Method for modifying 5' untranslated region
By modifying the 5'UTR with a ribosome binding site downstream of the transcription start point, the method enhances gene expression and productivity of target substances in microorganisms, achieving up to 25% increased production.
Patent Information
- Application Number
- JP2023219831
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-26
- Publication Date
- 2025-07-08
AI Technical Summary
There is a need to improve the productivity of target substances produced by microorganisms through enhanced gene expression methods.
The method involves modifying the 5'UTR of a promoter by substituting or inserting a ribosome binding site (RBS) 10 to 100 nucleotides downstream from the transcription start point to promote gene expression, using genetic engineering techniques to construct a modified promoter and transformant.
This approach significantly enhances the productivity of target substances by improving gene expression levels, with the modified promoter increasing expression by at least 10% to 25% compared to unmodified promoters.
Smart Images

Figure 2025102402000002 
Figure 2025102402000003 
Figure 2025102402000004
Abstract
Description
Technical Field
[0001] The present invention relates to a method for modifying a 5'untranslated region, a DNA molecule containing the modified 5'untranslated region or a promoter containing the same, and a method for producing a target substance using the same.
Background Art
[0002] In the industrial production of substances by microorganisms, improvement of productivity is an important issue. Many studies have been conducted on the modification of expression control regions such as promoters for improving the expression of target genes.
[0003] Patent Document 1 describes that a modified promoter obtained from the catabolite responsive element (cre)-like sequence of the alkaline cellulase gene of Bacillus sp. KSM-S237 strain (FERM BP-7875) and KSM-64 strain (FERM BP-2886) can improve the expression of the target gene. Patent Document 2 describes that a modified promoter with a base insertion between positions 326 and 330 of the nucleotide sequence of the promoter region of the alkaline cellulase gene of KSM-64 strain can improve the expression of the target gene. Patent Documents 3 and 4 describe that the 5'untranslated region (5'UTR) sequence obtained from the Bacillus subtilis aprE gene is operably linked to a heterologous gene to improve the expression of the gene. Patent Document 5 describes that a modified mRNA processing / stabilizing sequence with a Shine-Dalgarno sequence added is linked downstream of the promoter region of the target gene and upstream of the ribosome binding site to improve the expression of the target gene. Patent Document 6 describes a method for increasing the production of the target substance by introducing a specific DNA sequence forming a stem-loop more than 7 nucleotides downstream of the transcription start site of the gene related to the synthesis of the target substance. Non-Patent Document 1 describes that the expression of sacB was controlled by introducing a Shine-Dalgarno-like sequence into the 5'UTR of the sacB repressor gene sacR in Bacillus subtilis, and the expression increased or decreased depending on the number and position of the introduction. Non-Patent Document 2 describes that the expression of the target gene was improved by introducing multiple sequences containing a ribosome binding site and a start codon into the 5'UTR region of the target gene in the genus Bacillus.
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Patent Document 2
[0005] [Non-Patent Document 1] Lett Appl Microbiol, 2005, 41(2):221-6 [Non-Patent Document 2] Nucleic Acids Research, 2022, 50(20):11979-11990 [Summary of the Invention] [Problems to be Solved by the Invention]
[0006] Improvement in productivity in the production of target substances by microorganisms is desired. The present invention relates to a method for modifying a 5'UTR that promotes gene expression, a modified 5'UTR produced by the method, a DNA molecule containing a promoter containing the same, and a method for producing a target substance using the DNA molecule. [Means for Solving the Problems]
[0007] The present inventors have found that the expression of a target gene is significantly promoted by substituting or inserting an additional ribosome binding site (RBS) at a specific position of the 5'UTR contained in the promoter of the target gene in a microorganism.
[0008] Therefore, in one embodiment, the present invention is a DNA molecule containing a modified promoter, the modified promoter has a ribosome binding site substituted or inserted, The ribosome binding site is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, DNA molecule, is provided. In another embodiment, the present invention provides a transformant containing the DNA molecule. In yet another embodiment, the present invention provides a method for producing a target substance, which includes culturing the transformant. In yet another embodiment, the present invention is a method for producing a modified promoter, the method includes modifying the 5’UTR contained in the parental promoter, the modification of the 5’UTR includes substituting or inserting a ribosome binding site into the 5’UTR, the ribosome binding site is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, the parental promoter is a promoter containing a 5’UTR into which a ribosome binding site has not been substituted or inserted, method, is provided.
Advantages of the Invention
[0009] According to the present invention, the productivity of a target substance by microorganisms can be significantly improved.
Brief Description of the Drawings
[0010]
Figure 1
Figure 2
Figure 3
Figure 4
Modes for Carrying Out the Invention
[0011] All patent documents, non-patent documents, and other publications cited in this specification are hereby incorporated by reference in their entirety.
[0012] In this specification, the identity of amino acid sequences and nucleotide sequences is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it is calculated by performing an analysis using the homology analysis (Search homology) program of the genetic information processing software Genetyx-Win (Ver. 5.1.1; Software Development) with Unit size to compare (ktup) set to 2.
[0013] In this specification, "at least 80% identity" with respect to an amino acid sequence or a nucleotide sequence means an identity of 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 98% or more, and still more preferably 99% or more.
[0014] In this specification, unless otherwise defined, "one or several" used with respect to deletions, substitutions, additions, or insertions of amino acid residues or nucleotides in an amino acid sequence or a nucleotide sequence preferably means 1 to 5, more preferably 1 to 4, still more preferably 1 to 3, and still more preferably 1 to 2. In this specification, "addition" of an amino acid residue or a nucleotide includes addition of an amino acid residue or a nucleotide to one end and both ends of the sequence.
[0015] As used herein, the "corresponding position" or "corresponding region" on an amino acid sequence or nucleotide sequence can be determined by aligning the target sequence and a reference sequence (for example, the amino acid sequence of SEQ ID NO: 3) so as to give the maximum homology. The alignment of amino acid sequences or nucleotide sequences can be performed using known algorithms, and the procedures are known to those skilled in the art. For example, the alignment can be performed by using the Clustal W multiple alignment program (Thompson, J.D. et al, 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Clustal W can be used, for example, on the website of the DNA Data Bank of Japan (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]) operated by the National Institute of Genetics. The position of the target sequence aligned with any position of the reference sequence by the above alignment is regarded as the "corresponding position" at that any position. Also, the region sandwiched by the corresponding positions, or the region consisting of the corresponding motifs, is regarded as the corresponding region.
