Nucleic acid medicine targeting gastric cancer molecule

Abstract

To provide a nucleic acid medicine using an antisense nucleic acid to inhibit the expression of SYT13, thereby exhibiting better efficacy relative to siRNA targeting peritoneal dissemination of gastric cancer.SOLUTION: The present invention provides an antisense oligonucleotide which consists of a base sequence substantially complementary to the base sequence of a specific region in human SYT13 mRNA and which can inhibit the expression of human SYT13 mRNA; and a pharmaceutical composition comprising the antisense oligonucleotide.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a molecular target nucleic acid medicine targeting gastric cancer, particularly peritoneal dissemination of gastric cancer. More specifically, the present invention relates to an antisense nucleic acid against SYT13 and a pharmaceutical composition containing the same.

Background Art

[0002] Gastric cancer is a common cancer in Asia such as Japan, China, and Korea, and in South America. With the popularization of cancer screening, early detection and treatment have become possible, and the mortality rate due to gastric cancer has decreased. However, advanced gastric cancer still has a poor prognosis and is an important disease to be overcome.

[0003] As one of the recurrence and metastasis patterns of gastric cancer, peritoneal dissemination metastasis is known. Peritoneal dissemination is most frequently seen in cases that are stage IV at the time of diagnosis and is also the most common form of recurrence after resection. Furthermore, peritoneal dissemination is a major problem because the effects of treatment by resection, radiotherapy, and systemic administration of anticancer drugs are also low.

[0004] The group of the present inventors previously found that SYT13 is specifically highly expressed in gastric cancer with peritoneal dissemination metastasis, that peritoneal dissemination after gastrectomy can be predicted using its expression as an index, and that siRNA against SYT13 can suppress the proliferation ability, invasion ability, and migration ability of gastric cancer cell lines and can suppress metastasis due to peritoneal dissemination after gastrectomy (Patent Document 1 and Non-Patent Document 1).

[0005] SYT13 is a membrane protein belonging to the synaptotagmin (SYT) family. SYT family proteins have been identified as calcium-phospholipid binding molecules present on synaptic vesicles and are suggested to function as calcium sensors. In humans, the existence of 17 isoforms has been reported, and it has been reported that they are mainly distributed in brain tissues. Among these, SYT13 has been reported to bind to phospholipids regardless of the presence or absence of calcium and to be expressed in various tissues other than the brain (Non-Patent Document 2).

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

Non-Patent Documents

[0007]

Non-Patent Document 1

Non-Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0008] As described above, although it has been confirmed that by using siRNA against SYT13, the expression of SYT13 can be suppressed and metastasis by peritoneal seeding can be inhibited, the sequence information of the actually used siRNA is unknown, and sufficient examination has not been made on the suppression of SYT13 expression.

[0009] Therefore, the present inventors have now made it an object to provide a more effective nucleic acid drug targeting gastric cancer peritoneal seeding by suppressing the expression of SYT13 using an antisense nucleic acid, which is a nucleic acid drug different from siRNA.

Means for Solving the Problems

[0010] In view of the above problems, the present inventors first focused on the nucleotide sequence of human SYT13 mRNA and conducted repeated studies to obtain an antisense nucleic acid that has efficacy as a medicine and has no potential side effects. As a result, they found that a particularly highly effective one can be obtained by targeting a specific region in the nucleotide sequence of SYT13 mRNA, and thus completed the present invention.

[0011] That is, the present invention provides the following. 1. An antisense oligonucleotide capable of suppressing the expression of human SYT13 mRNA, which consists of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 348 - 366, 599 - 627, 997 - 1016, 1069 - 1088, 1419 - 1437, 1612 - 1641, 1775 - 1793, 2629 - 2647, 2810 - 2831, 3244 - 3262, 3315 - 3333, 3423 - 3442, 4266 - 4284, 4328 - 4346, or 4365 - 4400, 4714 - 4751, 4776 - 4795, 4949 - 4968 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide is substituted, deleted, or inserted with respect to the antisense oligonucleotide. 2. An antisense oligonucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3 - 43, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted, or inserted with respect to the antisense oligonucleotide. 3. An antisense oligonucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 50 - 59, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted, or inserted with respect to the antisense oligonucleotide. 4. An antisense oligonucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 60 - 69, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted, or inserted with respect to the antisense oligonucleotide. 5. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 70 to 79, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. 6. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 4, 20, 29, 35, 39, 62, and 79, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. 7. The antisense oligonucleotide according to any one of 1 to 6 above, having an artificial nucleic acid region containing a bicyclic sugar. 8. The antisense oligonucleotide according to any one of 1 to 7 above, wherein at least one internucleoside bond is a phosphorothioate bond. 9. The antisense oligonucleotide according to any one of 1 to 8 above, having an artificial nucleic acid region containing 5-methylcytosine. 10. The antisense oligonucleotide according to any one of 1 to 9 above, having a length of 15 to 19 nucleotides. 11. The antisense oligonucleotide according to any one of 1 to 10 above, which is a gapmer. 12. A conjugate in which the antisense oligonucleotide according to any one of 1 to 11 above and a further functional moiety are directly or indirectly linked. 13. The conjugate according to 12 above, wherein the further functional moiety is a targeting molecule or a drug having antitumor activity. 14. A pharmaceutical composition containing the antisense oligonucleotide according to any one of 1 to 11 above, or the conjugate according to 12 or 13 above. 15. The pharmaceutical composition according to 14 above, for the treatment or prevention of gastric cancer in humans. 16. The pharmaceutical composition according to 15 above, for the treatment or prevention of peritoneal dissemination metastasis after gastric cancer resection. This specification incorporates the disclosure of Japanese Patent Application No. 2019-154968, which is the basis of the priority of this application.

Advantages of the Invention

[0012] According to the present invention, by specifically delivering to the region where SYT13 is highly expressed and suppressing its expression, a gastric cancer molecular target nucleic acid medicine significantly superior to siRNA can be provided.

Brief Description of the Drawings

[0013]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10A

Figure 10B

Figure 10C

Figure 10D

Figure 10E

Figure 10F

Figure 10G

Figure 11A

Figure 11B

Figure 12A

Figure 12B

Figure 12C

Figure 13A

Figure 13B

Figure 13C

Figure 14A

Figure 14B

Figure 14C

Figure 15A

Figure 15B

Figure 16A

Figure 16B

Figure 17A

Figure 17B

Figure 18A

Figure 18B

Figure 18C

Figure 19

Mode for Carrying Out the Invention

[0014] Hereinafter, the present invention will be described in detail.

[0015] (Antisense oligonucleotide) The present invention relates to antisense oligonucleotides. More specifically, the present invention relates to an antisense oligonucleotide having a sequence substantially complementary to a part of the base sequence of SYT13 mRMA and suppressing the expression of human SYT13.

[0016] The SYT13 gene is present in mammals such as primates (e.g., cynomolgus monkeys, chimpanzees, and humans) and non-primates (e.g., cows, pigs, sheep, horses, cats, dogs, guinea pigs, rats, and mice), and the base sequence thereof and the amino acid sequence of the SYT13 protein encoded by the base sequence can be obtained from databases such as the National Center for Biotechnology Information (NCBI) database in the United States. It is also known that there are multiple isoforms of SYT13. For example, human SYT13 mRNA sequences include those represented by SEQ ID NO: 1 (NM_020826.2) and SEQ ID NO: 2 (NM_001247987.1) (shown as DNA sequences in SEQ ID NOs: 1 and 2).

