Lipid compounds and lipid nanoparticle compositions
The development of lipid nanoparticles using a novel lipid compound addresses the challenges of low cellular permeability and degradation in nucleic acid therapeutics, enhancing delivery efficiency and therapeutic efficacy.
Patent Information
- Application Number
- JP2025050091
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-08
- Filing Date
- 2025-03-25
- Publication Date
- 2025-06-19
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current nucleic acid therapeutics face challenges such as low cellular permeability and high sensitivity to degradation, particularly for RNA-containing molecules, limiting their effective delivery for therapeutic and prophylactic purposes.
Development of a lipid compound, potentially in the form of formula (I) or its derivatives, which can be used to formulate lipid nanoparticles. These nanoparticles, when combined with nucleic acid molecules like mRNA, antisense RNA, or other therapeutic agents, enhance delivery efficiency by improving cellular uptake and stability.
The use of these lipid nanoparticles effectively increases the delivery efficiency of nucleic acid molecules, ensuring sufficient activity, optimal pharmacokinetics, and improved therapeutic outcomes, including expression of mRNA after delivery.
Smart Images

Figure 2025092522000001 
Figure 2025092522000002 
Figure 2025092522000003
Abstract
Description
Technical Field
[0001] 1. Sequence Listing This specification is being filed together with a computer-readable form (CRF) copy of the sequence listing. The CRF, entitled 14639-019-146_SeqListing_ST25.txt, was created on December 20, 2021, is 627 bytes in size, and is hereby incorporated by reference in its entirety.
[0002] 2. Technical Field The present disclosure generally relates to lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-conjugated lipids, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules including nucleic acid mimetics such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholinos) both in vitro and in vivo for therapeutic or prophylactic purposes, including vaccination.
Background Art
[0003] 3. Background Art Therapeutic nucleic acids have the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other treatments for genetic diseases. Since the first clinical studies on therapeutic nucleic acids were initiated in the 2000s, significant progress has been made through the design of nucleic acid molecules and their delivery methods. However, nucleic acid therapeutics still face several challenges, including low cellular permeability and high sensitivity to the degradation of certain nucleic acid molecules containing RNA. Therefore, there is a need to develop new nucleic acid molecules, as well as related methods and compositions that facilitate their delivery in vitro or in vivo for therapeutic and / or prophylactic purposes. Lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-conjugated lipids, to form lipid nanoparticles for the delivery of therapeutic agents. There is a need to develop new lipid compounds (e.g., cationic lipid compounds) that result in efficient delivery of therapeutic agents, sufficient activity of therapeutic agents (e.g., expression of mRNA after delivery), optimal pharmacokinetics, and / or other suitable physiological, biological, and / or therapeutic properties.
Summary of the Invention
[0004] 4. Summary of the Invention In one embodiment, provided herein is a lipid compound, including its pharmaceutically acceptable salts, prodrugs, or stereoisomers, that can be used alone or in combination with other lipid components and / or polymers, such as neutral lipids, charged lipids, steroids (e.g., including all sterols), and / or their analogs, and / or polymer-conjugated lipids, to form lipid nanoparticles for the delivery of therapeutic agents (e.g., nucleic acid molecules including nucleic acid mimics such as locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino). In some examples, the lipid nanoparticles are used to deliver nucleic acids such as antisense RNA and / or messenger RNA. Methods for the use of such lipid nanoparticles for the treatment of various diseases or conditions, such as those caused by infectious entities and / or protein deficiencies, are also provided.
[0005] In one embodiment, provided herein is a compound of formula (I),
Chemical Formula
[0006]
[0007] In one embodiment, provided herein is a nanoparticle composition comprising a compound provided herein and a therapeutic or prophylactic agent. In one embodiment, the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.
Mode for Carrying Out the Invention
[0008] 5. Mode for Carrying Out the Invention 5.1 General Techniques The techniques and procedures described or referenced herein are generally understood and / or commonly used by those skilled in the art using conventional methodologies, such as the widely used methodologies described by Sambrook et al., Molecular Cloning: A Laboratory Manual (3d ed. 2001), Current Protocols in Molecular Biology (Ausubel et al. eds., 2003), etc.
[0009] 5.2 Terms Unless otherwise indicated, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of interpreting this specification, the following explanations of terms apply, and where appropriate, terms used in the singular also include the plural and vice versa. All patents, applications, published applications, and other publications are hereby incorporated by reference into this specification. In the event of any conflict between the explanation of any term described herein and any document incorporated by reference into this specification, the explanation of the term described below shall prevail.
[0010] As used herein, unless otherwise specified, the term "lipid" refers to a group of organic compounds that includes, but is not limited to, esters of fatty acids, and is generally characterized by being sparingly soluble in water but soluble in many nonpolar organic solvents. Lipids are generally sparingly soluble in water but have limited water solubility, and there are specific categories of lipids (e.g., lipids modified by polar groups, such as DMG-PEG2000) that can dissolve in water under certain conditions. Known types of lipids include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three classes: (1) "simple lipids" including fats, oils, and waxes; (2) "complex lipids" including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derived lipids" such as steroids. Further, as used herein, lipid also encompasses lipidoid compounds. The term "lipidoid compound," also simply referred to as "lipidoid," refers to lipid-like compounds (e.g., amphiphilic compounds having lipid-like physical properties).
[0011] The term "lipid nanoparticle" or "LNP" refers to particles having at least one dimension on the nanometer (nm) order (e.g., 1 to 1,000 nm) that contain one or more lipid molecules. The LNPs provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP contains a non-lipid payload molecule that is either partially or fully encapsulated inside a lipid shell. In particular, in some embodiments, the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid components of the LNP include at least one cationic lipid. Without being bound by theory, it is believed that the cationic lipid can interact with the negatively charged payload molecule and promote the incorporation and / or encapsulation of the payload into the LNP during LNP formation. Other lipids that can form part of the LNPs provided herein include, but are not limited to, neutral lipids such as steroids and charged lipids, polymer-conjugated lipids, and various zwitterionic lipids. In certain embodiments, the LNPs according to the present disclosure include one or more lipids of formula (I) (and its sub-formulas) described herein.
[0012] The term "cationic lipid" refers to any lipid that is positively charged at any pH value or hydrogen ion activity of its environment or can be positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use). Thus, the term "cationic" encompasses both "permanently cationic" and "cationizable". In certain embodiments, the positive charge in the cationic lipid results from the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid includes a zwitterionic lipid that is positively charged in its intended use environment (e.g., at physiological pH). In certain embodiments, the cationic lipid is one or more lipids of formula (I) (and its sub-formulas) described herein.
[0013] The term "polymer-conjugated lipid" refers to a molecule that includes both a lipid moiety and a polymer moiety. An example of a polymer-conjugated lipid is a pegylated lipid (PEG-lipid) in which the polymer moiety includes polyethylene glycol.
[0014] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or a neutral zwitterionic form within a selected pH value, or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the environment of the intended use of the lipid, such as physiological pH. By way of non-limiting example, neutral lipids that may be used in connection with the present disclosure include phosphatidylcholines such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl)dimethylammonio)ethyl hydrogen phosphate (DOCP), sphingomyelin (SM), ceramides, steroids such as sterols and their derivatives, but are not limited thereto. The neutral lipids provided herein may be synthesized or derived (isolated or modified) from natural sources or compounds.
[0015] The term "charged lipid" encompasses any lipid molecule that exists in either a positively charged or negatively charged form within a selected pH or selected pH range. In some embodiments, the selected pH value or range corresponds to the pH conditions in the environment of the intended use of the lipid, such as physiological pH. By way of non-limiting example, charged lipids that may be used in connection with the present disclosure include phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethanecarbamoyl sterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) sodium salt (DOPG-Na), and 1,2-dioleoyl-sn-glycero-3-phosphate sodium salt (DOPA-Na), but are not limited thereto. The charged lipids provided herein can be synthesized or derived (isolated or modified) from natural sources or compounds.
[0016] As used herein, unless otherwise specified, the term "alkyl" refers to a straight or branched hydrocarbon chain radical consisting only of saturated carbon and hydrogen atoms. In one embodiment, the alkyl group has, for example, from 1 to 24 carbon atoms (C1-C 24 alkyl), from 4 to 20 carbon atoms (C4-C 20 alkyl), from 6 to 16 carbon atoms (C6-C 16 alkyl), from 6 to 9 carbon atoms (C6-C9 alkyl), from 1 to 15 carbon atoms (C1-C 15 alkyl), from 1 to 12 carbon atoms (C1-C 12(alkyl), having 1 to 8 carbon atoms (C1-C8 alkyl) or 1 to 6 carbon atoms (C1-C6 alkyl), which are bonded to the remainder of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl, etc. Unless otherwise specified, the alkyl group is optionally substituted.
[0017] As used herein, unless otherwise specified, the term "alkenyl" refers to a straight-chain or branched hydrocarbon chain radical consisting only of carbon and hydrogen atoms containing one or more carbon-carbon double bonds. The term "alkenyl" also includes radicals having "cis" and "trans" configurations, or alternatively "E" and "Z" configurations, as understood by those skilled in the art. In one embodiment, the alkenyl group has, for example, 2 to 24 carbon atoms (C2-C 24 alkenyl), 4 to 20 carbon atoms (C4-C 20 alkenyl), 6 to 16 carbon atoms (C6-C 16 alkenyl), 6 to 9 carbon atoms (C6-C9 alkenyl), 2 to 15 carbon atoms (C2-C 15 alkenyl), 2 to 12 carbon atoms (C2-C 12 alkenyl), 2 to 8 carbon atoms (C2-C8 alkenyl) or 2 to 6 carbon atoms (C2-C6 alkenyl), which are bonded to the remainder of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. Unless otherwise specified, the alkenyl group is optionally substituted.
[0018] As used herein, unless otherwise specified, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting only of carbon and hydrogen atoms containing one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, 2 to 24 carbon atoms (C2-C 24 alkynyl), 4 to 20 carbon atoms (C4-C 20 alkynyl), 6 to 16 carbon atoms (C6-C 16 alkynyl), 6 to 9 carbon atoms (C6-C9 alkynyl), 2 to 15 carbon atoms (C2-C 15 alkynyl), 2 to 12 carbon atoms (C2-C 12 alkynyl), 2 to 8 carbon atoms (C2-C8 alkynyl) or 2 to 6 carbon atoms (C2-C6 alkynyl), which are attached to the remainder of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, etc. Unless otherwise specified, the alkynyl group is optionally substituted.
[0019] As used herein, unless otherwise specified, the term "alkylene" or "alkylene chain" refers to a straight or branched polyvalent (e.g., divalent or trivalent) hydrocarbon chain that links the remainder of the molecule to a saturated radical group (or groups) consisting only of carbon and hydrogen atoms. In one embodiment, the alkylene has, for example, 1 to 24 carbon atoms (C1-C 24 alkylene), 1 to 15 carbon atoms (C1-C 15 alkylene), 1 to 12 carbon atoms (C1-C 12It has (an alkylene), 1 to 8 carbon atoms (C1-C8 alkylene), 1 to 6 carbon atoms (C1-C6 alkylene), 2 to 4 carbon atoms (C2-C4 alkylene), or 1 to 2 carbon atoms (C1-C2 alkylene). Examples of the alkylene group include, but are not limited to, methylene, ethylene, propylene, etc. The alkylene chain is bonded to the rest of the molecule via a single bond and to the radical group via a single bond. The bonding points of the alkylene chain to the rest of the molecule and the radical group(s) can be via one carbon or any two (or more) carbons within the chain. Unless otherwise specified, the alkylene chain is optionally substituted.
[0020] As used herein, unless otherwise specified, the term "alkenylene" refers to a straight-chain or branched polyvalent (e.g., divalent or trivalent) hydrocarbon chain consisting only of carbon and hydrogen atoms containing one or more carbon-carbon double bonds, connecting the rest of the molecule to a radical group (or groups). In one embodiment, the alkenylene has, for example, 2 to 24 carbon atoms (C2-C 24 alkenylene), 2 to 15 carbon atoms (C2-C 15 alkenylene), 2 to 12 carbon atoms (C2-C 12 alkenylene), 2 to 8 carbon atoms (C2-C8 alkenylene), 2 to 6 carbon atoms (C2-C6 alkenylene), or 2 to 4 carbon atoms (C2-C4 alkenylene). Examples of the alkenylene include, but are not limited to, ethenylene, propenylene, n-butenylene, etc. The alkenylene is bonded to the rest of the molecule via a single bond or a double bond and to the radical group via a single bond or a double bond. The bonding points of the alkenylene to the rest of the molecule and the radical group(s) can be via one carbon or any two (or more) carbons within the chain. Unless otherwise specified, the alkenylene is optionally substituted.
[0021] As used herein, unless otherwise specified, the term "cycloalkyl" consists of only carbon and hydrogen atoms and refers to a saturated, non-aromatic monocyclic or polycyclic hydrocarbon radical. The cycloalkyl group may include a fused or bridged ring system. In one embodiment, cycloalkyl has, for example, 3 to 15 ring carbon atoms (C3-C 15 cycloalkyl), 3 to 10 ring carbon atoms (C3-C 10 cycloalkyl), or 3 to 8 ring carbon atoms (C3-C8 cycloalkyl). The cycloalkyl is attached to the remainder of the molecule by a single bond. Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Unless otherwise specified, the cycloalkyl group is optionally substituted.
[0022] As used herein, unless otherwise specified, the term "cycloalkylene" is a polyvalent (e.g., divalent or trivalent) cycloalkyl group. Unless otherwise specified, the cycloalkylene group is optionally substituted.
[0023] As used herein, unless otherwise specified, the term "cycloalkenyl" consists of only carbon and hydrogen atoms and refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical containing one or more carbon-carbon double bonds. The cycloalkenyl may include a fused or bridged ring system. In one embodiment, cycloalkyl has, for example, 3 to 15 ring carbon atoms (C3-C 15 cycloalkenyl), 3 to 10 ring carbon atoms (C3-C 10It has (cycloalkenyl), or cycloalkenyl having 3 to 8 ring carbon atoms (C3-C8 cycloalkenyl). The cycloalkenyl is bonded to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl radicals include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, etc. Unless otherwise specified, the cycloalkenyl group is optionally substituted.
[0024] As used herein, unless otherwise specified, the term "cycloalkenylene" is a polyvalent (e.g., divalent or trivalent) cycloalkenyl group. Unless otherwise specified, the cycloalkenylene group is optionally substituted.
[0025] As used herein, unless otherwise specified, the term "heterocyclyl" refers to a non-aromatic radical monocyclic or polycyclic moiety containing one or more (e.g., one, one or two, 1 - 3, or 1 - 4) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl can be attached to the main structure at any heteroatom or carbon atom. The heterocyclyl group can be monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring systems, and the polycyclic ring systems can be fused, bridged, or spiro ring systems. The heterocyclyl polycyclic ring system can contain one or more heteroatoms within one or more rings. The heterocyclyl group can be saturated or partially unsaturated. A saturated heterocycloalkyl group can be referred to as "heterocycloalkyl". A partially unsaturated heterocycloalkyl group can be referred to as "heterocycloalkenyl" when the heterocyclyl contains at least one double bond, or "heterocycloalkynyl" when the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclyl has, for example, 3 - 18 ring atoms (3 - 18 membered heterocyclyl), 4 - 18 ring atoms (4 - 18 membered heterocyclyl), 5 - 18 ring atoms (5 - 18 membered heterocyclyl), 4 - 8 ring atoms (4 - 8 membered heterocyclyl), or 5 - 8 ring atoms (5 - 8 membered heterocyclyl). Whenever it appears herein, a numerical range such as "3 - 18" refers to each integer within the given range. For example, "3 - 18 ring atoms" means that the heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc., and can contain up to 18 ring atoms. Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, the heterocyclyl group is optionally substituted.
[0026] As used herein, unless otherwise specified, the term "heterocyclylene" refers to a polyvalent (e.g., divalent or trivalent) heterocyclyl group. Unless otherwise specified, the heterocyclylene group is optionally substituted.
[0027] As used herein, unless otherwise specified, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, aryl has 6 to 18 cyclic carbon atoms (C6-C 18 aryl), 6 to 14 cyclic carbon atoms (C6-C 14 aryl), or 6 to 10 cyclic carbon atoms (C6-C 10 aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one of the rings is aromatic and the others can be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl). Unless otherwise specified, the aryl group is optionally substituted.
[0028] As used herein, unless otherwise specified, the term "arylene" refers to a polyvalent (e.g., divalent or trivalent) aryl group. Unless otherwise specified, the arylene group is optionally substituted.
[0029] As used herein, unless otherwise specified, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring independently contains one or more (e.g., one, one or two, 1-3, or 1-4) heteroatoms selected from O, S, and N. Heteroaryl can be attached to the main structure by any heteroatom or carbon atom. In certain embodiments, heteroaryl has 5-20, 5-15, or 5-10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic rings, wherein at least one of the rings is aromatic and the others can be saturated, partially unsaturated, or aromatic, and at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, heteroaryl groups are optionally substituted.
[0030] As used herein, unless otherwise specified, the term "heteroarylene" is a polyvalent (e.g., divalent or trivalent) heteroaryl group. Unless otherwise specified, the heteroarylene group is optionally substituted.
[0031] When the groups described herein are said to be "substituted", they may be substituted with any suitable substituent or substituents. Exemplary examples of substituents include those found in the exemplary compounds and embodiments provided herein, as well as halogen atoms such as F, Cl, Br, or I, cyano, oxo (=O), hydroxyl (-OH), alkyl, alkenyl, alkynyl, cycloalkyl, aryl, -(C=O)OR’, -O(C=O)R’, -C(=O)R’, -OR’, -S(O) x R’, -S-SR’, -C(=O)SR’, -SC(=O)R’, -NR’R’, -NR’C(=O)R’, -C(=O)NR’R’, -NR’C(=O)NR’R’, -OC(=O)NR’R’, -NR’C(=O)OR’, -NR’S(O) x NR’R’, -NR’S(O) x R’, and -S(O) x NR’R’ are included, but not limited to, and R’ is, in each occurrence, independently, H, C1-C 15 alkyl, or cycloalkyl, and x is 0, 1, or 2. In some embodiments, the substituent is a C1-C 12 alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group such as fluoro. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR’). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR’R’).
[0032] As used herein, unless otherwise specified, the term "optional" or "optionally" (e.g., optionally substituted) means that the subsequent described event or circumstance may or may not occur, and the description includes both the case where the event or circumstance occurs and the case where it does not occur. For example, "optionally substituted alkyl" means that the alkyl radical may or may not be substituted, and the description includes both substituted alkyl radicals and unsubstituted alkyl radicals.
[0033] As used herein, unless otherwise specified, the term "prodrug" of a biologically active compound refers to a compound that can be converted to the biologically active compound under physiological conditions or by solubilization. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. A prodrug may be inactive when administered to a subject in need thereof, but is converted to the biologically active compound in vivo. Prodrugs are typically rapidly converted in vivo, for example, by hydrolysis in the blood, to yield the original biologically active compound. Prodrug compounds often provide advantages of solubility, tissue compatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam)). Discussions of prodrugs are provided in Higuchi, T., et al., A.C.S. Symposium Series, Vol. 14, and Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
[0034] In one embodiment, the term "prodrug" also means any covalent carrier that releases an active compound in vivo when such prodrug is administered to a mammalian subject. A prodrug of a compound can be prepared by modifying a functional group present in the compound in such a manner that the modification is cleaved either by conventional manipulation or in vivo to yield the original compound. Prodrugs include compounds in which a hydroxyl group, an amino group, or a mercapto group is bonded to any group, which upon administration of the prodrug of the compound to a mammalian subject, cleaves to form a free hydroxyl group, a free amino group, or a free mercapto group, respectively.
[0035] Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohols, or amide derivatives of amine functional groups, in the compounds provided herein.
[0036] As used herein, unless otherwise specified, the term "pharmaceutically acceptable salt" includes both acid and base addition salts.
[0037] Examples of pharmaceutically acceptable acid addition salts include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and, without limitation thereto, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid and other organic acids.
[0038] Examples of pharmaceutically acceptable base addition include, but are not limited to, salts prepared by adding an inorganic base or an organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, etc. In one embodiment, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include primary, secondary, and tertiary amines such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, substituted amines including natural substituted amines, cyclic amines, and salts of basic ion exchange resins, but are not limited thereto. In one embodiment, the organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
[0039] The compounds provided herein may contain one or more chiral centers and, therefore, can give rise to enantiomers, diastereomers, and other stereoisomeric forms that can be defined as (R)- or (S)- from the perspective of absolute stereochemistry or, for amino acids, as (D)- or (L)-. Unless otherwise specified, the compounds provided herein are meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers can be prepared using a chiral synthon or chiral reagent or can be resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of a racemate (or racemate of a salt or derivative), for example using chiral high performance liquid chromatography (HPLC). When the compounds described herein contain an olefinic double bond or other geometrically chiral center, unless otherwise specified, the compounds are intended to include both E and Z geometric isomers. Similarly, all tautomeric forms are also intended to be included.
[0040] As used herein, unless otherwise specified, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the manner in which the atoms are arranged in space. "Atropisomers" are stereoisomers arising from hindrance to rotation about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion can be known as a "racemic" mixture. "Diastereoisomers" are stereoisomers that have at least two chiral atoms but are not mirror images of each other.
[0041] "Stereoisomers" can also include E and Z isomers, or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as either the E or Z isomer. In other embodiments, the compounds described herein are a mixture of the E and Z isomers.
[0042] "Tautomers" refer to isomeric forms of a compound that are in equilibrium with each other. The concentration of the isomeric forms depends on the environment in which the compound is found and can vary, for example, depending on whether the compound is a solid or is in an organic or aqueous solution.
[0043] It should also be noted that the compounds described herein can contain atoms in unnatural proportions of atomic isotopes for one or more of the atoms. For example, the compound can be radiolabeled with a radioactive isotope such as, for example, tritium ( 3 H), iodine 125 ( 125 I), sulfur 35 ( 35 S), or carbon 14 ( 14 C), or can contain deuterium ( 2 H), carbon 13 ( 13 C), or nitrogen 15 ( 15N) can be isotopically enriched. As used herein, an "isotopic molecular species" is a compound that is isotopically enriched. The term "isotopically enriched" refers to an atom having an isotopic composition other than the natural isotopic composition of that atom. "Isotopically enriched" can also refer to a compound containing at least one atom having an isotopic composition other than the natural isotopic composition of that atom. The term "isotopic composition" refers to the amount of each isotope present for a given atom. Radiolabeled compounds and isotopically enriched compounds are useful as therapeutic agents, such as cancer therapeutic agents, research reagents, such as binding assay reagents, and diagnostic agents, such as in vivo contrast agents. All isotopic variations of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, isotopic molecular species of the compounds described herein are provided. For example, the isotopic molecular species is enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" means a compound in which at least one hydrogen (H) is replaced with deuterium (D or 2 as shown by H), i.e., the compound is enriched in deuterium at at least one position.
[0044] Note that if there is a discrepancy between the structure shown and the name given to that structure, the structure shown shall prevail.
[0045] As used herein, unless otherwise specified, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, lubricant, sweetening agent, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifying agent, which have been approved by the United States Food and Drug Administration as acceptable for use in humans or livestock.
[0046] The term "composition" is intended to optionally include a product containing a specified amount of a specified component (e.g., the mRNA molecules provided herein).
[0047] The terms "polynucleotide" or "nucleic acid" as used interchangeably herein refer to polymers of nucleotides of any length and include, for example, DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides can include modified nucleotides such as methylated nucleotides and their analogs. Nucleic acids can be in either single-stranded or double-stranded form. As used herein, unless otherwise specified, "nucleic acid" also includes nucleic acid mimetics such as locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino. "Oligonucleotide", as used herein, generally refers to a short synthetic polynucleotide, although not necessarily so, that is generally less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides. Unless otherwise specified, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end, and the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of addition from 5' to 3' of nascent RNA transcription is referred to as the transcription direction, the sequence region on the DNA strand having the same sequence as the RNA transcript that is at the 5' end of the RNA transcript is referred to as the "upstream sequence", and the sequence region on the DNA strand having the same sequence as the RNA transcript that is at the 3' end of the RNA transcript is referred to as the "downstream sequence".
[0048] "Isolated nucleic acid" refers to a nucleic acid, such as RNA, DNA, or hybrid nucleic acids, that is substantially separated from other genomic DNA sequences and proteins or complexes such as ribosomes and polymerases that are naturally associated with the native sequence. An "isolated" nucleic acid molecule is a nucleic acid molecule that has been separated from other nucleic acid molecules present in the natural source of the nucleic acid molecule. Further, an "isolated" nucleic acid molecule such as mRNA, when produced by recombinant techniques, may not substantially contain other cellular material or medium, or when chemically synthesized, may not substantially contain chemical precursors or other chemicals. In certain embodiments, one or more nucleic acid molecules encoding the antigens described herein are isolated or purified. The term encompasses nucleic acid sequences removed from their naturally occurring environment, including recombinant or cloned DNA or RNA isolates, and chemically synthesized analogs or biologically synthesized analogs by heterologous systems. A substantially pure molecule may include the isolated form of the molecule.
[0049] When used with respect to a nucleic acid molecule, the term "coding nucleic acid" or its grammatical equivalents encompasses (a) a nucleic acid molecule that can be transcribed and then translated into a peptide and / or polypeptide to produce an mRNA, either in its native state or when manipulated by methods well known to those of skill in the art, and (b) the mRNA molecule itself. The antisense strand is the complement of such a nucleic acid molecule from which the coding sequence can be derived. The term "coding region" refers to the portion within a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR with respect to the coding region of a nucleic acid molecule, the UTR is designated as a 5'-UTR when located at the 5' end of the coding region, and the UTR is designated as a 3'-UTR when located at the 3' end of the coding region.