[0016] As used herein, the "amino acid residue" means the 20 kinds of amino acid residues constituting proteins, alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).
[0017] In this specification, a "promoter" is a DNA sequence having a function of controlling the expression of a gene (a polynucleotide encoding a target substance). Generally, the "promoter" of a certain gene is present upstream of the open reading frame (ORF) of the gene and controls the expression of the ORF. A promoter may include regions such as a transcription start point and a 5'untranslated region (5'UTR), or can be defined as a region further including an enhancer, a cis element, etc. Enhancers and cis elements are located upstream of the transcription start point and improve the activity of the promoter by binding transcription factors, etc. The 5'UTR is the region from the transcription start point to before the start codon downstream, which is itself transcribed into mRNA but not translated and functions as a regulatory region when translating mRNA into protein. Therefore, activation of a promoter promotes transcription of a gene into mRNA and controls translation of the transcribed mRNA into protein.
[0018] The 5'UTR of Bacillus bacteria contains a ribosome binding site. In this specification, a "ribosome binding site" (RBS) is a site having a sequence complementary to the 3'-terminal portion of 16S rRNA when transcribed into mRNA. The ribosome binding site promotes the binding of mRNA and ribosome and translation of mRNA. The ribosome binding site of Bacillus bacteria contains the Shine-Dalgarno (SD) sequence represented by SEQ ID NO: 1.
[0019] In this specification, an "open reading frame (ORF)" refers to the region from the start codon to the stop codon. The ORF contains the coding region (CDS) of a gene.
[0020] In this specification, an "expression control region" (or simply "control region") refers to a DNA sequence having a function of controlling the transcription or translation of a gene, including a promoter, the 5'UTR constituting it, a transcription start point, a ribosome binding site and other sites and regions, an enhancer and a cis element that improve the transcriptional activity of the promoter, and a 3'untranslated region (3'UTR), etc.
[0021] In this specification, with respect to a gene or a regulatory region such as a promoter or 5'UTR, "upstream" and "downstream" refer to the 5'-side and 3'-side of the gene or region, respectively. Unless otherwise defined, the upstream and downstream of a gene are not limited to the upstream and downstream regions adjacent to the ORF of the gene. Also, unless otherwise defined, the upstream and downstream with respect to a promoter or 5'UTR are not limited to the upstream region adjacent to the 5'-end of the region and the downstream region adjacent to the 3'-end of the region, respectively.
[0022] In this specification, "operably linked" between a regulatory region and a gene means that the gene (ORF) and the regulatory region are linked such that the gene can be expressed under the control of the regulatory region. Also, in this specification, "operably linked" between each region (for example, a promoter and 5'UTR) contained in a regulatory region means that in the regulatory region, the respective regions are linked such that they enable the control of the expression of the downstream gene (ORF). Therefore, basically, the "gene" that is operably linked to a regulatory region in this specification refers to the ORF. The procedure for "operably linking" a gene and a regulatory region or each region in a regulatory region is well known to those skilled in the art.
[0023] As used herein, the "expression cassette" refers to a polynucleotide construct for controlling the expression of a target gene contained therein. Usually, an expression cassette contains a target gene to be expressed and a control region for controlling the expression of the gene. The control region preferably includes a promoter, which is located upstream of the ORF of the target gene and is operably linked thereto. For example, when the target gene encodes a polynucleotide encoding a preproprotein containing a signal peptide, the promoter is located upstream of the region encoding the signal peptide and is operably linked to the polynucleotide encoding the preproprotein to control the expression of the preproprotein. Further, the expression cassette may contain a 3'untranslated region (3'UTR) of the target gene. Preferably, the expression cassette has, at its ends, restriction enzyme recognition sites for enabling substitution or insertion of the expression cassette into a vector or genomic DNA. The expression cassette can be used for constructing an expression vector or introducing a foreign gene into genomic DNA. Preferably, the expression cassette of the present invention is a DNA construct.
[0024] As used herein, the term "native" when used with respect to a control region or the function, structure, or property of a cell is used to indicate that the function, structure, or property is originally present in the control region or cell. In contrast, the term "foreign" is used to indicate a function, structure, or property that is not originally present in the control region or cell but is introduced from the outside. For example, "native" and "foreign" RBSs in a control region mean an RBS originally present within the control region and an RBS introduced from the outside with respect to the control region, respectively. The "foreign" RBS may consist of the same nucleotide sequence as the "native" RBS present in the control region into which it is introduced, or may consist of a different nucleotide sequence.
[0025] As used herein, the term "Bacillus bacterium" refers to a bacterium belonging to the genus Bacillus of the family Bacillaceae. Examples of Bacillus bacteria include B. subtilis (Bacillus subtilis), B. cereus, B. thuringiensis, B. megaterium, B. amyloliquefaciens, B. pumilus, B. licheniformis, B. licheniformis, and mutants thereof.
[0026] Unless otherwise specified, the names of the genes or proteins described in this specification follow the registration information of the Protein Data Bank (PDB) ([www.rcsb.org / ]).
[0027] The present invention provides a method for modifying a 5'UTR that promotes gene expression, a modified 5'UTR produced by the method or a promoter containing the same, and their uses in the production of a target substance by a microorganism.
[0028] The modified 5'UTR provided by the present invention is constructed by substituting or inserting one or more foreign ribosome binding sites (RBSs) into the 5'UTR to be modified (hereinafter also referred to as "parent 5'UTR"). The total number of RBSs to be substituted or inserted is not particularly limited and may be 1, 2, or 3 or more.