[0017] As used herein, the term "antisense oligonucleotide" is used synonymously with the term "antisense nucleic acid" as commonly used in the art, and refers to a single-stranded oligonucleotide containing a nucleobase sequence capable of hybridizing (i.e., complementary) to a part of the mRNA of the target gene SYT13. Without being bound by theory, in the present invention, the antisense oligonucleotide forms a DNA-RNA hybrid with the target RNA and degrades the target RNA by being cleaved by RNase H, and as a result, can suppress the expression of the target gene. Generally, the region of the mRNA of the target gene to which the antisense oligonucleotide can hybridize may include the 3'UTR, 5'UTR, exon, intron, coding region, translation initiation region, translation termination region, or other nucleic acid regions.

[0018] In the present invention, the antisense oligonucleotide can suppress the expression of human SYT13 mRNA. More specifically, the antisense oligonucleotide of the present invention consists of a base sequence substantially complementary to the base sequence of a specific region of human SYT13 mRNA. Although not particularly limited, when confirming the suppression of the expression of human SYT13 mRNA using a model animal transplanted with human cancer cells, it is preferable to use an antisense oligonucleotide consisting of a base sequence that is not complementary to the base sequence of SYT13 mRNA of the animal (e.g., mouse) itself.

[0019] As used herein, "suppression" with respect to gene expression refers to reducing the amount (abundance) of mRNA produced by gene transcription. Suppression includes suppressing the mRNA amount by 20% or more, 30% or more, or 40% or more, preferably 50% or more, more preferably 80% or more, 90% or more, or 95% or more compared to the control. The suppression of gene expression may be determined by any method known in the art, but in particular, it can be determined by a PCR-based method such as real-time PCR using cells such as human or mouse cells.

[0020] As used herein, "nucleobase" or "base" refers to the base component of a nucleic acid and a heterocyclic moiety that can pair with the base of another nucleic acid. As used herein, "nucleobase sequence" may mean a sequence of consecutive nucleobases without considering the sugar, internucleoside bond, or nucleobase modification that constitutes a nucleic acid.

[0021] In one embodiment, the antisense oligonucleotide may include 11 to 19 consecutive nucleobase sequences that are substantially complementary to the base sequence shown in human SYT13 mRNA, for example, SEQ ID NO: 1 and / or SEQ ID NO: 2. The consecutive nucleobase sequences may be 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, or 19, for example, 13, 15, 17, or 19. The antisense oligonucleotide may consist of 11 to 19 consecutive nucleobase sequences that are substantially complementary to the base sequence shown in human SYT13 mRNA, for example, SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0022] Here, "substantially complementary" refers to those that can form complementary base pairs with one to several mismatches in addition to the base sequence that is completely complementary to the target base sequence. That is, the antisense oligonucleotide may include a nucleobase sequence in which 1 to several, for example, 1, 2, or 3 nucleobases are substituted, deleted, or inserted (particularly substituted) in a consecutive base sequence of 11 to 19 that is complementary to the target base sequence.

[0023] In the present invention, the nucleobase sequence of the antisense oligonucleotide may have no mismatch or 1 to 3, 1 to 2, or 1 mismatch with a part of human SYT13 mRNA. "Part" of the mRNA refers to the target region in the mRNA with which the antisense oligonucleotide can hybridize by base pairing, and the target region may have the same base length as the antisense oligonucleotide. "Mismatch" refers to the inability of the nucleobase of the first nucleic acid to base pair (not complementary) with the corresponding nucleobase of the second nucleic acid. In a preferred embodiment, the antisense oligonucleotide has a base sequence that is completely complementary to the base sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0024] More specifically, the present invention provides an antisense oligonucleotide capable of suppressing the expression of human SYT13 mRNA, which consists of 11 to 19 base sequences complementary to the base sequences at positions 348 to 366, 599 to 627, 997 to 1016, 1069 to 1088, 1419 to 1437, 1612 to 1641, 1775 to 1793, 2629 to 2647, 2810 to 2831, 3244 to 3262, 3315 to 3333, 3423 to 3442, 4266 to 4284, 4328 to 4346, 4365 to 4400, 4714 to 4751, 4776 to 4795, and 4949 to 4968 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3, 1 to 2, or 1 base is substituted, deleted, or inserted with respect to the antisense oligonucleotide.

[0025] Examples of the antisense oligonucleotide consisting of 11 to 19 base sequences complementary to the base sequence at positions 348 to 366 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted, or inserted with respect to the antisense oligonucleotide include, for example, an antisense oligonucleotide consisting of the base sequence shown in SEQ ID NO: 3, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted, or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-350-AmNA(15) in the examples can be mentioned.

[0026] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequence at positions 599 to 627 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in any of SEQ ID NO: 4 and SEQ ID NO: 50 to SEQ ID NO: 59, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, in the examples, antisense oligonucleotides such as hSYT13-605-AmNA(15), hSYT13-607-AmNA(13), hSYT13-609-AmNA(13), hSYT13-603-AmNA(15), hSYT13-607-AmNA(15), hSYT13-609-AmNA(15), hSYT13-601-AmNA(17), hSYT13-603-AmNA(17), hSYT13-605-AmNA(17), hSYT13-607-AmNA(17), or hSYT13-609-AmNA(17) are included.

[0027] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequence at positions 997 to 1016 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, in the examples, antisense oligonucleotides such as hSYT13-999-AmNA(15) or hSYT13-1000-AmNA(15) are included.

[0028] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 1069 to 1088 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 7 or 8, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-1071-AmNA(15) or hSYT13-1072-AmNA(15) in the examples can be mentioned.

[0029] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 1419 to 1437 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 9, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-1421-AmNA(15) in the examples can be mentioned.

[0030] An antisense oligonucleotide consisting of 11 to 19 base sequences complementary to the base sequences at positions 1612 to 1641 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the base sequence shown in any of SEQ ID NOs: 10 to 16, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotides described as hSYT13-1614-AmNA(15), hSYT13-1617-AmNA(15), hSYT13-1618-AmNA(15), hSYT13-1619-AmNA(15), hSYT13-1622-AmNA(15), hSYT13-1623-AmNA(15), or hSYT13-1625-AmNA(15) in the examples, etc. can be mentioned.

[0031] An antisense oligonucleotide consisting of 11 to 19 base sequences complementary to the base sequences at positions 1775 to 1793 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the base sequence shown in SEQ ID NO: 17, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotides described as hSYT13-1777-AmNA(15) in the examples, etc. can be mentioned.

[0032] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 2629 to 2647 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 18, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-2631-AmNA(15) in the Examples can be mentioned.

[0033] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 2810 to 2831 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in any of SEQ ID NOs: 19 to 22, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotides described as hSYT13-2812-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-2814-AmNA(15), or hSYT13-2815-AmNA(15) in the Examples can be mentioned.

[0034] An antisense oligonucleotide consisting of 11 to 19 base sequences complementary to the base sequences at positions 3244 to 3262 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the base sequence shown in SEQ ID NO: 23, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-3246-AmNA(15) in the examples and the like can be mentioned.

[0035] An antisense oligonucleotide consisting of 11 to 19 base sequences complementary to the base sequences at positions 3315 to 3333 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the base sequence shown in SEQ ID NO: 24, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-3317-AmNA(15) in the examples and the like can be mentioned.

[0036] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 3423 to 3442 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 25 or 26, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-3425-AmNA(15) or hSYT13-3426-AmNA(15) in the examples can be mentioned.

[0037] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 4266 to 4284 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 27, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotide described as hSYT13-4268-AmNA(15) in the examples can be mentioned.

[0038] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 4328 to 4346 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 28, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, an antisense oligonucleotide described as hSYT13-4330-AmNA(15) in the examples can be mentioned.

