DNA constructs for cancer diagnosis and treatment

Abstract

To provide DNA constructs for cancer diagnosis and treatment.SOLUTION: The invention relates to a DNA construct and a strain having an introduced recombinant vector comprising the DNA construct, where the DNA construct of the invention can carry out both treatment and diagnosis of cancer at the same time since the expression levels of a gene operably linked to the downstream of a first promoter and a gene operably linked to the downstream of a second promoter in a host strain or a cell are balanced. The DNA construct of the invention cannot express the anticancer protein and the reporter protein at all when doxycycline is not present so that by controlling the presence or absence of doxycycline treatment, it is possible to express the anticancer protein at a dose suitable for cancer treatment and at the same time to enable real time monitoring of the size of the cancer depending on the expression level of the reporter protein.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a DNA construct for cancer diagnosis and treatment and a strain into which a recombinant vector containing the DNA construct has been introduced.

Background Art

[0002] At present, most cancers are currently treated by respective individual methods corresponding to surgical operation, radiotherapy, and chemotherapy, or combinations thereof. Surgical operation to mostly remove cancer tissue can be very effective for removing cancer tissue located in specific sites, such as the breast, colon, and skin, but it is difficult to use for treating cancer tissue in some regions such as the spine. Also, in the case of systemic chemotherapy often used for breast cancer, lung cancer, and testicular cancer, side effects that disrupt the replication or metabolic process of normal cells may be induced, and resistance to therapeutic agents used in chemotherapy generated from patients may occur.

[0003] On the other hand, when cancer occurs in an individual, since angiogenesis and cell growth proceed at a very high rate in the body, an environment with incomplete angiogenesis and oxygen deficiency is created inside the cancer tissue, which is very suitable for the growth of anaerobic bacteria such as Salmonella or Escherichia coli strains. Thus, current cancer treatment using bacteria that can target cancer, such as Salmonella and Clostridium strains, depends on the function of specific bacteria that can target solid tumors and proliferate within the tumor. However, when a tumor-lysing protein or a reporter protein is introduced into the bacteria and the bacteria thus transformed are administered to an individual, it is possible to specifically identify cancer tissue or minimize side effects showing toxicity to normal cells and treat cancer.

[0004] Diseases are induced in humans by toxins secreted from various bacterial pathogens existing in nature. Among the various bacterial pathogens capable of inducing such diseases, Salmonella enterica, which has a close relationship with our diet, is known as an Enterobacteriaceae that inhabits the intestinal tract of primates including humans, and secretes cytolysin, which is known as an exotoxin. The cytolysin secreted in this way is a cytotoxic protein having a molecular weight of about 34 kDa, and is known to cause hemolysis that destroys red blood cells in the intestines of primates including humans, form pores in the membranes of normal cells to induce cell lysis, and lead to death due to severe vascular inflammation and local tissue necrosis. However, recent research results have shown that cytolysin isolated and purified from Salmonella enterica specifically reacts with cancer tissues present in the intestinal tract in the body, induces the death of cancer tissues, and has attracted attention as a next-generation anti-cancer therapeutic agent. Therefore, bacteria transformed with the gene secreting the cytotoxic substance cytolysin have a very high potential for use as anti-cancer therapeutic agents for targeting cancer tissues.

[0005] Despite the fact that cancer diagnosis or treatment using bacteria is thus possible, the current situation is that there has been little research on expression vectors that enable proteins suitable for diagnosis and treatment to be specifically expressed in cancer tissues. After bacteria are injected into the body, clearance is carried out by the reticuloendothelial system such as the liver and spleen for the first three days, and then rapidly increases in cancer tissues after a certain period of time. Therefore, it is required that the therapeutic protein can be expressed after a certain period of time from the viewpoint of stability. Therefore, the use of an inducible promoter is recommended for the expression of the therapeutic protein. However, inducible promoters such as the P BAD promoter require L-arabinose, which is not allowed for human use, to be used as an inducer, so the hurdle for clinical application is high. The P tetThe promoter has the advantages that it is relatively easy to use clinically and can perform bidirectional transcription of two genes using the TetA promoter and the TetR promoter. However, the protein expression rates between the TetA promoter and the TetR promoter show a difference of 100:1 or more, and it can be utilized more effectively only when the balance of this part is adjusted. At present, it is necessary to develop new technologies for bacteria transformed with an expression system in a form applicable to clinical use and with a balanced protein expression level.

Summary of the Invention

Problems to be Solved by the Invention

[0006] One object of the present invention is to provide a DNA construct.

[0007] Another object of the present invention is to provide a recombinant vector containing the DNA construct.

[0008] Still another object of the present invention is to provide a strain into which the recombinant vector has been introduced; and a diagnostic composition for cancer containing the same.

[0009] Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer containing the strain as an active ingredient.

[0010] Still another object of the present invention is to provide a method for providing information for diagnosing cancer, which includes the step of treating the strain.

[0011] However, the technical problems to be solved by the present invention are not limited to the problems described above, and other problems not described will be clearly understood by those with ordinary knowledge in the art from the following description.

Means for Solving the Problems

[0012] In one embodiment of the present invention, a DNA construct is provided.

[0013] The DNA construct of the present invention includes a gene encoding a regulatory protein; and a first promoter and a second promoter induced by the regulatory protein.

[0014] Any one selected from the group consisting of a gene encoding an anti-cancer protein; a gene encoding a cytokine; a gene encoding a chemokine; a gene encoding an immune modulator; an oligonucleotide specific for a cancer antigen; and a gene encoding a reporter protein is operably linked downstream of the first promoter and the second promoter of the present invention.

[0015] Since the first promoter and the second promoter of the present invention can be simultaneously induced by one regulatory protein expressed by another promoter, compared with the case where a gene encoding a regulatory protein is operably linked downstream of the second promoter, the expression levels between the host cell; or the proteins encoded by the genes operably linked downstream of the first promoter and the second promoter in the host cell can be balanced. Thus, when the DNA construct according to the present invention is used, diagnosis and treatment are performed simultaneously.

[0016] The "DNA construct" of the present invention, when introduced into a host strain or cell by transformation, is a structure that enables the expression of a target protein, etc., and means that it contains not only a gene encoding the target protein but also a base sequence corresponding to a promoter, which is an essential regulatory element operably linked so that the gene can be expressed.

[0017] The "promoter" of the present invention refers to a base sequence present in the upstream region of a gene operably linked in a host strain or cell, and means the base sequence of a specific site of the DNA construct to which RNA polymerase can bind in order to initiate transcription.

[0018] The regulation of the expression of the regulatory protein of the present invention can be achieved by cis-acting elements (Cis-regulatory elements; CRE) or trans-acting elements (Trans-regulatory elements; TRE).

[0019] In the present invention, the "regulation" or "expression regulation" can mean that the transcription and translation of a specific gene are activated or suppressed.

[0020] The cis-acting element of the present invention is a region of non-coding DNA that regulates the transcription of adjacent genes. It is an essential component of the gene regulatory network and controls gene expression. The cis-acting element may be at least one selected from the group consisting of a ribosome binding site (RBS), a 5'-untranslated region (5'-UTR), a transcription factor binding site, and terminators, but is not limited thereto.

[0021] In the present invention, the ribosome binding site (RBS) is also called the Shine-Dalgarno sequence (SD sequence). After the genetic information incorporated in DNA is transcribed into messenger RNA (mRNA), for translation to occur, the ribosome must bind to this mRNA. At this time, it refers to a short sequence present on the mRNA so that the ribosome can bind effectively.

[0022] In the present invention, the 5'-untranslated region (5'-UTR) is a non-translated region located on both sides of the coding region, which is the part of the mRNA that is translated into amino acids in the 5' region. It was considered to be a part that was unnecessary and discarded during the process of evolution, but it is known to play an important role in the regulation of gene expression.

[0023] In the present invention, the transcription factor binding site is a DNA site that plays a role in turning on and off a specific gene in the vicinity. The transcription factor binding site may be at least one selected from the group consisting of a promoter, an enhancer, and a silencer of the gene encoding the regulatory protein, but is not limited thereto.