[0029] Before substitution or insertion, the one or more RBSs may be, in part or in whole, of the same sequence or of different sequences, but all contain a nucleotide sequence consisting of the SD sequence GGAGG (SEQ ID NO: 1). Preferably, each of the one or more RBSs contains a nucleotide sequence consisting of AGGAGG (SEQ ID NO: 2). Preferred examples of the RBS include polynucleotides consisting of any of the nucleotide sequences of SEQ ID NOs: 1 to 7 below, and nucleotide sequences in which one or several nucleotides are deleted, substituted, added or inserted with respect to any of the nucleotide sequences of SEQ ID NOs: 3 to 7, provided that they are polynucleotides consisting of a nucleotide sequence containing GGAGG (SEQ ID NO: 1), preferably AGGAGG (SEQ ID NO: 2). SEQ ID NO: 1: GGAGG SEQ ID NO: 2: AGGAGG SEQ ID NO: 3: GAAAGGAGG SEQ ID NO: 4: AGGAGGGA SEQ ID NO: 5: GAAAGGAGGGA SEQ ID NO: 6: CGAAAGGAGGGAT SEQ ID NO: 7: CTTGAAAGGAGGGATGCCTAA
[0030] Among the one or more RBSs substituted or inserted into the 5’UTR, at least one is located 10 to 100 nucleotides downstream, preferably 10 to 60 nucleotides downstream, more preferably 13 to 55 nucleotides downstream from the transcription start point upstream of the 5’UTR. The substitution or insertion positions of the remaining RBSs are not particularly limited, but are preferably located 10 to 150 nucleotides downstream, more preferably 10 to 100 nucleotides downstream, still more preferably 10 to 60 nucleotides downstream, still more preferably 13 to 55 nucleotides downstream from the transcription start point. In this specification, "the RBS is located N nucleotides downstream from the transcription start point" means that the 5’ end of the RBS is located N nucleotides downstream from the 3’ end of the transcription start point.
[0031] Thus, in one embodiment, the modified 5’UTR constructed in the present invention has one RBS (also referred to herein as the “first additional RBS”) that is substituted or inserted so as to be located 10 to 100 nucleotides downstream from the transcription start point upstream thereof. The RBS contains the nucleotide sequence of SEQ ID NO: 1. Preferably, the RBS contains the nucleotide sequence of SEQ ID NO: 2. In one embodiment, the RBS contains the nucleotide sequence of any one of SEQ ID NOs: 1 to 7. Preferably, the RBS consists of the nucleotide sequence of any one of SEQ ID NOs: 1 to 7, or consists of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of any one of SEQ ID NOs: 3 to 7 (provided that the sequence of SEQ ID NO: 1 or 2 is included). Preferably, the RBS is located 10 to 60 nucleotides downstream, more preferably 13 to 55 nucleotides downstream, from the transcription start point upstream of the modified 5’UTR.
[0032] In another embodiment, the modified 5’UTR constructed in the present invention has one or more additional RBSs further substituted or inserted in addition to the aforementioned first additional RBS. Each of the one or more additional RBSs may consist of the same nucleotide sequence as the first additional RBS or a different nucleotide sequence as long as it contains the nucleotide sequence of SEQ ID NO: 1. Preferably, each of the one or more additional RBSs contains the nucleotide sequence of SEQ ID NO: 2. Also, each of the one or more additional RBSs may consist of the same nucleotide sequence or each may consist of a different nucleotide sequence. In one embodiment, each of the one or more additional RBSs independently contains the nucleotide sequence of any one of SEQ ID NOs: 1 to 7. Preferably, each of the one or more additional RBSs independently consists of the nucleotide sequence of any one of SEQ ID NOs: 1 to 7, or consists of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of any one of SEQ ID NOs: 3 to 7 (provided that the sequence of SEQ ID NO: 1 or 2 is included).
[0033] In one embodiment, each of the one or more other RBSs is located 10 to 150 nucleotides downstream, preferably 10 to 100 nucleotides downstream, more preferably 10 to 60 nucleotides downstream, and even more preferably 13 to 55 nucleotides downstream from the transcription start point upstream of the modified 5'UTR. In another embodiment, at least a part of the one or more other RBSs is located 10 to 100 nucleotides downstream from the transcription start point upstream of the modified 5'UTR, and the remainder is located 101 nucleotides or more downstream from the transcription start point upstream of the modified 5'UTR. In another embodiment, at least a part of the one or more other RBSs is located 10 to 60 nucleotides from the transcription start point upstream of the modified 5'UTR, and the remainder is located 61 nucleotides or more downstream from the transcription start point upstream of the modified 5'UTR. In another embodiment, at least a part of the one or more other RBSs is located 13 to 55 nucleotides from the transcription start point upstream of the modified 5'UTR, and the remainder is located 56 nucleotides or more downstream from the transcription start point upstream of the modified 5'UTR.
[0034] Preferably, the modified 5'UTR constructed in the present invention contains the original RBS contained in the parental 5'UTR. That is, preferably, the first additional RBS and the other RBSs are not replaced with the sequence of the original RBS and are not inserted into the sequence of the original RBS.
[0035] In one embodiment, the modified 5'UTR constructed in the present invention is a 5'UTR derived from a Bacillus promoter modified to replace or insert an RBS as described above. Preferably, the parental 5'UTR of the modified 5'UTR is the 5'UTR contained in the Bacillus promoter.
[0036] The promoter derived from the parental 5’UTR is preferably a highly functional promoter that exhibits high transcriptional promoting activity in Bacillus bacteria. Examples of such promoters include promoters of genes encoding secreted proteins of Bacillus bacteria, such as the endoglucanase gene of Bacillus sp. KSM-64, the endoglucanase gene of Bacillus sp. KSM-S237, aprE, nprE, and amyE of Bacillus subtilis, and amyL and amyQ of B. licheniformis; the promoter of the Bacillus subtilis spoVG gene; promoters of ribosomal RNA genes and ribosome-related genes, such as those selected from the group consisting of rrnO, rrnE, rrnI, rrnJ, rrnB, rpsD, rpsJ, and rpoD; the P43 promoter, SP82 promoter, or scr promoter of Bacillus bacteria, and the like.
[0037] Preferred examples of the promoter derived from the parental 5’UTR include promoters of cellulase genes of Bacillus bacteria, such as the promoter of the alkaline cellulase gene of Bacillus sp. KSM-64 and the promoter of the alkaline cellulase gene of Bacillus sp. KSM-S237 (FERM BP-7875). The promoter of the cellulase gene of KSM-64 consists of the nucleotide sequence of SEQ ID NO: 54. The promoter of the alkaline cellulase gene of KSM-S237 consists of the nucleotide sequence of SEQ ID NO: 55.