[0039] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 4365 to 4400 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of a nucleotide sequence shown in any of SEQ ID NOs: 29 to 36 and 60 to 69, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, in the examples, hSYT13-4367-AmNA(15), hSYT13-4368-AmNA(15), hSYT13-4371-AmNA(15), hSYT13-4373-AmNA(15), hSYT13-4374-AmNA(15), hSYT13-4377-AmNA(15), hSYT13-4378-AmNA(15), hSYT13-4381-AmNA(15), hSYT13-4374-AmNA(13), hSYT13-4376-AmNA(15), hSYT13-4380-AmNA(15), hSYT13-4382-AmNA(15), hSYT13-4374-AmNA(17), hSYT13-4376-AmNA(17), hSYT13-4378-AmNA(17), hSYT13-4380-AmNA(17), hSYT13-4382-AmNA(17), or an antisense oligonucleotide described as hSYT13-4374-AmNA(19), etc. can be mentioned.

[0040] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 4714 to 4751 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in any of SEQ ID NOs: 37 to 39 and 70 to 79, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, in the examples, hSYT13-4716-AmNA(15), hSYT13-4717-AmNA(15), hSYT13-4729-AmNA(15), hSYT13-4725-AmNA(13), hSYT13-4727-AmNA(13), hSYT13-4725-AmNA(15), hSYT13-4727-AmNA(15), hSYT13-4731-AmNA(15), hSYT13-4725-AmNA(17), hSYT13-4727-AmNA(17), hSYT13-4729-AmNA(17), hSYT13-4731-AmNA(17), or hSYT13-4733-AmNA(17) and other antisense oligonucleotides described as such. Furthermore, in the examples, antisense oligonucleotides described as 4733-A, 4733-B, 4733-C, 4733-D, 4733-E, 4733-F, 4733-G, 4733-H, 4733-I, 4733-J, 4733-K, 4733-L, 4733-M, or 4733-N are also included.

[0041] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 4776 to 4795 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 40 or 41, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotides described as hSYT13-4778-AmNA(15) or hSYT13-4779-AmNA(15) in the examples are included.

[0042] An antisense oligonucleotide consisting of 11 to 19 nucleotide sequences complementary to the nucleotide sequences at positions 4949 to 4968 in the nucleotide sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide, includes, for example, an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 42 or 43, or an antisense oligonucleotide consisting of a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the antisense oligonucleotide. More specifically, for example, the antisense oligonucleotides described as hSYT13-4951-AmNA(15) or hSYT13-4952-AmNA(15) in the examples are included.

[0043] In a preferred embodiment, the nucleotide sequence of the antisense oligonucleotide may be a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3 to 43, or a nucleotide sequence in which 1 to 3 nucleotides are substituted, deleted or inserted with respect to the nucleotide sequence. In this embodiment, more specifically, the antisense oligonucleotide is preferably as shown in Table 1 described below.

[0044] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 50 to 59, or a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the base sequence. In this embodiment, more specifically, the antisense oligonucleotide is preferably the one shown in Table 2 described below.

[0045] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 60 to 69, or a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the base sequence. In this embodiment, more specifically, the antisense oligonucleotide is preferably the one shown in Table 3 described below.

[0046] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 70 to 79, or a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the base sequence. In this embodiment, more specifically, the antisense oligonucleotide is preferably the one shown in Table 4 described below.

[0047] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 4, 20, 29, 35, 39, 62, and 79, or a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the base sequence.

[0048] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 80 to 93, or a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the base sequence. In this embodiment, more specifically, the antisense oligonucleotide is preferably the one shown in Table 5 described below.

[0049] Array identity can be analyzed using algorithms known in the art, for example, by BLAST analysis (see, e.g., Altschul, S.F., et al., Basic local alignment search tool. 1990, J. Mol. Biol. 215: 403-410).

[0050] The antisense oligonucleotides of the present invention may have a length in the range of 11 to 20 bases, for example, 12 to 19 bases, 14 to 18 bases, or 15 to 17 bases.

[0051] In the present invention, the antisense oligonucleotides may include natural (unmodified) nucleotides (deoxyribonucleotides, ribonucleotides, or both) and / or unnatural (modified) nucleotides.

[0052] Generally, a "nucleoside" is a combination of a sugar and a nucleobase. A "nucleotide" further includes a phosphate group covalently bonded to the sugar moiety of the nucleoside. The phosphate group generally forms the internucleoside linkage of the oligonucleotide. An oligonucleotide is formed by covalent bonds between adjacent nucleosides, forming a linear polymer oligonucleotide.

[0053] As used herein, "modified nucleoside" independently means a nucleoside having a modified sugar and / or a modified nucleobase. "Modified nucleotide" independently means a nucleotide having a modified internucleoside linkage, a modified sugar, and / or a modified nucleobase. Oligonucleotides containing modified nucleotides are preferred over unmodified forms due to desirable properties such as enhanced affinity for the target nucleic acid and increased nuclease resistance.

[0054] As used herein, "modified internucleoside linkage" refers to an internucleoside linkage having a substitution or some change from a naturally occurring internucleoside linkage (i.e., a phosphodiester linkage). Examples of modified internucleoside linkages include, but are not limited to, phosphorothioate linkages, phosphorodithioate linkages, phosphorodiamidate linkages, and phosphoramidate linkages. A phosphorothioate linkage refers to an internucleoside linkage in which a non-bridging oxygen atom of a phosphodiester linkage is replaced by a sulfur atom. The modified internucleoside linkage is preferably a linkage having higher nuclease resistance than a naturally occurring internucleoside linkage.

[0055] As used herein, "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. "Unmodified nucleobase" or "natural nucleobase" refers to adenine (A) and guanine (G), which are purine bases, and thymine (T), cytosine (C), and uracil (U), which are pyrimidine bases. Examples of modified nucleobases include, but are not limited to, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, or 5-iodocytosine; 5-fluorouracil, 5-bromouracil, 5-iodouracil, or 5-hydroxyuracil; 2-thiothymine; N6-methyladenine or 8-bromoadenine; and N2-methylguanine or 8-bromoguanine.

[0056] As used herein, "modified sugar" refers to a sugar having a substitution or some change from a natural sugar moiety (i.e., the sugar moiety found in DNA (2'-H) or RNA (2'-OH)). Modified sugars can impart properties such as enhanced affinity for a target nucleic acid and increased nuclease resistance to oligonucleotides. Examples of modified sugars include, for example, bicyclic sugars, 5'-vinyl, 5'-methyl, 4'-S, 2'-F, 2'-OCH3 (2'-methoxy or 2'-O-methyl group), and 2'-O(CH2)2OCH3 substituents.

[0057] As used herein, "bicyclic sugar" refers to a sugar having two rings. Nucleic acids containing a bicyclic sugar moiety are generally referred to as bridged nucleic acids (BNA). The bicyclic sugar may be a sugar in which the carbon atoms at the 2'-position and the 4'-position are bridged by two or more atoms. Examples of bicyclic sugars include, but are not limited to, sugars having a methyleneoxy (4'-CH2-O-2') bridge (LNA™, also known as 2',4'-BNA), sugars having an ethyleneoxy (4'-(CH2)2-O-2') bridge (also known as ENA), sugars having a 4'-CH(CH3)-O-2' bridge (cEt, constrained ethyl), sugars having a 4'-CH(CH2OCH3)-O-2' bridge (cMOE, constrained MOE), sugars having an amide bridge (AmNA, Amido-bridged nucleic acid), and the like.