[0050] As used herein, the term "mRNA" refers to a messenger RNA molecule that contains one or more open reading frames (ORFs) that can be translated by a cell or organism provided with the mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In some embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).
[0051] In certain embodiments, the mRNA is a monocistronic mRNA that contains only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein that contains at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a polycistronic mRNA that contains two or more ORFs. In certain embodiments, the polycistronic mRNA encodes two or more peptides or proteins that can be the same as or different from each other. In certain embodiments, each peptide or protein encoded by the polycistronic mRNA contains at least one epitope of a selected antigen. In certain embodiments, the different peptides or proteins encoded by the polycistronic mRNA each contain at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope can be at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten epitopes of the antigen.
[0052] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and their natural or synthetic analogs or derivatives.
[0053] As used herein, the term "functional nucleotide analog" refers to a modified version of a standard nucleotide A, G, C, U, or T that (a) retains the base pairing properties of the corresponding standard nucleotide and (b) contains at least one chemical modification to the (i) nucleobase, (ii) sugar group, (iii) phosphate group, or (iv) any combination of (i)-(iii) of the corresponding natural nucleotide. As used herein, base pairing includes not only the standard Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a standard nucleotide and a functional nucleotide analog or between a pair of functional nucleotide analogs, such that hydrogen bonding between a modified nucleobase and a standard nucleobase or between two complementary nucleobase structures is enabled by the arrangement of hydrogen bond donors and hydrogen bond acceptors. For example, a functional analog of guanosine (G) retains the ability to form a base pair with cytosine (C) or a functional analog of cytosine. An example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. As described herein, functional nucleotide analogs can be either naturally occurring or non-naturally occurring. Thus, a nucleic acid molecule containing a functional nucleotide analog can have at least one modified nucleobase, sugar group, and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group, or internucleoside linkage of a nucleic acid molecule are provided herein.
[0054] As used herein, the terms "translation enhancer element", "TEE" and "translation enhancer" refer to regions within nucleic acid molecules that function to promote the translation of the coding sequence of a nucleic acid into a protein or peptide product, for example, via cap-dependent or cap-independent translation. A TEE is typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhances the level of translation of a coding sequence located either upstream or downstream. For example, a TEE in the 5'UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule. A variety of TEE sequences are known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug;10(8):747-750, Chappell et al. PNAS June 29, 2004 101(26)9590-9594). Some TEEs are known to be conserved across multiple species (Panek et al. Nucleic Acids Research, Volume 41, Issue 16, 1 September 2013, Pages 7625-7634).
[0055] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions and can thus base pair with each other to form at least one double helix and an unpaired loop. The resulting structure is known as a stem-loop structure, hairpin, or hairpin loop, which is a secondary structure found in many RNA molecules.
[0056] As used herein, the term "peptide" refers to a polymer containing 2 to 50 amino acid residues linked by one or more (optional) covalent peptide bonds. The term applies to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).
[0057] The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers having more than 50 amino acid residues linked by covalent peptide bonds. That is, descriptions regarding polypeptides apply equally to descriptions of proteins, and vice versa. The term applies to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the term encompasses amino acid chains of any length, including full-length proteins (e.g., antigens).
[0058] The term "antigen" refers to a substance that can be recognized by the immune system of a subject (including the adaptive immune system) and can induce an immune response (including an antigen-specific immune response) after the subject comes into contact with the antigen. In certain embodiments, the antigen is a protein associated with diseased cells such as cells infected by a pathogen or tumorous cells (e.g., tumor-associated antigen (TAA)).
[0059] In the context of a peptide or polypeptide, the term "fragment" as used herein refers to a peptide or polypeptide that contains an amino acid sequence less than full length. Such fragments can arise, for example, from cleavage at the amino terminus, cleavage at the carboxy terminus, and / or internal deletions of residue(s) from the amino acid sequence. Fragments can arise, for example, from alternative RNA splicing, or in vivo protease activity. In certain embodiments, a fragment refers to a polypeptide that comprises an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 contiguous amino acid residues of a polypeptide. In certain embodiments, a fragment of a polypeptide retains at least one, at least two, at least three, or more functions of the polypeptide.
[0060] An "epitope" is a site on the surface of an antigen molecule to which a single antibody molecule binds, such as a site on the surface of an antigen having antigenic or immunogenic activity in an animal such as a mammal (e.g., human) that can bind to one or more antigen-binding regions of an antibody and can induce an immune response. An epitope having immunogenic activity is a portion of a polypeptide that induces an antibody response in an animal. An epitope having antigenic activity is a portion of a polypeptide to which an antibody binds, determined by any method well known in the art, including, for example, immunoassays. An antigenic epitope need not necessarily be immunogenic. Epitopes often consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and have specific three-dimensional structural characteristics and specific charge characteristics. Antibody epitopes can be linear epitopes or conformational epitopes. A linear epitope is formed by a continuous sequence of amino acids in a protein. A conformational epitope is formed from amino acids that are discontinuous in the protein sequence but come together when the protein folds into its three-dimensional structure. An induced epitope is formed when the three-dimensional structure of a protein is in a modified conformation, such as following activation or binding of another protein or ligand. In certain embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is a linear feature of a polypeptide. Generally, an antigen has several or many different epitopes and can react with many different antibodies.
[0061] As used herein, the term "gene vaccine" refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease). Administration of the vaccine to a subject ("vaccination") enables the production of the encoded peptide or protein, thereby inducing an immune response against the target disease in the subject. In certain embodiments, the immune response includes an adaptive immune response such as the production of antibodies against the encoded antigen and / or the activation and proliferation of immune cells capable of specifically eliminating disease cells expressing the antigen. In certain embodiments, the immune response further includes an innate immune response. According to the present disclosure, the vaccine can be administered to a subject either before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of a healthy or asymptomatic subject immunizes or reduces the susceptibility of the vaccinated subject to the development of the target disease. In some embodiments, vaccination of a subject presenting with symptoms of a disease ameliorates or treats the disease state in the vaccinated subject.
[0062] "Innate immune response" and "innate immunity" are recognized in the art and refer to non-specific defense mechanisms initiated by the body's immune system upon recognition of pathogen-associated molecular patterns, involving different forms of cellular activity including cytokine production and cell death via various pathways. As used herein, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production), activation of the NFκB pathway, increased proliferation, maturation, differentiation and / or survival of immune cells, and in some cases, induction of cell apoptosis. Activation of the innate immunity can be detected using methods known in the art such as measurement of (NF)-κB activation.
[0063] The terms "adaptive immune response" and "adaptive immunity" are recognized in the art and refer to antigen-specific defense mechanisms initiated by the body's immune system upon recognition of a specific antigen, including both humoral and cell-mediated responses. As used herein, the adaptive immune response includes cell responses induced and / or augmented by a vaccine composition, such as the gene compositions described herein. In some embodiments, the vaccine composition includes an antigen that is the target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition enables the production in an immunized subject of an antigen that is the target of an antigen-specific adaptive immune response upon administration. Activation of the adaptive immune response can be detected using methods known in the art, such as measuring the level of antigen-specific antibody production or antigen-specific cell-mediated cytotoxicity.
[0064] The term "antibody" is intended to include the polypeptide products of B cells within the immunoglobulin class of polypeptides consisting of two identical pairs of polypeptide chains that can bind to a specific molecular antigen, each pair having one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal portion of each chain containing a variable region of about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain containing a constant region. See, for example, Antibody Engineering (Borrebaeck ed., 2d ed. 1995), and Kuby, Immunology (3d ed. 1997). In certain embodiments, the specific molecular antigen can be bound by the antibodies provided herein, including polypeptides, fragments thereof, or epitopes. Antibodies include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intrabodies, anti-idiotype (anti-Id) antibodies, and functional fragments of any of the foregoing, where the functional fragment refers to a portion of a heavy or light chain polypeptide of an antibody that retains some or all of the binding activity of the antibody from which the fragment is derived. Non-limiting examples of functional fragments include single-chain Fv (scFv) (including, for example, monospecific, bispecific, etc.), Fab fragments, F(ab’) fragments, F(ab)2 fragments, F(ab’)2 fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetra-bodies, and minibodies. In particular, the antibodies provided herein include immunoglobulin molecules and molecules containing immunologically active portions of immunoglobulin molecules, such as antigen-binding domains or antigen-binding sites (e.g., one or more CDRs of an antibody).Such antibody fragments can be found, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (1989), Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995), Huston et al., 1993, Cell Biophysics 22:189-224, Pluckthun and Skerra, 1989, Meth. Enzymol. Enzymol. 178:497-515, and Day, Advanced Immunochemistry (2d ed. 1990). The antibodies provided herein can be of any class of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, and IgA), any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2).
[0065] The term "administer" or "administration" refers to the act of injecting or otherwise physically delivering a substance that exists outside the body (e.g., a lipid nanoparticle composition described herein) to a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When a disease, disorder, condition, or their symptoms are being treated, the administration of the substance is typically performed after the onset of the disease, disorder, condition, or their symptoms. When a disease, disorder, condition, or their symptoms are being prevented, the administration of the substance is typically performed before the onset of the disease, disorder, condition, or their symptoms.
[0066] "Chronic" administration refers to the administration of a drug(s) in a continuous mode (e.g., for a period of several days, weeks, months, or years, etc.) to maintain the initial therapeutic effect (activity) for a long period, in contrast to the acute mode. "Intermittent" administration is not continuous without interruption, but rather is periodic treatment.
[0067] As used herein, the term "targeted delivery" or the verb form "target" refers to the process of facilitating the arrival of a delivery agent (such as a therapeutic payload molecule in the lipid nanoparticle compositions described herein) to a particular organ, tissue, cell, and / or intracellular component (referred to as the targeted location) over any other organ, tissue, cell, or intracellular component (referred to as the non-targeted location). Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivery agent in a targeted cell population after systemic administration with the concentration of the delivery agent in a non-targeted cell population. In certain embodiments, targeted delivery results in at least a two-fold higher concentration at the targeted location compared to the non-targeted location.
[0068] "Effective amount" generally refers to an amount sufficient to reduce the severity and / or frequency of symptoms, eliminate symptoms and / or the underlying cause, prevent the occurrence of symptoms and / or their underlying cause, and / or improve or correct damage resulting from or associated with a disease, disorder, or condition, including, for example, infections and tumors. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.
[0069] As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or ameliorate the severity and / or duration of a given disease, disorder, or condition, and / or the symptoms associated therewith (e.g., an infectious disease such as caused by a viral infection, or a neoplastic disease such as cancer). The "therapeutically effective amount" of a substance / molecule / agent of the present disclosure (e.g., the lipid nanoparticle composition described herein) can vary according to factors such as the medical condition, age, gender, and weight of the individual, as well as the ability of the substance / molecule / agent to elicit the desired response in the individual. A therapeutically effective amount encompasses an amount where the toxic or detrimental effects of the substance / molecule / agent are outweighed by the therapeutically beneficial effects. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition described herein, or a therapeutic or prophylactic agent (e.g., therapeutic mRNA) contained therein, effective to "treat" a disease, disorder, or condition in a subject or mammal.
[0070] A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, would be likely to prevent, delay, or reduce the likelihood of the occurrence (or recurrence) of an intended prophylactic effect, e.g., a disease, disorder, condition, or associated symptom(s) (e.g., an infectious disease such as caused by a viral infection, or a neoplastic disease such as cancer). Typically, prophylactic dosages are used in a subject prior to or at an early stage of a disease, disorder, or condition, and while not necessarily so, a prophylactically effective amount may be less than a therapeutically effective amount. A complete therapeutic or prophylactic effect is not necessarily achieved by administration of a single dose and may occur only after administration of a series of doses. Thus, a therapeutically effective amount or a prophylactically effective amount can be administered in one or more administrations.
[0071] The terms "prevent," "preventing," and "prevention" refer to reducing the likelihood of the occurrence (or recurrence) of a disease, disorder, condition, or associated symptom(s) (e.g., an infectious disease such as caused by a viral infection, or a neoplastic disease such as cancer).
[0072] The terms "manage", "managing", and "management" refer to the beneficial effects obtained by a subject from a therapy that does not result in a cure of a disease (e.g., a prophylactic or therapeutic agent). In certain embodiments, the subject is administered one or more therapies (e.g., a prophylactic or therapeutic agent such as the lipid nanoparticle compositions described herein) to prevent the progression or worsening of a disease, and "manages" an infectious or neoplastic disease, or one or more symptoms thereof.
[0073] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the onset, recurrence, development, or spread of a disease and / or related symptoms in a subject.
[0074] The term "therapeutic agent" refers to any agent that can be used for the treatment, prevention, or alleviation of a disease, disorder, or condition, including the treatment, prevention, or alleviation of one or more symptoms of the disease, disorder, or condition, and / or related symptoms.
[0075] The term "therapy" refers to any protocol, method, and / or agent that can be used for the prevention, management, treatment, and / or improvement of a disease, disorder, or condition. In certain embodiments, the terms "therapy(ies)" and "therapy" refer to biological therapies, supportive therapies, and / or other therapies useful for the prevention, management, treatment, and / or improvement of a disease, disorder, or condition known to those of ordinary skill in the art, such as medical practitioners.
[0076] As used herein, a "prophylactically effective serum titer" is the serum titer of an antibody in a subject (e.g., a human) that completely or partially inhibits the onset, recurrence, development, or spread of a disease, disorder, or condition, and / or related symptoms in the subject.
[0077] In certain embodiments, a "therapeutically effective serum titer" is the serum titer of an antibody in a subject (e.g., a human) that reduces the severity, duration, and / or symptoms associated with a disease, disorder, or condition in the subject.
[0078] The term "serum titer" refers to the average serum titer from multiple samples (e.g., at multiple time points) in a subject, or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000, or more.
[0079] The term "side effect" encompasses the undesirable and / or harmful effects of a therapy (e.g., a prophylactic or therapeutic agent). An undesirable effect is not necessarily harmful. Side effects from a therapy (e.g., a prophylactic or therapeutic agent) can be harmful, unpleasant, or dangerous. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, dyspnea, insomnia, dizziness, mucositis, effects on nerves and muscles, fatigue, thirst, loss of appetite, rash or swelling at the administration site, influenza-like symptoms such as fever, chills, fatigue, digestive problems, as well as allergic reactions. There are numerous additional undesirable effects experienced by patients and known in the art. Many are described in the Physician’s Desk Reference (68th ed. 2014).
[0080] The terms "subject" and "patient" can be used interchangeably. As used herein, in certain embodiments, a subject is a mammal such as a non - primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). In certain embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., human) having an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., human) at risk of developing an infectious disease or a neoplastic disease.
[0081] The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment that provides a detectable signal through its activity.
[0082] The term "detectable agent" refers to a substance that can be used to confirm the existence or presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. A detectable agent can be a substance that can be visualized or, otherwise, determined and / or measured (e.g., by quantification).
[0083] "Substantially all" means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
[0084] As used herein, unless otherwise indicated, the terms "about" or "approximately" mean the tolerance of a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term "about" or "approximately" means within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05% of a given value or range.
[0085] As used herein, the singular terms "a", "an", and "the" include plural references unless the context clearly dictates otherwise.
[0086] All publications, patent applications, accession numbers, and other references cited herein are hereby incorporated by reference in their entirety, as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing in this specification is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.
[0087] Numerous embodiments of the present invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the present invention. Accordingly, the description of the experimental section and examples is intended to be illustrative only and not to limit the scope of the invention as set forth in the claims.
[0088] 5.3 Lipid Compounds Unless otherwise specified, the descriptions provided herein apply, where applicable, to all formulas provided herein (e.g., formula (I), including its sub-formulas).
[0089] In one embodiment, provided herein is a compound of formula (I), [Chemical formula] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein, G 1 and G 2 are each independently a bond, C2-C 12 alkylene, or C2-C 12 alkenylene, and one or more -CH2- in G 1 and G 2 are optionally replaced by -O-, each L 1 is independently -OC(=O)R 1, -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b )(OR c ), -NR a P(=O)(OR b )(OR c ), -(C 6 -C 10 arylene)-R 1 , -(6 - 10 membered heteroarylene)-R 1 , -(4 - 8 membered heterocyclylene)-R 1 , or R1, each L 2 is, independently, -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NRd C(=O)NR e R f 、 -OC(=O)NR e R f 、 -NR d C(=O)OR 2 、 -SC(=S)R 2 、 -C(=S)SR 2 、 -C(=S)R 2 、 -CH(OH)R 2 、 -P(=O)(OR e )(OR f )、 -NR d P(=O)(OR e )(OR f )、 -(C6 - C 10 arylene)-R 2 、 -(6 - to 10 - membered heteroarylene)-R 2 、 -(4 - to 8 - membered heterocyclylene)-R 2 、 or R 2 and R 1 and R 2 are each independently C6 - C 24 alkyl or C6 - C 24 alkenyl, R a 、 R b 、 R d 、 and R e are each independently H, C1 - C 24 alkyl, or C2 - C 24 alkenyl, R c and R f are each independently C1 - C 24 alkyl or C2 - C 24 alkenyl, G 3 is C2 - C 12 alkylene or C2 - C 12 alkenylene, and part or all of the alkylene or alkenylene is optionally replaced by C3 - C8 cycloalkylene, C3 - C8 cycloalkenylene, C3 - C8 cycloalkynylene, 4 - to 8 - membered heterocyclylene, C6 - C 10 arylene, or 5 - to 10 - membered heteroarylene, R3 is hydrogen, C1-C 12 alkyl, C2-C 12 alkenyl, C2-C 12 alkynyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, or R 3 , G 1 , or G 1 a part of, together with the nitrogen to which they are attached, forms a cyclic moiety, or R 3 , G 3 , or G 3 a part of, together with the nitrogen to which they are attached, forms a cyclic moiety, and R 4 is C1-C 12 alkyl or C3-C8 cycloalkyl, x is 0, 1, or 2, n is 1 or 2, m is 1 or 2, each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is, independently, optionally substituted, and the compound, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0090] In one embodiment, provided herein is a compound of formula (I),
Chemical formula
[0091] In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, n is 1 and m is 1. In one embodiment, n is 1 and m is 2. In one embodiment, n is 2 and m is 1. In one embodiment, n is 2 and m is 2.
[0092] In one embodiment, the compound is a compound of formula (II-A),
Chemical formula
[0093] In one embodiment, the present compound is a compound of formula (II-B),
Chemical formula
[0094] In one embodiment, the present compound is a compound of formula (II-C),
Chemical formula
[0095] In one embodiment, the present compound is a compound of formula (II-D),
Chemical formula
[0096] In one embodiment, G 3 is C2-C 12 alkylene. In one embodiment, G 3 is C2-C8 alkylene. In one embodiment, G 3 is C2-C6 alkylene. In one embodiment, G 3 is C2-C4 alkylene. In one embodiment, G 3 is C2 alkylene. In one embodiment, G 3 is C3 alkylene. In one embodiment, G 3 is C4 alkylene. In one embodiment, G 3 is C5 alkylene. In one embodiment, G 3 is C6 alkylene. In one embodiment, G 3 is -CH2CH2-.
[0097] In one embodiment, G 3 is C2-C 12is an alkenylene. In one embodiment, G 3 is C2-C8 alkenylene. In one embodiment, G 3 is C2-C6 alkenylene. In one embodiment, G 3 is C2-C4 alkenylene. In one embodiment, G 3 is C2 alkenylene. In one embodiment, G 3 is C3 alkenylene. In one embodiment, G 3 is C4 alkenylene. In one embodiment, G 3 is C5 alkenylene. In one embodiment, G 3 is C6 alkenylene. In one embodiment, G 3 is (Z)-CH2-CH=CH-CH2-. In one embodiment, G 3 is (E)-CH2-CH=CH-CH2-.
[0098] In one embodiment, G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, and part or all of the alkylene or alkenylene is replaced by C3-C8 cycloalkylene, C3-C8 cycloalkenylene, C3-C8 cycloalkynylene, 4- to 8-membered heterocyclylene, C6-C 10 arylene, or 5- to 10-membered heteroarylene. In one embodiment, G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, and part or all of the alkylene or alkenylene is replaced by C3-C8 cycloalkylene. In one embodiment, G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, and all of the alkylene or alkenylene is replaced by C3-C8 cycloalkylene, that is, G 3 is C3-C8 cycloalkylene. In one embodiment, G 3 is cyclopropylene. In one embodiment, G 3is cyclobutylene. In one embodiment, G 3 is cyclopentylene. In one embodiment, G 3 is cyclohexylene. In one embodiment, G 3 is cycloheptylene. In one embodiment, G 3 is cyclooctylene.
[0099] In one embodiment, G 3 is
Chemical formula
[0100] In one embodiment, G 3 is unsubstituted.
[0101] In one embodiment, the compound is a compound of formula (III-A),
Chemical formula
[0102] In one embodiment, the compound is a compound of formula (III-B),
Chemical formula
[0103] In one embodiment, the compound is a compound of formula (III-C),
Chemical formula
[0104] In one embodiment, the compound is a compound of formula (III-D),
Chemical formula
[0105] In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
[0106] In one embodiment, G 1 is a bond. In one embodiment, G 1 is C2-C 12 alkylene. In one embodiment, G 1 is C4-C8 alkylene. In one embodiment, G 1 is C5-C7 alkylene. In one embodiment, G 1 is C2 alkylene. In one embodiment, G 1 is C3 alkylene. In one embodiment, G 1 is C4 alkylene. In one embodiment, G 1 is C5 alkylene. In one embodiment, G 1 is C6 alkylene. In one embodiment, G 1 is C7 alkylene. In one embodiment, G 1 is C2-C 12 alkenylene. In one embodiment, G 1 is C4-C8 alkenylene. In one embodiment, G 1 is C5-C7 alkenylene. In one embodiment, G 1 is C5 alkenylene. In one embodiment, G 1is C7 alkenylene. In one embodiment, G 1 is linear. In one embodiment, G 1 is branched. In one embodiment, G 1 is divalent. In one embodiment, G 1 is trivalent.
[0107] In one embodiment, G 2 is a bond. In one embodiment, G 2 is C2-C 12 alkylene. In one embodiment, G 2 is C4-C8 alkylene. In one embodiment, G 2 is C5-C7 alkylene. In one embodiment, G 2 is C2 alkylene. In one embodiment, G 2 is C3 alkylene. In one embodiment, G 2 is C4 alkylene. In one embodiment, G 2 is C5 alkylene. In one embodiment, G 2 is C6 alkylene. In one embodiment, G 2 is C7 alkylene. In one embodiment, G 2 is C2-C 12 alkenylene. In one embodiment, G 2 is C4-C8 alkenylene. In one embodiment, G 2 is C5-C7 alkenylene. In one embodiment, G 2 is C5 alkenylene. In one embodiment, G 2 is C7 alkenylene. In one embodiment, G 2 is linear. In one embodiment, G 2 is branched. In one embodiment, G 2 is divalent. In one embodiment, G 2 is trivalent.
[0108] In one embodiment, G 1 and G 2 are each independently C2-C 12 alkylene. In one embodiment, G 1 and G2 is, independently of each other, C5 alkylene. In one embodiment, G 1 and G 2 are, independently of each other, C7 alkylene.
[0109] In one embodiment, one or more -CH2- in G 1 is replaced by -O-. In one embodiment, one or more non-terminal -CH2- in G 1 is replaced by -O-. In one embodiment, one non-terminal -CH2- in G 1 is replaced by -O-. In one embodiment, G 1 is (C2-C5 alkylene)-O-(C2-C6 alkylene).
[0110] In one embodiment, G 1 is
Chemical formula
Chemical formula
Chemical formula
Chemical formula
Chemical formula
Chemical formula
[0111] In one embodiment, one or more -CH2- in G 2 is replaced by -O-. In one embodiment, one or more non-terminal -CH2- in G 2 is replaced by -O-. In one embodiment, one non-terminal -CH2- in G 2 is replaced by -O-. In one embodiment, G 2 is (C2-C5 alkylene)-O-(C2-C6 alkylene).
[0112] In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is. In one embodiment, G 2 is [Chemical formula] is.
[0113] In one embodiment, the present compound is a compound of formula (IV), [Chemical formula] wherein s is an integer from 2 to 12, y is an integer from 2 to 12, z is an integer from 2 to 12, a compound or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0114] In one embodiment, the present compound is a compound of formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G), or (IV-H), [Chemical formula] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0115] In one embodiment, the present compound is a compound of formula (V), [Chemical formula] wherein y is an integer from 2 to 12, z is an integer from 2 to 12, and the compound, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0116] In one embodiment, the present compound is a compound of formula (V-A), (V-B), (V-C), (V-D), (V-E), (V-F), (V-G), or (V-H),
Chemical formula
[0117] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.
[0118] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.
[0119] In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
[0120] In one embodiment, y is 5, z is 5, and s is 2.
[0121] In one embodiment, L 1 is R 1 is.