[0038] Another preferred example of the promoter derived from the parental 5’UTR is a promoter consisting of a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 54 or 55 and having promoter activity. Another preferred example of the promoter derived from the parental 5’UTR is a promoter consisting of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added, or inserted with respect to the nucleotide sequence of SEQ ID NO: 54 or 55.
[0039] The modified 5'UTR can be prepared according to genetic engineering techniques known in the art. For example, the parental 5'UTR or the promoter containing the same can be isolated from the genome of Bacillus bacteria (e.g., KSM-64, KSM-S237, etc.) according to known methods. Alternatively, a parental 5'UTR having a desired nucleotide sequence can be prepared by introducing mutations into the nucleotide sequence of the isolated parental 5'UTR or the promoter containing the same according to known methods. Methods for deletion, substitution, insertion, or addition of nucleotides to a nucleotide sequence are described, for example, in Dieffenbach et al. (Cold Spring Harbar Laboratory Press, New York, 581-621, 1995). Alternatively, the nucleotide sequence of the parental 5'UTR or the promoter containing the same can be chemically synthesized. For chemical synthesis of nucleotide sequences, commercially available DNA synthesis services, etc. can be used.
[0040] Substitution or insertion of the RBS into the parental 5'UTR can be carried out according to conventional methods in the art. For example, a fragment containing the parental 5'UTR and a fragment containing the RBS are amplified by PCR or the like, and the obtained fragments are ligated by SOE (splicing by overlap extension)-PCR (Gene, 1989, 77(1): p61-68) to construct a modified 5'UTR in which the RBS is substituted or inserted. Alternatively, using the vector containing the parental 5'UTR as a template, an inverse PCR using a primer containing the sequence of the RBS can be used to construct a modified 5'UTR in which the RBS is substituted or inserted.
[0041] The modified 5'UTR obtained in the present invention acts to improve the expression of the gene controlled by the promoter containing the same. Specifically, the modified 5'UTR is arranged downstream of the transcription start point in the promoter and upstream of the ORF of the gene, and is operably linked to the ORF of the gene.
[0042] In a preferred embodiment, in the present invention, a modified promoter containing the modified 5’UTR is produced. The modified promoter is a promoter in which the RBS is substituted or inserted. More specifically, the modified promoter is a promoter in which the RBS is substituted or inserted into its 5’UTR. In other words, the modified promoter is produced by modifying the 5’UTR contained in the parental promoter. The modification of the 5’UTR is performed by substituting or inserting the RBS into the 5’UTR. The method for substituting or inserting the RBS into the 5’UTR of the parental promoter is as described above.
[0043] The parental promoter to be subjected to the modification may be a promoter derived from the control region of any gene, but is preferably a promoter of a Bacillus bacterium gene. The parental promoter is preferably a high-function promoter that can exhibit high transcriptional promotion activity in Bacillus bacteria. Preferred examples of the parental promoter include genes encoding secreted proteins of Bacillus bacteria, such as the endoglucanase gene of Bacillus sp. KSM-64, the endoglucanase gene of Bacillus sp. KSM-S237, aprE, nprE, and amyE of Bacillus subtilis, and promoters of genes selected from the group consisting of amyL and amyQ of B. licheniformis; the promoter of the Bacillus subtilis spoVG gene; promoters of ribosomal RNA genes and ribosome-related genes, such as genes selected from the group consisting of rrnO, rrnE, rrnI, rrnJ, rrnB, rpsD, rpsJ, and rpoD; the P43 promoter, the SP82 promoter, the scr promoter, and the like. In a preferred embodiment, the parental promoter consists of the nucleotide sequence of SEQ ID NO: 54 or 55, or a nucleotide sequence having at least 80% identity with the sequence and having promoter activity.
[0044] The parental promoter may be present in the genome in the cell, may be an isolated polynucleotide fragment, or may be contained in a vector such as an expression vector. For example, a polynucleotide fragment of a parental promoter can be prepared from Bacillus bacteria, and a modified promoter fragment can be constructed by substituting or inserting an RBS into the 5'UTR contained in the fragment of the parental promoter. Alternatively, the 5'UTR contained in the parental promoter in the genome of Bacillus bacteria can be modified by homologous recombination or the like so that an RBS is substituted or inserted into the 5'UTR, thereby constructing a modified promoter in the genome. Alternatively, the promoter in the genome of Bacillus bacteria can be replaced with a modified promoter containing the modified 5'UTR by homologous recombination or the like, thereby constructing a modified promoter in the genome. Alternatively, a fragment of a modified 5'UTR with an RBS substituted or inserted can be prepared and ligated downstream of the transcription start point of the promoter, thereby constructing a modified promoter. Alternatively, the 5'UTR of the promoter in the genome of Bacillus bacteria can be replaced with the modified 5'UTR by homologous recombination or the like, thereby constructing a modified promoter in the genome.
[0045] The modified promoter containing the modified 5'UTR acts to improve gene expression. The modified promoter containing the modified 5'UTR can improve gene expression more than the parental promoter before modification containing the parental 5'UTR (where the RBS is not substituted or inserted). Preferably, the modified promoter increases the gene expression level by at least 10%, preferably at least 20%, more preferably at least 25% compared to the parental promoter.
[0046] The modified 5'UTR and the modified promoter containing the same can be used to improve the expression of a target gene. Accordingly, the present invention provides a polynucleotide containing the modified 5'UTR or a modified promoter containing the same, and their use for the expression of a target gene. Preferably, the polynucleotide is DNA.
[0047] In one embodiment, the polynucleotide comprising the modified 5'UTR or the modified promoter containing the same can be directly introduced into the genome of a host cell. For example, the polynucleotide comprising the modified 5'UTR or the modified promoter containing the same can be introduced into the genome of a host cell and operably linked to the target gene.
[0048] In one embodiment, the polynucleotide comprising the modified 5'UTR or the modified promoter containing the same is an expression cassette. The expression cassette may further contain a cis element that improves the transcriptional activity of the promoter, or a 3'UTR, etc., in addition to the modified 5'UTR or the modified promoter. Furthermore, the expression cassette may contain a selection marker gene such as a drug resistance gene or an auxotrophic marker gene.
