direct and indirect T cell responses by patient T cells were assessed to determine whether cell-mediated allogeneic responses were distinct. Determine whether the cells grow after rejection of the seed graft (Baertschiger 2004, Cooper 2004, Ye 1 995).

[0198]

[0295] Cross-reactivity between heterologous and homologous reactions is observed at least at low levels. However, these results should be considered in the context of the proposed study. Kidney trials may not identify suitable matches and therefore cannot provide transplants. Transplants are planned for highly sensitized patients who have not had any prior exposure to the virus. It is unlikely that this would alter the chances of receiving an allograft thereafter. It has not been identified as a significant barrier to re-transplantation and, therefore, may not be clinically monitorable (Baertschiger 2004, Cooper 2015). Therefore, sensitization via xenogeneic cells is thought to be unlikely to impede allograft survival.

[0199]

[0296] Biodistribution. The possibility of migration of donor cells to distant tissues / organs in the recipient as a result of xenotransplantation remains. Chimera studies demonstrate that this can actually increase the success of engraftment and decrease the probability of rejection (Starzl 1993, Vagefi 2015). However, there may be unknown consequences of porcine donor cell migration and, therefore, strategies have been developed to determine whether cell migration has occurred. Biodistribution is studied as part of porcine-NHP xenotransplantation research in accordance with the principles outlined in FDA guidance documents including Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans, Dec 2016 (Section IX.C.5; FDA Dec 2016), Gene Therapy Clinical Trials - Observing Subjects for Delayed Adverse Events, Nov 2016 (Section IV.B.2; FDA Nov 2016), and Preclinical Assessment of Investigational Cellular and Gene Therapy Products, Nov 2013 (Section V.C.5.; FDA 2013). However, there may be unknown consequences of porcine donor cell migration and, therefore, strategies have been developed to determine whether cell migration has occurred. Biodistribution is studied as part of porcine-NHP xenotransplantation research in accordance with the principles outlined in FDA guidance documents including Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans, Dec 2016 (Section IX.C.5; FDA Dec 2016), Gene Therapy Clinical Trials - Observing Subjects for Delayed Adverse Events, Nov 2016 (Section IV.B.2; FDA Nov 2016), and Preclinical Assessment of Investigational Cellular and Gene Therapy Products, Nov 2013 (Section V.C.5.; FDA 2013). l, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplan tation Products in Humans, Dec 2016 (Section IX.C.5; FDA Dec 2016), Gene Therapy Clinical Trials - Observing Subjects for Delayed Adverse Events, Nov 2016 (Sect ion IV.B.2; FDA Nov 2016), and Preclinical Assessment of Investigational Cellula r and Gene Therapy Products, Nov 2013 (Section V.C.5.; FDA 2013) and is included as part of porcine-NHP xenotransplantation research.

[0200]

[0297] Tumorigenicity. For all animals included in SCNT and reproductive medicine facilities, daily monitoring is performed for evidence of tumor formation. All animals showing a moribund state or death are subjected to complete necropsy and gross and microscopic pathological examinations by an animal pathologist. Health and pathology records of all genetically engineered animals are maintained and summarized to determine the risk of potential tumorigenicity due to specific or unintentional genetic modifications.

[0201] Example 12: Kidney transplantation from pig to human

[0298] Kidney xenotransplantation has been studied for decades, and pig xenografts have been evaluated in early clinical trials (Starzl 1964). The challenge is to enable a xenotransplantation technique that provides a clinical benefit equivalent to that of allograft survival.

[0202]

[0299] Clinical trial design. The proposed clinical trial population includes transplant patients aged 18 - 65 with end-stage renal disease who are unlikely to find a suitable kidney donor in a timely manner due to the presence of a high level of panel reactive antibodies against HLA (PRA). High PRA poses substantial challenges in matching with a suitable cadaveric or living donor, leading to an extended waiting time for further years of hemodialysis and increased morbidity. Despite the prioritization of the waiting list, >90% of PRA patients still experience significantly longer waiting times compared to less sensitized patients. Subjects with >90% PRA sensitization to HLA antigens and a negative flow crossmatch to porcine donor lymphocytes (or endothelial cells) are targeted.

[0203]

[0300] The patient receives a 120±10 gm porcine kidney that provides an estimated glomerular filtration rate (GFR) of 40 - 50 mL / min / 1.73m 2 . A single porcine kidney from a 9 - 12 month old donor is transplanted into the right or left iliac fossa in the same manner as that used for allogeneic kidney transplantation. The primary endpoint is freedom from hemodialysis for one year after transplantation. The patient is evaluated by serial blood tests for creatinine levels, urinary protein, and calculation of GFR using the MDRD formula: GFR (mL / min / 1.73m ) = 175 × (S cr) 2 × (age) × (0.742 for females) × (1.212 for African -1.154 American ethnicity). Protocol - specified graft biopsies are performed every three months and as indicated by cause, based on a >20% increase in creatinine from baseline, defined as the mean of the best three consecutive creatinine measurements in the first month after transplantation, or proteinuria >300 mg / day. Safety measures include monitoring of coagulation parameters, clinical chemistry, hematology, and infectious diseases in the outpatient setting. -0.203

[0204]

[0301] Organs for porcine - to - human kidney transplantation. Data suggest that porcine kidneys exhibit functional efficacy with similar kidney weights as human kidneys, and thus, kidney transplantation with grafts and recipient body weights can be equivalent to those clinically used for allografts. In humans, allograft kidney transplantation is performed over a wide range of kidney weights relative to recipient body weight. On average, adult male kidneys weigh 125 - 170 grams and adult female kidneys weigh 115 - 155 grams (Boron 2003). The recipient ​​​​​​​​​​​​Considering the upper limit range of the dose for the ratio of kidney weight to body weight, there is no evidence that any form of renal function excess is harmful. Rather, the upper limit of transplantable kidney mass is limited by technical problems. For example, it is possible to successfully transplant the kidney of an adult into a 10 kg infant, which is equivalent to a kidney of 12 - 17 gm / kg, which is about 3 - 4 times the average adult kidney mass ratio (3 - 4 gm of kidney / kg; Dona ti-Bourne 2014). This upper limit range of graft weight to recipient weight is relevant to the proposed preclinical tests detailed below. In experimental preclinical tests, kidneys of 50 - 75 g from 8 - 10 week old pig donors are transplanted into 5 - 12 kg NHP recipients (about 10 gm of kidney / kg).

[0205]

[0302] Glomerular filtration rate (GFR; mL / min / 1.73m2) is a standard measure of kidney function or renal efficacy used to stage the progression of dialysis and / or transplant eligible chronic kidney disease (CKD) and renal failure. In determining the lower limit range of the dose for kidney weight relative to recipient body weight, the goal is to achieve a GFR of 45 - 60 mL / min / 1.73m 2 (CKD stage 3A; Levey 2011). This target GFR range is based on data suggesting that the renal function of CKD 3A is equivalent and stable to that achieved with human single kidney allografts, while the lower GFR of CKD stage 3B (GFR 30 - 45 mL / min / 1.73m 2 ) is associated with an increased risk of end-stage renal disease and all-cause and cardiovascular mortality (Sharma 2010). The target GFR range of 45 - 60 mL / min / 1.73m 2 is ​​, equivalent to that achieved by single-kidney allotransplantation in humans (50 - 65 mL / min / 1.73 m 2 ; Gourishankar 2003, Marcen 2010).

[0206]

[0303] Taking into account that the GFR per kidney mass is equivalent in human and porcine kidneys would require xenotransplantation of kidney mass equivalent to that routinely used in allotransplantation (115 - 170 gm). Considering that there is a possibility that some renal function may be lost during the provision process and after transplantation due to the treatment of the recipient with calcineurin inhibitor-form nephrotoxic immunosuppression should be taken into account.

[0207]

[0304] Pharmacology and toxicology information. Efficacy and safety are evaluated by pharmacological tests using both rodent and NHP models . A stepwise approach is adopted that includes various integrated safety endpoints, as well as clinical pathology and pathophysiology evaluations in genetically engineered donor porcine tissues. In vitro cell and tissue function, as well as clinical pathology and histopathology evaluations in donor pig and NHP xenografts are included. Endpoints include graft function and rejection, as well as recipient safety related to the function of innate and adaptive immunity, inflammation, and the complement and coagulation cascades.