[0058] Examples of sugars having an amide bridge include sugars having a 4'-C(O)-N(CH3)-2' bridge. For the structure and preparation method of sugars having an amide bridge, for example, refer to Yahara, A., et al., Amido-bridged nucleic acids (AmNAs): synthesis, duplex stability, nuclease resistance, and in vitro antisense potency, ChemBioChem, 2012, 13(7): 2513-2516, Yamamoto, T., et al., Amido-bridged nucleic acids with small hydrophobic residues enhance hepatic tropism of antisense oligonucleotides in vivo, Org. Biomol. Chem., 2015, 13: 3757-3765, and International Publication No. WO2011 / 052436. For sugars having a 4'-CH(CH3)-O-2' bridge (cEt) and sugars having a 4'-CH(CH2OCH3)-O-2' bridge (cMOE), refer to Punit, P.S., et al., Short antisense oligonucleotides with novel 2'-4' conformationally restricted nucleoside analogues show improved potency without increased toxicity in animals, J. Med. Chem., 2009, 52(1): 10-13. In addition, the antisense oligonucleotide may include nucleotide mimetics such as peptide nucleic acids and morpholino nucleic acids.

[0059] Generally, different nucleotides in the same strand can independently undergo different modifications. Also, for example, to enhance nuclease resistance, the same nucleotide can have modified internucleoside linkages (e.g., phosphorothioate linkages), and further can have modified sugars (e.g., bicyclic sugars). The same nucleotide can also have modified nucleobases (e.g., 5-methylcytosine), and further can have modified sugars (e.g., bicyclic sugars).

[0060] In one embodiment, the antisense oligonucleotide may comprise at least one modified nucleotide. The modified nucleotide may comprise a modified internucleoside linkage, a modified sugar moiety, and / or a modified nucleobase.

[0061] In one embodiment, at least one of the internucleoside linkages of the antisense oligonucleotide may be a modified internucleoside linkage. At least 70%, at least 80%, at least 90%, or 100% of the internucleoside linkages of the antisense oligonucleotide may be modified internucleoside linkages. The modified internucleoside linkage may be a phosphorothioate linkage.

[0062] In one embodiment, at least one of the sugar moieties of the antisense oligonucleotide may be a bicyclic sugar. The bicyclic sugar may have a methyleneoxy (4'-CH2-O-2') bridge or an amide bridge (e.g., 4'-C(O)-N(CH3)-2' bridge). In the present invention, those having an amide bridge can be preferably used as the antisense oligonucleotide.

[0063] In one embodiment, at least one of the nucleobases of the antisense oligonucleotide may be a modified nucleobase. The modified nucleobase may be 5-methylcytosine.

[0064] In certain embodiments, the antisense oligonucleotide may be a gapmer. As used herein, a "gapmer" refers to an oligonucleotide consisting of a central region (DNA gap region) containing at least 4 consecutive deoxyribonucleosides, and regions (5' wing region and 3' wing region) containing unnatural nucleosides disposed on the 5'-end side and 3'-end side thereof. The length of the DNA gap region may be 4 to 16 bases long, 5 to 14 bases long, 6 to 12 bases long, or 8 to 10 bases long. The lengths of the 5' wing region and 3' wing region may independently be 1 to 6 bases long, 1 to 5 bases long, or 2 to 4 bases long. The 5' wing region and 3' wing region only need to contain at least one unnatural nucleoside, and may contain natural nucleosides. The 5' wing region and 3' wing region may each contain one or more types of unnatural nucleosides. All the nucleosides in the 5' wing region and 3' wing region may be unnatural nucleosides. Alternatively, the nucleosides at one or both (especially the 3'-end) of the 5'-end and 3'-end of the gapmer may be natural nucleosides (especially deoxyribonucleosides). The unnatural nucleosides contained in the 5' wing region and 3' wing region may be nucleosides having bicyclic sugars. The bicyclic sugar may be a sugar having a methyleneoxy (4'-CH2-O-2') bridge, or a sugar having an amide bridge (e.g., 4'-C(O)-N(CH3)-2' bridge). The unnatural nucleosides contained in the 5' wing region and 3' wing region may contain modified nucleobases (e.g., 5-methylcytosine).

[0065] In a preferred embodiment, the antisense oligonucleotide is the gapmer used in the examples described below. A structural example of the antisense oligonucleotide that can be preferably used in the present invention is shown in FIG. 1, but the structure of the preferred gapmer is not limited thereto, and may be different in the modification pattern of sugars, nucleobases, and / or internucleoside linkages.

[0066] The antisense oligonucleotides of the present invention can be produced by methods known in the art. For example, the antisense oligonucleotides can be synthesized using a commercially available automated nucleic acid synthesizer and then purified using, for example, a reverse phase column. Alternatively, the antisense oligonucleotides can be ordered from a manufacturer (e.g., Gene Design Co., Ltd.) by specifying the nucleobase sequence and the modification sites and types, and obtained.

[0067] The antisense oligonucleotides of the present invention can be used as a medicament for suppressing peritoneal dissemination metastasis of gastric cancer by suppressing the expression of the human SYT13 gene.

[0068] The antisense oligonucleotides of the present invention can suppress the proliferation, migration, and / or invasion of cancer cells expressing SYT13 in vitro or in vivo. Delivery of the antisense oligonucleotides into cells can be performed using any method commonly used in the art, for example, lipofection, electroporation, microinjection, particle gun method, and transduction using a virus or plasmid as a vector. Alternatively, the antisense oligonucleotides can be directly transfected into cells. For example, the antisense oligonucleotides can be suitably delivered into cells in vitro and in vivo using the CEM method (Nucleic Acids Research, 2015, Vol.43, No.19, e128; doi: 10.1093 / nar / gkv626).

[0069] The antisense oligonucleotides of the present invention can be used as a medicament for suppressing peritoneal dissemination metastasis of gastric cancer by suppressing the expression of the human SYT13 gene. The effects of the present invention are demonstrated by the following examples.

[0070] (Conjugate) The present invention also provides a conjugate in which the above antisense oligonucleotide and a further functional moiety are directly or indirectly linked.

[0071] The further functional moiety contemplated in the present invention may be a small molecule such as a peptide, sugar, lipid, etc., and is not particularly limited, but may be, for example, a targeting molecule or a drug having antitumor activity. More specifically, the functional molecule may be a binding molecule such as an antibody against a protein that may be highly expressed at the tumor site or an antigen-binding fragment thereof, GalNAc that can bind to a glycoprotein receptor, a lipid such as cholesterol or a long-chain fatty acid that can enhance cell membrane permeability, etc. Also, the functional molecule may be, for example, another drug having antitumor activity.

[0072] The antisense oligonucleotide and the further functional moiety may be directly bound or may be bound via a linker commonly used in the art. The binding is preferably a covalent bond, although not limited thereto. By administering as a conjugate, the delivery of the antisense oligonucleotide of the present invention to the target site can be promoted and / or the effect of the antisense oligonucleotide of the present invention can be improved.

[0073] (Pharmaceutical composition) The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide or conjugate of the present invention. The pharmaceutical composition of the present invention can be used, for example, for preventing or treating peritoneal dissemination metastasis after gastric cancer resection.