[0024] The promoter of the gene encoding the regulatory protein of the present invention may include all promoters that can be induced to be active under the environmental conditions and developmental states of most host strains or cells, and preferably may be a weak promoter.

[0025] The "weak promoter" of the present invention refers to a promoter that induces expression at a level of 1×10 -2 preferably 1×10 -3 or less, and induces expression as follows. The expression level of the transcript is thus 1×10 -3It may include any promoter to be expressed below. For example, it may be at least one selected from the group consisting of E. coli σ70 promoter; E. coli σS promoter; E. coli σ32 promoter; B. subtilis σA promoter; B. subtilis σB promoter; K112706 or K112707 which is a promoter derived from Salmonella; bacteriophage T7 promoter; bacteriophage SP6 promoter; a promoter derived from yeast; I712004 or K076017 which is a promoter derived from eukaryotic cells; OXB1 promoter and a promoter derived from plants, but is not limited thereto.

[0026] The E. coli σ70 promoter of the present invention may be at least one selected from the group consisting of I14018, I14033, I14034, I732021, I742126, J01006, J23103, J23109, J23112, J23113, J23117, J23119, J23150, J23151, J44002, J48104, J56015, J64951, K088007, K119000, K119001, K1330002, K137029, K137030, K137031, K137032, K137085, K137086, K137087, K137088, K137089, K137090, K137091, K1585100, K1585101, K1585102, K1585103, K1585104, K1585105, K1585106, K1585110, K1585113, K1585115, K1585116, K1585117, K1585118, K1585119, K2486171, K256002, K256018, K256020, K256033, K292000, K823007, K823010, K823013, M13101, M13102, M13103, M13104, M13105, M13106, M13108, M13110, M31519, R1074, R1075 and S03331, but is not limited thereto.

[0027] The E. coli σS promoter of the present invention may be J45992 or J45993, but is not limited thereto.

[0028] The E. coli σ32 promoter of the present invention may be J45504, K1895002 or K1895003, but is not limited thereto.

[0029] The B. subtilis σA promoter of the present invention may be at least one selected from the group consisting of K143012, K143013, K823000, K823002 and K823003, but is not limited thereto.

[0030] The B. subtilis σB promoter of the present invention may be K143010, K143011 or K143013, but is not limited thereto.

[0031] The bacteriophage T7 promoter of the present invention may be at least one selected from the group consisting of I719005, J34814, J64997, K113010, K113011, K113012, K1614000, R0085, R0180, R0181, R0182, R0183, Z0251, Z0252 and Z0253, but is not limited thereto.

[0032] The bacteriophage SP6 promoter of the present invention may be J64998, but is not limited thereto.

[0033] The yeast-derived promoter of the present invention may be at least one selected from the group consisting of I766557, J63005, K105027, K105028, K105029, K105030, K105031, K122000, K124000, K124002, K319005, M31201, K2365040, K2365036, K2365041, K2365042, K2365032, K2365051, K2365514, K2365515, and K2365516, but is not limited thereto.

[0034] In the present invention, the weak promoter may be the OXB1 promoter represented by SEQ ID NO: 16, but is not limited thereto.

[0035] The plant-derived promoter of the present invention may be at least one selected from the group consisting of PLPR0203, PLPR0210, PLPR0177, PLPR0193, PLPR0507, PLPR0422, PLPR0228, PLPR0226, PLPR0223, PLPR0040, PLPR0465, PLPR0232, PLPR0205, PLPR0247, PLPR0328, PLPR0525, AtREG383, AtREG415, AtREG416, OsREG438, OsREG443, OsREG501, PpREG186, PpREG194, and PpREG197, but is not limited thereto.

[0036] For the purpose of the present invention, when a gene encoding a regulatory protein is operably linked downstream of the weak promoter, compared to the case where it is operably linked downstream of the first promoter or the second promoter, it can be regulated so that transcription of the genes present specifically downstream of the first and second promoters occurs only when a substance that suppresses the regulatory protein is administered.

[0037] The promoter of the gene encoding the regulatory protein of the present invention may have a base sequence of SEQ ID NO: 8 at the -35 site and a base sequence of SEQ ID NO: 9 at the -10 site, based on the gene encoding the regulatory protein, but is not limited thereto.

[0038] The enhancer of the present invention is a sequence found in both prokaryotes and eukaryotes, generally having a region of 50 to 1500 bp, and is located upstream or downstream from the starting point of the neighboring gene to induce the binding of the transcription factor.

[0039] The silencer of the present invention maintains the same mechanism as the enhancer and antagonizes the enhancer. The transcription factor that binds to the silencer is a repressor. The enhancer and the silencer may be present in regions close to each other or may be in the same region with different transcription factors.

[0040] The terminators of the present invention are also called transcription terminators, and mediate the termination of gene or operon transcription in the genome. In prokaryotes, there are Rho-dependent terminators and Rho-independent terminators.

[0041] The trans-acting factor of the present invention is also called a trans-activating factor or a trans-acting transcription factor, and is a factor that activates gene transcription in trans. The trans-acting factor may be at least one selected from the group consisting of the transcription factor, aptamer, sRNA, and antisense RNA (asRNA), but is not limited thereto.

[0042] In the present invention, the transcription factor is a protein that binds to the transcription factor binding site and helps to turn on or off a specific gene.

[0043] In the present invention, the aptamer is a part of a riboswitch and is a general term for an oligonucleotide or peptide substance that can bind to a specific target molecule. The aptamer may be a peptide aptamer or a nucleic acid aptamer. The riboswitch is a type of mRNA that regulates gene expression, and examples include, but are not limited to, glmS riboswitch, FMN riboswitch, and Cobalamin riboswitch.

[0044] In the present invention, the sRNA and antisense RNA (asRNA) refer to single-stranded RNA that can complementarily bind to a specific RNA. It complementarily binds to the sense RNA, which is messenger RNA (mRNA) that expresses a specific protein, and ultimately regulates the expression of the protein.

[0045] The first promoter and the second promoter of the present invention may be inducible promoters induced by the regulatory protein.

[0046] The "inducible promoter" of the present invention is a promoter that transcribes so that a gene linked downstream can be specifically expressed only under specific chemical or physical conditions. For example, it may be the promoter of the LacZ gene that is expressed in the presence of galactose such as IPTG (isopropyl-β-D-1-thiogalactopyranoside), the arabinose operon araBAD promoter that is expressed only in the presence of L-arabinose, or the tet promoter whose expression is regulated by tetracycline. Preferably, the first promoter and the second promoter may be the tet promoter. More preferably, the first promoter may be the tetA promoter and the second promoter may be the tetR promoter, but it is not limited thereto.

[0047] The gene encoding the regulatory protein of the present invention is a protein that binds to the first promoter and the second promoter and regulates so that RNA polymerase cannot bind. For the purpose of the present invention, when the first promoter and the second promoter are tet promoters, it may be a TetR protein that binds to the regulatory site of the tet promoter and can suppress the activity of the tet promoter, but is not limited thereto.

[0048] The "Operably linked" of the present invention means that one nucleic acid fragment of interest is functionally linked to another nucleic acid fragment, whereby the function or expression of one nucleic acid fragment of interest is affected by the other nucleic acid fragment.

[0049] The "reporter protein" of the present invention is a protein that performs a function that enables visual diagnosis of cancer, and may be, for example, at least one selected from the group consisting of fluorescent proteins, luciferase, and proteins used in nuclear medicine or MRI imaging, but is not limited thereto.

[0050] The "fluorescent protein" of the present invention is a protein that exhibits fluorescence by itself so that cancer can be visually diagnosed. For example, it may be at least one selected from the group consisting of Green Fluorescent Protein (GFP), Modified Green Fluorescent Protein (MGFP), Enhanced Green Fluorescent Protein (EGFP), Red Fluorescent Protein (RFP), Enhanced Red Fluorescent Protein (ERFP), Blue Fluorescent Protein (BFP), Enhanced Blue Fluorescent Protein (EBFP), Yellow Fluorescent Protein (YFP), and Enhanced Yellow Fluorescent Protein (EYFP), but is not limited thereto.