[0208]

[0305] Assisted reproduction of somatic cell nuclear transfer and genetically engineered donor pigs. Genetically engineered donor pigs are routinely monitored for safety considerations with a complete clinical pathology examination including clinical chemistry and hematology, as well as gross and microscopic histopathological examinations For all donor pigs in the breeding colony, fertility, embryo / fetal development, organ and tissue development​​​​​​​ And monitor and record potential tumor formation.

[0209]

[0306] Animals are identified by unique ear tags printed with permanent ink (placed at the origin). The pig flow includes a quarantine area, which is an outdoor group housing shed with a wood shavings floor. The feed troughs are made of wood and kept clean without garbage and waste. Fresh and freely available water is always available through nipple drinkers. The shed relies on the movement of outdoor wind to circulate air, and the temperature is maintained above 10°C. Biosecurity requires at least 24 hours of non-contact with other pigs, specific shed clothing, and immersion of boots in disinfectant before and after contact with the shed. The quarantine period includes a 35 - 40-day quarantine, Parvo Shield L5E, FluSure XP / ER Bac Plus, Ingelvac FLEX combo (circovirus and mycovirus), and inoculation with Dectomax, and two blood samplings to prove no increase in disease antibodies (PRRSV, PRRSX3). After release from quarantine, the pigs are moved to the buffer area of the facility. This area is a closed group housing shed for up to 12 pigs, a shed with sawdust bedding. The bedding is changed weekly. The temperature is controlled in the range of 15 - 24°C by a thermostat-controlled fan and a propane heater. The pigs are fed in stainless steel troughs, and fresh and freely available water is always available through nipple drinkers. The pigs are observed at least once a day according to their health status. Pigs with health problems observed are housed in a single shed for individual care and attention.

[0210]

[0307] and will be treated as directed by the attending veterinarian and the Head of Embryology. Requires at least 24 hours of no contact with other pigs. Use limited to barn areas. The coveralls and boots are fitted with Virkon-S or Syner before and after the shed contact. The source donor pigs used in clinical trials were prepared according to the relevant Follow all applicable guidance and regulations.

[0211]

[0308] Validation of genetic engineering. Endogenous gene knockout and human transgene expression at the genome level. The gene knockout will be verified at the mRNA and protein levels. - Either sequencing or deep sequencing is performed to identify the intended target region Second, RNA-seq and / or RT-PCR were performed to confirm the gene mutation at the to confirm that the mRNA contains the intended mutation and is susceptible to nonsense-mediated decay. RT assay was performed to demonstrate loss of RT activity in PERV KO cells. In addition, immunohistochemistry (IHC) staining and / or flow cytometry are performed. , ensuring that the gene product is not present in or on the cell surface.

[0212]

[0309] Off-target mutations remain despite advances in the field of precision gene editing There may be a need to generate safe and effective donor organs for clinical xenotransplantation. Potential off-target effects of CRISPR-Cas9 gene editing need to be understood. To determine effectiveness, the following multi-stage evaluation approach was used: 1. Karyotyping of modified cell clones to determine the integrity of chromosomal structure; 2. CIRCLE-Seq: A highly sensitive in vitro screening strategy for comprehensively detecting genome-wide CRISPR- Cas9 off-target mutations. Potential off-target sites are monitored in any derived cell lines from a specific gRNA using subsequent targeted amplicon sequencing; 3. Whole genome sequencing (WGS): For examining single point mutations and small structural variations in genetically engineered cell lines or pigs. Table 2 lists the resolution and sensitivity of the detection methods used.

[0213]

Table 4

[0214]

[0310] Regarding the expression of the transgene, the integrity and expression of the human transgene at the genomic level, mRNA level, and protein level are verified using sequencing, RT-PCR / RNA-seq, and IHC / flow cytometry techniques. Furthermore, the position of the random transgene integration is determined by junction capture based on inverse PCR, and the results are verified by junction PCR.

[0215]

[0311] Clones are selected using a single-copy transgene integrated into the intergenic region of at least 10,000 bp from any known gene and ncRNA, and at least 50,000 bp from any cancer gene and tumor suppressor gene. For site-specific integration and endogenous gene humanization, allelic site-specific integration / substitution is verified by junction PCR and droplet digital PCR (ddPCR).

[0216] ​​​​​​Example 13: Non-Human Primate (NHP) Kidney Transplantation

[0312] Preclinical transplantation studies. For preclinical transplantation studies, safety and efficacy tests were conducted in NHP. Hearts, kidneys, and livers from 8- to 10-week-old Pig 2.0 donors were used for solid organ transplantation studies, and livers and lungs were used for perfusion organ studies. Over a 5-month period, 15 organ transplants and 11 organ perfusions were performed. Specifically, as summarized in Table 3, 4 liver and 7 lung perfusions were performed while 7 kidney transplants, 4 heart transplants, and 4 liver transplants were performed.

[0217]

Table 5

[0218]

[0313] The immunosuppression regimen for kidney transplantation consisted of combinations and strengths of clinically relevant reagents acceptable for allografts. Clinical monitoring included abdominal ultrasounds on days 2, 5, 7, 9, 12, and 14, and clinical laboratory tests (CBC, Chem 17, blood, serum) on days 2, 5, 7, 9, 12, and 14 and weekly.

[0219]

[0314] The survival of transplanted kidneys from Pig2.0 donors and control pigs (GTKO.hCD55) was analyzed. A summary of the results is provided in Table 4.

[0220]

Table 6

[0221]

[0315] The two recipients with the longest survival of GTKO.hCD55 pig kidneys survived until day 76 and day 93, respectively, and were euthanized due to kidney failure and weight loss. Of the two, one was found to have thrombotic microangiopathy (TMA), chronic antibody-mediated rejection (AMR) and borderline T cell-mediated rejection (TCMR); while the other one had C4d deposition, but no other histological evidence of rejection. The remaining seven recipients received kidneys from Pig 2.0. In these pigs, transduced human proteins that regulate immune response or complement activation were highly expressed. The NHP recipients of these genetically modified pig kidneys survived for 190, 72, 20, 15, and 6 days under an immunosuppressive regimen for kidney transplantation.

[0222]

[0316] One recipient is currently doing well with normal kidney function (creatinine 0.6 mg / dl) at day 190 under an immunosuppressive regimen for kidney transplantation. Multiple biopsies showed no signs of rejection or TMA.

[0223]

[0317] Collectively, these data demonstrate long-term survival of kidney xenografts with triple xenogeneic antigen KO involving multiple transductions of human genes encoding regulatory proteins in the natural response and complement pathway, i.e., the absence of rejection or TMA was achieved with minimal maintenance immunosuppression.

[0224]

[0318] Deterioration of the health status of the monkeys contributed to the early termination of some xenotransplanted monkeys. Complications included blood transfusion, injection site abscesses and infections, and wound healing. Some cases presented with bleeding in the bladder and / or ureter, presumably due to excessive anticoagulation. An overview of the Pig2.0 grafts is shown in Table 5.