[0122] In one embodiment, L 1 is -OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-NR a P(=O)(OR b )(OR c )、or -(4- to 8-membered heterocyclylene)-R 1 In one embodiment, L 1 is -OC(=O)R 1 、-C(=O)OR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、or -C(=O)NR b R c In one embodiment, L 1 is -OC(=O)R 1 、-C(=O)OR 1 、-NR a C(=O)R 1 、or -C(=O)NR b R c In one embodiment, L1 is -C(=O)OR 1 In one embodiment, L 1 is -C(=O)OR 1 In one embodiment, L 1 is -NR a C(=O)R 1 In one embodiment, L 1 is -C(=O)NR b R c In one embodiment, L 1 is -OR 1 In one embodiment, L 1 is -NR a P(=O)(OR b )(OR c ) 1 is -(4 - to 8 - membered heterocyclylene)-R 1 In one embodiment, L 1 is
Chemical formula
[0123] In one embodiment, L 2 is R 2
[0124] In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S - SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2 , -CH(OH)R 2 , -P(=O)(OR e )(OR f ), or -NR d P(=O)(OR e )(OR f ), or -(4 - to 8 - membered heterocyclylene)-R 2 is. In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , or -C(=O)NR e R f is. In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -NR d C(=O)R 2 , or -C(=O)NR e R f is. In one embodiment, L 2 is -OC(=O)R 2 is. In one embodiment, L 2 is -C(=O)OR 2 is. In one embodiment, L 2 is -NR d C(=O)R 2 is. In one embodiment, L 2 is -C(=O)NR e R f is. In one embodiment, L 2 is -OR 2 is. In one embodiment, L 2 is -NR d P(=O)(OR e )(OR f ) is. In one embodiment, L 2 is -(4 - to 8 - membered heterocyclylene)-R 2It is. In one embodiment, L 2 is
Chemical formula
[0125] In one embodiment, L 1 is -C(=O)OR 1 or -C(=O)NR b R c and L 2 is -C(=O)OR 2 or -C(=O)NR e R f It is. In one embodiment, L 1 is -C(=O)OR 1 and L 2 is -C(=O)OR 2 It is. In one embodiment, L 1 is -C(=O)OR 1 and L 2 is -C(=O)NR e R f It is. In one embodiment, L 1 is -C(=O)NR b R c and L 2 is -C(=O)OR 2 It is. In one embodiment, L 1 is -C(=O)NR b R c and L 2 is -C(=O)NR e R f It is.
[0126] In one embodiment, L 1 is -OC(=O)R 1 or -NR a C(=O)R 1 and L 2 is -OC(=O)R 2 or -NR d C(=O)R 2 It is. In one embodiment, L 1 is -OC(=O)R 1 and L 2 is -OC(=O)R2 is. In one embodiment, L 1 is -OC(=O)R 1 is, and L 2 is -NR d C(=O)R 2 is. In one embodiment, L 1 is -NR a C(=O)R 1 is, and L 2 is -OC(=O)R 2 is. In one embodiment, L 1 is -NR a C(=O)R 1 is, and L 2 is -NR d C(=O)R 2 is.
[0127] In one embodiment, L 1 is -OR 1 is, and L 2 is -C(=O)OR 2 is. In one embodiment, L 1 is -OR 1 is, and L 2 is -C(=O)NR e R f is. In one embodiment, L 1 is -C(=O)OR 1 is, and L 2 is -OR 2 is. In one embodiment, L 1 is -C(=O)NR b R c is, and L 2 is -OR 2 is.
[0128] In one embodiment, the compound is a compound of formula (VI),
Chemical formula
[0129] In one embodiment, z is an integer from 2 to 10. In one embodiment, z is an integer from 2 to 6. In one embodiment, z is an integer from 4 to 10. In one embodiment, z is selected from 4, 5, 6, 7, 8, and 9. In one embodiment, z is 5.
[0130] In one embodiment, R 3 is C1-C 12 alkyl. In one embodiment, R 3 is C1-C8 alkyl. In one embodiment, R 3 is C1-C6 alkyl. In one embodiment, R 3 is C1-C4 alkyl. In one embodiment, the alkyl is linear alkyl. In one embodiment, the alkyl is branched alkyl. In one embodiment, R 3 is methyl. In one embodiment, R 3 is ethyl. In one embodiment, R 3 is n-propyl. In one embodiment, R 3 is isopropyl. In one embodiment, R 3 is n-butyl. In one embodiment, R 3 is n-pentyl. In one embodiment, R 3 is n-hexyl. In one embodiment, R 3 is n-octyl. In one embodiment, R 3 is n-nonyl.
[0131] In one embodiment, R 3 is C2-C 12 alkenyl. In one embodiment, R 3 is C2-C8 alkenyl. In one embodiment, R 3 is C2-C4 alkenyl. In one embodiment, the alkenyl is linear alkenyl. In one embodiment, the alkenyl is branched alkenyl. In one embodiment, R 3 is ethenyl. In one embodiment, R 3 is allyl.
[0132] In one embodiment, R 3is C2-C 12 alkynyl. In one embodiment, R 3 is C2-C8 alkynyl. In one embodiment, R 3 is C2-C4 alkynyl. In one embodiment, the alkynyl is straight-chain alkynyl. In one embodiment, the alkynyl is branched alkynyl.
[0133] In one embodiment, R 3 is C3-C8 cycloalkyl. In one embodiment, R 3 is cyclopropyl. In one embodiment, R 3 is cyclobutyl. In one embodiment, R 3 is cyclopentyl. In one embodiment, R 3 is cyclohexyl. In one embodiment, R 3 is cycloheptyl. In one embodiment, R 3 is cyclooctyl.
[0134] In one embodiment, R 3 is C3-C8 cycloalkenyl. In one embodiment, R 3 is cyclopropenyl. In one embodiment, R 3 is cyclobutenyl. In one embodiment, R 3 is cyclopentenyl. In one embodiment, R 3 is cyclohexenyl. In one embodiment, R 3 is cycloheptenyl. In one embodiment, R 3 is cyclooctenyl.
[0135] In one embodiment, R 3 is 4- to 8-membered heterocyclyl. In one embodiment, R 3 is 4- to 8-membered heterocycloalkyl. In one embodiment, R 3 is oxetanyl. In one embodiment, R 3 is tetrahydrofuranyl. In one embodiment, R 3 is tetrahydropyranyl. In one embodiment, R 3is tetrahydrothiopyranyl.
[0136] In one embodiment, R 3 is C6-C 10 aryl. In one embodiment, R 3 is phenyl.
[0137] In one embodiment, R 3 is 5- to 10-membered heteroaryl. In one embodiment, R 3 is 5-membered heteroaryl. In one embodiment, R 3 is 6-membered heteroaryl.
[0138] In one embodiment, R 3 , G 1 , or G 1 forms a cyclic moiety together with the nitrogen to which they are attached.
[0139] In one embodiment, the compound is a compound of formula (VII) wherein
Chemical formula
[0140] In one embodiment, R 3 , G 3 , or G 3 forms a cyclic moiety together with the nitrogen to which they are attached.
[0141] In one embodiment, the compound is a compound of formula (VIII-A), (VIII-B), (VIII-C), (VIII-D), (VIII-E), (VIII-F), or (VIII-G) wherein [Chemical formula] wherein s’ is an integer from 0 to 10, u is 1, 2, or 3, v is 1, 2, or 3, y is an integer from 2 to 12, z is an integer from 2 to 12, y0 is an integer from 1 to 11, z0 is an integer from 1 to 11, y1 is an integer from 0 to 9, z1 is an integer from 0 to 9, a compound, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0142] In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, v is 1. In one embodiment, v is 2. In one embodiment, v is 3. In one embodiment, u is 1 and v is 1. In one embodiment, u is 2 and v is 2. In one embodiment, u is 3 and v is 3.
[0143] In one embodiment, the present compound is a compound of formula (IX-A), (IX-B), (IX-C), (IX-D), (IX-E), (IX-F), (IX-G), (IX-H), (IX-I), (IX-J), (IX-K), (IX-L), (IX-M), (IX-N), (IX-O), (IX-P), (IX-Q), (IX-R), (IX-S), (IX-T), (IX-U), (IX-V), (IX-W), (IX-X), (IX-Y), (IX-Z), or (IX-AA), [Chemical formula] [Chemical formula] wherein s is an integer from 2 to 12, y is an integer from 2 to 12, z is an integer from 2 to 12, y0 is an integer from 1 to 11, z0 is an integer from 1 to 11, y1 is an integer from 0 to 9, z1 is an integer from 0 to 9, y2 is an integer from 2 to 5, y3 is an integer from 2 to 6, y4 is an integer from 0 to 3, y5 is an integer from 1 to 5, z2 is an integer from 2 to 5, z3 is an integer from 2 to 6, z4 is an integer from 0 to 3, z5 is an integer from 1 to 5, a compound, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0144] In one embodiment, y0 is an integer from 1 to 7. In one embodiment, y0 is 1. In one embodiment, y0 is 2. In one embodiment, y0 is 3. In one embodiment, y0 is 4. In one embodiment, y0 is 5. In one embodiment, y0 is 6. In one embodiment, y0 is 7. In one embodiment, z0 is an integer from 1 to 7. In one embodiment, z0 is 1. In one embodiment, z0 is 2. In one embodiment, z0 is 3. In one embodiment, z0 is 4. In one embodiment, z0 is 5. In one embodiment, z0 is 6. In one embodiment, z0 is 7.
[0145] In one embodiment, y1 is an integer from 2 to 6. In one embodiment, y1 is 2. In one embodiment, y1 is 3. In one embodiment, y1 is 4. In one embodiment, y1 is 5. In one embodiment, y1 is 6. In one embodiment, z1 is an integer from 2 to 6. In one embodiment, z1 is 2. In one embodiment, z1 is 3. In one embodiment, z1 is 4. In one embodiment, z1 is 5. In one embodiment, z1 is 6.
[0146] In one embodiment, y2 is 2. In one embodiment, y2 is 3. In one embodiment, y2 is 4. In one embodiment, y2 is 5. In one embodiment, z2 is 2. In one embodiment, z2 is 3. In one embodiment, z2 is 4. In one embodiment, z2 is 5.
[0147] In one embodiment, y3 is 2. In one embodiment, y3 is 3. In one embodiment, y3 is 4. In one embodiment, y3 is 5. In one embodiment, y3 is 6. In one embodiment, z3 is 2. In one embodiment, z3 is 3. In one embodiment, z3 is 4. In one embodiment, z3 is 5. In one embodiment, z3 is 6.
[0148] In one embodiment, y4 is 0. In one embodiment, y4 is 1. In one embodiment, y4 is 2. In one embodiment, y4 is 3. In one embodiment, z4 is 0. In one embodiment, z4 is 1. In one embodiment, z4 is 2. In one embodiment, z4 is 3.
[0149] In one embodiment, y5 is 1. In one embodiment, y5 is 2. In one embodiment, y5 is 3. In one embodiment, y5 is 4. In one embodiment, y5 is 5. In one embodiment, z5 is 1. In one embodiment, z5 is 2. In one embodiment, z5 is 3. In one embodiment, z5 is 4. In one embodiment, z5 is 5.
[0150] In one embodiment, y2 is 2 and y3 is 2. In one embodiment, y2 is 2 and y4 is 1. In one embodiment, z2 is 2 and z3 is 2. In one embodiment, z2 is 2 and z4 is 1.
[0151] In one embodiment, s, y, z, L 1 , and L 2 are as defined elsewhere. In one embodiment, L1 is -OR 1 、-OC(=O)R 1 、-C(=O)OR 1 、or -C(=O)NR b R c and L 2 is -OR 2 、-OC(=O)R 2 、-C(=O)OR 2 、or -C(=O)NR e R f In one embodiment, when two Ls 1 are present, each L 1 is independently -OC(=O)R 1 In one embodiment, when two Ls 2 are present, each L 2 is independently -OC(=O)R 2 In one embodiment, when only one L 1 is present, L 1 is -C(=O)OR 1 In one embodiment, when only one L 1 is present, L 1 is -C(=O)NR b R c In one embodiment, when only one L 2 is present, L 2 is -C(=O)OR 2 In one embodiment, when only one L 2 is present, L 2 is -C(=O)NR e R f In one specific embodiment of any one of Formulas (IX - A) to (IX - AA), when only one L
[0152] is present, L 1 is -C(=O)OR 1 In another embodiment, L 1 is -C(=O)NR 1 In one embodiment, R b or R c is -R 1 or R c is -R 7 -CH(R8 )(R 9 ) and R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0153] In one specific embodiment of any one of formulas (IX-A) to (IX-AA), when only one L 2 exists, L 2 is -C(=O)OR 2 . In another embodiment, L 2 is -C(=O)NR e R f . In one embodiment, R 2 or R f is -R 7 -CH(R 8 )(R 9 ), and R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0154] In one specific embodiment of any one of formulas (IX-A) to (IX-AA),
Chemical formula
[0155] In one specific embodiment of any one of formulas (IX-A) to (IX-AA),
Chemical formula
[0156] In one specific embodiment of any one of Formulas (IX-A) to (IX-AA),
Chemical Formula
[0157] In one specific embodiment of any one of Formulas (IX-A) to (IX-AA),
Chemical Formula
[0158] In one embodiment, R 3 is unsubstituted.
[0159] In one embodiment, R 3 is C1-C6 alkyl, halo, C1-C6 haloalkyl, nitro, oxo, -OR g , -NR g C(=O)R h , -C(=O)NR g R h , -C(=O)R h , -OC(=O)R h , -C(=O)OR h , and -O-R i -OH and is substituted with one or more substituents selected from the group consisting of R g is, independently for each occurrence, H or C1-C6 alkyl, R h is, independently for each occurrence, C1-C6 alkyl, R i is, independently for each occurrence, C1-C6 alkylene.
[0160] In one embodiment, R 3 is substituted with one or more C1-C6 alkyl (e.g., methyl). In one embodiment, R 3 is substituted with one or more halo (e.g., -F). In one embodiment, R 3 is substituted with one or more C1-C6 haloalkyl (e.g., -CF3). In one embodiment, R 3 is substituted with one or more hydroxyls. In one embodiment, R 3 is substituted with one hydroxyl.
[0161] In one embodiment, R 3 is substituted with one or more C3-C8 cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, each optionally substituted. In one embodiment, R 3 is C1-C6 alkyl substituted with one or more C3-C8 cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, each optionally substituted. In one embodiment, C3-C8 cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is unsubstituted. In one embodiment, C3-C8 cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is substituted with one or more C1-C6 alkyl, halo, C1-C6 haloalkyl, nitro, hydroxyl, or cyano.
[0162] In one embodiment, R 4 is C1-C 12 alkyl. In one embodiment, R4 is C1-C8 alkyl. In one embodiment, R 4 is C1-C6 alkyl. In one embodiment, R 4 is C1-C4 alkyl. In one embodiment, R 4 is methyl. In one embodiment, R 4 is ethyl. In one embodiment, R 4 is n-propyl. In one embodiment, R 4 is isopropyl. In one embodiment, R 4 is n-butyl. In one embodiment, R 4 is n-pentyl. In one embodiment, R 4 is n-hexyl. In one embodiment, R 4 is n-octyl. In one embodiment, R 4 is n-nonyl.
[0163] In one embodiment, R 4 is C3-C8 cycloalkyl. In one embodiment, R 4 is cyclopropyl. In one embodiment, R 4 is cyclobutyl. In one embodiment, R 4 is cyclopentyl. In one embodiment, R 4 is cyclohexyl. In one embodiment, R 4 is cycloheptyl. In one embodiment, R 4 is cyclooctyl.
[0164] In one embodiment, R 4 is unsubstituted.
[0165] In one embodiment, R 4 is oxo, -OR g , -NR g C(=O)R h , -C(=O)NR g R h , -C(=O)R h , -OC(=O)R h , -C(=O)OR h , -O-R i-OH, and -N(R 10 )R 11 and is substituted with one or more substituents selected from the group consisting of R g is, independently for each occurrence, H or C1-C6 alkyl, R h is, independently for each occurrence, C1-C6 alkyl, R i is, independently for each occurrence, C1-C6 alkylene, R 10 is hydrogen or C1-C6 alkyl, R 11 is C1-C6 alkyl, C3-C8 cycloalkyl, or C3-C8 cycloalkenyl, R 10 and R 11 together with the nitrogen to which they are attached form a cyclic moiety, R 11 or the cyclic moiety is optionally substituted with one or more of hydroxyl, oxo, -NH2, -NH(C1-C6 alkyl), or -N(C1-C6 alkyl)2.
[0166] In one embodiment, R 4 is substituted with one or more hydroxyls. In one embodiment, R 4 is substituted with one hydroxyl.
[0167] In one embodiment, R 4 is substituted C1-C 12 alkyl. In one embodiment, R 4 is -(CH2) p Q, -(CH2) p CHQR, -CHQR, or -CQ(R)2, where Q is C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR, -O(CH2) pN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R 22 , -O(CH2) p OR, -N(R)C(=NR 23 )N(R)2, -N(R)C(=CHR 23 )N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR 23 )N(R)2, -N(OR)C(=CHR 23 )N(R)2, -C(=NR 23 )N(R)2, -C(=NR 23 )R, -C(O)N(R)OR, or -C(R)N(R)2C(O)OR, where each p is independently 1, 2, 3, 4, or 5, R 22 is C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, R 23 is H, -CN, -NO2, C1-C6 alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C2-C6 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, each R is independently H, C1-C3 alkyl, or C2-C3 alkenyl, or two Rs in the N(R)2 moiety together with the nitrogen to which they are attached form a cyclic moiety, each X is independently F, Cl, Br, or I.
[0168] In one embodiment, R 4is -CH2CH2OH. In one embodiment, R 4 is -CH2CH2CH2OH. In one embodiment, R 4 is -CH2CH2CH2CH2OH. In one embodiment, R 4 is -CH2CH2OCH2CH2OH.
[0169] In one embodiment, R 4 is substituted with one or more -N(R 10 )R 11 . In one embodiment, R 4 is substituted with one -N(R 10 )R 11 .
[0170] In one embodiment, R 10 is hydrogen.
[0171] In one embodiment, R 11 is C3-C8 cycloalkenyl. In one embodiment, R 11 is cyclobutenyl. In one embodiment, R 11 is substituted with one or more of oxo, -NH2, -NH(C1-C6 alkyl), or -N(C1-C6 alkyl)2.
[0172] In one embodiment, R 10 and R 11 together with the nitrogen to which they are attached form a cyclic moiety. In one embodiment, the cyclic moiety is a 5- to 10-membered heteroaryl. In one embodiment, the cyclic moiety is pyrimidin-1-yl. In one embodiment, the cyclic moiety is purin-9-yl. In one embodiment, the cyclic moiety is substituted with one or more of oxo, -NH2, -NH(C1-C6 alkyl), or -N(C1-C6 alkyl)2.
[0173] In one embodiment, R 4 is
Chemical formula
[0174] In one embodiment, R 1 is a linear C6-C 24 alkyl. In one embodiment, R 1 is a linear C7-C 15 alkyl. In one embodiment, R 1 is a linear C7 alkyl. In one embodiment, R 1 is a linear C8 alkyl. In one embodiment, R 1 is a linear C9 alkyl. In one embodiment, R 1 is a linear C 10 alkyl. In one embodiment, R 1 is a linear C 11 alkyl. In one embodiment, R 1 is a linear C 12 alkyl. In one embodiment, R 1 is a linear C 13 alkyl. In one embodiment, R 1 is a linear C 14 alkyl. In one embodiment, R 1 is a linear C 15 alkyl.
[0175] In one embodiment, R 1 is a linear C6-C 24 alkenyl. In one embodiment, R 1 is a linear C7-C 17 alkenyl. In one embodiment, R 1 is a linear C7 alkenyl. In one embodiment, R 1 is a linear C8 alkenyl. In one embodiment, R 1 is a linear C9 alkenyl. In one embodiment, R1 is a linear C 10 alkenyl. In one embodiment, R 1 is a linear C 11 alkenyl. In one embodiment, R 1 is a linear C 12 alkenyl. In one embodiment, R 1 is a linear C 13 alkenyl. In one embodiment, R 1 is a linear C 14 alkenyl. In one embodiment, R 1 is a linear C 15 alkenyl. In one embodiment, R 1 is a linear C 16 alkenyl. In one embodiment, R 1 is a linear C 17 alkenyl.
[0176] In one embodiment, R 1 is a branched C6-C 24 alkyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene and R 8 and R 9 are independently C4-C8 alkyl.
[0177] In one embodiment, R 1 is a branched C6-C 24 alkenyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene and R8 and R 9 is, independently, C2-C 10 alkenyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene and R 8 and R 9 are, independently, C6-C 10 alkenyl.
[0178] In one embodiment, R 2 is linear C6-C 24 alkyl. In one embodiment, R 2 is linear C7-C 15 alkyl. In one embodiment, R 2 is linear C7 alkyl. In one embodiment, R 2 is linear C8 alkyl. In one embodiment, R 2 is linear C9 alkyl. In one embodiment, R 2 is linear C 10 alkyl. In one embodiment, R 2 is linear C 11 alkyl. In one embodiment, R 2 is linear C 12 alkyl. In one embodiment, R 2 is linear C 13 alkyl. In one embodiment, R 2 is linear C 14 alkyl. In one embodiment, R 2 is linear C 15 alkyl.
[0179] In one embodiment, R 2 is linear C6-C 24 alkenyl. In one embodiment, R 2 is linear C7-C 17 alkenyl. In one embodiment, R 2 is linear C7 alkenyl. In one embodiment, R 2 is linear C8 alkenyl. In one embodiment, R2 is a linear C9 alkenyl. In one embodiment, R 2 is a linear C 10 alkenyl. In one embodiment, R 2 is a linear C 11 alkenyl. In one embodiment, R 2 is a linear C 12 alkenyl. In one embodiment, R 2 is a linear C 13 alkenyl. In one embodiment, R 2 is a linear C 14 alkenyl. In one embodiment, R 2 is a linear C 15 alkenyl. In one embodiment, R 2 is a linear C 16 alkenyl. In one embodiment, R 2 is a linear C 17 alkenyl.
[0180] In one embodiment, R 2 is a branched C6-C 24 alkyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0181] In one embodiment, R 2 is a branched C6-C 24 alkenyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9) and R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9 ), and R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C6-C 10 alkenyl.
[0182] In one embodiment, R c is linear C6-C 24 alkyl. In one embodiment, R c is linear C7-C 15 alkyl. In one embodiment, R c is linear C7 alkyl. In one embodiment, R c is linear C8 alkyl. In one embodiment, R c is linear C9 alkyl. In one embodiment, R c is linear C 10 alkyl. In one embodiment, R c is linear C 11 alkyl. In one embodiment, R c is linear C 12 alkyl. In one embodiment, R c is linear C 13 alkyl. In one embodiment, R c is linear C 14 alkyl. In one embodiment, R c is linear C 15 alkyl.
[0183] In one embodiment, R c is linear C6-C 24 alkenyl. In one embodiment, R c is linear C7-C 17 alkenyl. In one embodiment, R c is linear C7 alkenyl. In one embodiment, Rc is a linear C8 alkenyl. In one embodiment, R c is a linear C9 alkenyl. In one embodiment, R c is a linear C 10 alkenyl. In one embodiment, R c is a linear C 11 alkenyl. In one embodiment, R c is a linear C 12 alkenyl. In one embodiment, R c is a linear C 13 alkenyl. In one embodiment, R c is a linear C 14 alkenyl. In one embodiment, R c is a linear C 15 alkenyl. In one embodiment, R c is a linear C 16 alkenyl. In one embodiment, R c is a linear C 17 alkenyl.
[0184] In one embodiment, R c is a branched C6-C 24 alkyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0185] In one embodiment, R c is a branched C6-C 24 alkenyl. In one embodiment, R c is -R 7-CH(R 8 )(R 9 ) and R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C6-C 10 alkenyl.
[0186] In one embodiment, R f is linear C6-C 24 alkyl. In one embodiment, R f is linear C7-C 15 alkyl. In one embodiment, R f is linear C7 alkyl. In one embodiment, R f is linear C8 alkyl. In one embodiment, R f is linear C9 alkyl. In one embodiment, R f is linear C 10 alkyl. In one embodiment, R f is linear C 11 alkyl. In one embodiment, R f is linear C 12 alkyl. In one embodiment, R f is linear C 13 alkyl. In one embodiment, R f is linear C 14 alkyl. In one embodiment, R f is linear C 15 alkyl.
[0187] In one embodiment, R f is linear C6-C 24 alkenyl. In one embodiment, R f is linear C7-C 17 alkenyl. In one embodiment, Rf is a linear C7 alkenyl. In one embodiment, R f is a linear C8 alkenyl. In one embodiment, R f is a linear C9 alkenyl. In one embodiment, R f is a linear C 10 alkenyl. In one embodiment, R f is a linear C 11 alkenyl. In one embodiment, R f is a linear C 12 alkenyl. In one embodiment, R f is a linear C 13 alkenyl. In one embodiment, R f is a linear C 14 alkenyl. In one embodiment, R f is a linear C 15 alkenyl. In one embodiment, R f is a linear C 16 alkenyl. In one embodiment, R f is a linear C 17 alkenyl.
[0188] In one embodiment, R f is a branched C6-C 24 alkyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0189] In one embodiment, R f is a branched C6-C 24It is alkenyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C6-C 10 alkenyl.
[0190] In one embodiment, R 1 , R 2 , R c , and R f are each independently linear C6-C 18 alkyl, linear C6-C 18 alkenyl, or -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl or C2-C 10 alkenyl.
[0191] In one embodiment, R 1 , R 2 , R c , and R f are each independently linear C7-C 15 alkyl, linear C7-C 15 alkenyl, or -R 7 -CH(R 8 )(R 9 ), where R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl or C6-C10 It is alkenyl.
[0192] In one embodiment, R 1 , R 2 , R c , and R f are each independently one of the following structures:
Chemical formula
[0193] In one embodiment, R a is H. In one embodiment, R d is H. In one embodiment, R a , R b , R d , and R e are each independently H. In one embodiment, R b is C1-C 24 alkyl. In one embodiment, R b is C1-C 12 alkyl. In one embodiment, R b is C2-C 24 alkenyl. In one embodiment, R b is C2-C 12 alkenyl. In one embodiment, R e is C1-C 24 alkyl. In one embodiment, R e is C1-C 12 alkyl. In one embodiment, R e is C2-C 24 alkenyl. In one embodiment, R e is C2-C 12 alkenyl.