[0051] The protein used in the nuclear medicine or MRI imaging of the present invention may be, for example, at least one selected from the group consisting of Herpes simplex virus thymidine kinsease, Dopamine receptor, Somatostatin receptor, Sodium-iodide transporter, iron receptor, Transferrin receptor, Ferritin, and iron transporter (magA), but is not limited thereto.

[0052] The "cytokine" of the present invention is a protein secreted by immune cells. As long as the cytokine of the present invention can regulate the host immune response and induce the death of cells related to diseases, such as cancer cells, and can be used in cancer immunotherapy, it may include all of them. Preferably, it may be IFN-α2, IL-2, IL-15, IL-21, and IL-12, but is not limited thereto.

[0053] The "chemokine" of the present invention plays a role in regulating cell migration between tissues and the position and interaction of cells within tissues. As long as it can induce white blood cells into the tumor microenvironment and mediate the host response to diseases, such as cancer, it may include all of them. Preferably, it may be CXCR3, CCR5, etc., but is not limited thereto.

[0054] The "immunomodulator" of the present invention enables various treatments by utilizing the individual's innate immune system. As long as it can activate immune cells and induce the death of cells related to diseases, such as cancer cells, it may include all of them.

[0055] The "anticancer protein" of the present invention is a peptide having a function of directly or indirectly inducing the death of cancer cells. For example, it may be at least one selected from the group consisting of toxin proteins, antibodies specific to cancer antigens or fragments of the antibodies, tumor suppressor proteins, angiogenesis inhibitors, cancer antigens, prodrug-converting enzymes, and pro-apoptotic proteins, but is not limited thereto.

[0056] The "toxin protein" of the present invention is a protein having a function capable of directly or indirectly inducing the death of cancer cells. For example, it may be at least one selected from the group consisting of Ricin, Saporin, Gelonin, Momordin, Debouganin, diphtheria toxin, Pseudomonas toxin, HlyA, FAS ligand (FASL), Tumour necrosis factor-α (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and Cytolysin A (ClyA). More preferably, it may be Cytolysin A consisting of the amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto.

[0057] The "tumor suppressor protein" of the present invention is a gene that maintains its function while existing in normal cells, but when its function is lost, normal cells are induced to divide and grow indiscriminately and converted into cancer cells. For example, it may be a Retinoblastoma protein (RB), p53 protein, Adenomatous polyposis coli (APC) protein, Phosphatase and tensin homologue (PTEN) protein, cyclin dependent kinase inhibitor 2A (CDKN2A) protein, etc., but is not limited thereto.

[0058] The antibody specific to the cancer antigen of the present invention or a fragment of the antibody is an antibody capable of specifically binding to an antigen that is a protein specifically expressed at a high level on the surface or in the cytoplasm of cancer cells. For example, it may be an antibody specific to HER2 or the like that is specifically expressed at a high level in breast cancer or gastric cancer cells, but is not limited thereto.

[0059] The antibody of the present invention means a protein molecule that can specifically bind to an antigenic site of a protein or peptide molecule. The form of the antibody is not particularly limited, and as long as it is a polyclonal antibody, a monoclonal antibody, or something having antigen-binding ability, it may be included even in some cases of the antibody, and all types of immunoglobulin antibodies may be included. Further, special antibodies such as humanized antibodies may be included, and the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule. The functional fragment of the antibody molecule means a fragment having at least an antigen-binding function, and may be Fab, F(ab’), F(ab’)2, Fv, etc., but is not limited thereto.

[0060] The “antibody” of the present invention can be produced by a conventional method after cloning the gene encoding the cancer antigen of the present invention into an expression vector by a conventional method to obtain the protein encoded by the gene.

[0061] The “angiogenesis inhibitor” of the present invention means a protein or compound having a function of suppressing the generation of new blood vessels around cancer cells and directly or indirectly inducing the death of cancer cells. Preferably, the angiogenesis inhibitor may be angiostatin, endostatin, thrombospondin, a protease inhibitor protein, etc., but is not limited thereto.

[0062] The "cancer antigen" of the present invention refers to a protein that is expressed in cancer cells but hardly expressed in normal cells, and by using this as an antigen to induce an anti-tumor immune reaction, it can induce the direct or indirect death of cancer cells. The cancer antigen of the present invention is preferably alpha-fetoprotein (α-fetoprotein; AFP), vascular endothelial growth factor receptor 2 (Vascular endothelial growth factor receptor2; VEGFR2), survivin, legumain, prostate cancer specific antigen (Prostate cancer specific antigen; PCSA), etc., but is not limited thereto.

[0063] The "prodrug-converting enzyme" of the present invention is a protein having a function of converting an inactive drug into an active drug through metabolism by an enzymatic reaction. When such a prodrug-converting enzyme is used, the inactive drug is metabolized and converted into an active drug that can directly or indirectly induce the death of cancer cells, and thus it can be very usefully used for the prevention or treatment of cancer. The prodrug-converting enzyme of the present invention is preferably thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, herpes simplex virus type I thymidine kinase / ganciclovir (HSV1-TK / GCV), β-glucuronidase, etc., but is not limited thereto.

[0064] The "whole-cell killing protein" of the present invention refers to a protein that induces the direct or indirect killing of cancer cells by depriving cancer cells of factors (such as proteins, nutrients, oligonucleotides, etc.) essential for the growth or maintenance of cancer cells. The whole-cell killing protein of the present invention may preferably be, but is not limited to, L-asparaginase (L-ASNase), RNA-binding motif protein 5 (RBM5), etc.

[0065] The oligonucleotide specific to the cancer antigen of the present invention is a nucleotide that can suppress the expression or function of the cancer antigen by binding complementarily to the gene or mRNA of the cancer antigen, and may be any one selected from the group consisting of antisense oligonucleotides, aptamers, siRNA, and shRNA, but is not limited thereto.

[0066] The "antisense oligonucleotide" of the present invention means DNA, RNA, or derivatives thereof that contain a nucleic acid sequence complementary to the sequence of a specific mRNA, and can bind to the complementary sequence in the mRNA to inhibit the translation of the mRNA into protein. The antisense oligonucleotide may be synthesized in vitro using a conventional method such as using RNA polymerase I, etc., and then administered in vivo, or may be synthesized in vivo by a method such as using a vector in which the origin of the recognition site (MCS) is in the opposite direction.

[0067] The "aptamer" of the present invention refers to a small single-stranded oligonucleic acid that can specifically recognize a target substance with high affinity. For the purpose of the present invention, the target substance may be the gene or mRNA of a cancer antigen.

[0068] As used herein, the term "siRNA" of the present invention refers to short double-stranded RNAs capable of inducing the RNA interference (RNAi) phenomenon by cleavage of specific mRNAs. It is composed of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. For the purpose of the present invention, the siRNA can specifically bind to the mRNA transcribed from the gene encoding the cancer antigen and effectively suppress the expression of such a gene.

[0069] As used herein, the term "shRNA" of the present invention refers to short hairpin RNA, which has the advantage of higher transfection efficiency into cells and longer maintenance of RNA interference compared to siRNA. After transforming an adenovirus, a lentivirus, a plasmid expression vector system, etc. from a promoter of RNA polymerase III into cells and expressing them, RNA interference can be induced, but it is not limited thereto. For the purpose of the present invention, the shRNA can specifically bind to the mRNA transcribed from the gene encoding the cancer antigen and effectively suppress the expression of such a gene.

[0070] In another embodiment of the present invention, a recombinant vector containing the DNA construct of the present invention is provided.

[0071] The recombinant vector of the present invention contains the DNA construct of the present invention, and by expressing the regulatory protein by another promoter, the genes operably linked downstream of the first promoter and the second promoter can be expressed in a balanced manner only when a substance that suppresses the regulatory protein is administered from the outside.

[0072] In the recombinant vector of the present invention, since the content regarding the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific to a cancer antigen, reporter protein, promoter, etc. is the same as that described in the DNA construct, it is omitted to avoid excessive complexity of this specification.

[0073] The recombinant vector of the present invention is a means for introducing into a cell to express a protein, and known recombinant vectors such as plasmid vectors, cosmid vectors, bacteriophage vectors can be used, and the recombinant vector can be easily produced by those skilled in the art by any known method using DNA recombination technology.