Table 7

[0226]

[0319] When the kidneys isolated from the payload 9 (A) and payload 10 (B) donor pigs were transplanted into recipient monkeys and analyzed, it was verified that the recipients showed stable serum creatinine concentrations (Figs. 32A and 32B). Some recipient monkeys also showed stable or recovering hematocrit levels (Figs. 33A and 33B). Platelet counts were low in some recipient monkeys but recovered in others (Figs. 34A and 34B). The fluctuations in WBC reflect the immunosuppressive regimen and infectious events (Figs. 35A and 35B). When the kidneys isolated from the payload 9 (A) and payload 10 (B) donor pigs were transplanted into recipient monkeys and analyzed, it was verified that the recipients showed stable serum creatinine concentrations (Figs. 32A and 32B). Some recipient monkeys also showed stable or recovering hematocrit levels (Figs. 33A and 33B). Platelet counts were low in some recipient monkeys but recovered in others (Figs. 34A and 34B). The fluctuations in WBC reflect the immunosuppressive regimen and infectious events (Figs. 35A and 35B). When the kidneys isolated from the payload 9 (A) and payload 10 (B) donor pigs were transplanted into recipient monkeys and analyzed, it was verified that the recipients showed stable serum creatinine concentrations (Figs. 32A and 32B). Some recipient monkeys also showed stable or recovering hematocrit levels (Figs. 33A and 33B). Platelet counts were low in some recipient monkeys but recovered in others (Figs. 34A and 34B). The fluctuations in WBC reflect the immunosuppressive regimen and infectious events (Figs. 35A and 35B). When the kidneys isolated from the payload 9 (A) and payload 10 (B) donor pigs were transplanted into recipient monkeys and analyzed, it was verified that the recipients showed stable serum creatinine concentrations (Figs. 32A and 32B). Some recipient monkeys also showed stable or recovering hematocrit levels (Figs. 33A and 33B). Platelet counts were low in some recipient monkeys but recovered in others (Figs. 34A and 34B). The fluctuations in WBC reflect the immunosuppressive regimen and infectious events (Figs. 35A and 35B). When the kidneys isolated from the payload 9 (A) and payload 10 (B) donor pigs were transplanted into recipient monkeys and analyzed, it was verified that the recipients showed stable serum creatinine concentrations (Figs. 32A and 32B). Some recipient monkeys also showed stable or recovering hematocrit levels (Figs. 33A and 33B). Platelet counts were low in some recipient monkeys but recovered in others (Figs. 34A and 34B). The fluctuations in WBC reflect the immunosuppressive regimen and infectious events (Figs. 35A and 35B). When the kidneys isolated from the payload 9 (A) and payload 10 (B) donor pigs were transplanted into recipient monkeys and analyzed, it was verified that the recipients showed stable serum creatinine concentrations (Figs. 32A and 32B). Some recipient monkeys also showed stable or recovering hematocrit levels (Figs. 33A and 33B). Platelet counts were low in some recipient monkeys but recovered in others (Figs. 34A and 34B). The fluctuations in WBC reflect the immunosuppressive regimen and infectious events (Figs. 35A and 35B).

[0227]

[0320] Orthotopic liver xenotransplantation. Until recently, the survival period of orthotopic liver xenotransplantation (OLTx) from pigs to baboons was limited to 9 days. In 2 cases of recipients of GTKO livers, the survival period was improved to 25 days and 29 days by administration of human coagulation factors, but consistent survival has still not been elucidated. Orthotopic liver xenotransplantation. Until recently, the survival period of orthotopic liver xenotransplantation (OLTx) from pigs to baboons was limited to 9 days. In 2 cases of recipients of GTKO livers, the survival period was improved to 25 days and 29 days by administration of human coagulation factors, but consistent survival has still not been elucidated. Orthotopic liver xenotransplantation. Until recently, the survival period of orthotopic liver xenotransplantation (OLTx) from pigs to baboons was limited to 9 days. In 2 cases of recipients of GTKO livers, the survival period was improved to 25 days and 29 days by administration of human coagulation factors, but consistent survival has still not been elucidated. Orthotopic liver xenotransplantation. Until recently, the survival period of orthotopic liver xenotransplantation (OLTx) from pigs to baboons was limited to 9 days. In 2 cases of recipients of GTKO livers, the survival period was improved to 25 days and 29 days by administration of human coagulation factors, but consistent survival has still not been elucidated.

[0228]

[0321] This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN This time, OLTx from 4 pigs to baboons was performed. The livers were obtained from two gene constructs of transgenic pigs lacking targets for xenogeneic antibodies and containing human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF and aCD154. All recipients received an infusion of KCentra. Different from previous studies, splenectomy was not performed and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusion of GpIIb / IIIa inhibitor. Graft function was monitored daily by chemistry, lactate, CBC, IN It was evaluated using R and the weekly coagulation profile.

[0229]

[0322] Baboons B1, B2, and B4 were successful in OLTx with life - sustaining graft function. LFT reached its peak at POD1 in all baboons and normalized between POD4 - 7 (Figures 38A, 38B). Each baboon showed thrombocytopenia, and spontaneous recovery began at POD8 in B2 and at POD4 in B4 (Figure 38C). The transfusion requirement (Figure 38D) was less than historical experience. Consumption of coagulation factors occurred immediately after OLTx and was then produced at normal porcine levels (Figures 38E - 38I). B1 was euthanized at POD8 due to respiratory failure caused by fluid overload and abdominal compartment syndrome. Liver biopsy showed focal ischemia, no rejection was observed, and it was C4d - negative (Figures 38A - B). B2 recovered smoothly, and the biopsy at POD8 was normal. Hemoptysis and an increased transfusion requirement led to the need for euthanasia at POD14. Pulmonary hemorrhage was confirmed at autopsy. H + E staining of the liver showed diffuse sinusoidal neutrophil infiltrate, which suggested an infectious complication against rejection. B2 was C4d - negative, and LFT remained normal throughout (Figures 38C - D). B3 had hypotension and intraoperative hypoxemia after reperfusion, and euthanasia was necessary. At autopsy, diffuse pulmonary hemorrhage with a normal liver and patent vasculature was observed. B4 recovered uneventfully and required only one postoperative transfusion. An increase in Tbili and LFT at POD7 prompted an investigation, where bile leak and hepatic artery thrombosis (HAT) were confirmed, and euthanasia was necessary. Biopsy showed focal subcapsular necrosis with C4d - negative, indicating no evidence of rejection. There was no evidence of this, consistent with HAT (Figures 38E-F).

[0230]

[0323] Taken together, these data on OLTx using novel genetically modified porcine organs indicate that Reduced reperfusion injury, reduced RBC consumption, and the first successful outcome without splenectomy or use of CVF Survival without antibody-mediated rejection is demonstrated. These results suggest that this pig line is suitable for further OLTx studies.

[0231]

[0324] Liver xenotransplantation. Barriers to successful porcine liver transplantation include preformed xenoantibodies. Molecular disorders that lead to hyperacute rejection, dysregulated complement, coagulation, and innate and adaptive immunity Genetically modified pigs have the potential to circumvent these obstacles and are compatible with a variety of genetic constructs. A rapid and efficient model for evaluating the efficacy of a compound is needed. Ex-vivo liver xenoperfusion (EVLXP) of wild-type rats and liver xenoperfused with human blood and plasma We report initial results using genetically modified porcine liver (hWB+P).

[0232]

[0325] Briefly, livers derived from Pig 2.0 (EG group, n = 3) and WT (n = 2); and GTKO.hCD55 (n=4) livers were studied. EVXLP was prepared from fresh heparinized The procedure was performed at 37°C using hWB+P. Failure during EVXLP was due to elevated vascular resistance, severe hypoxemia, and The clinical features of the lesions were defined as a decrease in blood flow due to vascular disturbance or gross necrosis. Blood gas analysis was performed. Tissue biopsies were stained with H+E for IgG, IgM and complement (C4d ) deposition was investigated.

[0233]

[0326] All groups showed a progressive decrease in blood flow with a corresponding increase in vascular resistance. Deterioration occurred earlier and progressed more rapidly in WT and GTKO.CD55 compared to EG livers (Figs. 39A, 39B), correlating with longer EG liver survival. The mean liver survival time was 5 hours (range 5 - 7 hours) for WT, 4.5 hours (range 4 - 6 hours) for GTKO.CD55, and 13 hours (range 11 - 14 hours) for EG livers. Platelets and neutrophils decreased rapidly in all groups, with the largest loss observed in WT, although the differences did not meet statistical significance (Figs. 39C, 39D). RBC counts were preserved through perfusion in EG, significantly higher than in WT livers and tending to be higher than in GTKO.CD55 (Fig. 39E). EG liver tissue biopsies showed preserved liver architecture with mild diffuse portal and sinusoidal inflammation on H+E (Fig. 41A). WT livers showed focal ischemic necrosis and vascular congestion on H+E (Fig. 41E), strong staining for IgM and IgG (Figs. 41F - 41G) and C4d positivity (Fig. 41H). In contrast, EG livers showed diffuse mild sinusoidal IgG and IgM deposition (Figs. 41B - 41C) with C4d negativity (Fig. 41D), suggesting that reduced pre - formed antigen and added human complement regulatory protein expression led to improved complement regulation and less injury. Xenogeneic livers from transgenic pigs lacking xeno - specific antigens and containing humanized transgenes related to complement activation and immune cell function had a milder degree of platelet sequestration, maintained RBC volume, reduced antibody and complement deposition, and significantly extended survival compared to WT or GTKO.CD55 xenografts. This model simulates xenotransplantation from pigs to humans.