[0194] In one embodiment, this compound is a compound in Table 1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
Table 1-1
Table 1-2
Table 1-3
Table 1-4
Table 1-5
Table 1-6
Table 1-7
Table 1-8
Table 1-9
Table 1-10
Table 1-11
Table 1-12
Table 1-13
Table 1-14
Table 1-15
Table 1-16
Table 1-17
[0195] In one embodiment, the compound is a compound of Table 1A, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
Table 2-1
Table 2-2
[0196] In one embodiment, provided herein is a compound of formula (X),
Chemical formula
[0197] In one embodiment, Z is -OH. In one embodiment, Z is halogen. In one embodiment, Z is -Cl.
[0198] In one embodiment, the compound of formula (X) is an intermediate used, for example, in the process for preparing the compound of formula (I) as exemplified in the examples provided herein.
[0199] It is understood that any embodiment of the compounds provided herein above, as well as any particular substituents and / or variables in the compounds provided herein above, may independently combine with the substituents and / or variables of other embodiments and / or compounds to form embodiments not specifically described above. Additionally, if a list of substituents and / or variables is recited for any particular group or variable, each individual substituent and / or variable may be deleted from a particular embodiment and / or claim, and the remaining list of substituents and / or variables will be considered to be within the scope of the embodiments provided herein.
[0200] It should be understood that combinations of substituents and / or variables of the indicated formulas herein are permitted only if such combinations result in stable compounds.
[0201] 5.4 Nanoparticle Compositions In one aspect, described herein is a nanoparticle composition comprising a lipid compound described herein. In certain embodiments, the nanoparticle composition comprises a compound according to formula (I) (and its sub-formulas) described herein.
[0202] In some embodiments, the maximum dimension of the nanoparticle compositions provided herein is 1 μm or less (e.g., ≤1 μm, ≤900 nm, ≤800 nm, ≤700 nm, ≤600 nm, ≤500 nm, ≤400 nm, ≤300 nm, ≤200 nm, ≤175 nm, ≤150 nm, ≤125 nm, ≤100 nm, ≤75 nm, ≤50 nm, or less) when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticles provided herein have at least one dimension in the range of about 40 to about 200 nm. In one embodiment, the at least one dimension is in the range of about 40 to about 100 nm.
[0203] Examples of nanoparticle compositions that can be used in connection with the present disclosure include, for example, lipid nanoparticles (LNP), nanolipoprotein particles, liposomes, lipid vesicles, and lipoplexes. In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers can be functionalized and / or crosslinked to each other. The lipid bilayer can include one or more ligands, proteins, or channels.
[0204] The properties of the nanoparticle composition can depend on its components. For example, a nanoparticle composition containing cholesterol as a structural lipid can have different properties from a nanoparticle composition containing a different structural lipid. Similarly, the properties of the nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition containing a higher mole fraction of phospholipids can have different properties from a nanoparticle composition containing a lower mole fraction of phospholipids. The properties can also vary depending on the method and conditions for preparing the nanoparticle composition.
[0205] Nanoparticle compositions can be characterized by various methods. For example, microscopy methods (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure the zeta potential. Particle size can also be determined using dynamic light scattering. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can be used to measure multiple properties of the nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
[0206] Dh (size): The average size of the nanoparticle composition can be in the range of tens of nm to hundreds of nm. For example, the average size can be about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or about 150 nm, i.e., about 40 nm to about 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.
[0207] PDI: The nanoparticle composition can be relatively uniform. The polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.
[0208] Encapsulation efficiency: The efficiency of encapsulation of the therapeutic and / or prophylactic agent is described by the amount of the therapeutic and / or prophylactic agent that is encapsulated or otherwise associated with the nanoparticle composition after preparation relative to the initial amount provided. A high encapsulation efficiency is desirable (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of the therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after decomposing the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in the solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
[0209] Apparent pKa: The zeta potential of the nanoparticle composition can be used to indicate the electrokinetic potential at the interface of the composition. For example, the zeta potential can account for the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because higher charged species may give rise to undesirable interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the nanoparticle composition is from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.
[0210] In another embodiment, the self-replicating RNA can be formulated into liposomes. By way of non-limiting example, the self-replicating RNA can be formulated into liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. In one aspect, the liposomes can include lipids having pKa values that are advantageous for the delivery of mRNA. In another aspect, the liposomes can have an essentially neutral surface charge at physiological pH and can thus be effective for immunization (see, e.g., the liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).
[0211] In some embodiments, the described nanoparticle composition includes a lipid component that includes at least one lipid, such as a compound according to one of the formulas (I) (and sub-formulas thereof) described herein. For example, in some embodiments, the nanoparticle composition can include a lipid component that includes one of the compounds provided herein. The nanoparticle composition can also include one or more other lipid or non-lipid components described below.
[0212] In one embodiment, a nanoparticle composition comprising a compound provided herein and an mRNA exhibits an improved expression level of the mRNA (e.g., as compared to standard cationic lipid compounds known in the art, such as MC3). In one embodiment, after a nanoparticle composition comprising a compound provided herein is administered to a subject, the compound exhibits rapid tissue clearance (e.g., hepatic clearance).
[0213] 5.4.1 Cationic / Ionizable Lipids As described herein, in some embodiments, the nanoparticle compositions provided herein include one or more charged lipids or ionizable lipids in addition to the lipids according to formula (I) (and its sub-formulas). Without being bound by theory, it is believed that certain charged or zwitterionic lipid components of the nanoparticle compositions resemble lipid components in cell membranes, thereby improving cellular uptake of the nanoparticles.Exemplary charged or ionizable lipids that can form part of the present nanoparticle composition include 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3[(9Z,12Z)-octadeca-9,12-dien-1-[yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecane-8-amine.Additional exemplary charged or ionizable lipids that can form part of the present nanoparticle composition include the lipids described in Sabnis et al. “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates”, Molecular Therapy Vol. 26 No 6, 2018 (e.g., Lipid 5), which is incorporated herein by reference in its entirety.
[0214] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1), N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamide)ethyl]-3,4-di[oleoyloxy]-benzamide (MVL5), dioctadecylamidoglycyl spermine (DOGS), 3b-[N-(N’,N’-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol), dioctadecyldimethylammonium bromide (DDAB), SAINT-2, N-methyl-4-(dioleyl)methylpyridinium, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI), dialkylated amino acid (DILA 2)(e.g., C18:1-norArg-C16), dioleyldimethylammonium chloride (DODAC), 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC), 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (MOEPC), (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl), (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G), (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentane-1-aminium chloride (DOTAPen) may be mentioned. Primary amines (e.g., DODAG N’,N’-dioctadecyl-N-4,8-diaza-10-aminodecanoyl glycine amide) and guanidinium head groups (e.g., guanidinium head groups (e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium tren-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)) and other cationic lipids having a head group charged at physiological pH are also suitable. Yet another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl). In certain embodiments, the cationic lipid is a specific enantiomer or racemic form and includes various salt forms of the cationic lipids as described above (e.g., chloride or sulfate). For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate).In some embodiments, the cationic lipid is an ionizable cationic lipid such as, for example, dioctadecyldimethylammonium bromide (DDAB), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-(2dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP), 1,2-dioleoyloxy-3-dimethylaminopropylamine (DODMA), and morpholinocholeterol (Mo-CHOL). In certain embodiments, the lipid nanoparticles comprise a combination or two or more cationic lipids (e.g., two or more of the cationic lipids described above).
[0215] In addition, in some embodiments, the chargeable or ionizable lipid that can form part of the nanoparticle composition is a lipid containing a cyclic amine group. Further cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each of which are incorporated herein by reference in their entirety.
[0216] 5.4.2 Polymer-Conjugated Lipids In some embodiments, the lipid component of the nanoparticle composition can include one or more polymer-conjugated lipids, such as pegylated lipids (PEG lipids). Without being bound by theory, it is believed that the polymer-conjugated lipid component in the nanoparticle composition can improve the colloidal stability and / or reduce the protein absorption of the nanoparticles. Exemplary polymer-conjugated lipids that can be used in connection with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000, or Chol-PEG2000.
[0217] In one embodiment, the polymer-conjugated lipid is a pegylated lipid. For example, some embodiments include pegylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl glycerol (PEG-DMG), pegylated phosphatidylethanololamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2’,3’-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), pegylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecaneoxy)propyl)carbamate or 2,3-di(tetradecaneoxy)propyl--N-(ω-methoxy(polyethoxy)ethyl)carbamate.
[0218] In one embodiment, the polymer-conjugated lipid is present at a concentration in the range of 1.0 to 2.5 mole percent. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.7 mole percent. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.
[0219] In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 100:1 to about 20:1.
[0220] In one embodiment, the pegylated lipid has the following formula: [Chemical formula] or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein R 12 and R 13 are each independently a straight-chain or branched, saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, and the alkyl chain is optionally interrupted by one or more ester bonds, w has an average value in the range of 30 to 60.
[0221] In one embodiment, R 12 and R 13 are each independently a straight-chain saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average w ranges from 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In certain embodiments, the average w is about 49.
[0222] In one embodiment, the pegylated lipid has the following formula: [Chemical formula] wherein the average w is about 49.
[0223] 5.4.3 Structural Lipids In some embodiments, the lipid component of the nanoparticle composition can include one or more structural lipids. Without being bound by theory, it is believed that structural lipids can stabilize the amphiphilic structure of the nanoparticles, such as, but not limited to, the lipid bilayer structure of the nanoparticles. Exemplary structural lipids that can be used in connection with the present disclosure include cholesterol, fucosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatin, ursolic acid, α-tocopherol, and mixtures thereof, but are not limited thereto. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (such as prednisone, dexamethasone, prednisone, and hydrocortisone), or combinations thereof.
[0224] In one embodiment, the lipid nanoparticles provided herein include a steroid or a steroid analog. In one embodiment, the steroid or steroid analog is cholesterol. In one embodiment, the steroid is present at a concentration in the range of 39 - 49 mole percent, 40 - 46 mole percent, 40 - 44 mole percent, 40 - 42 mole percent, 42 - 44 mole percent, or 44 - 46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mole percent.
[0225] In one embodiment, the molar ratio of the cationic lipid to the steroid is in the range of 1.0:0.9 - 1.0:1.2, or 1.0:1.0 - 1.0:1.2. In one embodiment, the molar ratio of the cationic lipid to cholesterol is in the range of about 5:1 - 1:1. In one embodiment, the steroid is present at a concentration in the range of 32 - 40 mole percent of the steroid.
[0226] 5.4.4 Phospholipids In some embodiments, the lipid component of the nanoparticle composition can include one or more phospholipids, such as one or more (poly)unsaturated lipids. Without being bound by theory, it is believed that the phospholipids assemble into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle composition include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin, but are not limited thereto. In certain embodiments, the nanoparticle composition includes DSPC. In certain embodiments, the nanoparticle composition includes DOPE.In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.
[0227] Additional exemplary neutral lipids include, for example, dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE), and 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (trans DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM.
[0228] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).
[0229] In addition, phospholipids that can form part of the nanoparticle composition include those described in International Publication No. WO 2017 / 112865, the entire content of which is hereby incorporated by reference in its entirety.
[0230] 5.4.5 Therapeutic Payload According to the present disclosure, the nanoparticle compositions described herein may further comprise one or more therapeutic and / or prophylactic agents. These therapeutic and / or prophylactic agents may be referred to herein as "therapeutic payloads" or "payloads". In some embodiments, the therapeutic payloads may be administered in vivo or in vitro using the nanoparticles as delivery vehicles.
[0231] In some embodiments, the nanoparticle compositions include, as therapeutic payloads, antineoplastic agents (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antitumor agents (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs such as methotrexate and purine and pyrimidine analogs), anti-infective agents, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol), antihypertensive agents (e.g., clonidine and hydralazine), antidepressants (e.g., imipramine, amitriptyline, and doxepin), anticonvulsants (e.g., phenytoin), antihistamines (diphenhydramine, chlorpheniramine, promethazine), antibacterial / antimicrobial agents (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungal agents (e.g., miconazole, terconazole, econazole, isoconazole, butoconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitic agents, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and contrast agents, such as small molecule compounds (e.g., small molecule drugs).
[0232] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that induces an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic drugs include any agent that can be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids such as maytansinol, razoxane (CC-1065), and their analogs or homologs. Radioactive ions include, but are not limited to, iodine (e.g., iodine 125 or iodine 131), strontium 89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium 90, samarium 153, and praseodymium.
[0233] In other embodiments, the therapeutic payload of the nanoparticle composition may include, but is not limited to, therapeutic and / or prophylactic agents such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, razoxane (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mitramycin, and anthramycin (AMC)), and antimicrotubule agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).
[0234] In some embodiments, the nanoparticle composition contains biological molecules such as peptides and polypeptides as a therapeutic payload. The biomolecules forming part of the nanoparticle composition can be either of natural origin or synthetic. For example, in some embodiments, the therapeutic payload of the nanoparticle composition can include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), factor VIII, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.
[0235] 5.4.5.1 Nucleic Acids In some embodiments, the nanoparticle composition contains one or more nucleic acid molecules (e.g., DNA or RNA molecules) as a therapeutic payload. Exemplary forms of nucleic acid molecules that can be included in the nanoparticle composition as a therapeutic payload include deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger RNA (mRNA), their hybrids, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like, but are not limited thereto. In certain embodiments, the therapeutic payload includes RNA. Examples of RNA molecules that can be included in the nanoparticle composition as a therapeutic payload include shortmers, agomirs, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer substrate RNA (dsRNA), short hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA molecules known in the art, but are not limited thereto. In certain embodiments, the RNA is mRNA.
[0236] In other embodiments, the nanoparticle composition includes siRNA molecules as a therapeutic payload. In particular, in some embodiments, the siRNA molecules can selectively interfere with and downregulate the expression of a gene of interest. For example, in some embodiments, the siRNA payload selectively silences a gene associated with a particular disease, disorder, or condition when the nanoparticle composition comprising the siRNA is administered to a subject in need thereof. In some embodiments, the siRNA molecules comprise sequences that are complementary to the mRNA sequence encoding the protein product of interest. In some embodiments, the siRNA molecules are immunomodulatory siRNAs.
[0237] In some embodiments, the nanoparticle composition includes shRNA molecules or vectors encoding shRNA molecules as a therapeutic payload. In particular, in some embodiments, the therapeutic payload produces shRNA intracellularly when administered to a target cell. The constructs and mechanisms regarding shRNA are well known in the relevant art.
[0238] In some embodiments, the nanoparticle composition includes mRNA molecules as a therapeutic payload. In particular, in some embodiments, the mRNA molecules encode a polypeptide of interest, which can include any native or non-native or otherwise modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.
[0239] In some embodiments, the nucleic acid molecules of the present disclosure include mRNA molecules. In certain embodiments, the nucleic acid molecule comprises at least one coding region (e.g., an open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (towards the 5' end) of the coding region and is referred to herein as the 5'-UTR. In certain embodiments, the untranslated region (UTR) is located downstream (towards the 3' end) of the coding region and is referred to herein as the 3'-UTR. In certain embodiments, the nucleic acid molecule comprises both a 5'-UTR and a 3'-UTR. In some embodiments, the 5'-UTR comprises a 5' cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecule comprises a polyA region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a stabilizing region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5'-UTR and / or 3'-UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions that can be excised during splicing. In certain embodiments, the nucleic acid molecule comprises one or more regions selected from the 5'-UTR and the coding region. In certain embodiments, the nucleic acid molecule comprises one or more regions selected from the coding region and the 3'-UTR. In certain embodiments, the nucleic acid molecule comprises one or more regions selected from the 5'-UTR, the coding region, and the 3'-UTR.
[0240] Coding region In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) that encodes a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each of which encodes a peptide or protein. In those embodiments where the coding region comprises two or more ORFs, the encoded peptides and / or proteins may be the same as or different from each other. In some embodiments, the multiple ORFs in the coding region are separated by non-coding sequences. In certain embodiments, the non-coding sequence separating two ORFs comprises an internal ribosome entry site (IRES).
[0241] Without being bound by theory, it is believed that an internal ribosome entry site (IRES) can act as a sole ribosome binding site or function as one of multiple ribosome binding sites of an mRNA. An mRNA molecule containing two or more functional ribosome binding sites can encode several peptides or polypeptides that are translated independently by ribosomes (e.g., polycistronic mRNA). Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in connection with the present disclosure include, but are not limited to, those derived from picornavirus (e.g., FMDV), pestivirus (CFFV), poliovirus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV).
[0242] In various embodiments, the nucleic acid molecules of the present disclosure encode for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecule encodes a tripeptide. In some embodiments, the nucleic acid molecule encodes a tetrapeptide. In some embodiments, the nucleic acid molecule encodes a pentapeptide. In some embodiments, the nucleic acid molecule encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes a heptapeptide. In some embodiments, the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a decapeptide. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.
[0243] In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecules are at least about 35 nt in length. In some embodiments, the nucleic acid molecules are at least about 40 nt in length. In some embodiments, the nucleic acid molecules are at least about 45 nt in length. In some embodiments, the nucleic acid molecules are at least about 50 nt in length. In some embodiments, the nucleic acid molecules are at least about 55 nt in length. In some embodiments, the nucleic acid molecules are at least about 60 nt in length. In some embodiments, the nucleic acid molecules are at least about 65 nt in length. In some embodiments, the nucleic acid molecules are at least about 70 nt in length. In some embodiments, the nucleic acid molecules are at least about 75 nt in length. In some embodiments, the nucleic acid molecules are at least about 80 nt in length. In some embodiments, the nucleic acid molecules are at least about 85 nt in length. In some embodiments, the nucleic acid molecules are at least about 90 nt in length. In some embodiments, the nucleic acid molecules are at least about 95 nt in length. In some embodiments, the nucleic acid molecules are at least about 100 nt in length. In some embodiments, the nucleic acid molecules are at least about 120 nt in length. In some embodiments, the nucleic acid molecules are at least about 140 nt in length. In some embodiments, the nucleic acid molecules are at least about 160 nt in length. In some embodiments, the nucleic acid molecules are at least about 180 nt in length. In some embodiments, the nucleic acid molecules are at least about 200 nt in length. In some embodiments, the nucleic acid molecules are at least about 250 nt in length. In some embodiments, the nucleic acid molecules are at least about 300 nt in length. In some embodiments, the nucleic acid molecules are at least about 400 nt in length. In some embodiments, the nucleic acid molecules are at least about 500 nt in length. In some embodiments, the nucleic acid molecules are at least about 600 nt in length. In some embodiments, the nucleic acid molecules are at least about 700 nt in length. In some embodiments, the nucleic acid molecules are at least about 800 nt in length. In some embodiments, the nucleic acid molecules are at least about 900 nt in length. In some embodiments, the nucleic acid molecules are at least about 1000 nt in length.In some embodiments, the nucleic acid molecule is at least about 1100 nt in length. In some embodiments, the nucleic acid molecule is at least about 1200 nt in length. In some embodiments, the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the nucleic acid molecule is at least about 1400 nt in length. In some embodiments, the nucleic acid molecule is at least about 1500 nt in length. In some embodiments, the nucleic acid molecule is at least about 1600 nt in length. In some embodiments, the nucleic acid molecule is at least about 1700 nt in length. In some embodiments, the nucleic acid molecule is at least about 1800 nt in length. In some embodiments, the nucleic acid molecule is at least about 1900 nt in length. In some embodiments, the nucleic acid molecule is at least about 2000 nt in length. In some embodiments, the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.
[0244] In certain embodiments, the therapeutic payload comprises a vaccine composition (e.g., a gene vaccine) described herein. In some embodiments, the therapeutic payload comprises a compound capable of inducing immunity against the state or disease of one or more targets. In some embodiments, the target state is associated with or caused by an infection by a pathogen such as a coronavirus (e.g., 2019-nCoV), influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis. In some embodiments, the therapeutic payload comprises a pathogenic protein characteristic of the pathogen, or a nucleic acid sequence (e.g., mRNA) encoding an antigenic fragment or epitope thereof. When administered to a vaccinated subject, the vaccine enables the expression of the encoded pathogenic protein (or its antigenic fragment or epitope), thereby inducing the subject's immunity against the pathogen.
[0245] In some embodiments, the target state is associated with or caused by the neoplastic proliferation of cells such as cancer. In some embodiments, the therapeutic payload comprises a tumor-associated antigen (TAA) characteristic of cancer, or a nucleic acid sequence (e.g., mRNA) encoding an antigenic fragment or epitope thereof. When administered to a vaccinated subject, the vaccine enables the expression of the encoded TAA (or its antigenic fragment or epitope), thereby inducing the subject's immunity against tumor cells expressing the TAA.
[0246] 5' cap structure Without being bound by theory, it is believed that the 5' cap structure of a polynucleotide is involved in nuclear transport and increased polynucleotide stability, and binds to an mRNA cap-binding protein (CBP) involved in polynucleotide stability and translational ability in cells through the association of CBP with polyA-binding protein to form mature circular mRNA species. The 5' cap structure further aids in the removal of 5'-proximal introns during mRNA splicing. Thus, in some embodiments, the nucleic acid molecules of the present disclosure comprise a 5' cap structure.
[0247] The nucleic acid molecule can have its 5' end capped by the endogenous transcriptional machinery of the cell, generating a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5'-terminal transcribed sense nucleotide. This 5' guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or ante-terminal transcribed nucleotides at the 5' end of the polynucleotide can also optionally be 2'-O-methylated. 5'-decapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules such as mRNA molecules for degradation.
[0248] In some embodiments, the nucleic acid molecules of the present disclosure include one or more modifications to the native 5' cap structure generated by endogenous processes. Without being bound by theory, modifications on the 5' cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase the translation efficiency of the polynucleotide.
[0249] Exemplary modifications to the native 5' cap structure include the generation of a non-hydrolyzable cap structure that prevents decapping and thus increases polynucleotide half-life. In some embodiments, since hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester linkage, in some embodiments, modified nucleotides can be used during the capping reaction. For example, in some embodiments, vaccinia capping enzymes from New England Biolabs (Ipswich, Mass.) can be used with α-thio-guanosine nucleotides, according to the manufacturer's instructions, to create phosphorothioate linkages in the 5'-ppp-5' cap. Additional modified guanosine nucleotides such as α-methyl-phosphonate and seleno-phosphate nucleotides can be used.
[0250] Further exemplary modifications to the native 5’ cap structure include modifications at the 2’ and / or 3’ positions of the capped guanosine triphosphate (GTP), replacement of the methylene portion (CH2) of the sugar ring oxygen (which produced a carbocyclic ring), modifications in the triphosphate bridging portion of the cap structure, or modifications in the nucleobase (G) portion.
[0251] Further exemplary modifications to the native 5’ cap structure include, but are not limited to, 2’-O-methylation of the ribose sugar of the 5’ terminal and / or 5’ pre-terminal nucleotide of the polynucleotide on the 2’ hydroxy group of the sugar, as described above. Multiple distinct 5’ cap structures can be used to generate the 5’ cap of a polynucleotide such as an mRNA molecule. Further exemplary 5’ cap structures that can be used in connection with the present disclosure include those described in International Patent Publications WO2008127688, WO2008016473, and WO2011015347, the entire contents of each of which are incorporated herein by reference.
[0252] In various embodiments, the 5’ terminal cap can include a cap analog. As used herein, a cap analog, also referred to as a synthetic cap analog, chemical cap, chemical cap analog, or structural or functional cap analog, differs from the native (i.e., endogenous, wild-type, or physical) 5’ cap in its chemical structure while retaining the cap function. Cap analogs can be synthesized chemically (i.e., non-enzymatically) or enzymatically and / or can be ligated to a polynucleotide.
[0253] For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5’-5’-triphosphate group, where one guanosine contains an N7-methyl group and a 3’-O-methyl group (i.e., N7,3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m 7G-3’mppp-G, which may equivalently be designated 3’O-Me-m7G(5’)ppp(5’)G. The 3’-O atom of other unmodified guanosines is linked to the 5’-terminal nucleotide of the capped polynucleotide (e.g., mRNA). N7- and 3’-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2’-O-methyl group on guanosine (i.e., N7,2’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m7Gm-ppp-G).
[0254] In some embodiments, the cap analog may be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified with a borano phosphate group or a phosphorothioate group, such as the dinucleotide cap analog described in U.S. Patent No. 8,519,110, at different phosphate positions, the entire content of which is incorporated herein by reference in its entirety.
[0255] In some embodiments, the cap analog may be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5’)ppp(5’)G and N7-(4-chlorophenoxyethyl)-m3’-OG(5’)ppp(5’)G cap analogs (see, e.g., various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574, the entire content of which is incorporated herein by reference). In other embodiments, the cap analog useful in connection with the nucleic acid molecules of the present disclosure is a 4-chloro / bromophenoxyethyl analog.
[0256] In various embodiments, the cap analog may include a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
[0257] Without being bound by theory, the cap analog may enable the concomitant capping of the polynucleotide in an in vitro transcription reaction, although it is contemplated that up to 20% of the transcription product may remain uncapped. This can lead to a reduction in translation ability and a reduction in cellular stability, similar to the structural differences of the cap analog from the native 5' cap structure of the polynucleotide produced by the endogenous transcription machinery of the cell.
[0258] Thus, in some embodiments, the nucleic acid molecules of the present disclosure can be post-transcriptionally capped using enzymes to generate a more authentic 5' cap structure. As used herein, the phrase "more authentic" refers to a feature that structurally or functionally firmly reflects or mimics an endogenous or wild-type feature. That is, a "more authentic" feature better represents an endogenous wild-type, natural, or physiological cellular function and / or structure compared to a synthetic feature or analog of the prior art, or is superior to the corresponding endogenous wild-type, natural, or physiological feature in one or more respects. Non-limiting examples of more authentic 5' cap structures useful in connection with the nucleic acid molecules of the present disclosure include, among others, enhanced binding of cap-binding proteins, increased half-life, reduced sensitivity to 5' endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures (or wild-type, natural, or physiological 5' cap structures) known in the art. For example, in some embodiments, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate bond between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, the cap guanosine includes N7 methylation, and the 5'-terminal nucleotide of the polynucleotide includes 2'-O-methyl. Such a structure is referred to as a cap 1 structure. This cap results in, for example, higher translational ability, cellular stability, and reduced activation of pro-inflammatory cytokines compared to other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N, pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).