[0074] In the present invention, specific examples of the recombinant vector may be selected from the group consisting of commercially widely used pCDNA vectors, F, R1, RP1, Col, pBR322, ToL, Ti vectors, cosmids, lambda, lambdoid, M13, Mu, p1 P22, Qμ, T-even, T2, T3, T7 phages, plant viruses, etc., but are not limited thereto. For the purpose of the present invention, a suitable recombinant vector can be selected according to the properties of the host cell.

[0075] In still another embodiment of the present invention, there is provided a host cell or a strain into which a recombinant vector containing the DNA construct of the present invention has been introduced.

[0076] The host cells of the present invention include cells of mammalian, plant, insect, fungal or cellular origin, for example, bacterial cells such as Escherichia coli, Streptomyces or Salmonella strains, yeast cells, fungal cells such as Pichia pastoris; insect cells such as Drosophila, Spodoptera Sf9 cells, CHO (Chinese hamster ovary cells), SP2 / 0 (mouse myeloma), Human lymphoblastoid, COS, NSO (mouse myeloma), 293T cells, Bowes melanoma cells, HT-1080 cells, BHK cells (Baby Hamster Kidney cells), HEK cells (Human Embryonic Kidney cells) or PERC.6 cells (human retinal cells), and at least one selected from the group consisting of plant cells, but is not limited thereto. For the purpose of the present invention, the strain may be at least one selected from the group consisting of anaerobic strains, for example, Salmonella strains, Clostridium strains, Bifidobacterium strains and Escherichia coli strains, preferably at least one selected from the group consisting of Salmonella typhimurium, Salmonella choleraesuis and Salmonella enteritidis, more preferably Salmonella typhimurium, but is not limited thereto.

[0077] The strain of the present invention may be attenuated.

[0078] The "attenuation" of the present invention means that when microorganisms are administered to a patient, modifications are made to genes or the like so that toxicity and other side effects can be reduced. For the purpose of the present invention, when the strain is a Salmonella strain, for attenuation, at least one gene selected from the group consisting of aroA, aroC, aroD, aroE, Rpur, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA and spoA may be modified, but is not limited thereto.

[0079] The method of modifying the gene of the present invention is carried out by various methods known in the art for deleting or disrupting genes. For example, the deletion and disruption methods are carried out by methods such as homologous recombination, chemical mutagenesis, irradiation mutagenesis or transposon mutagenesis.

[0080] In the present invention, since the strain targets the inside of cancer tissue, which is an environment with incomplete angiogenesis and oxygen deficiency and is very suitable for the growth of anaerobic strains, when a recombinant vector capable of simultaneously and balancedly expressing a reporter protein and an anti-cancer protein that can be imaged in real time is introduced into such a strain, cancer can be very effectively diagnosed and simultaneously treated.

[0081] Regarding the content of the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific for cancer antigen, reporter protein, promoter and recombinant vector in the strain of the present invention, since it is the same as that described in the DNA construct and recombinant vector, it is omitted to avoid excessive complexity of this specification.

[0082] The recombinant vector of the present invention can be introduced into a host cell or a strain by transformation (or transduction). However, any transformation method can be used for the transformation method used in the present invention, and it can be easily performed by a conventional method in the art. Specifically, transformation methods for bacteria such as the commonly used Salmonella strains, the CaCl2 precipitation method, the Hanahan method in which DMSO (Dimethyl sulfoxide), a reducing substance, is used in the CaCl2 method to enhance efficiency, the electroporation method, the calcium phosphate precipitation method, the protoplast fusion method, the stirring method using silicon carbide fibers, the Agrobacterium-mediated transformation method, the transformation method using PEG, the dextran sulfate, lipofectamine, and the drying / suppression-mediated transformation method, etc. can be used to introduce the recombinant vector into the strain, but it is not limited thereto.

[0083] In still other embodiments of the present invention, a pharmaceutical composition for preventing or treating cancer is provided.

[0084] The pharmaceutical composition of the present invention contains the strain of the present invention as an active ingredient.

[0085] In the strain of the present invention, when the DNA construct according to the present invention is transformed and a substance that suppresses a regulatory protein is administered after targeting cancer in an individual, a reporter protein capable of imaging in real time and an anti-cancer protein are simultaneously and balancedly expressed in such a strain. Therefore, cancer can be very effectively prevented or treated, and at the same time, cancer can be diagnosed in real time.

[0086] The "cancer" of the present invention is a disease characterized by the rapid and uncontrolled growth of variant cells, and may be at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, adenocarcinoma of the lymph nodes, gallbladder cancer, blood cancer, thyroid cancer, endocrine adenocarcinoma, oral cancer, liver cancer, biliary tract cancer, colorectal cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, gastric cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and solitary myeloma. Preferably, it may be at least one selected from the group consisting of liver cancer, biliary tract cancer, colorectal cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, gastric cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, and skin cancer. More preferably, it may be colorectal cancer, but is not limited thereto.

[0087] The "prevention" of the present invention may include, without limitation, any act of blocking the symptoms caused by cancer or suppressing or delaying those symptoms using the active ingredient of the present invention.

[0088] As used herein, the term "treatment" of the present invention means any act in which the symptoms caused by cancer improve or the individual benefits using the active ingredient of the present invention, and means an attempt to obtain a useful or desirable result including a clinical result. A useful or desirable clinical result can be detectable or, even if not possible, include the alleviation or improvement of one or more symptoms or conditions, reduction of the disease scope, stabilization of the disease state, suppression of disease occurrence, suppression of disease spread, delay or deferral of disease progression, delay or deferral of disease onset, improvement or alleviation of the disease state, and regression (partial or total), and is not necessarily limited thereto. Further, "treatment" can mean that the patient's survival is extended more than predicted in the absence of treatment. Furthermore, "treatment" can mean suppression of disease progression, deferral of temporary disease progression, and more preferably is related to permanently stopping the progression of the disease. As understood by those skilled in the art, if, during improvement of a particular disease state, the treatment results in an opposite result from the patient being treated, i.e., a result greater than all the advantages affected by the treatment, the result may not be beneficial or desirable.

[0089] In the pharmaceutical composition of the present invention, the content regarding the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific for a cancer antigen, reporter protein, promoter recombinant vector, strain, and transformation, etc. is the same as that described in the DNA construct, recombinant vector, and strain, and thus is omitted in order to avoid excessive complexity of this specification.

[0090] The pharmaceutical composition of the present invention is characterized by being in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition can be characterized by being targeted at humans.

[0091] The pharmaceutical composition of the present invention can be formulated into oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories, and sterile injection solutions, although not limited thereto. The pharmaceutical composition of the present invention can contain a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers can include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, flavors, etc. for oral administration, and buffers, preservatives, soothing agents, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used for injections, and bases, excipients, lubricants, preservatives, etc. can be used for topical administration. The dosage form of the pharmaceutical composition of the present invention can be manufactured in various ways by mixing with pharmaceutically acceptable carriers as described above. For example, for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be manufactured in unit dosage ampoules or multiple dosage forms. In addition, it can be formulated into solutions, suspensions, tablets, capsules, sustained-release preparations, etc.

[0092] On the other hand, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil, etc. Additionally, fillers, anticoagulants, lubricants, wetting agents, flavors, emulsifiers, preservatives, etc. can be included.

[0093] The administration routes of the pharmaceutical composition of the present invention are not limited thereto, and include oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred.

[0094] As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

[0095] The pharmaceutical composition of the present invention can vary widely depending on various factors including the activity of the specific compound used, age, body weight, general health, sex, formulation, administration time, administration route, excretion rate, drug combination and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition varies depending on the patient's condition, body weight, degree of disease, drug form, administration route and duration, but can be appropriately selected by those skilled in the art, and can be administered at 0.0001 - 50 mg / kg or 0.001 - 50 mg / kg per day. The administration may be once a day or divided into several times. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention is formulated into tablets, dragees, capsules, solutions, gels, syrups, slurries, suspensions.

[0096] In still other embodiments of the present invention, a composition for cancer diagnosis is provided.

[0097] The diagnostic composition of the present invention contains the strain according to the present invention as an active ingredient.