[0234]

[0327]

[0235]

[0328] ​It is an efficient and useful tool for evaluating the effectiveness of specific genetic modifications.

[0236]

[0329] Lung heterologous perfusion. Ex vivo lung perfusion using human blood is a standardized method for evaluating the effects of combinations of transgenes. Here, we report results related to a novel transgenic pig line evaluated in the context of a reference cohort. Specifically, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely.

[0237]

[0237]

[0330] Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely. Briefly, eight pairs of pig-derived lungs with a combination of Gal1, 3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and natural and adaptive immune cell functions were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as a reference group. For each pair of pig lungs, the blood was left "untreated" (n = 5 Pig 2.0, n = 3 reference) or "treated" with the thromboxane synthase inhibitor and histamine receptor blocker 1-BIA (n = 7 for Pig 2.0, n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was selectively terminated after 8 hours of perfusion if the lungs did not function prematurely.

[0238]

[0331] The median survival time of Pig 2.0 lungs was 450 minutes (range 300 - 480 minutes) in the untreated group, versus 30 minutes (range 20 - 300 minutes) for reference lungs (P = 0.04), and 480 minutes (range 360 - 480 minutes) in the treated cohort, versus 300 minutes (range 145 - 360 minutes) (P = 0.009). The increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed in "untreated" Pig 2.0 lungs compared to GalTKO.hCD55 lungs (Figure 42). The median survival time of Pig 2.0 lungs was 450 minutes (range 300 - 480 minutes) in the untreated group, versus 30 minutes (range 20 - 300 minutes) for reference lungs (P = 0.04), and 480 minutes (range 360 - 480 minutes) in the treated cohort, versus 300 minutes (range 145 - 360 minutes) (P = 0.009). The increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed in "untreated" Pig 2.0 lungs compared to GalTKO.hCD55 lungs (Figure 42). The median survival time of Pig 2.0 lungs was 450 minutes (range 300 - 480 minutes) in the untreated group, versus 30 minutes (range 20 - 300 minutes) for reference lungs (P = 0.04), and 480 minutes (range 360 - 480 minutes) in the treated cohort, versus 300 minutes (range 145 - 360 minutes) (P = 0.009). The increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed in "untreated" Pig 2.0 lungs compared to GalTKO.hCD55 lungs (Figure 42). The median survival time of Pig 2.0 lungs was 450 minutes (range 300 - 480 minutes) in the untreated group, versus 30 minutes (range 20 - 300 minutes) for reference lungs (P = 0.04), and 480 minutes (range 360 - 480 minutes) in the treated cohort, versus 300 minutes (range 145 - 360 minutes) (P = 0.009). The increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed in "untreated" Pig 2.0 lungs compared to GalTKO.hCD55 lungs (Figure 42). The median survival time of Pig 2.0 lungs was 450 minutes (range 300 - 480 minutes) in the untreated group, versus 30 minutes (range 20 - 300 minutes) for reference lungs (P = 0.04), and 480 minutes (range 360 - 480 minutes) in the treated cohort, versus 300 minutes (range 145 - 360 minutes) (P = 0.009). The increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed in "untreated" Pig 2.0 lungs compared to GalTKO.hCD55 lungs (Figure 42). Additional blood treatments with 1 - BIA and H - blocker attenuated the increase in PVR in both Pig 2.0 and the reference group. Neutrophil and platelet capture usually occurred within 5 - 15 minutes after perfusion and was not attenuated in relation to the Pig 2.0 multi - gene - transfected lung.

[0239]

[0332] These data demonstrate that the novel Pig 2.0 donor genetics protect the lung from PVR increase and lung injury and are associated with a significant improvement in lung survival in this stringent model. As already reported with other lung genetics, leukocyte and white cell capture was not prevented. The combination of transgenes expressed by the Pig 2.0 lung may be useful to achieve success in xenotransplantation of the lung and other organs.

[0240]

[0333] Transgene expression. RNAseq expression data showed that complement and cytotoxic genes were expressed in samples collected from payload 9 and payload 10 Pig 2.0 pigs (Figure 36). FACS data showed that complement and cytotoxic proteins were expressed in samples collected from payload 5, payload 9, and payload 10 pigs (Figure 37). All three payloads expressed complement (CD46, CD55, and CD59) and cytotoxic - related proteins (e.g., B2M, HLA - E, CD47). Furthermore, payload 5 expressed CD39 and payload 10 expressed PDL1. Performance in NHP varies greatly, but the gene expression profiles are similar among the 5 pigs carrying payload 5.

[0241]

[0334] The use of numerical values specified in this application is described as approximations through the minimum and maximum values specified within the recited range, unless otherwise explicitly stated, and the term "about" has been previously attached. The disclosure of a range is intended to be a continuous range that includes all values between the recited minimum and maximum values, as well as any range that can be formed through such values. The numerical values presented in this application represent various embodiments of the present disclosure.

[0242]

[0335] This disclosure is not intended to be exhaustive or to limit the technology to the exact forms disclosed herein. Specific embodiments are disclosed herein for illustrative purposes, but as will be recognized by those of ordinary skill in the relevant art, various equivalent modifications can be made without departing from the technology. In some cases, well-known structures and functions are not shown and / or not described in detail in order to avoid unnecessarily obscuring the description of the embodiments of the technology. The steps of a method can be presented in a specific order in this specification, but in alternative embodiments, the steps can have a different appropriate order. Similarly, specific embodiments of the technology disclosed in the context of a particular embodiment can be combined or excluded in other embodiments. Further, the advantages associated with specific embodiments have been disclosed in the context of those embodiments, but other embodiments can also exhibit such advantages, and not all embodiments are necessarily required to exhibit such advantages or other advantages disclosed herein within the scope of the technology. Accordingly, the present disclosure and related technologies can encompass other embodiments that are not explicitly shown and / or described herein.

[0243]

[0336] From the above, specific embodiments of the present disclosure have been described herein for purposes of illustration, but it is understood that various modifications can be made without departing from the scope of the present disclosure. Accordingly, the present disclosure is not limited except as by the appended claims.

[0244]