[0074] The pharmaceutical composition may further contain any pharmaceutical adjuvant commonly used in the pharmaceutical field. In this specification, as pharmaceutical adjuvants, pharmaceutically acceptable carriers (solid or liquid carriers), excipients, stabilizers, disintegrants, surfactants, binders, lubricants, emulsifiers, suspending agents, antioxidants, flavoring agents, fillers, solubilizers, coating agents, coloring agents, flavoring agents, preservatives, buffering agents, and other various carriers or additives can be used. Specifically, as pharmaceutical adjuvants, water, physiological saline, other aqueous solvents, pharmaceutically acceptable organic solvents, mannitol, lactose, starch, microcrystalline cellulose, glucose, calcium, polyvinyl alcohol, collagen, polyvinylpyrrolidone, carboxyvinyl polymer, sodium alginate, water-soluble dextran, water-soluble dextrin, sodium carboxymethyl starch, pectin, gum arabic, xanthan gum, casein, gelatin, agar, propylene glycol, polyethylene glycol, petrolatum, paraffin, glycerin, stearyl alcohol, stearic acid, sorbitol, and the like can be mentioned. The pharmaceutical adjuvants can be appropriately selected or combined according to the dosage form of the preparation.

[0075] The pharmaceutical composition can be administered to a subject orally or parenterally. Examples of parenteral administration include, but are not limited to, intraperitoneal administration. To effectively bring about a therapeutic effect, it is preferable to administer the pharmaceutical composition locally and directly to the damaged area. Also, using a continuous infusion pump, the pharmaceutical composition can be continuously administered to the damaged area. The pharmaceutical composition can be in the form of preparations such as injections and drip infusions. Those skilled in the art can manufacture these preparations by conventional methods.

[0076] The pharmaceutical composition may be administered in a therapeutically effective amount. The specific dosage of the pharmaceutical composition is determined based on, for example, the judgment of a physician according to the severity of the disease, the overall health condition, age, gender, weight, and tolerance to the treatment of an individual subject. For example, the pharmaceutical composition may be administered in an amount such that the antisense oligonucleotide is 0.000001 mg / kg body weight / day to 1000 mg / kg body weight / day, or 0.001 mg / kg body weight / day to 1 mg / kg body weight / day, or 0.005 mg / kg body weight / day to 0.5 mg / kg body weight / day, or 0.01 mg / kg body weight / day to 0.1 mg / kg body weight / day. The pharmaceutical composition can be administered once or multiple times, for example, at regular time intervals, such as intervals of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, etc., and can be administered to the subject several times or dozens of times. Alternatively, the pharmaceutical composition may be continuously administered using a continuous infusion pump as described above. Those skilled in the art can appropriately set the dosage (rate), duration, etc. in the case of continuous administration.

[0077] The subject to which the pharmaceutical composition is administered is a mammal, such as a primate (e.g., cynomolgus monkey, chimpanzee, and human) and a non - primate (e.g., cow, pig, sheep, horse, cat, dog, guinea pig, rat, and mouse), and more preferably a human. The subject may be, for example, a gastric cancer model animal transplanted with human gastric cancer cells.

[0078] The present invention also provides a method for preventing or treating peritoneal seeding metastasis after gastrectomy, which comprises administering the antisense oligonucleotide, conjugate, or pharmaceutical composition of the present invention to a subject in need thereof. The present invention also provides the use of the antisense oligonucleotide or conjugate of the present invention in the manufacture of a medicament for preventing or treating peritoneal seeding metastasis after gastrectomy.

Examples

[0079] Hereinafter, the present invention will be further specifically described using examples. However, the technical scope of the present invention is not limited to these examples.

[0080] [Example 1 Selection of Antisense Oligonucleotide Candidate Sequences] As the target region of the antisense oligonucleotide, a region having a common sequence was extracted from the mRNA sequences of two variants of SYT13, NM_020826.2 (SEQ ID NO: 1) and NM_001247987.1 (SEQ ID NO: 2). At this point, thousands of target sequence candidates were obtained.

[0081] Next, after confirming the homology with mouse SYT13 mRNA by BLAST, sequences with high predicted secondary structure and high risk of toxicity expression of the resulting antisense oligonucleotides were excluded, etc., and several hundred candidate sequences were selected.

[0082] The sequence of the antisense strand was obtained from the selected sequences, and after further narrowing down the candidate sequences by selection based on the physical properties as an antisense oligonucleotide, sequences with high off-target risk were excluded, and 41 candidate sequences were selected. Then, based on those sequences, antisense oligonucleotide molecules were designed and synthesized respectively.

[0083] The structure of the antisense oligonucleotide used in this example is shown in Fig. 1. For example, when designing a 15-mer antisense oligonucleotide, three artificial nucleic acid regions were provided on the 5' side and two artificial nucleic acid regions were provided on the 3' side, and a natural nucleic acid region was provided in between. In this example, as the artificial nucleic acid, an amide-bridged nucleic acid (AmNA) having the following sugar structure was used (A. Yahara et al., ChemBioChem, 2012, 13, 2513-2516; T. Yamamoto et al., Org. Biomol. Chem., 2015, 13, 3757-3765).

[0084] [Chemical Formula]

[0085] In the above structure, "Base" means a base, and thus adenine, cytosine, guanine, thymine, but in the artificial nucleic acid region, it may include modified bases such as 5-methylcytosine.

[0086] In Figure 1, the black circles in the artificial nucleic acid region indicate that AmNA is used instead of deoxyribose, which is found in natural nucleic acids as a sugar, and the white circles in the natural nucleic acid region indicate that deoxyribose is used. It was confirmed that by introducing AmNA at both ends of the antisense oligonucleotide molecule, the affinity with the target mRNA can be improved. Also, in this example, as the base in the artificial nucleic acid region, 5-methylcytosine was used instead of cytosine found in natural nucleic acids.

[0087] Also, the antisense oligonucleotide used in this example has a phosphorothioate bond instead of the phosphodiester bond found in natural nucleic acids, and the enzyme resistance performance was improved.

[0088] Table 1 below shows the sequence information of the antisense oligonucleotides designed based on the candidate sequences selected above, and the control antisense oligonucleotides (NEG1 and NEG2) designed not to bind to any of the known genes. For example, "hSYT13-350-AmNA(15)" in Table 1 has a sequence complementary to 15 consecutive bases starting from the 350th position in SEQ ID NO: 1, which is the base sequence of human SYT13 mRNA. In Table 1, the underlines indicate mismatched bases with mouse SYT13 mRNA.

[0089]

Table 1

[0090] [Example 2 Screening Based on the Expression Inhibitory Effect of SYT13 mRNA] The gastric cancer cell line KATOIII derived from human signet ring cell carcinoma (obtained from American Type Culture Collection, ATCC) was cultured at 37°C under 5% CO2 in a medium prepared by mixing RPMI1640 (Nacalai Tesque, Inc.) and DMEM (Nacalai Tesque, Inc., Low-Glucose) at a 1:1 ratio and adding 10% fetal bovine serum (FBS, biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Inc., Stabilized). The cells were seeded at a concentration of 10,000 cells / 100 μL per well in a 96-well plate containing DMEM with 10% FBS and cultured at 37°C under 5% CO2 for 24 hours.

[0091] Cell transfection was performed by the CEM method. Specifically, after adding 900 mM calcium chloride diluted 100-fold to DMEM containing 10% FBS, the antisense oligonucleotide synthesized in Example 1 was added to a final concentration of 6.25 nM, 25 nM, or 100 nM and cultured at 37°C under 5% CO2 for an additional 24 hours.

[0092] RNA was extracted from the transfected cells using the Cell Lysis &RT Kit (TOYOBO Super Prep TM Cell Lysis &RT Kit for qPCR) and reverse-transcribed into cDNA.

[0093] For the obtained cDNA, real-time PCR (RT-PCR) was performed using ABI PowerUp TM SYBR (registered trademark) Green Master Mix and the following primers (200 nM each). PCR was performed using a thermal cycler (ABI StepOne Plus TM Real-Time PCR System) under the conditions of 30 seconds at 95°C, followed by 45 cycles of 3 seconds at 95°C and 30 seconds at 60°C.