[0098] When the strain of the present invention is transformed with the DNA construct according to the present invention and targets cancer cells in an individual, and then a substance that suppresses a regulatory protein is administered, a reporter protein capable of real-time imaging and an anti-cancer protein are simultaneously and evenly expressed in such a strain, so that cancer can be very effectively prevented or treated, and at the same time, cancer can be diagnosed in real time.

[0099] The "diagnosis" of the present invention means all acts of confirming in-vivo cancer tissues, including the ability to monitor in real time the presence or absence of cancer by the reporter protein expressed from the DNA construct introduced into the strain when the strain of the present invention is located targeting cancer.

[0100] In the diagnostic composition of the present invention, the content regarding the DNA construct, anti-cancer protein, reporter protein, constitutive promoter, inducible promoter, recombinant vector, Salmonella strain, transformation, cancer, etc. is the same as that described in the DNA construct, recombinant vector, strain and pharmaceutical composition, so it is omitted to avoid excessive complexity of this specification.

[0101] In still other embodiments of the present invention, a method for providing information for the diagnosis of cancer is provided.

[0102] The method of the present invention includes the step of treating a biological sample isolated from a target individual with a strain into which the recombinant vector according to the present invention has been introduced.

[0103] The method for providing information for the diagnosis of cancer of the present invention may further include the step of diagnosing as cancer when a reporter protein is expressed from the strain.

[0104] The "biological sample" of the present invention means any substance, tissue or cell obtained from an individual or derived from an individual, and can include, for example, tissue, cell, or cell extract, but is not limited thereto.

[0105] In the method for providing information for the diagnosis of the present invention, regarding the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific for cancer antigen, reporter protein, promoter, recombinant vector, strain, transformation, cancer, diagnosis, etc., since they are the same as those described in the DNA construct, recombinant vector, strain, pharmaceutical composition and diagnostic composition, they are omitted to avoid excessive complexity of this specification.

[0106] In still other embodiments of the present invention, it relates to a method for diagnosing, preventing or treating cancer, which includes the step of administering the strain according to the present invention to an individual in a pharmaceutically effective amount.

[0107] In the present invention, the "individual" refers to an individual in need of cancer prevention or treatment, and includes not only primates, such as humans, but also all mammals such as cows, horses, sheep, pigs, goats, camels, llamas, dogs, cats, etc., but is not limited thereto.

Advantages of the Invention

[0108] The DNA construct according to the present invention can simultaneously perform cancer treatment and diagnosis by making the expression levels of genes operably linked downstream of the first promoter and the second promoter balanced in a host strain or cell.

[0109] In addition, since the DNA construct of the present invention cannot express the anti-cancer protein and the reporter protein at all in the absence of doxycycline, by adjusting the presence or absence of doxycycline treatment, the anti-cancer protein can be expressed at a dose for appropriate cancer treatment, and at the same time, the size of cancer can be monitored in real time according to the expression level of the reporter protein.

Brief Description of the Drawings

[0110]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Modes for Carrying Out the Invention

[0111] In one embodiment of the present invention, a DNA construct is provided.

Examples

[0112] Hereinafter, the present invention will be described in more detail through examples. These examples are merely for explaining the present invention more specifically, and it will be apparent to those having ordinary knowledge in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.

[0113] Example [Preparation Example 1] Preparation of a DNA construct regulatable by Doxycycline [1-1] Preparation of a DNA construct containing the OXB1 promoter Using the pJL39 plasmid (Mol Ther., 21(11), p.1985-1995, (2013)) as the template strand (Figure 1), a forward primer (5’-CGGAATTCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG-3’; SEQ ID NO: 2) prepared to contain a restriction enzyme EcoRI site and a reverse primer (5’-GCTCTAGACAGCTGTTAAGACCCACTTTCACATTTAAGTTGTTTTTCT-3’; SEQ ID NO: 3) prepared to contain a restriction enzyme PvuII-XbaI site were used to amplify the tetR gene. Thereafter, restriction enzymes EcoRI and XbaI were added to the amplification product for cleavage, and after purification to obtain a tetR gene amplification product, this was introduced into the pBAD24 (Catalog No. ATCC ○ R 87399 TM , ATCC, USA) plasmid to prepare the pBAD-TetR plasmid during the introduction process.

[0114] Thereafter, a divergent promoter region containing a multiple cloning site was introduced into the pBAD-TetR plasmid by the PvuII and HindIII fragments of the pJL39 plasmid to prepare the pTetR-BAD plasmid. The araC and araBAD promoters were removed from the pTetR-BAD plasmid using NheI and Pcil restriction enzymes to prepare the pTetII plasmid.

[0115] Using pSF-OXB1 (Oxford Genetics, England) as a template, the constitutive promoter OXB1 (SEQ ID NO: 16), which was amplified with a forward primer (5’-CTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTGCT-3’; SEQ ID NO: 4) and a reverse primer (5’-TGAATTCCTCCTGCTAGCTAGTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3’; SEQ ID NO: 5), was introduced into the pTetII plasmid by the Gibson assembly method, finally generating the pJH18 plasmid containing OXB1, tetA, and the tetR promoter.

[0116] Using the pJH18 plasmid as a backbone, genes encoding tetR, Rluc8, and cytolysin A (ClyA) were introduced downstream of the promoter in the combinations shown in Table 1 below, generating the pJH18-RR, pJH18-AR, and pJH18-CR plasmids (Figure 2).

[0117]

Table 1

[0118] [1-2] Preparation of DNA constructs containing OXB11, 13, and 20 promoters In the same manner as in Preparation Example [1-1], using pSF-OXB11, pSF-OXB13, or pSF-OXB20 as a template, the constitutive promoters OXB11, OXB13, and OBX20 amplified with a forward primer (5’-TGCTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTG-3’: SEQ ID NO: 6) and a reverse primer (5’-AGCTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3’: SEQ ID NO: 7) were introduced into the pJH18 plasmid prepared in Preparation Example [1-1] by the Gibson assembly method (pTetOXB11-AR, pTetOXB11-RR, pTetOXB13-AR, pTetOXB13-RR, pTetOXB20-AR, pTetOXB20-RR). Here, the protein expression efficiency by the plasmid is high in the order of OXB11, OXB13, and OXB20, and in the case of OXB1, it shows the weakest protein expression efficiency.

[0119] [1-3] Preparation of DNA construct containing Tac promoter The constitutive promoter Tac was introduced into the pJH18 plasmid prepared in Preparation Example [1-1]. Specifically, after amplifying the Tac promoter sequence, which is a constitutive promoter, with a Tac forward primer (5’-CCCTATGCTACTCCGTCAAGCCGTCAATTGTTGACAATTAATCATCGGCTCGTATAATGTCTGATTCGTTACCAAGCT-3’: SEQ ID NO: 10) and a reverse primer (5’-AGCTTGGTAACGAATCAGACATTATACGAGCCGATGATTAATTGTCAACAATTGACGGCTTGACGGAGTAGCATAGGG-3’: SEQ ID NO: 11), the Tac promoter was introduced into the pJH18 plasmid by the Gibson assembly method to prepare the pTetTac-RR plasmid.

[0120] [1-4] Preparation of DNA construct containing J23101 promoter Similarly, the J23101, which is a constitutive promoter, was introduced into the pJH18 plasmid prepared in the Preparation Example [1-1]. Specifically, after amplifying the J23101 promoter sequence, which is composed of the J23101 forward primer (5’-TGCTACTCCGTCAAGCCGTCTTTACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3’: SEQ ID NO: 12) and the reverse primer (5’-GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTAAAGACGGCTTGACGGAGTAGCA-3’: SEQ ID NO: 13), the J23101 promoter was introduced into the pJH18 plasmid using the Gibson assembly method to prepare the pTetJ23101-RR plasmid.

[0121] [1-5] Preparation of DNA construct containing J23119 promoter Similarly, the J23119, which is a constitutive promoter, was introduced into the pJH18 plasmid prepared in the Preparation Example [1-1]. Specifically, after amplifying the J23119 promoter sequence, which is composed of the J23119 forward primer (5’-TGCTACTCCGTCAAGCCGTCTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3’: SEQ ID NO: 14) and the reverse primer (5’-GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAGACGGCTTGACGGAGTAGCA-3’: SEQ ID NO: 15), the J23119 promoter was introduced into the pJH18 plasmid using the Gibson assembly method to prepare the pTetJ23119-RR plasmid.