[0337] While specific embodiments of the present disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the present disclosure will become apparent to those skilled in the art upon review of this specification and the following claims. The full scope of the present disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations. This application includes the following inventions. [Item 1] An isolated cell, tissue, organ, or animal comprising a plurality of transgenes of at least two types selected from the group consisting of an inflammation response transgene, an immune response transgene, an immunomodulatory substance transgene, and combinations thereof. [Item 2] An isolated cell, tissue, organ, or animal comprising a plurality of transgenes, wherein the plurality of transgenes comprises at least one inflammation response transgene, at least one immune response transgene, and at least one immunomodulatory substance transgene. [Item 3] The isolated cell, tissue, organ, or animal according to Item 1 or 2, wherein the inflammation response transgene is selected from the group consisting of TNFα-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and combinations thereof. [Item 4] The isolated cell, tissue, organ, or animal according to Item 1 or 2, wherein the immune response transgene is selected from the group consisting of human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof. [Item 5] The immune regulatory substance-introducing gene is the isolated cell, tissue, organ, or animal according to Item 1 or 2, which is selected from the group consisting of programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof. [Item 6] The plurality of introduced genes further includes at least one coagulation response-introducing gene, which is the isolated cell, tissue, organ, or animal according to Item 1 or 2. [Item 7] The coagulation response-introducing gene is the isolated cell, tissue, organ, or animal according to Item 6, which is selected from the group consisting of cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. [Item 8] The plurality of introduced genes further includes at least one complement response-introducing gene, which is the isolated cell, tissue, organ, or animal according to Item 1 or 2. [Item 9] The complement response-introducing gene is the isolated cell, tissue, organ, or animal according to Item 8, which is selected from the group consisting of human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC-inhibitory factor (hCD59), and combinations thereof. [Item 10] An isolated cell, tissue, organ, or animal comprising six or more introduced genes independently selected from the group consisting of complement response-introducing genes, coagulation response-introducing genes, inflammatory response-introducing genes, immune response-introducing genes, and immune regulatory substance-introducing genes. [Item 11] The isolated cell, tissue, organ, or animal according to Item 10, which comprises 9, 10, 11, or 12 introduced genes. [Item 12] The complement response-introducing gene is the isolated cell, tissue, organ, or animal according to Item 10, which is selected from the group consisting of human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC-inhibitory factor (hCD59), and combinations thereof. [Item 13] The isolated cell, tissue, organ, or animal according to Item 10, wherein the coagulation response-introduced gene is selected from the group consisting of cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. [Item 14] The isolated cell, tissue, organ, or animal according to Item 10, wherein the inflammation response-introduced gene is selected from the group consisting of TNFα-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and combinations thereof. [Item 15] The isolated cell, tissue, organ, or animal according to Item 10, wherein the immune response-introduced gene is selected from the group consisting of human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof. [Item 16] The isolated cell, tissue, organ, or animal according to Item 10, wherein the immunomodulatory substance-introduced gene is selected from the group consisting of programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof. [Item 17] The isolated cell, tissue, organ, or animal according to any one of Items 10 to 16, wherein the six or more introduced genes are selected from the group consisting of hCD46, hCD55, hCD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1. [Item 18] The isolated cell, tissue, organ, or animal according to Item 17, wherein the cell, tissue, organ, or animal contains the hCD46, hCD55, hCD59, CD39, THBD, TFPI, A20, HO-1, CD47, HLA-E, B2M, and PD-L1 introduced genes or the THBD, TFPI, CD39, CD46, CD55, CD59, CD46, HO-1, A20, B2M, HLA-E SCT, and CD47 introduced genes. [Item 19] The isolated cell, tissue, organ, or animal according to Item 18, comprising the vector in one of FIGS. 17 to 20, 31, or 47 to 49. [Item 20] The isolated cell, tissue, organ, or animal according to any one of Items 10 to 19, wherein the at least six transgenes are expressed from a single locus. [Item 21] The isolated cell, tissue, organ, or animal according to any one of Items 10 to 20, wherein the at least six transgenes are expressed at a clinically effective level. [Item 22] The isolated cell, tissue, organ, or animal accordin...

Claims

1. Inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, and combinations thereof A combination of at least two types of multiple transgenes selected from the group consisting of: A cultured cell, tissue, organ, or animal.

2. An isolated cell, tissue, organ, or animal comprising a plurality of transgenes, said plurality The transgenes include at least one inflammatory response transgene, at least one immune response transgene, and and isolated cells, tissues, organs, and / or tissues containing at least one immunomodulator transgene. Officers, or animals.

3. The inflammatory response transgene may be TNFα-inducible protein 3 (A20), heme oxygenase Cluster of differentiation 47 (CD47), and combinations thereof The isolated cell, tissue, organ, or animal of claim 1 or 2, selected from the group consisting of:

4. The immune response transgenes include human leukocyte antigen-E (HLA-E), beta-2 microglobulin (β-2 microglobulin), and the like.

3. The method according to claim 1, wherein the aryl group is selected from the group consisting of aryl, arylphosphoric acid (B2M), ... An isolated cell, tissue, organ, or animal.

5. The immunomodulatory substance transgene is a gene encoding a programmed death ligand 1 (PD-L1), a Fas ligand, gando (FasL), and combinations thereof. The isolated cell, tissue, organ, or animal described.

6. 4. The method of claim 3, wherein the plurality of transgenes further comprises at least one coagulation response transgene.

3. An isolated cell, tissue, organ, or animal according to 1 or 2.

7. The coagulation response transgenes include cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. The isolated cell, tissue, organ, or animal of claim 6 .

8. The plurality of transgenes further comprises at least one complement response transgene.

3. An isolated cell, tissue, organ, or animal according to 1 or 2.

9. The complement response transgene may be human membrane cofactor protein (hCD46), human complement catabolite (hCD47), human CD55, human MAC-inhibitor factor (hCD59), and combinations thereof 9. The isolated cell, tissue, organ, or animal of claim 8, selected from the group consisting of:

10. Complement response transgene, coagulation response transgene, inflammatory response transgene, immune response transgene and an immunomodulatory substance transgene, An isolated cell, tissue, organ, or animal containing the transgene.

11. The isolated cell, tissue, organ, or animal may contain 9, 10, 11, or 12 transgenes.

11. The isolated cell, tissue, organ, or animal of claim 10, comprising a gene.

12. The complement response transgene may be human membrane cofactor protein (hCD46), human complement catabolite (hCD47), human CD55, human MAC-inhibitor factor (hCD59), and combinations thereof 11. The isolated cell, tissue, organ, or animal of claim 10, selected from the group consisting of:

13. The coagulation response transgenes include cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. The isolated cell, tissue, organ, or animal of claim 10 .

14. The inflammatory response transgene may be TNFα-inducible protein 3 (A20), heme oxygenase Cluster of differentiation 47 (CD47), and combinations thereof The isolated cell, tissue, organ, or animal of claim 10, selected from the group consisting of:

15. The immune response transgenes include human leukocyte antigen-E (HLA-E), beta-2 microglobulin (β-2 microglobulin), and the like.

11. The monoamine of claim 10, selected from the group consisting of phosphodiesterase (P2M), ... Isolated cells, tissues, organs, or animals.

16. The immunomodulatory substance transgene is a gene encoding a programmed death ligand 1 (PD-L1), a Fas ligand, gando (FasL), and combinations thereof. An isolated cell, tissue, organ, or animal.

17. The six or more transgenes are selected from hCD46, hCD55, hCD59, HLA-E, B 2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1 The isolated cell or composition according to any one of claims 10 to 16, selected from the group consisting of: tissue, organ, or animal.

18. The cells, tissues, organs, or animals may be selected from the group consisting of hCD46, hCD55, hCD59, CD39 , THBD, TFPI, A20, HO-1, CD47, HLA-E, B2M, and PD- L1 transgene or THBD, TFPI, CD39, CD46, CD55, CD59, C D46, HO-1, A20, B2M, HLA-E SCT, and CD47 transgenes.

20. The isolated cell, tissue, organ, or animal of claim 17.

19. The vector according to claim 18, comprising the vector according to any one of figures 17 to 20, 31 or 47 to 49. The isolated cells, tissues, organs, or animals described herein.

20. The at least six transgenes are expressed from a single locus.

10. An isolated cell, tissue, organ, or animal according to any one of claims 9.

21. 10. The method of claim 10, wherein the at least six transgenes are expressed at a clinically effective level. An isolated cell, tissue, organ, or animal according to any one of claims 1 to 20.

22. The claimed invention further comprises a genetically modified von Willebrand factor (vWF) gene.

22. The isolated cell, tissue, organ, or animal of any one of claims 10 to 21.

23. 23. The method of claim 22, wherein the modified vWF gene is humanized. tissue, organ, or animal.

24. The invention further includes the deletion, disruption, or inactivation of asialoglycoprotein receptor 1 (ASGR1). The isolated cell, tissue, organ, or animal according to any one of claims 10 to 23.

25. The method according to claim 1, further comprising deleting, disrupting or inactivating one or more carbohydrate antigen genes.

25. The isolated cell, tissue, organ, or animal of any one of claims 24.

26. The one or more carbohydrate antigen genes are β1,4 N-acetylgalactosaminyltransferase 1 (GGTA), β1,4 N-acetylgalactosaminyltransferase 2 ( B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase ( 26. The isolated cell, tissue or organ of claim 25, wherein the isolated cell, tissue or organ is selected from the group consisting of: , or animals.

27. The isolated cell, tissue, organ, or subject may be a porcine cell, a porcine tissue, a porcine organ, a porcine or or a progeny thereof. , or animals.