[0259] Although not bound by theory, the nucleic acid molecules of the present disclosure can be capped post-transcriptionally, and it is believed that nearly 100% of the nucleic acid molecules can be capped because this process is more efficient.
[0260] Untranslated region (UTR) In some embodiments, the nucleic acid molecules of the present disclosure include one or more untranslated regions (UTRs). In some embodiments, the UTR is positioned upstream of the coding region in the nucleic acid molecule and is referred to as the 5'-UTR. In some embodiments, the UTR is positioned downstream of the coding region in the nucleic acid molecule and is referred to as the 3'-UTR. The sequence of the UTR can be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs can be included in the nucleic acid molecule and can be of the same or different sequences and / or of different genetic origins. According to the present disclosure, any portion (including none) of the UTR in the nucleic acid molecule can be codon-optimized and any of them can independently contain one or more different structural or chemical modifications before and / or after codon optimization.
[0261] In some embodiments, the nucleic acid molecules of the present disclosure (e.g., mRNA) include UTRs and coding regions that are homologous to each other. In other embodiments, the nucleic acid molecules of the present disclosure (e.g., mRNA) include UTRs and coding regions that are heterologous to each other. In some embodiments, to monitor the activity of the UTR sequence, a nucleic acid molecule comprising the UTR and the coding sequence of a detectable probe can be administered in vitro (e.g., to a cell or tissue culture) or in vivo (e.g., to a subject), and the effect of the UTR sequence (e.g., regulation of the expression level, cellular localization of the encoded product, or half-life of the encoded product) can be measured using methods known in the art.
[0262] In some embodiments, the UTRs of the nucleic acid molecules (e.g., mRNA) of the present disclosure include at least one translation enhancer element (TEE) that functions to increase the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the TEE is located in the 5'-UTR of the nucleic acid molecule. In other embodiments, the TEE is located in the 3'-UTR of the nucleic acid molecule. In still other embodiments, at least two TEEs are located in the 5'-UTR and 3'-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure may include one or more copies of the TEE sequence or may include two or more different TEE sequences. In some embodiments, the different TEE sequences present in the nucleic acid molecules of the present disclosure may be homologous or heterologous with respect to each other.
[0263] A variety of TEE sequences known in the art can be used in connection with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or IRES element. Chappell et al. Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004, Zhou et al. Proc. Natl. Acad. Sci. 102:6273-6278, 2005. Further internal ribosome entry sites (IRESs) that can be used in connection with the present disclosure include those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776, and U.S. Patent Publication No. 2011 / 0124100, as well as International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055369, but are not limited thereto, and the entire content of each of these is hereby incorporated by reference in its entirety. In some embodiments, the TEE may be those described in Supplementary Tables 1 and 2 of Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug;10(8):747-750, the content of which is hereby incorporated by reference in its entirety.
[0264] Additional exemplary TEEs that may be used in connection with the present disclosure include, but are not limited to, the TEE arrays disclosed in U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644, and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, European Patent No. 2610340, the contents of each of which are hereby incorporated by reference in their entirety.
[0265] In various embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure includes at least one UTR that includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the TEE sequences in the UTR of the nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule are different TEE sequences. In some embodiments, a plurality of different TEE sequences are arranged in one or more repeating patterns in the UTR region of the nucleic acid molecule. For illustrative purposes only, the repeating patterns can be, for example, ABABAB, AABBAABBAABB, ABCABCABC, etc., and in these exemplary patterns, each capital letter (A, B, or C) represents a different TEE sequence. In some embodiments, at least two TEE sequences are contiguous (i.e., there is no spacer sequence in between) in the UTR of the nucleic acid molecule. In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, the UTR can include a TEE sequence spacer sequence module that is repeated at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or more than 9 times in the UTR. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR, or both the 5'-UTR and 3'-UTR of the nucleic acid molecule.
[0266] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) of the present disclosure includes at least one translation inhibitory element that functions to reduce the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule includes one or more miR sequences or fragments thereof (e.g., miR seed sequences) recognized by one or more microRNAs. In some embodiments, the UTR of the nucleic acid molecule includes one or more stem-loop structures that downregulate the translational activity of the nucleic acid molecule. Other mechanisms for suppressing the translational activity associated with nucleic acid molecules are known in the art. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR, or both the 5'-UTR and 3'-UTR of the nucleic acid molecule.
[0267] Polyadenylation (polyA) region During natural RNA processing, a long chain of adenosine nucleotides (polyA region) is usually added to messenger RNA (mRNA) molecules to increase the stability of the molecules. Immediately after transcription, the 3´ end of the transcript is cleaved to release a 3´-hydroxy. Then, polyA polymerase adds a chain of adenosine nucleotides to the RNA. This process, called polyadenylation, adds a polyA region that is between 100 and 250 residues in length. Without being bound by theory, it is believed that the polyA region can confer various advantages to the nucleic acid molecules of the present disclosure.
[0268] Thus, in some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure includes a polyadenylation signal. In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure includes one or more polyadenylation (polyA) regions. In some embodiments, the polyA region consists entirely of adenosine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule includes at least one polyA region at its 3’ end. In some embodiments, the nucleic acid molecule includes at least one polyA region at its 5’ end. In some embodiments, the nucleic acid molecule includes at least one polyA region at its 5’ end and at least one polyA region at its 3’ end.
[0269] According to the present disclosure, the polyA region can have different lengths in different embodiments. In particular, in some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 85 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 95 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 140 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 150 nucleotides in length.In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 190 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 200 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 300 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 600 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length.In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.
[0270] In some embodiments, the length of the polyA region in the nucleic acid molecule can be selected based on the full length of the nucleic acid molecule, or a part thereof (for example, the length of the coding region, or the length of the open reading frame of the nucleic acid molecule, etc.). For example, in some embodiments, the polyA region occupies about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the full length of the nucleic acid molecule containing the polyA region.
[0271] Although not bound by theory, certain RNA-binding proteins are thought to be able to bind to the polyA region located at the 3' end of mRNA molecules. These polyA-binding proteins (PABP) can regulate mRNA expression, such as by interacting with the translation initiation machinery in cells and / or protecting the 3' polyA tail from degradation. Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure include at least one binding site for polyA-binding protein (PABP). In other embodiments, the nucleic acid molecule is conjugated or complexed with PABP before being loaded into a delivery vehicle (e.g., a lipid nanoparticle).
[0272] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure include a polyA-G cassette. The G cassette is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G cassette is incorporated at the end of the polyA region. The resulting polynucleotide (e.g., mRNA) can be assayed at various time points for other parameters including stability, protein production, and half-life. It has been discovered that the polyA-G cassette structure results in protein production equal to at least 75% of the protein production seen using only a 120-nucleotide polyA region.
[0273] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure may include a polyA region and may be stabilized by the addition of a 3' stabilizing region. In some embodiments, the 3' stabilizing region that can be used to stabilize the nucleic acid molecule (e.g., mRNA) includes the polyA or polyA-G cassette structure described in International Patent Publication No. WO2013 / 103659, the contents of which are hereby incorporated by reference in their entirety.
[0274] In other embodiments, 3’ stabilizing regions that can be used in connection with the nucleic acid molecules of the present disclosure include chain-terminating nucleosides such as 3’-deoxyadenosine (cordycepin), 3’-deoxythymidine, 3’-deoxycytidine, 3’-deoxyguanosine, 3’-deoxythymidine, 2’,3’-dideoxyadenosine, 2’,3’-dideoxyuridine, 2’,3’-dideoxycytidine, 2’,3’-dideoxyguanosine, 2’,3’-dideoxythymidine, etc., 2’-deoxynucleosides, or O-methyl nucleosides, 3’-deoxynucleosides, 2’,3’-dideoxynucleosides, 3’-O-methyl nucleosides, 3’-O-ethyl nucleosides, 3’-arabinosides, and other alternative nucleosides known in the art and / or described herein, but are not limited thereto.
[0275] Secondary structure Without being bound by theory, it is contemplated that stem-loop structures direct RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA-binding proteins, and can function as substrates for enzymatic reactions. For example, the incorporation of miR sequences and / or TEE sequences can change the shape of stem-loop regions that can increase and / or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3’UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct;12(10):1014-20, the content of which is incorporated herein by reference in its entirety).
[0276] Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) described herein, or portions thereof, can adopt a stem-loop structure, such as but not limited to a histone stem-loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence that is about 25 or about 26 nucleotides in length, such as but not limited to those described in International Patent Publication No. WO2013 / 103659, the content of which is hereby incorporated by reference in its entirety. Further examples of stem-loop sequences include those described in International Patent Publication Nos. WO2012 / 019780 and WO201502667, the content of which is hereby incorporated by reference. In some embodiments, the stem-loop sequence includes the TEE described herein. In some embodiments, the stem-loop sequence includes the miR sequence described herein. In certain embodiments, the stem-loop sequence may include the miR-122 seed sequence. In certain embodiments, the nucleic acid molecule includes the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule includes the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).
[0277] In some embodiments, the nucleic acid molecules of the present disclosure (e.g., mRNA) include a stem-loop sequence located upstream (towards the 5' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5'-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules of the present disclosure (e.g., mRNA) include a stem-loop sequence located downstream (towards the 3' end) of the coding region within the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule can contain two or more stem-loop sequences. In some embodiments, the nucleic acid molecule includes at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.
[0278] In some embodiments, a nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain-terminating nucleoside that functions to retard degradation and thus increase the half-life of the nucleic acid molecule. Exemplary chain-terminating nucleosides that may be used in connection with the present disclosure include 3'-deoxyadenosine (cordycepin), 3'-deoxythymidine, 3'-deoxycytidine, 3'-deoxyguanosine, 3'-deoxythymidine, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytidine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine and other 2',3'-dideoxynucleosides, 2'-deoxynucleosides, or O-methyl nucleosides, 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methyl nucleosides, 3'-O-ethyl nucleosides, 3'-arabinosides, as well as other alternative nucleosides known in the art and / or described herein. In other embodiments, the stem-loop structure can be stabilized by modification of the 3' region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (International Patent Publication No. WO2013 / 103659, which is incorporated herein by reference in its entirety).
[0279] In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one stem-loop sequence and a polyA region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a polyA region or polyadenylation signal include those described in International Patent Publication Nos. WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499 and WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.
[0280] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a polyA region or polyadenylation signal can encode a pathogenic antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120499 and WO2013 / 120628, the entire contents of each of which are incorporated herein by reference in their entirety.
[0281] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a polyA region or polyadenylation signal can encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120497 and WO2013 / 120629, the entire contents of each of which are incorporated herein by reference in their entirety.
[0282] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a polyA region or polyadenylation signal can encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120500 and WO2013 / 120627, the entire contents of each of which are incorporated herein by reference in their entirety.
[0283] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a polyA region or polyadenylation signal can encode an allergic antigen or an autoimmune self-antigen, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120498 and WO2013 / 120626, the entire contents of each of which are incorporated herein by reference in their entirety.
[0284] Functional nucleotide analogs In some embodiments, the payload nucleic acid molecules described herein contain only standard nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is believed that certain functional nucleotide analogs can impart useful properties to nucleic acid molecules. Examples of useful properties in the context of the present disclosure include, but are not limited to, increased stability of the nucleic acid molecule, reduced immunogenicity of the nucleic acid molecule in inducing an innate immune response, enhanced production of the protein encoded by the nucleic acid molecule, increased intracellular delivery and / or retention of the nucleic acid molecule, and / or reduced cytotoxicity of the nucleic acid molecule.
[0285] Accordingly, in some embodiments, the payload nucleic acid molecule includes at least one functional nucleotide analog described herein. In some embodiments, the functional nucleotide analog includes at least one chemical modification to a nucleobase, sugar moiety, and / or phosphate group. Accordingly, a payload nucleic acid molecule that includes at least one functional nucleotide analog contains at least one chemical modification to a nucleobase, sugar moiety, and / or internucleoside linkage. Exemplary chemical modifications to the nucleobases, sugar moieties, or internucleoside linkages of nucleic acid molecules are provided herein.
[0286] As described herein, from 0% to 100% of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% of the nucleotides in the nucleic acid molecule are functional nucleotide analogs as described herein. In any of these embodiments, the functional nucleotide analogs can be present at any position(s) of the nucleic acid molecule, including the 5' end, 3' end, and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).
[0287] As described herein, 0% to 100% of certain nucleotides in a payload nucleic acid molecule (e.g., all purine-containing nucleotides as a certain type, or all pyrimidine-containing nucleotides as a certain type, or all A, G, C, T, or U as a certain type) can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% of certain nucleotides in a nucleic acid molecule are functional nucleotide analogs as described herein. In any of these embodiments, the functional nucleotide analogs can be present at any position(s) of the nucleic acid molecule, including the 5'-end, 3'-end, and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).
[0288] Modification to Nucleobase In some embodiments, the functional nucleotide analogs contain non-standard nucleobases. In some embodiments, the standard nucleobases in nucleotides (e.g., adenine, guanine, uracil, thymine, and cytosine) can be modified or substituted to provide one or more functional analogs of the nucleotides. Exemplary modifications to the nucleobases include, but are not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions, one or more condensations or ring openings, oxidations, and / or reductions. One or more substitutions or modifications are included, including, but not limited to, those described above.
[0289] In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3 U), 5-methoxy-uracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracil 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s2 U), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thio-uracil (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouridine, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 5s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uracil (m 5 U), 5-(isopentenylaminomethyl)-2-thio-uracil (m 5 s 2 U), 5,2’-O-dimethyl-uridine (m 5 Um), 2-thio-2’-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2’-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2’-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2’-O-methyl-uridine (cmnm 5 Um), 3,2’-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2’-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil are included.
[0290] In some embodiments, the non-standard nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosine include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytosine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2’-O-dimethyl-cytidine (m5Cm), N4-acetyl-2’-O-methyl-cytidine (ac4Cm), N4,2’-O-dimethyl-cytidine (m4Cm), 5-formyl-2’-O-methyl-cytidine (fSCm), N4,N4,2’-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.
[0291] In some embodiments, the non-standard nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having alternative adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2’-O-dimethyl-adenosine (m6Am), N6,N6,2’-O-trimethyl-adenosine (m62Am), 1,2’-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.
[0292] In some embodiments, the non-standard nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxwybutosine (o2yW), hydroxywybutosine (OHyW), hypomodified hydroxywybutosine (OHyW*), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-trimethylguanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.
[0293] In some embodiments, the non-standard nucleobases of the functional nucleotide analogs can independently be purines, pyrimidines, purine or pyrimidine analogs. For example, in some embodiments, the non-standard nucleobases can be modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-standard nucleobases can be, for example, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azauracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine, or 1,3,5triazine, including natural and synthetic derivatives of the bases.
[0294] Modifications to the sugar In some embodiments, the functional nucleotide analogs contain non-standard sugar groups. In various embodiments, the non-standard sugar groups are five-carbon or six-carbon sugars (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or their deoxy derivatives) having one or more substitutions such as halo groups, hydroxy groups, thiol groups, alkyl groups, alkoxy groups, alkenyloxy groups, alkynyloxy groups, cycloalkyl groups, aminoalkoxy groups, alkoxyalkoxy groups, hydroxyalkoxy groups, amino groups, azide groups, aryl groups, aminoalkyl groups, aminoalkenyl groups, aminoalkynyl groups, etc.
[0295] Generally, RNA molecules contain a ribose sugar group, which is a five-membered ring with oxygen. Exemplary non-limiting alternative nucleotides include replacement of oxygen in ribose (e.g., with S, Se, or an alkylene such as methylene or ethylene), addition of a double bond (e.g., replacing ribose with cyclopentenyl or cyclohexenyl), ring contraction of ribose (e.g., forming a four-membered ring of cyclobutane or oxetane), ring expansion of ribose (e.g., forming a six- or seven-membered ring with additional carbon or heteroatoms for anhydrohexitol, allitol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (which also has a phosphoramidate backbone)), polycyclic forms (e.g., "unlocked" forms such as tricyclo and glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA where ribose is replaced by a glycol unit linked by a phosphodiester bond)), threose nucleic acid (TNA where ribose is replaced by α-L-threofuranosyl-(3’→2’)), and peptide nucleic acid (PNA where the 2-amino-ethyl-glycine linkage replaces the ribose and phosphodiester backbone).
[0296] In some embodiments, the sugar group contains one or more carbons having the opposite stereochemical configuration of the corresponding carbon in ribose. Thus, the nucleic acid molecule can include, for example, nucleotides containing arabinose or L-ribose as the sugar. In some embodiments, the nucleic acid molecule includes at least one nucleoside, and the sugar is L-ribose, 2'-O-methylribose, 2'-fluororibose, arabinose, hexitol, LNA, or PNA.
[0297] Modification of internucleoside linkages In some embodiments, the payload nucleic acid molecules of the present disclosure can include one or more modified internucleoside linkages (e.g., phosphate backbone). The backbone phosphate groups can be modified by replacing one or more oxygen atoms with different substituents.
[0298] In some embodiments, functional nucleotide analogs can include replacement of the unmodified phosphate moiety with another internucleoside linkage described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphorodithioate, phosphororoselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, phosphorodiamidate, alkyl or aryl phosphonate, and phosphotriester. Phosphorodithioate replaces both non-bonding oxygens with sulfur. The phosphate linker can also be modified by replacing the linked oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene-phosphonate).
[0299] Alternative nucleosides and nucleotides can include replacing one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens in the same position (e.g., the alpha (α), beta (β), or gamma (γ) position) can be replaced with sulfur (thio) and methoxy. Replacement of one or more of the oxygen atoms at the position of the phosphate moiety (e.g., α-thiophosphate) is provided to confer stability (such as to exonucleases and endonucleases) to RNA and DNA via unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently longer half-lives in the cellular environment.
[0300] Other internucleoside linkages that can be used in accordance with the present disclosure, including internucleoside linkages that do not contain a phosphorus atom, are described herein.
[0301] As further examples of nucleic acid molecules (e.g., mRNA), compositions, formulations, and / or methods related thereto that can be used in connection with the present disclosure, there are those described in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, the contents of each of which are hereby incorporated by reference in their entirety.
[0302] 5.5 Formulations According to the present disclosure, the nanoparticle compositions described herein can include at least one lipid component and one or more additional components such as therapeutic and / or prophylactic agents. The nanoparticle compositions can be designed for one or more specific uses or targets. The elements of the nanoparticle compositions can be selected based on a specific use or target and / or based on the effectiveness, toxicity, cost, ease of use, availability, or other characteristics of one or more of the elements. Similarly, a specific formulation of the nanoparticle composition can be selected for a specific use or target, for example, depending on the effectiveness and toxicity of a specific combination of elements.
[0303] The lipid component of the nanoparticle composition can include, for example, a lipid according to one of the formulas (I) (and sub-formulas thereof) described herein, phospholipids (unsaturated lipids such as DOPE or DSPC, etc.), PEG lipids, and structural lipids. The elements of the lipid component can be provided in specific fractions.
[0304] In one embodiment, provided herein is a nanoparticle composition comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, the cationic or ionizable lipid compound includes a compound according to one of the formulas (I) (and sub-formulas thereof) described herein, and optionally, one or more additional ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-conjugated lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticles.
[0305] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticles) comprising: i) 40 to 50 mole percent of a cationic lipid, ii) a neutral lipid, iii) a steroid, iv) a polymer-conjugated lipid, and v) a therapeutic agent.
[0306] As used herein, "mole percent" refers to the ratio of the moles of a component to the total moles of all lipid components (i.e., the total moles of cationic lipid(s), neutral lipid, steroid, and polymer-conjugated lipid) in the LNP.
[0307] In one embodiment, the lipid nanoparticles comprise 41-49 mole percent, 41-48 mole percent, 42-48 mole percent, 43-48 mole percent, 44-48 mole percent, 45-48 mole percent, 46-48 mole percent, or 47.2-47.8 mole percent of a cationic lipid. In one embodiment, the lipid nanoparticles comprise about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mole percent of a cationic lipid.
[0308] In one embodiment, the neutral lipid is present at a concentration in the range of 5-15 mole percent, 7-13 mole percent, or 9-11 mole percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mole percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
[0309] In one embodiment, the steroid is present at a concentration in the range of 39-49 mole percent, 40-46 mole percent, 40-44 mole percent, 40-42 mole percent, 42-44 mole percent, or 44-46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mole percent. In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.
[0310] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone) ranges from 2:1 to 30:1, such as from 3:1 to 22:1. In one embodiment, the N / P ranges from 6:1 to 20:1 or from 2:1 to 12:1. Exemplary N / P ranges include about 3:1. About 6:1, about 12:1, and about 22:1.
[0311] In one embodiment, provided herein are lipid nanoparticles comprising the following. i) A cationic lipid having an effective pKa greater than 6.0, ii) 5 to 15 mole percent of a neutral lipid, iii) 1 to 15 mole percent of an anionic lipid, iv) 30 to 45 mole percent of a steroid, v) A polymer-conjugated lipid, and vi) A therapeutic agent, or a pharmaceutically acceptable salt or prodrug thereof, The mole percent is determined based on the total moles of lipid present within the lipid nanoparticle.
[0312] In one embodiment, the cationic lipid can be any of several lipid species that carry a net positive charge at a selected pH, such as physiological pH. Exemplary cationic lipids are described hereinbelow. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
[0313] In one embodiment, the lipid nanoparticle comprises 40 to 45 mole percent of a cationic lipid. In one embodiment, the lipid nanoparticle comprises 45 to 50 mole percent of a cationic lipid.
[0314] In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 2:1 to about 8:1. In one embodiment, the lipid nanoparticles contain 5 to 10 mole percent of neutral lipid.
[0315] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), or 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).
[0316] In one embodiment, the lipid nanoparticles contain 1 to 10 mole percent of anionic lipid. In one embodiment, the lipid nanoparticles contain 1 to 5 mole percent of anionic lipid. In one embodiment, the lipid nanoparticles contain 1 to 9 mole percent, 1 to 8 mole percent, 1 to 7 mole percent, or 1 to 6 mole percent of anionic lipid. In one embodiment, the molar ratio of anionic lipid to neutral lipid ranges from 1:1 to 1:10.
[0317] In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5:1 to 1:1. In one embodiment, the lipid nanoparticles contain 32 to 40 mole percent of steroid.
[0318] In one embodiment, the total of the mole percent of neutral lipid and the mole percent of anionic lipid ranges from 5 to 15 mole percent. In one embodiment, the total of the mole percent of neutral lipid and the mole percent of anionic lipid ranges from 7 to 12 mole percent.
[0319] In one embodiment, the molar ratio of anionic lipid to neutral lipid ranges from 1:1 to 1:10. In one embodiment, the total of the mole percent of neutral lipid and the mole percent of steroid ranges from 35 to 45 mole percent.
[0320] In one embodiment, the lipid nanoparticles comprise the following. i) 45 to 55 mole percent of a cationic lipid, ii) 5 to 10 mole percent of a neutral lipid, iii) 1 to 5 mole percent of an anionic lipid, and iv) 32 to 40 mole percent of a steroid.
[0321] In one embodiment, the lipid nanoparticles comprise 1.0 to 2.5 mole percent of a conjugated lipid. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.
[0322] In one embodiment, the neutral lipid is present at a concentration in the range of 5 to 15 mole percent, 7 to 13 mole percent, or 9 to 11 mole percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mole percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
[0323] In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present at a concentration in the range of 39 to 49 mole percent, 40 to 46 mole percent, 40 to 44 mole percent, 40 to 42 mole percent, 42 to 44 mole percent, or 44 to 46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mole percent. In some embodiments, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2.
[0324] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 5:1 to 1:1.
[0325] In one embodiment, the lipid nanoparticles comprise 1.0 to 2.5 mole percent of a conjugated lipid. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.
[0326] In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 35:1 to about 25:1.
[0327] In one embodiment, the lipid nanoparticles have an average diameter in the range of 50 nm to 100 nm, or 60 nm to 85 nm.
[0328] In one embodiment, the composition comprises the cationic lipid, DSPC, cholesterol, and PEG lipid provided herein, as well as mRNA. In one embodiment, the cationic lipid, DSPC, cholesterol, and PEG-lipid provided herein are in a molar ratio of about 50:10:38.5:1.5.
[0329] The nanoparticle composition can be designed for one or more specific uses or targets. For example, the nanoparticle composition can be designed to deliver therapeutic and / or prophylactic agents such as RNA to specific cells, tissues, organs, or their systems or groups in the body of a mammal. The physiochemical properties of the nanoparticle composition can be modified to increase selectivity for a specific body target. For example, the particle size can be adjusted based on the fenestration sizes of various organs. The therapeutic and / or prophylactic agents included in the nanoparticle composition can be selected based on the desired delivery target(s). For example, the therapeutic and / or prophylactic agents can be selected for a specific indication, condition, disease or disorder and / or for delivery to a specific cell, tissue, organ, or its system or group (e.g., local or specific delivery). In certain embodiments, the nanoparticle composition can include mRNA encoding a polypeptide of interest that can be translated intracellularly to produce the polypeptide of interest. Such a composition can be designed to be specifically delivered to a particular organ. In certain embodiments, the composition can be designed to be specifically delivered to the mammalian liver.