[0122] [Preparation Example 2] Cancer cell lines and culture conditions The CRL-2638 and HB-8064 (ATCC, USA) of the CT26 colon cancer cell line and the MC38 (Massachusetts General Hospital and Harvard Medical School, USA, and Jeonnam University, Korea) of the mouse colorectal adenocarcinoma cell line were used in the experiment.

[0123] The cells were cultured in a 5% CO2 incubator at 37 °C using high-glucose DMEM (Dulbecco’s Modified Eagles Medium) medium (catalog number: #LM001-05, Welgene, Korea) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.

[0124] [Preparation Example 3] Preparation of Salmonella Strain Introduced with Plasmid The Salmonella strain used was SHJ2037 (relA::cat, spoT::kan), which is Salmonella typhimurium (S. typhimurium) lacking ppGpp.

[0125] After transforming the Salmonella strain with the plasmid prepared in the above Preparation Example 1 using electroporation, each of the transformed strains was cultured overnight using LB medium containing 100 μg / ml of ampicillin. Then, the culture solution was diluted at a ratio of 1:100 using fresh LB medium containing ampicillin, and by additional culture, when the OD 600 value reached 0.5 - 0.7, doxycycline diluted with ethanol to a final concentration of 0, 10, 50, 100, 300, 500 ng / ml was added to the culture solution, and the culture was carried out in a shaking incubator at 200 rpm and 37 °C.

[0126] [Preparation Example 4] Preparation of Experimental Animal Model C57BL / 6 and BALB / c mice (Orient Company, Korea) at 5 to 6 weeks of age corresponding to a weight of 20 to 30 g were used. MC38 or CT26 of Preparation Example 2 was subcutaneously injected into the flanks of the mice to construct a tumor animal model.

[0127] For visualization of the tumor animal model and evaluation of tumor size, 2% isoflurane was used for anesthesia, and 200 mg / kg of ketamine and 10 mg / kg of xylazine were used during surgery.

[0128] The evaluation of the tumor size (mm 3 ) was calculated using (length × height × width) / 2, and when the tumor size of the animal model was 1500 mm 3 or more, the animal model was euthanized.

[0129] [Example 1] Prediction of the tetR promoter of the pTetII plasmid Using the pTetII plasmid prepared as an intermediate product in Preparation Example [1-1], the sequence of the promoter capable of regulating the expression of the tetR protein was predicted using BPROM (Bacterial sigma 70 promoter prediction program), and the results are shown in Figure 3.

[0130] As shown in Figure 3, based on the tetR protein of the pTetII plasmid, the nucleotide sequence of SEQ ID NO: 6 was predicted at the -35 site, and the nucleotide sequence of SEQ ID NO: 7 was predicted at the -10 site.

[0131] Through the above results, it can be seen that the pTetII plasmid according to the present invention can naturally express the tetR protein when SEQ ID NOs: 6 and 7 are located at the -35 and -10 sites, respectively, even when it does not contain another promoter such as OXB1.

[0132] [Example 2] Comparison of Protein Expression Levels and Luciferase Activity in Strains Transformed with pJH18-RR and pJH18-AR Plasmids [2-1] Comparison of Protein Expression Levels by Western Blot Analysis and Coomassie Blue Staining To confirm whether the expression levels between the genes introduced downstream of the tetA and tetR promoters were balanced in the plasmids prepared in Preparation Example [1-1], the Rluc8 protein expressed from the strains of Preparation Example 3 into which the plasmids prepared in Preparation Example [1-1] were introduced was stained with Coomassie Blue staining solution, or Western blot analysis was performed using an antibody specific to the protein.

[0133] Specifically, the culture solution of the strain of Preparation Example 3 was diluted with PBS to 4×10 7 CFU / ml, and centrifuged at 13,000 rpm for 5 minutes to collect the pellet. The pellet fraction was washed with PBS and mixed with SDS sample buffer containing 0.2% β-mercaptoethanol (catalog number: EBA-1052, ELPIS BIOTECH) to obtain a strain lysate. Then, the strain lysate was electrophoresed on 15% SDS-PAGE, and the gel was stained with Coomassie Blue staining solution, or the protein was transferred from the gel to a nitrocellulose membrane and blocked with 5% skim milk at room temperature. Thereafter, the expression level of the Rluc8 protein was confirmed using an Rluc8 antibody (catalog number: AB3256, Millipore, USA), and the results are shown in Figure 4.

[0134] As shown in Figure 4, the expression level of the RLuc8 protein from the tetA promoter was 2 to 6 times higher than the level of the protein expressed from the tetR promoter and was very sensitive to the concentration of the saturating inducer even at the lowest concentration of doxycycline (10 ng / ml).

[0135] [2-2] Comparison of Functional Expression Levels of Proteins by Analysis of Luciferase Activity For the measurement of luciferase activity in the strain of Preparation Example 3 into which the plasmids prepared in the above Preparation Example [1-1] were respectively introduced, the strain was resuspended in 1 ml of PBS. Then, after adding 1 μg / ml of coelenterazine diluted with ethanol as a substrate to the resuspended strain, the luciferase activity value was measured under the condition of 1-second exposure time using a NightOWL II LB 983 In Vivo imaging system (Berthold technologies, GmbH&Co.KG, Germany) or a Bio-Rad imager ChemoDocTM XRS+ system. The values thus measured were normalized by the CFU of each strain and calculated as relative luminescence units (RLU), which are values normalized using the values containing the control plasmid without Rluc8. The results are shown in FIGS. 5 and 6.

[0136] As shown in FIGS. 5 and 6, the luciferase activity value was confirmed only in the presence of doxycycline (FIG. 5), and it was confirmed that the activity level of the protein regulated by the tetA and tetR promoters was about 3 times higher for the tetA promoter than for the tetR promoter (FIG. 6).

[0137] From the above results, it can be seen that when the tetR protein, which is a regulatory protein that can suppress the tetA promoter and the tetR promoter, is continuously expressed by another promoter, the tetA promoter and the tetR promoter can be simultaneously induced only in the presence of an inhibitor of the tetR protein.

[0138] [2-3] Comparison of luciferase activity between pTetII plasmid and pJH18-CR plasmid After introducing the pTetII plasmid and the pJH18-CR plasmid prepared as intermediate products in the above Preparation Example [1-1] into the strain by the same method as in Preparation Example 3, the luciferase activity between the strains was measured by the same method as in Example [2-2], and the results are shown in FIGS. 7 and 8.

[0139] As shown in FIGS. 7 and 8, it was confirmed that the luciferase activity value not only increased in a doxycycline concentration-dependent manner when the OXB1 promoter was present (pJH18-CR), but also when the base sequences represented by SEQ ID NO: 8 and SEQ ID NO: 9 were located at the -35 site and the -10 site, respectively.

[0140] From the above results, in the case of the plasmid containing the DNA construct according to the present invention, since the base sequence inherent in the plasmid acts as a promoter and can induce the expression of the regulatory protein, it can be seen that the regulatory protein can be continuously expressed without artificially introducing another promoter upstream of the regulatory protein.

[0141] [2-4] Comparison of luciferase activities between DNA constructs containing OXB1 and OXB11 promoters After introducing the pTetOXB11 plasmid and the pJH18 plasmid prepared in the above Preparation Example [1-2] into the strain by the same method as in Preparation Example 3, the luciferase activity between the strains was measured by the same method as in Example [2-2], and the results are shown in FIGS. 9 and 10.

[0142] As shown in FIGS. 9 and 10, it was confirmed that the luciferase activity was higher when the OXB1 promoter, which is a weaker promoter, was present (pJH18) than when the OXB11 promoter was present (pTetOXB11).

[0143] From the above results, it can be seen that in the case of the plasmid containing the weak promoter, compared with the plasmid containing the intermediate promoter, by expressing the regulatory protein present downstream of the promoter at a low level, the expression level of the target protein is effectively increased so as to be sensitive to the concentration of doxycycline, and ultimately the expression levels of the genes present downstream of the tetA and tetR promoters are balanced.