28. The isolated cells, tissues, organs, or animals may be PERV-free porcine cells, PERV-free porcine cells, 28. The isolated cell or tissue of claim 27, which is a PERV-containing pig tissue or a PERV-free pig. tissue, organ, or animal.

29. The isolated cell of any one of claims 1 to 28, wherein the organ is a kidney or a liver. Cell, tissue, organ, or animal.

30. Inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, and combinations thereof A vector comprising at least two types of multiple transgenes selected from the group consisting of -

31. A vector comprising a plurality of transgenes, the plurality of transgenes comprising at least one at least one inflammatory response transgene, at least one immune response transgene, and at least one immune A vector comprising an immunoregulatory substance transgene.

32. The inflammatory response transgene may be TNFα-inducible protein 3 (A20), heme oxygenase Cluster of differentiation 47 (CD47), and combinations thereof 32. The vector according to claim 30 or 31, selected from the group consisting of

33. Expression of at least a portion of the inflammatory response transgene can be mediated by a tissue-specific promoter, a ubiquitous promoter, or a ubiquitous promoter.

33. The method according to claim 30, wherein the promoter is a cyclic nucleotide sequence, ... The vector described in any one of claims 1 to 4.

34. The vector of claim 33, wherein the tissue-specific promoter is an endothelial-specific promoter. Kutor.

35. The immune response transgenes include human leukocyte antigen-E (HLA-E), beta-2 microglobulin (β-2 microglobulin), and the like.

32. The compound according to claim 30 or 31, selected from the group consisting of: phosphodiesterase (B2M), ... The vector described.

36. Expression of at least a portion of the immune response transgene is driven by a ubiquitous promoter.

36. The vector of claim 30, 31, or 35.

37. The immunomodulatory substance transgene is a gene encoding a programmed death ligand 1 (PD-L1), a Fas ligand, gando (FasL), and combinations thereof.

2. The vector described in 1.

38. 4. The method of claim 3, wherein the plurality of transgenes further comprises at least one coagulation response transgene.

32. The vector according to claim 30 or 31.

39. The coagulation response transgenes include cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. The vector of claim 38 .

40. Expression of at least a portion of the coagulation response transgene is driven by a tissue-specific promoter.

40. The vector of claim 38 or 39, which is driven.

41. 41. The method of claim 40, wherein the tissue-specific promoter is an endothelial-specific promoter. vector.

42. 42. The method of claim 41, wherein the endothelial specific promoter is a low-expressing endothelial specific promoter. The vector described.

43. The plurality of transgenes further comprises at least one complement response transgene.

32. The vector according to claim 30 or 31.

44. The complement response transgene may be human membrane cofactor protein (hCD46), human complement catabolite (hCD47), human CD55, human MAC-inhibitor factor (hCD59), and combinations thereof 44. The vector of claim 43, selected from the group consisting of:

45. Expression of at least a portion of the complement response transgene is driven by a ubiquitous promoter.

45. The vector of claim 43 or 44.

46. Complement response transgene, coagulation response transgene, inflammatory response transgene, immune response transgene and an immunomodulatory substance transgene, A vector containing a transgene.

47. 47. The method of claim 46, wherein the vector comprises 9, 10, 11, or 12 transgenes. Vector.

48. The complement response transgene may be human membrane cofactor protein (hCD46), human complement catabolite (hCD47), human CD55, human MAC-inhibitor factor (hCD59), and combinations thereof 47. The vector of claim 46, wherein the vector is selected from the group consisting of:

49. Expression of at least a portion of the complement response transgene is driven by a ubiquitous promoter. The vector according to any one of claims 46 to 48.

50. The coagulation response transgenes include cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. The vector of claim 46 .

51. Expression of at least a portion of the coagulation response transgene is driven by a tissue-specific promoter. The vector according to any one of claims 43 to 50, which is driven.

52. 52. The method of claim 51, wherein the tissue-specific promoter is an endothelial-specific promoter. vector.

53. 53. The method of claim 52, wherein the endothelial specific promoter is a low-expressing endothelial specific promoter. The vector described.

54. The inflammatory response transgene may be TNFα-inducible protein 3 (A20), heme oxygenase Cluster of differentiation 47 (CD47), and combinations thereof 47. The vector of claim 46, selected from the group consisting of

55. Expression of at least a portion of the inflammatory response transgene can be mediated by a tissue-specific promoter, a ubiquitous promoter, or a ubiquitous promoter. Any of claims 46 to 54, driven by a promoter, a promoter, or any combination thereof. The vector described in any one of claims 1 to 4.

56. 56. The method of claim 55, wherein the tissue-specific promoter is an endothelial-specific promoter. vector.

57. The immune response transgenes include human leukocyte antigen-E (HLA-E), beta-2 microglobulin (β-2 microglobulin), and the like.

47. The betaine of claim 46, selected from the group consisting of B2M, B2P, B2R, B2S, B2T, B2T2, B2T3, B2T4, B2T5, B2T6, B2T7, B2T8, B2T9, B2T10, B2T11, B2T22, B2T12, B2T13, B2T14, B2T15, B2T23 Kutor.

58. Expression of at least a portion of the immune response transgene is driven by a ubiquitous promoter. The vector according to any one of claims 46 to 57.

59. The immunomodulatory substance transgene is a gene encoding a programmed death ligand 1 (PD-L1), a Fas ligand, gando (FasL), and combinations thereof. Vector.

60. The six or more transgenes are selected from hCD46, hCD55, hCD59, HLA-E, B 2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1 The vector according to any one of claims 46 to 59, selected from the group consisting of:

61. The vectors include hCD46, hCD55, hCD59, CD39, THBD, TFP I, A20, HO-1, CD47, HLA-E, B2M, and PD-L1 transgenes, or THBD, TFPI, CD39, CD46, CD55, CD59, CD46, HO-1, 61. The method of claim 60, comprising transgenes A20, B2M, HLA-E SCT, and CD47. Vector.

62. 62. The vector according to claim 61, comprising the vector in one of figures 17-20, 31, or 47-49. Vector on the web.

63. 46-6, wherein the at least six transgenes are expressed from a single locus.

3. A vector according to any one of claims 2 to 3.

64. A method for producing the isolated cell, tissue or animal according to any one of claims 1 to 29.

65. Single-copy polycistronic transgene integration via transposition, recombinase-mediated cascades Mono / bi-allelic site-specific integration via reverse transcriptional exchange (RMCE), genome replacement, endogenous 65. The method of claim 64, comprising gene humanization, gene humanization, or any combination thereof.

66. had reduced liver injury and / or stable coagulation when exposed to non-porcine blood A transgenic pig liver comprising: The decreased liver damage may include decreased bile production, one or more metabolic enzymes, and one or more serum electrolytes. and The stable coagulation is characterized by the prothrombin time (PT) and international normalized ratio (PT-NIR), Fibrinogen levels (FIB) and lower activated partial thromboplastin time Transgenic pig liver, as assessed by determining one or more levels of APTT. 。

67. The metabolic enzymes are alanine aminotransferase (ALT), aspartate aminotransferase (ASAT), and albumin (ALB).

67. The transgenic pig liver of claim 66.

68. 67. The method of claim 66, wherein the serum electrolyte is potassium (K) and / or sodium (Na).

68. A transgenic pig liver according to claim 67.

69. (a) Inflammatory response transgenes, immune response transgenes, immunomodulatory substance transgenes, and the like A plurality of transgenes of at least two types selected from the group consisting of any combination of the above. Including, (b) Substantially no production of xenotropic porcine endogenous retrovirus (PERV) virions. stomach, An isolated porcine cell, tissue, organ, or animal.

70. (a) a plurality of transgenes, said plurality of transgenes comprising at least one inflammatory response A transgene, at least one immune response transgene, and at least one immunomodulator. Containing a transgene, (b) Substantially no production of xenotropic porcine endogenous retrovirus (PERV) virions. stomach, An isolated porcine cell, tissue, organ, or animal.

71. The isolated porcine cell, tissue, organ, or animal is capable of expressing PERV polymerase (pol 71. The isolated porcine cell or tissue of claim 69 or 70, which is substantially free of the enzyme activity of , organ, or animal.