[0094] GAPDH forward primer: CGACAGTCAGCCGCATCTT (SEQ ID NO: 46) GAPDH reverse primer: CCC AAT ACG ACC AAA TCC GTTG (SEQ ID NO: 47) SYT13 forward primer: TGGTGGTGCTGATTAAAGCC (SEQ ID NO: 48) SYT13 reverse primer: TGCTTCTTCTTCAGCTTCCG (SEQ ID NO: 49)

[0095] The relative expression level of SYT13 mRNA was calculated from the measured values of the expression levels of SYT13 mRNA and GAPDH mRNA (comparative control). A part of the results is shown in Figure 2. As shown in Figure 2, it was demonstrated that the tested antisense oligonucleotides suppressed the expression of SYT13 mRNA in a concentration-dependent manner.

[0096] [Example 3 Demonstration of Concentration-Dependent Expression Suppression in Various Cells] Using the human gastric cancer cell lines MKN1, MKN45, and OCUM-1 (obtained from the JCRB Cell Bank of the National Institute of Biomedical Innovation, Health and Nutrition), the effects of the antisense oligonucleotides synthesized in Example 1 were examined. For the operating procedures such as cell culture, those suitable for each cell were appropriately used, but they were substantially the same as those in Example 2.

[0097] In MKN1 cells, MKN1 cells cultured at 37 °C and 5% CO2 in RPMI1640 (Nacalai Tesque, Inc.) supplemented with 10% FBS (Biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Inc., Stabilized) were seeded at a density of 8,000 cells / 100 μL per well into a 96-well plate containing DMEM with 10% FBS. After culturing at 37 °C and 5% CO2 for 24 hours, the antisense oligonucleotide synthesized in Example 1 was added to a final concentration of 6.25 nM, 25 nM, or 100 nM, and the cells were further cultured at 37 °C and 5% CO2 for another 24 hours. RNA was extracted from the transfected cells using the Cell Lysis &RT Kit (TOYOBO Super Prep TM Cell Lysis &RT Kit for qPCR), and reverse-transcribed into cDNA.

[0098] In MKN45 cells, MKN45 cells cultured at 37 °C and 5% CO2 in RPMI1640 (Nacalai Tesque, Inc.) supplemented with 10% FBS (Biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Inc., Stabilized) were seeded at a density of 30,000 cells / 500 μL per well into a 24-well plate containing DMEM with 10% FBS. After culturing at 37 °C and 5% CO2 for 24 hours, the antisense oligonucleotide synthesized in Example 1 was added to a final concentration of 50 nM or 200 nM, and the cells were further cultured at 37 °C and 5% CO2 for another 24 hours. RNA was extracted from the transfected cells using the QIAGEN Rneasy® Mini Kit (QIAGEN®), and reverse-transcribed into cDNA using the ABI High-Capacity cDNA Reverse Transcription Kit.

[0099] OCUM-1 cells were cultured at 37 °C under 5% CO2 in DMEM (Nacalai Tesque, Low-Glucose) supplemented with 10% FBS (Biowest), 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Stabilized), and 0.5 mM sodium pyruvate. The OCUM-1 cells were seeded at a concentration of 7,500 cells / 100 μL per well in a 96-well plate containing DMEM with 10% FBS, and cultured at 37 °C under 5% CO2 for 24 hours. Then, the antisense oligonucleotides synthesized in Example 1 were added to a final concentration of 50 nM, 100 nM, or 200 nM, and the cells were further cultured at 37 °C under 5% CO2 for 24 hours. RNA was extracted from the transfected cells using the Cell Lysis &RT Kit (TOYOBO Super Prep TM Cell Lysis &RT Kit for qPCR ) and reverse-transcribed into cDNA. As a result, as shown in FIGS. 3 to 6, concentration-dependent expression suppression by the antisense oligonucleotides of the present invention was demonstrated for all cell lines.

[0100] [Example 4 Examination of Optimization of Antisense Oligonucleotides 1] For three antisense oligonucleotides, hSYT13-605-AmNA(15), hSYT113-4378-AmNA(15), and hSYT13-4729-AmNA(15), for which particularly good effects were confirmed by the screening test of Example 2, ten antisense oligonucleotides were designed and synthesized while fixing the number of introduced artificial nucleic acids and varying the length and position of the natural nucleic acid region. Table 2 below shows the sequence information of the antisense oligonucleotides designed for the examination of optimization using hSYT13-605-AmNA(15) as the parental sequence, Table 3 shows the sequence information of the antisense oligonucleotides designed for the examination of optimization using hSYT113-4378-AmNA(15) as the parental sequence, and Table 4 shows the sequence information of the antisense oligonucleotides designed for the examination of optimization using hSYT13-4729-AmNA(15) as the parental sequence.

[0101]

Table 2

[0102]

Table 3

[0103]

Table 4

[0104] [Example 5 Inhibitory Effect of SYT13 mRNA Expression in Cancer Cells] For each of the antisense oligonucleotides synthesized in Example 4, the inhibitory effect on the expression of SYT13 in OCUM-1, MKN1, and NUGC-4 was examined in the same manner as in Example 3. In this example, the final concentration of the antisense oligonucleotide was set to 100 nM or 400 nM. The operating procedures for OCUM-1 and MKN1 cells were the same as in Example 3.

[0105] For NUGC-4 cells, NUGC-4 cells cultured at 37°C under 5% CO2 in RPMI1640 (Nacalai Tesque, Inc.) supplemented with 10% FBS (Biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Inc., Stabilized) were seeded into a 96-well plate containing 10% FBS-containing DMEM at a concentration of 8,000 cells / 100 μL per well and cultured at 37°C under 5% CO2 for 24 hours. RNA was extracted from the transfected cells using the Cell Lysis &RT Kit (TOYOBO Super Prep TM Cell Lysis &RT Kit for qPCR) and reverse-transcribed into cDNA.

[0106] As a result, as shown in FIGS. 7 to 9, among the antisense oligonucleotides designed for optimization using hSYT13-4729-AmNA(15) and hSYT113-4378-AmNA(15) as parent sequences, those having a higher inhibitory activity on SYT13 mRNA expression than the parent sequences were found.

[0107] [Example 6 Inhibitory effect on proliferative ability 1] The sequence information is shown in Table 1. For hSYT13-605-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-4367-AmNA(15), hSYT13-4378-AmNA(15), and hSYT13-4729-AmNA(15), which were confirmed to have a high inhibitory effect on SYT13 mRNA expression in Example 2, the inhibitory effects on the proliferative ability of cancer cells in vitro were examined.

[0108] MKN1 / Luc, NUGC4, AGS, N87, and GSU cells were seeded in 96-well plates at a density of 3000 cells / well, and KATO3 and OCUM1 cells were seeded at a density of 5000 cells / well. After transfection with antisense oligonucleotides at a final concentration of 400 nM (MKN1 / Luc, NUGC4) or 100 nM (AGS, N87, GSU, KATO3, OCUM1) by the CEM method, the cells were cultured. The cell numbers were measured using Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc.) on days 0, 1, 3, and 5, and the fold change relative to the cell number at the initial stage of culture was calculated. Each sample was measured in 8 wells, and their average values and standard deviations were calculated.

[0109] As a result, as shown in FIGS. 10A to 10G, although variations in the results were observed depending on the cell lines used, it was shown that the above five antisense oligonucleotides could have a significant inhibitory effect on the proliferation of human gastric cancer cell lines.