[0144] [Example 3] Comparison of protein expression and activity levels in the strain into which the pJH18-CR plasmid was introduced [3-1] Comparison of protein expression and activity levels Using the same methods as the Western blot analysis, Coomassie Brilliant Blue staining, and luciferase activity analysis methods described in the above Examples [2-1] and [2-2], the pJH18-CR (P OXB1 ::tetR, P tetA ::ClyA and P tetR ::Rluc8) in the strain introduced by the method described in Preparation Example 3 was analyzed for protein expression level, and the results are shown in FIGS. 11 and 12.

[0145] As shown in FIGS. 11 and 12, when the strain into which pJH18-CR was introduced was treated with doxycycline, it was confirmed that the expression levels of the cytolysin A protein and the Rluc8 protein were expressed in a balanced manner almost equally.

[0146] [3-2] Confirmation of hemolytic activity The strain into which the pJH18-CR in the above Preparation Example [1-1] diluted with PBS was introduced by the method described in Preparation Example 3 was spread on a blood agar plate containing 0 or 20 ng / ml of doxycycline, cultured overnight at 37°C, and then a photo of the plate was taken, and the results are shown in FIG. 13.

[0147] As shown in Fig. 13, it was confirmed that the hemolytic activity of the strain on blood agar appears only when doxycycline is included (+), regardless of the type of promoter present upstream of the gene encoding cytolysin A.

[0148] Through the above results, it can be seen that the tetA and tetR promoters of the plasmid according to the present invention are induced to be active only by doxycycline, and thus the expression level of the protein can be effectively regulated simultaneously.

[0149] [Example 4] Comparison of protein expression levels in strains introduced with pJH87 and pJH18-CR plasmids By the same methods as the Western blot analysis, Coomassie Brilliant Blue staining, and luciferase activity analysis methods described in the above Examples [2-1] and [2-2], the pJH87 (P tetA ::ClyA and P tetR ::TetR::Rluc8) and pJH18-CR (P OXB1 ::tetR, P tetA ::ClyA and P tetR ::Rluc8) were introduced into the strains by the method described in Preparation Example 3, and when the concentration of doxycycline was administered at 20 ng / ml or more, the protein expression levels were analyzed in a state where the expression level of cytolysin A protein was induced to saturate, and the results are shown in Figs. 14 to 16.

[0150] As shown in Figs. 14 to 16, it was confirmed that the expression level of cytolysin A protein in the strain introduced with the pJH18-CR plasmid appears about 5 times higher than that in the strain introduced with the pJH87 plasmid. Furthermore, it was confirmed that the activity level of the Rluc8 protein is about 80 times higher in the strain introduced with the pJH18-CR plasmid than in the strain introduced with the pJH87 plasmid.

[0151] From the above results, compared with a plasmid constructed such that the gene encoding tetR is present downstream of the tetR promoter, when, as in the present invention, the gene encoding tetR can be regulated by another promoter, particularly a weak promoter, it can be seen that not only can the anticancer protein and the reporter gene be simultaneously expressed and activity-induced at high levels by the tetA and tetR promoters that can be activity-induced by one regulatory factor, but also the expression and activity ratio can be relatively balanced.

[0152] [Example 5] Tumor Suppression Ability and Imaging Analysis of Recombinant Strains in a Tumor Animal Model Induced with Cancer Using the method described in Preparation Example 3, a Salmonella strain into which pJH18-CR or pJH18 had been introduced was injected into the tail vein of the tumor animal model constructed in Preparation Example 4. Thereafter, imaging of the strain in the tumor animal model and analysis of the expression level of the cytolysin A protein were performed by the luciferase activity analysis method and Western blot analysis method described in Examples [2-1] and [2-2], and the results are shown in FIGS. 17 to 19.

[0153] Also, in the tumor animal model, the size of the tumor was measured for 0 to 34 days as in Preparation Example 4, and the survival rate of the tumor animal model was measured for 50 days, and the results are shown in FIGS. 20 and 21. Here, only PBS was injected into the tail vein of the tumor animal model as a control group.

[0154] As shown in FIGS. 17 to 18, it was confirmed that luciferase activity was measured only in the tumor tissue of the tumor animal model injected with the Salmonella strain into which pJH18-CR had been introduced, compared with the control group. Furthermore, it was also confirmed that luciferase activity was measured when the tumor tissue of the tumor animal model injected with the Salmonella strain into which pJH18-CR had been introduced was excised. Also, as shown in FIG. 19, in the case of the Salmonella strain into which pJH18-CR had been introduced, it was confirmed that cytolysin A protein was specifically expressed only when doxycycline was present (Dox+).

[0155] As shown in FIGS. 20 and 21, it was confirmed that in a tumor animal model in which cytolysin A protein was expressed from a Salmonella strain into which pJH18-CR was introduced, the tumor size was significantly reduced and the survival rate was increased as compared with the case where PBS and pJH18 were injected.

[0156] Through the above results, in the case of the Salmonella strain into which pJH18-CR according to the present invention was introduced, by activating a promoter that regulates the expression of a protein and an anticancer protein that can be visualized by one regulator, the position of the tumor can be accurately visualized in an individual with a tumor, and at the same time, it can be seen that the growth of the tumor can be suppressed and the survival rate of an individual with cancer can be significantly improved.

[0157] [Example 6] Comparison of luciferase activities between DNA constructs containing promoters After introducing the pTetTac-RR, pTetJ23101-RR, and pTetJ23119-RR plasmids prepared in the above Preparation Examples [1-3] to [1-5] into the strain in the same manner as in Preparation Example 3, the luciferase activities between the strains were measured in the same manner as in Example [2-2], and the results are shown in FIGS. 22 and 23.

[0158] As shown in FIGS. 22 and 23, it was confirmed that the sensitivity to doxycycline and the luciferase activity were higher in the case of the plasmid in which the OXB1 promoter was present (pJH18) than in the case of the plasmids in which the Tac, J23101, and J23119 promoters were present (pTetTac-RR, pTetJ23101-RR, pTetJ23119-RR).

[0159] Through the above results, in the case of the plasmid containing the weak promoter of the present invention, compared with the plasmid containing the published constitutive promoter, by expressing the regulatory protein present downstream of the promoter at a low level, the expression level of the target protein is effectively increased so as to be sensitive to the concentration of doxycycline, and ultimately the expression levels of the genes present downstream of the tetA and tetR promoters are balanced.

[0160] As described above in detail for specific parts of the present invention, such specific descriptions are merely preferred embodiments for those with ordinary knowledge in the art, and thus it is clear that the scope of the present invention is not limited. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Industrial Applicability

[0161] The present invention relates to a DNA construct for cancer diagnosis and treatment and a strain into which a recombinant vector containing the DNA construct has been introduced.

[0162] Sequence Listing Free Text SEQ ID NO: 1: Amino acid sequence of cytolysin A 10 20 30 40 50 MIMTGIFAEQ TVEVVKSAIE TADGALDLYN KYLDQVIPWK TFDETIKELS 60 70 80 90 100 RFKQEYSQEA SVLVGDIKVL LMDSQDKYFE ATQTVYEWCG VVTQLLSAYI 110 120 130 140 150 LLFDEYNEKK ASAQKDILIR ILDDGVKKLN EAQKSLLTSS QSFNNASGKL 160 170 180 190 200 LALDSQLTND FSEKSSYFQS QVDRIRKEAY AGAAAGIVAG PFGLIISYSI 210 220 230 240 250 AAGVIEGKLI PELNNRLKTV QNFFTSLSAT VKQANKDIDA AKLKLATEIA 260 270 280 290 300 AIGEIKTETE TTRFYVDYDD LMLSLLKGAA KKMINTCNEY QQRHGKKTLF EVPDV

[0163] Sequence number 2: Forward primer 5’-CGGAATTCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG-3’

[0164] Sequence number 3: Reverse primer 5’-GCTCTAGACAGCTGTTAAGACCCACTTTCACATTTAAGTTGTTTTTCT-3’

[0165] Sequence number 4: Forward primer 5’-CTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTGCT-3’