[0330] The amount of the therapeutic agent and / or prophylactic agent in the nanoparticle composition may depend on the size, composition, desired target and / or use, or other properties of the nanoparticle composition, as well as the properties of the therapeutic agent and / or prophylactic agent. For example, the amount of RNA useful in the nanoparticle composition may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of the therapeutic agent and / or prophylactic agent and other elements (e.g., lipids) in the nanoparticle composition may also vary. In some embodiments, the weight / weight ratio of the lipid component to the therapeutic agent and / or prophylactic agent in the nanoparticle composition may be about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the weight / weight ratio of the lipid component to the therapeutic agent and / or prophylactic agent may be about 10:1 to about 40:1. In certain embodiments, the weight / weight ratio is about 20:1. The amount of the therapeutic agent and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).
[0331] In some embodiments, the nanoparticle composition includes one or more RNAs, and the one or more RNAs, lipids, and their amounts can be selected to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of the number of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. The one or more RNAs, lipids, and their amounts can be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio can be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio can be about 5.67:1.
[0332] The physical properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition containing cholesterol as a structural lipid can have different properties compared to a nanoparticle composition containing a different structural lipid. Similarly, the properties of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition containing a higher molar fraction of phospholipid can have different properties from a nanoparticle composition containing a lower molar fraction of phospholipid. The properties can also vary depending on the method and conditions for preparing the nanoparticle composition.
[0333] Nanoparticle compositions can be characterized by various methods. For example, microscopy methods (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure the zeta potential. Particle size can also be determined using dynamic light scattering. Multiple properties of the nanoparticle composition, such as particle size, polydispersity index, and zeta potential, can also be measured using an instrument such as a Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK).
[0334] In various embodiments, the average size of the nanoparticle composition can be from several tens of nm to several hundreds of nm. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition can be from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm, from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm. In certain embodiments, the average size of the nanoparticle composition can be from about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.
[0335] The nanoparticle composition can be relatively uniform. A polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.
[0336] The zeta potential of the nanoparticle composition can be used to indicate the electrokinetic potential at the interface of the composition. For example, the zeta potential can account for the surface charge of the nanoparticle composition. Nanoparticle compositions having a relatively low positive or negative charge are generally desirable because higher charged species may give rise to undesirable interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the nanoparticle composition is from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.
[0337] The efficiency of encapsulation of the therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent that is encapsulated or otherwise associated with the nanoparticle composition after preparation, relative to the initial amount provided. A high encapsulation efficiency is desirable (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after decomposing the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in the solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
[0338] The nanoparticle composition can optionally include one or more coatings. For example, the nanoparticle composition can be formulated into capsules, films, or tablets having a coating. Capsules, films, or tablets containing the compositions described herein can have any useful size, tensile strength, hardness, or density.
[0339] 5.6 Pharmaceutical Compositions In accordance with the present disclosure, the nanoparticle composition can be formulated, in whole or in part, as a pharmaceutical composition. The pharmaceutical composition can include one or more nanoparticle compositions. For example, the pharmaceutical composition can include one or more nanoparticle compositions that include one or more different therapeutic and / or prophylactic agents. The pharmaceutical composition can further include one or more pharmaceutically acceptable excipients or auxiliary components such as those described herein. General guidelines regarding the formulation and manufacture of pharmaceutical compositions and drugs are available, for example, in Remington’s The Science and Practice of Pharmacy, 21 st Edition, A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and auxiliary components can be used in any pharmaceutical composition, except where any conventional excipient or auxiliary component can be incompatible with one or more components of the nanoparticle composition. An excipient or auxiliary component can be incompatible with the components of the nanoparticle composition if its combination with the components can result in any undesirable biological or other adverse effects.
[0340] In some embodiments, one or more excipients or auxiliary components can constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, one or more excipients or auxiliary components can constitute 50%, 60%, 70%, 80%, 90%, or more of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the United States Food and Drug Administration. In some embodiments, the excipient is of pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia and / or International Pharmacopoeia.
[0341] The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional components in the pharmaceutical composition according to the present invention can vary depending on the identity, size, and / or condition of the subject being treated and / or further depending on the route by which the composition is administered. By way of example, the pharmaceutical composition can comprise from 0.1% to 100% (weight / weight) of one or more nanoparticle compositions.
[0342] In certain embodiments, the nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or shipment (e.g., at a temperature of about -150°C to about 0°C, or about -80°C to about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C), such as stored at a temperature below 4°C). For example, a pharmaceutical composition containing a compound of any of formula (I) (and its sub-formulas) is a solution that is refrigerated for storage and / or shipment, for example, at about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the present disclosure also relates to a method of increasing the stability of a nanoparticle composition and / or pharmaceutical composition containing a compound of any of formula (I) (and its sub-formulas) by storing the nanoparticle composition and / or pharmaceutical composition at a temperature below 4°C, such as about -150°C to about 0°C, or about -80°C to about -20°C, for example, at a temperature of about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for at least about 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months at a temperature below 4°C (e.g., about 4°C to -20°C). In one embodiment, the formulation is stabilized for at least 4 weeks at about 4°C. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and one or more pharmaceutically acceptable carriers selected from among Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), physiological saline, PBS, and sucrose.In certain embodiments, the pharmaceutical compositions of the present disclosure have a pH value of about 7 to 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or 7.5 - 8, or 7 - 7.8). For example, the pharmaceutical compositions of the present disclosure include the nanoparticle compositions, tris, saline, and sucrose disclosed herein and have a pH of about 7.5 - 8, which is suitable for storage and / or shipment, for example, at about -20°C. For example, the pharmaceutical compositions of the present disclosure include the nanoparticle compositions and PBS disclosed herein and have a pH of about 7 - 7.8, which is suitable for storage and / or shipment, for example, at about 4°C or lower. As used in the context of the present disclosure, "stability", "stabilized", and "stable" refer to the resistance of the nanoparticle compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., decomposition, particle size change, aggregation, change in encapsulation, etc.) under given manufacturing, preparation, transportation, storage, and / or use conditions, for example, when stresses such as shear force, freeze / thaw stress, etc. are applied.
[0343] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including patients or subjects who can benefit from the therapeutic effects provided by the delivery of therapeutic and / or prophylactic agents to one or more specific cells, tissues, organs, or systems or groups thereof, such as the renal system. The descriptions provided herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions are primarily directed to compositions suitable for administration to humans, but it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. To provide compositions suitable for administration to various animals, the modifications of compositions suitable for administration to humans are well understood, and an ordinary skilled veterinary pharmacologist can design and / or perform such modifications, if any, by merely ordinary experiments. The subjects to which administration of the compositions is contemplated include humans, other primates, and other mammals including commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats, but are not limited thereto.
[0344] A pharmaceutical composition comprising one or more nanoparticle compositions can be prepared by any method known in the field of pharmacology or developed in the future. Generally, such a preparation method involves associating the active ingredient with excipients and / or one or more other auxiliary components, and then, if desired or necessary, dividing, shaping, and / or packaging the product into the desired single or multiple volume units.
[0345] The pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" is an individual quantity of a pharmaceutical composition that contains a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient generally equals the dosage of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dosage, such as, for example, half or one-third of such a dosage.
[0346] Pharmaceutical compositions can be prepared in various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injection dosage forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.
[0347] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, the liquid dosage form may include, for example, inert diluents commonly used in the art such as water or other solvents, solubilizing agents, and emulsifying agents such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, cyclodextrin, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and sorbitan fatty acid esters, and mixtures thereof. In addition to the inert diluent, the oral composition may include additional agents such as additional therapeutic and / or prophylactic agents, wetting agents, emulsifying agents and suspending agents, sweetening agents, flavoring agents, and / or aromatic agents. In certain embodiments for parenteral administration, the composition is mixed with a solubilizing agent such as Cremophor™, alcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or combinations thereof.
[0348] Injectable preparations, for example, sterile aqueous or oily suspensions, may be formulated according to known techniques using suitable dispersing, wetting, and / or suspending agents. Sterile injectable preparations may also be solutions, suspensions, and / or emulsions in a non-toxic parenterally acceptable diluent and / or solvent, for example, in 1,3-butanediol. Acceptable vehicles and solvents that may be used include water, Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile fixed oils are conventionally used as a solvent or suspending medium. For this purpose, any bland fixed oil containing synthetic mono- or diglycerides may be used. Fatty acids such as oleic acid may be used in the preparation of injectables.
[0349] Injectable preparations can be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating a sterile agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other injectable sterile culture medium before use.
[0350] The present disclosure is a method for delivering a therapeutic agent and / or a prophylactic agent to mammalian cells or organs, producing a polypeptide of interest in mammalian cells, and treating a disease or disorder in a mammalian subject in need thereof, the method comprising administering to the mammalian subject and / or contacting a nanoparticle composition comprising the therapeutic agent and / or the prophylactic agent with mammalian cells.
Examples
[0351] 6. Examples The examples in this section are presented by way of illustration and not by way of limitation.
[0352] General method. General preparative HPLC method: HPLC purification is generally carried out on a Waters 2767 equipped with a diode array detector (DAD) using an Inertsil Pre-C8 OBD column, with water containing 0.1% TFA as solvent A and acetonitrile as solvent B.
[0353] General LCMS method: LCMS analysis is carried out on a Shimadzu (LC-MS2020) system. Generally, chromatography is carried out on a SunFire C18 using water containing 0.1% formic acid as solvent A and acetonitrile solvent B containing 0.1% formic acid.
[0354] 6.1 Example 1: Preparation of starting materials and intermediates. Preparation of Compound A
Chemical formula
[0355] Preparation of Compound B [Chemical formula] A mixture of chlorohexanone (2.0 g, 20.0 mmol, 1.0 eq), titanium(IV) isopropoxide (7.4 g, 26 mmol, 1.3 eq), and 2-aminoethanol (3.66 g, 60.0 mmol, 3.0 eq) in methanol (10.0 mL) was stirred under argon at room temperature for 5 h. Then, sodium borohydride (760.0 mg, 20.0 mmol, 1.0 eq) was added at 0 °C and the resulting mixture was stirred for an additional 2 h. The reaction was quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 minutes, then the reaction mixture was acidified with hydrochloric acid (1 M, 5 mL), filtered through a pad of celite, and washed with water and EA. The organic layer was separated, dried over Na2SO4, evaporated under reduced pressure, and purified by flash column chromatography (FCC) (PE / EA = 5 / 1 - 0 / 1) to afford compound B (1.5 g, 52% yield) as a yellow oil.
[0356] Preparation of Compound C
Chem.
[0357] Preparation of Compound D
Chem.
[0358] Preparation of Compound E
Chem.
[0359] Step 2: Preparation of compound E-2 To a solution of compound E-1 (1.42 g, 4.057 mmol, 1.0 equiv) in ACN (25 mL) were added compound A (5.106 mg, 12.17 mmol, 3.0 equiv), K2CO3 (1.668 g, 12.17 mmol, 3.0 equiv), Cs2CO3 (397 mg, 1.217 mmol, 0.3 equiv), and NaI (30 mg, 0.2029 mmol, 0.05 equiv). The reaction mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent and purification by FCC gave compound E-2 (2.5 g, 89.55%) as a colorless oil. LCMS: at room temperature: 0.241 min; MS m / z (ESI): 688.5 [M+H] + .
[0360] Step 3: Preparation of compound E To a solution of compound E-2 (250 mg, 0.3633 mmol) in MeOH (10 mL) was added Pd / C (50 mg). The reaction mixture was stirred at room temperature under H2 for 16 h. LCMS indicated that the reaction was complete. After removal of the solvent, purification by preparative HPLC gave compound E (105 mg, yield 50.88%) as a colorless oil.
[0361] 11H NMR (400 MHz, CDCl3): δ 3.97 (d, J = 6 Hz, 2H), 3.58 (s, 1H), 2.73 - 2.58 (m, 3H), 2.45 - 2.40 (m, 1H), 2.33 - 2.29 (m, 2H), 1.66 - 1.60 (m, 2H), 1.51 - 1.40 (m, 2H), 1.39 - 1.34 (m, 4H), 1.26 (s, 46H), 0.90 - 0.86 (m, 9H). LCMS: at room temperature: 1.083 min, MS m / z (ESI): 568.5 [M + H] + 。
[0362] Preparation of Compound F
Chem.
[0363] Preparation of Compound G
Chem.
[0364] Preparation of Compound H
Chem.
[0365] Preparation of Compound K
Chemical Structure
[0366] Preparation of Compound L
Chemical Structure
[0367] Preparation of SM2:
Chemical formula
[0368] Preparation of SM4:
Chemical formula
[0369] Preparation of SM9:
Chem.
[0370] Preparation of SM10:
Chem.
[0371] Step 2: Preparation of compound SM10-3 To a mixture of compound SM10-2 (2.4 g, 6.255 mmol, 1.0 equiv) and DIEA (1.62 g, 12.51 mmol, 2.0 equiv) in DCM (60 mL) was added MsCl (0.86 g, 7.506 mmol, 1.2 equiv) at 0 °C under N2. The reaction mixture was stirred at 0 °C for 1 h. TLC indicated that the reaction was complete. The mixture was poured into water and washed with DCM. The organic layer was separated and dried over Na2SO4. Removal of the solvent and FCC gave compound SM10-3 (2.5 g, 86.57%) as a yellow oil.
[0372] Step 3: Preparation of compound SM10-4 To a solution of compound SM10-3 (1.5 g, 3.249 mmol, 1.0 equiv) in ACN (30 mL) were added compound B (0.45 g, 3.899 mmol, 1.2 equiv), K2CO3 (1.35 g, 9.747 mmol, 3.0 equiv), Cs2CO3 (318 mg, 0.9747 mmol, 0.3 equiv), and NaI (49 mg, 0.3249 mmol, 0.1 equiv). The reaction mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent and FCC gave compound SM10-4 (700 mg, 44.81%) as a yellow oil. LCMS: RT: 0.830 min, MS m / z (ESI): 481.4 [M+H] + 。
[0373] Step 4: Preparation of Compound SM10 To a solution of Compound SM10-4 (300 mg, 0.6240 mmol, 1.0 eq) in DCM (15 mL) was added SOCl2 (223 mg, 1.872 mmol, 3.0 eq). The reaction mixture was stirred at 35 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent gave Compound SM10 (310 mg, crude) as a yellow oil. LCMS: RT: 0.860 min, MS m / z (ESI): 499.3 [M+H] + 。
[0374] Preparation of SM11:
Chemical formula
[0375] Step 2: Preparation of Compound SM11 To a solution of Compound SM11-2 (1.0 g, 2.235 mmol, 1.0 eq) in ACN (15 mL) were added Compound SM6 (0.41 g, 6.704 mmol, 3.0 eq), K2CO3 (0.93 g, 6.704 mmol, 3.0 eq), Cs2CO3 (218 mg, 0.6704 mmol, 0.3 eq), and NaI (33 mg, 0.2235 mmol, 0.1 eq). The reaction mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent and purification by FCC gave Compound SM11 (700 mg, 44.81%) as a yellow oil. LCMS: RT: 0.890 min, MS m / z (ESI): 428.3 [M+H] + 。
[0376] Preparation of SM [Chemical formula] Step 1: Preparation of Compound SM-2 To a mixture of NaH (12 g, 227.1 mmol, 2.5 equiv) in DMF (100 mL), Compound SM-1 (12 g, 90.84 mmol, 1.0 equiv) was added at 0 °C under N2. The reaction mixture was stirred at 0 °C for 1 hour. C8H 17 Br (44 g, 227.1 mmol, 2.5 equiv) in DMF (100 mL) was added thereto. The reaction mixture was stirred at room temperature for 16 hours. TLC indicated that the reaction was complete. The mixture was powdered in water and washed with EA. The organic matter was separated and dried over Na2SO4. Removal of the solvent and FCC gave Compound SM-2 (17.8 g, 54.96%) as a colorless oil. 1 1H NMR (400 MHz, CCl3D): 3.71 (s, 6H), 1.88 - 1.84 (m, 4H), 1.59 (s, 1H), 1.25 (s, 19H), 1.14 - 1.10 (m, 4H), 0.89 - 0.86 (m, 6H).
[0377] Step 2: Preparation of Compound SM-3 To a solution of SM-2 (17.8 g, 49.93 mmol, 1.0 equiv) in DMF (260 mL), LiCl (21.17 g, 499.3 mmol, 10.0 equiv) was added. The reaction mixture was stirred at 120 °C for 12 hours. TLC indicated that the reaction was complete. The mixture was powdered in water and washed with EA. The organic matter was separated and dried over Na2SO4. Removal of the solvent and FCC gave Compound SM-3 (10 g, 67.10%) as a colorless oil. 1 1H NMR (400 MHz, CCl3D): 0.89 - 0.86 (m, 6H), 1.25 (s, 22H), 1.45 - 1.40 (m, 2H), 1.59 (s, 4H), 2.36 - 2.30 (m, 1H), 3.67 (s, 3H).
[0378] Step 3: Preparation of Compound SM To a solution of compound SM-3 (10 g, 33.50 mmol, 1.0 equiv) in THF (100 mL), LiAlH4 (2.546 g, 67.00 mmol, 2.0 equiv) was slowly added at 0 °C. The reaction mixture was stirred at reflux for 1 h. TLC indicated the completion of the reaction. After cooling to 0 °C, water (3.4 mL), 15% aqueous NaOH (3.4 mL), and water (10 mL) were successively added to quench the mixture. The resulting mixture was diluted with EA, and the precipitate was removed by filtration. The filtrate was evaporated under reduced pressure and compound SM (8.5 g, 93.80%) was obtained as a yellow oil by FCC. 1 1H NMR (400 MHz, CCl3D): 0.90 - 0.86 (m, 6H), 1.27 (s, 27H), 1.43 (s, 3H), 3.54 (d, J = 5.2 Hz, 2H).
[0379] Preparation of SM15:
Chemical formula
[0380] Preparation of SM16:
Chemical formula
[0381] Preparation of SM18:
Chem.
[0382] Preparation of SM20:
Chem.
[0383] Step 2: Preparation of Compound SM20 A solution of Compound SM20-1 (0.2 mg, 0.41 mmol, 1.0 equiv) in DCM (5.0 mL) was added with SOCl2 (144.0 mg, 1.23 mmol, 3.0 equiv) at room temperature. The mixture was stirred for 16 h. LCMS indicated the completion of the reaction. The mixture was evaporated under reduced pressure to afford Compound SM20 (0.23 g, crude) as a brown oil. LCMS: RT: 1.330 min, MS m / z (ESI): 500.3 [M+H] + 。
[0384] Preparation of SM22:
Chemical Structure
[0385] Step 2: Preparation of compound SM22-3 To a solution of compound SM22-2 (17.0 g, 67.61 mmol, 1.0 equiv) in EtOH (200 mL) was added H2SO4 (40 mL). The reaction mixture was stirred at 90 °C for 48 h. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 × 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4, and concentrated in vacuo to give the target product (15 g, 75% yield) as a yellow oil.
[0386] Step 3: Preparation of compound SM22 To a solution of compound SM22-3 (14 g, 46.90 mmol, 1.0 equiv) in MeOH (240 mL) and H2O (60 mL) was added LiOH . H2O (9.84 g, 234.5 mmol, 5.0 equiv). The reaction mixture was stirred at 50 °C for 10 h. The reaction mixture was concentrated in vacuo to give the crude target product. The crude product was dissolved in water. The residue was adjusted to pH = 2 with 6 M HCl and extracted with EtOAc (3 × 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4, and concentrated in vacuo to give compound SM22 (15 g, 75% yield) as a yellow oil. 1 1H NMR (400 MHz, CCl3D): 0.87 (t, J = 8 Hz, 6H), 1.22 - 1.46 (m, 24H), 1.85 - 1.95 (m, 2H), 2.22 - 2.34 (m, 1H).
[0387] Preparation of SM23:
Chem.
[0388] Step 2: Preparation of Compound SM23 To a solution of Compound 23-1 (1.5 g, 3.58 mmol, 1.0 equiv) in CH3CN (50 mL) were added K2CO3 (1.48 g, 10.73 mmol, 3.0 equiv), Cs2CO3 (0.4 g, 1.07 mmol, 0.3 equiv), NaI (0.16 g, 1.07 mmol, 0.3 equiv), and Compound SM6 (0.45 g, 7.15 mmol, 2.0 equiv). The reaction mixture was stirred at 80 °C for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH2Cl2:MeOH = 10:1) to afford the target product (800 mg, yield 56%) as a yellow oil. LCMS: RT: 0.898 min, MS m / z (ESI): 400.3 [M+H] + .
[0389] Preparation of SM24:
Chem.
[0390] Preparation of SM26: [Chemical formula] Step 1: Preparation of compound SM26-2 To a mixture of compound SM26-1 (2 g, 7.080 mmol, 1.0 equiv) and compound SM7 (1.42 g, 8.496 mmol, 1.2 equiv) were added DIEA (1.8 g, 14.16 mmol, 2.0 equiv), EDCI (2 g, 10.62 mmol, 1.5 equiv), DMAP (0.17 g, 1.416 mmol, 0.2 equiv) in DCM (30 mL). The reaction mixture was stirred at 50 °C for 16 h. TLC indicated that the reaction was complete. The mixture was powdered in water and washed with DCM. The organic matter was separated and dried over Na2SO4. Removal of the solvent and FCC gave compound SM26-2 (1.5 g, 49.10%) as a yellow oil.
[0391] Step 2: Preparation of compound SM26 To a solution of compound SM26-2 (1.5 g, 3.476 mmol, 1.0 equiv) in ACN (30 mL), compound SM6 (0.64 g, 10.43 mmol, 3.0 equiv), K2CO3 (1.4 g, 10.43 mmol, 3.0 equiv), Cs2CO3 (0.34 g, 1.043 mmol, 0.3 equiv), and NaI (0.16 g, 1.043 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent and FCC gave compound SM26 (800 mg, 55.90%) as a yellow oil.
[0392] Preparation of SM30: [Chemical formula] Step 1: Preparation of compound SM30-2 To a solution of compound SM30-1 (6.3 g, 35.2 mmol, 1.0 equiv) in DCM (150 mL), TsOH . H2O (1.3 g, 7.0 mmol, 0.2 equiv) and Na2SO4 (15.0 g, 105.6 mmol, 3.0 equiv) were added. The mixture was stirred at room temperature overnight. The mixture was filtered and concentrated. The residue was purified by column chromatography on silica gel (PE / EA = 100 / 1) to give compound SM30-2 (9.7 g, 66% yield) as a colorless oil.
[0393] Step 2: Preparation of compound SM30 A solution of compound SM30-2 (4.2 g, 10.0 mmol, 1.0 equiv) and ethanolamine (1.8 g, 30.0 mmol, 3.0 equiv) in ACN (50 mL) was added with K2CO3 (4.1 g, 30.0 mmol, 3.0 equiv), Cs2CO3 (977 mg, 3.0 mmol, 0.3 equiv), and NaI (450 mg, 3.0 mmol, 0.3 equiv). The mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. The residue was concentrated and purified by column chromatography on silica gel (PE / EA = 10 / 1~3 / 1~1 / 1~0 / 1) to afford compound SM30 (2.3 g, yield 58%) as a colorless oil. LCMS: at room temperature: 1.010 min, MS m / z (ESI): 402.4 [M+H] + .
[0394] Preparation of SM34: [Chemical formula] Step 1: Preparation of compound SM34-2 To a solution of compound SM22-1 (30 g, 98.2 mmol, 1.0 equiv) in DMF (400 mL) was added compound SM34-1 (36.4 g, 196.4 mmol, 2.0 equiv). The mixture was stirred at 90 °C for 16 h. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (PE / EA = 100 / 1) to afford compound SM34-2 (31.6 g, yield 86%) as a yellow oil.
[0395] Step 2: Preparation of compound SM34-3 To a solution of compound SM34-2 (15.8 g, 42.5 mmol, 1.0 eq) in EtOH (500 mL) was added hydrazine monohydrate (5.0 g, 85.0 mmol, 2.0 eq). The mixture was stirred at reflux for 16 h. LCMS indicated completion of the reaction. The mixture was filtered and washed with EtOH. The filtrate was concentrated and purified by column chromatography on silica gel (DCM / MeOH = 20 / 1) to afford compound SM34-3 (9.1 g, 88% yield) as a yellow oil.
[0396] Step 3: Preparation of compound SM34-4 To a solution of compound SM34-3 (6.5 g, 26.9 mol, 1.2 eq) in DCM (100 mL) were added compound W (4.4 g, 22.4 mmol, 1.0 eq), HATU (12.8 g, 33.6 mmol, 1.5 eq), and DIPEA (8.7 g, 67.2 mmol, 3.0 eq). The mixture was stirred at room temperature for 16 h. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel to afford compound SM34-4 (7.4 g, 65.6% yield) as a yellow oil.
[0397] Step 4: Preparation of compound SM34 To a solution of compound SM34-4 (7.4 g, 18.0 mmol, 1.0 eq) and compound SM6 (3.3 g, 54.0 mmol, 3.0 eq) in THF (50 mL) were added DIPEA (6.9 g, 54.0 mmol, 3.0 eq) and NaI (800 mg, 5.4 mmol, 0.3 eq). The mixture was stirred at 70 °C for 10 h. LCMS indicated completion of the reaction. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel to afford compound SM34 (6.3 g, 88% yield) as a colorless oil. LCMS: at room temperature: 1.620 min, MS m / z (ESI): 399.5 [M+H] + 。
[0398] Preparation of SM38: [Chemical formula] A mixture of compound 71-7 (600 mg, 1.25 mmol, 1.0 equivalent), isopropylamine (739 mg, 12.5 mmol, 10.0 equivalents), K2CO3 (519 mg, 3.76 mmol, 3.0 equivalents), Cs2CO3 (124 mg, 0.38 mmol, 0.3 equivalent), and NaI (51 mg, 0.38 mmol, 0.3 equivalent) in ACN (10 mL) was stirred at reflux overnight. LCMS indicated the product. The mixture was diluted with EA, washed with water and brine, dried, and concentrated. The residue was purified by FCC to obtain compound SM38 (320 mg, yield 58.0%) as a colorless oil.