[0049] In one embodiment, the polynucleotide comprising the modified 5'UTR or the modified promoter containing the same further contains a target gene (for example, a polynucleotide encoding a target substance or an enzyme involved in its synthesis). The target gene is operably linked to the modified 5'UTR or the modified promoter.
[0050] In one embodiment, the expression cassette is an expression vector. For example, the expression vector can be prepared by substituting or inserting the polynucleotide comprising the modified 5'UTR or the modified promoter containing the same into any vector by a conventional method. For example, the polynucleotide is constructed to have restriction enzyme recognition sequences at both ends thereof. The expression vector of the present invention can be constructed by incorporating this into an expression vector cleaved with a restriction enzyme (restriction enzyme method). Preferably, in the expression vector, the modified 5'UTR or the modified promoter containing the same is operably linked upstream of the polynucleotide of the target gene.
[0051] The type of the vector is not particularly limited and may be any vector such as a plasmid, phage, phagemid, cosmid, virus, YAC vector, shuttle vector, etc. The vector may be a vector for introduction into the genome of a host cell or a vector retained outside the genome. The vector is preferably a vector that can be amplified in bacteria, more preferably in Bacillus bacteria (e.g., Bacillus subtilis or its mutant strain). Preferably, the vector is an expression vector capable of inducing the expression of the introduced gene in Bacillus bacteria.
[0052] Examples of the vector include pUC-based vectors such as pBluescript II SK(-) (Stratagene), pUC18 / 19, pUC118 / 119 (Takara Bio), pET-based vectors (Takara Bio), pGEX-based vectors (GE Healthcare), pCold-based vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Plasmid, 1986, 15(2): 93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW-based vectors such as pMW118 / 119, pMW218 / 219 (Nippon Gene), pRI-based vectors such as pRI909 / 910 (Takara Bio), pBI-based vectors (Clontech), IN3-based vectors (Implantation Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (Gene, 1985, 36: 321-331), pAB4-1 (Mol Gen Genet, 1987, 206: 71-75), pLeu4 (Gene, 1989, 84: 335-343), pPyr225 (Mol Genet Genomics, 2002, 268: 397-406), pFG1 (Curr Genet, 1990, 18: 447-451), yeast expression vectors pNAN8142 (Biosci Biotechnol Biochem, 1996, 60: 383-389), pMA91 (Biosci Biotechnol Biochem, 1998, 62: 1615-1618), and the like.
[0053] The target gene linked to the modified 5'UTR or the modified promoter containing the same is not particularly limited. For example, the target gene is a polynucleotide encoding a target substance or an enzyme involved in its synthesis. The target gene may be a heterologous gene encoding a heterologous expression product, a gene derived from the same species introduced from the outside, a gene encoding an expression product originally possessed by the host cell, or a gene encoding any other protein, peptide, nucleic acid, etc. Examples of the target substance include enzymes, hormones, cytokines, other bioactive peptides, transporters, etc. Examples of enzymes include oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase or synthetase (synthetase), etc. Preferred examples include cellulase-based biomass degrading enzymes such as cellulase and hemicellulase, exoglucanase, endoglucanase, β-glucosidase, protease, lipase, mannanase, arabinase, galactase, amylase, etc.
[0054] The present invention also provides a transformant containing a polynucleotide containing the modified 5'UTR or the modified promoter containing the same. The transformant can be produced by introducing a polynucleotide containing the modified 5'UTR or the modified promoter containing the same into a host.
[0055] Examples of the host of the transformant include microbial cells, preferably bacteria of the genus Bacillus, bacteria of the genus Clostridium, yeast, Escherichia coli, etc. Among these, bacteria of the genus Bacillus are preferred, and Bacillus subtilis or its mutant strains are more preferred. Therefore, the transformant of the present invention is preferably a recombinant bacterium of the genus Bacillus, and more preferably a recombinant of Bacillus subtilis or its mutant strain.
[0056] For the introduction of the polynucleotide containing the modified 5'UTR or the modified promoter containing the same into a host cell, well-known transformation techniques such as the calcium phosphate method, electroporation method, lipofection method, particle gun method, PEG method, etc. can be applied. For example, as methods applicable to Bacillus subtilis or its mutant strains, there are the competent cell transformation method (J Bacteriol, 1967, 93: 1925 - 1937), electroporation method (FEMS Microbiol Lett, 1990, 55: 135 - 138), protoplast transformation method (Mol Gen Genet, 1979, 168: 111 - 115), Tris-PEG method (J Bacteriol, 1983, 156: 1130 - 1134), etc.
[0057] The transformant can be used for the expression of the target gene. In the cells of the transformant, the modified 5'UTR or the modified promoter containing the same highly expresses the target gene operably linked thereto. If the target gene is a polynucleotide encoding a target substance or an enzyme involved in its synthesis, the productivity of the target substance by the transformant is improved.
[0058] Therefore, the present invention also provides a method for producing a target substance including culturing the transformant. The culturing of the transformant can be carried out according to general methods in the art. For example, when the transformant is Bacillus subtilis or its mutant strain, the medium for its culture may contain a carbon source necessary for the growth of Bacillus subtilis, and an inorganic nitrogen source or an organic nitrogen source. If necessary, the medium may contain other nutrients such as inorganic salts, vitamins, antibiotics, etc. Culture conditions such as temperature, aeration and agitation conditions, pH of the medium, and culture time, etc. can be appropriately selected according to the type and characteristics of the microorganism, culture scale, etc.
[0059] After culturing, the target substance can be recovered from the culture. If necessary, the recovered target substance may be further purified. The method for recovering or purifying the target substance from the culture is not particularly limited, and it may be carried out according to known recovery or purification methods. For example, the culture is recovered, and if necessary, cell disruption treatment is performed by ultrasonic waves, pressurization, etc., and then the cell components are removed by methods such as the inclination method, filtration, centrifugation, etc., and then the fraction containing the remaining target substance may be recovered. Alternatively, by operably linking a polynucleotide encoding a secretion signal peptide that functions in the transformant to the gene encoding the target substance, the target substance can be secreted and produced extracellularly. In this case, the fraction containing the target substance can be recovered without disrupting the cells.