[0166] Sequence number 5: Reverse primer 5’-TGAATTCCTCCTGCTAGCTAGTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3’

[0167] Sequence number 6: Forward primer 5’-TGCTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTG-3’

[0168] Sequence number 7: Reverse primer 5’-AGCTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3’

[0169] Sequence number 8: -35 promoter TTCGCG

[0170] Sequence number 9: -10 promoter ATGCATAAT

[0171] Sequence number 10: Forward primer 5’-CCCTATGCTACTCCGTCAAGCCGTCAATTGTTGACAATTAATCATCGGCTCGTATAATGTCTGATTCGTTACCAAGCT-3’

[0172] Sequence number 11: Reverse primer 5’-AGCTTGGTAACGAATCAGACATTATACGAGCCGATGATTAATTGTCAACAATTGACGGCTTGACGGAGTAGCATAGGG-3’

[0173] Sequence number 12: Forward primer 5’-TGCTACTCCGTCAAGCCGTCTTTACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3’

[0174] Sequence number 13: Reverse primer 5’- GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTAAAGACGGCTTGACGGAGTAGCA-3’

[0175] Sequence number 14: Forward primer 5’- TGCTACTCCGTCAAGCCGTCTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3’

[0176] Sequence number 15: Reverse primer 5’- GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAGACGGCTTGACGGAGTAGCA-3’

[0177] SEQ ID NO: 16: OXB1 promoter 5’- AAGCTGTTGTGACCGCTTGCTCTAGCCAGCTATCGAGTTGTGAACCGATCCATCTAGCAATTGGTCTCGATCTAGCGATAGGCTTCGATCTAGCTATGTAGAAACGCCGTGTGCTCGATCGCCTGACGCTTTTTATCGCAACTCTCTACTGTTGCTTCAACAGAACATATTGACTATCCGGTATTACCCGGC-3’

Claims

1. A gene encoding a regulatory protein; and A DNA construct comprising a first promoter and a second promoter induced by the regulatory protein.

2. the first promoter is a tetA promoter; The DNA construct of claim 1 , wherein the second promoter is a tetR promoter.

3. The DNA construct of claim 1 , wherein the regulatory protein is a TetR protein.

4. 2. The DNA construct of claim 1, wherein the expression of the regulatory protein is regulated by a cis-acting element or a trans-acting element.

5. The DNA construct according to claim 4, wherein the cis-acting element is at least one selected from the group consisting of a ribosome binding site (RBS), a 5'-untranslated region (5'-UTR), a transcription factor binding site, and terminators.

6. The DNA construct of claim 5 , wherein the transcription factor binding site is at least one selected from the group consisting of a promoter of a gene encoding the regulatory protein; an enhancer; and a silencer.

7. The DNA construct of claim 6 , wherein the promoter of the gene encoding the regulatory protein is a weak promoter.

8. The weak promoter is a promoter that can express a transcript transcribed from a gene operably linked downstream of the promoter at an expression level of 1×10 －２ 8. The DNA construct of claim 7, which is:

9. The DNA construct according to claim 4, wherein the trans-acting factor is at least one selected from the group consisting of a transcription factor, an aptamer, a sRNA, and an antisense RNA (asRNA).

10. The DNA construct of claim 1, wherein any one selected from the group consisting of a gene encoding an anti-cancer protein; a gene encoding a cytokine; a gene encoding a chemokine; a gene encoding an immune modulator; an oligonucleotide specific to a cancer antigen; and a gene encoding a reporter protein is operably linked downstream of the first promoter and the second promoter.

11. The DNA construct according to claim 10, wherein the anti-cancer protein is at least one selected from the group consisting of a toxin protein, an antibody specific to a cancer antigen or a fragment of the antibody, a tumor suppressor protein, an angiogenesis inhibitor, a cancer antigen, prodrug-converting enzymes, and a pro-apoptotic protein.

12. The DNA construct according to claim 11, wherein the toxin protein is at least one selected from the group consisting of ricin, saporin, gelonin, momordin, devouganin, diphtheria toxin, pseudomonas toxin, hemolysin (HlyA), FAS ligand (FASL), tumor necrosis factor-α (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and cytolysin A (ClyA).

13. The DNA construct according to claim 11, wherein the tumor suppressor protein is at least one selected from the group consisting of RB (Retinoblastoma protein) protein, p53 protein, APC (Adenomatous polyposis coli) protein, PTEN (Phosphatase and tensin homologue) protein, and CDKN2A (cyclin dependent kinase inhibitor 2A) protein.

14. The DNA construct according to claim 11, wherein the angiogenesis inhibitor is at least one selected from the group consisting of angiostatin, endostatin, thrombospondin, and protease inhibitor protein.

15. The DNA construct according to claim 11, wherein the cancer antigen is at least one selected from the group consisting of alpha-fetoprotein (AFP), vascular endothelial growth factor receptor 2 (VEGFR2), survivin, legumain, and prostate cancer specific antigen (PCSA).

16. The prodrug converting enzymes include thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, herpes simplex virus type I thymidine kinase / ganciclovir, and purine nucleoside phosphorylase.

12. The DNA construct according to claim 11, which is at least one selected from the group consisting of HSV1-TK / GCV, HSV1-TK / GCV, and β-glucuronidase.

17. The DNA construct according to claim 11, wherein the whole cell killing protein is L-asnase or RNA-binding motif protein 5 (RBM5).

18. The DNA construct according to claim 10 , wherein the cancer antigen-specific oligonucleotide is a base sequence encoding at least one selected from the group consisting of an antisense oligonucleotide, an aptamer, an siRNA, and an shRNA.

19. The DNA construct according to claim 10, wherein the reporter protein is at least one selected from the group consisting of a fluorescent protein, luciferase, and a protein used in nuclear medicine or MRI imaging.

20. The fluorescent protein includes a green reporter protein (Green Fluorescent Protein; GFP), a modified green reporter protein (Modified Green Fluorescent Protein; MGFP), an enhanced green reporter protein (Enhanced Green Fluorescent Protein; EGFP), a red reporter protein (Red Fluorescent Protein; RFP), an enhanced red reporter protein (Enhanced Red Fluorescent Protein; ERFP), a blue reporter protein (Blue Fluorescent Protein; BFP), an enhanced blue reporter protein (Enhanced Blue Fluorescent Protein; EFFP), and a red reporter protein (Red Fluorescent Protein; RFP).

20. The DNA construct of claim 19, wherein the reporter protein is at least one selected from the group consisting of Yellow Reporter Protein (EBFP), Yellow Fluorescent Protein (YFP), and Enhanced Yellow Fluorescent Protein (EYFP).

21. 20. The DNA construct of claim 19, wherein the protein used in nuclear medicine or MRI imaging is at least one selected from the group consisting of herpes simplex virus thymidine kinase, dopamine receptor, somatostatin receptor, sodium-iodide transporter, iron receptor, transferrin receptor, ferritin, and iron transporter (magA).

22. A recombinant vector comprising the DNA construct according to any one of claims 1 to 21.

23. A strain into which the recombinant vector according to claim 22 has been introduced.

24. The bacterial strain according to claim 23, wherein the bacterial strain is at least one selected from the group consisting of Salmonella strains, Clostridium strains, Bifidobacterium strains and Escherichia coli strains.

25. A pharmaceutical composition for diagnosing, preventing or treating cancer, comprising the strain according to claim 23 as an active ingredient.

26. 26. The pharmaceutical composition of claim 25, wherein the cancer is at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain cancer, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and solitary myeloma.

27. A composition for diagnosing cancer, comprising the strain according to claim 23 as an active ingredient.

28. 24. A method for providing information for the diagnosis of cancer comprising the step of treating a biological sample isolated from an individual of interest with a bacterial strain according to claim 23.

29. The method for providing information for the diagnosis of cancer according to claim 28, further comprising a step of diagnosing the cancer when a reporter protein is expressed from the bacterial strain.

30. 24. A method for diagnosing, preventing or treating cancer comprising the step of administering to an individual a pharma- ceutically effective amount of the strain of claim 23.

31. The method for diagnosing, preventing or treating cancer according to claim 30, wherein the cancer is at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain cancer, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia and solitary myeloma.

Images