[0110] [Reference Example Proliferation inhibitory effect by siRNA] As an siRNA capable of targeting human SYT13 mRNA, Accell SYT13 siRNA (manufactured by Dharmacon) was used. After transfection of 400 nM into MKN1 and NUGC4 cell lines at 50,000 cells / mL by the CEM method in the same manner as in Example 6, the effect on the growth ability of these cell lines was examined. As a control, siRNA (Accell Green Non-targeting, manufactured by Dharmacon) designed not to bind to any known genes was used for comparison.

[0111] As a result, as shown in FIGS. 11A and 11B, for both MKN1 and NUGC4 cell lines, when 400 nM of siRNA was used, no significant growth inhibitory effect was obtained compared to the control.

[0112] [Example 7 Inhibitory effect on migration ability 1] Using an ibidi culture insert (ibidi GmbH, Martinsried, Germany), the inhibitory effect of the antisense oligonucleotide of the present invention on the migration ability of gastric cancer cell lines in vitro was examined.

[0113] As cells, MKN1 / Luc (3×10 4 cells / well), N87 (30×10 4 cells / well), NUGC4 (3.5×10 4 cells / well), and either the antisense oligonucleotide of the present invention such as hSYT13-605-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-4367-AmNA(15), hSYT13-4378-AmNA(15), or hSYT13-4729-AmNA(15), or a control antisense oligonucleotide (NEG1) were used to confirm the inhibitory effect on the migration of cells into the cell-free gap.

[0114] As a result, as shown in FIGS. 12A to 12C, although variations in the results were observed depending on the cell lines used, it was shown that the above five antisense oligonucleotides could have a significant inhibitory effect on the migration of human gastric cancer cell lines.

[0115] [Example 8 Inhibitory effect 1 on invasiveness] Using a BioCoat Matrigel Invasion Chamber (BD Biosciences, Bedford, MA, USA), the inhibitory effect of the antisense oligonucleotides of the present invention on the in vitro invasiveness of gastric cancer cell lines was examined.

[0116] As cells, MKN1 / Luc (2.5×10 4 cells / well), AGS (5×10 4 cells / well), GSU (5×10 4 cells / well) were used, and either the antisense oligonucleotides of the present invention, hSYT13-605-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-4367-AmNA(15), hSYT13-4378-AmNA(15), or hSYT13-4729-AmNA(15), or a control antisense oligonucleotide (NEG1) was used to compare the number of invading cells in the chamber.

[0117] As a result, as shown in FIGS. 13A to 13C, although variations in the results were observed depending on the cell lines used, it was shown that the above five antisense oligonucleotides could have a significant inhibitory effect on the invasion of human gastric cancer cell lines.

[0118] [Example 9 In vivo test 1] Using the same method as described in WO 2016 / 143697, MKN1-luc cells or NUGC4 cells into which a luciferase gene was introduced were inoculated into immunodeficient mice (10-week-old male BALBc-nu / nu) at 1×10 6A peritoneal seeding model was created by administering 1 ml intraperitoneally at a concentration of

[0119] After cancer cell transplantation, hSYT13-4729(15) or hSYT13-4378(15) (both with a molecular weight of approximately 5000) at 0.2 mg per administration (equivalent to 10 mg / kg based on a mouse body weight of 20 g) was added to 500 μL of 5% glucose solution and administered twice a week for 6 weeks (Figure 14A). As a control, a control antisense oligonucleotide (NEG1, SEQ ID NO: 44) or the Accell SYT13 siRNA (manufactured by Dharmacon) used in the above reference example was administered at 0.2 mg per administration (equivalent to 10 mg / kg based on a mouse body weight of 20 g) for 6 weeks.

[0120] In mice transplanted with MKN1-luc cells, in vivo imaging was performed using an In Vivo Imaging System (IVIS®) Lumina (Xenogen, Alameda, California, USA). Specifically, 2 weeks, 4 weeks, or 6 weeks after cell transplantation, D-luciferin (150 mg / kg) (Summit Pharmaceuticals International, Tokyo, Japan) was administered intraperitoneally to the mice, and after 15 minutes, images were taken with the IVIS® and the signal intensity was measured using Living Image® version 2.6 software (Xenogen). As a result, luminescence indicating the engraftment of peritoneal seeding-like cells was observed in mice not administered the antisense oligonucleotide, and in mice administered the control antisense oligonucleotide or siRNA, whereas in mice administered the antisense oligonucleotide of the present invention, luminescence could not be detected, or if detected, the luminescence amount was significantly less (data not shown).

[0121] Six weeks after cancer cell transplantation, some mice were sacrificed, and the total weight of peritoneal dissemination foci for each group of mice was compared. The results are shown in FIGS. 14B and 14C. Compared with the mice not administered with antisense oligonucleotides, the mice administered with control antisense oligonucleotides, and the mice administered with siRNA, the mice administered with the antisense oligonucleotides of the present invention (hSYT13-4729(15) and hSYT13-4378(15)) had a significantly lower total weight of peritoneal dissemination foci, demonstrating that peritoneal dissemination can be effectively suppressed.

[0122] [Example 10 Inhibitory effect on proliferative ability 2] In addition to hSYT13-4378(15) and hSYT13-4729(15), four antisense oligonucleotides, hSYT13-4380(17) and hSYT13-4733(17) (the sequence information is shown in Tables 3 and 4, respectively) that showed suitable activity in Example 5, were used to examine the inhibitory effect on the proliferative ability of MKN1 cells or NUGC4 cells in vitro in the same manner as in Example 6.

[0123] As a result, as shown in FIGS. 15A and 15B, under the tested conditions, significant growth inhibitory effects were confirmed in hSYT13-4378(15), hSYT13-4729(15) and hSYT13-4380(17) compared with the group without addition of antisense oligonucleotides (Cont) and the group with addition of control antisense oligonucleotides (NEG1).

[0124] [Example 11 Inhibitory effect on migratory ability 2] Using four antisense oligonucleotides, hSYT13-4378(15), hSYT13-4729(15), hSYT13-4380(17) and hSYT13-4733(17), the inhibitory effect on the migratory ability of MKN1 cells or NUGC4 cells in vitro was examined in the same manner as in Example 7.

[0125] As a result, as shown in FIGS. 16A and 16B, under the tested conditions, in hSYT13-4378(15), hSYT13-4380(17), and hSYT13-4733(17), a significant migration inhibitory effect was confirmed as compared with the group without addition of antisense oligonucleotide (Cont) and the group with addition of control antisense oligonucleotide (NEG1).

[0126] [Example 12 Inhibitory effect on invasiveness 2] Using four kinds of antisense oligonucleotides of hSYT13-4378(15), hSYT13-4729(15), hSYT13-4380(17), and hSYT13-4733(17), in the same manner as in Example 8, the inhibitory effect on the in vitro invasiveness of MKN1 cells or NUGC4 cells was examined.

[0127] As a result, as shown in FIG. 17A, it was shown that the invasiveness was suppressed when the antisense oligonucleotide of the present invention was added as compared with the group without addition of antisense oligonucleotide (Cont) and the group with addition of control antisense oligonucleotide (NEG1).

[0128] As shown in FIG. 17B comparing the number of invasive cells, under the tested conditions, in hSYT13-4378(15), hSYT13-4729(15), and hSYT13-4733(17), a significant invasion inhibitory effect was confirmed as compared with the group without addition of antisense oligonucleotide (Cont) and the group with addition of control antisense oligonucleotide (NEG1).

[0129] [Example 13 In vivo test 2] Using peritoneal dissemination model mice prepared in the same manner as in Example 9, an in vivo test was carried out.