[0060] If necessary, the fraction containing the recovered target substance can be subjected to methods such as dialysis, salting out, ion exchange method, distillation, solvent extraction, etc., or a combination thereof, to purify the target substance. In the method for producing the target substance according to the present invention, the culturing of the transformant and the recovery of the target substance may be carried out by any of batch, semi-batch, and continuous methods.
[0061] As exemplary embodiments of the present invention, the following substances, production methods, uses, methods, etc. are further disclosed in this specification. However, the present invention is not limited to these embodiments.
[0062] [1] A DNA molecule containing a modified promoter, wherein the modified promoter has a ribosome binding site substituted or inserted, and the ribosome binding site is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, DNA molecule. [2] Preferably, the ribosome binding site contains the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, More preferably, the ribosome binding site consists of the following nucleotide sequence: The nucleotide sequence of any one of SEQ ID NOs: 1 to 7; or, A nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of any one of SEQ ID NOs: 3 to 7, provided that it contains the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The DNA molecule according to [1]. Preferably, the modified promoter is a promoter derived from a Bacillus cellulase gene in which the ribosome binding site is substituted or inserted into the 5'UTR, the DNA molecule according to [1] or [2]. Preferably, the promoter derived from the Bacillus cellulase gene before the ribosome binding site is substituted or inserted consists of the nucleotide sequence of SEQ ID NO: 54 or 55 or a nucleotide sequence having at least 80% identity with the sequence, the DNA molecule according to [3]. Preferably, the modified promoter has one or more other ribosome binding sites further substituted or inserted into the 5'UTR, the DNA molecule according to any one of [1] to [4]. Preferably, each of the one or more other ribosome binding sites contains the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2. More preferably, each of the one or more other ribosome binding sites independently consists of the following nucleotide sequence: The nucleotide sequence of any one of SEQ ID NOs: 1 to 7; or A nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of any one of SEQ ID NOs: 3 to 7, provided that it contains the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The DNA molecule according to [5]. Preferably, the one or more other ribosome binding sites are located 10 to 150 nucleotides downstream from the transcription start point of the modified promoter, the DNA molecule according to [5] or [6]. Preferably, the modified promoter contains the original ribosome binding site, the DNA molecule according to any one of [1] to [7]. Preferably, it further contains a polynucleotide encoding a target substance or an enzyme involved in its synthesis, the DNA molecule according to any one of [1] to [8]. The DNA molecule according to [9], preferably an expression cassette or an expression vector. 〔11〕A transformant containing the DNA molecule according to any one of 〔1〕~〔10〕. 〔12〕The transformant according to 〔11〕, preferably a bacterium belonging to the genus Bacillus. 〔13〕A method for producing a target substance, comprising culturing the transformant according to 〔11〕 or 〔12〕. 〔14〕A method for producing a modified promoter, the method comprising modifying the 5'UTR contained in the parental promoter, the modification of the 5'UTR comprising substituting or inserting a ribosome binding site into the 5'UTR, the ribosome binding site being located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, the parental promoter being a promoter containing a 5'UTR into which no ribosome binding site has been substituted or inserted. Method. 〔15〕Preferably, the ribosome binding site contains the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more preferably, the ribosome binding site consists of the following nucleotide sequence: the nucleotide sequence of any one of SEQ ID NOs: 1 to 7; or, a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of any one of SEQ ID NOs: 3 to 7, provided that the nucleotide sequence contains the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The method according to 〔14〕. 〔16〕Preferably, the parental promoter is a promoter derived from a Bacillus cellulase gene, the method according to 〔14〕 or 〔15〕. 〔17〕Preferably, the promoter derived from the Bacillus cellulase gene consists of the nucleotide sequence of SEQ ID NO: 54 or 55 or a nucleotide sequence having at least 80% identity with the sequence, the method according to 〔16〕. 〔18〕Preferably, the method according to any one of 〔14〕 to 〔17〕 further comprises substituting or inserting one or more additional ribosome binding sites into the 5’UTR. 〔19〕Preferably, each of the one or more additional ribosome binding sites comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2. More preferably, each of the one or more additional ribosome binding sites independently consists of the following nucleotide sequence: The nucleotide sequence of any one of SEQ ID NOs: 1 to 7; or A nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of any one of SEQ ID NOs: 3 to 7, provided that the nucleotide sequence contains the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The method according to 〔18〕. 〔20〕Preferably, the method according to 〔18〕 or 〔19〕, wherein the one or more additional ribosome binding sites are substituted or inserted 10 to 150 nucleotides downstream from the transcription start point of the modified promoter. 〔21〕Preferably, the method according to any one of 〔14〕 to 〔20〕, wherein the modified promoter contains the original ribosome binding site. 〔22〕Preferably, the method according to any one of 〔14〕 to 〔21〕, wherein the modified promoter improves the gene expression level by at least 10% compared to the parental promoter.
Example
[0063] Hereinafter, the present invention will be described more specifically with reference to examples.
[0064] Example 1 Construction of a plasmid for introducing a protease expression cassette containing a modified 5’UTR 1) Construction of a plasmid for introducing a protease expression cassette A plasmid for introducing a protease expression cassette into the amyE locus in the B. subtilis genome by homologous recombination was constructed as follows. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 8) and the reverse primer (SEQ ID NO: 9) with the pMW119 plasmid as the template. Next, the insert fragment was amplified by PCR using the forward primer (SEQ ID NO: 10) and the reverse primer (SEQ ID NO: 11) with the ORF sequence of the amyE gene and the B. subtilis 168 strain genome as the template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-amy plasmid. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 12) and the reverse primer (SEQ ID NO: 13) with the pMW-amy plasmid as the template. Next, the insert fragment containing the ORF sequence of the spectinomycin resistance gene was amplified by PCR using the forward primer (SEQ ID NO: 14) and the reverse primer (SEQ ID NO: 15) with the kao119 strain genome (Patent No. 6088282) as the template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-amy-sp plasmid. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 12) and the reverse primer (SEQ ID NO: 16) with the pMW-amy-sp plasmid as the template. Next, the insert fragment was amplified by PCR using the forward primer (SEQ ID NO: 17) and the reverse primer (SEQ ID NO: 18) with pHA-64TSA (Japanese Patent Application Laid-Open No. 2010-273672) as the template. This insert fragment contained the promoter (P SP64 ) of the alkaline cellulase gene of Bacillus sp. KSM-64 and the ORF of the gene encoding the alkaline protease (KP43 protease) derived from Bacillus sp. KSM-KP43 (FERM BP-6532). The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-TS43 plasmid.