[0399] Preparation of SM39: [Chemical formula] To a solution of compound SM24 (10 g, 23.9 mmol, 1.0 equivalent) in CH3CN (150 mL) were added K2CO3 (9.9 g, 71.7 mmol, 3.0 equivalents), Cs2CO3 (2.3 g, 7.17 mmol, 0.3 equivalent), NaI (1.1 g, 7.17 mmol, 0.3 equivalent), and compound SM6 (2.9 g, 47.8 mmol, 2.0 equivalents). The reaction mixture was stirred at 80 °C for 16 hours. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH2Cl2:MeOH = 20:1 to 10:1) to obtain compound SM39 (5.1 g, yield 53%) as a yellow oil. LCMS: room temperature: 0.880 min, MS m / z (ESI): 400.3 [M+H].
[0400] 6.2 Example 2: Preparation of Compound 1. [Chemical formula] Step 1: Preparation of Compound 1-1 A mixture of compound A (1.26 g, 3 mmol, 1.5 equiv), compound B (280 mg, 2 mmol, 1 equiv), DIEA (774 mg, 6 mmol, 3 equiv), and NaI (0.1 equiv) in tetrahydrofuran (THF, 6 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum and purified by silica gel column chromatography (MeOH:DCM = 0:1 to 1:80) to afford the desired product compound 1-1 (269 mg, 28.5% yield) as a yellow oil. LCMS: room temperature: 1.000 min, MS m / z (ESI): 482.5 [M+H] + 。
[0401] Step 2: Preparation of compound 1-2 A mixture of compound 1-1 (269 mg, 0.56 mmol, 1 equiv) and SOCl2 (200 mg, 1.68 mmol, 3 equiv) in DCM (6 mL) was stirred at 35 °C overnight. The mixture was concentrated under vacuum to afford the desired product compound 1-2 (313 mg, crude) as a yellow oil. LCMS: room temperature: 0.970 min, MS m / z (ESI): 500.4 [M+H] + 。
[0402] Step 3: Preparation of compound 1 A mixture of compound 1-2 (313 mg, 0.63 mmol, 1.2 equiv), compound C (211 mg, 0.53 mmol, 1 equiv), DIEA (205 mg, 1.59 mmol, 3 equiv), and a catalytic amount of NaI in THF (4 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum and purified by preparative HPLC to afford compound 1 (79 mg, 14.6% yield) as a light brown oil.
[0403] 11H NMR (400 MHz, CDCl3) δ: 0.83 - 0.93 (m, 12H), 1.04 - 1.16 (m, 2H), 1.18 - 1.39 (m, 60H), 1.40 - 1.55 (m, 3H), 1.56 - 1.74 (m, 9H), 1.86 (s, 2H), 2.25 - 2.39 (m, 5H), 2.56 (s, 3H), 2.70 (s, 3H), 3.62 (s, 2H), 3.89 - 4.04 (m, 4H). LCMS: At room temperature: 2.000 min, MS m / z (ESI): 863.7 [M + H] + 。
[0404] The following compounds were prepared in a manner similar to Compound 1 using the corresponding starting materials.
Table 3
[0405] 6.3 Example 3: Preparation of Compound 2.
Chemical formula
[0406] 11H NMR (400 MHz, CDCl3) δ: 4.08 - 4.05 (m, 2H), 3.55 - 3.52 (m, 2H), 2.34 - 2.30 (m, 2H), 1.83 - 1.76 (m, 2H), 1.69 - 1.60 (m, 4H), 1.51 - 1.43 (m, 2H), 1.23 (s, 16H), 0.89 - 0.86 (m, 3H).
[0407] Step 2: Preparation of Compound 2-2 To a solution of Compound 2-1 (1 g, 2.863 mmol, 1.2 equiv) in ACN (20 mL) were added Compound D (275 mg, 2.386 mmol, 1.0 equiv), K2CO3 (989 mg, 7.158 mmol, 3.0 equiv), Cs2CO3 (233 mg, 0.7158 mmol, 0.3 equiv), and NaI (18 mg, 0.1193 mmol, 0.05 equiv). The reaction mixture was stirred at 85 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent and purification of the crude product by FCC gave Compound 2-2 (170 mg, 18.57%) as a yellow oil. LCMS: RT: 0.811 min, MS m / z (ESI): 384.3 [M+H] + .
[0408] Step 3: Preparation of Compound 2-3 To a solution of Compound 2-2 (170 mg, 0.4432 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl2 (158 mg, 1.330 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 16 h. LCMS indicated that the reaction was complete. Removal of the solvent gave Compound 2-3 (180 mg, crude) as a yellow oil. LCMS: RT: 0.860 min, MS m / z (ESI): 402.3 [M+H] + .
[0409] Step 4: Preparation of Compound 2 To a mixture of Compound 2-3 (170 mg, 0.4476 mmol, 1.0 equiv) and DIEA (289 mg, 2.238 mmol, 5.0 equiv) in THF (10 mL) were added Compound E (381 mg, 0.6715 mmol, 1.5 equiv), and NaI (20 mg). The reaction mixture was stirred at 70 °C for 16 h. LCMS indicated the completion of the reaction. After removal of the solvent, purification by preparative HPLC gave Compound 2 (35 mg, 8.37% yield) as a colorless oil.
[0410] 1 H NMR (400 MHz, CDCl3) δ: 4.07 - 4.04 (m, 2H), 3.9 (d, J = 5.6 Hz, 2H), 3.53 (m, 1H), 3.08 - 3.04 (m, 1H), 2.49 - 2.37 (m, 9H), 2.32 - 2.25 (m, 5H), 1.98 - 1.88 (m, 4H), 1.66 - 1.58 (m, 9H), 1.49 - 1.38 (m, 7H), 1.26 (s, 63H), 0.90 - 0.86 (m, 12H). LCMS: at room temperature: 0.994 min, MS m / z (ESI): 933.8 [M+H] + 。
[0411] 6.4 Example 4: Preparation of Compound 3.
Chemical formula
[0412] Step 2: Preparation of Compound 3-2 To a solution of Compound 3-1 (200 mg, 0.54 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl2 (193 mg, 1.62 mmol, 3.0 equiv). The mixture was stirred at 30 °C for 16 h. LCMS indicated that the reaction was complete. The mixture was concentrated under reduced pressure to afford Compound 3-2 (200 mg, 95%) as a yellow oil.
[0413] Step 3: Preparation of Compound 3 To a solution of Compound 3-2 (200 mg, 0.52 mmol, 1.0 equiv) and Compound C (416 mg, 1.04 mmol, 2.0 equiv) in THF (10 mL) were added N,N-diisopropylethylamine (DIPEA, 202 mg, 1.56 mmol, 3.0 equiv) and NaI (24 mg, 0.16 mmol, 0.3 equiv). The mixture was stirred at 70 °C for 16 h. LCMS indicated that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to afford Compound 3 (80 mg, 8% yield) as a yellow oil.
[0414] 11H NMR (400 MHz, CDCl3) δ: 0.48 - 0.50 (m, 4H), 0.86 - 0.90 (m, 9H), 1.26 - 1.30 (m, 45H), 1.49 - 1.66 (m, 11H), 1.72 - 1.77 (m, 1H), 2.28 - 2.32 (m, 4H), 2.52 - 2.76 (m, 10H), 3.52 - 3.58 (m, 2H), 3.96 - 3.98 (m, 2H), 4.04 - 4.07 (m, 2H). LCMS: Room temperature: 1.250 min, MS m / z (ESI): 751.6 [M+H] + 。
[0415] The following compounds were prepared in a manner similar to Compound 3 using the corresponding starting materials.
Table 4
[0416] 6.5 Example 5: Preparation of Compound 6.
Chemical formula
[0417] Step 2: Preparation of Compound 6-2 A mixture of compound 6-1 (412 mg, 1 mmol, 1 equiv) and SOCl2 (357 mg, 3 mmol, 3 equiv) in DCM (6 mL) was stirred at 35 °C overnight. The mixture was concentrated under vacuum to afford compound 6-2 (430 mg, crude) as a yellow oil. LCMS: at room temperature: 0.930 min, MS m / z (ESI): 430.3 [M+H] + 。
[0418] Step 3: Preparation of compound 6 A mixture of compound 6-2 (215 mg, 0.5 mmol, 1 equiv), compound C (150 mg, 0.4 mmol, 0.75 equiv), DIEA (195 mg, 1.5 mmol, 3 equiv), and a catalytic amount of NaI in THF (3 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum and purified by preparative HPLC to afford compound 6 (15 mg, yield 12.8%) as a light brown oil.
[0419] 1 1H NMR (400 MHz, CDCl3) δ: 0.83 - 0.92 (m, 9H), 1.18 - 1.36 (m, 40H), 1.38 - 1.48 (m, 4H), 1.49 - 1.75 (m, 27H), 1.85 - 2.15 (m, 5H), 2.16 - 2.27 (m, 1H), 2.30 - 2.39 (m, 3H), 3.11 - 3.25 (m, 2H), 3.35 - 3.48 (m, 1H), 3.93 - 3.99 (m, 2H), 4.01 - 4.11 (m, 2H). LCMS: at room temperature: 1.720 min, MS m / z (ESI): 793.6 [M+H] + 。
[0420] 6.6 Example 6: Preparation of compound 8.
Chemical Structure
[0421] Step 2: Preparation of compound 8-2 To a solution of compound 8-1 (300 mg, 0.64 mmol) in CH2Cl2 (10 mL) was added SOCl2 (250 mg, 2.05 mmol). The reaction mixture was stirred at 30 °C for 10 h. The reaction mixture was concentrated in vacuo to give compound 8-2 (310 mg, 100% yield) as a yellow oil.
[0422] Step 3: Preparation of compound 8 To a solution of compound 8-2 (300 mg, 0.62 mmol) in THF (10 mL) were added DIEA (240 mg, 1.85 mmol), NaI (100 mg, 0.65 mmol), and compound C (530 mg, 1.31 mmol). The reaction mixture was stirred at 70 °C for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give compound 8 (45 mg, 8.5% yield) as a yellow oil.
[0423] 11H NMR (400 MHz, CDCl3) δ: 0.87 - 0.90 (t, J = 6.8 Hz, 12H), 1.26 (m, 50H), 1.40 - 1.51 (m, 8H), 1.60 - 1.66 (m, 8H), 1.77 - 1.73 (m, 3H), 2.31 - 2.33 (m, 4H), 2.48 - 2.61 (m, 10H), 3.05 - 3.09 (m, 1H), 3.48 - 3.55 (m, 4H), 3.96 - 3.97 (m, 4H). LCMS: Room temperature: 1.740 min, MS m / z (ESI): 849.7 [M + H] + 。
[0424] The following compounds were prepared in a manner similar to Compound 8 using the corresponding starting materials.
Table 5
[0425] 6.7 Example 7: Preparation of Compound 10.
Chemical formula
[0426] Step 2: Preparation of Compound 10-2 To a solution of Compound H (1.0 g, 2.24 mmol, 1.0 equiv) and Compound D (511.0 mg, 4.48 mmol, 2.0 equiv) in ACN (20.0 mL) were added Cs2CO3 (218.0 mg, 0.67 mmol, 0.3 equiv), K2CO3 (927.0 mg, 6.72 mmol, 3.0 equiv), and NaI (33.0 mg, 0.22 mmol, 0.1 equiv) at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS indicated completion of the reaction. The mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0 to 20 / 1) to give Compound 10-2 (0.6 g, 56% yield) as a brown oil. LCMS: at room temperature: 0.950 min, MS m / z (ESI): 482.4 [M+H] + 。
[0427] Step 3: Preparation of Compound 10-3 To a solution of Compound 10-2 (0.2 mg, 0.41 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl2 (144.0 mg, 1.23 mmol, 3.0 equiv) at room temperature. The mixture was stirred for 16 h. LCMS indicated completion of the reaction. The mixture was evaporated under reduced pressure to give Compound 10-3 (0.23 g, crude) as a brown oil. LCMS: at room temperature: 1.330 min, MS m / z (ESI): 500.3 [M+H] + 。
[0428] Step 4: Preparation of Compound 10 To a solution of Compound 10-3 (150.0 mg, 0.3 mmol, 1.0 equiv) and Compound 10-1 (192.0 mg, 0.45 mmol, 1.5 equiv) in THF (5.0 mL) was added DIEA (193 mg, 1.5 mmol, 5.0 equiv) at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS indicated completion of the reaction. The mixture was evaporated under reduced pressure and purified by preparative HPLC to give Compound 10 (80.0 mg, 25% yield) as a brown oil.
[0429] 11H NMR (400 MHz, CDCl3) δ: 0.86 - 0.89 (m, 12H), 1.26 - 1.32 (m, 61H), 1.41 - 1.65 (m, 12H), 1.85 - 2.02 (m, 4H), 2.28 - 2.61 (m, 14H), 3.00 - 3.12 (m, 1H), 3.53 - 3.55 (m, 2H), 3.97 (d, J = 5.6 Hz, 4H). LCMS: At room temperature: 2.520 min, MS m / z (ESI): 891.7 [M+H] + 。
[0430] 6.8 Example 8: Preparation of Compound 11.
Chemical Structure
[0431] Step 2: Preparation of Compound 11-1 To a solution of 11-A (18.0 mg, 51.6 mmol, 1.0 equiv) in DMF (300 mL) was added potassium phthalimide (19.1 g, 103.2 mmol, 2.0 equiv). The mixture was stirred at 90 °C for 16 h. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. Purification by silica gel column chromatography (PE / EA = 100 / 1) afforded Compound 11-1 (14.6 g, 71% yield) as a colorless oil.1 1H NMR (400 MHz, CDCl3) δ: 0.85 - 0.88 (m, 6H), 1.24 - 1.29 (m, 28H), 1.82 - 1.89 (m, 1H), 3.56 - 3.58 (m, 2H), 7.72 - 7.72 (m, 2H), 7.83 - 7.85 (m, 2H).
[0432] Step 3: Preparation of Compound 11 - 2 Hydrazine monohydrate (3.65 g, 73.0 mmol, 2.0 equiv) was added to a solution of Compound 11 - 1 (14.6 g, 36.5 mmol, 1.0 equiv) in EtOH (400 mL). The mixture was stirred at reflux for 16 h. LCMS indicated the completion of the reaction. The mixture was filtered and washed with EtOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM / MeOH = 100 / 1 - 50 / 1) to afford Compound 11 - 2 (6.9 g, 70% yield) as a yellow oil. LCMS: at room temperature: 1.260 min, MS m / z (ESI): 270.3 [M + H] + .
[0433] Step 4: Preparation of Compound 11 - 3 6 - Bromohexanoic acid (6.0 g, 30.7 mmol, 1.2 equiv), HATU (11.7 g, 30.7 mmol, 1.2 equiv), and DIPEA (9.9 g, 76.8 mmol, 3.0 equiv) were added to a solution of Compound 11 - 2 (6.9 g, 25.6 mmol, 1.0 equiv) in DCM (250 mL). The mixture was stirred at room temperature for 16 h. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. Purification by silica gel column chromatography (PE / EA = 10 / 1 - 8 / 1) afforded Compound 11 - 3 (7.1 g, 62% yield) as a yellow oil.
[0434] Step 5: Preparation of Compound 11 - 4 To a solution of Compound 11-3 (800 mg, 1.79 mmol, 1.5 equiv) and Compound D (137 mg, 1.19 mmol, 1.0 equiv) in ACN (40 mL) were added K2CO3 (493 mg, 3.57 mmol, 3.0 equiv), Cs2CO3 (116 mg, 0.357 mmol, 0.3 equiv), and NaI (54 mg, 0.357 mmol, 0.3 equiv). The mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 10 / 1) to afford Compound 11-4 (400 mg, 70% yield) as a yellow oil. LCMS: at room temperature: 0.920 min, MS m / z (ESI): 481.4 [M+H] + .
[0435] Step 6: Preparation of Compound 11-5 To a solution of Compound 11-4 (200 mg, 0.42 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl2 (150 mg, 1.26 mmol, 3.0 equiv). The mixture was stirred at 30 °C for 16 h. LCMS indicated that the reaction was complete. The mixture was concentrated under reduced pressure to afford Compound 11-5 (200 g, 95%) as a yellow oil. LCMS: at room temperature: 0.980 min, MS m / z (ESI): 499.3 [M+H] + .
[0436] Step 7: Preparation of Compound 11-6 To a solution of Compound 11-3 (610 mg, 1.36 mmol, 1.0 equiv) and ethanolamine (166 mg, 2.72 mmol, 2.0 equiv) in ACN (20 mL) were added K2CO3 (564 mg, 4.08 mmol, 3.0 equiv), Cs2CO3 (134 mg, 0.41 mmol, 0.3 equiv), and NaI (61 mg, 0.41 mmol, 0.3 equiv). The mixture was stirred at 80 °C for 16 h. LCMS indicated that the reaction was complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated. Purification by silica gel column chromatography (DCM / MeOH = 10 / 1) afforded Compound 11-6 (320 mg, 55% yield) as a yellow oil. LCMS: at room temperature: 0.96 min, MS m / z (ESI): 427.3 [M+H] + .
[0437] Step 8: Preparation of Compound 11 To a solution of Compound 11-5 (175 mg, 0.35 mmol, 1.0 equiv) and Compound 11-6 (150 mg, 0.35 mmol, 1.0 equiv) in THF (10 mL) were added DIPEA (136 mg, 1.05 mmol, 3.0 equiv), and NaI (10 mg, 0.07 mmol, 0.2 equiv). The mixture was stirred at 70 °C for 16 h. LCMS indicated that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to afford Compound 11 (34 mg, 11% yield) as a yellow oil.
[0438] 1 H NMR (400 MHz, CDCl3) δ: 0.86 - 0.90 (m, 12H), 1.26 - 1.34 (m, 64H), 1.41 - 1.54 (m, 6H), 1.59 - 1.77 (m, 6H), 1.99 - 2.07 (m, 2H), 2.17 - 2.21 (m, 4H), 2.47 - 2.71 (m, 10H), 3.15 - 3.18 (m, 4H), 3.55 - 3.62 (m, 2H), 5.73 - 5.84 (m, 2H). LCMS: at room temperature: 1.610 min, MS m / z (ESI): 889.8 [M+H] + .
[0439] The following compounds were prepared in a manner similar to that of Compound 11 using the corresponding starting materials. [Table 6]
[0440] 6.9 Example 9: Preparation of Compound 15. [Chemical formula] To a solution of Compound 11-6 (221 mg, 0.52 mmol, 1.0 equiv) and Compound 10-3 (259 mg, 0.52 mmol, 1.0 equiv) in THF (10 mL) were added DIPEA (202 mg, 1.56 mmol, 3.0 equiv) and NaI (16 mg, 0.104 mmol, 0.2 equiv). The mixture was stirred at 70 °C for 16 h. LCMS indicated that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to afford Compound 15 (121 mg, 26% yield) as a yellow oil.
[0441] 1 H NMR (400 MHz, CDCl3) δ: 0.86 - 0.92 (m, 12H), 1.26 - 1.30 (m, 67H), 1.46 - 1.72 (m, 12H), 1.98 - 2.09 (m, 2H), 2.15 - 2.19 (m, 2H), 2.31 - 2.71 (m, 8H), 3.16 - 3.23 (m, 2H), 3.56 - 3.66 (m, 2H), 3.95 - 4.03 (m, 2H), 7.30 (s, 1H). LCMS: at room temperature: 1.68 min, MS m / z (ESI): 890.7 [M+H] + .
[0442] The following compounds were prepared in a manner similar to that of Compound 15 using the corresponding starting materials. [Table 7]
[0443] 6.10 Example 10: Preparation of Compound 18. [Chemical formula] Step 1: Preparation of Compound 18-1 To a stirred solution of dimethyl malonate (5 g, 38 mmol, 1 equiv) in DMF (76 mL) was added sodium hydride (3.8 g, 95 mmol, 2.5 equiv) at room temperature under an argon atmosphere. After 0.5 h, (Z)-1-bromodeca-4-ene (21 g, 95 mmol, 2.5 equiv) was added to the mixture, and the mixture was stirred at room temperature overnight. The mixture was quenched with water (130 mL), extracted with EA (3 × 65 mL), the combined organic layers were washed with brine (2 × 65 mL), dried over anhydrous sodium sulfate, and concentrated under vacuum. Purification by silica gel column chromatography (EA:PE = 0% - 5%) gave Compound 18-1 (10.5 g, yield 68.2%) as a colorless oil.
[0444] Step 2: Preparation of Compound 18-2 A mixture of Compound 18-1 (10.5 g, 25.7 mmol, 1 equiv) and LiCl (10.9 g, 257 mmol, 10 equiv) in DMF (180 mL) was stirred at 120 °C for 24 h. The mixture was diluted with water, extracted with EA, washed with brine, dried, and concentrated. The residue was purified by silica gel column chromatography (EA:PE = 0% - 5%) to give Compound 18-2 (7.5 g, yield 83.2%) as a colorless oil. 1 1H NMR (400 MHz, CDCl3) δ: 0.80 - 0.95 (m, 6H), 1.18 - 1.37 (m, 16H), 1.40 - 1.52 (m, 2H), 1.54 - 1.66 (m, 3H), 1.90 - 2.08 (m, 7H), 2.24 - 2.41 (m, 1H), 3.60 - 3.75 (m, 3H), 5.24 - 5.49 (m, 4H).
[0445] Step 3: Preparation of Compound 18-3 A mixture of compound 18-2 (7.5 g, 21.5 mmol, 1 equiv) and LiAlH4 (1.6 g, 43 mmol, 2 equiv) in THF (100 mL) was stirred at 80 °C overnight. The mixture was quenched with water, filtered, the filtrate was concentrated, and purified by silica gel column chromatography (EA:PE = 0% - 5%) to obtain compound 18-3 (6.2 g, yield 89.8%) as a yellow oil.
[0446] Step 4: Preparation of compound 18-4 A mixture of compound 18-3 (1.8 g, 5.5 mmol, 1 equiv), 6-bromohexanoic acid (1.3 g, 6.6 mmol, 1.2 equiv), DIEA (2.14 g, 16.5 mmol, 3 equiv), DMAP (337 mg, 2.76 mmol, 0.5 equiv), and EDCI (1.27 g, 6.6 mmol, 1.2 mmol) in DCM (20 mL) was stirred at 40 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (EA:PE = 0% - 2%) to obtain compound 18-4 (2.1 g, yield 75.2%) as a colorless oil.
[0447] 1 H NMR (400 MHz, CDCl3) δ: 0.83 - 0.93 (m, 6H), 1.23 - 1.40 (m, 20H), 1.41 - 1.54 (m, 2H), 1.62 - 1.72 (m, 3H), 1.83 - 2.10 (m, 10H), 2.25 - 2.46 (m, 2H), 3.18 - 3.52 (m, 2H), 3.87 - 4.03 (m, 2H), 5.18 - 5.58 (m, 4H).
[0448] Step 5: Preparation of compound 18-5 A mixture of compound 18-4 (300 mg, 0.6 mmol, 1 equiv), compound B (133 mg, 0.9 mmol, 1.5 equiv), DIEA (232 mg, 1.8 mmol, 3 equiv), and sodium iodide (30 mg, 0.2 mmol, 0.3 equiv) in THF (6 mL) was stirred at 70 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0% - 10%) to afford compound 18-5 (147 mg, yield 43.6%) as a colorless oil. LCMS: room temperature: 0.900 min, MS m / z (ESI): 562.4 [M+H] + 。
[0449] Step 6: Preparation of compound 18-6 A mixture of compound 18-5 (147 mg, 0.26 mmol, 1 equiv) and SOCl2 (93 mg, 0.78 mmol, 3 equiv) in DCM (5 mL) was stirred at 35 °C overnight. The mixture was concentrated to afford compound 18-6 (137 mg, yield 90.2%). LCMS: room temperature: 1.210 min, MS m / z (ESI): 580.4 [M+H] + 。
[0450] Step 7: Preparation of compound 18-7 A mixture of compound 18-4 (1971 mg, 2 mmol, 1 equiv), 2-aminoethanol (147 mg, 2.4 mmol, 1.2 mmol), K2CO3 (828 mg, 6 mmol, 3 equiv), Cs2CO3 (20 mg, 0.06 mmol, 0.03 equiv), and NaI (15 mg, 0.1 mmol, 0.05 equiv) in ACN (40 mL) was stirred at 80 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0% - 10%) to afford compound 18-7 (610 mg, yield 65.4%) as a brown oil. LCMS: room temperature: 0.910 min, MS m / z (ESI): 480.4 [M+H] + 。
[0451] Step 8: Preparation of compound 18 A mixture of compound 18-6 (137 mg, 0.24 mmol, 1 equiv), compound 18-7 (138 mg, 0.29 mmol, 1.2 equiv), sodium iodide (10 mg, 0.07 mmol, 0.3 equiv), and DIEA (93 mg, 0.72 mmol, 3 equiv) in THF (5 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum. Purification by preparative HPLC gave compound 18 (21 mg, 8.7% yield) as a light brown oil.
[0452] 1 H NMR (400 MHz, CDCl3) δ: 0.83 - 0.92 (m, 12H), 1.15 - 1.23 (m, 3H), 1.24 - 1.36 (m, 47H), 1.37 - 1.52 (m, 5H), 1.56 - 1.69 (m, 12H), 1.71 - 1.79 (m, 4H), 1.95 - 2.05 (m, 14H), 2.21 - 2.33 (m, 4H), 2.42 - 2.60 (m, 9H), 3.49 - 3.56 (m, 1H), 3.95 - 3.99 (m, 3H), 5.30 - 5.42 (m, 8H). LCMS: retention time at room temperature: 0.640 min, MS m / z (ESI): 1023.7 [M+H] + 。
[0453] 6.11 Example 11: Preparation of compound 19.