[0130] In this example, 2×10 6After preparing a peritoneal dissemination model mouse by intraperitoneally transplanting 1 ml of the NUGC4 cell line at a density of [[ID=]] cells / ml, as antisense oligonucleotides, hSYT13-4378(15) and hSYT13-4733(17), and a control antisense oligonucleotide (NEG1, SEQ ID NO: 44) were added at 0.2 mg per administration (equivalent to 10 mg / kg for a 20 g mouse) to 500 μL of 5% glucose solution and administered twice a week for 12 weeks (Figure 18A).

[0131] Eight weeks after cancer cell transplantation, some of the mice were sacrificed and tumor growth was visually confirmed. As a result, while peritoneal dissemination-like tumor growth was significant in the non-antisense oligonucleotide-administered mice (Control) and the control antisense oligonucleotide-administered mice (NEG1), peritoneal dissemination was hardly confirmed in the hSYT13-4378(15)-administered mice and the hSYT13-4733(17)-administered mice (data not shown).

[0132] Figure 18B shows a comparison of the total weight of peritoneal dissemination nests for the mice in each group. As visually confirmed, compared to the control mice (non-antisense oligonucleotide-administered mice and control antisense oligonucleotide-administered mice), the total weight of peritoneal dissemination nests was very slight in the antisense oligonucleotide-administered mice of the present invention, demonstrating that peritoneal dissemination can be effectively suppressed.

[0133] [Example 14 Survival Analysis] For the mice administered the antisense oligonucleotide for 12 weeks and those not administered (8 mice in each group) in Example 13, the survival days from cancer cell transplantation (seeding) were measured.

[0134] As a result, as shown in Figure 18C, the survival days were significantly longer in the antisense oligonucleotide-administered mice of the present invention compared to the non-antisense oligonucleotide-administered group (CEM) and the control antisense oligonucleotide-administered group (NEG1), demonstrating that it has an effect of suppressing recurrence due to peritoneal dissemination.

[0135] [Example 15 Demonstration of the Inhibitory Effect on SYT13 mRNA Expression Using Antisense Oligonucleotides with Different Modifications] Based on hSYT13-4733-AmNA(17) (SEQ ID NO: 79) for which high SYT13 mRNA expression inhibitory activity was confirmed in Example 5, 14 antisense oligonucleotides (4733-A to 4733-N) with modified patterns of sugars, nucleobases, and / or internucleoside linkages were designed and synthesized. The sequence information of these antisense oligonucleotides is shown in Table 5.

[0136] [Table 5]

[0137] As can be understood from Table 5 and the attached Sequence Listing, both hSYT13-4733-AmNA(17) and 4733-A to 4733-N are 17-base-long gapmers. In hSYT13-4733-AmNA(17), it contains unnatural nucleosides with amide-bridged sugars (described as "AmNA" in the table) at 3 positions on the 5'-terminal side and 2 positions on the 3'-terminal side, and all internucleoside linkages are phosphorothioate linkages.

[0138] In contrast, in 6 antisense oligonucleotides of 4733-A to 4733-F, one or both of the 5'-terminal side and 3'-terminal side wing regions (5'-wing region and 3'-wing region), and further a part of the internucleoside linkages at the boundary between the wing region and the DNA gap region are phosphodiester linkages.

[0139] Also, in 8 antisense oligonucleotides of 4733-G to 4733-N, the number and / or position of unnatural nucleosides (AmNA) with amide-bridged sugars are changed in one or both of the 5'-wing region and 3'-wing region, and 4733-H, 4733-K, and 4733-M contain 5-methylcytosine in the 3'-wing region.

[0140] For hSYT13-4733-AmNA(17) (SEQ ID NO: 79) and the above 14 antisense oligonucleotides (4733-A to 4733-N), in the same manner as in Example 5, the inhibitory effect on the expression of SYT13 in NUGC-4 cells was examined.

[0141] As a result, as shown in Fig. 19, the expression of SYT13 mRNA was significantly suppressed in vitro by any of the antisense oligonucleotides as compared with the group without addition of the antisense oligonucleotide (Control) and the group with addition of the control antisense oligonucleotide (NEG1, addition of the antisense oligonucleotide of SEQ ID NO: 44). In particular, in 4733-B, 4733-C, 4733-D, 4733-E, 4733-F, and 4733-M, an expression inhibitory effect equal to or higher than that of hSYT13-4733-AmNA(17) was confirmed, and it was demonstrated that they exhibit antisense activity suitable for suppressing the expression of SYT13.

[0142] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims

1. An antisense oligonucleotide capable of suppressing the expression of human SYT13 mRNA, which is composed of 11 to 19 base sequences complementary to the base sequences at positions 4714 to 4751 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide composed of a base sequence in which 1 to 3, 1 to 2, or 1 base is substituted, deleted, or inserted with respect to the antisense oligonucleotide.

2. An antisense oligonucleotide capable of suppressing the expression of human SYT13 mRNA, which is composed of 11 to 19 base sequences complementary to the base sequences at positions 348 to 366, 599 to 627, 997 to 1016, 1069 to 1088, 1419 to 1437, 1612 to 1641, 1775 to 1793, 2629 to 2647, 2810 to 2831, 3244 to 3262, 3315 to 3333, 3423 to 3442, 4266 to 4284, 4328 to 4346, 4365 to 4400, 4714 to 4751, 4776 to 4795, or 4949 to 4968 in the base sequence shown in SEQ ID NO: 1, or an antisense oligonucleotide composed of a base sequence in which 1 to 3, 1 to 2, or 1 base is substituted, deleted, or inserted with respect to the antisense oligonucleotide.

3. An antisense oligonucleotide composed of a base sequence selected from the group consisting of SEQ ID NOs: 3 to 43, or an antisense oligonucleotide composed of a base sequence in which 1 to 3 bases are substituted, deleted, or inserted with respect to the antisense oligonucleotide.

4. An antisense oligonucleotide composed of a base sequence selected from the group consisting of SEQ ID NOs: 50 to 59, or an antisense oligonucleotide composed of a base sequence in which 1 to 3 bases are substituted, deleted, or inserted with respect to the antisense oligonucleotide.

5. An antisense oligonucleotide composed of a base sequence selected from the group consisting of SEQ ID NOs: 60 to 69, or an antisense oligonucleotide composed of a base sequence in which 1 to 3 bases are substituted, deleted, or inserted with respect to the antisense oligonucleotide.

6. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 70 to 79, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide.

7. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 4, 20, 29, 35, 39, 62, and 79, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases are substituted, deleted or inserted with respect to the antisense oligonucleotide.

8. The antisense oligonucleotide according to any one of claims 1 to 7, which has an artificial nucleic acid region containing a bicyclic sugar.

9. The antisense oligonucleotide according to any one of claims 1 to 8, wherein at least one internucleoside bond is a phosphorothioate bond.

10. The antisense oligonucleotide according to any one of claims 1 to 9, which has an artificial nucleic acid region containing 5-methylcytosine.

11. The antisense oligonucleotide according to any one of claims 1 to 10, which is 15 to 19 nucleotides in length.

12. The antisense oligonucleotide according to any one of claims 1 to 11, which is a gapmer.

13. An antisense oligonucleotide according to any one of claims 1 to 12, and a conjugate in which a further functional moiety is directly or indirectly linked.

14. The conjugate according to claim 13, wherein the further functional moiety is a targeting molecule or a drug having antitumor activity.

15. A pharmaceutical composition containing the antisense oligonucleotide according to any one of claims 1 to 12, or the conjugate according to claim 13 or 14.

16. The pharmaceutical composition according to claim 15, for the treatment or prevention of gastric cancer in humans.

17. The pharmaceutical composition according to claim 16, for the treatment or prevention of peritoneal dissemination metastasis after gastrectomy.

Images