72. The isolated porcine cells, tissues, organs, or animals contain a functional full-length PERV pol gene.

71. The isolated porcine cell or cell composition of claim 69 or 70, wherein the expression of the protein is substantially absent. tissue, organ, or animal.

73. At least about 97% of the coding sequence of the genomic PERV pol copy is disrupted; 71. An isolated porcine cell, tissue, organ or animal according to claim 69 or 70.

74. Substantially all of the coding sequences of the genomic PERV pol copy are disrupted.

71. An isolated porcine cell, tissue, organ, or animal according to claim 69 or 70.

75. At least one copy of PERV pol mRNA transcribed from the genomic PERV pol copy 71. The isolated porcine gene of claim 69 or 70, wherein at least about 97% of the coding sequence is disrupted. A cell, tissue, organ, or animal.

76. The disruption is at least one nucleotide position in the PERV pol coding sequence. Any of claims 73 to 75, comprising at least one frameshift insertion / deletion (indel). An isolated porcine cell, tissue, organ, or animal according to any one of claims 1 to 4.

77. The isolated porcine cells, tissues, organs, or animals contain functional PERV gag and / or or env protein. A cultured cell, tissue, organ, or animal.

78. The isolated porcine cells, tissues, organs, or animals contain PERV gag and / or e 78. The method of claim 69, comprising the intact coding sequence of substantially all genomic copies of the nv gene. An isolated cell, tissue, organ or animal of a pig according to any one of claims 1 to 4.

79. The isolated porcine cells, tissues, organs, or animals are capable of transmitting reduced PERV to human cells.

80. An isolated cell or tissue of a pig according to any one of claims 69 to 78, which exhibits infectivity; Organs or animals.

80. The isolated porcine cells, tissues, organs, or animals have a reduced 80. The pig monoclonal antibody of claim 79, which exhibits at least 200-fold lower PERV infectivity for human cells. Isolated cells, tissues, organs, or animals.

81. The isolated porcine cell, tissue, organ, or animal is a porcine animal that is Isolated porcine cells, tissues, organs, or animals lacking RNA-targeted genome modifications.

81. The method of claim 79 or 80, which exhibits reduced PERV infectivity in human cells compared to the method of claim 80.

2. An isolated cell, tissue, organ, or animal of a pig.

82. PERV infectivity can be measured by measuring the infectivity of isolated cells, tissues, organs, or animals of the pig or their Any of claims 79 to 81, characterized in that the surgical explant is co-cultured with human cells. An isolated porcine cell, tissue, organ, or animal according to any one of claims 1 to 4.

83. PERV infectivity was determined by co-culturing extracellular fluid from the pigs with human cells. The isolated pig according to any one of claims 79 to 81, which is a pig animal. A cell, tissue, organ, or animal.

84. PERV infectivity was assessed by assaying for the presence of PERV genomic sequences or antigens after the co-culture. By analyzing the human cells by sequencing, PCR, or immunoassay, 84. The isolated porcine cell of claim 82 or 83, which is at least partially confirmed to be Tissues, organs, or animals.

85. The PERV may be PERV-A, PERV-B, PERV-A / C, or a recombinant variant thereof. The isolated cells, tissues, or organs of a pig according to any one of claims 69 to 84, which are heterologous. Officers, or animals.

86. The inflammatory response transgene may be TNFα-inducible protein 3 (A20), heme oxygenase cluster of differentiation 47 (CD47), and any combination thereof. The isolated porcine cell according to any one of claims 69 to 85, selected from the group consisting of: Tissues, organs, or animals.

87. The immune response transgenes include human leukocyte antigen-E (HLA-E), beta-2 microglobulin (β-2 microglobulin), and the like. 69 to 8. The compound according to claim 69, wherein the compound is selected from the group consisting of phosphorus (B2M), phosphorus (B2M), and any combination thereof.

7. An isolated porcine cell, tissue, organ, or animal according to any one of claims 6.

88. The immunomodulatory substance transgene is a gene encoding a programmed death ligand 1 (PD-L1), a Fas ligand, gando (FasL), and any combination thereof.

88. An isolated porcine cell, tissue, organ, or animal according to any one of claims 1 to 87.

89. 4. The method of claim 3, wherein the plurality of transgenes further comprises at least one coagulation response transgene.

90. An isolated porcine cell, tissue, organ, or animal according to any one of claims 69 to 88.

90. The coagulation response transgenes include cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and any combination thereof.

90. The isolated porcine cell, tissue, organ, or animal of claim 89, selected from:

91. The plurality of transgenes further comprises at least one complement response transgene.

91. An isolated porcine cell, tissue, organ, or animal according to any one of claims 69 to 90.

92. The complement response transgene may be human membrane cofactor protein (hCD46), human complement catabolite (hCD47), human CD55, human MAC-inhibitor factor (hCD59), and any combination thereof 92. The isolated porcine cell, tissue or organ of claim 91, selected from the group consisting of: , or animals.

93. The isolated porcine cell, tissue, organ, or animal contains genomic integration of the transgene.

93. The isolated porcine cell, tissue, organ or animal.

94. The isolated porcine cell, tissue, organ, or animal is capable of germline transmission of the transgene.

94. The isolated porcine cell, tissue, organ or animal of claim 93, comprising a genomic integration capable of thing.

95. The porcine cell, tissue, organ, or animal is capable of expressing a detectable gene transcribed from the transgene. The isolated porcine cell of any one of claims 69 to 94, which expresses the mRNA of the bell. Cell, tissue, organ, or animal.

96. The pig cell, tissue, organ, or animal is capable of expressing a detectable gene translated from the transgene. The isolated pig according to any one of claims 69 to 95, expressing a protein of the bell. A cell, tissue, organ, or animal.

97. The pig cell, tissue, organ, or animal is transformed with mRNA transcribed from the transgene. Any of claims 69 to 95, which expresses a translated, therapeutically effective level of protein.

2. An isolated porcine cell, tissue, organ, or animal according to claim 1.

98. (a) Complement response transgene, coagulation response transgene, inflammatory response transgene, immune response transgene and an immunomodulatory substance transgene, containing the above transgene, (b) Substantially no production of xenotropic porcine endogenous retrovirus (PERV) virions. stomach, An isolated porcine cell, tissue, organ, or animal.

99. The isolated porcine cell, tissue, organ, or animal is 99. The isolated porcine cell, tissue, organ, or animal of claim 98, comprising 12 or 13 .

100. The complement response transgene may be human membrane cofactor protein (hCD46), human complement catabolite (hCD47), human CD55, human MAC-inhibitor factor (hCD59), and combinations thereof 100. The isolated porcine cell, tissue or organ of claim 98 or 99, selected from the group consisting of: , or animals.

101. Transcription of at least a portion of the complement response transgene is under the transcriptional control of a ubiquitous promoter.

101. The isolated porcine cell, tissue, organ, or animal of claim 100.

102. The coagulation response transgenes include cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof. The isolated porcine cell, tissue or organ according to any one of claims 98 to 101, , or animals.

103. Transcription of at least a portion of the coagulation response transgene is regulated by transcriptional regulation of a tissue-specific promoter. The isolated porcine cell, tissue, or organ according to any one of claims 98 to 102, Officers, or animals.

104. The method of claim 103, wherein the tissue-specific promoter is an endothelial-specific promoter. An isolated porcine cell, tissue, organ, or animal.

105. 104. The method of claim 103, wherein the endothelial specific promoter is a low-expressing endothelial specific promoter.

2. An isolated porcine cell, tissue, organ, or animal according to claim 1.

106. The inflammatory response transgene may be TNFα-inducible protein 3 (A20), heme oxygenase Cluster of differentiation 47 (CD47), and combinations thereof The isolated porcine cell or tissue according to any one of claims 98 to 105, Organs or animals.

107. Transcription of at least a portion of the inflammatory response transgene can be mediated by a tissue-specific promoter, a ubiquitous promoter, or a ubiquitous promoter. Any of claims 98 to 106, wherein the promoter is a nucleotide sequence of the ... An isolated porcine cell, tissue, organ or animal as described in any one of claims 1 to 4.