[0065] 2) Insertion of RBS into 5'UTR The 5' UTR in the promoter (P SP64 ) contained in the pMW-TS43 plasmid was modified by inserting an RBS. Inverse PCR was performed using the forward primer (SEQ ID NO: 19) and the reverse primer (SEQ ID NO: 20) with the pMW-TS43 plasmid as a template. The obtained PCR product was transformed into Escherichia coli to obtain the pMW-TS43-5'RBS-a plasmid. Inverse PCR was performed using the forward primer (SEQ ID NO: 21) and the reverse primer (SEQ ID NO: 22) with the pMW-TS43 plasmid as a template. The obtained PCR product was transformed into Escherichia coli to obtain the pMW-TS43-5'RBS-b plasmid. Inverse PCR was performed using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 24) with the pMW-TS43 plasmid as a template. The obtained PCR product was transformed into Escherichia coli to obtain the pMW-TS43-5'RBS-c plasmid. Inverse PCR was performed using the forward primer (SEQ ID NO: 25) and the reverse primer (SEQ ID NO: 26) with the pMW-TS43 plasmid as a template. The obtained PCR product was transformed into Escherichia coli to obtain the pMW-TS43-5'RBS-d plasmid. Inverse PCR was performed using the forward primer (SEQ ID NO: 27) and the reverse primer (SEQ ID NO: 28) with the pMW-TS43-5'RBS-d plasmid as a template. The obtained PCR product was transformed into Escherichia coli to obtain the pMW-TS43-5'RBS-d×2 plasmid.
[0066] pMW-TS43-5'RBS-a, b, c, d each contain P SP64The following RBS sequences are inserted at the +31 position (within the 5' UTR) from the transcription start point of : pMW-TS43-5’RBS-a: GGAGG (SEQ ID NO: 1), pMW-TS43-5’RBS-b: GAAAGGAGG (SEQ ID NO: 3), pMW-TS43-5’RBS-c: AGGAGGGA (SEQ ID NO: 4), pMW-TS43-5’RBS-d: GAAAGGAGGGA (SEQ ID NO: 5). In pMW-TS43-5’RBS-d×2, the sequence of SEQ ID NO: 5 is inserted at the +31 position and the +138 position (both within the 5' UTR) from the transcription start point of SP64
[0067] Hereinafter, the modified promoters contained in pMW-TS43-5’RBS-a, b, c, and d are referred to as P SP64 -5’RBS-a, b, c, and d, respectively, and the modified promoter contained in pMW-TS43-5’RBS-d×2 is referred to as P SP64 -5’RBS-d×2. Also, these parental promoters (including the unmodified 5’ UTR) are referred to as P SP64 The structures of these promoters are shown in Figure 1.
[0068] 3) Insertion of RBS at different positions in the 5’UTR Inverse PCR was performed using the pMW-TS43 plasmid as a template, and the obtained PCR product was transformed into Escherichia coli to construct plasmids in which the RBS sequence: AGGAGG (SEQ ID NO: 2) was inserted at different positions in the 5’UTR of SP64 (at the +7, +13, +31, +55, +79, +103, or +127 position from the transcription start point of SP64 ). The primers used for insertion at each position are as follows: (+7) SEQ ID NOS: 29 and 30, (+13) SEQ ID NOS: 31 and 32, (+31) SEQ ID NOS: 33 and 34, (+55) SEQ ID NOS: 35 and 36, (+79) SEQ ID NOS: 37 and 38, (+103) SEQ ID NOS: 39 and 40, (+127) SEQ ID NOS: 41 and 42. The modified promoters contained in the constructed plasmids are, for each RBS insertion position, respectively, P SP64 - It is called 5’RBS(+7), (+13), (+31), (+55), (+79), (+103) and (+127).
[0069] Example 2 Preparation of Recombinant Bacillus Strains Containing Modified 5’UTR 1) Construction of prsA Overexpression Strain An overexpression cassette of the prsA gene (SEQ ID NO: 43) was introduced into the sigF gene deletion strain (ΔsigF strain: Patent No. 4336082) of B. subtilis 168 to prepare a prsA overexpression strain. The DNA fragment for introducing the prsA overexpression cassette was constructed by the following method. First, the following PCR fragments 1 to 3 were constructed: PCR fragment 1: Forward primer; SEQ ID NO: 44, Reverse primer; SEQ ID NO: 45, Template DNA; prsA-Ka strain genomic DNA (Patent No. 4839144); PCR fragment 2: Forward primer; SEQ ID NO: 46, Reverse primer; SEQ ID NO: 47), Template DNA: MazF cassette (Genet. Syst., 84(4):315 - 318, 2009); PCR fragment 3: Forward primer; SEQ ID NO: 48, Reverse primer; SEQ ID NO: 49), Template DNA: 168 strain genomic DNA. The PCR fragments 1 to 3 were ligated by SOE-PCR (Forward primer; SEQ ID NO: 50, Reverse primer; SEQ ID NO: 51) to construct a DNA fragment for introducing the prsA overexpression cassette. The constructed DNA fragment for introducing the prsA overexpression cassette was introduced into the ΔsigF strain, and the prsA overexpression cassette was introduced into the nprE locus of the ΔsigF strain. Gene introduction was performed by homologous recombination according to the marker-free deletion method developed by Morimoto et al. (Genet. Syst., 84(4):315 - 318, 2009) (Figure 2). The obtained prsA overexpression ΔsigF strain (ΔsigF-prsA strain) was used as the parental strain for the preparation of the following recombinant Bacillus strains.
[0070] 2) Introduction of the Expression Cassette into the Bacillus subtilis Genome Using the plasmid for introducing the protease expression cassette constructed in Example 1 as a template, a genomic introduction PCR fragment was obtained by PCR using a forward primer (SEQ ID NO: 52) and a reverse primer (SEQ ID NO: 53). This PCR fragment was introduced into the ΔsigF - prsA strain prepared in 1) above by the competent cell method (see Patent No. 6088282), and was introduced by homologous recombination into the amyE gene locus on the genome.