Chemical formula
[0454] Step 2: Preparation of compound 19-2 To a solution of compound 19-1 (664.0 mg, 2.0 mmol, 1.0 equiv) and compound B (572.0 mg, 4.0 mmol, 2.0 equiv) in ACN (10.0 mL) were added Cs2CO3 (195.0 mg, 0.6 mmol, 0.3 equiv), K2CO3 (828.0 mg, 6.0 mmol, 3.0 equiv), and NaI (28.0 mg, 0.2 mmol, 0.1 equiv) at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS indicated completion of the reaction and the mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0 - 20 / 1) to afford compound 19-2 (0.37 g, 47% yield) as a yellow oil. LCMS: RT: 0.740 min, MS m / z (ESI): 396.3 [M+H] + 。
[0455] Step 3: Preparation of compound 19-3 To a solution of Compound 19-2 (170.0 mg, 0.43 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl2 (152.0 mg, 1.29 mmol, 3.0 equiv) at room temperature. The mixture was stirred for 16 h. LCMS indicated the completion of the reaction, and Compound 19-3 (0.2 g, crude) was obtained as a brown oil by concentration under reduced pressure. LCMS: RT: 0.785 min, MS m / z (ESI): 414.3 [M+H] + 。
[0456] Step 4: Preparation of Compound 19 To a solution of Compound 19-3 (200.0 mg, 0.48 mmol, 1.0 equiv) and Compound 10-1 (247.0 mg, 0.58 mmol, 1.2 equiv) in THF (5.0 mL) was added DIEA (309.0 mg, 2.4 mmol, 5.0 equiv) at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS indicated the completion of the reaction, and Compound 19 (80.0 mg, 21% yield) was obtained as a yellow oil by concentration under reduced pressure and purification by preparative HPLC.
[0457] 1 1H NMR (400 MHz, CDCl3) δ: 0.86 - 0.89 (m, 9H), 1.26 - 1.45 (m, 43H), 1.60 - 1.80 (m, 17H), 1.98 - 2.16 (m, 4H), 2.28 - 2.61 (m, 15H), 3.52 - 3.54 (m, 2H), 3.96 - 4.08 (m, 4H), 5.26 - 5.46 (m, 2H). LCMS: RT: 1.137 min, MS m / z (ESI): 805.7 [M+H] + 。
[0458] 6.12 Example 12: Preparation of Compound 20.
Chemical Structure
[0459] Step 2: Preparation of compound 20-2 To a solution of cyclobutane (840 mg, 12.0 mmol, 1.2 equiv) in MeOH (10 mL) was added 2-(benzyloxy)ethan-1-amine (1.5 g, 10.0 mmol, 1.0 equiv). The mixture was stirred at 25 °C for 2 h. Then, NaCNBH3 (1.0 g, 15.0 mmol, 1.5 equiv) was added to the mixture. The mixture was stirred at 25 °C for 16 h. LCMS indicated completion of the reaction. The mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 20 / 1) to afford mixture 20-2 (1.0 g, crude) as a yellow oil.
[0460] Step 3: Preparation of compound 20-3 A solution of Compound 20-1 (0.8 g, 2.96 mmol, 1.0 equiv) and Compound 20-2 (1.0 g, 3.84 mmol, 1.3 equiv) in EtOH (10.0 mL) was stirred at 70 °C for 16 h. LCMS indicated that the reaction was complete. The reaction mixture was concentrated and purified by FCC (DCM / MeOH = 30 / 1) to afford Compound 20-3 (0.5 g, 35% yield) as a yellow oil. LCMS: at room temperature: 0.840 min, MS m / z (ESI): 476.3 [M+H] + .
[0461] Step 4: Preparation of Compound 20-4 To a solution of Compound 20-3 (475 mg, 1.0 mmol, 1.0 equiv) in THF (10 mL) was added Nah (160 mg, 4.0 mmol, 4.0 equiv). The mixture was stirred at room temperature for 2 h, then C8H 17 Br (576 mg, 3.0 mmol, 3.0 equiv) was added and the mixture was stirred at 70 °C for 16 h. LCMS indicated that the reaction was complete, water was added, extracted with EA, concentrated, and purified by FCC (PE / EA = 20 / 1) to afford Compound 20-4 (300 mg, 51% yield) as a colorless oil. LCMS: at room temperature: 1.280 min, MS m / z (ESI): 588.4 [M+H] + .
[0462] Step 5: Preparation of Compound 20-5 To a solution of Compound 20-4 (250 mg, 0.43 mmol, 1.0 equiv) in EA (10 mL) were added Pd / C (25.0 mg) and HCl (5 drops). The mixture was stirred under H2 at room temperature for 16 h. LCMS indicated that the reaction was complete, filtered, and concentrated to afford Compound 20-5 (250 mg, crude) as a yellow oil. LCMS: at room temperature: 1.023 min, MS m / z (ESI): 498.4 [M+H] + .
[0463] Step 6: Preparation of Compound 20-6 To a solution of Compound 20-5 (240.0 mg, 0.5 mmol, 1.0 eq) in DCM (5.0 mL), SOCl2 (177.0 mg, 1.5 mmol, 3.0 eq) was added at room temperature. The mixture was stirred for 16 h. LCMS indicated the completion of the reaction, and the mixture was concentrated under reduced pressure to afford Compound 20-6 (0.27 g, crude) as a brown oil.
[0464] Step 7: Preparation of Compound 20 To a solution of Compound 20-6 (120.0 mg, 0.23 mmol, 1.0 eq) and Compound 10-1 (120.0 mg, 0.28 mmol, 1.2 eq) in THF (5.0 mL), DIEA (148.0 mg, 1.1 mmol, 5.0 eq) was added at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS indicated the completion of the reaction, and the mixture was evaporated under reduced pressure and purified by preparative HPLC to afford Compound 20 (30.0 mg, yield 14%) as a yellow oil.
[0465] 1 H NMR (400 MHz, CDCl3) δ: 0.86 - 0.89 (m, 12H), 1.21 - 1.35 (m, 65H), 1.50 - 1.65 (m, 11H), 1.98 - 2.00 (m, 3H), 2.28 - 2.32 (m, 2H), 2.53 - 2.62 (m, 9H), 3.40 - 3.59 (m, 10H), 3.96 (d, J = 5.6 Hz, 2H). LCMS: at room temperature: 4.600 min, MS m / z (ESI): 907.8 [M+H] + 。
[0466] 6.13 Example 13: Preparation of Compound 22.
Chemical Structure
[0467] Step 2: Preparation of compound 22-2 To a solution of compound 22-1 (5.3 g, 16.13 mmol, 1.0 equiv) in DMF (100 mL), LiCl (6.8 g, 161.3 mmol, 10.0 equiv) was added. The reaction mixture was stirred at 120 °C for 12 h. TLC indicated that the reaction was complete. The reaction mixture was quenched with water and washed with EA. The organic layer was separated and dried over Na2SO4. Removal of the solvent and purification by FCC gave compound 22-2 (3.4 g, yield 78.07%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ: 3.67 (s, 3H), 2.33 - 2.31 (m, 1H), 1.60 - 1.40 (m, 6H), 1.25 (s, 18H), 0.89 - 0.86 (m, 6H).
[0468] Step 3: Preparation of compound 22-3 To a solution of compound 22-2 (3.4 g, 12.57 mmol, 1.0 equiv) in THF (60 mL) was slowly added LiAlH4 (955 mg, 25.14 mmol, 2.0 equiv) at 0 °C. The reaction mixture was stirred at reflux for 1 h. TLC indicated the completion of the reaction. After cooling to 0 °C, water (1.3 mL), 15% aqueous NaOH solution (1.3 mL), and water (3.9 mL) were added successively to quench the mixture. The resulting mixture was diluted with EA, and the precipitate was removed by filtration. The filtrate was concentrated under reduced pressure, and the crude product was purified by FCC to give compound 22-3 (2.3 g, 75.48%) as a yellow oil. 1 1H NMR (400 MHz, CDCl3) δ: 3.54 (d, J = 5.6 Hz, 2H), 1.46 - 1.40 (m, 2H), 1.27 (s, 24H), 0.90 - 0.87 (m, 6H).
[0469] Step 4: Preparation of compound 22-4 To a solution of compound 22-3 (1 g, 4.125 mmol, 1.0 equiv) in DCM (15 mL) were added 6-bromohexanoic acid (0.966 g, 4.950 mmol, 1.2 equiv), EDCI (1.19 g, 6.188 mmol, 1.5 equiv), DMAP (101 mg, 0.8250 mmol, 0.2 equiv), and DIEA (1.07 g, 8.250 mmol, 2.0 equiv). The reaction mixture was stirred at 50 °C for 16 h. TLC indicated the completion of the reaction. Removal of the solvent and purification by FCC gave compound 22-4 (1 g, 57.79%) as a yellow oil.
[0470] Step 5: Preparation of compound 22-5 To a solution of compound 22-4 (0.33 g, 0.79 mmol, 1.0 eq) in ACN (15 mL) were added ethanolamine (49 mg, 0.79 mmol, 1.0 eq), K2CO3 (329 mg, 2.384 mmol, 3.0 eq), Cs2CO3 (78 mg, 0.2384 mmol, 0.3 eq), and NaI (6 mg, 0.0397 mmol, 0.05 eq). The reaction mixture was stirred at 80 °C for 16 h. LCMS indicated completion of the reaction. Removal of the solvent and purification by FCC gave compound 22-5 (280 mg, 47.73%) as a yellow oil.
[0471] Step 4: Preparation of compound 22 To a solution of compound 22-5 (230 mg, 0.53 mmol, 1.0 eq) and compound 6-2 (257.0 mg, 0.64 mmol, 1.2 eq) in THF (10.0 mL) was added DIEA (413.0 mg, 3.2 mmol, 5.0 eq) at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS indicated completion of the reaction, and the mixture was evaporated under reduced pressure and purified by preparative HPLC to give compound 22 (100.0 mg, 24% yield) as a colorless oil.
[0472] 1 H NMR (400 MHz, CDCl3) δ: 0.86 - 0.89 (m, 9H), 1.26 - 1.35 (m, 52H), 1.46 - 1.49 (m, 3H), 1.60 - 1.65 (m, 8H), 1.78 (s, 3H), 2.28 - 2.32 (m, 5H), 2.49 - 2.60 (m, 10H), 3.54 (s, 2H), 3.95 - 4.06 (m, 4H). LCMS: RT: 1.250 min, MS m / z (ESI): 793.7 [M+H] + 。
[0473] 6.14 Example 14: Preparation of compound 25.
Chemical formula
[0474] Step 2: Preparation of compound 25-4 A mixture of compound 25-2 (2.5 g, 10.36 mmol, 1.0 equiv) and compound 25-3 (5.56 g, 20.72 mmol, 2.0 equiv) in EtOH (100 mL) was stirred at 70 °C for 10 h. LCMS indicated that the reaction was complete. Removal of the solvent and FCC gave compound 25-4 (2.5 mg, yield 47%) as a yellow oil. LCMS: rt: 1.320 min, MS m / z (ESI): 510.4 [M+H] + 。
[0475] Step 3: Preparation of compound 25-5 To a mixture of NaH (710 mg, 17.65 mmol, 6.0 equiv) in THF (60 mL) was added compound 25-4 (1.5 g, 2.94 mmol, 1.0 equiv) under N2 at rt. The reaction mixture was stirred at rt for 2 h. C8H 17 Br (2.27 g, 11.77 mmol, 4.0 equiv) was added thereto. The reaction mixture was stirred at 70 °C for 10 h. LCMS indicated that the reaction was complete. The mixture was powdered in water and washed with EA. The organic matter was separated and dried over Na2SO4. Removal of the solvent and FCC gave compound 25-5 (0.8 mg, yield 43%) as a yellow oil. LCMS: rt: 0.733 min, MS m / z (ESI): 622.5 [M+H] + 。
[0476] Step 4: Preparation of compound 25-6 To a solution of compound 25-5 (0.8 g, 1.29 mmol, 1.0 eq) in ethyl acetate (100 mL) was added Pd / C (1.0 g). The reaction mixture was stirred at room temperature under H2 for 48 h. LCMS indicated that the reaction was complete. The mixture was filtered through diatomaceous earth. Removal of the solvent gave compound 25-6 (350 mg, 61% yield) as a yellow oil. LCMS: room temperature: 1.040 min, MS m / z (ESI): 442.4 [M+H] + 。
[0477] Step 5: Preparation of Compound 25 To a mixture of compound 25-6 (350 mg, 0.8 mmol, 1.0 eq), DIEA (200 mg, 1.6 mmol, 2.0 eq) in THF (20 mL) were added compound 25-7 (200 mg, 0.4 mmol, 0.5 eq), NaI (60 mg). The reaction mixture was stirred at 70 °C for 10 h. LCMS indicated that the reaction was complete. After removal of the solvent, the residue was purified by preparative HPLC to give the title compound (20 mg, 12% yield) as a yellow oil.
[0478] 1 H NMR (400 MHz, CDCl3) δ: 0.87 (t, J = 8 Hz, 12H), 1.26 - 1.97 (m, 91H), 2.19 - 2.64 (m, 10H), 3.28 - 3.53 (m, 9H). LCMS: room temperature: 0.627 min, MS m / z (ESI): 919.8 [M+H] + 。
[0479] 6.15 Example 15: Preparation of Compound 26.
Chemical Structure
[0480] Step 2: Preparation of Compound 26-3 To a solution of Compound 26-2 (100 mg, 0.23 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl2 (82 mg, 0.69 mmol, 3.0 equiv) at room temperature. The mixture was stirred at 35 °C for 16 h. LCMS indicated completion of the reaction. The mixture was evaporated under reduced pressure to afford Compound 26-3 (100 mg, crude) as a yellow oil. LCMS: RT: 0.920 min, MS m / z (ESI): 460.3 [M+H] + .
[0481] Step 3: Pr...
Claims
1. A compound of formula (I), 【Chemistry 1】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: G 1 and G 2 each independently represents a bond, C 2 -C 12 Alkylene, or C 2 -C 12 alkenylene, G 1 and G 2 At least one -CH 2 - is optionally replaced by -O-; Each L 1 are independently -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b ) (OR c ), -NR a P(=O)(OR b ) (OR c ), -(C 6 -C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 , -(4- to 8-membered heterocyclylene)-R 1 , or R 1 and Each L 2 are independently -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2 , -CH(OH)R 2 , -P(=O)(OR e ) (OR f ), -NR d P(=O)(OR e ) (OR f ), -(C 6 -C 10 Arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 , -(4- to 8-membered heterocyclylene)-R 2 , or R 2 and R 1 and R 2 Each independently, C 6 -C 24 Alkyl or C 6 -C 24 alkenyl, R a , R b , R d , and R e Each independently represents H, C 1 -C 24 Alkyl, or C 2 -C 24 alkenyl, R c and R f Each independently, C 1 -C 24 Alkyl or C 2 -C 24 alkenyl, G 3 But, C 2 -C 12 Alkylene or C 2 -C 12 alkenylene, wherein part or all of the alkylene or alkenylene is C 3 -C 8 Cycloalkylene, C 3 -C 8 Cycloalkenylene, C 3 -C 8 Cycloalkynylene, 4-8 membered heterocyclylene, C 6 -C 10 optionally replaced by arylene, or 5- to 10-membered heteroarylene; R 3 is hydrogen, C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 aryl, or 5-10 membered heteroaryl, or R 3 , G 1 , or G 1 together with the nitrogen to which they are attached form a cyclic moiety, or 3 , G 3 , or G 3 form a cyclic moiety together with the nitrogen to which they are attached, R 4 But, C 1 -C 12 Alkyl or C 3 -C 8 is cycloalkyl, x is 0, 1, or 2; n is 1 or 2; m is 1 or 2; or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
2. A compound of formula (II-A), (II-B), (II-C), or (II-D), 【Chemistry 2】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
3. G 3 But, C 2 -C 6 3. The compound of claim 1 or 2 which is an alkylene.
4. A compound of formula (III-A), (III-B), (III-C), or (III-D), 【Chemistry 3】 wherein s is an integer from 2 to 12. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
5. The compound of claim 4 , wherein s is 2.
6. G 1 and G 2 Each independently, C 2 -C 12 The compound according to any one of claims 1 to 5, which is an alkylene.
7. G 1 and G 2 Each independently, C 5 The compound of claim 6 which is an alkylene.
8. A compound of formula (IV), 【Chemistry 4】 In the formula, s is an integer from 2 to 12; y is an integer from 2 to 12; The compound, wherein z is an integer from 2 to 12; or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
9. L 1 But -OC(=O)R 1 , -C(=O)OR 1 , -NR a C(=O)R 1 or -C(=O)NR b R c And L 2 But -OC(=O)R 2 , -C(=O)OR 2 , -NR d C(=O)R 2 or -C(=O)NR e R f The compound according to any one of claims 1 to 8,
10. A compound of formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G), or (IV-H), 【Chemistry 5】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
11. A compound of formula (V), 【Chemistry 6】 In the formula, y is an integer from 2 to 12; The compound, wherein z is an integer from 2 to 12; or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
12. L 1 But -OC(=O)R 1 , -C(=O)OR 1 , -NR a C(=O)R 1 or -C(=O)NR b R c And L 2 But -OC(=O)R 2 , -C(=O)OR 2 , -NR d C(=O)R 2 or -C(=O)NR e R f 12. The compound of claim 11, wherein
13. A compound of formula (VA), (V-B), (V-C), (V-D), (V-E), (V-F), (V-G), or (V-H), 【Chemistry 7】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
14. The compound according to any one of claims 8 to 13, wherein y is 5 and z is 5.
15. A compound of formula (VI), 【Chemistry 8】 wherein z is an integer from 2 to 12; or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
16. R 3 But, C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, or C 3 -C 8 The compound of any one of claims 1 to 15, which is cycloalkyl.
17. R 3 , G 1 , or G 1 The compound of any one of claims 1 to 15, wherein portions of:
18. A compound of formula (VII) 【Chemistry 9】 In the formula, s is an integer from 2 to 12; u is 1, 2, or 3; v is 1, 2, or 3; y' is an integer from 0 to 10; The compound, wherein z is an integer from 2 to 12; or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
19. R 3 , G 3 , or G 3 The compound of any one of claims 1 to 15, wherein portions of:
20. A compound of formula (VIII-A), (VIII-B), (VIII-C), (VIII-D), (VIII-E), (VIII-F), or (VIII-G), 【Chemistry 10】 In the formula, s′ is an integer from 0 to 10; u is 1, 2, or 3; v is 1, 2, or 3; y is an integer from 2 to 12; z is an integer from 2 to 12; y0 is an integer from 1 to 11; z0 is an integer from 1 to 11; y1 is an integer from 0 to 9, The compound, wherein z1 is an integer of 0 to 9. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
21. Formulas (IX-A), (IX-B), (IX-C), (IX-D), (IX-E), (IX-F), (IX-G), (IX-H), (IX-I), (IX-J), (IX-K), (IX-L), (IX-M), (IX-N), (I A compound of: 【Chemistry 11-1】 【Chemistry 11-2】 In the formula, s is an integer from 2 to 12; y is an integer from 2 to 12; z is an integer from 2 to 12; y0 is an integer from 1 to 11; z0 is an integer from 1 to 11; y1 is an integer from 0 to 9, z1 is an integer from 0 to 9, y2 is an integer from 2 to 5, y3 is an integer from 2 to 6, y4 is an integer from 0 to 3; y5 is an integer from 1 to 5; z2 is an integer from 2 to 5, z3 is an integer from 2 to 6, z4 is an integer from 0 to 3; The compound, wherein z5 is an integer of 1 to 5. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
22. L 1 But, -OR 1 , -OC(=O)R 1 , -C(=O)OR 1 or -C(=O)NR b R c And L 2 But, -OR 2 , -OC(=O)R 2 , -C(=O)OR 2 or -C(=O)NR e R f 22. The compound of claim 21 ,
23. R 3 The compound of any one of claims 1 to 22, wherein is unsubstituted.
24. R 4 But substitution C 1 -C 12 The compound according to any one of claims 1 to 23, which is alkyl.
25. R 4 But -CH 2 CH 2 25. The compound of claim 24, wherein:
26. R 4 But -(CH 2 ) p Q, -(CH 2 ) p CHQR, -CHQR, or -CQ(R) 2 and Q is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 Aryl, 5- to 10-membered heteroaryl, -OR, -O(CH 2 ) p N (R) 2 , -C(O)OR, -OC(O)R, -CX 3 , -CX 2 H, -CXH 2 , -CN, -N(R) 2 , -C(O)N(R) 2 , -N(R)C(O)R, -N(R)S(O) 2 R, -N(R)C(O)N(R) 2 , -N(R)C(S)N(R) 2 , -N(R)R 22 , -O(CH 2 ) p OR, -N(R)C(=NR 23 ) N (R) 2 , -N(R)C(=CHR 23 ) N (R) 2 , -OC(O)N(R) 2 , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) 2 R, -N(OR)C(O)OR, -N(OR)C(O)N(R) 2 , -N(OR)C(S)N(R) 2 , -N(OR)C(=NR 23 ) N (R) 2 , -N(OR)C(=CHR 23 ) N (R) 2 , -C(=NR 23 ) N (R) 2 , -C(=NR 23 )R, -C(O)N(R)OR, or -C(R)N(R) 2 C(O)OR, where each p is independently 1, 2, 3, 4, or 5; R 22 But, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 aryl, or 5-10 membered heteroaryl; R 23 H, -CN, -NO 2 , C 1 -C 6 Alkyl, -OR, -S(O) 2 R, -S(O) 2 N (R) 2 , C 2 -C 6 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 aryl, or 5-10 membered heteroaryl; Each R is independently H, C 1 -C 3 Alkyl or C 2 -C 3 alkenyl or N(R) 2 the two R's in the moiety together with the nitrogen to which they are attached form a cyclic moiety; 25. The compound of claim 24, wherein each X is independently F, CI, Br, or I.
27. R 1 , R 2 , R c , and R f each independently represents a linear C 6 -C 18 Alkyl, linear C 6 -C 18 alkenyl, or -R 7 -CH(R 8 ) (R 9 ) in which R 7 But, C 0 -C 5 alkylene, R 8 and R 9 But independently, C 2 -C 10 Alkyl or C 2 -C 10 The compound according to any one of claims 1 to 26, which is alkenyl.
28. R 1 , R 2 , R c , and R f each independently represents a linear C 7 -C 15 Alkyl, linear C 7 -C 15 alkenyl, or -R 7 -CH(R 8 ) (R 9 ) and R 7 But, C 0 -C 1 alkylene, R 8 and R 9 But independently, C 4 -C 8 Alkyl or C 6 -C 10 28. The compound of claim 27 which is alkenyl.
29. R a , R b , R d , and R e The compound of any one of claims 1 to 28, wherein each is independently H.
30. A compound of Table 1 or Table 1A, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.
31. A compound of formula (X), 【Chemistry 12】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: G 1 is bond, C 2 -C 12 Alkylene, or C 2 -C 12 alkenylene, Each L 1 are independently -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b ) (OR c ), -(C 6 -C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 , or R 1 and R 1 But, C 6 -C 24 Alkyl or C 6 -C 24 alkenyl, R a and R b Each independently represents H, C 1 -C 12 Alkyl, or C 2 -C 12 alkenyl, R c But, C 1 -C 24 Alkyl or C 2 -C 24 alkenyl, R 3 is hydrogen, C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 aryl, or 5-10 membered heteroaryl, or R 3 , G 1 , or G 1 form a cyclic moiety together with the nitrogen to which they are attached, x is 0, 1, or 2; n is 1 or 2; Z is -OH or halogen; or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
32. A composition comprising a compound according to any one of claims 1 to 31 and a therapeutic or prophylactic agent.
33. 33. The composition of claim 32, further comprising one or more structured lipids.
34. 34. The composition of claim 33, wherein the one or more structured lipids is DSPC.
35. 35. The composition of claim 33 or 34, wherein the molar ratio of said compound to said structured lipid ranges from about 2:1 to about 8:
1.
36. The composition of any one of claims 32 to 35, further comprising a steroid.
37. 37. The composition of claim 36, wherein the steroid is cholesterol.
38. 38. The composition of claim 36 or 37, wherein the molar ratio of the compound to the steroid ranges from about 5:1 to about 1:
1.
39. The composition of any one of claims 32 to 38, wherein the composition further comprises one or more polymer-conjugated lipids.
40. 40. The composition of claim 39, wherein the polymer-conjugated lipid is DMG-PEG2000 or DMPE-PEG2000.
41. 41. The composition of claim 39 or 40, wherein the molar ratio of said compound to said polymer-conjugated lipid ranges from about 100:1 to about 20:
1.
42. The composition of any one of claims 32 to 41, wherein the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.
43. 43. The composition of claim 42, wherein the mRNA is a monocistronic mRNA.
44. 43. The composition of claim 42, wherein the mRNA is a multicistronic mRNA.
45. The composition according to any one of claims 42 to 44, wherein the antigen is a pathogenic antigen.
46. The composition according to any one of claims 42 to 44, wherein the antigen is a tumor-associated antigen.
47. The composition of any one of claims 42 to 46, wherein the mRNA comprises one or more functional nucleotide analogues.
48. 48. The composition of claim 47, wherein the functional nucleotide analog is one or more selected from pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.
49. The composition of any one of claims 32 to 48, wherein the composition is a nanoparticle.
50. A lipid nanoparticle comprising a compound according to any one of claims 1 to 31 or a composition according to any one of claims 32 to 48.
51. A pharmaceutical composition comprising a compound according to any one of claims 1 to 31, a composition according to any one of claims 32 to 48, or a lipid nanoparticle according to claim 50, and a pharma- ceutically acceptable excipient or diluent.