108. The method of claim 107, wherein the tissue-specific promoter is an endothelial-specific promoter. An isolated porcine cell, tissue, organ, or animal.

109. The immune response transgenes include human leukocyte antigen-E (HLA-E), beta-2 microglobulin (β-2 microglobulin), and the like.

109. The method of claim 98, wherein the aryl group is selected from the group consisting of aryl, arylphosphoric acid (B2M), ...

2. An isolated porcine cell, tissue, organ or animal according to any one of claims 1 to 11.

110. Expression of at least a portion of the immune response transgene is driven by a ubiquitous promoter. The isolated porcine cell, tissue or organ according to any one of claims 98 to 109, Or animals.

111. The immunomodulatory substance transgene is a gene encoding a programmed death ligand 1 (PD-L1), a Fas ligand, gando (FasL), and combinations thereof.

1. An isolated porcine cell, tissue, organ, or animal according to any one of claims 0 to 10.

112. The six or more transgenes are selected from hCD46, hCD55, hCD59, HLA-E, B 2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1 The isolated porcine cell of any one of claims 98 to 111, wherein the isolated porcine cell is selected from the group consisting of: Cell, tissue, organ, or animal.

113. The cells, tissues, organs, or animals may be selected from the group consisting of hCD46, hCD55, hCD59, CD39 , THBD, TFPI, A20, HO-1, CD47, HLA-E, B2M, and PD- L1 transgene or THBD, TFPI, CD39, CD46, CD55, CD59, C D46, HO-1, A20, B2M, HLA-E SCT, and CD47 transgenes. The isolated porcine cell, tissue, organ or animal.

114. 113. The method of claim 98, wherein the transgene is expressed from a single locus.

2. An isolated porcine cell, tissue, organ or animal according to claim 1.

115. Any of claims 98 to 114, wherein the transgene is transcribed into three or less cistrons.

2. An isolated porcine cell, tissue, organ, or animal according to claim 1.

116. A cistron contains coding sequences for at least three different transgenes, said at least Three different transgenes were used to encode the porcine teschovirus 2A (P2A) peptide.

116. The isolated porcine cell, tissue, organ or method of claim 115, wherein the isolated porcine cell, tissue, organ or method is separated by a sequence. animal.

117. Further comprising the deletion, disruption, or inactivation of one or more heterologous carbohydrate antigen production genes; 117. An isolated cell, tissue, organ or animal according to any one of claims 69 to 116.

118. The one or more heterologous carbohydrate antigen producing genes may be glycoprotein α-galactosyltransferase. GGTA, β1,4 N-acetylgalactosaminyltransferase 1 B4GalNT2, cytidine monophosphate-N-acetylneuraminic acid hydroxylase 118. The isolated cell of claim 117, wherein the isolated cell is selected from the group consisting of: , tissue, organ, or animal.

119. 2 copies of GGTA, 4 copies of B4GALNT2, or 2 copies of CMAH, or 118. The method of claim 118, comprising the deletion, disruption, or inactivation of any of these in any combination. Isolated cells, tissues, organs, or animals.

120. (a) Complement response transgene, coagulation response transgene, inflammatory response transgene, immune response transgene and an immunomodulatory substance transgene, containing the above transgene, (b) Substantially no production of xenotropic porcine endogenous retrovirus (PERV) virions. Ku, (c) two copies of GGTA, four copies of B4GALNT2, or two copies of CMAH; or any combination thereof, including deletion, disruption, or inactivation. An isolated porcine cell, tissue, organ, or animal.

121. The cells, tissues, organs, or animals, when exposed to human blood or a fraction thereof, produce human antibodies. The isolated pig according to any one of claims 69 to 120, which exhibits reduced binding to the body. A cell, tissue, organ, or animal.

122. The cells, tissues, organs, or animals, when exposed to human blood or a fraction thereof, produce human antibodies.

122. The isolated porcine cell of claim 121, which exhibits at least about 5-fold reduced binding to the body. , tissue, organ, or animal.

123. The cells, tissues, organs, or animals, when exposed to human blood or a fraction thereof, produce human antibodies.

122. The isolated porcine cell of claim 121, which exhibits at least about 10-fold reduced binding to the body. Cell, tissue, organ, or animal.

124. The isolated antibody according to any one of claims 121 to 123, wherein the antibody is an IgM antibody. porcine cells, tissues, organs, or animals.

125. The isolated antibody according to any one of claims 121 to 123, wherein the antibody is an IgG antibody. porcine cells, tissues, organs, or animals.

126. The cells, tissues, organs, or animals exhibit reduced natural proliferation and proliferation upon exposure to human blood. The isolated antibody according to any one of claims 69 to 125, which exhibits killer (NK) cytotoxicity. Porcine cells, tissues, organs, or animals.

127. The cell, tissue, organ, or animal has at least about 20% 127. The isolated porcine cell of claim 126, which exhibits low natural killer (NK) cytotoxicity. Cell, tissue, organ, or animal.

128. The cells, tissues, organs, or animals exhibit reduced complement expression when exposed to human blood-derived complement. The isolated porcine cell or tissue according to any one of claims 69 to 127, which exhibits complement toxicity. , organ, or animal.

129. The cell, tissue, organ, or animal, when exposed to complement derived from human blood, 129. The isolated porcine cell, tissue, or organ of claim 128, which exhibits about 5-fold less complement toxicity than the isolated porcine cell, tissue, or organ of claim 128. Or animals.

130. The cells, tissues, organs, or animals exhibit reduced TAT complexes when exposed to human blood. The isolated porcine cell or tissue according to any one of claims 69 to 129, which exhibits somatogenesis. Organs or animals.

131. The cell, tissue, organ, or animal is at least about three-fold reduced in cell viability when exposed to human blood.

131. The isolated porcine cell, tissue or organ of claim 130, which exhibits reduced TAT complex formation. , or animals.

132. The cell, tissue, organ, or animal exhibits at least about 10-fold increased cellular proliferation and proliferation when exposed to human blood.

131. The isolated porcine cell, tissue, or organ of claim 130, which exhibits reduced TAT complex formation. Officers, or animals.

133. Normal blood counts of white blood cells, platelets, monocytes, neutrophils, eosinophils, or any combination of these The isolated porcine cell of any one of claims 69 to 132, which is an animal. tissue, organ, or animal.

134. Serum alkaline phosphatase level, aspartame aminoacyltransferase levels, alanine aminotransferase levels, ALT / AST levels, cholesterol levels total bilirubin, triglycerides, or albumin / globulin levels, or 7. The animal of claim 6, wherein the animal exhibits normal liver function as assessed by any combination of 9-133. An isolated porcine cell, tissue, organ, or animal according to any one of claims 9 to 133.

135. Serum creatine kinase level, creatine kinase-MB level, lactate dehydrogenase or any combination thereof, showing normal cardiac function as assessed by The isolated porcine cell or tissue according to any one of claims 69 to 134, which is an animal. Organs or animals.

136. as assessed by serum creatinine level, urea level, or a combination of both The isolated animal according to any one of claims 69 to 135, which is an animal exhibiting normal kidney function. porcine cells, tissues, organs, or animals.

137. When assessed by thrombin time, prothrombin level, or a combination of both The isolated animal according to any one of claims 69 to 136, which is an animal exhibiting normal coagulation function in vivo.

2. A cultured porcine cell, tissue, organ, or animal.

138. (a) α-galactosyltransferase 1 (GGTA), β1,4 N-acetylglucosamine Galactosaminyltransferase 2 (B4GalNT2), or cytidine monophosphate acid-N-acetylneuraminic acid hydroxylase (CMAH), or a combination thereof deletion, disruption, or inactivation of one or more heterologous carbohydrate antigen producing genes, including (b) the transgene; (c) the absence of production of xenotropic porcine endogenous retrovirus (PERV) virions; or teeth (d) any combination thereof; The genes (a) to (d) are capable of being transmitted to offspring animals by normal Mendelian inheritance. The isolated pig according to any one of claims 69 to 137, which is an animal. A cell, tissue, organ, or animal.

Images