[0071] Example 3 Protease productivity of recombinant Bacillus spp. 1) Cultivation of recombinant Bacillus spp. The recombinant Bacillus spp. into which the protease expression cassette obtained in Example 2 was introduced was shake - cultured overnight at 30°C and 180 rpm in 2 mL of LB medium in a 10 - mL round - bottomed Spitz tube. 500 μL of the obtained culture solution was aliquoted and inoculated into 20 mL of 2×L - maltose medium (2% peptone, 1% yeast extract, 1% NaCl, 7.5% maltose, 7.5 ppm manganese(II) sulfate pentahydrate, antifoaming agent; % is v / w%). This was cultured at 32°C and 210 rpm for 72 hours.
[0072] 2) Evaluation of protease productivity The protease productivity of the recombinant Bacillus spp. was evaluated. The production amount of protease was determined as the protease activity value. After the completion of the culture in 1) above, the protease activity of the culture supernatant from which the cells were removed was measured by the following procedure. 0.9 mL of 1 / 15 M phosphate buffer (pH 7.4) and 0.05 mL of a 40 mM Glt - Ala - Ala - Pro - Leu - p - nitroanilide / dimethyl sulfoxide solution were placed in a test tube and incubated at 30°C for 5 minutes. 0.05 mL of the culture supernatant was added thereto, and after reacting at 30°C for 10 minutes, 2.0 mL of a 5% (w / v) aqueous citric acid solution was added to stop the reaction, and the absorbance at 420 nm was measured using a spectrophotometer and used as the protease activity value. The protease activity value (a.u.) of the recombinant Bacillus spp. into which the expression cassette containing the modified promoter was introduced was shown as a relative value with the activity of the recombinant Bacillus spp. into which the expression cassette containing the parental promoter was introduced set as 1.
[0073] The modified promoter (P) into which various RBS sequences were inserted, constructed in 2) of Example 1 SP64 The protease activities of the recombinant cells into which the modified expression cassettes containing -5’RBS-a, b, c, d, and d×2) were introduced are shown in Table 1 and FIG. 3. All of the modified expression cassettes improved protease productivity as compared with the cells into which the expression cassette containing the parental promoter (P SP64 ) was introduced.
[0074] The protease activities of the recombinant cells into which the modified promoters (P SP64 -5’RBS(+7), (+13), (+31), (+55), (+79), (+103), and (+127)) constructed in 3) of Example 1 were introduced are shown in Table 1 and FIG. 4. The RBS insertion positions affected the protease productivity of the recombinant cells.
[0075]
Table 1
Claims
1. A DNA molecule comprising a modified promoter, wherein the modified promoter has a ribosome binding site substituted or inserted therein, the ribosome binding site is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, DNA molecule.
2. The DNA molecule according to claim 1, wherein the ribosome binding site comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO:
2.
3. The DNA molecule according to claim 1 or 2, wherein the modified promoter is a promoter derived from a Bacillus cellulase gene in which the ribosome binding site is substituted or inserted into the 5'UTR.
4. The DNA molecule according to claim 3, wherein the promoter derived from the Bacillus cellulase gene before the ribosome binding site is substituted or inserted comprises the nucleotide sequence of SEQ ID NO: 54 or SEQ ID NO: 55 or a nucleotide sequence having at least 80% identity with the sequence.
5. The DNA molecule according to any one of claims 1 to 4, wherein one or more additional ribosome binding sites are further substituted or inserted into the 5'UTR of the modified promoter.
6. The DNA molecule according to claim 5, wherein each of the one or more additional ribosome binding sites comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO:
2.
7. The DNA molecule according to claim 5 or 6, wherein the one or more additional ribosome binding sites are located 10 to 150 nucleotides downstream from the transcription start point of the modified promoter.
8. The DNA molecule according to any one of claims 1 to 7, wherein the modified promoter contains the original ribosome binding site.
9. The DNA molecule according to any one of claims 1 to 8, further comprising a polynucleotide encoding a target substance or an enzyme involved in its synthesis.
10. The DNA molecule according to claim 9, which is an expression cassette or an expression vector.
11. A transformant containing the DNA molecule according to any one of claims 1 to 10.
12. The transformant according to claim 11, which is a Bacillus bacterium.
13. A method for producing a target substance, comprising culturing the transformant according to claim 11 or 12.
14. A method for producing a modified promoter, wherein the method comprises modifying the 5'UTR contained in the parental promoter, the modification of the 5'UTR comprises substituting or inserting a ribosome binding site into the 5'UTR, The ribosome binding site is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, The parental promoter is a promoter that includes a 5'UTR in which the ribosome binding site has not been replaced or inserted. Method.
15. The method according to claim 14, wherein the ribosome binding site comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO:
2.
16. The method according to claim 14 or 15, wherein the parental promoter is a promoter derived from a Bacillus cellulase gene.
17. The method according to claim 16, wherein the promoter derived from the Bacillus cellulase gene consists of the nucleotide sequence of SEQ ID NO: 54 or 55 or a nucleotide sequence having at least 80% identity with the sequence.
18. Furthermore, the method according to any one of claims 14 to 17, comprising replacing or inserting one or more other ribosome binding sites into the 5'UTR.
19. The method according to claim 18, wherein each of the one or more other ribosome binding sites comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO:
2.
20. The method according to claim 18 or 19, wherein the one or more other ribosome binding sites are replaced or inserted 10 to 150 nucleotides downstream from the transcription start point of the modified promoter.
21. The method according to any one of claims 14 to 20, wherein the modified promoter includes the original ribosome binding site.
22. The method according to any one of claims 14 to 21, wherein the modified promoter improves the gene expression level by at least 10% compared to the parental promoter.
Citation Information
Patent Citations
Dna fragment
JP2000078981A
mrna stabilization methods
JP2009518019A
Modified promoter
JP2011103875A
Increased protein expression
JP2018505686A
Modified 5'-untranslated region (UTR) sequences for increased protein production in Bacillus
JP2020534821A